FRONT COVER Fluorescently-labeled subsets of axons crossing each other in the chick optic chiasm on their way from the retina to the visual regions of the brain. Other axons in the same pathway are labeled in different patterns by each member of a panel of monoclonal antibodies generated against cell surface molecules. The first two of these "pattern" antigens sequenced in the gas phase sequencer are likely to be members of the immuno globulin family. Members of this large family of cell surface proteins are generally believed to function at cell surfaces to control the movement or differentiation of cells (Williams, A. F., Immunology Today 8, 298-303, 1987). It therefore seems possible that the "pattern" antigens play a role in developing neural patterns such as the one illustrated (see Dreyer group abstracts beginning on page l Lt l).
BACK COVER
A parasagittal nuclear magnetic resonance (NMR) image through a human brain upon which is superimposed the pattern of cerebral blood flow that was evoked when the subject viewed a small visual stimulus. The blood flow response was obtained with 0 1 5 positron emission tomography (PET). The response is in extrastriate visual cortex. The subject fixated on the center of a 3° circular pattern of red and black checks, which counterphased at 10 Hz. The illustrated pattern is the net response obtained by subtracting a matched presentation in which the subject viewed only the fixation point from the stimulus trial (Fox et al., Nature 323, 806-809, 1986). The PET data was collected at Washington University by Marcus Raichle, Peter Fox, Francis Miezin and John Allman. The NMR image was obtained for the same subject by William Bradley at the Huntington Memorial Research Institute. Bassem Mora and John Allman at the California Institute of Technology developed the program for superimposing the PET data in the NMR coordinate space. The NMR echo delay time (TE) was 100 milliseconds; the repetition time (TR) was 3 seconds. The center of the NMR slice was 28.2 millimeters to the left of the midsagittal plane; the slice was 2.7 millimeters thick (see Abstract No. 360).
Last year's cover was drawn by Martin Sereno (see Sereno, M. I. and Ulinski, P. S., Caudal topographic nucleus isthmi and the rostral nontopographic nucleus isthmi in the turtle, Pseudemys scripta (19&7) Joumal of Comparative Neurology 2~1, 319-34~). A REPORT FOR THE YEAR 1987-88
ON THE RESEARCH AND OTHER ACTIVITIES
OF THE
DIVISION OF BIOLOGY
ATTHE
CALIFORNIA INSTITUTE OF TECHNOLOGY
PASADENA, CALIFORNIA ii
BIOLOGY 1988
Constance R. Katz - Annual Report Secretary
Thanks to Stephanie Canada, Cathy Elkins, Nancy Gill, Rita Grable, Candi Hochenedel, Isabella Lubomirski, Renu Nandkishore, Katie Patterson, Gwen Pollard, Renee Thorf, and Marilyn Tomich for their assistance.
RESEARCH REPORTS
Much of the research work summarized here has not yet been ref)Orted in print, in many instances because it is not yet complete. For that reason this re-port is not intended as a publication and should not be cited as such. Individual projects should be referred to only if specific permission to do so is obtained from the investigator responsible for the material. References are made here to published papers bearing on the projects reported. Publications by members of the Division, covering the period from about June 1987-August 1988, are listed separately at the end of the research reports of each group. iii
TABLE OF CONTENTS
Page Introduction .••.•••..•...•..•.•••••....•.•..•...... •..•...... ••..•...... •....••....•.••...... •. 3 Staff of Instruction and Research, ...... , ...... ,, ...... ,., ...... ,,, ...... 9
Research Reports
DEVELOPMENTAL BIOLOGY
Eric H. Davidson - Summary ...... , ...... , , , ...... , , ...... 19 1. In vivo titration of Cyllla actin regulatory factors in sea urchin embryos ••...... ••.•.•...... 19 2. Factors that bind specifically to regulatory sequences of a sea urchin gene ..••..•.....•...... 19 3. Mapping of protein binding sites in the 5' regulatory sequence of Cy Illa actin ••...••...•.....• 20 4. In vivo competition shows essential regulatory regions of a sea urchin gene ••...... •...•....•. 20 5. Genomic analysis of activator proteins binding to the CyIIIa gene ...•••...•.....• , ...... 21 6. Binding of CyIIla gene trans-activators by other sea urchin genes ..••••.....•••••....•.... , .21 7. Cloning of sea urchin DNA binding proteins ...... 22 8. Regulation of CyIIla actin in hybrid sea urchin embryos ...... 22 9. Comparison of nuclear extract binding in two sea urchin species ••...... ••••.....•...•....•• 22 10. Interspecies comparison of actin CyIIIa regulatory region ...•...... •.•...... 23 11. Interactions of DNA-binding proteins with a sea urchin skeletal matrix gene ••.•...... •..•... 23 12. Molecular cloning of coelomocyte genes from the purple sea urchin ...... ••...... •...... 24 13. A characterization of the coelomocytes of the purple sea urchin .....••...... 24 14. Drosophila "homeobox" sequences in sea urchin DNA .••...... ••••...... •••...... •.. . 25 15. Bindin gene expression and testis maturation .••....•...... •••...•..•••...... •...... 25 16. Conservation(?) of sequences expressed in egg RNA ...... ,, ...... , ...... , ...... 25 17. Sea urchin cell lineage analysis beyond the eight-cell stage .•...... ••...... , , ...... •26 18. The production of transgenic sea urchin embryos ...... ••...... •.....•....•...... 26 19. Bindin gene evolution , ...... , ...... , ...... , , ...... 27 20. DNA sequence deletions and systematics ...... , ...... , ...... 27 21. Range of rates of evolution in Drosophila DNA ...... 28 22. The sources and evolution of Alu repeats .•••...•...•.••.•.•...•...... •.•...... 28 23. Patterns of mRNA prevalence and expression of Alu-like repeats in early mouse embryos ...... 29 Publications ...... 29
Leroy E. Hood - Summary ...... , ...... • , .30 24. The restricted use of T-cell receptor V genes in murine autoimmune encephalomyelitis raises possibilities for antibody therapy ...... •...... 31 25. The molecular specificity of experimental autoimmune thyroiditis ...... ••••...... , •...... 31 26. T lymphocytes and cytokines in mouse cardiac allograft rejection ....••.....•....•....•..... 32 27. The germline repertoire of T-cell receptor s-chain genes in patients with multiple sclerosis •••...... ••...... • , ....•....•...... , •...... , . , .•...... 32 28. Human I-cell receptor gene polymorphisms ...... 32 29. Mapping genomic organization of field inversion and two-dimensional gel electrophoresis: Application to the murine T-cell receptor y-gene family •...•...... •...... •33 30. Diversity and ontogeny of T-cell receptor c-chain expression ...... 33 31. Molecular characterization of the cytotoxic T cells directed against Epstein-Barr virus transformants •...... ••.••...••...•..•...• ...... •...... •...... 34 32. Structural and functional analysis of T-cell receptor genes from tumor-infiltrating lymphocytes ...... •..•••••...•••.••••••••...... •..•...... ••...... ••...... •.•....34 33. Molecular mimicry and experimental autoimmune encephalomyelitis: A model to study T-cell repertoire selection and MHC restriction •••.•...... •...... •34 34. Analysis of the promoter region of a I-cell receptor V gene •...... •.....•...... •...... 35 35. Use of transgenic mice to study the development of th1' I-cell repertoire ...•••.•.....•...•..35 36. Analysis of T-cell antigen recognition and activation using chimeric receptor genes ....••....•35 37. The chicken I -cell receptor ...... , , ...... , ...... , .. , ...... 36 38. Biology of class I major histocompatibility antigens: A model for studying regulated cell-cell interactions in the immune system •.•....•••••.....•.•••...... ••••...... • 36 39. Regulation of gene expression by interferons: Control of H-2 promoter responses ....•...... 39 40. Regulation of gene expression by interferons H-2 elements located downstream from transcription initiation sites ...•••...... •••...... ••••...... •••.•.....•• , .••...... • 39 41. Analysis of allelic differences in Qa-2 expression ...... 40 4.2. Analysis of sequences necessary for the attachment of the Qa-2 antigen to the cell membrane via a phospholipid tail ...... 40 iv
Leroy E. Hood - continued 43. Functional studies on Qa antigens: Expressing novel class I MHC antigens in transgenic mice ...... •...... •...... 41 44. Molecular mechanisms of tolerance induction and MHC restriction: Studies on immune tolerance to class I H-2 alloantigens in transgenic mice ...... 41 45. Characterization of class I MHC gene that maps distal to the H-2 and Tia complex .•.•••••••••42 46. Analysis of the Tia complex ...... 42 47. Class I gene expression in the BALB/c mouse; identification and characterization of class I genes expressed in adult thymus and bone marrow and fetal liver ...••••.•.••••••.•. 43 48. The myelin proteins and genes in primitive vertebrates ...... 4-3 49. Expression of the peripheral myelin protein Po in the central nervous system of transgenic mice ...... 44 50. The identification of proteins associated with neurite and growth core formation ...... 44 51. Genomic cloning of the human PrP gene ...... 45 52. Effect of recombinant wild and mutant types of plasminogen activator inhibitor l (PAI-I) on tumor cell invasion ...... 45 53. Isolation and characterization of a corticotropin-releasing hormone-like peptide from human placenta ...... , .. , , •• , ...... , .•• , , , ...... , ... , ...... 46 54. The chemical synthesis of peptides and proteins by automated stepwise solid phase synthesis ...... , ...... , , .. , ...... , .. , ...... 46 55. Principles of rapid, high efficiency synthesis of peptides ....• , , •••••••••••.•.•..•.•••.••.•• 47 56. High yield stepwise solid phase chemical synthesis of "difficult" peptides by the use of heat to dissociate intermolecular aggregates of the protected peptide chains ••..•...••• 47 57. A single peptide mediates the entire stereotyped behavior associated with egg laying in Aplysia califomica ...... , • , ...... , , , ...... 47 58. Structure-function studies on the egg laying hormone (ELH) of Aplysia caiifomica , , •••••••••• 48 59. Chemical synthesis of human transforming growth factor ...• , , •••••••••••••••...•••••••••• 48 60. The role of cysteine residues in determining the biological activity of interleukin-3 ..••.••••...•..••••••...•••.••••••••.•••••.••.••••••••••••••.•.....•..•• 4 9 61. Structure-function studies of human GM-CSF by total chemical synthesis: Identification of a minimum structure required for activity ...... 49 62. Total chemical synthesis and enzymatic activity of HIV-I protease .....••••••••••••••••••.. . 50 63. Total chemical synthesis of proteins by the chemical ligation of purified unprotected peptide segments •• , .. , • , , , , ...... , , ...... , , , , , , , ...... 50 64. Semisynthetic studies on the protein cytochrome c using chemical peptide synthesis , , •• , , , , , , .51 65. Location and chemical synthesis of a binding site for HIV-! on the CD4 protein •••••••••...... 51 66. Identification of a novel retroviral gene unique to HIV-2 and SIVMAC •...... •••••••••••••.• •52 67. Biological role of Pre-S sequences of the hepatitis B virus (HBV) envelope protein •••••••••••• •52 68. Search for antibodies neutralizing the infectivity of hepatitis B virus in Pre-S-specific antisera ••....••••••••.•...•••••••••.••...• , ••••••••••••••.••••...••.•• •52 69. Characterization of the HBV X-gene product...... •53 70. Current chemical approaches to the sequence analysis of peptides and proteins ••••••••••••.. . 53 71. Covalent immobilization of proteins for high sensitivity sequence analysis: Electroblotting onto chemically activated glass from SDS-polyacrylamide gels ••••••••••...... 53 72. High efficiency covalent immobilization of picomole amounts of peptides for solid phase sequence analysis ...... , ...... , ...... , , •••• , .•••.••.•...•54 73. Determination of phosphorylation sites in proteins ...... , ... , ...... , ...... 54 74. Accelerated high sensitivity solid phase sequence analysis •. , ••••.•••.•••••..... , ••.•••••• •55 75. N-terminal and internal protein sequence analysis of microgram amounts of proteins electroblotted from immobiline isoelectric focusing gels ••...•••.•••••••••••••.....••••••• •55 76. Molecular characterization of Plastin: A human leukocyte protein expressed in transformed human fibroblasts ...... , , ...... , , .. , ...... , ..••• , . , ••••.•... . 55 77. Structural analysis of a 180 kDa (pl80) human fibroblast membrane protein ..••••. , ••••••••• . 56 78. Structural analysis of proteins associated with Creutzfeldt-Jakob disease •••••••.••••.....•• •56 79. Analysis of phosphoproteins involved in signal transduction in murine T cells ...... 57 80. The optimization of automated fluorescence-based DNA sequence analysis ...... 57 81. Automated fluorescence-based specific primer-directed DNA sequence ...... 58 82. Improvements in automated data analysis in fluorescence-based DNA sequencing .. , ••••••••• •59 83. Automated fluorescence-based chemical DNA sequencing •...•.•..••••••••••••••...••••.••• 60 84. The chemical synthesis of derivatized oligonucleotides •••••••.••••••••••••••••••••••••..••60 85. An oligonucleotide ligation assay for gene detection .. , , , , .. , , ...... , , , , ...... , .61 86. A simplified approach to subtractive hybridization ..... ,,,,., ...... 61 87. A new extended DNA sequencing method ...... , ...... , , ••••••••••• 62 88. Automation of dideoxynucleotide DNA sequencing reactions using a Beckman Biomek 1000 robotic workstation ...... , . , , • , , , , ••••••.••• , , .... , ...... , •••• , , , , , •••••••..••62 89. A novel instrument for the separation of large DNA ·molecules using pulsed field homogeneous electric fields •.••••••••••••..•••••••••••..•••.••••••••••••••••..••••••••62 90. An inexpensive pulsed field gel electrophoresis apparatus •.•.•••••••••••••••••••••.••••.•••63 91. A temperature-controlled (heated) reaction vessel for the chemical synthesis of peptides and proteins ...... , , • , ...... , , ...... , , ... , , ...... 63 v
Leroy E. Hood - continued 92. A high sensitivity solid phase protein sequenator •...... •.....•...... •.63 93. The development and evaluation of algorithms for the analysis of PTH-amino acid derivative chromatograms .•...... •••••...•....••...... •••...... 64 94. A chromosomal mapper ...•..... , ...... , ...... , .. , ...... 64 95. Structure-function relationships in the transposition protein B of bacteriophage Mu •...... 64 96. Molecular biology of the neural cell adhesion molecule LI ...•..••....•...••••...... •• .65 97. Purification and properties of the cellular and scrapie hamster prion proteins ••.•...... •. . 65 98. Improved sequencing yields for praline-containing samples through programmed increases in cleavage temperature ...... •...... •••...... •66 Publications •••.....•...•....•...... •...... •...... •...... ••••...... •..66
Elias Lazarides - Summary ...... 68 99. Characterization and expression of a variant erythroid anion transporter polypeptide ...... 69 100. Manipulation of the membrane cytoskeleton of erythroid cells in transgenic mice ...... 69 101. Expression of the 100/105 kDa anion transporter in virally transformed erythroid progenitor cells ...... 70 102. The role of fatty acid acylation in assembly of ankyrin onto the plasma membrane ...... 71 103. Molecular mechanisms of generation of protein 4.1 variants in erythroid development ...... 71 101.j.. Functional differences in protein 4.l variants: A variant lacking the spectrin-actin binding domain .•...... •••..•....•....••...... •...... •..•••...... ••..72 105. Structural and functional analysis of gelsolin in avian erythroid cells ...... •••...... •...72 106. Identification of vimentin regulatory sequences by introduction of chimeric chicken-hamster vimentin genes into murine erythroleukemia cells ••••.....••••...... •. 73 107. Inducible vimentin expression in murine myeloma cells ...... •.••.....•.• , ••.•...... •.• , ... 74 108. The targeted expression of an exogenous vimentin gene in the erythroid cells of transgenic mice •...... •••••.••...•..••••....•.•.....• , .•...... ••...... •.74 109. The intermediate filament cytoskeleton of murine primitive erythrocytes ..•...... 75 110. Control of cell division in erythroid differentiation ...•.•• , ...... •...... 75 l l l. a-Amyloid expression in transgenic mice ••••.....•.••...... ••...... 76 Publications ...... 7 6
Edward B. Lewis - Summary ...... 77 112. A new type of infra-abdominal-2 mutant ...... 77 113. Derivation of new breakage points in the bithorax complex (BX-C) ...... •.. 78 114. Molecular analysis of the infra-abdominal-7 (iab-7) and iab-8 genes of the bi thorax complex ...... 78 115. Production of monoclonal antibodies to the iab-7 protein ...... •...... ••••...... ••• .79 116. The infra-abdominal-4 region of the BX-C ...... 79 Publications ...... 79
Howard D. Lipshitz - Summary ...... 79 117. Genetic and molecular analysis of terminal class ("torso-like") genes ...... 80 118. Molecular cloning of the posterior (11grandchildless-knirps") class gene, vasa •.•••••.•••••••••• 81 119. P-element transposon tagging of maternal effect pattern genes on the second chromosome •...... •••• , ...... , •...•..•.•...... ••..•...... •••...... •.81 120. RNA localization in the unfertilized egg ...... 82 121. Functional analysis of the early bithoraxoid transcripts ••...... •..••...... •..82 122. Molecular analysis of the late bithoraxoid gene ...... •.•.••...... ••...... 83 Publications ...... 83
Elliot M. Meyerowitz - Summary ...... 83 123. Toward the cloning of genes controliing development in Arabidopsis ••••••••••••••••••••••••• 84 121.j.. A search for new flower mutants of Arabidopsis thaliana ••••••••.••••••.••.••••••••••••••. 85 125. Characterization of Arabidopsis transformants .•.•..••••••.•...... •••.•.....•...••...... 85 126. Tissue-specific expression of reporter gene with seed storage protein promoter in Arabidopsis thaliana ...... 86 127. Characterization of an Arabidopsis seed gene ...... 86 128. Molecular analysis of ethylene-insensitive mutants in Arabidopsis •••••••••••••••••••••••••• •87 129. Eye development ...... 87 130. Developmentally regulated puffing of 68C-derived sequences .•.••••...... ••••••••..•..••...87 131. Cis-regulatory sequences of the Sgs-3 gene ...... 88 132. Mutagenesis of a regulatory element of Sgs-3 ...... 89 133. Screening for trans-acting factors required for Sgs-3 expression •••.•...... •...... 90 134. Identification of an enhancer-element for expression of the 68C glue genes ••••••.•...... •. 90 135. Regulation of two divergently transcribed genes that share a common upstream region •...... 91 vi
Elliot M. Meyerowitz - continued 136. Regulated expression of the Sg~3 gene by trans-acting factors •••••.••••••.••••••..••••••••92 137. Genes expressed in the embryonic salivary gland of Drosophila •••••••••••••••••••••••••••••92 138. Headclones •.••.••••••••••••.••••••••••••••••••••••••.•••..••.•••••••••••••••••••••••93 Publications •••••••••••..••....••••••••••••••••••••••••••••••••••••••••••••••••••••••93
Ellen Rothenberg - Summary •.•••••••••••••••••••••••••••••••••••••••••••••••••••••••••9 3 139. IL2 mRNA accumulation by subsets of murine T cells ••••••••••••..•.•••••••••••••••••••••94 140. Expression of serine esterase genes as a marker of commitment to helper vs. killer lineage •••••••••.•...... •.•.•••.•••••••••••••••••.•..•••••...••••••• •95 141. Expression of IL2 receptor subunits by subpopulations of the thymus •••••••••••••••..•....•• •95 142. Search for lymphokine genes in Xenopus laevis •••••••••••••••••••••••••••••••••••••••••••96 143. Studies on the mouse interleukin-2 gene promoter ••.•••••••••••••••••••••••••••..•••••••• 96 144. Transient expression of transfected genes in murine thymocytes •••••••••••••••••••...•.••••97 145. IL2R inducibility of thymocyte subpopulations ••••••••••••.••••••••••••••••••••••••••••.••97 146. Developmental regulation of IL2R inducibility ••••••••••••••••••••.•••••••••••••••••••••••98 147. Relationship of functional commitment and hormone dependence in T-cell ontogeny •••••••••••98 Publications ••••••••••••••••••••.•••.•••.•••••.••••.•••••••••••••••••••..•...••••••••99
Melvin I. Simon - Summary ••••••••••••.••••••••••.•••••••••••••••••••••••.•..••••.•••• 99 148. Protein phosphorylation of chemotaxis proteins •••••••••••••••••••...••...••••••••••••••• JOI 149. Transmembrane signal transduction in bacterial chemotaxis ...... 102 150. Heterologous expression of transducin a subunits and reconstitution of photoreceptor signal transduction .•••••••••...••••••••.•••••••••.•••...••••••..••••••• I 02 151. A novel class of GIP-binding regulatory proteins •••.•••..••••••••••••••••••••••...•..••• 103 152. The a and y subunits of G proteins •••••••••••••••••••••..••..•••.••••••••••••••.•••••.• 103 153. Expression of G-protein genes in human myeloid cells ••••••••..•••.•••••.•••••••••••••••. 104 l 54. G-protein expression during spermatogenesis •••••••••••••••••••••.•••••••••••••••••••••• I 04 155. Gene expression of LOH isozymes during meiosis and spermiogenesis by in situ hybridization •••...•••....••.•.••••••••••••••••••.••..•••••••••••••••••••... I 05 156. Differential gene expression during mouse spermatogenesis ••••••••.•....•.•....•.••••••• • 105 157. Testis-specific expression of phosphoglycerate kinase-2, CAT, and luciferase in transgenic mice .••••.••....•••...... ••••••..••...... •...•..... • 105 158. Mammalian chromosome mapping .••••.•••••••••.•••••••••.•••••.••••••••••••••••..•.• I 06 159. Optimized conditions for pulsed-field gel electrophoretic separations of DNA •••••...•.•••.• 106 160. Mapping the DNA binding domain of Hin recombinase by using synthetic sequence-specific DNA binding and cleaving peptides •••••••••••.••.••.•••••••••.••.....• I 07 161. DNA-binding properties of the Hin recombinase •••••••••••••••.••••••.•.•••••••••••••••• 107 162. Characterization of Hin-mediated, site-specific recombination in vivo ...... 108 Publications ••••••••••••••••••••••••.••••..••.•.••••••••••••••••••..•••••••••••••••• 108
Paul W. Sternberg - Summary •••••••••••••..•••.....•.•••••••••••••••.••...•.•..•••••• 109 163. Cell interactions during vulva! induction ...•.•••••••••••••••••••..••••••••••••••••••••.• 110 164. Molecular genetics of the let-23 locus ••••••..•••..•..•..•••••••••••••••••...•.••••••••• 111 165. Hyperinduction of the vulva •.••...•...••••••••••••••••••.••••••••••••••••••••.•••••.• 11 l 166. Transposon tagging of the lin-15 locus ...... ••••••••••••••••.•••..••••••••••••••••••••.. 112 167. Genetic and molecular analysis of the lin-3 locus ••.•••••••••••••••••••••.••••••••••••••• 112 l 68. Genetic approaches towards identifying the inductive signal ••.••••••••••••.•...... •••••••• 113 169. Male mating: Development and behavior •••••••••••••••••••.••••••••••••••.•••••••••••• 113 Publications ••••••••••..•••...... •••••••••••••••.•••••••.••••••••••••••.....•••••••• 114
MOLECULAR BIOLOGY AND BIOCHEMISTRY
John N. Abelson - Summary ••••••...•..•••..••••.••••••••••..••...... ••••••••.•••.•.. 117 170. A yeast mutant that accumulates pre-tRNA splicing "2/3" intermediates •....•••••••••••••.• 118 l 7 I. Structural and functional analysis of the active domains of yeast tRNA ligase ••••.•..•.••••. 118 172. Yeast tRNA ligase: Structure and function of the domains •...... ••.•••••••••••••..•••.••• 119 173. Crosslinking yeast tRNA ligase to bromouridine- and thiouridine-incorporated precursor transfer ribonucl,eic acid ...... 119 174. Sequencing of ORF2: An opening reading frame upstream of the tRNA ligase gene •••.•••.... 120 175. The organization of mRNA, rRNA and tRNA maturation pathways in the yeast nucleus ••••••. 120 176. In vitro assembly of yeast snRNPs .••.•.••••••••••••••••••..•••.••••••••••••••.•••••••• 121 177. Early events in spliceosome formation ...... 122 178. Spliceosome assembly in yeast ••••••••••••••••••.••••••••••••••••••••••••••••••••••••• 122 179. Identification of a yeast snRNP protein •••••••••..•..•.•••••••••••••••••••••••.••..••.• 123 180. Functions of the RNA! I protein ••••••••••••••.••.•.••••••••••••••••••••••••••••••••••• 123 vii
John N. Abelson - continued 181. Function of the yeast RNA5 protein in pre-mRNA splicing •...... ••...... •••...•....• 123 182. Biochemical and genetic characterization of ma17 and ma18, mutants in mRNA processing reactions .•..••...... ••••.•...... •••••...•....•...... ••••...... 124 183. The search for yeast hnRNPs ..•.••..••.•.•.....•.•••.....•....•.•...... •.•••...... 125 184. Finding hnRNP genes using the RNPCore consensus sequence .....••...... •••.••.•...... 125 185. Changing the identity of a tRNA ••.••••.....•••••...... •...... •••...... •...•... 126 186. Effect of extra loop size on recognition of a tRNA by its cognate aminoacyl tRNA synthetase ••...... ••...... ••...... •••..•...•...... •.....•.••....••...•• 127 187. Studies on the recognition of tRNAs by aminoacyl-tRNA synthetases ...... •.•...... •.•.. 127 Publications ...... •••••.•..••••••...•.•••••••...... •••...... •••••...... •.... 128
Giuseppe Attardi - Summary .••••.....••••••••••....•.••.•.....•.••.••.•....•••...... 128 188. Regulation of human mitochondrial DNA transcription in vitro •••••••••••••••••••••••••.•• 129 189. Identification and characterization of human mitochondrial transcription and replication factors .••..•••...•.••••...•.•..•••..•...... ••.•...... ••••.•.•..••.•.•.• 130 190. Characterization of RNase P from HeLa cell mitochondria •.•••..•...••....••.••.•.••..... 130 191. Transcription control in human mitochondria ...••.•.••. , ...... ••...••...•..... , •.....•. 131 192. Submitochondrial translation system from HeLa cells ...... •.•••..•.••.•..•...... •..... 131 193. Mitochondrial gene expression in rat brain synaptosomes during development and senescence •••••••..••••...•....•••.•...... •••...... •••...... •...... •. 131 . 194. Isolation of cDNA clones encoding the 24 kDa subunit of NADH dehydrogenase ...... •••• 132 195. Cloning of the bovine cDNA(s) that encode(s) the 51 kDa subunit of NADH dehydrogenase .....••...... •••...... •..•...•.•.••...•....••...... 132 196. Introduction of mitochondria into normal and mtDNA-less (p 0 ) human cell lines ...... •.•..... 132 197. Involvement of mtDNA in mitochondrial encephalopathies •.•...... ••....•...... •. 133 198. Extrachromosomal amplicons in methotrexate-resistant HeLa cells ...... •...... •...• 134 Publications ...... ••.....•...... •...... 134
Judith L. Campbell - Summary .....•.•..•.••.•...... ••...•...... •...••...... 13 5 199. Yeast DNA replication origins ..•...... •.••••••..•..••.••.....••••••.•••••...•.....•• 136 200. DNA polymerase a is required for mitotic and meiotic replication but not for DNA repair in Saccharomyces cerevisiae ••••••••••••••••••••••••• , ••••••••• , ...... •.....•. 136 201. Immunoaffinity purification of yeast DNA polymerase-primase complex .•...•...... •...... 137 202. Purification of DNA polymerase II from yeast ..••...... •.•••...... ••...... •...... 137 203. Cell cycle regulation of the DNA polymerase I gene ...... ••••...... •...... •...... 138 204. Isolation of yeast DNA polymerase I mutants resistant to nucleoside/pyrophosphate analogs ..••••...... •..••....•.••.....•.•...... •...... 138 205. In vitro initiation of DNA replication ...•.....•...... •...... 139 206. Studies in the CDC7 protein of yeast ...... •...... 139 207. The effect of dnaA protein and n' sites on the replication of plasmid ColEl ...... •...... •. ll!O 208. Mechanisms underlying gene amplification in E.coli ••••••.•.••••.••.•..••••••.•...•.•••• 140 Publications •...... •...... ••...... •••...... ••.•...... ••. 1li l
William J. Dreyer - Summary ...••...... ••...... •...... •••...... •.... llll 209. Histological analyses of retinotectal molecules .••...... •...... 142 210. Biochemical analyses, including amino-terminal sequencing of selected retinotectal molecules .•...... •...... ••...... •...... 142 211. Establishing in vitro culture systems to study expression and function of retinotectal molecules ...... •...... 142 Suggested References •...... •...... ••...... •.•...... 1li 3
Herschel K. Mitchell - Summary ...••....•...••...... •••.•...... •...... 1li3 212. Epithelial differentiation in Drosophila pupae .•.•...... •...... •...... •...... lll3 213. Spontaneous fragmentation of pupal proteins •.....•.•••••.•••..••...... •.....•....•.... lll3 214. Heat shock protection against cold shock •.....•••...•...... •...... •...•...... llili Publications •.••••.••..•••....••••••..•.••.••...... •••••...... •.•.•.....•...•...... 1lili
James H. Strauss - Summary ..••...••••.•.•...•••••...... •••.....•.••..•...... •...... 1lili 215. The function of the 3' nontranslated region of Sindbis virus •••••....•.••...... ••••.•...... lli5 216. Analysis of 5'-terminal sequences of Sindbis virus RNA .....•.•...... ••...... •••...... lli5 217. Analysis of the conserved SI-nucleotide element within nsPl .....•••.....••.•..•.....•.... !% 218. Fine mapping of Sindbis RNA- ts mutants: Lesions responsible for complementation group F mutants •.•••...... ••••...... •••••...... ••...•...••...... 147 219. Studies on the Sindbis virus replicase: Mapping of RNA- mutants in complementation groups A, B, and G ••••..•...... •.....••..•...... •.•...... •....•..••...•.....•. lll7 viii
James H. Strauss - continued 220. Deletion mapping of the putative nonstructural viral protease of Sindbis ••••.••••••••••••••• 147 221. Characterization of a posttranslational modification of nsP3 of Sindbis virus •••••••••••••••• 148 222. Site-directed mutagenesis of the proposed catalytic amino acids of the Sindbis virus capsid protein autoprotease •••...••••..•••••••••••••..•••••••••••••••••.•....•.••••••• 148 223. Molecular basis of Sindbis virus neurovirulence in mice ...... 148 224. Low pHcdependent Sindbis virus-induced fusion of BHK cells ••.•..••••.•...••••••••••••••• 149 225. Studies of membrane fusion during the entry of Sindbis virus by saturation mutagenesis ...... 149 226. Sindbis virus tsl03 has a mutation in glycoprotein E2 that leads to defective assembly of virions •••.•••••••..•••••••••••••.••••.••••••••••••.••••..••••••••.••••• • 150 227. Western equine encephalitis virus is a recombinant virus ...... 150 228. A study of the interactions between the nucleocapsid and cytoplasmic domains of the envelope proteins from hybrid genomes •••••••...•..••••••••.••••••.....•...••.••.•••••• 150 229. Comparative study of 3' untranslated nucleotide sequences of Sindbis virus isolates ••••.•.••• •151 230. Structure of Ockelbo virus genome and its relatedness to Sindbis virus •••.•••••••••••••••.. . 151 231. Construction of full-length cDNA clones of Ross River virus •..•••••..•••.••••••••••••••• • 152 232. Generation of chimeric viruses between Sindbis virus and Ross River virus ...... •- .152 233. Complete nucleotide sequence of O'Nyong-nyong virus •.•••••.••••••••••..••••••.••••••• • 152 234. Characterization of antigenic variants of Sindbis virus •••••••••••.•••••••••••••••••••••• • 153 235. Mapping neutralization epitopes on glycoprotein E2 of Sindbis virus •••.•..•.•••••••••••••• • 153 236. Isolation of the Sindbis virus receptor from chicken fibroblasts •••••••...•••••••••••••••.•• 154 237. Processing of dengue 2 polyproteins •••••••••••••••••••••••••••••••••••.•••••••••.•••••• 154 238. Expression of dengue 2 structural proteins by a recombinant vaccinia virus ••.••••••••••••••• 154 239. Construction of a dengue infectious cDNA clone ••••••.••••••••••••••••••••••••••••••••• • 155 240. Organ-specific selection of viral variants during chronic infection ...... 155 Publications •..••••••.....•••••••.••...•••••••••.••••••••••••••..••..••...•••.•••••• 156
Barbara J. Wold - Summary ..•.•..••••.•••..••.••••••.•...••..•••••...•••••••••.....•• 156 241. Conditional expression of cellular Myc (c-myc) in tissue culture ••••••.•.•..•.••..••.•••••• l 57 242. c-myc effects on myogenesis ..••••.•••••..•.•.••••••...••.•••••••••••••••....•.•••••• 158 243. Conditional myoblasts ..••••..•••.•••••...••..•••••••••••...••••••••••••••••••••••••• 159 244. Analysis of muscle creatine kinase transcriptional regulatory elements in transgenic mice ••••••..••••••••....•••••••••••..••••••••.••..••••••••••••••••.•••••• 159 245. Protein:DNA interactions in the muscle creatine kinase enhancer •••.••••.....••••••••••••• 160 246. Regulation of metallothionein gene expression •••••••••...•••••••••••••••••••••••.•••••• 160 247. Tissue-specific expression of mouse metallothionein genes ...... 161 248. c-myc expression during spermatogenesis ...... 162 249. MT/c-myc transgenic mice ...... 163 250. Xenopus myc-family genes ....•••••.••..•••.••••••...•.••.••••••••••••••••.....•••••• 163 251. Self-cleaving RNA ••••••••••.••.•••••••• ; •.•••••••••••••.••••••••••••••••..•.••••••• 163 Publications •.•••••••••.•••••••••.••.••••••••...••••••••.••••••.•••••••••••••••••••• 164
CELLULAR BIOLOGY AND BIOPHYSICS
Charles J. Brokaw - Summary ••••••..•.•••••...•••••••••••••.••••.....••••••••.••••••• 167 252. Initiation of sliding in new flagellar bends: A starting transient ..•••••••••••••••....•••••• 167 253. Direct visualization of sliding between microtubules in beating flagella .•••.•••••••••••••••. 167 254. Wavelength-determining mechanisms in Ciona sperm flagella •..••••••••••••••••.••..•.•••• 168 255. Effects of phosphorylation on extraction of outer dynein arms •.•••••.••••••••••..••.•••••• 168 Publications •.•••••••••••••••••••••.••••••••...... •••••••••••..•••.•..•••••••••••••• 168
Scott D. Emr - Summary .••••••••..•••••••••.••••••••••••••...•••••••••••••••••••.••• 169 256. Analysis of vacuolar targeting signals in several yeast hydrolases .••••••••••••••••...••••.. 170 257. Isolation, characterization, and cloning of ts alleles of the vpt mutants .•••••••••••••••••••• 171 258. Characterization of yeast mutants defective in vacuole assembly and protein sorting ••••••••. 172 259. Cloning and molecular characterization of VPT29 and VPTl5 •••••••• •••••••••••••••••••••• 172 260. Reconstitution of yeast vacuolar protein delivery in vitro ••••••••••..••••••••••.•••••••••. 173 261. Characterization of a component of the yeast secretion machinery: Identification of the SECl8 gene product •••••••••••.••••••••••••••••••••••••••••••••••.••••••••••••••• 173 262. Saturation mutagenesis of a yeast mitochondrial protein import signal •••••••••••••••.•.•••• 174 263. SecB, a component of the host protein export machinery ••••• • .••••••••••••••••••••....••• 176 Publications ...... •...... •...... •...... 17 6
John. J. Hopfield - Summary •••••••••.•••.•••••••••••.•••••••••••••••••••••••••••••••• 177 264. Problems in olfactory and vision systems •••.•.••••••••••••••••••••••••••••.••••••••••• ;l 77 265. Learning to process auditory signals ..••....••••.•...•••••••••••••.•.•.•••••..•..•••••• 177 Publications •••••••••••.••••••••...•.•••••••••••..•••••••••••••.•.•.•••••••••••••••• 178 ix
Jean-Paul Revel - Summary ...... •...... •• 178 266. Topological analysis of the 45 kDa heart gap junction protein .....•.....•...... 178 267. Antibodies to the 45 kDa gap junction protein block cell-cell communication between myocardial cells .••. , •.•••...... ••••....•..•...... ••••...... 179 268. Immunolocalization of a 45 kDa protein to gap junctions in heart ...... ••...... •...... 179 269. Expression of gap junction protein in yeast. ...••.•.••• , .• ,, •...•...... •...•..•.•...... 180 270. A novel flow cytometric assay for gap junction proteins , ...... •..•.••....•...... 180 271. Production and characterization of monoclonal antibodies to the heart gap junction protein •••...... •••...••...... •...... 180 272. Isolation of a mRNA encoding a gap junction protein from rat brain and cerebellum ..•.•....• 181 273. Characterization of the gap junction gene family ...... •...... •• , ....•...... • 181 Publications .••..••••••...•...... •..••••...•...... •...... •••...... • 181
CELLULAR NEUROBIOLOGY
Mary B. Kennedy - Summary .....••...... •...... •...•...... 185 274. Sequence of the a subunit of brain type II CaM kinase ...... 1S5 275. Comparison of the sequences of a., s, and B' subunits of the type II CaM kinase .. ~ '2' •••••••••• 186 276. Sequences of the autophosphorylation sites in type II CaM kinase that generate Ca + - independent activity . .••••••••.••.••••••.•••••• , •••.••.•.. , •••••••••••••.••.•••.•••• 187 277. Location of "slow" Ca 2+ /CaM-dependent autophosphorylation sites in type II Ca~ kinase ..•••••.••.••...... •.•.. , ...... •.•...... •. 1S7 278. Ca +-independent autophosphorylation sites in type II CaM kinase that suppress stimulation by calmodulin •...... •..•.•....•...... •...... •••...... • !SS 279. Dephosphorylation of CaM kinase autophosphorylation sites by protein phosphatases-1 and -2A ...... ••.•....•....••...•...... •••.• , ••...... •...... !SS 280. Distribution of messages encoding subunits of type II CaM kinase in brain regions and tissues.zof the rat ..•••...... •...••.....•...... •...... • 189 281. Type II Ca +/calmodulin-dependent protein kinase in Drosophila •••••••.••••••••••••.•.••• • 189 282. Structure of CNS postsynaptic densities .•.• , ••••...•...... •••...... •...... 190 283. Inhibition of type II CaM kinase by sphingosine ...... 190 Publications .•...... •.•..•...... •...... •...... 191
Henry A. Lester - Summary •..•...••...... •.....••...... •• 191 284. A rat brain Na channel a subunit with novel gating properties ....•..•...... •....•. 192 285. Inactivation kinetics of the rat brain Na channel IIA a subunit •...• , ••...... , ...•..•• 192 286. Low molecular weight RNA-encoded protein(s) modifies rat brain Na channel function ...... 193 287. At least two mRNA species contribute to the properties of rat brain "A"-type potassium channels expressed in Xenopus oocytes •.. , ...•...... •...... •...... , .193 288. Structure-function studies of the nicotinic acetylcholine receptor ...... •.••..•...... 194 2S9. Beta subunit of mouse-Torpedo hybrid AChRs expressed in Xenopus oocytes determines sensitivity to a non-competitive inhibitor ...... •...... 194. 290. Acetylcholine receptors: Subunit role in single-channel conductance, channel open duration, and voltage sensitivity .....•..•...... •.....•..••...... •...... 195 291. Structure-function studies of a voltage-gated potassium channel ...... •...... 195 292. Mouse brain serotonin receptor-mediated responses in Xenopus oocytes: Ionic mechanisms of calcium-activated chloride currents ....•...•...... •...... 195 293. Expression of yeast a-factor receptor in Xenopus oocytes ....•.•.•...... 196 294. Two functional types of acidic amino acid receptors are encoded by different mRNA populations ...••••••....•..•.•..••••.•...... •...... •..•••...... •..•...... • 196 295. Inositol triphosphate triggers a two-phase increase in intracellular calcium ...... •.. 197 296. Development and plasticity of small neural networks ..•....••...••.•...... •....•. 198 297. Neuron-microdevice connections ....•...... ••••.••..••...... •..•...... •...... 198 298. Soft X-ray microscopy ...•• , .•.....•..••.••••.....••....•...••...... •••••.•..•...... l 9S 299. Information processing in the retina ....•.•...... •••••....•..•.•...... 199 Publications .••.•••.•.•.....••..•...•••...... ••...... •.•••.•..••...... ••. 199
DEVELOPMENTAL NEUROBIOLOGY
David J. Anderson - Summary ...... ••••...•..••...... ••..•...... •203 300. Neural-specific and NGF-inducible expression of SCGlO-CAT constructs in transfected cells .•...... ••• , .••...•...... •..••.•.•..••.•••.•...... •....•.•••.....204 301. Expression of SCGlO promoter-CAT fusion constructs in transgenic mice .... ~ ..•.•.••...... 20t+ 302. The molecular basis of plasticity in the sympathoadrenal system •.•...... •••..•...... 205 303. Structure, regulation and possible function of the SCGlO protein •••...... •...•...... • 205 304. Characterization of non-neuronal SCGlO-related transcripts ...... •..•..•..••...... •.206 305. Monoclonal antibodies to the SCGIO protein ••..•.••.•...... •.....•....•.•....•...... 206 x
David J. Anderson - continued 306. Basic fibroblast growth factor acts as a differentiation and proliferation factor for adrenal chromaffin cells ••••••••••••••••.•••••..••••••••••••••••••••••••••••••••••••• 207 307. A quantitative assay for an adrenergic differentiation factor •••••..••••••••••••••••••••••• 207 308. Immortalization of embryonic sympathoadrenal progenitor cells ••••••••••••....•.•••..•••• 208 309. Control of PNMT expression in cultured embryonic adrenal chromaffin cells ••••••..•••...••• 208 310. When do neural crest cells commit to the Schwann cell lineage? ••••..•••.•••••••••••••••••209 Publications •.•••.••••••••••••••••••••.••••••..•••••••.•••••••••••••••.••.•...•..••. 209
Seymour Benzer - Summary • • • • • • • • . • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • . • • • • • • • • • • • • • • • • •21 0 310. Expression of four distinct opsins in the three visual organs of Drosophila ••••••••••••••••••• 211 311. Comparison of the developmental expression of three eye genes in Drosophila development: Chaoptic, sevenless and ninaE opsin Rhl ••.•••..•••••••••••••••••..•••...•• 211 312. The identification and characterization of 60 Drosophila cDNA clones expressed in the visual system ••••••••••••..•••••..•.•...••••••••••••••••••.••.••••..•••••••••••••212 313. Biochemical characterization of the sevenless protein .•••••••••••••••••••.•.•••••.•..•••• 213 314. An early expressed, photoreceptor-specific Drosophila antigen, Ag 72H5 .••••••••••••••••••• 214 315. Subcellular localization of mRNAs in Drosophila developing and adult compound eye revealed by light and electron microscopic in situ hybridization ••••••••••••••••••••.••• 214 316. Cloning and characterization of the Star gene ••.•..••••••••••••••.•••..••••••••••••••••• 215 317. The eyes absent gene of Drosophila: A developmental trigger for eye disc differentiation ••••••.••••.••••••••••••••.••••••..••••••••••••••••••.••••••••••••••• • 215 318. A generation of Drosophila eye mutants that are perturbed in their developmental pathway ••••..••.••••••••••••••••...... •..•••.••••••••••••.••••.•••••••••••••••.••• 216 319. Identification of retina- and brain-specific genes homologous between Drosophila and man ...... 216 320. Alzheimer's disease: Topographical distribution of a neuronal antigen ...... 216 321. Identification of an Alzheimer's disease-related neuronal subset-specific protein ...... 217 322. Axonal transport of neuronal antigens characteristic of subpopulations of CNS neurons ...... 217 323. Ectopic spinal cord neurons in amyotrophic lateral sclerosis .•...•••••••••••••••••..•••.• , .218 324. Selective vulnerability of a subpopulation of cortical neurons in Pick's disease •••••••.•••.... 218 Publications •••••••••••••••••••••.••••.•••••••••••••••••.••...••••••••••••..••••.... 219
James M. Bower - Summary ...••....•••••••••••••.••••••••••••••••••••..•...•.••.. , •• 219 325. A general purpose software package to realistically simulate neural networks ••••••••••••••• 220 326. A computer simulation of a three-dimensional model of piriform cortex with functional implications for storage and recognition of olfactory patterns ...... 220 327. Structural simulations of the inferior olivary nucleus •••••••.•...••••••••••••••.•...... •• 221 328. Silicon-based probes for multichannel recording in cerebellar cortex .••.•..• , , •• , •• , , , , , .•• 221 329. A comparison of physiological and anatomical maps in cerebellar cortex •..••..••••• , , • , , • , .222 330. Role of cell autonomous factors in establishing sensory maps in cerebellar cortex •••• , , •• , • , .222 331. Cerebellar map formation - trigeminal nerve section in neonates leaves holes in cerebellar granular layer tactile maps of adult.rats •...... •• , ••••••••••••••••... , , ••••• , .222 332. Object discrimination, body position, and self-generated electric fields in the weakly electric fish, Gnathonemus petersii •••••••••••• , •• , , •••••••••••••••••• , , •••••••• 223 333. A new approach to teaching science to elementary school children •••••••••••••.•..••••.• , .223 Publications ...... 223
Masakazu Konishi - Summary ••..••••••••••••••••••••••• , ••••••••••••••..•..•.•••••• , .224 334. Processing of interaural level differences in the inferior colliculus of the barn owl ...... , •• , .224 335. The role of commissural projections in the representation of bilateral auditory space in the barn owl's inferior colliculus ..••.•.•.••••••••••••••...•••••••••••.•••.•.•• , , • , •• 224 336. Commissural projections mediate inhibition in a lateral lemniscal nucleus of the barn owl ...... , ••••••..••..•..••••. , , • , , .. • 225 337. GABAergic inhibition in the inferior colliculus of the barn owl, .••.•.•••..•• , ••••• ,, .•..•• • 225 338. Comparative physiology of auditory localization in owls .•.•...••..••••••••.••••... , •..•• • 225 339. Auditory experience and the development of neuronal song selectivity •••...••••••• , , ••..••• 226 340. Non-classical auditory projections to songbird forebrain ••••..•••.•••••••••••••••. , •••••••227 341. Morphological and pharmacological correlates of song system development ••••••••..••••••••227 Publications ••••••••••...•••••••••••••••.••.•••••••••••.••••.••••••••••••••.••••••••227
Paul H. Patterson - Summary •.•....••.••••••••••••..••. , •••••••••••••••• , , • , , ...... 228 342. Phenotypic commitment and plasticity in the neural crest , , , •..•..•••••••• , , • , •..••••••.•229 343. The precursors of the sympathoadrenal lineage •.•••...••• , , ...... , , , , , ...... 229 xi
Paul H. Patterson - continued 344. Molecular cloning of a neuronal cholinergic differentiation factor •...... •••...•.....•...... 229 345. Evidence for distinct factors affecting transmitter and neuropeptide phenotypes •••.•...•••.. 230 346. The role of the cholinergic factor in vivo •••••••••••••••••••••••.••••••••••••••••••••.•• 230 347. Neural grafts in disease models ...... •...•.....••••...... ••••.•..••••....•.•••..... 230 348. Thy-! and neurite outgrowth ...•...•...... •....•.••...... ••••...... •..••....•..••...•. 230 349. Monoclonal antibodies that define rostro-caudal position in the mammalian nervous system ....•....•...... ••...... •.•••.•..••..••••...... ••.•.•....••.....231 350. Role of plasminogen activator and its inhibitors in axonal outgrowth and regeneration in vivo ••.•...... ••..•...... •...•...... •••...... •.....•••.....• 231 Publications .....••••...... •.•...... •.••....•..••••••...... •...... •.•••...... •.231
Mark A. Tanouye - Summary ..•...... •••...... •.•••...... •.••.....••••...•...•••.. 232 351. Multiple products of the Shaker gene .•••..••....•••.•....•.•••.....••.•.•...... •.....•233 352. Expression of A-type potassium channels from Shaker cDNAs •••...... ••••...... ••....•. 233 353. Spatial and temporal expression of alternatively-spliced Shaker transcripts studied by in situ hybridization ••••.....•••.....•...••••...... ••..•....••••..•••••...... •.• 234 354. Characterization of lethals in the Shaker complex locus of Drosophila ••••••••••••••••••••• . 235 355. Drosophila homologs of vertebrate sodium channel genes ...... •...... ••...... 235 356. Investigating potassium channel genes in Drosophila melanogaster •••••••.••••••••••••••••• 236 357. Analysis of the bendless gene ..••••.•...... ••••...... •...•...... •...... 237 35&. Long-term regulation of potassium channels in PCl2 pheochromocytoma cells by nerve growth factor .•.....•••.•...... ••...•....•..•...... ••.....•...... •. 237 359. Human and bovine bFGF but not cAMP induce sodium channels in PC 12 pheochromocytoma cells .••.....••••..•.....••...... •...... ••...... •..•.238 Publications .....•••.•...... ••••....•...... ••..•...... •.....•.••...... •..... 238
NEUROBIOLOGY AND BEHAVIORAL BIOLOGY
John M. Allman - Summary ....•...... •...... •..•..•...•...... •.. 241 360. In vivo functional localization of the human visual cortex using nuclear magnetic resonance imaging and positron emission tomography ...... ••.•...... ••...... 241 361. A region in human cortex sensitive to low contrast moving dots and high temporal frequencies .•••...... •.•..•...... •...... •...... ••...... •.....••.....•.. 242 362. Secondary discontinuities in the retinotopic organization of owl monkey visual areas DLp, Dli, and DLa ....•.•.•.....••...•...... •...... ••.••..•....••...... ••...... ••.242 363. Learning the solution to the aperture problem or pattern motion with a Hebb rule ...... 244 364. A novel primate astroglial marker: Immunocytochemical characterization ...... 244 365. Monoclonal antibodies as markers of cortical connectivity .....•...... •.245 366. Transneuronal retrograde transport of tetanus toxin C fragment from injections in the facial muscles ...•...... •...... •.••••....••...•...... •••...... ••.•...... 246 367. Single neuron responses to socially relevant stimuli in monkeys ...... ••...... ••...... •..246 368. Circadian rhythms of rain forest lemurs in Madagascar ...... •...... •...... •...... 247 369. The consumption of cyanogenic bamboo by a newly discovered species of bamboo lemur ...... 247 Publications •••..••.....•...... ••...... •••...... •...... ••..•...... 248
Bela Julesz - Summary ...•...... •...... •..•.....•.•...... •...•.. 2 4 9 370. Texton theory of preattentive vision ...... •...... •...... •...... •...... ••••.249 371. The control and speed of shifts of attention .....•...... •...... •...... •..••...... 249 372. Spatial interactions in rapid pattern discrimination •..•..•.....•...•.....••.•..•..•...... 250 Publications ••...... •••••...... •••...•.....•...... •...... •...•.....•.. 250
Christo£ Koch - Summary •...... •••••..•....••••••.....•.••....••••....•••••...... •. . 25 l 373. Computing optical flow in the primate's visual system: A network model ...••••...... ••... 251 374. Modelling electrical excitability in the cell body and axon of type B bullfrog sympathetic ganglion cells •...... ••••••...... ••...... ••••••.....••.•...... ••.•...•. . 252 375. Measuring velocity discrimination thresholds ••...•..•••••••....•.••.....••••...... ••.. 252 376. Simulating cat visual cortex: Circuitry underlying orientation selectivity .••...... •.• , ..... 253 377. Analog subthreshold VLSI circuits for interpolating sparsely sampled 2-D surfaces using resistive networks •.. , , ...... •••...... •••...... •••...... , ..•.....•••.....•.254 Publications •.....••..•.•...... ••••..•.••.••...... •.•...•..•••..••••••...... •.•. 254 xii
Marianne E. Olds - Summary •.••••.• , •••••••••..••.• , •••••••••••.•• , , ...••••• , , ••••••• 251; 378. The contribution of neostriated dopamine activity to the motor response and the output of dopamine target neurons in the ventral midbrain , . , ••.• , , ••••• , , ••••••.•••... , ••••• , , .255 379. Effects of activating the DA receptor in accumbens on motor activity and on the output of neurons receiving afferents from accumbens ...... 256 380. The role of the dopamine afferents to accumbens and frontal cortex in reinforcement supported by medial forebrain bundle stimulation •.•..•••• , , , , , ••...••.• , •••••• , , ••••••• . 256 381. The role of serotonin neurons in reinforcement produced by brain stimulation ...... 257 Publications .• , .••. , .•••... , . , • , .•.•••..•..••• , , ••. , .....•.. , , • , •••••..•...•.•...••• 257
R. W. Sperry - Summary •••••.••••. , , , , , ...... , , , , , , ••••• , ••••••• •258 382. Hemispheric specialization for spatial discrimination in monkeys ...... , .•... , ...... 258 383. Hemispheric specialization for discriminations of inverted monkey faces •••• ,,,.,,,, •••••• , .258 381;. Facial processing by split-brain and normal human subjects , , • , ••...•••••••••••.••••....• •259 385. Commissurotomy subjects show stroop effect in both hemispheres .•••••••••••••.•.•... , •• • 259 Publications •. , ....•. , , , , ...•••••••••.•••.•••.••.••••••.••..••••..•••••••••....••••. 260
David C. Van Essen - Summary ..•••• , •..•....•••• , , ..... , ...... , •••••• , ...... , , •• 260 386. Concurrent processing streams in visual areas V2 and V4 of the Macaque monkey .... , . , , , .. . 261 387. Compartmental organization of projections from V2 to extrastriate areas V3, V3A, and Vl;t in Macaque monkeys •••• , •.•••..•• , , •••••• , ••.• , •••• , •• , •••.•.•••••••••• , , •.••••. 262 388. Optical studies of cortical connectivity in primate visual cortex ...... , ...... 262 389. Cortico-cortical connections among extrastriate visual areas in the rat .... , , ...... 263 390. Neural responses to moving texture patterns in visual area MT •••• , , ••••••.•.•..• , .••• , , •• 263 391. Testing for shifter circuits in monkey striate cortex •• , . , , ••••••• , •• , •••••..••. , • , , , , , , •• 261; 392. Shifter circuits in electronic VLSI hardware •••.•• , ...... ,,,.,,, ...... , ... ,,,, ••• • 265 393. Slowing of synapse elimination by postsynaptic activity block , • , ..••. , , , , , , , , ••••...•.••• • 265 394. Computer modeling of neuromuscular synapse elimination ...... , .•...... •...... 266 395. Quantitative measurements of multiple innervation ...... •...... 267 396. Synapse loss on fast versus slow muscle fibers ...... , ...... 267 Publications ...... , .••.••.••••.•. 268
Facilities ...••••••••.•••••••..•••••••••.•.•.••••••••••••..•••••••••..••.•.•.••••••••..•••.••. 271 Graduates •.•.••••••••••.•••••••.•..•••••.••...•••.••••...••••••••••••.•••....••••••.•••...•. 277 Financial Support ...... 278 Author Index (by page number) ...... 280 Financial Support (by page number) ...... 283 INTRODUCTION LEWIS 3
EDWARD B. LEWIS
Ed Lewis, the Thomas Hunt Morgan Professor of Biology, quietly added the designation of "Emeritus" to his title at the end of the 1987-88 academic year. This signals attainment of the age of 70 on May 20, but no change in his status as one of the world's best known and best loved Drosophila geneticists. He plans to remain active in research and to continue to occupy his familiar habitat on the third floor of Kerckhoff.
