DOCSLIB.ORG

Chro Name PEAK START PEAK END PEAK SCORE PEAK FDR

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplemental Table 1. Gene promoters identified by PBX1 ChIP-on-chip. Chro Name PEAK_START PEAK_END PEAK_SCORE PEAK_FDR FEATURE_TO_PEAK_DISTANCE accession description synonyms chr12 9-Mar 56432831 56433180 1.24 3.79E-02 -2160 BC036455 membrane-associated ring finger (C3HC4) 9 FLJ36578|MARCH-IX|RNF179 chr17 ABC1 55511680 55512134 1.03 3.04E-02 -843 CR627418 amplified in breast cancer 1 DKFZp686D22141|FLJ22087 chr17 ABC1 55511680 55512134 1.03 3.04E-02 -689 AF349752 amplified in breast cancer 1 DKFZp686D22141|FLJ22087 chr9 ABCA1 106730857 106731706 0.95 2.89E-02 -1024 AK024328 ATP-binding cassette, sub-family A (ABC1), member 1 ABC-1|ABC1|CERP|FLJ14958|HDLDT1|TGD chr16 ABCA3 2332611 2332760 1.59 2.39E-02 -2090 NM_001089 ATP-binding cassette, sub-family A (ABC1), member 3 ABC-C|ABC3|EST111653|LBM180|MGC72201 chr19 ABCA7 991844 992293 2.2 0.00E+00 -1591 NM_033308 ATP-binding cassette, sub-family A (ABC1), member 7 ABCA-SSN|ABCX|FLJ40025 chr19 ABCA7 991844 992293 2.2 0.00E+00 -175 NM_019112 ATP-binding cassette, sub-family A (ABC1), member 7 ABCA-SSN|ABCX|FLJ40025 chr2 ABCG5 43920467 43920916 1 2.01E-02 -1298 BC111541 ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1) sterolin 1 chr2 ABCG5 43920467 43920916 1 2.01E-02 -1229 NM_022436 ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1) sterolin 1 chr2 ABCG8 43920467 43920916 1 2.01E-02 1085 NM_022437 ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2) sterolin 2 chr2 ABHD1 27198660 27199109 1 3.71E-02 -1321 BC039576 abhydrolase domain containing 1 FLJ36128|LABH1 chr2 ABHD1 27198660 27199109 1 3.71E-02 -1275 NM_152870 abhydrolase domain containing 1 FLJ36128|LABH1 chr3 ABHD10 113180088 113180437 1.84 0.00E+00 -325 NM_018394 abhydrolase domain containing 10 FLJ11342 chr3 ABHD10 113180088 113180437 1.84 0.00E+00 -310 BC014516 abhydrolase domain containing 10 FLJ11342 chr20 ACOT8 43919468 43919817 1.24 8.82E-03 -200 NM_183385 acyl-CoA thioesterase 8 HNAACTE|PTE1|PTE2|hACTE-III|hTE chr19 ACP5 11549796 11550145 1.08 4.62E-02 -476 BC025414 acid phosphatase 5, tartrate resistant MGC117378|TRAP chr19 ACP5 11549796 11550145 1.08 4.62E-02 -474 NM_001611 acid phosphatase 5, tartrate resistant MGC117378|TRAP chr19 ACP5 11549796 11550145 1.08 4.62E-02 795 BC111014 acid phosphatase 5, tartrate resistant MGC117378|TRAP chr10 ACTR1A 104251553 104252102 1.79 0.00E+00 576 BC026016 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ARP1 chr10 ACTR1A 104251553 104252102 1.79 0.00E+00 610 BC000693 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ARP1 chr10 ACTR1A 104251553 104252102 1.79 0.00E+00 624 NM_005736 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ARP1 chr10 ACTR1A 104252753 104253413 1.63 0.00E+00 -679 BC026016 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ARP1 chr10 ACTR1A 104252753 104253413 1.63 0.00E+00 -645 BC000693 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ARP1 chr10 ACTR1A 104252753 104253413 1.63 0.00E+00 -631 NM_005736 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ARP1 chr14 ACYP1 74600489 74600738 2.3 0.00E+00 -133 