DOCSLIB.ORG

SEPT8 Modulates Β-Amyloidogenic Processing of APP by Affecting the Sorting and Accumulation of BACE1 Kaisa M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SEPT8 Modulates Β-Amyloidogenic Processing of APP by Affecting the Sorting and Accumulation of BACE1 Kaisa M © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 2224-2238 doi:10.1242/jcs.185215 RESEARCH ARTICLE SEPT8 modulates β-amyloidogenic processing of APP by affecting the sorting and accumulation of BACE1 Kaisa M. A. Kurkinen1,*, Mikael Marttinen1,*, Laura Turner2, Teemu Natunen1, Petra Mäkinen1, Fanni Haapalinna3, Timo Sarajärvi1, Sami Gabbouj1, Mitja Kurki4, Jussi Paananen4, Anne M. Koivisto3, Tuomas Rauramaa5, Ville Leinonen4, Heikki Tanila6, Hilkka Soininen3, Fiona R. Lucas2, Annakaisa Haapasalo3,6,‡ and Mikko Hiltunen1,3,‡ ABSTRACT a large number of neuritic plaques and neurofibrillary tangles (NFTs) in the neocortex of the brain are detected in Alzheimer’sdisease Dysfunction and loss of synapses are early pathogenic events in ’ patients (Cummings, 2004; Mandelkow and Mandelkow, 1998). Alzheimer s disease. A central step in the generation of toxic amyloid- These consist of amyloid-β (Aβ) peptide and hyperphosphorylated tau β (Aβ) peptides is the cleavage of amyloid precursor protein (APP) by β protein, respectively. It is well established that the increased -site APP-cleaving enzyme (BACE1). Here, we have elucidated β-amyloidogenic processing of amyloid precursor protein (APP), whether downregulation of septin (SEPT) protein family members, leading to the augmented production of Aβ is a key feature underlying which are implicated in synaptic plasticity and vesicular trafficking, the molecular pathogenesis of Alzheimer’s disease (Neve et al., affects APP processing and Aβ generation. SEPT8 was found to 2000). The cleavage of APP by β-site APP-cleaving enzyme 1 reduce soluble APPβ and Aβ levels in neuronal cells through a post- (BACE1) leads to the formation of the N-terminal soluble APPβ translational mechanism leading to decreased levels of BACE1 (sAPPβ) and a membrane-bound APP C-terminal fragment, called protein. In the human temporal cortex, we identified alterations in the C99, which is subsequently cleaved by γ-secretase producing Aβ.By expression of specific SEPT8 transcript variants in a manner that contrast, the majority of APP is cleaved by α-secretases, which leads correlated with Alzheimer’s-disease-related neurofibrillary pathology. to the release of the soluble ectodomain portion of APP (sAPPα)and These changes were associated with altered β-secretase activity. We prevents Aβ formation. Although the role of sAPPα is still under also discovered that the overexpression of a specific Alzheimer’s- debate, recent findings have suggested that the overexpression of disease-associated SEPT8 transcript variant increased the levels of α ’ β sAPP in the brain of Alzheimer s disease model mice overexpressing BACE1 and A peptides in neuronal cells. These changes were human APP with the Swedish mutation and presenilin-1 with deletion related to an increased half-life of BACE1 and the localization of of exon 9 (APP/PS1ΔE9) mitigates synaptic and cognitive defects BACE1 in recycling endosomes. These data suggest that SEPT8 β caused by pre-existing pathology (Fol et al., 2016). modulates -amyloidogenic processing of APP through a mechanism In neurons, BACE1 shows presynaptic localization and it is largely affecting the intracellular sorting and accumulation of BACE1. conveyed in the neuronal recycling endosomes (Cole and Vassar, KEY WORDS: Alzheimer’s disease, Amyloid precursor protein, 2007; Das et al., 2013). BACE1 and APP are segregated in neurons Amyloid-β, BACE1, SEPT8 during resting state conditions, whereas, upon activity-dependent induction, these proteins converge into acidic microdomains INTRODUCTION through an endocytosis-dependent pathway (Das et al., 2013). This Alzheimer’s disease is the most common neurodegenerative disorder is important because BACE1 is optimally active in the acidic in the world, and affects up to 50% of individuals above the age of 85. intracellular