DOCSLIB.ORG

Probeuid,Sequence,Actuals,Cyto Range Max,Synonyms

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Probeuid,Sequence,Actuals,Cyto Range Max,Synonyms probeuid,sequence,actuals,cyto_range_max,Synonyms,Properties,Gene,Molecular_Func tions,Gadfly,Full_Name,Protein_Domains,Recombination_Map,GameFileID,chromosome_i d,PhysicalMapStart,PhysicalMapEnd,bias_toward,autosome,xsome_id,ovaries_38,teste s_39,soma_40,male_biased_41,female_biased_42,F,C,MF,M,MFC,CF,on_group,gca_male,s ca_male,rgca_male,rsca_male,gca_female,sca_female,rgca_female,rsca_female,sex_si gnificant,any_sig_male,any_sig_female,simple,pattern_male,pattern_female 3,AAGATAAAGAAAGCCGTCACAGACTTTACATCGGACATTACTTATAATCCTGGCAAGCGT,CG7441- RA,75A7,BEST:CK01295 - CG7441,,CG7441,tryptophan-tRNA ligase activity,CG7441,,,,AE003522,3L,17814954,17817713,male,1,autosome,0,1,0,0,0,0,0,0 ,0,0,0,both,n,n,n,n,n,n,n,y,y,n,y,n,nnnn,nnny 7,CTACTACAAGTACAAGAGCTACTCCAACTACGGCCACTTCGACTACACCTTCTTCAACGA,CG4178- RA,21E1,Lsp1-beta - LSP 1 - Lsp-1b - Lsp1beta - Lsp-1beta - DmeLSP1b - LSP-1 - LSP-1 beta - Lsp1b - LSP1beta - Lsp1 - LSP-1beta,,Lsp1beta,nutrient reservoir activity,CG4178,Larval serum protein 1 &bgr;,IPR000896 == Arthropod hemocyanin/insect LSP IPR005203 == Hemocyanin C-terminal IPR005204 == Hemocyanin N-terminal IPR008922 == Di-copper center-containing,2- 1.9,AE003588,2L,898647,901320,male,1,autosome,0,0,0,0,0,0,0,0,0,0,0,both,y,n,y,n ,y,n,n,n,y,y,y,n,ynyn,ynnn 8,GATGTACCATGAGTACAAATGCTGGGAGCGAGTAAATGGGAATAAGCTAGTGGAGGACAA,CG31557- RA,83D4,83f-2 - 83f-1 - Obp83e - Pseudogene 83e - OBP83e - 83f - CG15583 - Obp83f - Obp83ef,,Obp83ef,odorant binding,CG31557,Odorant-binding protein 83ef,IPR006170 == Pheromone/general odorant binding protein PBP/GOBP IPR006625 == Insect pheromone/odorant binding protein PhBP,,AE003600,3R,1935501,1936730,male,1,autosome,0,0,0,0,0,0,0,0,0,0,0,both,y,n ,n,n,y,n,n,n,y,y,y,n,ynnn,ynnn 15,AGAACAAGTCCATGAAAACCTCAAAGTTATATGTTATTAAGAGAGATGGCAGGCAGGAGG,CG5371- RA,31D8,ribonucleoside-diphosphate reductase large subunit - unnamed - RnrM1 - DmRNR1 - l(2)k06709 - RntL - RnrL - RNR1,,RnrL,,CG5371,Ribonucleoside diphosphate reductase large subunit,IPR000788 == Ribonucleotide reductase large subunit IPR005144 == ATP-cone IPR008926 == Ribonucleotide reductase R1 subunit N- terminal,,AE003628,2L,10325018,10327986,female,1,autosome,0,0,0,0,0,0,0,0,0,0,0, both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 17,ACAGCCACGATCACGGTCATTCGCACGGCGGATTCGAAGAGGTCAAGACCATCAAGGTCA,CG15731- RA,11A11,CG15731,,CG15731,,CG15731,,,,AE003489,X,12290341,12291697,,0,X,0,0,0,0, 0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,n,n,n,n,nnnn,nnnn 18,AACGCCGCAGTTGAATTGCGGGCAGTACACGTTCAACAAGACCTACTGCATCCCTCCGCA,CG12654- RA,8E2,CG12654,,CG12654,low-density lipoprotein receptor activity,CG12654,,,,AE003447,X,9227659,9229457,,0,X,0,0,0,0,0,0,0,0,0,0,0,both,n ,n,n,n,n,n,n,n,n,n,n,n,nnnn,nnnn 19,GATCTGGATCCCTTCAAGCAGATGAAACTCTTCAAGAAACTTCCCGAACTATTTCCCACA,CG9050- RA,26A4,BcDNA:GM32356 - CG9050,,CG9050,,CG9050,,,,AE003612,2L,5963138,5964322,female,1,autosome,0,0,0,0, 