Ed was honored this year by his friends and colleagues by dedication of this year's Markey Symposium in Developmental Biology to Edward B. Lewis. The program of this symposium, which was focused on the topic of "The Evolution of Development," is presented on page 5.
VISITORS
Among the many visitors to the Division this year, two deserve special notice:
Robert Sinsheimer, who came to the Division as Professor in 1957 and served the Division as Chairman from 1968 to 1977, returned for a sabbatical year following his retirement from the position of Chancellor of the University of California at Santa Cruz. Bob's year at Caltech was designed as a transition back into the life of biological research. After surveying activity in various areas of the Division, he began participating in the work of Eric Davidson's research group and will continue similar research when he reestablishes his own laboratory at UC Santa Barbara. Bob also found time while here to deliver this year's commencement address on June l 0.
Alfred Tissieres, who is well known here because of many previous visits to the Division, presented this year's Jean Weigle Memorial Lecture on April 19. His topic was "The response of organisms to heat shock or stress.11
HONORS AND A WARDS
Professor Seymour Benzer was elected to foreign membership in the Indian Academy of Sciences, and received the Karl Spencer Lashley Award of the American Philosophical Society for his contributions to neurobiology.
Our Division Chairman, Professor Leroy Hood, was a winner of the 1987 Albert Lasker Basic Medical Research Award in recognition of his research on the immune system. He was awarded an honorary doctorate by the University of British Columbia, awarded the Dickson Prize in Medicine for contributions to immunology and molecular biology, and received the Distinguished Service Award of the 1988 Miami BIO/TECHNOLOGY Winter Symposium for pioneering in the automation of protein and DNA sequencing and synthesis. He was elected to fellowship in the American Association for the Advancement of Science.
Professor John Hopfield received the Michelson-Morley Award for 1988 from Case Western Reserve University, and he was also elected to the American Philosophical Society.
Assistant Professor Christof Koch received Presidential Young Investigator Awards from both the National Science Foundation and the Office of Naval Research.
Professor Mark Konishi received the F. 0. Schmitt medal and prize in neuroscience from the Neuroscience Research Program, and a McKnight Foundation Neuroscience Research Award.
Professor Elias Lazarides received the Achievement Award from the Tokyo Society of Medical Sciences and the Faculty of Medicine of the University of Tokyo.
Assistant Professor Howard Lipshitz was designated as a Searle Scholar by the Chicago Community Trust.
Professor Paul Patterson received an award for Excellence in Teaching from the Associated Students of the California Institute of Technology. He also received a McKnight Foundation Neuroscience Research Award.
Professor Jean-Paul Revel has been elected president of the Electron Microscope Society of America.
Professor Emeritus Roger Sperry received the 1987 Mentor Society Award.
Assistant Professor Paul Sternberg received both a Presidential Young Investigator Award from NSF, and designation and funding as a Searle Scholar.
Dr. Michael Palazzolo, as Senior Research Fellow in the Meyerowitz research group, won a Lucille Markey Scholar Award, which provides funding both during his fellowship here at Caltech and in a future faculty position. 4
STRAUSS HAHN BROKAW
Chang Hahn received the Ferguson Prize of $2000 for the best Ph.D. thesis among those students receiving their Ph.D. degrees in June, 1988. His thesis on "Structure-function relationships in the structural proteins and in the RNAs of alphaviruses and flaviviruses" was based on his work in the laboratory of Professor James Strauss.
IN MEMORIAM
Professor Emeritus Sterling Emerson died on May 2 at his home in Altadena. He was one of the original faculty in Biology who accompanied Thomas Hunt Morgan to Pasadena in l 928 to become an Assistant Professor at Caltech. He retired as Professor of genetics in l 971. During his 43 years in the Division, he made major contributions to our understanding of genetics. Among his principle interests have been the origin of ring chromosomes in the plant Oenothera, the mechanisms of crossing over in Drosophila, the basis of sulfonamide inhibition in Neurospora and microorganisms, and the mechanism of gene conversion in Neurospora and Ascobolus. He was elected to the National Academy of Sciences in 1970.
EMERSON KEIGHLEY
Geoffrey Keighley, who came to Caltech in 1930 and retired as Research Associate in Biology in 1970, passed away on March 24. He received his Ph.D. from Caltech in 1944 and was initially associated with the research program of the late Professor Henry Borsook. In the l 960's, he worked more independently and carried out some of the definitive work characterizing the hormone erythropoietin. For many years, he bore primary responsibility for radiological safety in the Division.
Hilda Rook, Chief Clerk from 1949 to 1965, passed away on March 26. She was Lody Kempees' predecessor and the first person to hold that position. Hilda is warmly remembered by older members of the Division for the competence and humanity with which she filled that position.
Jim Gilliam, precision machinist, passed away on April 16. He worked in the Division for Felix Strumwasser from 1964 to 1975, and then returned in 1979 as the supervisor of the precision machine shop under the direction of Howard Berg.
Dale Linder began work in the Division shops in 1962 as a machinist, and in 1973 he transferred to the vivaria facility where he worked until his retirement in 1982. Dale passed away on May 14 in Kimball, Nebraska, where he was living with his daughter. 5
The Second Lucille P. Markey Charitable Trust Symposium in Developmental Biology
THE EVOLUTION OF DEVELOPMENT
This Symposium is in honor of Dr. Edward B. Lewis, T. H. Morgan Professor of Biology
April 4-6, 1988 Ramo Auditorium, Caltech
Welcome: Leroy Hood, Chairman, Division of Biology, California Institute of Technology
Opening Remarks: Robert Glaser, Director for Medical Science, Lucille P. Markey Charitable Trust
SESSION I: EVOLUTIONARY CHANGES IN DEVELOPMENTAL REGULATION. I. Eric H. Davidson, Chairman Fotis C. Kafatos, Harvard University Evolution of developmental regulation for choriogenesis in insects Paul Sternberg, California Institute of Technology Evolutionary change in nematode development programs Rudolf A. Raff, Indiana University Mechanisms underlying radical evolutionary changes in early development Joan Ruderman, Duke University The cyclins and regulation of the cell cycle in early embryos Elliot Meyerowitz, California Institute of Technology Pattern formation in the development of flowers
SESSION II. . EVOLUTIONARY CHANGES IN DEVELOPMENTAL REGULATION. II. Edward B. Lewis, Chairman Ian Duncan, Washington University Genetic analysis of the bithorax complex and its trans regulators Michael Akam, University of Cambridge Homeotic genes and the evolution of segment diversity Markus Noll, Biozentrum, University of Basel Application of the gene network concept to segmentation genes of Drosophila Peter Lawrence, Medical Research Council, Cambridge Parasegments in Drosophila - the basic unit of design?
SESSION lll: EVOLUTION OF ORGANOGENESIS Mark Konishi, Chairman John Allman, California Institute of Technology The phylogeny of cerebral cortex John D. Pettigrew, University of Queensland Flying cats and flying primates: Phylogenetic surprises in the nervous system Bernd Fritzsch, Universitat Bielefeld Does metamorphic reorganization recapitulate the phylogeny of the auditory nuclei in frogs? Donald Ready, Purdue University The arthropod eye: A periodic crystal to quasicrystal?
SESSION IV: EVOLUTION OF PROTEINS Melvin I. Simon, Chairman Leroy Hood, California Institute of Technology Evolution of the superfamily of immune system genes Joram Piatigorsky, National Institutes of Health Gene sharing in evolution and differentiation: Lens crystallins as enzymes James H. Strauss, California Institute of Technology Evolution of RNA viruses Russell Doolittle, University of California, San Diego Evolution of retroviral proteins
SESSION V: EVOLUTION OF GENOMES Elliot Meyerowitz, Chairman Heinz Saedler, Max Planck Institute Plant transposable elements and their role in evolution Jeffrey D. Palmer, The University of Michigan Evolutionary instability in chloroplast DNA and transfer of gene functions from the chloroplast to the nucleus Roy J. Britten, California Institute of Technology Genomic change in evolution Ira Herskowitz, University of California, San Francisco - -
BIOLOGY DIVISION STAFF
Instruction and Research
Administrative
9
STAFF OF INSTRUCTION AND RESEARCH
Division of Biology Leroy E. Hood, Chairman Charles J. Brokaw, Executive Officer David C. Van Essen, Executive Officer James H. Strauss, Executive Officer
Professors Emeriti James F. Bonner, Ph.D. George E. MacGinitie, M.A. Biology Biology Norman Davidson, Ph.D. Herschel K. Mitchell, Ph.D. Norman Chandler Professor of Chemical Biology Biology Emeritus in Chemistry and Chemical Engineering Ray D. Owen, Ph.D., Sc.D. Sterling Emerson, Ph.D. Biology Genetics Roger W. Sperry, Ph.D., Sc.D., Nobel Laureate Derek H. Fender, Ph.D. Board of Trustees Professor Emeritus of Biology and Applied Science Psychobiology Norman H. Horowitz, Ph.D. Biology
Professors John N. Abelson, Ph.D. Masakazu Konishi, Ph.D. Biology Bing Professor of Behavioral Biology John M. Allman, Ph.D. Elias Lazarides, Ph.D. Biology Biology Giuseppe A ttardi, M.D. Henry A. Lester, Ph.D. Grace C. Steele Professor of Molecular Biology Biology Seymour Benzer, Ph.D., D.Sc. Edward B. Lewis, Ph.D. James G. Boswell Professor of Neuroscience Thomas Hunt Morgan Professor of Biology Charles J. Brokaw, Ph.D. Paul H. Patterson, Ph.D. Biology Biology Eric H. Davidson, Ph.D. Jean-Paul Revel, Ph.D. Norman Chandler Professor of Cell Biology Albert Billings Ruddock Professor of Biology William J. Dreyer, Ph.D. Melvin I. Simon, Ph.D. Biology Anne P. and Benjamin F. Biaggini Professor of Leroy E. Hood, M.D., Ph.D., D.Sc. Biological Science Ethel Wilson and Robert Bowles James H. Strauss, Ph.D. Professor of Biology Biology John J. Hopfield, Ph.D. David C. Van Essen, Ph.D. Roscoe G. Dickinson Professor of Biology Chemistry and Biology
Associate Professors Judith L. Campbell, Ph.D. Elliot M. Meyerowitz, Ph.D. Chemistry and Biology Biology Mary B. Kennedy, Ph.D. Ellen Rothenberg, Ph.D. Biology Biology
Assistant Professors David J. Anderson, Ph.D. Howard D. Lipshitz, Ph.D. Biology Biology James M. Bower, Ph.D. Paul W. Sternberg, Ph.D. Biology Biology Scott D. Emr, Ph.D. Mark A. Tanouye, Ph.D. Biology Biology Christo! Koch, Ph.D. Barbara J. Wold, Ph.D. Biology and Engineering Biology 10
Visiting Professors Bela Julesz, Ph.D. Robert L. Sinsheimer, Ph.D. Biology Biology
Distinguished Carnegie Senior Research Associate Roy J, Britten, Ph.D. Biology
Senior Research Associates Anne Chomyn, Ph.D. Ellen G. Strauss, Ph.D. Biology Biology Charles R. Hamilton, Ph.D. lwona Stroynowski, Ph.D. Biology Biology Barbara R. Hough-Evans, Ph.D. S. Barbara Yancey, Ph.D. Biology Biology Stephen B. H. Kent, Ph.D. Biology
Myron A. Bantrell Senior Research Fellow Dennis G. Ballinger, Ph.D. Biology
Senior Research Fellows Ruedi Aebersold, Ph.D. Joan A. Kobori, Ph.D. Biology Biology Thomas T. Amatruda, M.D. Dwight H. Kono, M.D. Biology Biology Utpal Banerjee, Ph.D. Eric H. C. Lai, Ph.D. Biology Biology Frank J, Calzone, Ph.D. Hermann Lubbert, Ph.D. Biology Biology R. Andrew Cameron, Ph.D. Ryn Miake-Lye, Ph.D. Biology Biology Susan E. Celniker, Ph.D. Mark E. Nelson, Ph.D. Biology Biology Soo-Chen Cheng, Ph.D. Kenji Oosawa, Ph.D. Biology Biology Hilde Cheroutre, Ph.D. John Archie Pollock, Ph.D. Biology Biology John V. Cox, Ph.D. Carmie Puckett, M.D. Biology Biology Michael E. Cusick, Ph.D. Martin I. Sereno, Ph.D. • Biology Biology Gloria Dalbadie-McFarland, Ph.D. L. Courtney Smith, Ph.D. Biology Biology Edgar A. DeYoe, Ph.D. Lloyd M. Smith, Ph.D. Biology Biology Daniel J. Felleman, Ph.D. Terrance P. Snutch, Ph.D. Biology Biology Alan L. Goldin, M.D., Ph.D. K. Vijay Raghavan, Ph.D. Biology Biology Joan M. Goverman, Ph.D. Catherine M. Woods, Ph.D. Biology Biology Stephen W. Hunt III, Ph.D. Biology Robert J, Kaiser Jr., Ph.D. Biology 11
Research Fellows Markus Aebi, Ph.D. David R. Hyde, Ph.D. Jonathan D. Pollock, Ph.D. Bernhard Arden, Ph.D. Bradford A. Jameson, Ph.D. Brian J. Papka, Ph.D. Alexander Artiskevsky, Ph.D. Scott A. John, Ph.D. Leila M. Posakony, Ph.D. Manfred W. Baetscher, Ph.D. Nachum Kaplan, Ph.D. Kasturi L. Puranam, Ph.D. Josette Banroques, Ph.D. Michael P. King, Ph.D. Ram Sharma Puranam, Ph.D. Leslie A. Barber, Ph.D. Daniel J. Klionsky, Ph.D. Bruce A. Rabin, Ph.D. Steven S. Beall, M.D. Sigrun Korsching, Ph.D. Reinhard Rauhut, Ph.D. David M. Bedwell, Ph.D. Douglas S. Kralte, Ph.D. Margaret Roark, Ph.D. Bruce W. Birr en, Ph.D. Ben J. A. Kriise, Ph.D. Michael Rodriguez, FRCPA Anthony B. Bleecker, Ph.D. Brigitte Kruse, Ph.D. Cesare Rossi, Ph.D. Katherine A. Berkovich, Ph.D. Richard J. Kuhn, Ph.D. SteJ>hanie W. Ruby, Ph.D. Robert B. Bourret, Ph.D. Vipin Kumar, Ph.D. Raul A. Saavedra, Ph.D. Paul D. Boyer, Ph.D. Chia-lam Kuo, Ph.D. Frank O. Sangiorgi, Ph.D. Robert F. Bulleit, Ph.D. Ratneshwar Lal, Ph.D. Nechemia Sar, Ph.D. Nigel R. Burns, Ph.D. Ul! Landegren, M.D., Ph.D. Dorothea L. Schiller, Ph.D. Maries A. Cariolou, Ph.D. Janis Lem, Ph.D. Jens Schneider, Ph.D. Catherine E. Carr, Ph.D. Debra A. S. Leonard, Ph.D. Yukio Shirako, Ph.D. Tien-Hsien Chang, Ph.D. John P. Leonard, Ph.D. Sarah M. Smolik-Utlaut, Ph.D. Pierre Charnet, Ph.D. Reid J. Leonard, Ph.D. Teresa R. Strecker, Ph.D. Michael W. Clark, Ph.D. Eleni Levedakov, Ph.D. Fedora Sutton, Ph.D. Leigh E. Clawson, Ph.D. Donna L. Livant, Ph.D. Toshihiko Suzue, Ph.D. Mahshid Company, Ph.D. Paolo Loguercio Polosa, Ph.D. N. Kyle Tanner, Ph.D. Patrick J. Concannon, Ph.D. Hong Ma, Ph.D. Susan Taplitz, Ph.D. W. David Crank, Ph.D. Donald Mann, Ph.D. Nadine J. Theze, Ph.D. Mariam M. Dohadwala, Ph.D. Mathew K. Mathew, Ph.D. Pierre R. Thiebaud, Ph.D. Dan Eshel, Ph.D. David R. Mathog, Ph.D. Takeshi Toda, Ph.D. Patrizia Fabrizio, Ph.D. David S. McPheeters, Ph.D. William W. Trevarrow, Ph.D. Steven R. Fain, Ph.D. Kathleen L. McGuire, Ph.D. Julie C. L. Tseng-Crank, Ph.D. Tung Ming Fong, Ph.D. Kirk Mecklenburg, Ph.D. Pantelis Tsoulfas, M.D. Anne Frey, Ph.D. Jane E. Mendel, Ph.D. Nusrettin Ulker, Ph.D. lchiro Fujita, Ph.D. Ana I. Millaruelo, Ph.D. James L. Urban, Ph.D., M.D. Medha Gautam, Ph.D. Nozomu Mori, Ph.D. David J. Vandenbergh, Ph.D. Narasimhan Gautam, Ph.D. Kevin G. Massie, Ph.D. Thomas A. Vida, Ph.D. Anna C. Glasgow, Ph.D. Nalini Narasimhan, Ph.D. Ravi S. Vinayak, Ph.D. Susan Goelz, Ph.D. Hiroyuki Nawa, Ph.D. Susan F. Volman, Ph.D. Christopher Gomez, Ph.D., M.D. John J. Ngai, Ph.D. F. Hermann Wagner, Ph.D. Valeta A. Gregg, Ph.D. Robert W. Nickells, Ph.D. Allred E. Walter, Ph.D. Girija Gundappa-Sulur, Ph.D. Hubert G. M. Niesters, Ph.D. Kai Wang, Ph.D. Gregg G. Gundersen, Ph.D. Heinz Nika, Ph.D. Steven Werman, Ph.D. Roger W. Hackett, Ph.D. Karen A. Ocorr, Ph.D. Dorothee Wernicke-Jameson, Ph.D. John W. Hess, Ph.D. Jaime F. Olavarria, M.D., Ph.D. Thomas Wilkie, Ph.D. Jeffrey H. Hoger, Ph.D. Harry S. Orbach, Ph.D. Richard K. Wilson, Ph.D. Elly Holthuizen, Ph.D. Sally L. Orr, Ph.D. Carol W. Wuenschell, Ph.D. Christer S. L. H66g, M.D. Michael J. Palazzolo, M.D., Ph.D. Qi Xu, M.D. David S. Horowitz, Ph.D. Patty P.-Y. Pang, Ph.D. Tetsuo Yamamori, Ph.D. Kelly T. Hughes, Ph.D. Salil D. Patel, Ph.D. Martin F. Yanofsky, Ph.D. Huey Ru Hwu, Ph.D. Giovanni Pauletti, Ph.D. Lei Yu, Ph.D. Michael G. Paulin, Ph.D. Dennis Zaller, Ph.D.