compartments, such as early and late endosomes (Kang Owing to the global increase in the aging population, early diagnosis et al., 2012). Based on the amyloid cascade hypothesis, increased and treatment of Alzheimer’s disease are becoming increasingly soluble Aβ peptide levels augment synaptic dysfunction, Ca2+ important from both a human and socioeconomic perspective. dyshomeostasis, inflammation and oxidative stress, as well as tau Alzheimer’s disease is clinically associated with a global cognitive hyperphosphorylation and the formation of NFTs in specific brain decline, and a progressive loss of memory and reasoning. At autopsy, regions in Alzheimer’s disease patients (DeKosky and Scheff, 1990; Hu et al., 2014; Kuperstein et al., 2010). Thus, if started early enough, β 1Institute of Biomedicine, School of Medicine, University of Eastern Finland, 70211 lowering A levels could be sufficient to slow down the disease Kuopio, Finland. 2Eisai Ltd., Bernard Katz Building, University College London, process in Alzheimer’s disease. This idea is further supported by the 3 London WC1E 6BT, UK. Institute of Clinical Medicine – Neurology, School of genetic finding indicating that a naturally occurring A673T rare Medicine, University of Eastern Finland and Department of Neurology, Kuopio University Hospital, 70211 Kuopio, Finland. 4Institute of Clinical Medicine – variant in APP protects from Alzheimer’s-disease- and age-related Neurosurgery, School of Medicine, University of Eastern Finland and Neurosurgery cognitive decline by reducing BACE1-mediated cleavage of APP of NeuroCenter, Kuopio University Hospital, 70211 Kuopio, Finland. 5Institute of β Clinical Medicine – Pathology, School of Medicine, University of Eastern Finland and/or producing less of the aggregation-prone A 40 containing the and Department of Pathology, Kuopio University Hospital, 70211 Kuopio, Finland. A→T variation at position 2 (Di Fede et al., 2009; Jonsson et al., 2012; 6Department of Neurobiology, A.I. Virtanen, Institute for Molecular Sciences, School Benilova et al., 2014; Das et al., 2016). Soluble Aβ42 dimers extracted of Medicine, University of Eastern Finland, 70211 Kuopio, Finland. ’ *These authors contributed equally to this work from the Alzheimer s disease brain have been shown to specifically increase the phosphorylation of tau and subsequently promote ‡ Author for correspondence ([email protected]; [email protected]) neurodegeneration, supporting the intimate link between Aβ and tau ’ M.H., 0000-0003-3566-4096 in Alzheimer s disease pathogenesis (Shankar et al., 2008). This observation also concurs with the notion that synaptic dysfunction is Received 23 December 2015; Accepted 11 April 2016 the best correlate of the cognitive decline in Alzheimer’s disease, Journal of Cell Science 2224 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 2224-2238 doi:10.1242/jcs.185215 Fig. 1. See next page for legend. emphasizing the importance of understanding the early mechanisms predictive biomarkers in Alzheimer’s disease, it is necessary to focus leading to synaptotoxicity (Coleman and Yao, 2003). Collectively, in on the cellular processes involved in the early steps of Alzheimer’s order to identify factors that could be utilized as novel drug targets or disease pathogenesis. Journal of Cell Science 2225 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 2224-2238 doi:10.1242/jcs.185215 Fig. 1. RNAi screening of septin family member proteins in HEK293-AP– members are known to play a role in the regulation of presynaptic APP cells identifies SEPT8 as a target affecting APP processing and activity and function (Amin et al., 2008; Ito et al., 2009), we β β A 40 and A 42 levels. (A) qRT-PCR was conducted to assess the studied the effects of downregulation of septin family members knockdown effect of 5 mM siRNAs for each target after 72 h of transfection in HEK293-AP–APP cells. GAPDH-normalized mRNA levels of SEPT5 (n=4), (SEPT5, SEPT7, SEPT8 and SEPT10) on APP processing by SEPT7 (n=4), SEPT8 (siSEPT8_2, n=3) and SEPT10 (n=4) in siSEPT- and assessing the levels of total soluble APP and Aβ in human siControl-transfected cells are presented. (B) The levels of total soluble HEK293 cells overexpressing alkaline-phosphatase-conjugated alkaline-phosphatase-linked APP (sAP–APP) in each target siRNA- APP (HEK293-AP–APP) (Lichtenthaler et al., 2003). Validated transfected cell line was normalized to the cell survival (white bars) in each small interfering RNAs (siRNAs) for BACE1 and ADAM17 were sample and is shown as the percentage of the level compared to that with used as positive controls in the screening of total soluble AP–APP siControl. Cell survival was not affected due to the downregulation of septins. (sAP–APP) and Aβ levels. Downregulation of SEPT5, SEPT7 and siControl, siSEPT5, siSEPT7, siSEPT10, siBACE1 and siADAM17 (n=4), and – siSEPT8 (siSEPT8_2, n=3). (C) Three different SEPT8 siRNAs significantly SEPT8 (Fig. 1A) significantly decreased sAP APP levels in the decreased the mRNA levels of SEPT8 in HEK293-AP–APP cells (left). The cell culture medium when normalized to the cell survival levels of Aβ40 and Aβ42 in the cell culture medium are normalized to APP total (Fig. 1B). In addition, a trend towards decreased Aβ40 and protein levels in the respective cell lysates and shown as a percentage of the Aβ42 levels was observed in culture medium samples from cells in level compared to that with siControl (right). n=4. (D) Three different SEPT8 which SEPT5 and SEPT8 was downregulated (Fig. S1A). siRNAs significantly decreased SEPT8 mRNA levels in SH-SY5Y cells stably Conversely, a trend towards increased Aβ40 and Aβ42 levels overexpressing the human APP751 isoform (SH-SY5Y-APP751) (left). The levels of Aβ40 and Aβ42 in the cell culture medium are normalized to the total was observed in cells with SEPT7 and SEPT10 downregulation protein levels of APP in the respective cell lysates and shown as a percentage (Fig. S1A). To further elucidate the SEPT8 findings, two other of the level compared to that with siControl (right). n=4. In A–D, n values are siRNAs targeting different parts of SEPT8 mRNA sequence were biological replicates and results are mean±s.d. *P<0.05, **P<0.01 also applied to the HEK293-AP–APP cells to exclude potential (independent sample t-test).
Load more

Recommended publications
  • Genetic Loci on Chromosome 5 Are Associated with Circulating Levels Of
    Cytokine 81 (2016) 1–9 Contents lists available at ScienceDirect Cytokine journal homepage: www.journals.elsevier.com/cytokine Genetic loci on chromosome 5 are associated with circulating levels of interleukin-5 and eosinophil count in a European population with high risk for cardiovascular disease Olga McLeod a, Angela Silveira a, Elsa Valdes-Marquez b, Harry Björkbacka c, Peter Almgren d, Karl Gertow a, Jesper R. Gådin a, Alexandra Bäcklund a, Bengt Sennblad e, Damiano Baldassarre f,g, Fabrizio Veglia g, Steve E. Humphries h, Elena Tremoli f,g, Ulf de Faire i, Jan Nilsson c, Olle Melander d, Jemma C. Hopewell b, Robert Clarke b, Hanna M. Björck a, Anders Hamsten a, John Öhrvik a,j, ⇑ Rona J. Strawbridge a, , On behalf of the IMPROVE study group a Cardiovascular Medicine Unit, Department of Medicine Solna, Karolinska Institutet, Stockholm, Sweden b CTSU – Nuffield Department of Population Health, University of Oxford, Oxford, UK c Experimental Cardiovascular Research Unit, Department of Clinical Sciences Malmö, Lund University, Malmö, Sweden d Department of Clinical Sciences Malmö, Lund University, Malmö, Sweden e Cardiovascular Medicine Unit, Department of Medicine, Science for Life Laboratory, Karolinska Institutet, Stockholm, Sweden f Dipartimento di Scienze Farmacologiche e Biomolecolari, Università di Milano, Italy g Centro Cardiologico Monzino, IRCCS, Milan, Italy h Centre for Cardiovascular Genetics, University College London, UK i Division of Cardiovascular Epidemiology, Institute of Environmental Medicine, Karolinska Institutet, Stockholm, Sweden j Centre for Clinical Research Västerås, Uppsala University, SE-72189 Västerås, Sweden article info abstract Article history: IL-5 is a Th2 cytokine which activates eosinophils and is suggested to have an atheroprotective role.