BC035568 acylphosphatase 1, erythrocyte (common) type ACYPE chr14 ACYP1 74600489 74600738 2.3 0.00E+00 -124 NM_001107 acylphosphatase 1, erythrocyte (common) type ACYPE chr22 ADRBK2 24289545 24290094 0.92 4.83E-02 -1125 NM_005160 adrenergic, beta, receptor kinase 2 BARK2|GRK3 chr22 ADRBK2 24289545 24290094 0.92 4.83E-02 -1040 BC036797 adrenergic, beta, receptor kinase 2 BARK2|GRK3 chr6 AGPAT1 32253677 32254126 1.34 3.80E-03 -2063 BC004310 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1-AGPAT1|G15|LPAAT-alpha|LPAATA|MGC4007|MGC5423 chr6 AGPAT1 32253677 32254126 1.34 3.80E-03 -2051 BC090849 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1-AGPAT1|G15|LPAAT-alpha|LPAATA|MGC4007|MGC5423 chr6 AGPAT1 32253677 32254126 1.34 3.80E-03 -2024 NM_006411 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1-AGPAT1|G15|LPAAT-alpha|LPAATA|MGC4007|MGC5423 chr6 AGPAT1 32253677 32254126 1.34 3.80E-03 -81 NM_032741 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1-AGPAT1|G15|LPAAT-alpha|LPAATA|MGC4007|MGC5423 chr3 AGTR1 149929803 149930456 1.09 3.04E-02 -573 NM_032049 angiotensin II receptor, type 1 AG2S|AGTR1A|AGTR1B|AT1|AT1B|AT2R1|AT2R1A|AT2R1B|HAT1R chr1 AK2 33274958 33275307 1.34 3.73E-03 -105 BC009405 adenylate kinase 2 ADK2 chr1 AK2 33274958 33275307 1.34 3.73E-03 -91 BC090040 adenylate kinase 2 ADK2 chr1 AK2 33274958 33275307 1.34 3.73E-03 -74 NM_001625 adenylate kinase 2 ADK2 chr1 AK2 33274958 33275307 1.34 3.73E-03 -53 NM_013411 adenylate kinase 2 ADK2 chr17 AKAP1 52527985 52528634 1.11 2.01E-02 -775 NM_139275 A kinase (PRKA) anchor protein 1 AKAP|AKAP121|AKAP149|AKAP84|D-AKAP1|MGC1807|PRKA1|SAKAP84 chr15 AKAP13 83723751 83724803 0.75 3.35E-02 -674 AB055890 A kinase (PRKA) anchor protein 13 AKAP-Lbc|BRX|FLJ11952|FLJ43341|HA-3|Ht31|LBC|PROTO-LB|PROTO-LBC|c-lbc chr15 AKAP13 83723751 83724803 0.75 3.35E-02 -597 NM_006738 A kinase (PRKA) anchor protein 13 AKAP-Lbc|BRX|FLJ11952|FLJ43341|HA-3|Ht31|LBC|PROTO-LB|PROTO-LBC|c-lbc chr12 AKAP3 4627104 4627453 1.03 3.71E-02 -2696 BC047535 A kinase (PRKA) anchor protein 3 AKAP110|FSP95|PRKA3|SOB1 chr12 AKAP3 4627104 4627453 1.03 3.71E-02 -2674 NM_006422 A kinase (PRKA) anchor protein 3 AKAP110|FSP95|PRKA3|SOB1 chrX AKAP4 49851649 49853206 1 1.97E-02 -683 NM_139289 A kinase (PRKA) anchor protein 4 AKAP82|FSC1|HI|hAKAP82|p82 chrX AKAP4 49851649 49853206 1 1.97E-02 -23 NM_003886 A kinase (PRKA) anchor protein 4 AKAP82|FSC1|HI|hAKAP82|p82 chrX AKAP4 49853650 49854009 1.04 3.71E-02 -2085 NM_139289 A kinase (PRKA) anchor protein 4 AKAP82|FSC1|HI|hAKAP82|p82 chrX AKAP4 49853650 49854009 1.04 3.71E-02 -1425 NM_003886 A kinase (PRKA) anchor protein 4 AKAP82|FSC1|HI|hAKAP82|p82 chr19 AKT2 45484353 45484802 1.28 5.15E-03 -1541 NM_001626 v-akt murine thymoma viral oncogene homolog 2 PKBBETA|PRKBB|RAC-BETA chr11 ALKBH3 43856970 43857319 1 3.71E-02 -2049 BC103812 alkB, alkylation repair homolog 3 (E. coli) DEPC-1|DEPC1|MGC118790|MGC118792|MGC118793 chr11 ALKBH3 43856970 43857319 1 3.71E-02 -1854 BC067257 alkB, alkylation repair homolog 3 (E. coli) DEPC-1|DEPC1|MGC118790|MGC118792|MGC118793 chr11 ALKBH3 43856970 43857319 1 3.71E-02 -1825 NM_139178 alkB, alkylation repair homolog 3 (E. coli) DEPC-1|DEPC1|MGC118790|MGC118792|MGC118793 chr17 ALKBH5 18027213 18027562 1.27 5.15E-03 -895 AK000315 alkB, alkylation repair homolog 5 (E. coli) FLJ20308|OFOXD|OFOXD1 chr17 ALKBH5 18027213 18027562 1.27 5.15E-03 -625 NM_017758 alkB, alkylation repair homolog 5 (E. coli) FLJ20308|OFOXD|OFOXD1 chr1 AMY1A 104094063 104094320 1.55 4.78E-03 124 BC092444 amylase, alpha 1A%3B salivary AMY1|AMY1B chr1 AMY1A 104094063 104094320 1.55 4.78E-03 154 BC063129 amylase, alpha 1A%3B salivary AMY1|AMY1B chr1 AMY1A 103999966 104000226 1.39 7.52E-03 167 BC092444 amylase, alpha 1A%3B salivary AMY1|AMY1B chr1 AMY1A 103999966 104000226 1.39 7.52E-03 197 BC063129 amylase, alpha 1A%3B salivary AMY1|AMY1B chr1 AMY1A 103999966 104000226 1.39 7.52E-03 272 NM_004038 amylase, alpha 1A%3B salivary AMY1|AMY1B chr1 AMY1A 103999966 104000226 1.39 7.52E-03 433 NM_001008221 amylase, alpha 1A%3B salivary AMY1|AMY1B chr1 AMY1C 104094063 104094320 1.55 4.78E-03 228 NM_001008219 amylase, alpha 1C%3B salivary AMY1 chr14 ANG 20225471 20226424 0.74 4.05E-02 -827 BC062698 angiogenin, ribonuclease, RNase A family, 5 MGC71966|RNASE4|RNASE5 chr8 ANGPT1 108580330 108580789 1.42 1.40E-03 -1129 NM_001146 angiopoietin 1 AGP1|AGPT|ANG1 chr1 ANGPTL7 11171184 11172033 0.94 1.35E-02 -375 NM_021146 angiopoietin-like 7 AngX|CDT6|RP4-647M16.2|dJ647M16.1 chr17 ANKFN1 51583634 51584583 1.07 2.42E-02 -1725 NM_153228 ankyrin-repeat and fibronectin type III domain containing 1 FLJ38335 chr17 ANKFN1 51585934 51586283 1 3.71E-02 274 NM_153228 ankyrin-repeat and fibronectin type III domain containing 1 FLJ38335 chr5 ANKHD1 139760836 139761285 1.12 2.01E-02 -615 AF521882 ankyrin repeat and KH domain containing 1 MASK chr5 ANKHD1 139760836 139761285 1.12 2.01E-02 -576 BC004457 ankyrin repeat and KH domain containing 1 MASK chr5 ANKHD1 139760836 139761285 1.12 2.01E-02 -551 NM_017747 ankyrin repeat and KH domain containing 1 MASK chr18 ANKRD29 19498649 19499005 1.01 3.71E-02 -2050 AK057782 ankyrin repeat domain 29 FLJ25053 chr18 ANKRD29 19498649 19499005 1.01 3.71E-02 -1980 BC030622 ankyrin repeat domain 29 FLJ25053 chr18 ANKRD29 19498649 19499005 1.01 3.71E-02 -1978 NM_173505 ankyrin repeat domain 29 FLJ25053 chr1 ANKRD35 144258500 144258649 1.75 2.39E-02 -2043 BC101618 ankyrin repeat domain 35 FLJ25124|MGC126667|MGC126669 chr1 ANKRD35 144258500 144258649 1.75 2.39E-02 -2025 NM_144698 ankyrin repeat domain 35 FLJ25124|MGC126667|MGC126669 chr15 ANP32A 66902079 66902440 0.95 4.83E-02 -2115 BC106719 acidic (leucine-rich) nuclear phosphoprotein 32 family, member A C15orf1|I1PP2A|LANP|MAPM|MGC119787|PHAP1|PHAPI|PP32 chr15 ANP32A 66902079 66902440 0.95 4.83E-02 -1982 BC007200 acidic (leucine-rich) nuclear phosphoprotein 32 family, member A C15orf1|I1PP2A|LANP|MAPM|MGC119787|PHAP1|PHAPI|PP32 chr1 ANP32E 148474898 148475547 0.94 3.54E-02 -340 AL833660 acidic (leucine-rich) nuclear phosphoprotein 32 family, member E LANP-L|LANPL|MGC5350 chr1 ANP32E 148474898 148475547 0.94 3.54E-02 -275 BC003380 acidic (leucine-rich) nuclear phosphoprotein 32 family, member E LANP-L|LANPL|MGC5350 chr1 ANP32E 148474898 148475547 0.94
Recommended publications
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception

    Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception

    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
  • GLUTATHIONE TRANSFERASE N STRUCTURE and GENE REGULATION

    GLUTATHIONE TRANSFERASE N STRUCTURE and GENE REGULATION

    GLUTATHIONE TRANSFERASE n STRUCTURE AND GENE REGULATION By Chu-Lin Xia This report is in part-fulfillment of the requirements for the degree of doctor of philosophy in the University of London University College, University of London January 1992 ProQuest Number: 10609162 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest ProQuest 10609162 Published by ProQuest LLC(2017). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States C ode Microform Edition © ProQuest LLC. ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106- 1346 ABSTRACT In the early stage of this research, amino acid residues that are essential for the activity of human pi class glutathione transferase (GST n) were identified using chemical modification with group-specific reagents. Protection from inactivation by substrates, substrate analogues and inhibitors was used as the criterion for active site specificity. The results suggested the apparent involvement of one cysteine (Cys), one lysine (Lys), one arginine (Arg), one histidine (His) or tyrosine (Tyr) or both, one aspartate (Asp) or glutamate (Glu) and tryptophan (Trp) residues in the glutathione binding site (G-site) of GSTtc. It was concluded that without the knowledge of the three-dimensional structure of GST 7i, further work in this area would not be profitable and therefore, attention was turned to the regulation of GST n gene expression.
  • SNP Genotypes of Olfactory Receptor Genes Associated with Olfactory Ability in German Shepherd Dogs

    SNP Genotypes of Olfactory Receptor Genes Associated with Olfactory Ability in German Shepherd Dogs

    SHORT COMMUNICATION doi: 10.1111/age.12389 SNP genotypes of olfactory receptor genes associated with olfactory ability in German Shepherd dogs † ‡ – M. Yang*, G.-J. Geng , W. Zhang , L. Cui§, H.-X. Zhang and J.-L. Zheng‡ † *Police-dog Technology Department, National Police University of China, Shenyang, Liaoning 110034, China. Technology Department, ‡ Shenyang Traffic Police Detachment, Shenyang, Liaoning 110001, China. Forensic Medicine Department, National Police University of China, Shenyang, Liaoning 110854, China. §Document Inspection Department, National Police University of China, Shenyang, Liaoning – 110854, China. Mark Inspection Department, National Police University of China, Shenyang, Liaoning 110854, China. Summary To find out the relationship between SNP genotypes of canine olfactory receptor genes and olfactory ability, 28 males and 20 females from German Shepherd dogs in police service were scored by odor detection tests and analyzed using the Beckman GenomeLab SNPstream. The representative 22 SNP loci from the exonic regions of 12 olfactory receptor genes were investigated, and three kinds of odor (human, ice drug and trinitrotoluene) were detected. The results showed that the SNP genotypes at the OR10H1-like:c.632C>T, OR10H1-like:c.770A>T, OR2K2-like:c.518G>A, OR4C11-like: c.511T>G and OR4C11-like:c.692G>A loci had a statistically significant effect on the scenting abilities (P < 0.001). The kind of odor influenced the performances of the dogs (P < 0.001). In addition, there were interactions between genotype and the kind of odor at the following loci: OR10H1-like:c.632C>T, OR10H1-like:c.770A>T, OR4C11-like:c.511T>G and OR4C11-like:c.692G>A(P< 0.001).
  • Identification and Interaction Analysis of Molecular Markers in Pancreatic

