<<

MIT OpenCourseWare http://ocw.mit.edu

12.007 Geobiology Spring 2009

For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. Chirality of amino‐acids

LEFT RIGHT

COOH COOH

H C R R C H

NH NH 2 2

Figure by MIT OpenCourseWare. Origin of chirality ?

Image removed due to copyright restrictions. Please see: Figure 1 in Bailey Jeremy et al. "Circular Polarization in Star-Formation Regions: Implications for Biomolecular Homochirality." Science 31 281, no. 5377 ( July 1998): 672-674. DOI: 10.1126/science.281.5377.672.

CIRCULAR POLARIZATION IN Orion OMC1 (a region in the Orion nebula M42) and NGC 6334

(Bailey et al., 1998) Meteorite

Image courtesy of NASA.

Murchison meteorite Tagish lake meteorite -rich particles in a carbonaceous chondrite

Image removed due to copyright restrictions. Please see: Figure 1 in Nakamura Keiko -Messenger et al. "Organic Globules in the Tagish Lake Meteorite: Remnants of the Protosolar Disk." Science 1 314, no. 5804 (December 2006): 1439-1442. DOI: 10.1126/science.1132175.

Nakamura – Messenger et al. 2006 Murchison Discharge Amino acid meteorite experiment Alanine α-Amino-N- α-Aminoisobutyric acid Valine Norvaline Image removed due to copyright restrictions. Isovaline Proline Pipecolic acid Aspartic acid Glutamic acid β-Alanine β-Amino-N-butyric acid β-Aminoisobutyric acid γ-Aminobutyric acid Sarcosine N-Ethylglycine N-Methylalanine

Figure by MIT OpenCourseWare. Image removed due to copyright restrictions. Gly Ala β-Ala Ser IsoSer α-AIB β-AIB α-ABA β-ABA Condenser γ-ABA HomoSer 2-Me-Ser Asp 5 Liter flask β-OH-Asp { Tungsten Val Isoval electrodes Norval Orn Glu 2-Me-Glu α-AAA Phe Steam aspirator MA EA Ethanolamine Iso-PA N-PA

10-6 10-4 10-2 1 500 cc flask Molar ratio C B Figure by MIT OpenCourseWare. Figure by MIT OpenCourseWare. Mineral surfaces and synthesis of organics

Conditions for Reactions in the Figure

3 Reaction Catalyst Temp. Pressure CH3 COOH 9 CO2 CH3 SH 5 (1) (2) (Fe,Ni)S 100oC 0.2 MPa

SCH3 o CH (1) (3) (Fe,Ni)S 100 C 0.2 MPa O CH3 3 CO 4 HO C CO (9) (3) FeS 100oC 0.2 MPa CH3 H2S/CO 2 HCO2H (1) (5) (Fe,Ni)S 100oC 0.2 MPa CO CO CH3 OC Fe, Co, Ni (3) (4) (Fe,Ni)S 100oC 0.2 MPa Cluster/mineral 1 CO library (2) (6) FeS 250oC 200 MPa NH3 COOH (6) (7) FeS 100oC 0.2 MPa 8 Peptide library Ala CO 6 7 (7) (8) (Fe,Ni)S 100oC 0.2 MPa CH3

Figure by MIT OpenCourseWare. Figure by MIT OpenCourseWare.

Wächtershäuser comment on, Cody et al . (2000) Science 289:1337. Information in the Cell

Transcription Translation

RNA DNA Protein

Figure by MIT OpenCourseWare. Protein Structure

Image courtesy of nist.gov. DNA STRUCTURE AND FUNCTION

atgaaacgtgaatcttatcaagcggagatgttcaattggtgtgaagccctgaa agatcag attcaaaagcgaggtcagcttgaccagtttgaagatcaaatcgacaagatg attgaggct ctggaagatgaccaaacaacagaagaagattggtataaacaggccgctg ccctttatcgg gatattacagaatcagatgatacaagtgaaagacgcgcttatgtccctatag ggaaacac gtgctgccaaagcttccttacaaatactccgccttagaaccttatatatcacgc gatatt atgatccttcatcatacaaaacatcatcaaagctatgtcgatggcctgaacaa agcagaa tcagagcttaaaaaagcgagagcgacaaagaattatgacttaatcactcatt gggaaaga gagcttgcgttccatggagcaggccattatttgcatagtattttttggttttctatgc at ccaaacggaaaacggcgtcctacaggggcattgttccaaatgatagaccttt catttgga agctattccgcttttaaagaacattttacccaggcctctaaaaaagtggaagg cgtcggc tgggccattctggtctgggcacctcgatcaggacggctggagattttaacggc agaaaaa caccagctctttagccaatgggatgtgatcccccttttaccgcttgacgtatgg gagcat gcctactatttgcaatacaaaaatgaccgggccagctatgtcgatcactggtg gaatgtc gtggattggcgcgaggctgaaaaacgttttgagcaggcaaaagaagtcgttt ggaagctc tat CODON TABLE

A C G U

tLys1,2 tThr1,2 tArg1,2 tIso1,2 A

tAsn1,2 tThr3,4 tSer1,2 tIso3,4 C A tLys3,4,5 tThr5,6,7 tArg3,4,5 tMet1,2,3 G

tAsn3,4,5 tThr8,9,10 tSer3,4,5 tIso5,6,7 U

tGln1,2 tPro1,2 tArg6,7 tLeu6,7 A

tHis1,2 tPro3,4 tArg8,9 tLeu8,9 C C tGln3,4,5 tPro5,6,7 tArg10,11,12 tLeu10,11,12 G

tHis3,4,5 tPro8,9,10 tArg13,14,15 tLeu13,14,15 U

tGlu1,2 tAla1,2 tGly1,2 tVal1,2 A

tAsp1,2 tAla3,4 tGly3,4 tVal3,4 C G tGlu3,4,5 tAla5,6,7 tGly5,6,7 tVal5,6,7 G

tAsp3,4,5 tAla8,9,10 tGly8,9,10 tVal8,9,10 U

Stop tSer6,7 Stop tLeu1,2 A

tTyr1,2 tSer8,9 tCys1,2 tPhe1,2 C U Stop tSer10,11,12 tTrp1,2,3 tLeu3,4,5 G

tTyr3,4,5 tSer13,14,15 tCys3,4,5 tPhe3,4,5 U

Figure by MIT OpenCourseWare. RNA CAN CATALYZE PROCESSES

Ribozyme Cut (cleaved) RNA messages

RNA message

Ribozyme-mediated cut introduced into RNA message

Figure by MIT OpenCourseWare.