0,0,0,0,0,0,0,both,y,n,n,n,y,n,n,n,y,y,y,n,ynnn,ynnn 21,CAATCACTCAACAATGACTTTGTGAACAACACCAATGCTTCCGGCAGTCAATTGGGAAGT,CG32836- RA,60E5,CG32836,,CG32836,molecular_function unknown,CG32836,,,,AE003465,2R,20394823,20395970,female,1,autosome,0,0,0,0,0,0,0 ,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 24,TGCTTCTTCAAAGCCCAAAGTCTATTCGATTCTGGAGAAGGCTCGATATGTGATGGACGA,CG3613- RA,58D8,qrk58E-1 - qkr58E-1 - qkr-58-E - KH-domain,,qkr58E-1,RNA binding,CG3613,,,,AE003457,2R,17920490,17923124,female,1,autosome,0,0,0,0,0,0,0, 0,0,0,0,both,y,n,n,n,n,n,n,n,y,y,n,n,ynnn,nnnn 26,AATATCCATGGTATCGTTCAAAAATCGCTTCGCCCACATCAAGAAGTGCTTCAGCATCAA,CG30096- RA,53B3,CG30096,,CG30096,molecular_function unknown,CG30096,,,,AE003807,2R,11836412,11836973,female,1,autosome,0,0,0,0,0,0,0 ,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 31,ATATTTCCTTACCATCTGCACCAAGAACCACTTGAGTCTGGCCGTGATCTTGAAGATCTT,CG16993- RA,77B6,in - B,,in,,CG16993,,,,AE003591,3L,20301041,20304103,male,1,autosome,0,0,0,0,0,0,0,0, 0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 32,GAAAATGTTGAATCAGATTACATCATCGCTGGCAGATACTCTCTTTAAGACGGAAATCGT,CG11064- RA,102F6,RfaBP - RFABG - RFBP - DRBP - T3 - retinoid-fatty acid binding protein - RfaBp,,RfaBp,fatty acid binding - heme binding - microtubule binding - retinoid binding - structural molecule activity,CG11064,,,,AE003846,4,1085162,1096454,male,0,4,0,0,0,0,0,0,0,0,0,0,0,bo th,y,n,n,n,n,n,n,n,y,y,n,n,ynnn,nnnn 33,ACGAGTGCTCCAGCGTCTATGGAACCGATGTGATCACCGACAACGTCATCTGCACCTCCA,CG8869- RA,25B4,Jonah 25B - CG8869 - 25B - Jon25B - Jon25Bii - SP112,,Jon25Bii,chymotrypsin activity - serine-type endopeptidase activity,CG8869,Jonah 25Bii,IPR001254 == Peptidase S1 chymotrypsin IPR001314 == Peptidase S1A chymotrypsin IPR009003 == Peptidase trypsin-like serine and cysteine proteases,2- [13],AE003608,2L,4952250,4953134,male,1,autosome,0,0,0,0,0,0,0,0,0,0,0,both,y,n, y,n,y,n,n,n,y,y,y,n,ynyn,ynnn 35,TCGACCATTATCCCACACGTTTCGGACAAAACGGAAAGTGTGAAGAAATTCAAAAAGGAA,CG30365- RA,44C4,CG2149 - CG30365 - BcDNA:AT04457,,CG30365,,CG30365,,,,AE003837,2R,3870761,3873003,male,1,autosome,0 ,0,0,0,0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 47,ATCCGCAAGTATATGAACGGAAATGGCGGCAAAAACATCAACGAACTATCAGATTTGGTT,CG9139- RA,61F5,CG9139,,CG9139,guanyl-nucleotide exchange factor activity,CG9139,,,,AE003471,3L,1279274,1282029,female,1,autosome,0,0,0,0,0,0,0,0 ,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 50,GACTTTAAGAACGAATTGAATGAACTGGGCATGCTAGAGGATTCAATGGATGGGGATACA,CG11375- RA,96A23,BAF180 - baf180 - CG11375,,baf180,,CG11375,,,,AE003749,3R,20625691,20630977,female,1,autosome,0,0, 0,0,0,0,0,0,0,1,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 52,AGGTACTTTATTCCAAACGGCTTCAGCAGCTCCAGCCTCAACTGGGACGTGGGCGTCATC,CG3650- RA,60E3,SP159 - CG3650,,CG3650,trypsin activity,CG3650,,,,AE003465,2R,20356576,20357361,,1,autosome,0,0,0,0,0,0,0,0,0,0 ,0,both,n,n,n,n,n,y,n,n,n,n,y,n,nnnn,nynn 56,ACATTAATGTGGAGGACATAAAGCCAGAGGTGAAAAAGATCGAACGCGATGATGATGAAA,CG18041- RA,99C4,CG18041,,CG18041,,CG18041,,,,AE003771,3R,25680412,25683191,female,1,auto