    [Show full text]
  • Cell Type-Specific CLIP Reveals That NOVA Regulates 2 Cytoskeleton Interactions in Motoneurons
    bioRxiv preprint doi: https://doi.org/10.1101/237347; this version posted January 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Cell type-specific CLIP reveals that NOVA regulates 2 cytoskeleton interactions in motoneurons. 3 4 Yuan Yuan1, Shirley Xie1, Jennifer C. Darnell1, Andrew J. Darnell1, Yuhki Saito1,2, 5 Hemali Phatnani3,5, Elisabeth Murphy1, Chaolin Zhang4,5,6, Tom Maniatis5,6, and Robert 6 B. Darnell1,2,3* 7 8 1Laboratory of Molecular Neuro-Oncology, 2Howard Hughes Medical Institute, The 9 Rockefeller University, 1230 York Ave. NY, NY 10065 USA* 10 3New York Genome Center, 101 Avenue of the Americas, NY, NY 10013 USA* 11 4Department of Systems Biology, 5Department of Biochemistry and Molecular Biophysics, 12 6Center for Motor Neuron Biology and Disease, Columbia University, New York NY 13 10032, USA 14 *Correspondence author: Robert B. Darnell, M.D., Ph.D. 15 Laboratory of Molecular Neuro-Oncology 16 The Rockefeller University 17 Howard Hughes Medical Institute 18 Box 226 19 1230 York Avenue 20 New York, NY 10021 21 Phone: (212) 327-7460 22 Fax: (212) 327-7109 23 e-mail: [email protected] 24 25 26 27 28 MOTONEURON-SPECIFIC CLIP 29 Key words: cell-type specific, CLIP, motoneuron, NOVA, RNA, alternative splicing, 30 alternative last exon usage, septin 31 32 1 bioRxiv preprint doi: https://doi.org/10.1101/237347; this version posted January 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
    Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.
    [Show full text]
  • Genome-Scale Single-Cell Mechanical Phenotyping Reveals Disease-Related Genes Involved in Mitotic Rounding
    ARTICLE DOI: 10.1038/s41467-017-01147-6 OPEN Genome-scale single-cell mechanical phenotyping reveals disease-related genes involved in mitotic rounding Yusuke Toyoda 1,2, Cedric J. Cattin3, Martin P. Stewart 3,4,5, Ina Poser1, Mirko Theis6, Teymuras V. Kurzchalia1, Frank Buchholz1,6, Anthony A. Hyman1 & Daniel J. Müller 3 To divide, most animal cells drastically change shape and round up against extracellular confinement. Mitotic cells facilitate this process by generating intracellular pressure, which the contractile actomyosin cortex directs into shape. Here, we introduce a genome-scale microcantilever- and RNAi-based approach to phenotype the contribution of > 1000 genes to the rounding of single mitotic cells against confinement. Our screen analyzes the rounding force, pressure and volume of mitotic cells and localizes selected proteins. We identify 49 genes relevant for mitotic rounding, a large portion of which have not previously been linked to mitosis or cell mechanics. Among these, depleting the endoplasmic reticulum-localized protein FAM134A impairs mitotic progression by affecting metaphase plate alignment and pressure generation by delocalizing cortical myosin II. Furthermore, silencing the DJ-1 gene uncovers a link between mitochondria-associated Parkinson’s disease and mitotic pressure. We conclude that mechanical phenotyping is a powerful approach to study the mechanisms governing cell shape. 1 Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany. 2 Division of Cell Biology, Life Science Institute, Kurume University, Hyakunen-Kohen 1-1, Kurume, Fukuoka 839-0864, Japan. 3 Department of Biosystems Science and Engineering (D-BSSE), Eidgenössische Technische Hochschule (ETH) Zurich, Mattenstrasse 26, 4058 Basel, Switzerland.