    Identification and Interaction Analysis of Molecular Markers in Pancreatic

    medRxiv preprint doi: https://doi.org/10.1101/2020.12.20.20248601; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification and Interaction Analysis of Molecular Markers in Pancreatic Ductal Adenocarcinoma by Integrated Bioinformatics Analysis and Molecular Docking Experiments Basavaraj Vastrad1 , Chanabasayya Vastrad *2, Anandkumar Tengli3 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics,Chanabasava Nilaya, Bharthinagar, Dharwad, Karanataka 580001, India. 3. Department of Pharmaceutical Chemistry, JSS College of Pharmacy, Mysuru and JSS Academy of Higher Education & Research, Mysuru- 570015, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.20.20248601; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract The current investigation aimed to mine therapeutic molecular targets that play an key part in the advancement of pancreatic ductal adenocarcinoma (PDAC). The expression profiling by high throughput sequencing dataset profile GSE133684 dataset was downloaded from the Gene Expression Omnibus (GEO) database.
  • ANTICORPI BT-Policlonali

    ANTICORPI BT-Policlonali

    ANTICORPI BT-policlonali Cat# Item Applications Reactivity Source BT-AP00001 11β-HSD1 Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00002 11β-HSD1 Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00003 14-3-3 β Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00004 14-3-3 β/ζ Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00005 14-3-3 γ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00006 14-3-3 ε Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00007 14-3-3 ε Polyclonal Antibody WB,IHC-p Mouse,Rat Rabbit BT-AP00008 14-3-3 ζ Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit WB,IHC- BT-AP00009 14-3-3 ζ Polyclonal Antibody p,IP,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00010 14-3-3 ζ/δ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00011 14-3-3 η Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00012 14-3-3 θ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00013 14-3-3 θ/τ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00014 14-3-3 σ Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse Rabbit BT-AP00015 14-3-3-pan (Acetyl Lys51/49) Polyclonal Antibody WB,ELISA Human,Mouse,Rat Rabbit BT-AP00016 17β-HSD11 Polyclonal Antibody WB,ELISA Human Rabbit BT-AP00017 17β-HSD4 Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00018 2A5B Polyclonal Antibody WB,ELISA Human Rabbit BT-AP00019 2A5E Polyclonal Antibody WB,ELISA Human,Mouse Rabbit BT-AP00020 2A5G Polyclonal Antibody
  • United States Patent (19) 11 Patent Number: 5,869,438 Svendsen Et Al

    United States Patent (19) 11 Patent Number: 5,869,438 Svendsen Et Al

    USOO5869438A United States Patent (19) 11 Patent Number: 5,869,438 Svendsen et al. (45) Date of Patent: Feb. 9, 1999 54) LIPASE WARIANTS 52 U.S. Cl. ......................... 510/226; 435/198; 435/69.1; 435/252.3; 435/320.1; 435/196; 536/23.2; 75 Inventors: Allan Svendsen, Birkerød; Shamkant 536/23.7; 530/350; 510/392; 510/305 Anant Patkar, Lyngby; Erik Gormsen, 58 Field of Search ..................................... 435/198, 196, Virum; Jens Sigurd Okkels; Marianne 435/187-188, 69.1, 252.3, 320.1, 71.1; Thellersen, both of Frederiksberg, all of 424/94.1; 536/22.2, 23.7; 510/305, 226, Denmark 392 73 Assignee: Novo Nordisk A/S, Bagsvaerd, 56) References Cited Denmark FOREIGN PATENT DOCUMENTS 21 Appl. No.: 479,275 O305 216 A1 3/1989 European Pat. Off.. O 407 225A1 1/1991 European Pat. Off.. 22 Filed: Jun. 7, 1995 WO95/09909 4/1995 WIPO. Related U.S. Application Data Primary Examiner Robert A. Wax ASSistant Examiner Tekchand Saidha 63 Continuation-in-part of PCT/DK94/00162, Apr. 22, 1994, which is a continuation-in-part of PCT/DK95/00079, Feb. Attorney, Agent, or Firm-Steve T. Belson; Elias J. 27, 1995, which is a continuation-in-part of Ser. No. 434, Lambiris 904, May 1, 1995, abandoned, which is a continuation of Ser. No. 977,429, which is a continuation of PCT/DK91/ 57 ABSTRACT 00271, Sep. 13, 1991, abandoned. The present invention relates to lipase variants which exhibit 30 Foreign Application Priority Data improved properties, detergent compositions comprising Said lipase variants, DNA constructs coding for Said lipase Sep.
  • A Rose Extract Protects the Skin Against Stress Mediators: a Potential Role of Olfactory Receptors