Faculty Associate Marianne E. Olds, Ph.D. Biology
Visiting Associates Rafi Ahmed, Ph.D. Vivian H. Cohn, Ph.D. University of Caliromia, Los Angeles University of Southern California Schoo! of Medicine Serge Alziari, Ph.D. Universite de CZerymont II, Paris Jesus Del Mazo, Ph.D. Center for Biological Research, Madrid Charles H. Anderson, Ph.D. Jet Propulsion Laboratory, Pasadena Allison J. Doupe, M.D., Ph.D. University of California, Los Angeles Leslie Brothers, M.D. University of California Schoo! of Medicine, David R. Fromson, Ph.D. Los Angeles California State University, Fullerton Wang Qin Chen, Ph.D. David R. Hinton, Ph.D. Chinese Academy of Sciences, Beijing University of Southern California 12
Visiting Associates (continued) Annemarie Hofmann, Ph.D. David Nishioka, Ph.D. Freie Universitat, Berlin Georgetown University Laura L. Hoopes, Ph.D. Polly Henninger Pechstedt, Ph.D. Occidental College, Los Angeles Pitzer College Nancy C. Lan, Ph.D. Lajos Piko, Ph.D. University of Southern California Veterans Administration Medical Center Walter E. Laug, M.D. Bernardo C. Rudy, M.D., Ph.D. Children's Hospital of Los Angeles New York University Medical Center Robin Lowry, M.D. M. Hadi Shojaeian-Zansani, Ph.D. Royal Victoria Hospital, McGill University, Montreal Yale University Shlomo Lustig, Ph.D. David R. Smyth, Ph.D. Israel Institute for Biological Research, Ness-Ziona Monash University, Melbourne, Australia Paolo Mascagni, Ph.D. Richard E. H. Wettenhall, Ph.D. University of London LaTrobe University, Melbourne Minnie McMillan, Ph.D. Patricia C. Wright, Ph.D. University of Southern California Duke University Carol A. Miller, M.D. Eran Zaidel, Ph.D. University of Southern California School of Medicine University of California, Los Angeles Deborah A. Nickerson, Ph.D. University of South Florida, Tampa
Graduate Students Ralph Adolphs, B.S., M.S. Jan H. Hoh, B.S. Larry Proctor, A.B. Elliot Altman, B.S. Tim Hunkapiller, B.S. Mani Ramaswami, M.S. Roger Anderson, B.A. Gregg D. Jongeward, B.S. Mahendra Rao, M.B.B.S. Raffi V. Aroian, S.B. Alexander Kamb, A.B. Patricia J. Renfranz, B.S. Lois M. Banta, B.A. Jon Faiz Kayyem, B.S., M.S. Jane S. Robinson, B.A. Ronald G. Benson, B.S. Michael P. King, B.A. Murray 0. Robinson, B.A. Ojvind J. Bernander, M.S. James J. Knierim, B.A. David W. Ruff, B.S. Upinder S. Bhalla, B.A. George Komatsoulis, B.S. James H. Sabry, M.D. John L. Bowman, B.S. Tina J. Kramer, B.S.E. E. Karina Schimmerling, B.A. Kurt A. Brorson, B.A. Maurice Yao-Tze Lee, B.S. Christopher Schoenherr, B.S. Edward M. Callaway, B.S. William M. Leiserson, B.A. Erich M. Schwarz, A.B. James T. Campanelli, B.S., M.S. Michael A. Lochrie, B.A. David J. Shuey, B.S. George J. Carman, A.B. Nagesh K. Mahanthappa, B.A. David W. Sivertsen, B.S. Caren Chang, A.B. Christopher H. Martin, A.B. James M. Soha, B.S., M.S. Chong Chen, B.S., M.S. Peter H. Mathers, Sc.B. Jeffrey H. Stack, B.S. Dali Ding, B.S. Kenneth J. McCormack, B.A. Derek L. Stemple, B.A., B.S. Kurt Eakle, B.S. Colin T. McDonald, A.B. Michael P. Strathmann, B.S. Michael R. Emerling, A.B. Joseph T. Meier, B.A. Scott Strobel, B.A., B.S. Lance Fors, A.B. Arie M. Michelsohn, B.A. Humbert H. Suarez, M.D. James Fox, B.S. Steven G. Miller, B.S. Henry M. Sucov, B.A. William K. Funkhouser Jr., B.A., Jeffrey H. Miner, B.A. Sean Tavtigian, B.A. M.D. Joseph Minor Jr., B.S. John H. Thompson, B.S. Mark D. Garfinkel, B.A. Sean S. Molloy, B.A. Joanne Topol, A.B., M.S. Paul A. Garrity, B.A. Richard D. Mooney, B.S. Bernard Vernooy, B.A., M.A. Chang Soo Hahn, B.A. Andrew J. Moore, B.S. Usha Vijayraghavan, B.Sc., M.Sc. Young Shin Hahn, B.S. Paul R. Mueller, B.S. Roger A. Wagner, B.S. Susan R. Halsell, B.A., M.A. Jennifer Normanly, B.A. Kang-Sheng Wang, B.S., M.S. Bruce A. Hamilton, B.A. Thomas J. Novak, B.A. Shawn K. Westaway, A.S., B.A. John G. Harris, B.S., M.S. Bruce L. Patton, B.S. Kellie L. Whittaker, B.A., M.A. Paul K. Herman, B.Sc. Kevin Plaxco, B.S. Julia A. Yang, B.A. Russell J. Hill, B.A. Frank Preugschat, B.Sc. Benton N. Yoshida, B.S., M.S.
Members of the Professional Staff Eugene Akutagawa, B.S. Karl J. Fryxell, Ph.D. Suzanna J. Horvath, Ph.D. Cesar G. Labarca, Ph.D. Evelynn McGuinness, Ph.D. Francis M. Miezin, M.S.E.E. Carol Readhead, Ph.D. Jane Z. Sanders, Ph.D. David B. Teplow, Ph.D. Bea (Natalie) Trifunac, Ph.D. 13
Staff Associates Linda E. Iverson, Ph.D. Janet M. Roman, Ph.D. Terry T. Takahashi, Ph.D. Betty A. Vermeire, Ph.D.
Research and Laboratory Staff Anita Ackermann Martha Fiallos Li-Ching Lo, B.S., M.S. Christine A. Acklin, B.S. William W. Fisher, B.A. Steve Luber, B.A. Judy R. Adams Henry K. W. Fong, Ph.D. Jin Luo, M.S. Amit Agarwal, B.A. Joaquin Forbes Josephine Macenka, B.S. Frances B. Aguirre Roberta R. Franks, Ph.D. Sara L. MacKellar, B.S. Chulbul Ahmed, Ph.D. Peter C. W. Gaines, B.S. Jessica L. Madow, B.M. James W. L. Allen Jr., B.A., David C. Garrett Jenny Tzu-I Mao, B.S. M.M. Teresa Geffroy, B.A. Jorge Mata Helen Alvarez Elaine F. Gese, A.B., M.A. Carol A. Mayeda, B.S. Marika F. Anderson, B.S. Danielle 0. Gladding, B.A. Doreen McDowell, B.A. Patricia A. Anderson, B.S. Daniel S. Glantz, B.A. Ross J. McMahon, B.S. Petros Arakelian, B.S. Eel Goedemans James G. Moore Brian J. Austin, B.A. Jane D. Goldsborough, B.A. Sandra N. Nagayama, B.S. Mathew J. Avalos Marcia B. Goodstein, B.A. Hieu T. M. Nguyen, B.A. Gladys C. Aversa Roberta M. Goldstein, B.A., M.S. Barbara J. Otto Jon R. Backstrom, A.A., B.S. Annie Gouin, B.S., M.S. Ker-Hwa Ou, B.S., M.S. Rollin H. Baker, B.A., M.S. Gary Grant Karen F. Parker, B.A. George Baklayan, B.S. Dolores Guzman Karen A. Pepper, B.S. Carlzen Balagot Parvin Hartsteen Susan K. Perry, B.S. Naomi A. Barker, B.Sc. Maria E. Hernandez Rosetta Pillow Will F. Baron, B.Sc. Ronald L. Hill Gary D. Pipes, A.A. Barbara B. Barth, B.A. Wade M. Hines, B.A. John Raes, B.S. Alexander S. Battaglia, B.A. Andrea E. Holboke, B.A. Irma Ribeiro Tamara K. Bauer, B.S. Joann Imrich, B.A. Jane Rigg, B.A. Jerry Beckman Joyce Ito, A.A., B.S. Joan L. Roach, B.A. H. Joseph Berejikyan, B.S. Debora Jackson Scott L. Rosenfeld, B.A. David H. Bilitch, B.S. Dennis Jackson Judith Rosenthal, B.S. Kathleen N. Blackburn, A.A. Jill W. Jenik, B.S. Miriam L. Rusch V. Craig Bond, Ph.D. Venise L. Jennings, B.S. Emma Saffman, B.S. A. Lidia Bowman Bertha E. Jones Kathleen D. Segesman, B.S. MaryAnn Buckles, Ph.D. Laurence G. Jones, B.S., M.S. Linda Martin Selk, B.A. Debra A. Carlyle, B.A. Gertrude Jordan Meichun Shen, B.A., M.A. Jeffrey D. Carpenter, B.S. Lucia Jourdau-Tuccillo, M.S. Floyd G. Shon, B.S. Julia W. Chang, B.S. Susan B. Kallenbach, B.A. Elizabeth K. Smith, B.S. Steven M. Clark, B.S. Irene R. Kazy Charles F. Spence, B.S. Louise Cloutier, D.E.C. Daniel J. Keelan, B.Sc. David B. Stout, B.S. Joseph Curtis, B.A. Benneta T. Keeley Erich C. Strauss Ann E. Cutting, B.A. Sherry A. Kempin, B.A., M.S. Becky G. Tanamachi, B.S. Linda L. Czyzyk, B.A. Chin Sook Kim, B.A., M.S. Kathleen Tazumi, B.S. Jessica A. Dausman, B.S. Jennifer K. Kim, B.S. Lisette M. Tefo, B.A. Noel A. Davi, B.S. Rosina K. T. Kinzel Caryn D. Tong, B.S. Cheryl A. Davis, B.S. Patrick F. Koen Pravin Tulachan, B.S. Maria A. DeBruyn Patti M. Koenig, M.S. John Uhley, B.S. Arthur W. DeJohn H. Marie Krempin, R.N. Jessie Walker Vicky L. Deloff, B.S. Julianna Krist, M.S. John C. Wathey, Ph.D. John A. DeModena, B.S. Susan Shu-Ai Tsai Lai, B.S. Mildred A. Weaver, A.S. Rochelle A. Diamond, B.A. Lisa N. Larson, B.A., M.S. Udo Wehmeier, B.S. Tuyet Mai Dinh Ali R. Lashgari, B.S. Eva L. Westmoreland Susan M. Donnellan Patrick S. Leahy, B.S. Michael A. Whitney, B.S. Arger L. Drew Carol C. Lee, B.S., M.S. Joe Williams Jean E. Edens Cherrie W. Leighton, B.A. Kristi Wilson Eveline Eichenberger Edith M. Lenches, B.S. Haul Wong, B.S. Erika M. Erdmann, B.A., Ph.D. Jill K. Lewis Tod M. Woolf, B.S. Pamela L. Eversole-Cire, B.S., Keith D. Lewis, B.A. Walter M. Yamada III, A.B. M.S. Catherine Lin, B.S., M.A. Rosalind Young, B.Sc., Moira A. Fearey, B.S. Ting Yi Lin M.Sc. Renny Feldman Randolph B. Lipscher, B.A. Annette S. Yuen, B.A. 14
Student Assistants Craig Abbott Mark Foxwell Bassem Mora Michael Ahn Michael J. Goebel James O'Dea Keith Akama Curt Hagenlocher Carlos Ramirez Michelle M. Arcinue Jay Higley Jean C. Rhim Henry Berg Eran W. Hood Ronald Rogge Sandip Biswal John Hoskins Randall A. Scharlach John Bowers Andrew Hsu Cheng Song Tom Brinck Mark Huie Catherine Speiser David Bruning Birgitta Jentoft-Nilsen Erik Staats Hwai-Wen (Cathy) Chang Ani Ketabgian David Taub Ami Choksi Leonard Kim Patricia White Arthur DeJohn Tanya Kurosky Hsi-Jen Yeh Xi-Yang Deng Rodney Larsen Richard Yeh Christopher T. Dodd Michael Lazzaro Kenneth K. Yoshimoto Andrew Essen Randy S. Levinson Kyuson Yun Donna F. Evans Ann J. Lewis Renny Feldman James Li J. Dominic Femino Matthew A. Machlis Robert W. Maher 15
ADMINISTRATIVE STAFF
Michael Miranda, Administrator Elizabeth T. Har low, Division Secretary
Accounting The Mabel and Arnold Beckman Laboratories of Lody Kempees, Manager Behavioral Biology Ruth M. Erickson Nancy M. Gill, Manager - Grants - Graduate Student Program Computer Facility Sandra L. Koceski - Accounting David Chan Michael P. Walsh - Electronics Shop Tim Heitzman Hamid Jafari Grants John N. Power Renu Nandkishore Candace S. Hochenedel - Word Processing Joanne C. White - Word Processing
Instrument Repair Shop Anthony Solyom
Braun Laboratories in Memory of Carl F and Machine Shop Win ifred H Braun Frank L. Ostrander, Supervisor Isabella M. Lubomirski, Manager John Klemic - Grants Leroy Lamb Patricia A. Bateman - Accounting Mary R. Marsh - Travel Catherine M. Elkins - Word Processing Research Fellow Program Constance R. Katz - Annual Report Secretary Gwenda Pollard
Stockroom and Supplies William F. Lease, Supervisor Angelo J. Delise William G. Kerckhoff Marine Laboratory Giao K. Do Jerry G. Beckmann, Supervisor Jose Gonzales Barbara B. Barth Patricia Perrone Robert Simpson Roberto Vega, Supervisor Milton Grooms Thomas J, Menchaca
Word Processing Facility Stephanie A. Canada Rita M. Grable Kathleen Patterson Renee Thorf Marilyn G. Tomich
DEVELOPMENTAL BIOLOGY
Roy J. Britten
Eric H. Davidson
Leroy E. Hood
Elias Lazarides
Edward B. Lewis
Howard D. Lipshitz
Elliot M. Meyerowitz
Ellen Rothenberg
Melvin I. Simon
Paul W. Sternberg
19
Professor: Eric H. Davidson spatial and temporal regulation of structural genes, Visiting Professor: Robert L. Sinsheimer expression of which underlies the initial appearance of Distinguished Carnegie Senior Research Associate: Roy J. Britten 1 cytodifferentiation. Cis-regulatory sequences of the Senior Research Associate: Barbara R. Hough-Evans marker genes are being identified, and their specific Visiting Associates: David R. Fromson, David Nishioka, Lajos Piko interaction with trans-acting protein factors that can Senior Research Fellows: Frank J. Calzone, R. Andrew Cameron, L. Courtney Smith be extracted from eggs and embryos is being Research Fellows: Steven R. Fain, Christer S. L. Hoog, characterized. We regard the developmental origin, Huey Ru Hwu, Donna L. Livant, Robert W. activation, and spatial distribution of such regulatory Nickells, Nadine J. Theze, Pierre R. Thiebaud, Steven D. Werman factors as a route to a causal interpretation of Graduate Students: Roger Anderson, Joseph Minor Jr., Henry M. Sucov, Kellie L. Whittaker differential gene activity at the beginning of the life Research and Laboratory Staff: Carlzen Balagot, Will cycle. F. Baron, Barbara B. Barth, Ann E. Cutting, Tuyet Mai Dinh, Joaquin Forbes, Roberta R. Franks, David C. Garrett, Danielle 0. Gladding, Marcia B. 1. In Vivo Titration of Cyllla Actin Regulatory Goodstein, Ronald L. Hill, Debora Jackson, Factors in Sea Urchin Embryos Patrick S. Leahy, Jane Rigg, David B. Stout Donna L. Livant, Ann E. Cutting 'Concurrently a member of the staff of the Carnegie We have obtained an estimate in vivo of the Institution of Washington. quantity of the limiting factor(s) required for develop
Support: The work described in the following research mental activation and transcriptional expression of a reports has been supported by: lineage-specific gene in the sea urchin embryo, which Beckman Fund Biomedical Research Support Grant (NIH) can be Compared with estimates of factor prevalence Carnegie Institution of Washington obtained in vitro in other work. A fusion construct in Norman Chandler Professorship in Cell Biology which the bacterial gene for chloramphenicol acetyl Charles B. Corser Fund for Biological Research Lucille P. Markey Charitable Trust transferase (CAT) is controlled by cis-regulatory National Institutes of Health, USPHS elements of the CyIIla cytoskeletal actin gene National Science Foundation Alfred P. Sloan Foundation (CyIIla•CAT) was introduced in varying numbers of Veterans Administration copies into sea urchin eggs. The activity of the Cy Illa •CAT fusion in 24 hr blastula stage embryos was shown to saturate as the number of exogenous genes is Summarr. The focus of interest in this laboratory is increased. The mean number of Cyllla•CAT fusion the developmental expression, the organization, and genes per nucleus at which half saturation was the evolution of the genome in higher animals. Sea obtained is about 105 ± 40. This result suggests that urchin eggs, embryos, and larvae serve as experimental equilibrium parameters earlier measured in vitro may systems for much of our work. Other projects concern apply at least approximately within the embryo nuclei. genes expressed in adult tissues. A number of sea urchin genes active at particular times and in 2. Factors That Bind Specifically to Regulatory particular cell lineages and cell types have been cloned Sequences of a Sea Urchin Gene and characterized. In addition, cloned genes of Frank J. Calzone, Pierre R. Thiebaud, humans and other primates are being utilized in Nadine J. Theze, Ronald L. Hill evolutionary studies. Generally, projects concerned Previous gene transfer experiments have identified with the molecular biology of sea urchin development a 2500 nt 5' domain of the Cyllla cytoskeletal actin are carried out in our Pasadena laboratory, while those gene, which contains cis-regulatory sequences that are at the Kerckhoff Marine Lab are centered on genomic necessary and sufficient for spatial and temporal evolution. control of Cyllla gene expression during embryo Recently developed methods for gene transfer in genesis. This gene is activated in late cleavage, the sea urchin are being exploited in studies of exclusively in aboral ectoderm cell lineages. In this differential gene expression in the early embryo. The study we focus on interactions demonstrated in vitro major issue in this work is the molecular basis of between sequences of the regulatory domain and 20 proteins present in crude extracts derived from sea several proteins. Synthetic oligonucleotides corre urchin embryo nuclei, and from unfertilized eggs. sponding to putative binding sites have been used to Quantitative gel shift measurements are utilized to confirm the binding sequence by gel retardation estimate minimum numbers of factor molecules per competition experiments. Our survey has given us a embryo at 24 hr postfertilization, when the CyIIla gene complete map of the 2.5 kb cis-regulatory region is active; at 7 hr, when it is still silent; and in the important for Cyllla gene expression. unfertilized egg. We also estimate the binding affinity preferences (Kr) of the various factors for their 4. In Vivo Competition Shows Essential Regulatory respective sites, relative to their affinity for synthetic Regions of a Sea Urchin Gene DNA competitors. At least 11 different specific inter Roberta R. Franks, Barbara R. Hough-Evans, actions occur within the regulatory regions, some of Roger Anderson Which produce multiple DNA-protein complexes. Previous gene transfer experiments have identified Values of Kr range from about 2 x 104 to about 106 for a 2.5 kilobase (kb) cis-regulatory region of the sea these factors under the conditions applied. With one urchin CyIIla cytoskeletal actin gene which is exception, the minimum factor prevalences that we sufficient for correct developmental expression. When measured in the 400-cell 24 hr embryo nuclear fused with the bacterial chloramphenicol acetyl extracts fell within the range of 105-2 x 106 molecules transferase (CAT) reporter gene, this region directs per embryo, i.e., a few hundred to a few thousand temporal and spatial expression of CAT mRNA in molecules per nucleus. Three developmental patterns transgenic embryos at the same developmental time were observed with respect to factor prevalence: and in the same embryonic region, the aboral ecto factors reacting at one site were found in unfertilized derm, as the endogenous CyIIla gene. Coinjection of egg cytoplasm at about the same level per egg or excess molecules of the regulatory region with the embryo as in 24 hr embryo nuclei; factors reacting complete CyIIla•CAT gene depresses the activity of with five other regions of the regulatory domain are the transgene almost stoichiometrically, apparently by not detectable in egg cytoplasm but in 7 hr mid competition for binding of limited numbers of Cyllla cleavage stage embryo nuclei are already at or close trans-acting transcription factors. This sequence to their concentrations in the 24 hr embryo nuclei; and includes several different regions where DNA:protein factors reacting with five additional regions are not interactions have been shown to occur in vitro, detectable m egg cytoplasm, and are low in 7 hr utilizing proteins present in nuclear extracts derived embryo nuclei, i.e., ~ l 0% per embryo of the level they from embryos. In this study we focus on the identifi attain in 2'+ hr embryo nuclei. The rise in concen cation, by in vivo competition, of subelements within tration of factors of the latter class could provide the this region where functionally significant cis-trans proximal cause for the temporal activation of the interactions take place. CAT enzyme activity is CyIIla gene at the early blastula stage. quantitated at 24 hr and the pattern of CAT mRNA accumulation in embryonic tissues examined by in situ hybridization at 72 hr postfertilization, when the 3. Mapping of Protein Binding Sites in the 5' Regulatory Sequence of Cyllla Actin Cyllla gene is active. Coinjection of a 1.2 kb DNA fragment located just upstream of this region, or of a Nadine J. Theze, Frank J. Calzone, Pierre R. Thiebaud, Ronald L. Hill sequence derived from the first intron of the Cyllla We used different approaches to define more gene, has neither a quantitative nor qualitative effect precisely the binding site of each protein that has been on Cyllla•CAT gene activity. However, eight non shown to 'interact with 51 sequences of the sea urchin overlapping competitor DNA sequences derived from CyIIla cytoplasmic actin gene (Abstract No. 2). By gel within the regulatory region depress CAT enzyme retardation, we mapped the binding sites to 30-50 bp activity in transgenics to varying extents, compared to for most of the proteins. DNase I footprinting assays control embryos which contain the intact Cyllla•CAT combined with methyl interference allowed us to gene only. In no case is the activity of the transgene determine the sequence-specific interaction for stoichiometrically competed. A spatially promiscuous ' 21 pattern of Cyllla•CAT activity is observed in embryos The second method we are experimenting with following coinjection of excess quantities ?f a frag utilizes the coincidence of select restriction endo ment located at position -0.2 kb to -0.3 kb relative to nuclease recognition sites occurring in the regions of the CyIIIa transcription start site. When examined by protein interactions with the CyIIla gene. In vitro in situ hybridization, these embryos display CAT tran experiments show that cutting DNA probes with scripts not only in aboral ectoderm cells but also in restriction enzymes that recognize DNA sequences ectopic lineages: mesenchyme cells, gut cells, and within these regions can destroy the sites recognized oral ectoderm. We interpret these results to indicate by sea urchin nuclear proteins. Conversely, binding of that the normal regulatory system controlling CyIIla nuclear proteins can protect these sites from cleavage gene expression depends on a large number of cis-trans by restriction enzymes. We have employed this latter interactions, both positive and negative, required phenomenon to assay for the binding of proteins to combinatorially. these sites in nuclei. Purified nuclei are briefly digested with an excess of a restriction enzyme. 5. Genomic Analysis of Activator Proteins Binding Fragments generated by this digestion are analyzed by to the CyIIIa Gene genomic blotting. Preliminary results indicate that Robert w. Nickells some sites of the Cyllla promoter region are protected The early cleavages of the developing sea urchin from cleavage by restriction enzymes. This protection embryo establish a set of founder cells, the progeny of appears to be enhanced in nuclei isolated from a which give rise to clones of cells that contribute to population of cells enriched for aboral ectoderm versus specific regions of the growing embryo and larva. We nuclei isolated from cells that do not express the have been investigating the controls regulating the Cyllla gene. expression of the cytoskeletal actin gene, CyIIIa, These analyses of when, and in what ce II types, which becomes transcriptionally active at the early nuclear binding proteins interact with the CyIIIa gene blastula stage and only in the cells of lineages should provide some insight into the mechanism of composing the aboral ectoderm tissue. Gel retardation developmental regulation of this gene. analyses and DNase I footprinting have revealed at least 11 sites of interactions between nuclear 6. Binding of CyIIIa Gene Trans-Activators by Other Sea Urchin Genes extracted proteins and the Cyllla promoter region (see Abstract No. 2). It is now of interest to determine the Pierre R. Thiebaud, Nadine J. Theze, Frank J. Calzone pattern of these DNA:protein interactions within the Several Cyllla gene trans-activators have been cells composing the aboral ectoderm lineages. identified (Abstract No. 2). These factors bind to well We are currently experimenting with two method defined 5' sequences of the gene (Abstract No. 3). In ologies to assay for DNA:protein interactions in viva order to know whether these DNA-binding proteins and/or in isolated nuclei. The first method involves interact with other sea urchin genes, we analyzed by protection of the DNA (by a bound protein) from gel retardation assay, the binding competition of each methylation by dimethyl sulfate (DMS). DMS methyl factor (P 1 to Pg) to Cyllla sequences versus 5' ates G residues, which are then susceptible to cleavage sequences of Strongylocentrotus purpuratus Spec, with piperidine. In in vitro experiments, proteins spicule matrix protein (SM50) and Cy! actin genes. specifica!ly bound to DNA probes protect specific G These genes share with CyIIla gene the same temporal residues from methylation. G-methylation reactions expression. Spec gene is expressed in aboral ectoderm with DMS are also possible in intact cells and isolated cells like CyIIIa gene. SM50 is expressed in mesen nuclei, making this procedure desirable for analysis of chyme cells, and Cyl actin genes are more generally DNA:protein interactions occurring in vivo. Fragments expressed, in every cell of the embryo, at the develop generated by this procedure can be analyzed by ment stage (24 hours) analyzed here. As a Kr value blotting the fragments from sequencing gels (genomic has been determined for each binding protein, we have sequencing) or by primer extension using a modifica defined a Krs value corresponding to the affinity of tion of the polymerase chain reaction procedure. the same protein for 5' sequences of competing genes. 22
It appears that the binding proteins P 1-P 8 may be cleavage, exclusively in cell lineages that will give rise classified in three groups. P 6 and P8 show no affinity to aboral ectoderm in later stages. Previous gene for the competing genes and seem to be Cyllla gene transfer studies have identified a 2.5 kb 5' domain that specific. P1, P3, P4, and P5 compete with the contains cis-regulatory sequences that are necessary different genes and may be considered like general and sufficient for spatial and temporal control of this trans-activator acting in a temporal manner. P2 and gene. For those experiments the CyIIIa regulatory P7 have a strong affinity for Spec gene sequences and region was fused with the bacterial chloramphenicol could be spatial activators. acetyltransferase (CAT) reporter gene, and the CyIIla•CAT fusion construct injected into eggs. When 7. Cloning of Sea Urchin DNA Binding Proteins CyIIla•CAT was introduced into eggs of a second sea urchin species, Lytechinus variegatus, temporal Christer s. L. Hoag control was maintained correctly. That is, the gene The CyIIla cytoskeletal actin gene of Strongylo was activated in the late cleavage stage of Lytechinus centrotus purpuratus is transcriptionally activated at development. Spatial regulation was lost, however, the early blastula stage of embryonic development and and the gene was expressed in all tissue types. We is expressed exclusively in the cell lineages that give have exploited this difference in utilizing reciprocal rise to the aboral ectoderm of the advanced embryo hybrid embryos of the two species, S. purpuratus and and larva. Previous in vivo experiments have identified L. variegatus, to observe the distribution of CyIIla a 2.5 kb regulatory region upstream of the CyIIIa cap actin mRNA transcribed from the S. purpuratus site that is sufficient for correct developmental expression. In this regulatory region there exist at genome. Our probe for in situ hybridization of hybrid embryo sections was a portion of the 3' untranslated least 11 individual sites where specific DNA:protein interactions occur in vitro (see Abstract No. 3). To region of the CyIIla actin gene not represented in the Lytechinus genome. We found that no matter from understand how these interactions between DNA and protein direct the expression of the CyIIIa actin gene which species the egg (containing maternal factors) was obtained, the pattern of spatial expression of in time and space, it will be necessary to isolate and analyze all transcription factors of importance. To CyIIla actin resembled that of Strongylocentrotus. Cyllla transcripts were found only in the aboral ecto achieve this goal, a recently developed in situ plaque screening technique using nitrocellulose filters has derm. lt was concluded that spatial control of CyIIla actin is dependent on zygotic rather than maternal been applied (Singh et al., 1988; Vinson et al., 1988). Using this technique, !.-ZAP and l.gtll expression factors. In addition, we postulate that the spatial libraries, made from poly(A)+ RNAs that were isolated control factor acts by repressing gene activation in from embryos during different stages of embryo non-expressing tissues. genesis, will be screened. A cDNA clone has been isolated from one library that expresses a fusion 9. Comparison of Nuclear Extract Binding in Two Sea Urchin Species protein that binds strongly to DNA, although in a non specific way. Roger Anderson After injection of the CyIIIa•CAT construct into References: Singh, H., LeBowitz, J. H., Baldwin, A. S. Jr. and eggs of the sea urchin Lytechinus variegatus, correct Sharp, P.A. (19&8) Cell 52, 415-423. temporal expression is observed but the spatial Vinson, R. C., LaMarco, K. L., Johnson, P. F., Landschultz, W. H. and McKnight, S. L. ( 1988) expression, which in Strongylocentrotus purpuratus is Submitted for publication. restricted to the aboral ectoderm, is not restricted to any particular tissue or cell type (see Biology 1987, 8. Regulation of Cyllla Actin in Hybrid Abstract No. 13). This result demonstrates that these Sea Urchin Embryos two types of regulation are independent. To determine Barbara R. Hough-Evans what the differences in binding to this region are, The Cyllla cytoskeletal actin gene of the sea urchin which are responsible for the differences in regulation Strongylocentrotus purpuratus is activated in late between Lytechinus and Strongylocentrotus, I am 23