some,0,0,0,0,0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 57,CTGGTCTAAGGAGTGGCATTATGTCGTATTTTCGGACGAGAAGAAATTTAATCTGGAGGG,CG33347- RA,41F3,CG33347,,CG33347,,CG33347,,,,AE003787,2R,862866,863168,male,1,autosome,0 ,0,0,0,0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 59,GATGAGTTGGGAATCGTTTCGGTATGAACTTAACGAGCGAACCTCCCATTTGATTGCAAA,CG5561- RA,22A1,CG5561,,CG5561,,CG5561,,,,AE003586,2L,1352970,1354109,male,1,autosome,0, 0,0,0,0,0,0,0,0,0,1,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 60,AAAAACGGCCCTAATAGCTCCGAACAGTCAGCAAATTTTCAAGCTACAGAATCAAGTGAT,CG9342- RA,38F5,CG9342,,CG9342,carrier activity - triglyceride binding,CG9342,,,,AE003668,2L,20906684,20910443,female,1,autosome,0,0,0,0,0,0,0, 0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 61,GAGAAAATAAAGATACCTACTTTTATACTCCACGGAAAGAAGGATCCCATGATAGCAGCG,CG5377- RA,94A16,CG5377,,CG5377,serine hydrolase activity,CG5377,,,,AE003739,3R,18292627,18293849,female,1,autosome,0,1,0,0,0,0,0 ,0,0,0,0,both,y,n,n,n,n,n,n,n,y,y,n,n,ynnn,nnnn 63,AGTCTAGACCAAATAGTAGAAGTATTAGTAGCCTTAATCGTAGTCAATTGCCTGGCCACA,CG4316- RA,89B9,stubbloid - c-SP56 - sbd - Sb - st-sb - Sb-sbd - SP56,,Sb,serine-type endopeptidase activity - trypsin activity,CG4316,,,,AE003712,3R,11954451,11971006,,1,autosome,0,0,0,0,0,0,0,0,0,0 ,0,fem,,,,,n,n,n,n,n,,n,,,nnnn 69,ATCTTAACCGCGTTCAGGAACTTGGGGATAAAGCCAGGAAGGCGTGTGCAACCAGCGGTC,CG12511- RA,25F2,CG12511,,CG12511,,CG12511,,,,AE003610,2L,5678785,5679150,male,1,autosome ,0,0,0,0,0,0,0,0,0,0,0,both,y,n,n,n,n,n,n,n,y,y,n,n,ynnn,nnnn 73,CTACAATGCAATTAAATTCCGACCTGATCATTTCACCGAATATCTGCTTAGCCCGGAAGT,CG1239- RA,83C1,cg1239 - CG1239,,CG1239,,CG1239,,,,AE003602,3R,1559263,1560424,female,1,autosome,0,0,0,0, 0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 82,ACGATTCGCAAAAGCCATCAAAAAGTCCCTAAACGACATGAGAAAACTAATCCTGCTCAC,CG5122- RA,34A6,CG5122,,CG5122,carnitine O-acetyltransferase activity,CG5122,,,,AE003639,2L,13130613,13134805,male,1,autosome,0,0,0,0,0,0,0,0 ,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 84,TTCGTCACCAGTTTCAACAAGCAATGCGAGGAAGTGGAGAAGTTCCCAGTGATCATTGAA,CG8374- RA,85E5,dmt - 0481/03 - s048103,,dmt,molecular_function unknown,CG8374,,,,AE003684,3R,5536862,5540397,female,1,autosome,0,1,0,0,0,0,0,0, 0,0,0,both,n,n,n,n,n,n,n,y,y,n,y,n,nnnn,nnny 86,GCAGCGGCTGTATGAGGATAATTATTCAAATCTTCTACAGCTAAACATTAAGCCGCCCCA,CG31672- RA,22C1,BEST:LD15963 - CG4248 - CG31672 - n(2)k09932,,CG31672,,CG31672,,,,AE003584,2L,2045525,2048054,female,1,autosome,0, 0,0,0,0,0,0,0,0,0,0,both,y,n,n,n,n,n,n,n,y,y,n,n,ynnn,nnnn 87,CCGATACTCCATGAAAGGCATCAATTTCGATGTTAAACGCGATATACAAAAGGTGGATGC,CG5509- RA,87B11,CG5509,,CG5509,,CG5509,,,,AE003696,3R,8278212,8278677,male,1,autosome,0 ,0,0,0,0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 88,ATTGCGATGGTTTTGGCATTTCCTGATAACGACGATAAAAATGTTCTTGTGCCAGCTGAT,CG13427- RA,57A5,CG13427,,CG13427,,CG13427,,,,AE003791,2R,16053811,16054128,,1,autosome,0 ,0,0,0,0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,n,n,n,n,nnnn,nnnn 