    A Rose Extract Protects the Skin Against Stress Mediators: a Potential Role of Olfactory Receptors

    Supplementary data A Rose extract protects the skin against stress mediators: a potential role of olfactory receptors Romain Duroux 1,*, Anne Mandeau 1, Gaelle Guiraudie-Capraz 2, Yannick Quesnel 3 and Estelle Loing 4 1 IFF-Lucas Meyer Cosmetics, Toulouse, France 2 Aix-Marseille University, CNRS, INP, Marseille, France 3 ChemCom S.A., Brussels, Belgium 4 IFF-Lucas Meyer Cosmetics, Quebec, Canada * Correspondence: [email protected] Supplemental methods Keratinocytes cell culture and skin explants Skin organ cultures were prepared from tissues samples derived from volunteers undergoing routine therapeutic procedures, in collaboration with Alphenyx (Marseille). For this study, skin samples were derived from abdominal or breast tissues of healthy women (30-40 years old). Samples were received 1 day post-surgery and used directly for microdissection or cell extraction. Microdissected human skin was cultured at 37°C under 5% CO2, in DMEM (Dutscher, #L0060-500) plus 10% FBS (Sigma Aldrich, #F7524), 1% Penicillin/Streptomycin (Sigma Aldrich, #P0781-100), and 1% of minimum medium non-essential amino acids 10X (Gibco, #11140-035). For keratinocyte culture, cells were isolated from human skin epidermis. Briefly, skin samples were cut into small pieces and immersed in Thermolysin (Sigma Aldrich, #T7902-100mg) at 4°C overnight. Epidermis was then carefully detached from dermis before being incubated with Trypsin-EDTA for 15 minutes at 37°C. Trypsin inhibitor was next added, the mixture centrifuged and the supernatant discarded before adding KGM2 Medium (Promocell, #C- 20011) with 1% Penicillin/Streptomycin (Sigma Aldrich, #P0781-100). NHEK were then maintained in culture at 37 °C under 5 % CO2 and 95 % relative humidity.
  • OR2A5 (NM 012365) Human Tagged ORF Clone – RC220078L3

    OR2A5 (NM 012365) Human Tagged ORF Clone – RC220078L3

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC220078L3 OR2A5 (NM_012365) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR2A5 (NM_012365) Human Tagged ORF Clone Tag: Myc-DDK Symbol: OR2A5 Synonyms: OR2A8; OR2A11P; OR2A26; OR7-138; OR7-141 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC220078). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_012365 ORF Size: 933 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 OR2A5 (NM_012365) Human Tagged ORF Clone – RC220078L3 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_012365.1, NP_036497.1 RefSeq Size: 936 bp RefSeq ORF: 936 bp Locus ID: 393046 UniProt ID: Q96R48, A0A126GW49 Protein Pathways: Olfactory transduction MW: 35 kDa Gene Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell.
  • OR13C2 (NM 001004481) Human Untagged Clone – SC300715