performing quantitative gel retardation experiments 11. Interactions of DNA-Binding Proteins with a on the various cloned fragments that have been shown Sea Urchin Skeletal Matrix Gene to bind factors in S. purpuratus (see Abstract No. 2). I Henry M. Sucov, Kellie L. Whittaker, Frank J. Calzone will then be able to compare the differences in binding The micromeres of the sea urchin embryo are sites used and in the specificity and dissociation formed as a quartet of particularly small cells at the constants. vegetal pole of the embryo at fourth cleavage, and
ultimately give rise to a protein-CaC03 skeletal 1O. Interspecies Comparison of Actin CyIlla Regulatory Region structure known as a spicule. As primary cultures of micromeres isolated at fourth cleavage proceed to Steven R. Fain, Joseph Minor Jr. differentiate in vitro on schedule, forming spicules Previous work (see Biology 1987, Abstract No. 14) often indistinguishable from their in vivo counterparts, showed that 6 out of 6 independently-isolated actin it is believed the micromeres are endowed at the time cDNA clones from the sea urchin Lytechinus of their formation with the determinants necessary variegatus (Lv) hatching blastula (16 hr) cross reacted and unique for their ontogeny. This mechanism of cell with the 3' untranslated region probe of the Cy! actin lineage specification is known as cytoplasmic localiza gene from Strongylocentrotus purpuratus (Sp). Two of tion and is seen in the determination of early lineages these clones have been subcloned and restriction in a wide variety of animal embryos. mapped. The two clones differ ,in overall length (1.83 We have isolated and characterized a gene that kb and 1.7 kb) but they display the same distribution of encodes a 50 kDa protein found as a major component restriction sites and both include -300 bp of sequence of the spicule matrix. This gene, called SM50, is that cross reacts with the Cy! 3' untranslated region expressed only in the descendants of the micromeres, probe from Sp. We are presently sequencing the 1.83 the primary mesenchyme, which are destined to kb clone. produce the spicule. The SM50 promoter has been In hopes of obtaining a clone of the gene in Lv that experimentally defined by gene transfer as a 560 bp is homologous to the CyIIIa gene of Sp, an oligo(dT) restriction fragment (corresponding to -440 to +120 primed cDNA library has been prepared from Lv relative to the SM50 transcription initiation site) gastrula (21 hr) poly(A)+ RNA. This library is being which functions in vivo to direct proper spatial and characterized. In addition, we are preparing an quantitative expression in sea urchin embryos. We have oligo(dT)-primed cDNA library from Lv blastula (8 hr) begun an analysis of the nuclear proteins that bind to poly(A)+ RNA. These libraries will be screened with the SM50 promoter, using a gel retardation assay, and the Cy! 3' untranslated probe and a Cy! exon probe to have so far identified and mapped five protein-binding identify actin clones that are hot from Cyl transcripts sites in the SM50 promoter. Two of these have been and thus, may be from CyIIIa transcripts. seen in promoters of other genes. One is the We have synthesized an oligonucleotide probe (33 positively-acting CCAA T sequence which is found in nucleotides) that encodes the unique 11 amino acid genes in a variety of animals, including the sea urchin region (11256-266) of CyIIla cytoplasmic actin in Sp aboral ectoderm-specific gene CyIIIa, and the other is (Akhurst et al., 1987). This sequence has not been ob a putative negative regulatory element (known as P3A) served in any other cytoplasmic actin so far examined, also identified in the CyIIIa gene. The other three and it may result from a functional constraint on binding sites have no apparent homology to elements CyIIIa actin in Sp that is shared by Lv. We are of other genes tested, but two bind the same protein presently performing stringency tests on genome blots factor. Preliminary mutational analysis indicates that of Sp and Lv DNAs. We plan to screen an Lv genomic the duplicated upstream elements bind a required library with this oligonucleotide probe as another positively-acting transcription factor. All of the means of obtaining the CyIIIa homologous gene in Lv. proteins, with one exception, show a similar temporal Reference: appearance profile: undetectable in the egg when the Akhurst, R. J., Calzone, F. J., Lee, J. J., Britten, R. J. SM50 gene is off, and present at 7 hr and throughout and Davidson, E. H. (1987) J. Mal. Biol. 194, 193- 203. embryogenesis when the gene is on. The factor that 24 binds to the duplicated elements seems to be present activated coelomocytes and resting coelomocytes, and at low prevalence in the egg and continues to be clone 15 was not expressed in the blastula stage present throughout the rest of development. All embryo. (A subpopulation of coelomocytes, the red factors are present in ectoderm extracts as well as spherulous cells, is known to be present in the gonads extracts made from mesenchyme/endoderm ''bags." of the purple sea urchin, and may be an explanation for Therefore, modification of these DNA-binding pro clone 15 expression in ovary.) Clone 17 was present in teins, rather than their absolute presence or absence, equal amounts in activated and resting coelomocytes may be the important parameter in the tissue-specific and was absent from ovary and blastula. Twice as transcriptional regulation of the SM50 gene. In terms many transcripts of clone 6 were present in activated of cytoplasmic localization, perhaps only the active coelomocytes as in resting coelomocytes, while levels forms of these factors (or alternatively, the enzymatic in ovary and blastula were very low. This suggests a machinery required for their modification) are possible immune relevant p.ctivation of clone 6. segregated into the micromeres. Sequencing data show no open reading frame for clone 6, but only I kb has been cloned. In addition, the 12. Molecular Cloning of Coelomocyte Genes from basis for the hybridization between mouse Thy 1 and the Purple Sea Urchin the sea urchin cDNAs was due to poly G/C stretches in L. Courtney Smith all clones. Several approaches have been employed by various Future investigations will include the cloning and investigators to study the evolution of the mammalian sequencing of the remainder of clone 6 plus in situ immune system. One approach has been to investigate analysis to determine if different cell types express the animals that fall along the phylogenetic branch different clones. that leads to mammals. Among many other animal groups, this includes one invertebrate deuterostome 13. A Characterization of the Coelomocytes of the Purple Sea Urchin phylum, the echinoderms. 1 Star fish and sea urchins have been shown to John E. Bowers , L. Courtney Smith possess an effective cellular immune system. This has The circulating coelomic cells (coelomocytes) have been demonstrated by studies on coelomic clearance of been implicated as mediators of the echinoderm injected substances, allogeneic tissue graft rejection immune system. These cells appear to be involved in and cytotoxic responses of mixed allogeneic coelomo the clearance of injected bacteria and macromolecules cytes in vitro. These studies have implicated the from the coelom, and in rejecting tissue allografts. circulating coelomic cells (coelomocytes) as mediators The primary goal of this research effort will be to of the echinoderm immune responses. characterize the coelomocytes and to determine their To identify genes involved in sea urchin immunity, proliferative source in the urchin. several sea urchins were immunologically sensitized by The purple sea urchin has four morphologically repeated injection of coelomic cells and fluid from a different types of coelomocytes: phagocytes, . red sister sea urchin species. The activated coelomocytes spherulous cells, colorless spherulous cells, and were collected, the poly(A)+ RNA was isolated and a vibratile cells. When the sea urchin coelomic fluid, cDNA library was constructed. Twelve clones were which contains the coelomocytes, is removed from the isolated from the library by cross hybridization to a animal and is replaced with artificial urchin medium, mouse Thy I cDNA clone. near normal concentrations of coelomocytes return by Genomic blots showed five of the clones to be 24 hours. Culturing various organs and body wall frag single copy genes, while one contained a repeat. On ments have suggested that the source of coelomocyte RNA blots, clone 17 hybridized to six transcripts of 7 production may be the lining of the coelom that lies kb and larger. Clone 15 revealed bands of 2.0 and 2.2 along the test wall. kb, while clone 6 hybridized to a single 4 kb transcript. Preliminary trials of culturing coelomocytes have Probe protection assays showed clone 15 to be most suggested that ihe functional analysis of cells in vitro prevalent in ovary with decreasing amounts in will be feasible. Observations on the reactions of 25 coelomocytes to bacteria and allogeneic cells will use vector were used to measure the prevalence of bindin our newly developed culture conditions. Coelomocytes mRNA in the mature testis. Testis RNA contains 107 can be separated into their morphological types by bindin transcripts per microgram of total RNA. density centrifugation which will be employed in the The onset of bindin mRNA transcription in the functional characterization of each cell type. In developing testes of juvenile sea urchins is being addition, certain plant lectins (wheat germ agglutinin examined. Testis tissue samples have been collected and Ulex europaeus agglutinin I) bind to subpopulations from juvenile sea urchins that underwent meta of the coelomocytes. These can be used with morphosis in culture and were reared under controlled fluorescence-activated cell sorting to define and light conditions designed to foster the onset of an_alyze these subpopulations in vitro. gametogenesis. These samples were analyzed histo
1 logically for the presence of sperm and intermediate Undergraduate, California Institute of Technology. stages of spermatogenesis. Total RNA extracted from gonads at known stages of spermatogenesis are being 14. Drosophila "Homeobox" Sequences in Sea Urchin DNA analyzed to determine the stage at which bindin expression begins. Robert L. Sinsheimer, Christer s. L. Hoag The embryological development of Drosophila along 16. Conservation(?) of Sequences Expressed the anterior-posterior and dorsal-ventral axes is in Egg RNA controlled by sets of morphogenetic genes. Many of Roy J. Britten, Will F. Baron these genes share a tract of DNA of approximately 180 Previous observations have shown that a few base pairs, the ''homeobox," which is present in slightly percent of the single copy DNA of Lytechinus pictus varying sequence in each gene. forms precise duplexes with the DNA of Strongylo DNA tracts with evident homology to the homeo centrotus purpuratus even though 80% of the DNA box regions of one or more of the Drosophila genes fails to hybridize at all and the species' last common have been found in a wide variety of animal species, ancestor existed 80 to l 00 million years ago. The including the sea urchin which has a very different, purpose of this work is to search for very similar DNA non-segmental, developmental pattern. It would be of sequences at great evolutionary distance among the embryological and ~volutionary interest to understand the function of these genes in an echinoderm. expressed sequences in egg RNA. Labeled cDNA was prepared from the egg RNA of S. purpuratus, the For this purpose, plasmids have been obtained con highly conserved ribosomal RNA sequences removed by taining, separately, six of the Drosophila homeobox hybridization to total RNA from starfish tubefeet, and containing genes: ant, ubx, abd-2, eve, caud, and the duplexes removed on hydroxyapatite, also re zen. Large-scale preparations of each plasmid have moving any sequences- that could form duplexes in the been made. The homeobox regions of each gene will be excised and used to screen genomic and cDNA libraries cDNA, as might be expected if the two complements of repeats were present in different transcripts. of Strongylocentrotus purpuratus to identify genes This purified S. purpuratus egg RNA cDNA tracer with homologous DNA regions. was then hybridized to RNA Cot 1000 with an excess of egg RNA from a L. pictus and the duplexes 15. Bindin Gene Expression and Testis Maturation thermally eluted from hydroxyapatite. A starfish RNA R. Andrew Cameron, Joseph Minor Jr. control showed few duplexes. The L. pictus hybridized Bindin, a single copy gene expressed in the sea one-fourth as much as the S. purpuratus control with urchin testis, is being used as a marker for testis an average of only 7% divergence. Thus, there are a differentiation. To do this, a subclone was constructed large number of prevalent RNA sequences with little by cloning the middle 436 bp Sall-Sall fragment of a divergence. In comparison, the coding regions of H4 bindin DNA clone from Strongylocentrotus purpuratus histone genes at this distance (fully conserved amino testis cDNA into the RNA transcription vector acid sequence) show 12.596 divergence due to silent pBluescript KS Ml3+. RNA transcripts from this substitutions. In order to examine this unexplained 26 sequence similarity, the cDNA in the precise hybrids is always give rise to either the left or the right lateral in the process of being cloned. quadrant. If specification occurred later, then the aboral quadrant would be associated equally with right 17. Sea Urchin Cell Lineage Analysis Beyond or left lateral quadrants. We are injecting lineage the Eight-Cell Stage tracers into one of the two cell blastomeres and R. Andrew Cameron, Scott E. Fraser 1 analyzing the pattern of labeling at the pluteus stage. Our previous sea urchin embryo cell lineage Lucifer yellow CH yields a punctate distribution of dye analysis beginning at the eight-cell stage reveals a in the cells of the pluteus which is difficult to inter consistent pattern in which each of the cells pret clearly. Dextran conjugated with rhodamine and contributes a unique portion of the ectoderm at the lysine yields interpretable patterns which are being pluteus stage. Furthermore, the position of the used to establish the relationship between quadrants. individual clones of cells demonstrates that the larval 1 Department of Physiology and Biophysics, University axis of symmetry lies equidistant from the first and of California, Irvine. second cleavage planes. Several features of the specification of larval symmetry and cellular fates 18. The Production of Transgenic Sea Urchin Embryos remain unexplained. When is the larval axis of symmetry specified? At which division do the progeny Donna L. Livant, Barbara R. Hough-Evans of each blastomere contribute exclusively to a single The generation of transgenic sea urchin embryos tissue type? has always been accomplished by the injection of At the eight-cell stage, the lateral animal half linear DNA molecules into the cytoplasm of sea urchin blastomeres (NL) contribute to both the aboral eggs. After fertilization, the injected DNA is quickly ectoderm of the pluteus and the oral ectoderm, which ligated into a few large concatenates. In most includes the ciliated band demarcating the boundary embryos, the concatenated DNA is incorporated into between these two areas of ectoderm. The exact one or a few blastomere nuclei after the third or division following the eight-cell stage at which the fourth cleavage. Following its incorporation, the progeny of the NL blastomeres contribute exclusively exogenous DNA replicates at the same rate as the to one or the other ectoderm is not known. When we DNA of the recipient blastomere with little subsequent iontophoretically injected a fluorescent lineage tracer loss, and is retained in the cells that descend from that into animal half blastomeres at the 16-cell stage, the blastomere. At 24 hr, the resulting blastulae contain boundary along which the progeny of the NL daughter the exogenous DNA distributed randomly with respect cells bisected the NL region was parallel to the to cell type in an average of 6% of their nuclei. No anterior-posterior axis of the pluteus and each portion blastula has been found containing exogenous DNA in includes both ciliated band and aboral ectoderm. Thus, more than 25% of its nuclei. Twenty percent of the the division between oral and aboral ectoderm does not resulting blastulae contain none of the injected DNA. occur at the 16-cell stage. At the 32-cell stage, the These highly mosaic embryos have been used animal half blastomeres have divided horizontally. successfully to explore the temporal and spatial Injections of dye into these blastomeres produced regulation of genes transcribed specifically in early tracts of cells restricted to either the ciliated band or embryonic cell lineages containing many cells. Their the aboral ectoderm. Thus, the NL cell lineages branch utility in the elucidation of the regulatory mechanisms into exclusive clones of oral and aboral ectoderm at governing late embryonic or larval cell lineage the 32-cell stage. specific genes is very limited because the genes are If the larval axis of symmetry is specified earlier in often expressed in very few cells. development than the eight-cell stage, consistent Recently, we have generated transgenic embryos relationships between adjacent early blastomeres containing exogenous DNA in all or nearly all cells at would be expected. For example, if the axis is 24 hr blastula stage in approximately 25% of the specified in the zygote, then the two-cell blastomere embryo population. The exogenous DNA is absent which gives rise to the aboral quadrant of cells would from the remaining embryos. We inject linear DNA 27 molecules into the cytoplasm of fertilized sea urchin amino acids of this protein are 99% identical between eggs multiple times separated by intervals of 5-10 the species, while the ends cannot be easily aligned minutes. We believe that this injection method due to extensive rearrangement of sequences introduces into the fertilized egg many more large containing the repeated motif QGMGG. concatenates capable of nuclear incorporation. The In order to determine which of these changes might incorporation event thus occurs much earlier, usually be responsible for the change in species specificity, prior to first cleavage. Approximately 50% of the peptides (18-28 amino acids long) covering differences fertilized eggs injected by this protocol develop into between the bindins were made in the Division's Micro normal 72 hr plutei. The majority of these plutei chemical Facility, These peptides will be assayed for survive until metamorphosis, and some larvae undergo their species-specific activity in several ways. metamorphosis. The generation of larvae containing Currently, the peptides have been labeled with 1251 exogenous DNA in all or nearly all nuclei should make and are being assayed for adhesion to eggs. several areas feasible for investigation. Among these In addition, several features of the S. franciscanus are the regulation of genes specific to lineages bindin flanking sequences are being studied. There is a containing few cells, the generation of "mutant" sequence in the 5' untranslated region that is comple embryo phenotypes by the addition into all embryo mentary in 29 of 30 nucleotides to a sequence in the nuclei of large numbers of cell lineage-specific gene coding region, thus presenting the possibility of trans regulatory regi~ns, and the generation of transgenic lational control through base pairing. Also inserted in adult sea urchins. the 3' untranslated region of the S. franciscanus bindin message is an element consisting of two inverted 19. Bindin Gene Evolution repeated sequences surrounding a unique sequence. Joseph Minor Jr., David R. Fromson This element appears to be a new transposable element Bindin is a sperm acrosomal protein responsible for that is present in the genomes of S. purpuratus and S. the species-specific adhesion of sperm to egg in sea franciscanus but is absent from the genome of L. urchins. In the case of the closely related sympathic variegatus. species Strongylocentrotus pu.rpuratus and S. francis canus, the interaction of bindin with its receptor 20. DNA Sequence Deletions and Systematics appears to be responsible for maintaining the species Roy J. Britten isolating barrier. ln this study, the bindin genes of S. If a genetic character present in a lineage changes purpuratus, S. franciscus and a more distantly related irreversibly and the changed form can be shown to be sea urchin Lytechinus variegatus are being compared. present in certain lineages and absent from others, it The complete protein coding sequence and some 5' is a "shared derived character" of good quality. Clear and 3' flanking sequences of S. franciscanus bindin conclusions about trees of relationship can be drawn if have been obtained from a 2.3 kb cDNA clone. The the distribution of a number of such characters protein sequence has been compared to the previously supports one pattern while none fit alternative obtained S. purpuratus sequence. Conserved in the S. patterns. However, morphological or behavioral shared franciscanus bindin is the overall structure of the derived characters of such quality are rare for closely protein-it is a 485 amino acid long protein that is related species. DNA sequence deletions appear to be cleaved in the middle. The C-terminal 238 amino acids shared derived characters of excellent quality and are are the acrosomal protein responsible for sperm common. If a strictly single copy DNA sequence of adhesion. The function of the N-terminal 247 amino moderate length and little genetic significance is acids remains unknown, and it may serve only for deleted from an individual genome, the DNA region packaging the mature protein (which is insoluble). Its containing the deletion may, by stochastic drift, level of amino acid conservation (75% AA identity) is replace the original throughout the species and the the same as the average protein sequence divergence. sequence information may be irreversibly lost. The divergence of the C-terminal 238 amino acids Unequal crossover involving interspersed repeated differs markedly from the average: the middle 7 5 sequences often leads to deletions (particularly in 28 primates owing to the great prevalence of the Alu fashion is under analysis by restriction mapping and interspersed repeat). It is possible to set limits on the further hybridization using shorter purified fragments rate of introduction of deletions in the DNA of the to determine the nature of specific insert differences. primary lineages from interspecies hybridization In addition, we are conducting deleted fraction measurements and from the presence in human popula experiments to test for and isolate sequence absent tions of genetic defects arising from deletions (e.g., from either D. simulans or D. melanogaster. Although muscular dystrophy, thalassemia, and familial hyper our primary interest is to determine if this cholesterolemia). The estimated rate of incorporation phenomenon contributes in any way to the observed of deletions into the genome based on familial defects reductions in percent hybridization, we plan to assess is much less than that based on DNA hybridization the importance of deletion for identifying cladistic measurements, as a result of selection or uncertainty markers for phylogenetic and systematic purposes. in the significance of the hybridization data. Even with the lower estimate, there are sufficient deletions 22. The Sources and Evolution of Alu Repeats for systematic studies of very closely related species Roy J. Britten, David B. Stout, Will F. Baron such as chimp, human, and gorilla. At this lower rate, Nearly a million copies of the Alu repeated hundreds of thousands of nucleotides would have been sequence are interspersed throughout human DNA with deleted from the DNA of our last common ancestor an average spacing of about 4 kb, having been inserted shared with one of the other apes if it existed only a by retroposition throughout primate evolution. They million years. In several laboratories, DNA sequences derive from a series of at least four "source genes" have already been isolated by hybridization failure and that have replaced each other in overlapping periods cloned as a result of deletions suffered in specific cell over the last 70 million years. The resulting four lineages. Thus, it appears that systematics by virtue classes of Alu sequences can be identified by 25 of DNA deletion is practical, although it has not yet diagnostic positions, and each class differs from the been tried. successive class by a set of coordinated mutations. This conclusion was reached by comparisons (done 21. Range of Rates of Evolution in Drosophila DNA here, and by J. Jurka and T. Smith at Dana-Farber) of Steven D. Werman, Roy J. Britten the hundreds of Alu repeats that have been sequenced. Large contrasts in the rates of evolution are The source genes preserve much of the sequence of present between different regions of the genome of a the 7SL RNA gene that was the very early precursor of given insect species. For example, interspecies the Alu repeat. Of the 25 diagnostic changes, 23 are hybridization measurements between Drosophila mutations of the original 7SL sequence. About 25 CpG sibling species show only 70% hybridization, and the dinucleotides are conserved in the source genes, but as DNA that does hybridize has about 2% sequence soon as an Alu sequence is inserted, it begins to be divergenc~. It is not known how much of the failure to mutated, the CpGs at about 10 times the rate of the hybridize is due to deletion of DNA regions and how other nucleotides. The remainder of the positions (not much is due to a very high rate of base substitution. CpG or diagnostic) shows a neutral drift rate We have focused on isolation and characterizing non (0.15%/MY) equal to that for total single copy DNA. hybridizing fractions in an attempt to understand the Recently, an Alu sequence was inserted into the mechanism underlying the differences. gorilla genome that is absent from the human genome Using a lambda EMBL3-me1anogaster library, we and is a good example of the product of the modern have purified randomly chosen melanogaster inserts source gene. A cloned DNA probe for it was given us that were labeled as probes (32P) and hybridized in by G. Trabuchet of Universite Claude Bernard, Lyon, solution with D. simulans and D. melanogaster driver France, and studies of its hybridization to human DNA DNAs. Inserts with melting curve characteristics that show that as many as 25% of the Alu repeats are showed significant hybridization depressions (?_75%) nearly identical to it in sequence. This implies that with expected delta TMs (circa 2°C) were examined gene regions do not contain a fully representative further. One of the cloned inserts screened in this sample of recently inserted Alu sequences. 29