89,TCGACATCCTCTGATGAACCCAAGTACAAGGAGCTCATTGAAGAATACGAAATGCTCAAC,CG13813- RA,77A3,CG13813,,CG13813,,CG13813,,,,AE003514,3L,20165561,20166913,female,1,auto some,0,0,0,0,0,0,0,0,0,0,0,fem,,,,,n,n,n,n,y,,n,,,nnnn 91,CACATAACAAGAATAGTAGAACATTGTACAGAAACTCCGCTGGAAGATGACTACGAGCAC,CG7988- RA,90F5,CG7988,,CG7988,molecular_function unknown,CG7988,,,,AE003721,3R,14046248,14047199,female,1,autosome,0,0,0,0,0,0,0, 0,0,1,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 94,TCACAGTTTACTTTGCCTATAAAATGTGAGCCACAAAGTGTACAAGGTATCGAGCAGCAG,CG2267- RA,100A1,CG2267,,CG2267,,CG2267,,,,AE003774,3R,26452962,26454750,male,1,autosome ,0,0,0,0,0,0,0,0,0,0,0,both,n,n,n,n,n,n,n,n,y,n,n,n,nnnn,nnnn 95,CTTTCGTTCGTGTTTATCGGATATGTGTTGCGGATCAAATACAGGTACAAGCAGCACTAC,CG8008- RA,45B1,CG8008,,CG8008,,CG8008,,,,AE003834,2R,4669720,4673248,male,1,autosome,0,
Load more

Recommended publications
  • An Atpase Domain Common to Prokaryotic Cell Cycle Proteins
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7290-7294, August 1992 Biochemistry An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp7O heat shock proteins (structural comparison/property pattern/remote homology) PEER BORK, CHRIS SANDER, AND ALFONSO VALENCIA European Molecular Biology Laboratory, D-6900 Heidelberg, Federal Republic of Germany Communicated by Russell F. Doolittle, March 6, 1992 ABSTRACT The functionally diverse actin, hexokinase, and hsp7O protein families have in common an ATPase domain of known three-dimensional structure. Optimal superposition ofthe three structures and alignment ofmany sequences in each of the three families has revealed a set of common conserved residues, distributed in five sequence motifs, which are in- volved in ATP binding and in a putative interdomain hinge. From the multiple sequence aliment in these motifs a pattern of amino acid properties required at each position is defined. The discriminatory power of the pattern is in part due to the use of several known three-dimensional structures and many sequences and in part to the "property" method ofgeneralizing from observed amino acid frequencies to amino acid fitness at each sequence position. A sequence data base search with the pattern significantly matches sugar kinases, such as fuco-, glucono-, xylulo-, ribulo-, and glycerokinase, as well as the prokaryotic cell cycle proteins MreB, FtsA, and StbA. These are predicted to have subdomains with the same tertiary structure as the ATPase subdomains Ia and Ha of hexokinase, actin, and Hsc7O, a very similar ATP binding pocket, and the capacity for interdomain hinge motion accompanying func- tional state changes.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation
    Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation Basti Bergdahl*, Anders G. Sandstro¨ m, Celina Borgstro¨ m, Tarinee Boonyawan¤, Ed W. J. van Niel, Marie F. Gorwa-Grauslund Division of Applied Microbiology, Department of Chemistry, Lund University, Lund, Sweden Abstract Hexokinase 2 (Hxk2p) from Saccharomyces cerevisiae is a bi-functional enzyme being both a catalyst and an important regulator in the glucose repression signal. In the presence of xylose Hxk2p is irreversibly inactivated through an autophosphorylation mechanism, affecting all functions. Consequently, the regulation of genes involved in sugar transport and fermentative metabolism is impaired. The aim of the study was to obtain new Hxk2p-variants, immune to the autophosphorylation, which potentially can restore the repressive capability closer to its nominal level. In this study we constructed the first condensed, rationally designed combinatorial library targeting the active-site in Hxk2p. We combined protein engineering and genetic engineering for efficient screening and identified a variant with Phe159 changed to tyrosine. This variant had 64% higher catalytic activity in the presence of xylose compared to the wild-type and is expected to be a key component for increasing the productivity of recombinant xylose-fermenting strains for bioethanol production from lignocellulosic feedstocks. Citation: Bergdahl B, Sandstro¨m AG, Borgstro¨m C, Boonyawan T, van Niel EWJ, et al. (2013) Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation. PLoS ONE 8(9): e75055. doi:10.1371/journal.pone.0075055 Editor: Paul Hoskisson, University of Strathclyde, United States of America Received June 29, 2013; Accepted August 5, 2013; Published September 6, 2013 Copyright: ß 2013 Bergdahl et al.
    [Show full text]
  • Supplementary Information
    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9.410,182 B2 W (45) Date of Patent: Aug
    USOO941 0182B2 (12) United States Patent (10) Patent No.: US 9.410,182 B2 W (45) Date of Patent: Aug. 9, 2016 (54) PHOSPHATASE COUPLED OTHER PUBLICATIONS GLYCOSYLTRANSFERASE ASSAY Wu et al., R&D Systems Poster, “Universal Phosphatase-Coupled (75) Inventor: Zhengliang L. Wu, Edina, MN (US) Glycosyltransferase Assay”, Apr. 2010, 3 pages.* “Malachite Green Phosphate Detection Kit'. Research and Diagnos (73) Assignee: Bio-Techne Corporation, Minneapolis, tic Systems, Inc. Catalog No. DY996, Feb. 4, 2010, 6 pages.* MN (US) Zhu et al., Analytica Chimica Acta 636:105-110, 2009.* Motomizu et al., Analytica Chimica Acta 211:119-127, 1988.* *) NotOt1Ce: Subjubject to anyy d1Sclaimer,disclai theh term off thisthi Schachter et al., Methods Enzymol. 98.98-134, 1983.* patent is extended or adjusted under 35 Unverzagt et al., J. Am. Chem. Soc. 112:9308-9309, 1990.* U.S.C. 154(b) by 0 days. IUBMB Enzyme Nomenclature for EC 3.1.3.1, obtained from www. chem.cmul.ac.uk/iubmb? enzyme/EC3/1/3/5.html, last viewed on (21) Appl. No.: 13/699,175 Apr. 13, 2015, 1 page.* IUBMB Enzyme Nomenclature for EC 3.1.3.5, obtained from www. (22) PCT Filed: May 24, 2010 chem.cmul.ac.uk/iubmb? enzyme/EC3/1/3/5.html, last viewed on Apr. 13, 2015, 1 page.* (86). PCT No.: PCT/US2010/035938 Compain et al., Bio. Med. Chem. 9:3077-3092, 2001.* Lee et al., J. Biol. Chem. 277:49341-49351, 2002.* S371 (c)(1), Donovan R S et al., “A Solid-phase glycosyltransferase assay for (2), (4) Date: Nov.