    [Show full text]
  • Septin 8 (SEPT8) (NM 001098813) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP316253 Septin 8 (SEPT8) (NM_001098813) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human septin 8 (SEPT8), transcript variant 4 Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 43.3 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_001092283 Locus ID: 23176 UniProt ID: Q92599 RefSeq Size: 4270 Cytogenetics: 5q31.1 RefSeq ORF: 1107 Synonyms: SEP2; SEPT8 Summary: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Septin 8 (SEPT8) (NM_001098813) Human Recombinant Protein – TP316253 Product images: Coomassie blue staining of purified SEPTIN8 protein (Cat# TP316253).
    [Show full text]
  • 35Th International Society for Animal Genetics Conference 7
    35th INTERNATIONAL SOCIETY FOR ANIMAL GENETICS CONFERENCE 7. 23.16 – 7.27. 2016 Salt Lake City, Utah ABSTRACT BOOK https://www.asas.org/meetings/isag2016 INVITED SPEAKERS S0100 – S0124 https://www.asas.org/meetings/isag2016 epigenetic modifications, such as DNA methylation, and measuring different proteins and cellular metab- INVITED SPEAKERS: FUNCTIONAL olites. These advancements provide unprecedented ANNOTATION OF ANIMAL opportunities to uncover the genetic architecture GENOMES (FAANG) ASAS-ISAG underlying phenotypic variation. In this context, the JOINT SYMPOSIUM main challenge is to decipher the flow of biological information that lies between the genotypes and phe- notypes under study. In other words, the new challenge S0100 Important lessons from complex genomes. is to integrate multiple sources of molecular infor- T. R. Gingeras* (Cold Spring Harbor Laboratory, mation (i.e., multiple layers of omics data to reveal Functional Genomics, Cold Spring Harbor, NY) the causal biological networks that underlie complex traits). It is important to note that knowledge regarding The ~3 billion base pairs of the human DNA rep- causal relationships among genes and phenotypes can resent a storage devise encoding information for be used to predict the behavior of complex systems, as hundreds of thousands of processes that can go on well as optimize management practices and selection within and outside a human cell. This information is strategies. Here, we describe a multi-step procedure revealed in the RNAs that are composed of 12 billion for inferring causal gene-phenotype networks underly- nucleotides, considering the strandedness and allelic ing complex phenotypes integrating multi-omics data. content of each of the diploid copies of the genome.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • UC San Francisco Previously Published Works
    UCSF UC San Francisco Previously Published Works Title Complex landscapes of somatic rearrangement in human breast cancer genomes. Permalink https://escholarship.org/uc/item/51c8s0fm Journal Nature, 462(7276) ISSN 0028-0836 Authors Stephens, Philip J McBride, David J Lin, Meng-Lay et al. Publication Date 2009-12-01 DOI 10.1038/nature08645 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Europe PMC Funders Group Author Manuscript Nature. Author manuscript; available in PMC 2012 July 17. Published in final edited form as: Nature. 2009 December 24; 462(7276): 1005–1010. doi:10.1038/nature08645. Europe PMC Funders Author Manuscripts COMPLEX LANDSCAPES OF SOMATIC REARRANGEMENT IN HUMAN BREAST CANCER GENOMES Philip J Stephens1, David J McBride1, Meng-Lay Lin1, Ignacio Varela1, Erin D Pleasance1, Jared T Simpson1, Lucy A Stebbings1, Catherine Leroy1, Sarah Edkins1, Laura J Mudie1, Chris D Greenman1, Mingming Jia1, Calli Latimer1, Jon W Teague1, King Wai Lau1, John Burton1, Michael A Quail1, Harold Swerdlow1, Carol Churcher1, Rachael Natrajan2, Anieta M Sieuwerts3, John WM Martens3, Daniel P Silver4, Anita Langerod5, Hege EG Russnes5, John A Foekens3, Jorge S Reis-Filho2, Laura van ’t Veer6, Andrea L Richardson4,7, Anne- Lise Børreson-Dale5,8, Peter J Campbell1, P Andrew Futreal1, and Michael R Stratton1,9 1)Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK 2)Molecular Pathology Laboratory, The Breakthrough Breast Cancer Research Centre, Institute of Cancer Research, 237 Fulham Road,