The Alu repeats may be thought of as a million PUBLICATIONS pseudogenes, and they occur frequently in intrans and Britten, R. J., Baron, W. F ., Stout, D. B. and Davidson, 3' untranslated exons. Because of unequal crossover, E. H. ( 1988) Sources and evolution of human Alu they are responsible for many deletions and duplica repeated sequences. Proc. Natl. A cad. Sci. USA 85, 4770-4774. tions, some of which lead to genetic defects. The net Calzone, F. J., Britten, R. J. and Davidson, E. H. (1987) Mapping of gene transcripts by nuclease evolutionary effects of the source genes are complex. protection assays and cDNA primer extension. In: Guide to Molecular Cloning, Berger, S. L. and 23. Patterns of mRNA Prevalence and Expression of Kimmel, A. R. (Eds.), Meth. Enzymol. 152, 611-632. Alu-Like Repeats in Early Mouse Embryos Calzone, F. J., Lee, J. J., Le, N., Britten, R. J. and Davidson, E. H. ( 1988) A long-nontranslatable Lajos Pik6, Kent D. Taylor1 poly(A) RNA stored in the egg of the sea urchin Strongylocentrotus purpuratus. Genes & Dev. 2, Previously, we and others have shown that the two 305-318. cell stage is a critical period of mouse embryo Calzone, F. J., Theze, N., Thiebaud, P., Hill, R. L., development when a transition from maternal to Britten, R. J. and Davidson, E. H. (1988) Develop mental appearance of factors that bind specifically zygotic genomic control takes place. In the two-cell to cis-regulatory sequences of a gene expressed in the sea urchin embryo. Genes and Dev., submitted embryo, the bulk of the maternally inherited mRNA is for publication. degraded and is replaced by newly synthesized mRNA Davidson, E. H. (1988) What molecular biology tells us about the genomic program for development. In: derived from the embryonic genome. In order to Echinoderm Phylogeny and Evolutionary Biology, explore the changes in the structure of the mRNA Paul, C. R. C and Smith, A. B. (Eds.), John Wiley and Sons, Sussex, in press. population as a result of this transition, we isolated a Davidson, E. H. (1987) Understanding embryonic random cDNA-plasmid library of 69 clones from late development: A contemporary view. Am. Zool. 27, 581-591. two-cell embryos. We analyzed the developmental Flytzanis, C. N., Hough-Evans, B. R., Britten, R. J. changes in the prevalence of the cloned sequences by and Davidson, E. H. (1988) Gene transfer by micro injection into the sea urchin egg. In: Develop dot hybridization of the cDNA clones with labeled mental Genetics of Animals and Plants, Malacinski, cDNA probes synthesized to poly(A)' RNA from G. M. (Ed.), MacMillan Publishing Co., New York, in press. different stages of development from one-cell through Franks, R. R., Hough-Evans, B. R., Britten, R. J. and blastocyst. The number of copies of individual tran Davidson, E. H. (1988) Direct introduction of cloned DNA into the sea urchin zygote nucleus, and scripts was quantitatively estimated by comparison to fate of injected DNA. Development 102, 287-299. standard clones of known prevalence. About two-thirds Franks, R. R., Hough-Evans, B. R., Britten, R. J. and Davidson, E. H. ( 1987) Spatially deranged though of the cDNA clones, representing from rare to highly temporally correct expression of a Strongylo abundant sequences, gave a positive reaction in these centrotus purpuratus actin gene fusion in trans genic embryos of a different ·sea urchin family. tests at the two-cell and later stages. However, about Genes and Development, 2, 1-12. half of the positive clones failed to react with cDNA Hough-Evans, B. R., Britten, R. J. and Davidson, E. H. (1988) Mosaic incorporation and regulated expres probes from the egg, suggesting that a large set of sion of an exogenous gene in the sea urchin embryo. zygote-specific genes not included in the maternal Dev. Biol. 129, 198-208. Hough-Evans, B. R., Britten, R. J. and Davidson, E. H. gene set becomes transcriptionally active in the two (1988) Regulation of a sea urchin cytoplasmic actin cell embryo. Six of the cDNA clohes represented Bl gene in embryos of interspecies hybrids. Submitted for publication. and B2 repeat sequences (mouse Alu-like repeats). As Katula, K. S., Hough-Evans, B. R., Britten, R. J. and measured by hybridization with labeled cDNA, Bl and Davidson, E. H. (1987) Ontogenic expression of a Cyl actin gene fusion injected into sea urchin eggs. B2 transcripts were abundantly expressed throughout Development 101, 437-447. cleavage, being represented by about l o5 to 106 copies Livant, D., Cutting, A., Britten, R. J. and Davidson, E. H. (1988) An in vivo titration of regulatory factors per embryo. However, the developmental pattern of required for expression of a fusion gene in trans prevalence was different for the two transcripts, genic sea urchin embryos. Proc. Natl. Acad. Sci. USA, in press. suggesting that their expression is regulated indepen Minor, J. E., Lee, J. J., Akhurst, R. J., Leady, P. S., dently. The Bl and B2 transcripts in the early embryo Britten, R. J. and Davidson, E. H. (1987) Sea urchin actin gene linkages determined by genetic consist mostly of small RNAs transcribed by RNA segregation. Dev. Biol. 122, 291-295. polymerase III; their function is as yet unknown. Piko, L. and Taylor, K. D. (1987) Amounts of 1 mitochondrial DNA and abundance of some mito Veterans Administration Medical Center, Sepulveda, chondrial gene transcripts in early mouse embryos. CA. Dev. Biol. 123, 364-374. 30
Rose, S. J. III, Rosenberg, M. J., Britten, R. J. and Support: The work described in the following research Davidson, E. H. (1987) Expression of myosin heavy reports has been supported by: chain gene in the sea urchin: Coregulation with American Foundation for AIDS Research muscle actin transcription in early development. American Cancer Society Dev. Biol. 123, 115-124. Arthritis Foundation Sucov, H. M., Hough-Evans, B. R., Franks, R. R., The Donald E. and Delia B. Baxter Foundation 0 Britten, R. J. and Davidson, E. H. (i 988) A Biomedical Research Support Grant (NIH) regulatory domain sufficient to direct lineage Ethel Wilson Bowles and Robert Bowles specific expression of a skeletal matrix protein Professorship in Biology gene in the sea urchin embryo. Genes & Dev., in Cancer Research Institute, Inc. press. Johnson & Johnson Leukemia Society of America Lucille P. Markey Charitable Trust Monsanto Co. Francis L. Moseley Fund for Cancer Research National Cancer Institute National Institutes of Health, USPHS National Science Foundation Professor: Leroy E. Hood Department of the Navy, Office of Senior Research Associates: Stephen B. H. Kent, Naval Research lwona Stroynowski Netherlands Organization for the Advancement of Visiting Associates: Wang Qin Chen, Laura L. Hoopes, Pure Research (N. W.0.) Nancy C. Lan, Walter E. Laug, Robin Lowry, Pandex Laboratories, Inc. Paolo Mascagni, Minnie McMillan, Deborah A. The Procter & Gamble Co. Nickerson, Richard E. H. Wettenhall Royal Dutch Academy of Sciences (K.N.A. W.) Senior Research Fellows: Ruedi Aebersold, Hilde The Seaver Institute Cheroutre, Joan M. Goverman, Stephen W. Hunt Sundry Donors for Cancer Research lll, Robert J. Kaiser Jr., Joan A. Kobori, Dwight Swedish National Science Research Council H. Kono, Eric H. C. Lai, Carmie Puckett, Lloyd Swiss National Foundation M. Smith The Upjohn Company Research Fellows: Bernhard Arden, Steven S. Beall, The Weingart Foundation Leigh E. Clawson, Patrick J. Concannon, Christopher Gomez, Elly Holthuizen, Bradford A. Jameson, Vipin Kumar, Chia-lam Kuo, Ulf Landegren, Eleni Levedakou, Donald Mann, Heinz Nika, Sally L. Orr, Brian J. Popko, Raul A. Summary: Our group has a wide variety of interests Saavedra, Dorothea L. Schiller, Jens Schneider, including molecular immunology, molecular neuro Nusrettin Ulker, James L. Urban, Ravi S. Vinayak, Kai Wang, Dorothee Wernicke-Jameson, Richard biology, protein structure-function relationships and K. Wilson, Dennis Zaller biotechnology. Graduate Students: Kurt A. Brorson, Lance Fors, We are working on two systems related to William K. Funkhouser Jr., Tim Hunkapiller, Bette Korber', Joseph T. Meier, Bernard Vernooy molecular immunology-T-cell receptors (TcR) and. Members of the Professional Staff: Suzanna J. class I molecules of the major histocompatibility Horvath, Carol Readhead, Jane z. Sanders, David B. Teplow complex (MHC). In both cases we are interested in the Research and Laboratory Staff: Anita Ackermann, Christine A. Acklin, Petros Arakelian, George structure, organization, regulation, evolution and Baklayan, Tamara K. Bauer, H. Joseph Berejikyan, function of these genes and their proteins (Wilson et Kathleen N. Blackburn, Steven M. Clark, Joseph al., 1988). We also have an interest in autoimmune Curtis, Jessica A. Dausman, Noel A. Davi, Cheryl A. Davis, Maria A. DeBruyn, Vicky L. DeLoff, diseases (Urban et al., 1988). Peter C. W. Gaines, Teresa Geffroy, Elaine F. Gese, Eef Goedemans, Wade M. Hines, Dennis In molecular neurobiology, we have studied the Jackson, Jill W. Jenik, Bertha E. Jones, Irene R. molecular biology of myelin basic protein and po• two Kazy, Chin Sook Kim, Lisa N. Larson, Keith D. Lewis, Randolph B. Lipscher, Sara L. MacKellar, components of the myelin sheath (Readhead et al., Jorge Mata, Barbara J. Otto, Karen F. Parker, 1987). In addition, we are isolating genes that Susan K. Perry, Gary D. Pipes, John Raes, Emma Saffman, Kathleen D. Segesman, Linda Martin associated with neurite and growth cone formation. Selk, Meichun Shen, Elizabeth K. Smith, Charles We are using the techniques of chemical protein F. Spence, Erich C. Strauss, Caryn D. Tong, Jessie Walker, Mildred A. Weaver, Tod M. Woolf, Haul synthesis to study structure-function relationships in Wong, Annette S. Yuen small proteins and protein subdomains (Parraga et al., 1988). 1 Division of Chemistry and Chemical Engineering, California Institute of Technology. Finally, we are developing new techniques and instrumentation for two-dimensional gel electro phoresis, protein microsequencing, rapid DNA 31 sequencing and mapping and the computer analysis of segment. All 33 TH cells expressed the same J a39 protein and DNA data (Hood, 1988). We also are gene segment. Almost all TH cells expressed the same developing procedures for DNA diagnostics (Landegren VB gene consisting of V 8.2, D 2.l, and J 2.6 gene 6 6 6 et al., 1988). segments (26 out of 33 TH cells; 7996). The seven Our group also directs the applied microchemical remaining TH cells all expressed a second VB gene facilities for the synthesis of DNA and proteins and consisting of Yal3, D6!.l, and J 62.2 gene segments. the sequencing of proteins. Thus, the TH cell response to MBP capable of causing References: an autoimmune encephalomyelitis in Bl O.PL mice is Hood, L. (1988) JAMA 259, 1837-1844. highly restricted in its TcR gene segment usage. The Landegren, U., Kaiser, R., Sanders, J. and Hood, L. ( 1988) Science, in press. antigen-binding sites from TH cells employing all Parraga, G., Horvath, S. J., Eisen, A., Taylor, W. E., combinations of the two Va and Va genes are Hood, L., Young, E. T. and Kievit, R. E. ( 1988) Science, in press. remarkably similar in their antigen-binding profiles. Readhead, C. W., Popko, B., Takahashi, N., Shine, D., The monoclonal antibody F23. l, which recognizes the Sidman, R. and Hood, L. (1987) Cel! 48, 703-712. Urban, J. L., Kumar, V., Kono, D. H., Gomez, C., murine V13 & chain, was found to completely block Horvath, S. J., Clayton, J., Ando, D. G., Sercarz, E. recognition of the MBP peptide l-9NAc by Va8 TH E. and Hood, L. (1988) Cell 54, 577-592. Wilson, R. K., Lai, E., Concannon, P., Barth, R. K. and cells in vitro. When injected intraperitoneally into Hood, L. E. (1988) Immunol. Rev. IOI, 149-172. BIO.PL mice, the F23.l antibody resulted in a long lasting suppression of Va8+ T cells in vivo and in 24. The Restricted Use of T-Cell Receptor V Genes preliminary experiments significantly reduced the in Murine Autoimmune Encephalomyelitis Raises Possibilities for Antibody Therapy susceptibility of these mice to MBP peptide-induced EAE. These results suggest that antibodies directed James L. Urban, Vipin Kumar, Dwight H. Kono, Christoph.er Gomez, Suzanna J. Horvath against specific TcR V regions may prove useful as Experimental allergic encephalomyelitis (EAE) is both diagnostic and therapeutic reagents for human an animal model for neurological autoimmune disease, autoimmune disease. induced in susceptible animals by active immunization with myelin basic protein (MBP) or by passive transfer 25. The Molecular Specificity of Experimental of class II-restricted CD4 (L3T4+) T helper (TH) Autoimmune Thyroiditis lymphocytes reactive against certain MBP epitopes. Richard K. Wilson By immunization with MBP, we have generated TH Experimental autoimmune thyroiditis (EAT) is a T clones and hybridomas specific for an acetylated N cell-mediated autoimmune disease induced in terminal nonapeptide of MBP, l-9NAc, known to genetically susceptible animals upon immunization induce EAE in PL/J and BIO.PL (H-2u) mice. Seven T with autologous thyroglobulin (TG) or adoptive transfer cell receptor (TcR) a variable (V) genes and six B of syngeneic thyroglobulin-reactive T cells. EAT and variable (V 6) genes were sequenced and a total of 43 analogous human autoimmune thyroid diseases are MBP-specific TH hybridomas and clones were analyzed characterized by infiltration of the thyroid by mono by Northern and Southern blots to identify their nuclear cells, hyperstimulation of hormone secretion expressed Va. and V6 TcR genes. Sequence analyses and tissue destruction usually resulting in the demonstrated that six of seven Va genes were inhibition of thyroid function. We have produced and cloned several mouse T -cell lines and T -cell identical. Five of six VB genes used the same VB' D 6, and J 6 gene segments. In total, at least 33 of the 43 hybridomas that proliferate in response to bovine TG. TH cells analyzed were clonally distinct, based on 1) Additionally, some of the anti-TG T-cell hybridomas isolation from different mice, 2) use of different Va or appear to induce the histopathology characteristic of V6 gene segments, 3) a or s chain junctional nucleotide autoimmune thyroid disease upon transfer into differences, or 4) differences in nonproductive C3HeB/FeJ mice. Using these T-cell hybridomas, we rearrangements. The predominant Va2.3 gene segment have localized a disease-causing epitope to a small was expressed in 20 of these 33 TH cells (6196) and the fragment of TG, which will be partially sequenced and remaining were found to express the Va 4.2 gene fine-mapped using synthetic peptides. Furthermore, 32
T-cell receptor-encoding cDNAs have been isolated fragment length polymorphism (RFLP) alleles detected and will be sequenced and compared to determine if with Va 8, Va 11 , and c8 probes in the MS patients was predominant usage of specific T-cell receptor gene significantly different from that found in normal segments occurs in autoimmune thyroiditis. The individuals. Because 84% of the MS patients were knowledge gained from these experiments will DR2\ the findings in these patients were compared to eventually allow us to engineer cytotoxic anti-receptor a second group of 43 normals who were DR2+. The antibodies capable of specifically deleting the auto distribution of TcR haplotypes in the MS patients was reactive anti-TG T-cell subset from diseased animals. also significantly different from that in the DR2+ normals. The data suggest that an MS susceptibility 26. T Lymphocytes and Cytokines in Mouse Cardiac gene(s) may be located in the region of the TcR S Allograft Rejection chain gene complex. 1 Robin Lowry, Doreen Harcus 1 Department of Pathology, University of California, Mouse_ heart grafts have been transplanted across Los Angeles, CA. 2 Neuroimmunology Branch, National Institute of isolated H-2 disparities for studies on clonal Neurological, Communicative Disorders, and Stroke, heterogeneity of infiltrating T lymphocytes. National Institutes of Health, Bethesda, MD. Infiltrating T cells have been isolated in bulk cultures following brief in vivo, in vitro enzymatic digestion 28. Human T-Cell Receptor Gene Polymorphisms and mechanical disruption of the graft and cloned by Eleni Levedakou, Ulf Landegren limiting dilution in conditioned media. The phenotype The a and B chains of the T-cell receptor are and fine specificity of such clones have been deter enormously diverse and mediate responses to a wide mined and cDNA libraries prepared for T-cell receptor range of foreign antigens. The observed polymorphism sequence analysis. in the human T-cell receptor 8 chain locus (Concannon In addition, we are assessing patterns of cytokine et al., 1987) will permit linkage studies to determine if transcription in heterotopic heart grafts placed in this locus is involved in the development of immuno unmodified (rejecting) and "tolerant" mice. RNA logical diseases. Therefore, we have undertaken an transcripts of full-length and/or oligonucleotide probes analysis of the sequence polymorphism of a given for the cytokines 11-2, 11-3, 11-4, 11-5, GM-CSF, IFN human T-cell receptor V8 gene segment (Va 1), among G, TNF, and LT have· been generated for detection of unrelated individuals. For this analysis, the technique cytokine message in cloned T cells and graft of enzymatic amplification of the gene segment from homogenates (Northern blots, quantitative RNase total genomic DNA, followed by direct sequencing, is probe-protection analysis) as well as tissue sections (in used as described below. First, the genomic sequence situ hybridization). of the V8 I gene was determined directly from the cosmid clone, using cDNA sequence information. 1Royal Victoria Hospital, McGill University, Montreal, Canada. Based on these genomic sequence data, two amplification primers flanking the VSi gene segment 27. The Germline Repertoire of T-Cell Receptor were constructed. Amplification is performed by the a-Chain Genes in Patients with polymerase chain reaction (PCR) (Saiki al., 1988), Multiple Sclerosis et starting with small amounts (. J µg) of total genomic Steven S. Beall, Patrick J. Concannon, Patrick 1 1 DNA from unrelated individuals. Under conditions Charmley , Henry F. McFarland', Richard A. Gatti , 2 2 Dale E. Mc Farlin , William E. Biddison that ensure high specificity, an amplification of about The T-cell receptor (TcR) B chain germline gene 106 of the DNA segment is obtained. The reaction repertoire of 40 multiple sclerosis (MS) patients was involves a cyclic succession of incubation steps at compared to that of JOO normal individuals. No different temperatures: denaturation, annealing, and differences in the number of gene segments defined by extension using the thermostable DNA polymerase probes representing 14 different human V subfamilies (Taq). The amplified product (1-2 µg of an -1 kb frag 8 and the constant region genes were found. The ment) is then gel purified and sequenced without distribution of haplotypes defined by restriction cloning,-using the Taq polymerase. 33
The human V61 gene will be examined as a first variable (V) region genes expressed in adult thymo step in our study of polymorphisms in T-cell receptor cytes from C57BL/Ka mice comprised Va genes that genes. This analysis will be extended to include other could be divided into JO different subfamilies (Arden members of T-cell receptor variable gene subfamilies. et al., 1985). V gene segments specific for each
References: subfamily were subcloned and used as probes to screen Concannon, P., Gatti, R. A. and Hood, L. E. (19&7) J. the cDNA library from adult C57BL/Ka thymocytes. E:rp. Med. 165, 1130-1140. The organization of the immunoglobulin heavy chain Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. I., Higuchi, R., Horn, G. T., Mullis, K. B. and Erlich, locus in multiple isotypes Zed us to test the possibility H. A. (1988) Science 239, 487-491. that the a-chain variable region gene pool might be utilized by novel constant (C) region genes other than 29. Mapping Genomic Organization by Field Ca. Therefore, we isolated only the cDNA clones that Inversion and Two-Dimensional Gel Electrophoresis: Application to the Murine hybridized to the va probes but not to a ca probe. T-Cell Receptor y-Gene Family Meanwhile, a frequent rearrangement in the a. locus Tod M. Woolf, Eric H. c. Lai, Mitchell Kronenberg 1 was cloned and identified as the T-cell receptor a A new two-dimensional gel electrophoresis chain (Chien et al., l 987). An oligonucleotide probe technique has been developed for the mapping of specific for C0 was used to screen our seven V~, C~ multigene families. Resolution in the first dimension cDNA clones. Two out of seven clones contained the is based on the generation of large size DNA frag c-chain constant region gene combined with V gene ments by infrequently-cutting restriction enzymes and segments from the Val and Va IO subfamilies. One separation of these fragments by field inversion gel cDNA clone was a transcribed Va2 to Ja TTJ I (FIG) electrophoresis. A second restriction enzyme rearrangement and one was a Va. 4 gene segment germ digestion is then carried out with the separated DNA line transcript. A C 0-specific cDNA probe was fragments in the agarose gel. Standard gel electro subcloned and used to screen the same cDNA library. phoresis in the second dimension allows one to Four additional C0-containing cDNA clones were estimate the number of hybridizing genes contained in isolated. Sequence analysis revealed another member each large DNA fragment. We also have developed a of the Va 7 subfamily. However, none of them was novel method to increase the separation, resolution identical to the known Va gene segments. Two cDNA and hybridization signal in the second dimension by clones contained new V0 gene segments not condensing the bands from the first dimension into homologous to any of the known Va subfamilies. They spots. As an example, we have applied these belong to single- and two-member subfamilies. techniques to determine the organization of the Deletional mapping in T-cell lines and linkage murine T-cell receptor y locus. The murine y-gene studies by field-inversion gel electrophoresis are under family was found to be contained on two DNA frag way to determine whether V0 gene segments are ments encompassing 195 kilobases of DNA. The two clustered or interspersed with Va. gene segments. dimensional gel electrophoresis method is particularly cDNA libraries have been constructed from mRNA of useful in the analysis of the organization of multigenic day 16 and day 18 fetal thymocytes to investigate the families where single copy probes are not readily extent of variation between V0 gene segment usage at available, and should extend the potential usefulness of different stages of fetal development and the adult V0 field inversion gel electrophoresis in gene mapping. repertoire.