    [Show full text]
  • Supplementary Informations SI2. Supplementary Table 1
    Supplementary Informations SI2. Supplementary Table 1. M9, soil, and rhizosphere media composition. LB in Compound Name Exchange Reaction LB in soil LBin M9 rhizosphere H2O EX_cpd00001_e0 -15 -15 -10 O2 EX_cpd00007_e0 -15 -15 -10 Phosphate EX_cpd00009_e0 -15 -15 -10 CO2 EX_cpd00011_e0 -15 -15 0 Ammonia EX_cpd00013_e0 -7.5 -7.5 -10 L-glutamate EX_cpd00023_e0 0 -0.0283302 0 D-glucose EX_cpd00027_e0 -0.61972444 -0.04098397 0 Mn2 EX_cpd00030_e0 -15 -15 -10 Glycine EX_cpd00033_e0 -0.0068175 -0.00693094 0 Zn2 EX_cpd00034_e0 -15 -15 -10 L-alanine EX_cpd00035_e0 -0.02780553 -0.00823049 0 Succinate EX_cpd00036_e0 -0.0056245 -0.12240603 0 L-lysine EX_cpd00039_e0 0 -10 0 L-aspartate EX_cpd00041_e0 0 -0.03205557 0 Sulfate EX_cpd00048_e0 -15 -15 -10 L-arginine EX_cpd00051_e0 -0.0068175 -0.00948672 0 L-serine EX_cpd00054_e0 0 -0.01004986 0 Cu2+ EX_cpd00058_e0 -15 -15 -10 Ca2+ EX_cpd00063_e0 -15 -100 -10 L-ornithine EX_cpd00064_e0 -0.0068175 -0.00831712 0 H+ EX_cpd00067_e0 -15 -15 -10 L-tyrosine EX_cpd00069_e0 -0.0068175 -0.00233919 0 Sucrose EX_cpd00076_e0 0 -0.02049199 0 L-cysteine EX_cpd00084_e0 -0.0068175 0 0 Cl- EX_cpd00099_e0 -15 -15 -10 Glycerol EX_cpd00100_e0 0 0 -10 Biotin EX_cpd00104_e0 -15 -15 0 D-ribose EX_cpd00105_e0 -0.01862144 0 0 L-leucine EX_cpd00107_e0 -0.03596182 -0.00303228 0 D-galactose EX_cpd00108_e0 -0.25290619 -0.18317325 0 L-histidine EX_cpd00119_e0 -0.0068175 -0.00506825 0 L-proline EX_cpd00129_e0 -0.01102953 0 0 L-malate EX_cpd00130_e0 -0.03649016 -0.79413596 0 D-mannose EX_cpd00138_e0 -0.2540567 -0.05436649 0 Co2 EX_cpd00149_e0
    [Show full text]
  • Genetic Tools for High Yield Protein Production with Bacillus Megaterium
    Genetic tools for high yield protein production with Bacillus megaterium Von der Fakultät für Lebenswissenschaften der Technischen Universität Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) genehmigte D i s s e r t a t i o n von Simon Stammen aus Kevelaer 1. Referent: Professor Dr. Dieter Jahn 2. Referent: Professor Dr. Petra Dersch eingereicht am: 01.09.2010 mündliche Prüfung (Disputation) am: 08.10.2010 Druckjahr 2010 Vorveröffentlichungen der Dissertation: Teilergebnisse aus dieser Arbeit wurden mit Genehmigung der Fakultät für Lebenswissenschaften, vertreten durch den Mentor der Arbeit, in folgenden Beiträgen vorab veröffentlicht: Publikationen: Stammen, S. , Schuller, F., Dietrich, S., Gamer, M., Biedendieck R. and D. Jahn. 2010. Application of Escherichia coli phage K1E DNA-dependent RNA polymerase for in vitro RNA synthesis and in vivo protein production in Bacillus megaterium . Appl Microbiol Biotechnol 88 :529-539. Stammen, S. , Müller, B. K., Korneli, C., Biedendieck, R., Gamer, M., Franco-Lara, E. and D. Jahn. 2010. High yield intra- and extracellular protein production using Bacillus megaterium . Appl Environ Microbiol 76 :4037-4046. Bunk, B., Schulz, A., Stammen, S. , Münch, R., Warren, M. J., Rohde, M., Jahn, D. and R. Biedendieck. 2010. A short story about a big magic bug. Bioengineered Bugs 1:1-7. Gamer, M., Fröde, D., Biedendieck, R., Stammen, S. and D. Jahn. 2009. A T7 RNA polymerase-dependent gene expression system for Bacillus megaterium . Appl Microbiol Biotechnol 82 :1195-1203. Tagungs- und Industriebeiträge: Stammen, S. , Schuller, F., Dietrich, S., Gamer, M., Biedendieck, R. and D. Jahn. 2010. A novel DNA-dependent RNA polymerase of Escherichia coli phage K1E: production, characterization and application.