    OR13C2 (NM 001004481) Human Untagged Clone – SC300715

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC300715 OR13C2 (NM_001004481) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: OR13C2 (NM_001004481) Human Untagged Clone Tag: Tag Free Symbol: OR13C2 Synonyms: OR37K Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001004481, the custom clone sequence may differ by one or more nucleotides ATGGAATGGGAAAACCACACCATTCTGGTGGAATTTTTTCTGAAGGGACTTTCTGGTCACCCAAGACTTG AGTTACTCTTTTTTGTGCTCATCTTCATAATGTATGTGGTCATCCTTCTGGGGAATGGTACTCTCATTTT AATCAGCATCTTGGACCCTCACCTTCACACCCCTATGTACTTCTTTCTGGGGAACCTCTCCTTCTTGGAC ATCTGCTACACCACCACCTCTATTCCCTCCACGCTAGTGAGCTTCCTTTCAGAAAGAAAGACCATTTCCC TTTCTGGCTGTGCAGTGCAGATGTTCCTCGGCTTGGCCATGGGGACAACAGAGTGTGTGCTTCTGGGCAT GATGGCCTTTGACCGCTATGTGGCTATCTGCAACCCTCTGAGATATCCCATCATCATGAGTAAGGATGCC TATGTACCCATGGCAGCTGGGTCCTGGATCATAGGAGCTGTCAATTCTGCAGTACAATCAGTGTTTGTGG TACAATTGCCTTTCTGCAGGAATAACATCATCAATCATTTCACCTGTGAAATTCTGGCTGTCATGAAACT GGCCTGTGCTGACATCTCAGACAATGAGTTCATCATGCTTGTGGCCACAACATTGTTCATATTGACACCT TTGTTATTAATCATTGTCTCTTACACGTTAATCATTGTGAGCATCTTCAAAATTAGCTCTTCCGAGGGGA GAAGCAAAGCTTCCTCTACCTGTTCAGCCCATCTGACTGTGGTCATAATATTCTATGGGACCATCCTCTT CATGTACATGAAGCCCAAGTCTAAAGAGACACTTAATTCGGATGACTTGGATGCTACCGACAAAATTATA TCCATGTTCTATGGGGTGATGACTCCCATGATGAATCCTTTAATCTACAGTCTTAGAAACAAGGATGTGA AAGAGGCAGTAAAACACCTACTGAACAGAAGGTTCTTTAGCAAGTGA
  • Cows Selected for Divergent Mastitis Susceptibility Display a Differential

    Cows Selected for Divergent Mastitis Susceptibility Display a Differential

    J. Dairy Sci. 103:6364–6373 https://doi.org/10.3168/jds.2019-17612 © 2020, The Authors. Published by FASS Inc. and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Cows selected for divergent mastitis susceptibility display a differential liver transcriptome profile after experimental Staphylococcus aureus mammary gland inoculation A. Heimes,1 J. Brodhagen,1 R. Weikard,1 D. Becker,1 M. M. Meyerholz,2,3 W. Petzl,2 H. Zerbe,2 H.-J. Schuberth,3 M. Hoedemaker,4 M. Schmicke,5 S. Engelmann,6,7 and C. Kühn1,8* 1Leibniz Institute for Farm Animal Biology (FBN), Institute of Genome Biology, 18196 Dummerstorf, Germany 2Clinic for Ruminants with Ambulatory and Herd Health Services, Centre for Clinical Veterinary Medicine, Ludwig-Maximilians-University Munich, 85764 Oberschleißheim, Germany 3Immunology Unit, University of Veterinary Medicine Hannover, 30559 Hannover, Germany 4Clinic for Cattle, University of Veterinary Medicine Hannover, 30173 Hannover, Germany 5Faculty of Natural Sciences III, Martin-Luther Universität Halle-Wittenberg, 06120 Halle, Germany 6Technical University Braunschweig, Institute for Microbiology, 38023 Braunschweig, Germany 7Helmholtz Centre for Infection Research, Microbial Proteomics, 38124 Braunschweig, Germany 8Agricultural and Environmental Faculty, University Rostock, 18059 Rostock, Germany ABSTRACT Key words: BTA18, mastitis, somatic cell score, liver transcriptome, RNAseq Infection and inflammation of the mammary gland, and especially prevention of mastitis, are still major challenges for the dairy industry. Different approaches INTRODUCTION have been tried to reduce the incidence of mastitis. Rapid progress in molecular biology and genetics has Genetic selection of cows with lower susceptibility to made it possible to include information on genomic mastitis promises sustainable success in this regard.
  • Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation

    Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation

    Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays

    Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays

    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013