1Department of Molecular Biology and Immunology, References: University of California School of Medicine, Los Arden, B., Klotz, J. L., Siu, G. and Hood, L. E. (I 985) Angeles, CA. Nature 316, 783-787. Chien, Y., Iwashima, M., Kaplan, K. B., Elliott, J. F. and Davis, M. M. (1987) Nature 327, 677-682. 30. Diversity and Ontogeny of T --cen Receptor 6-Chain Expression
Bernhard Arden, Dennis Zaller, Kai Wang A repertoire study of the T -cell receptor a-chain 34
31. Molecular Characterization of the Cytotoxic and CD&+) specific for killing autologous tumor targets T Cells Directed Against Epstein-Barr Virus in vitro and having an ability to regress tumors in vivo Transformants as well. We have also analyzed the genomic rearrange Vipin Kumar, D. J. Moss', T. B. Sculley' ments of the T-cell receptor genes in these lines, Epstein-Barr virus (EB V) is the aetiological agent which indicates that they are oligoclonal. Preliminary of infectious mononucleosis and is associated with sequence analysis suggests a limited use of the Burkitt's lymphoma. EBY-specific T lymphocytes variable-gene repertoire of the T-cell receptor. If recognize the functionally defined lymphocyte indeed this is the case, then it would indicate that detected membrane antigen on transformed cells. The these cytotoxic T cells do recognize a specific epitope transformation-associated antigen, Epstein-Barr on the target tissue. Strategies then would be designed nuclear antigen (EBNA 2), is not expressed in Burkitt's to define the epitope in the transformed or tumor lymphoma. Cytotoxic T-cell clones have been cells. A fine mapping of the specificity of the T-cell generated against transformed lymphoblastoid cell receptor gene usage and the tumor target would be lines to address the question of whether EBY-specific carried out in an effort to understand the mechanism T-cell recognition could be mediated by EBNA 2. This of restricted killing by these cytotoxic T cells. may explain the failure of EBY-specific T-cell surveil 1 Surgery Branch, National Cancer Institute, Bethesda, lance to eliminate the tumor in Burkitt's lymphoma. MD. Both class I ~nd class II restricted T-cell clones have been derived against two types (A and B) of EBV 33. Molecular Mimicry and Experimental Autoimmune Encephalomyelitis: A Model to which differ in EBNA 2 protein (Moss et al., 1988). Study T -Cell Repertoire Selection and MHC Both CD4 and CD& clones of EBY-specific cytotoxic T Restriction cells could discriminate between cell lines infected Vipin Kumar, Suzanna J. Horvath with the two types of EBY. Studies are in progress to Experimental allergic encephalomyelitis (EAE) is a exactly fine map the T-cell epitope using overlapping T cell-mediated autoimmune disease of the central peptides and correlate to the specificity of the T-cell nervous system (CNS) induced in genetically receptor gene usage. Gene transfer experiments with susceptible animals upon immunization with myelin the T-cell receptor genes will be designed to test the basic protein (MBP). Many viruses also have been ability of the recipient cell to acquire the specific shown to produce demyelination. One of the proposed targeted killing. hypotheses is that the viral epitopes may be shared Reference: with the self, leading to immune activation and Moss, D. J., Misko, I. S., Burrows, S. R., Burman, K., damage. On the basis of sequence similarities between McCarthy, R. and Sculley, T. B. (1988) Nature 331, 719-721. MBP and the viral major proteins, a number of pep tides were synthesized. Various recombinant mouse 'Queensland Institute of Medical Research, Bramston Terrace, Brisbane, Australia. strains (e.g., BIO.PL, SJL, BALB/c, DBA/2, C57BL/6, C3H, PL/J, etc.) were immunized with these synthetic peptides. Preliminary results seem to correlate the T 32. Structural and Functional Analysis of T-Cell Receptor Genes from Tumor cell proliferative response in the mouse strains that Infiltrating Lymphocytes show demyelination upon viral infection. T-cell clones Vipin Kumar, Steven A. Rosenberg' and hybridomas will be generated against a defined The adoptive transfer of tumor-infiltrating peptide epitope (8-10 amino acids) of MBP from two lymphocytes has recently been successfully used in the different MHC backgrounds, e.g., H-2u and H-2s. A immunotherapy of various tyj:>es of tumors. Tumor fine analysis of the T-cell receptor repertoire will be specific lines were generated from human melanomas carried out to make the predictions about the struc and characterized for the surface expression of various tural recognition points among the T-cell receptor, T cell-specific markers by flow cytometric analysis. MHC and the peptide antigen in a ternary complex. In We have constructed cDNA libraries from a number of situ hybridization with specific T-cell variable region HLA-DR restricted, functional cytotoxic T cells (CD4 + genes in virus-infected demyelinating brain and spinal 35 cord sections would be performed to test molecular are H-2s /H-2k and have a deletion encompassing the
mimicry. V8 & locus. Transgenic animals will be examined to see if T cells expressing the transgenes will survive thymic 34. Analysis of the Promoter Region of a selection. These animals will then be crossed with T-Cell Receptor Va Gene MHC-congenic mouse strains (including an H-2u strain Kai Wang, Dennis Zaller and any allogeneic strain with which the I-cell line Tissue specificity of the promoter region from the reacts). Offspring from these crosses will be analyzed murine T-cell receptor Val 1 gene segment has been to determine if T cells that express the transgenic demonstrated by transfection of chloramphenicol receptors are preferentially expanded in the H-2u acetyltransferase (CAT) gene fusion constructions into background and are negatively selected in the allo various cell lines. Two approaches are being taken to reactive MHC background. study the regulation of this tissue specificity: We also are creating transgenic mice conta1n1ng 1) DNA footprinting. Nuclear extracts from various the heavy and light chain immunoglobulin genes from cell lines are being used to map the binding sites of T the F23. l hybridoma cell line. This hybridoma makes cell-specific trans-acting factors. an antibody specific for I-cell receptors that use
2) Deletional mapping. Several deletions in the variable regions from the V8 & gene family. The V8 & promoter region have been constructed. The deleted gene segment is found in approximately 20-25% of promoter regions have been fused to the CAT gene. mature T lymphocytes in most strains of mice. The Transfection studies with these deletion mutants are in influence of T-cell receptor-specific antibodies on the progress. development of the T-cell repertoire can be analyzed These studies should provide us with a better by examining the percentage of V g+ T cells in these 8 understanding of both the trans-acting nuclear transgenic mice. In addition, in the response to factor(s) and the DNA sequences that are responsible certain antigens, some V8 & gene segments are used for the tissue-specific expression of the I -cell preferentially. It will be of interest to see how the receptor gene. transgenic mice expressing the F23. l immunoglobulin genes will respond to these antigens. 35. Use of Transgenic Mice to Study the Development of the T-Cell Repertoire 36. Analysis of T-Cell Antigen Recognition and Activation Using Chimeric Receptor Genes Dennis Zaller, Vipin Kumar Mature T cells are biased towards the recognition Joan M. Goverman, Walter E. Laug of foreign antigens in association with self-major B cells bind soluble antigen through immunoglobulin histocompatibility complex (MHC) gene products. This (lg) receptors, while T cells recognize only antigen may be a result of the positive selection of T cells that presented on a cell surface in association with display receptors specific for slight variations of self polypeptides encoded in the major histocompatibility MHC gene products during thymic development. We complex (MHC). Receptors on both cell types are are attempting to test this hypothesis by creating heterodimeric structures in which both chains are transgenic mice with cloned T-cell receptor a and B composed of a variable (V) and constant (C) region. chain genes specific for a peptide derived from myelin The lg chains are designated light (L) and heavy (H) basic protein (MBP) in the context of H-2u. T-cell and the T-cell receptor chains are a and s. The V lines which include cells that express this a/a receptor domains of the T-cell receptor polypeptides have can cause experimental allergic encephalomyelitis remarkably similar tertiary structures to Ig V domains. (EAE), an autoimmune disease of the central nervous For both receptors, these domains are involved in system, when adoptively transferred into genetically recognition and binding of antigen and they are susceptible mice. The same T-cell lines are being encoded by genetic elements distinct from those that screened for reactivity against a panel of spleen cells encode the C region domains. Based on these obser bearing allo-MHC. The cloned receptor genes (V 88/ vations, we have designed a strategy to investigate Va2) will be injected into (SJL x C57BR)F2 mice which mechanisms of T-cell antigen recognition and 36
activation. We have constructed chimeric receptor create a large number of distinct immunoglobulin and genes in which the V regions of the I -cell receptor are T-cell receptor chains. replaced with those of an lg, thus generating T cells The diversity in the light chain of the chicken specific for a soluble antigen instead of cell-surface immunoglobulins is generated in a different way. antigen-associated MHC molecules. T cells expressing There is only one functional light chain V gene the chimeric receptors will be used to study receptor segment, which rearranges in all B cells to the single J protein interactions and T-cell activation require (joining) gene segment that is present. Some of the ments. We have transfected a T cell tumor line with diversity is generated due to imprecise joining at the two hybrid genes: one containing a VH gene joined to rearrangement points. Most of the diversity is created a Ca gene and the other containing a VL gene joined to by multiple gene conversion events between the re a Ca gene. lg V genes from Sl07, a B cell specific for arranged V gene and pseudogenes, which are located phosphorylcholine (PC), were used to construct the within 20 kb of the functional V gene segment. chimeric genes. Using F ACS analysis, we observed We want to find out how diversity is generated in significant expression of the hybrid VH-Ca chain on the chicken I -cell receptor. The first step is to the cell surface and two-dimensional gel analysis isolate the chicken I-cell receptor. We constructed a indicates expression of the VL -Ca chain on the cell cDNA library and isolated clones that hybridized with surface. Transfected T cells were tested for their mammalian T-cell receptor a and B probes. These ability to synthesize ll-2 when stimulated with clones did not hybridize with bands that were re Sepharose beads and PC attached to Sepharose beads. arranged in genomic DNA of a chicken thymus. We The transfected cells produced significant levels of sequenced these clones and found no clones that ll-2 when stimulated with the beads alone and resembled mammalian T-cell receptor chains. increased amounts when stimulated with PC-modified Currently, we are pursuing two ways for isolating Sepharose beads. These results are consistent with the the I-cell receptor. First, by using antibodies to the observation that Sl07 antibodies have an affinity for chicken CD3 molecule, we try to co-precipitate Sepharose as well as PC and indicate that the chimeric sufficient T-cell receptor protein to do protein receptor chains are able to transmit an activation sequencing. This is done in collaboration with Jill signal to the T cells. We are also transfecting the Lahti and Max Cooper at the University of Alabama at reciprocal chimeric genes in which VH is joined to Ca Birmingham and Ruedi Aebersold at Caltech. Second, and VL to c 6• We plan to use the chimeric gene we are constructing a subtracted cDNA library approach to investigate areas of the constant regions (thymus minus B cell) from which we will try to isolate important for a/S association and cell surface cDNAs that encode the I-cell receptor chains. expression. We also plan to extend this approach by constructing chimeric genes using V regions from anti 38. Biology of Class I Major Histocompatibility bodies specific for different antigens with different Antigens: A Model for Studying Regulated affinities. Cell-Cell Interactions in the Immune System Iwona Stroynowski 37. The Chicken I -Cell Receptor Cell-mediated response to pathogens involves a Chia-lam Kuo, Bernard Vemooy concerted interaction of many components of the Mammals generate diversity in their immuno immune system. The identities of some of these globulins and I -cell receptors by several mechanisms. components and their relative contributions to the Two or three gene segments are rearranged and immune response are known; many others remain to be juxtaposed to one another to generate a variable (V) discovered. We study the mechanism by which major gene. The junctions between these gene segments are histocompatibility complex (MHC) antigens function in variable, and random nucleotides can be inserted the recognition and elimination of the virally-infected between the gene segments. Immunoglobulins can and neoplastically transformed cells. Our experi undergo further diversification by somatic mutation. mental system is focused on mouse class I trans A relatively small pool of gene segments can thus plantation antigens which serve as the target 37 molecules for the cytotoxic lymphocytes during the individual Qa/Tla genes, their functions, and the recognition of "self" from "nonself." mechanisms leading to their specific tissue distribution Recent crystallographic data suggested a structural have not been identified. model for the class I-T cell interactions. It is One poorly understood feature of the expression of currently hypothesized that "nonself" recognition the Qa-2 antigens is their quantitative variation among requires specific association of transplantation mouse strains. We have previously reported that the antigens with peptides of tumor or viral origin. Many Ql genes from BALB/c mouse and C57BL/ JO mice of the parameters controlling specificity and encode membrane-bound as well as secreted forms of efficiency of these processes are not understood. the serologically-defined Qa-2 antigens. In the Which peptides associate with which MHC antigens? present study we have identified a second Qa subregion How is foreign antigen processed into peptides? Is the class I gene (Q9) which encodes a polypeptide similar cellular trafficking of MHC, viral and tumor antigens to Q7. This gene is present in mice encoding elevated coordinated? Where in the cell do their pathways levels of Qa-2 antigens. Furthermore, we have cross? Another fascinating and unknown area concerns observed that cell lines transfected with the allelic education of T cells for the recognition of the forms of the Q7 gene from C57BL/IO (Qa-2high) or nonself. How is self-tolerance induced? Where and BALB/c (Qa-210W) display quantitative differences in when in the developing organism is MHC restriction cell surface expression. Based on these studies, we imposed on T-cell repertoire? Does the quantity of suggest that gene dosage and allele-specific variation the class I antigens affect MHC restriction and contribute to the strain-specific variation in the levels tolerance? How are the class I antigens regulated in of Qa-2 expression. the ontogeny and in the adult mouse? 2. Recognition of Hybrid H-2/Qa-2 Class I Antigens Over the past year we have continued to work on by Cytotoxic T Cells mechanisms involved in interferon regulation of class I 2 Donald W. Mann , Iwona Stroynowski genes and to analyze non-classical Qa transplantation Leroy E. Hood, Jam es Forman 2 antigens. We have also initiated targeting of class I Cytotoxic T lymphocytes (CTLs) recognize gene expression to different tissues in order to polymorphic determinants on class I major histo examine MHC restriction and induction of tolerance in compatibility antigens. Previous studies indicated that transgenic mice. A system for studying intracellular these determinants are localized to the amino trafficking of transplantation antigens is being terminal al and a2 domains of these molecules. developed. The different approaches to these projects Alloreactive CTLs can be jlenerated against both are summarized in ·this and the following six abstracts categories of class I antigens: H-2 and Qa-2. While H- (Nos. 38-44). 2 class I molecules are integral membrane proteins anchored to the cell membrane by-a hydrophobic trans 1. Qa-Region Class I Gene Expression: Identification of a Second Gene Encoding membrane segment, Qa-2 molecules are attached to a Qa-2 Polypeptide cells by carboxyl ends carrying phosphatidylinositol
1 (PI) tails. Mark Soloski , Kathleen N. Blackbum, Leroy E. Hood, Iwona Stroynowski To test if alloreactive CTLs specific for H-2L d Class I molecules can be subdivided into two epitopes are able to recognize a hybrid H-2L d/Qa-2 categories: classically-defined transplantation molecule, we constructed a fusion gene, Ld /Q7d, which antigens, which are encoded by the H-2 subregion of encodes al and a2 domains from H-2L d and a3 and the major histocompatibility complex, and structurally carboxyl end components from Qld. The hybrid was related molecules encoded by the Qa/Tla subregion. eXpressed on the surface of rat liver cells. The Mice encode 2-3 H-2 class I genes and 20-40 Qa and molecule retained serological al/a2 H-2L d epitopes Tla genes. The Qa/Tla molecules differ from H-2 and was attached to cell membranes through a Pl antigens in amino acid sequence, molecular weight, linkage characteristic of Qa-2 molecules. tissue distribution and ability to present viral antigens Both bulk cultured and cloned H-2L d alloreactive to cytotoxic T cells. The polypeptides encoded by the CTLs as well as H-2Ld-restricted, VSV-specific CTLs 38 lysed transfectants expressing wild-type H-2L d but or in vitro NK susceptibility, the previously reported showed little or no lytic activity on cells that association between reduced MHC class I antigen expressed Ld /Q7d hybrid. These cells also failed to levels and increased NK susceptibility is not act as cold target competitors for alloreactive H-2L d universally applicable. CT Ls. 4. Targeting of Genetically Engineered Soluble These data indicate that recognition of poly Class I Molecules to Different Secretory Pathways morphic class I CTL epitopes in the al and a2 domains Keith D. Lewis, Laura M. Hoopes, Iwona Stroynowski is influenced by the structure of the carboxy end of Last year we reported construction of mutant class the molecule. This may involve Pl linkage, interaction I genes encoding soluble counterparts of the H-2L d with Lyt-2 or conformational distortion of al/a2 by antigens. The rationale for this approach was three COOH epitopes. Experiments in progress will attempt fold: to test the ability of the soluble class I antigens to distinguish between these possibilities. to induce tolerance in transgenic mice; to purify large quantities of the class I proteins for crystallography; 3. MHC Class I Antigen Expression and Growth of Tumors and to perform in vitro studies of the solution inter
3 actions between allogeneic class I and T-cell receptor Michael I. Nishimura , Iwona Stroynowski, Leroy E. Hood, Suzanne Ostrand-Rosenberg3 molecules. One of the recombinant genes, L d/QlOd, Recent reports suggested a correlation between was shown to direct efficient synthesis of a soluble decreased expression of tumor cell MHC class I product carrying al and a2 domains of H-2L d origin antigens and increased susceptibility to natural killer and a3 and carboxyl-end from secreted QlO protein. (NK) cells. These studies led to the hypothesis that To optimize secretion of these soluble Ld tumor cells displaying reduced levels of MHC class I molecules, we have introduced the Ld/Q!Od gene into antigens have reduced tumorigenicity in vivo because three cell lines: standard L cells, which have they are eliminated from the host by endogenous NK constitutive secretory pathway; hepatoma cells, which cells. We have examined this hypothesis using murine have more efficient constitutive pathway than L cells; hepatoma BW77 56 and its spontaneous H-2Kb loss and pituitary tumor cells, which have constitutive as variant Hepa-I. The parental BW7756 tumor is highly well as inducible secretory pathway. malignant in syngeneic C57L/J hosts while Hepa-I The expression of the soluble L d molecules in these cells do not give rise to tumors, suggesting that the cell lines varied quantitatively and qualitatively. loss of H-2Kb antigen expression correlates with Several parameters were shown to contribute to the decreased tumorigenicity and NK susceptibility. observed differences, including synthetic rates, Hepa-I cells were therefore transfected with the kinetics of intracellular trafficking from endoplasmic H-2Kb gene and tested for tumorigenicity. Syngeneic reticulum to Golgi and from Golgi to cell surface, or NK-deficient C57BL/6-beige mice challenged with glycosylation rate, type of sugars added and Hepa-I or the H-2Kb transfectants rejected the cells, association with Bz-microglobulin. Our data suggest suggesting that re-expression of the H-2Kb antigen that in L cells and in hepatoma cells, the soluble does not restore tumorigenicity and that NK cells are class I molecules are transported to the cell surface not involved in Hepa-I rejection. In vitro H-2Kb via a fast, constitutive pathway, while in pituitary antigen negative and positive Hepa-I cells are equally tumor cells a proportion of the molecules accumulates susceptible to tilerone-boosted NK cells, indicating intracellularly before being released into the medium. that MHC class I antigen expression also does not Studies in progress will identify the intracellular affect in vitro NK susceptibility. Tumor challenged compartment in which these molecules are stored or athymic nude and sublethally irradiated syngeneic retained. The observed differences in the intracellular mice developed tumors, demonstrating that T cells are trafficking may have important applications for probably responsible for rejection of the Hepa-I studies of the MHC-dependent antigen presentation in tumor, and that H-2Kb antigen expression has no different cells; current models suggest that class I effect on rejection. Since the expression of H-2Kb antigens encounter foreign antigens and associate With antigen on Hepa-I cells does not affect tumorigenicity peptides derived from these antigens in the cytoplasm; 39 the compartments in which it happens and kinetics of Two of these sequences are in functionally defined these reactions are not known. Clearly, the post enhancer regions and also bind to the transcription translational trafficking of the MHC antigens is very factor AP-1. The thirC! sequence is part of the region important for cell-mediated immune responses. We are involved in interferon regulation and is homologous to now developing this system further to study regulatory the enhancer element of the interferon s gene. Based steps controlling the MHC-peptide associations. on these observations, we proposed a model for
References: interferon regulation of H-2 promoters (Korber et al., Korber, B., Hood, L. and Stroynowski, I. (1988) In: 1988). Major Histocompatibility Genes and Their Role in Immune Function, David, C. S. (Ed.), Plenum Press, References: New York, in press. Korber, B., Hood, L. and Stroynowski (1987) Proc. Korber, B., Mermod, N., Hood, L. and Stroynowski, I. Natl. Acad. Sci. USA 84, 3380-3384. (1988) Science 239, 1302-1306. Korber B., Mermod, N., Hood, L. and Stroynowski, I. Mann, D., Stroynowski, I., Hood, L. and Forman, J. (1988) Science 239, 1302-1306. (1988) J. Exp. Med., Submitted for publication. Nishimura, M., Stroynowski, I., Hood, L. and Ostrand 1 Department of Biochemistry, University of Rosenberg, S. (1988) Submitted for publication. California, Berkeley, CA. Ostrand-Rosenberg, S., Cole, G., Nishimura, M., Clemens, V., Cole, G. and Stroynowski, I. (1988) In: 40. Regulation of Gene Expression by Interferons: Major Histocompatibility Genes and Their Role in H-2 Elements Located Downstream from Immune Function, David, C. S. (Ed.), Plenum Press, New York, in press. Transcription Initiation Sites Soloski, M. J., Einhorn, G., Hood, L. and Stroynowski, Elly Holthuizen, Bette Korber, Kathleen N. Blackbum, I. (1988) In: Major Histocompatibility Genes and Iwona Stroynowski Their Role in Immune Function, David, C. S. (Ed.), Plenum Press, New York, in press. Class I antigen expression undergoes modulation Soloski, M. J., Hood, L. and Stroynowski, I. (1988) during the ontogeny and during the adult life. It is Proc. Natl. Acad. Sci. USA 85, 3100-3104. maintained at different basal levels depending upon 'Department of Molecular Biology and Genetics, the tissue or cell type; in addition, it can be regulated Subdepartment of Immunology, The Johns Hopkins University School of Medicine, Baltimore, MD. by various agents. Both type I and type II interferons 'Department of Microbiology, University of Texas Health Science Center, Dallas, TX. have been proposed to play a physiological role in the 3Department of Biological Sciences, University of developmental onset of the class I gene expression and Maryland Baltimore County, Catonsville, MD. in the enhancement of their expression on the adult cells. 39. Regulation of Gene Expression by Interferons: Studies by Korber et al. indicate that the sequences Control of H-2 Promoter Responses 5' as well as 3' of the transcription initiation site are 1 Bette Korber, Nicolas Mermod , Iwona Stroynowski involved in the interferon-mediated regulation of class Interferons are important modulators of antiviral I gene expression. We have focused on the molecular and antitumor responses. In addition, they affect cell basis of the mechanism that is dependent on the 31 growth, differentiation and gene regulation. Both type sequences using H-2L d gene regulation as a model I and type II interferons induce or elevate expression system. of MHC antigens, thus contributing to the enhance Three H-2L d constructs were used for the initial ment of MHC-mediated immune responses. We have studies: wild type H-2L d DNA, H-2L d gene carrying previously reported that the DNA sequences located deletion of interferon response region in the promoter, upstream and downstream of the H-2 transcription and H-2L d gene fused to nonregulated feline leukemia initiation site are involved in the interferon-mediated virus promoter. The three constructs were stably regulation of class I gene expression (Korber et al., integrated into L cells and into neuronal tumor cells. 1987). More recently, we have shown that the magni Quantitative radioimmunoassays were used to study tude of the response to interferons and the require the amount of the H-2L d proteins on cells treated and ment for individual elements in the promoter of the not treated with interferons. To evaluate transcrip H-2Dd gene are cell-specific and dependent on the tional and/or posttranscriptional components of the 3' type of interferon used. Three DNA sequences in the regulation, the correlation between the increase in cell promoter were found to bind murine nuclear factors. surface H-2Ld, intracellular H-2L d and steady state 40
level of H-2L d mRNA was analyzed. Studies in Qa-2 expression since comparisons of sequences for progress using nuclear run-off experiments will Q7d, Q7b and Q9b genes show greater than 99% determine transcription initiation rates. homology. Analysis of the hybrid Q7d, Q7b and Q9b A combination of these approaches should provide gene expression is in progress. information on the relative contribution of the 3' References: control elements in the overall regulation by Soloski, M. J., Hood, L. and Stroynowski, I. (1988) interferons. With further analyses we hope to reveal Proc. Natl. Acad. Sci. USA 85, 3100-3104. Stroynowski, I., Soloski, M. J., Low, M. G. and Hood, L. the identity of these elements and the mechanisms by (1987) Cell 50, 759-768. which they operate.