    [Show full text]
  • Genome-Wide Investigation of Cellular Functions for Trna Nucleus
    Genome-wide Investigation of Cellular Functions for tRNA Nucleus- Cytoplasm Trafficking in the Yeast Saccharomyces cerevisiae DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Yi Chu Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2012 Dissertation Committee: Anita K. Hopper, Advisor Stephen Osmani Kurt Fredrick Jane Jackman Copyright by Hui-Yi Chu 2012 Abstract In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the cytoplasm for their essential role in protein synthesis. This export event was thought to be unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent. This newly discovered tRNA retrograde process is conserved from yeast to vertebrates. Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under investigation, previous studies identified several transporters involved in tRNA subcellular dynamics. At least three members of the β-importin family function in tRNA nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5 functions solely in the re-export process. In this thesis I focus on the physiological role(s) of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this hypothesis, I compared expression profiles from non-translating mRNAs and polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and wild-type cells, in fed or acute amino acid starvation conditions.
    [Show full text]
  • Dominant Negative G Proteins Enhance Formation and Purification
    This article is made available for a limited time sponsored by ACS under the ACS Free to Read License, which permits copying and redistribution of the article for non-commercial scholarly purposes. Letter Cite This: ACS Pharmacol. Transl. Sci. 2018, 1, 12−20 pubs.acs.org/ptsci Dominant Negative G Proteins Enhance Formation and Purification of Agonist-GPCR‑G Protein Complexes for Structure Determination † # † # † # † † Yi-Lynn Liang, , Peishen Zhao, , Christopher Draper-Joyce, , Jo-Anne Baltos, Alisa Glukhova, † † † † ‡ † ‡ Tin T. Truong, Lauren T. May, Arthur Christopoulos, Denise Wootten,*, , Patrick M. Sexton,*, , † and Sebastian G. B. Furness*, † Drug Discovery Biology, Monash Institute of Pharmaceutical Sciences, Monash University, Parkville, 3052, Australia ‡ School of Pharmacy, Fudan University, Shanghai 201203, China ABSTRACT: Advances in structural biology have yielded exponential growth in G protein-coupled receptor (GPCR) structure solution. Nonetheless, the instability of fully active GPCR complexes with cognate heterotrimeric G proteins has made them elusive. Existing structures have been limited to nanobody-stabilized GPCR:Gs complexes. Here we present methods for enhanced GPCR:G protein complex stabilization via engineering G proteins with reduced nucleotide affinity, limiting Gα:Gβγ dissociation. We illustrate the application of dominant negative G proteins of Gαs and Gαi2 to the purification of stable complexes where this was not possible with wild-type G protein. Active state complexes of adenosine:A1 receptor:Gαi2βγ and calcitonin gene-related peptide (CGRP):CLR:RAMP1:Gαsβγ:Nb35 were purified to homogeneity and were stable in negative stain electron microscopy. These were suitable for structure determination by cryo-electron microscopy at 3.6 and 3.3 Å resolution, respectively.