    [Show full text]
  • Fibroblasts from the Human Skin Dermo-Hypodermal Junction Are
    cells Article Fibroblasts from the Human Skin Dermo-Hypodermal Junction are Distinct from Dermal Papillary and Reticular Fibroblasts and from Mesenchymal Stem Cells and Exhibit a Specific Molecular Profile Related to Extracellular Matrix Organization and Modeling Valérie Haydont 1,*, Véronique Neiveyans 1, Philippe Perez 1, Élodie Busson 2, 2 1, 3,4,5,6, , Jean-Jacques Lataillade , Daniel Asselineau y and Nicolas O. Fortunel y * 1 Advanced Research, L’Oréal Research and Innovation, 93600 Aulnay-sous-Bois, France; [email protected] (V.N.); [email protected] (P.P.); [email protected] (D.A.) 2 Department of Medical and Surgical Assistance to the Armed Forces, French Forces Biomedical Research Institute (IRBA), 91223 CEDEX Brétigny sur Orge, France; [email protected] (É.B.); [email protected] (J.-J.L.) 3 Laboratoire de Génomique et Radiobiologie de la Kératinopoïèse, Institut de Biologie François Jacob, CEA/DRF/IRCM, 91000 Evry, France 4 INSERM U967, 92260 Fontenay-aux-Roses, France 5 Université Paris-Diderot, 75013 Paris 7, France 6 Université Paris-Saclay, 78140 Paris 11, France * Correspondence: [email protected] (V.H.); [email protected] (N.O.F.); Tel.: +33-1-48-68-96-00 (V.H.); +33-1-60-87-34-92 or +33-1-60-87-34-98 (N.O.F.) These authors contributed equally to the work. y Received: 15 December 2019; Accepted: 24 January 2020; Published: 5 February 2020 Abstract: Human skin dermis contains fibroblast subpopulations in which characterization is crucial due to their roles in extracellular matrix (ECM) biology.
    [Show full text]
  • Setd1 Histone 3 Lysine 4 Methyltransferase Complex Components in Epigenetic Regulation
    SETD1 HISTONE 3 LYSINE 4 METHYLTRANSFERASE COMPLEX COMPONENTS IN EPIGENETIC REGULATION Patricia A. Pick-Franke Submitted to the faculty of the University Graduate School in partial fulfillment of the requirements for the degree Master of Science in the Department of Biochemistry and Molecular Biology Indiana University December 2010 Accepted by the Faculty of Indiana University, in partial fulfillment of the requirements for the degree of Master of Science. _____________________________________ David Skalnik, Ph.D., Chair _____________________________________ Kristin Chun, Ph.D. Master’s Thesis Committee _____________________________________ Simon Rhodes, Ph.D. ii DEDICATION This thesis is dedicated to my sons, Zachary and Zephaniah who give me great joy, hope and continuous inspiration. I can only hope that I successfully set a good example demonstrating that one can truly accomplish anything, if you never give up and reach for your dreams. iii ACKNOWLEDGEMENTS I would like to thank my committee members Dr. Skalnik, Dr. Chun and Dr. Rhodes for allowing me to complete this dissertation. They have been incredibly generous with their flexibility. I must make a special thank you to Jeanette McClintock, who willingly gave her expertise in statistical analysis with the Cfp1 microarray data along with encouragement, support and guidance to complete this work. I would like to thank Courtney Tate for her ceaseless willingness to share ideas, and her methods and materials, and Erika Dolbrota for her generous instruction as well as the name of a good doctor. I would also like to acknowledge the superb mentorship of Dr. Jeon Heong Lee, PhD and the contagious passion and excitement for the life of science of Dr.