    [Show full text]
  • Apyrase from Potato (A6237)
    Apyrase from potato recombinant, expressed in Pichia pastoris Catalog Number A6237 Storage Temperature –20 °C CAS RN 9000-95-7 Precautions and Disclaimer EC 3.6.1.5 This product is for R&D use only, not for drug, Synonyms: Nucleoside-triphosphatase, household, or other uses. Please consult the Safety ATP diphosphohydrolase, Data Sheet for information regarding hazards and safe ADP diphosphohydrolase, handling practices. Adenosine 5¢-diphosphatase, Adenosine 5¢-triphosphatase Preparation Instructions This product is soluble in water. It is recommended to Product Description reconstitute material in water to a concentration of A large number of plant and animal tissues contain 100–500 units/ml. pyrophosphohydrolases commonly called apyrases. These enzymes catalyze the hydrolysis of a broad Storage/Stability range of nucleoside tri- and di-phosphates.1,2 Store product at –20 °C. When stored at –20 °C, the enzyme retains activity for at least two years. ATP ® ADP + Pi ® AMP + 2 Pi After reconstitution, product can be kept at 2–8 °C for Some characteristics distinguish apyrases from other up to one week. It is recommended to store the protein phosphohydrolases, such as high specific activity, in working aliquots at –20 °C. broad nucleotide substrate specificity for nucleotides, and insensitivity to specific inhibitors of P-type, F-type, References and V-type ATPases.3 In addition, they require metal 1. Kettlun, A.M. et al., Purification and cations for their activity, the major positive effect characterization of two isoapyrases from Solanum achieved with Ca+2 . tuberosum var. Ultimus. Phytochemistry, 31, 3691– 3696 (1992). This recombinant product was cloned from Solanum 2.
    [Show full text]
  • Regulation of Phosphotransferases in Glucose- and Xylose-Fermenting Yeasts
    Copyright © 1997 by Humana Press Inc. All rights of any nature whatsoever reserved. 0273-2289/97/63-65–0097$11.00 Regulation of Phosphotransferases in Glucose- and Xylose-Fermenting Yeasts V INA W. YANG AND THOMAS W. JEFFRIES * Institute for Microbial and Biochemical Technology, Forest Products Laboratory, ** One Gifford Pinchot Drive, Madison, WI 53705-2398 ABSTRACT This research examined the titers of hexokinase (HK), phosphofruc- tokinase (PFK), and xylulokinase (XUK) in Saccharomyces cerevisiae and two xylose fermenting yeasts, Pachysolen tannophilus and Candida she- hatae, following shifts in carbon source and aeration. Xylose-grown C. shehatae, glucose-grown P. tannophilus, and glucose-grown S. cerevisiae, had the highest specific activities of XUK, HK, and PFK, respectively. XUK was induced by xylose to moderate levels in both P. tannophilus and C. shehatae, but was present only in trace levels in S. cerevisiae. HK activi- ties in P. tannophilus were two to three fold higher when cells were grown on glucose than when grown on xylose, but HK levels were less inducible in C. shehatae. The PFK activities in S. cerevisiae were 1.5 to 2 times higher than in the two xylose-fermenting yeasts. Transfer from glucose to xylose rapidly inactivated HK in P. tannophilus, and transfer from xylose to glucose inactivated XUK in C. shehatae. The patterns of induction and inactivation indicate that the basic regulatory mechanisms differ in the two xylose fermenting yeasts. Index Entries: Saccharomyces cerevisiae; Pachysolen tannophilus; Candida shehatae; 6-phosphofructokinase; hexokinase; D-xylulokinase; regulation; phosphotransferase. * Author to whom all correspondence and reprint requests should be addressed. **Maintained in cooperation with the University of Wisconsin, Madison, WI This article was written and prepared by U.S.
    [Show full text]