    [Show full text]
  • Genetic Loci on Chromosome 5 Are Associated with Circulating
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by AIR Universita degli studi di Milano Genetic loci on chromosome 5 are associated with circulating levels of interleukin-5 and eosinophil count in a European population with high risk for cardiovascular disease Olga McLeoda, Angela Silveiraa, Elsa Valdes-Marquezb, Harry Björkbackac, Peter Almgrend Karl Gertowa, Jesper R. Gådina, Alexandra Bäcklunda, Bengt Sennblada,e, Damiano Baldassarref,g, Fabrizio Vegliag, Steve E. Humphriesh, Elena Tremolif,g, Ulf de Fairei, Jan Nilssonc, Olle Melanderd, Jemma C Hopewellb, Robert Clarkeb, Hanna M. Björcka, Anders Hamstena, John Öhrvika and Rona J. Strawbridgea on behalf of the IMPROVE study group aCardiovascular Medicine Unit, Department of Medicine Solna, Karolinska Institutet, Stockholm, Sweden. bCTSU – Nuffield Department of Population Health, University of Oxford, Oxford, UK cExperimental Cardiovascular Research Unit, Dept. of Clincal Sciences Malmö, Lund Univeristy, Malmö, Sweden. dDepartment of Clinical Sciences, Malmö, Lund University, Malmö, Sweden eCardiovascular Medicine Unit, Department of Medicine, Science for Life Laboratory, Karolinska Institutet, Stockholm, Sweden. fDipartimento di Scienze Farmacologiche e Biomolecolari, Università di Milano gCentro Cardiologico Monzino, IRCCS, Milan, Italy. hCentre for Cardiovascular Genetics, University College London, United Kingdom. iDivision of Cardiovascular Epidemiology, Institute of Environmental Medicine, Karolinska Institutet, Stockholm, Sweden. Correspondence
    [Show full text]
  • Identification of Four Novel Associations for B-Cell Acute
    ARTICLE https://doi.org/10.1038/s41467-019-13069-6 OPEN Identification of four novel associations for B-cell acute lymphoblastic leukaemia risk Jayaram Vijayakrishnan 1,19, Maoxiang Qian2,3,19, James B. Studd 1, Wenjian Yang2, Ben Kinnersley 1, Philip J. Law 1, Peter Broderick 1, Elizabeth A. Raetz4, James Allan5, Ching-Hon Pui 6,7, Ajay Vora8, William E. Evans 2,7, Anthony Moorman9, Allen Yeoh10,11, Wentao Yang2, Chunliang Li 12, Claus R. Bartram13, Charles G. Mullighan 6,7,14, Martin Zimmerman15, Stephen P. Hunger16, Martin Schrappe17, Mary V. Relling2,7, Martin Stanulla15, Mignon L. Loh18, Richard S. Houlston 1* & Jun J. Yang 2,6,7* 1234567890():,; There is increasing evidence for a strong inherited genetic basis of susceptibility to acute lymphoblastic leukaemia (ALL) in children. To identify new risk variants for B-cell ALL (B-ALL) we conducted a meta-analysis with four GWAS (genome-wide association studies), totalling 5321 cases and 16,666 controls of European descent. We herein describe novel risk loci for B-ALL at 9q21.31 (rs76925697, P = 2.11 × 10−8), for high-hyperdiploid ALL at 5q31.1 (rs886285, P = 1.56 × 10−8) and 6p21.31 (rs210143 in BAK1, P = 2.21 × 10−8), and ETV6- RUNX1 ALL at 17q21.32 (rs10853104 in IGF2BP1, P = 1.82 × 10−8). Particularly notable are the pleiotropic effects of the BAK1 variant on multiple haematological malignancies and specific effects of IGF2BP1 on ETV6-RUNX1 ALL evidenced by both germline and somatic genomic analyses. Integration of GWAS signals with transcriptomic/epigenomic profiling and 3D chromatin interaction data for these leukaemia risk loci suggests deregulation of B-cell development and the cell cycle as central mechanisms governing genetic susceptibility to ALL.
    [Show full text]