42. Analysis of Sequences Necessary for the Attachment of the Qa-2 Antigen to the Cell 41. Analysis of Allelic Differences in Qa-2 Membrane via a Phospholipid Tail Expression Nusrettin Ulker, Iwona Stroynowski Deborah A. Nickerson, Kathleen N. Blackbum, Iwona Stroynowski The Q9 gene of C57BL/6 mouse strain is located in In contrast to the wide tissue distribution of the K, the Qa region of MHC and encodes a portion of sero D and L antigens, the Qa/Tla antigens show tissue logically defined Qa-2 antigens (Soloski et al., 1988). tropisms. In addition, several studies have shown that Qa-2 antigens show a great degree of homology to the qualitative as well as quantitative variation exists in classical class I antigens; they differ from H-2 class I the Qa/Tla gene expression among different mouse antigens in that i) they show a very low level of poly strains. Very little is known about the factors that morphism, ii) they do not present viral antigens to regulate either the tissue distribution or the expression CTLs, iii) they are anchored to the cell membrane of Qa/Tla antigens in different mouse strains. In the through a phospholipid tail, and iv) they show tissue present study, we are evaluating the molecular mecha specific cell surface expression. nisms responsible for allelic variation in expression of The primary amino acid sequences that identify the Qa-2 antigen in BALB/c (Qa-210w) and C57BL/6 Qa-2 proteins for the attachment of the phospholipid (Qa-2high) mice. Previous studies (Stroynowski et al., group are not known; the molecular mechanism of this 1987; Soloski et al., 1988) have shown that the anti process is not understood. However, it is believed that genic specificities defined by the anti-Qa-2 antibodies the attachment of a phospholipid group to the Qa-2 are encoded by the Q7d gene in BALB/c mice (H-2d molecule is a posttranslational event that may require haplotype) and by the Q7b and Q9b genes in C57BL/6 a specialized cellular machinery. For instance, some mice (H-2b haplotype). Hence, it is clear that gene cell types such as hepatoma and T cells are capable of dosage plays a role in the Qa-2 expression but does not anchoring the Qa-2 molecules to the cell surface via a fully account for the observed sixfold difference in phospholipid tail, whereas some other types such as L levels of expression between these two mouse strains. cells lack this capability and express Qa-2 antigens as Indeed, Hepa-I cells transfected with Q7b DNA con secreted molecules. sistently show threefold higher levels of the Qa-2 Our previous studies on hybrid Qa-2/H-2 genes expression when compared to expression in Hepa-1 localized the sequences responsible for phospholipid cells transfected with Q7d DNA. Therefore, dif group attachment to the 3' region of the Qa gene. ferences in transcription and/or posttranscriptional Presently, we are using in vitro site-directed muta processing of Q7d and Q7b gene products also genesis techniques to modify the DNA sequences in the contribute to the strain variation in Qa-2 expression. 3' of the Q9b gene in a way that will make its protein Current studies are focused on evaluating the levels of product resemble H-2K, D, and L antigens. The Q7d and Q7b gene transcription in trans!ected cell modified gene will be introduced into hepatoma and L lines and on analysis of posttranscriptional synthesis cells. Transfectants will be monitored for the cell and processing of Qa-2 glycoproteins. Furthermore, surface expression of Qa-2 antigens. The nature of the we intend to determine precisely the DNA and amino anchorage of Qa-2 antigens to the cell membrane will acid sequences responsible for this allelic variation in be analyzed using phospholipase C, which cleaves off 41 molecules that are attached to the cell membrane epitopes. The task of discriminating between self and through a phospholipid tail. After defining the nonself epitopes rests upon lymphocytes and their cell regulatory sequences, we are planning to introduce surface receptors. them into one of the H-2 class I genes to test if this One of the central issues in immunology concerns modified antigen will be attached to the cell surface the mechanism by which organisms prevent their T - via a phospholipid tail, and if so, whether it will cell receptors from recognizing self-components. It is behave functionally as a Qa-2 antigen. believed that early on, the thymus plays a vital role in
Reference: the "education" of immunocompetent cells which are Soloski, M. J., Hood, L. and Stroynowski, I. (1988) found later throughout the body. Within the murine Proc. Natl. Acad. Sci. USA 85, 3100-3104, thymus, developing T cells begin to express a repertoire of receptors with exquisite specificity for 43. Functional Studies on Qa Antigens: Expressing Novel Class I MHC Antigens in Transgenic Mice self H-2 antigens associated with minor or foreign antigens, but which normally will not react with self Nusrettin Ulker, Iwona Stroynowski H-2 antigens alone. At present, it is still unclear Classical H-2K, D and L transplantation antigens which cells in the thymus educate T cells to recognize restrict viral and tumor antigens. In contrast, no such H-2 alone or H-2 plus minor or foreign antigens and function has been demonstrated for Qa antigens. This when this education occurs during the ~mbryonal life. is surprising in view of the fact that amino-terminal al The function of thymus as the sole educator of T cells and a2 domains of the Qa-2 antigens are as closely for the recognition of foreign antigens in the context related to classical MHC molecules as any al and a2 of class I H-2 antigens has recently been called into region of H-2 allele is related to another H-2 allele. question. Several lines of evidence suggest a role for We reasoned that the feature responsible for the func peripheral immune organs in the education of class I tional difference between H-2 and Qa antigens may be antigen-restricted T cells. Another puzzling question defined by carboxyl end of the molecule. This part of relates to the ability of T cells which have been Qa molecules contains the a3 domain, which is in educated in thymus by their own H-2 antigens to volved in interactions with Lyt-2, and the phospholipid recognize nonself H-2 molecules present on different (Pl) tail, which anchors Qa (but not H-2) molecule to cell types in the periphery. cell surface. In order to have a better understanding of the To test this possibility, we are constructing Ld /Q7d mechanisms of tolerance to H-2 transplantation transgenic mice. The transgene will be expected to antigens, we are constructing transgenic mice that will encode ol and o2 domains of the H-2L d protein and the express allogeneic class I antigens on individual tissues o3 domain and PI anchor from Q7d antigen. Once and cell types during defined periods of mouse transgenic mice expressing the hybrid molecules are development. As a model system, the H-2L d gene identified, they will be used to test whether the novel transcribed from different tissue-specific promoters class I molecule can act as a restriction element for will be expressed in mutant H-2dm2 mice. The presentation of viral antigens to cytotoxic T cells. H-2dm2 strain lacks the gene encoding H-2L d antigen and, as a result, rejects tissue grafts from the parental 44. Molecular Mechanisms of Tolerance Induction BALB/c; it is susceptible to VSV infections since and MHC Restriction: Studies on Immune Tolerance to Class I H-2 Alloantigens H-2L d antigen is the only restriction element for the in Transgenic Mice recognition of VSV in H-2d haplotype. Transgenic Nusrettin Ulker, Iwona Stroynowski mice expressing H-2d antigen in different tissues and Immunological phenomena are classically viewed as at different times during development will be analyzed tightly controlled discrimination between self and by several immunobiological assays to test the immune nonself. "Self" and "nonself" are defined in terms of responses in these mice. This approach should shed different antigenic epitopes. An animal will show a some light on the molecular mechanism of tolerance strong immune response when challenged with nonself, induction and H-2 restriction phenomena. whereas it will stay unresponsive to its own universe of 42
45. Characterization of Class I MHC Gene that those that m~p to the H-2 or Qa regions. Only one is Maps Distal to the H-2 and Tia Complex definitively known to be expressed in BALB/c mice: 1 1 Kurt A. Brorson, Su~ Richards , Bruce Loveland , T 13, the gene encoding the TL antigen. Only two of Stephen W. Hunt, Hilde Cheroutre, Kirsten Fischer-Lindahl 1 the remaining 17 genes have been fully sequenced: Tl, The class I MHC molecules are a family of cell a pseudogene, and the "37" gene which appears to be surface glycoproteins that include the classical trans able to produce a class I product. One other plantation antigens H-2K, H-20 and H-2L as well as serologically defined product maps to this region: others, TL, Qa-2,3, Qa-1 and Hmt whose function is Qa-1, but its gene has not been identified. unknown but are expressed mainly on cells of lymphoid In order to analyze these genes, we have under origin. It has been determined that in mice the genes taken to subclone all 20 genes from BALB/c mice, Tl that encode K, D and L map to the H-2 gene complex, through Tl& plus the "37" gene described by the while TL, Qa-2,3 and Qa-1 map to the Qa/Tla complex Kourilsky lab and a gene 5' of Tl that hybridizes to a 5' "" distal to the H-2 region. end class I probe into an SV40 expression vector. These The Hmt gene encodes a class I-like molecule that constructs will be transfected into Cas2, a tail fibro: associates with a mitochondrial-derived antigen, blast cell line derived from Bl0.Cas2 mice. The H-2, probably a small peptide, to form the maternally Qa, Ila and Hmt complex genes in this cell line are transmitted antigen (Mta). This antigen has been derived from the Mus Musculus castaneus subspecies of found to be transmitted genetically in a maternal mice, and therefore should show some allelic dif fashion, and can serve as a target for CTLs in cells of ferences at these loci from BALB/c Mus Musculus the Mta + genotype. Recently, the Fischer-Lindahl lab domesticus mice. In collaboration with the Rich lab, has mapped the Hmt element gene 0.1 centiMorgan these transfectants will be analyzed for Qa-1 b distal of the Tia region. In addition to the Hmt gene, expression to determine which, if any, of the 20 genes the Thy 19.4 gene, a gene that was isolated in a cDNA encodes the Qa-1 antigen. In addition, these trans library in our lab, was found to map to the same fectants will be analyzed for expression of the trans region, making it an excellent candidate for the gene fected genes by Northern blots hybridized with 1 encoding the Hmt element. In order to pursue this radiolabeled gene-specific 5 end subclones and trans possibility, we have isolated a full length clone of the membrane exon oligos. Those transfectants that are Thy 19.4 gene from BALB/c mice and have completely shown to express their transfected gene on the sequenced the 4.3 kb portion containing the Thy 19.4 message level will be analyzed on the protein level. gene. This gene seems to have an open reading frame Radiolabeled whole cell lysates will be sent to Protein and a structure similar to the other class I genes DataBase Inc., Huntington Station, NY, for two-" sequenced so far, although less than 70% homology to dimensional gel electrophoresis. Autoradiographs of those genes in the 5' end. In order to determine if it is these two-dimensional gels will be analyzed here at the Hmt gene, Fischer-Lindahl's lab is transfecting an Caltech using the Protein Database software for SV40 enhancer driven construct of this gene into a expression of novel proteins, especially in the 30-45 fibroblast cell line that has the Hmt null allele, and kDa range expected for class I glycoproteins. Those they will test the transfectants with Mtaa-specific genes that can be shown to be expressed in this trans CTL cell lines. fectant system will be the subject of future studies of in vivo expression. 1 Howard Hughes Medical Institute, University of Texas Health Science Center at Dallas. 'Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TX.
46. Analysis of the Tia Complex
Kurt A. Brorson, John Rodgers', Robert Rich 1 The majority of the 35+ BALB/c mouse class I MHC genes map to within the Tla complex, yet less is under stood about their expression or function than about 43
47. Class I Gene Expression in the BALB/c Mouse; gene expression, suggesting that some class I genes Identification and Characterization of Class I Genes Expressed in Adult Thymus will be found only on small subpopulations of the cells. and Bone Marrow and Fetal Liver In order to obtain a more detailed picture of the expression of the MHC class I genes in lymphocytes, Hilde Cheroutre, Deborah A. Nickerson, Stephen W. Hunt, Kurt A. Brorson, Kathleen D. Segesman RNA from a variety of cloned cells from the lymphoid The mouse MHC class I genes fall into two groups. lineage has been isolated and will be analyzed on The first group is comprised of the transplantation Northern blots for the presence of the different class I antigens (H-2K, D, L) which are expressed on the sur genes, using the specific probes. face of virtually all cells and direct the recognition of virus-infected and neoplastic cells by cytotoxic T 48. The Myelin Proteins and Genes in Primitive Vertebrates cells. The second, larger group of "differentiation antigens," located in the Qa and Tia region at the Lance Fors, Rued! Aebersold, Raul A. Saavedra telomeric side of the H-2D genes, has no known Myelin of the vertebrate nervous system is a function. Most of the Qa-Tla genes encode functional dynamic structure that provides electric insulation and proteins. For a few it is known that they are thus facilitates the rapid conduction of nerve impulses expressed mostly on lymphoid cells and during along axons. The major myelin proteins in the central different stages of development. nervous system (CNS) of mammals are proteolipid Expression of the class I genes in different tissues protein (PLP) and myelin basic protein (MBP), whereas was analyzed in order to obtain further insights into in the peripheral nervous system (PNS) the major their possible function. We have made cDNA libraries proteins are Po and MBP or another basic protein P2, of adult thymus and bone marrow and of fetal liver and depending on the species. Myelin as a concentric thymus. We have isolated the class I cDNA clones multilamellar structure appears first during vertebrate using an oligonucleotide probe derived from a con evolution in sharks; and therefore, shark represents the served region of the class I molecule and characterized system of choice to study the evolution of the myelin these clones by using specific oligonucleotide probes organelle. We have isolated the major CNS myelin and by DNA sequencing. We have analyzed completely proteins from the shark Heterodontus, separated them the class I cDNA clones isolated from the adult thymus in polyacrylamide gels and obtained extensive N and bone marrow and we are currently analyzing the terminal and internal fragment sequences. The clones from the fetal tissues. In comparing the results sequence data unequivocally show that the ma jar of adult thymus with bone marrow, eight of the 14 proteins of shark CNS myelin are homologous to class I genes expressed in the thymus are not found mammalian P 0 and MBP. Both shark P 0 and MBP among the bone marrow clones. Of the eight class I appear in our preparations as multiple bands, and genes expressed in the bone marrow, one is not present together account for 90% of total CNS myelin in the thymus. This suggests that the distinct lineages proteins. Thus, our results support the notion that developing in these organs may express distinct class I myelin has evolved as an organelle where two protein genes. components, a hydrophobic one, like PLP or P 0' and a We have analyzed the expression of the trans hydrophilic one, like MBP or P2, play major structural plantation antigens in the adult tissues and in fetal roles. We have used these protein sequence data also liver and found that the expression level of the H-2D to help generate oligonucleotide probes corresponding and L is comparable but that the level of expression to both shark proteins. We screened a shark brain for the H-2K gene is very different. In the thymus, cDNA library and isolated cDNA clones for both P 0 about 30% of the clones were H-2K, as expected, but and MBP. The shark cDNA clones code for Po and in the bone marrow we found only 8% and in the fetal MBP proteins that are 46% and 43% similar to their liver we could not identify one single H-2K clone respective mammalian counterparts. Shark and among 100 isolated class I transcripts. mammalian P 0 have an extracellular, a transmembrane In all tissues, the level of the individual class I gene and an intracellular domain. The structural analysis of expression ranges from l % to 30% of the total class I the shark and mammalian P 0 extracellular domain is 44 consistent with the shark domain also being organized phenotypes associated with these mutations. as an immunoglobulin-like domain. The shark genome 1 Division of Neural Development and Regenerations, bears only one MBP gene by Southern blot analysis, but Baylor College of Medicine, Houston, TX. two different classes of MBP cDNAs were found in the shark cDNA library. This observation supports the 50. The Identification of Proteins Associated with Neurite and Growth Core Formation idea that the various MBP forms seen in our shark protein preparations arise, like in mammals, from the Carmie Puckett · alternative splicing of exons. All these results, taken Neuronal differentiation and the action of growth together, indicate that the complex myelin structure factors on neurons are processes that are presumed to seen in mammals appeared early in vertebrate be central to the development of the nervous system. evolution. During the final stages of neuronal differentiation, the Our future plans include: I) use the shark cDNA post-mitotic neuron extends long processes termed probes to clone and analyze the genomic structure of neurites with a terminal elaboration called the growth both shark genes; 2) compare the genomic structure of cone. These structures are the developmental the shark genes to that of their mammalian counter precursors of both axons and synapses and establish the parts; and 3) use the transgenic system available in our synaptic connections of each post-mitotic neuron. One laboratory to determine whether the shark genes can major hypothesis to account for the specific functionally substitute and thus reestablish normal connections established by each neuron is that cell neural function in the mutant mice "shiverer" and recognition molecules on the growth cone and on "jimpy." adjacent glial or neuronal cell surfaces guide the growth cone to its appropriate target. Other proteins 49. Expression of the Peripheral Myelin Protein Po of unknown function termed growth-associated in the Central Nervous System of proteins (GAPs) are induced during neurite outgrowth. Transgenic Mice The induction of these proteins is closely correlated Brian J. Popko, H. David Shine 1 with neuritic outgrowth and also seen during axonal Shiverer and jimpy mutant mice are deficient in regeneration. The related experimental questions are myelin basic protein (MBP) and proteolipid protein whether there are proteins specific for the growth (PLP), respectively, but have normal well-compacted cone which can be identified and what genes are peripheral nervous system myelin. The central nervous specifically induced during neurite outgrowth. We will system (CNS) of these animals is severely hypo attempt to identify such proteins and their genes in myelinated. We have initiated studies in an effort to two different experimental systems. determine the proteins involved in the compaction and The first system we intend to study is the well maintenance of the lamellar structure of PNS myelin. characterized PC12 cell line and its response to nerve Po, which represents approximately .50% of the PNS growth .factor (NGF). Following exposure to NGF, myelin protein content, is a transmembrane, glyco PC12 cells undergo both short-term and long-term sylated protein with a molecular weight of responses and after 24 hours or more, NGF-treated approximately 30,000 daltons. The cytoplasmic domain PC12 cells display a morphological and biochemical of Po is rich in basic amino acids, suggesting that the phenotype characteristic of sympathetic neurons. protein may play a role similar to that of MBP. They stop replicating, sprout neurites and start to Additionally, the extracellular domain of Po is display spontaneous electrical potentials. In our hydrophobic, raising the possibility that P0 may have a preliminary attempt to identify the genes induced function analogous to that of PLP. We have begun to during this process, we will utilize the vectors and test these possibilities by generating a line of trans methods developed by Palazzolo and Meyerowitz genic mice that expresses a high level of P 0 in the (1987) at Caltech. Utilizing the SWAJ vector system, CNS. We are in the process of crossing this transgene we plan to make a subtractive library from NGF onto the shiverer and jimpy backgrounds to determine induced PCl2 cells utilizing mRNA from the uninduced what effect CNS expression of P0 will have on the cells for the subtraction. We will attempt to identify 45 clones representing membrane glycoproteins by using coded for by a host gene in both hamster and man. mRNA isolated from the microsomal fraction of NGF Studies utilizing mice infected with the scrapie agent induced PC l 2 cells to make a subtractive probe. By have demonstrated alleles designated Prn-i that seem using these methods, we hope to isolate cDNAs that to determine the significant differences in incubation can be later shown to identify mRNAs expressed in times in different mice strains. Recent work has these cells specifically during neurite outgrowth and demonstrated that these alleles are linked to the PrP growth cone formation. gene in the mouse. A second system for the identification of growth Approximately 10% of CJD appears to be inherited cone-associated proteins in developing neurons is based and is not likely to be due to vertical transmission. In on the physical separation of developing growth cones order to further study this in man, we have previously by centrifugation as developed by P!enninger et al. cloned a human cDNA for the PrP gene and have used (1983). This method allows the purification of this probe to isolate a genomic clone from a human relatively homogenous structures termed growth core cosmid library. This clone contains the entire human particles, which can then be compared to their mature PrP gene and the organization of the gene is identical counterpart, the presynaptic terminal or synaptosome. to that of hamsters. The human gene has two exons, By utilizing a membrane fraction of these growth core an untranslated leader sequence approximately 10 kb particles, other laboratories have shown that the upstream of a single exon encoding the protein. This polypeptide pattern seen on one-dimensional SDS cosmid was used to identify three restriction fragment PAGE is relatively simple and consists of about seven length polymorphisms, one of which is multiallelic and major bands. We intend to niake similar comparisons occurs frequently enough to be useful in examining between these structures in fetal and mature rodent families with inherited CJD. We are collaborating brains by computer-assisted two-dimensional gel with other investigators to- examine these families to analysis. If comparison of these preparations is not see if there is any linkage between this probe and limited by inhomogeneity, we would anticipate the a!!ected individuals in these CJD families. identification of specific proteins associated with the developing growth cone. 52. Effect of Recombinant Wild and Mutant Types of References: Plasminogen Activator Inhibitor l (PAI-I) on Palazzolo, M. J. and Meyerowitz, E. M. (1987) Gene Tumor Cell Invasion 52, l 97-206. Pfenninger, K. H., Ellis, L., Johnson, M. P ., Friedman, Walter E. Laug, Kai Wang, Suzanna J. Horvath L.B. and Somlo, S. (1983) Cell 35, 573-584. Malignant cells invade and destroy normal surrounding tissues, and thus get access to blood vessels and lymphatics with the ultimate result of 51. Genomic Cloning of the Human PrP Gene distant metastasis. This multistep process is mainly Carmie Puckett, Patrick J. Concannon mediated by various proteases elaborated by tumor Scrapie and Creutzfeldt-Jakob disease (CJD) are cells. Studies with specific protease inhibitors transmissible spongiform encephalopathies that are demonstrated a central role of plasminogen activators very similar in nature and occur respectively in sheep (PA) in this invas-ive and degradative process. The and man. Both of these diseases are transmissible to e!!ect of plasminogen activator inhibitor I (PAI-I), the hamsters and mice and produce the same neuro most potent inhibitor of PA, on this complex process pathological features. Several groups are investigating has not yet been evaluated due to its instability. Its the nature of these agents and the results of this work loss of inhibitory activity is thought to be due to rapid have led to several conflicting views on their nature. oxidation of Met at pos-ition 347, similar to that One group, Pruisner and his associates, has observed in alpha 1-antitrypsin. The PAI-I gene has developed a purification scheme that results in the been cloned and mutated clones with replacement of association of high titers of scrapie infectivity with a Met 347 by either _Ya! or Leu, respectively, have been 27-30 kDa protein designated PrP. This protein is obtained. Wild and both mutated types of lull length derived from a larger 33-35 kDa precursor which is PAI-I cDNA have been cloned into the pKK232-2 46 expression vector and recombinant proteins will be Comparative peptide mapping with rat CRH provided purified from JM105 lysates. The physicochemical further evidence that the placental CRH-like peptide properties and PA inhibitory activities of wild and is very homologous to if not identical with CRH. The mutated recombinant proteins will be evaluated and detection of a CRH-like peptide in placenta, together compared. The effect of these recombinant proteins on with our previous demonstration of immunoreactive tissue invasion and degradation by human tumor cells CRH in pregnant maternal plasma, suggests that the will be studied using established, complex in vitro placenta synthesizes CRH and may secrete it into the methods. In addition, the n,ucleotide sequence of the maternal circulation. signal peptide of PAI-I will be determined, synthesized 1 Second Department of Internal Medicine and and ligated to the full length PAI-I cDNAs. Expression Department of Obstetrics and Gynecology, Tohoku of wild and both mutated types in mammalian cells University School of Medicine, Sendai, Japan. 2Department of Genetics, Howard Hughes Medical (lOTl/2 cells) will be achieved after cloning into the Institute, Harvard Medical School, Boston, MA. 3 Department of Medicine, Mount Sinai School of pEMSVscribe 112 expression vector. Glycosylated Medicine, New York, NY. recombinant PAI-I proteins will be purified and their characteristics and effects on tumor cells in vitro will 54. The Chemical Synthesis of Peptides and Proteins be studied. Finally, the pEMSV constructs will be by Automated Stepwise Solid Phase Synthesis transfected into invasive human tumor cells to Stephen B. H. Kent, Linda Martin Selk, evaluate their effect on the degradative and invasive Karen F. Parker behavior of these cells. Methods for the chemical synthesis of peptides have been refined to the point where the total synthesis of polypeptide chains of 50 or more amino 53. Isolation and Characterization of a Corticotropin-Releasing Hormone-Like Peptide acids is routine. This brings to fruition the original from Human Placenta goal of peptide chemists: the total chemical synthesis 1 Atsushi Sasaki , Paul Tempst', Anthony S. Liotta', of proteins for investigation of the structural origins 3 Andrew N. Margioris , Stephen B. H. Kent, 1 1 1 of their activities. We have developed a generally Shuichi Sato , Osamu Shinkawa , Kaoru Y oshinaga , Dorothy T. Krieger' applicable chemistry for the automated assembly of Immunoreactive corticotropin-releasing hormone protected peptide chains at the rate of 20 min per (CRH) was detectable in extracts of human term residue and with yields up to 99.7% per amino acid placentae (5.2 ± 0.8 pmol/g wet wt, n = 9). Molecular residue. Complete deprotection is achieved with sieve chromatography revealed three size classes of strong acids (HF, sulfonic acids) without chain immunoreactive CRH. The major species eluted with cleavage artifacts and with minimal side reactions due the Kav of synthetic rat CRH; the minor species to the protecting groups. Synthetic products were exhibited apparent molecular weights of 18,000 and purified by reverse phase HPLC and characterized by 8,000. A placental CRH ( l-41)-sized peptide was isoelectric focusing on immobilized pH gradient gels, isolated by fractional acetone precipitation, molecular quantitative Edman degradation, and mass sieve chromatography, and sequential reverse phase spectrometry. The chemical synthesis of proteins (i.e., high performance liquid chromatography (HPLC) steps. long polypeptide chains folded into a precise three This peptide exhibited chromatographic behavior dimensional structure) is further complicated by the identical to rat CRH in all the HPLC isolation steps, requirement to fold the polypeptide chain to the as well as the same (UV absorbance-to-immuno precise three-dimensional structure of the protein_. A reactive CRH) ratio at the final purification step. key aspect of the success of this approach to the total Purified placental CRH stimulated ACTH release from chemical synthesis of peptides and proteins is anterior pituitary tissue in a dose-dependent manner automation which allows synthesis to be carried out in and was equipotent with synthetic rat CRH. Partial a rapid, reproducible fashion with quantitative sequencing indicated that 32 amino acids of this documentation of the results. The chemical synthesis peptide are identical to those of rat CRH and human approach to the preparation of peptides and proteins CRH (sequence translated from genomic sequence). complements the cloning approach and offers sub- 47 stantial advantages for the preparation of short of certain protected peptides to form intermolecular peptides (up to 40 amino acid residues) and peptides aggregates and hence become poorly solvated and containing a-carboxamide groups. unavailable for reaction, even when attached to a swollen resin support. Zn the past, we and others have 55. Principles of Rapid, High Efficiency Synthesis investigated with considerable success the use of more of Peptides efficient solvents to help overcome the poor salvation Stephen B. H. Kent, Linda Martin Selk, properties of these resin-bound peptides. However, for Karen F. Parker some particularly difficult sequences (e.g., the C We have critically reevaluated the chemistry used terminal 20 residues of interleukin-I), reproducibly for the assembly of protected peptide chains on resin poor yields in the peptide bond-forming step of step supports. Swelling of peptide resins originates from wise solid phase synthesis still occur (at the 0.5-10% the interaction of solvents with the protected peptide level). We have investigated the use of heating, in an and the polymer backbone. Thus, we have used a single inert high boiling solvent, to break up the inter 4-minute treatment with neat (100%) trifluoroacetic molecular aggregates causing these problems. An acid (TFA) to remove the Boe group at each step of automated peptide/protein synthesizer has been the chain assembly with 99.98% (±0.02%) efficiency. modified to heat the reactions to any desired The highly swollen state of the peptide resin results in temperature ( 56. High Yield Stepwise Solid Phase Chemical 1 Dorothea L. Schiller, Felix Strumwasser , Synthesis of "Difficult" Peptides by the Use of 2 Brian T. Chait , Stephen B. H. Kent Heat to Dissociate Intermolecular Aggregates of the Protected Peptide Chains Egg laying and its neuropeptidergic control in the opisthobranch mollusk Aplysia califarnica has been the Karen F. Parker, Linda Martin Selk, Steven M. Clark, Stephen B. H. Kent subject of intensive investigation. In Aplysia, both the Even when using highly optimized chemical egg laying and the associated stereotypic behavior protocols, some target sequences are difficult to (inhibition of locomotion and feeding, specific head assemble in high yield by stepwise solid phase movements, and extrusion of the egg string) are caused synthesis. We have proposed that these sequence by the electrical discharge of the bag cells, two dependent difficulties owe their origin to the tendency bilaterally symmetrical clusters of nerve cells at the 48 anterior pole of the abdominal ganglion. During the structural requirements for egg laying were further electrical discharge of the bag cells, at least three investigated with a series of synthetic analogs. It was peptides are released whose primary structures are found that several amino acids could be deleted from known. These include egg laying hormone (ELH) and a the C terminus of the molecule but that the intact N 27-residue acidic peptide, as well as the nine-residue territinus was required for activity. Furthermore, a set peptide a-bag cell peptide. These three and other of analogs was designed and synthesized in which the peptides are cleaved from a common precursor as N-terminal residues (1-20) of the ELH molecule were deduced from the nucleotide structure of the cloned replaced with other amphiphilic helices, preserving the gene. These observations have led to two distinct, C-terminal residues 21-36. None of these analogs was mutually exclusive hypotheses for the molecular basis active. Investigations are under way to further define of egg laying and the associated stereotyped behavior the structural requirements for bioactivity in the ELH in A. califomica. Choice between these hypotheses molecule. hinges on the ability of the ELH molecule alone to Reference: cause egg laying and all components of the associated Scheller, R. H., Jackson, J. F., McAllister, L. B., Rothmann, B. S., Mayeri, E. and Axel, R. (1983) stereotyped behavior. We therefore set out to Cell 32, 7-22. chemically synthesize the 36-amino-acid-residue ELH 1 molecule, according to its published structure, and to Marine Biological Laboratory, Woods Hole, MA. 2Mass Spectrometry Laboratory, The Rockefeller determine its biological activity in A. califomica. We University, New York, NY. have carried out the total chemical synthesis, including purification and formal proof of covalent 59. Chemical Synthesis of Human Transforming structure, of the ELH molecule. Synthetic ELH Growth Factor induced normal egg laying and all aspects of the 1 2 Dorothea L. Schiller, David D. L. Woo , Jahn Wilkes , associated behavioral array on injection into A. David H. Live', Stepften B. H. Kent califomica. This observation implies that currently Total chemical synthesis of small proteins (up to popular theories of the molecular origin and genetic 20,000 daltons) and their analogs is a powerful and control of innate behaviors are not correct. practical research approach to structure-function 1 analysis of proteins. Marine Biological Laboratories, Woods Hole, MA. 2Mass Spectrometry Laboratory, The Rockefeller Human TGF-a was synthesized on a fully auto University, New York, NY. mated peptide synthesizer (Applied Biosystems, 430A) 58. Structure-Function Studies on the Egg Laying reprogrammed to use a double coupling protocol. The Hormone (ELH) of Aply8ia califomica preformed symmetric anhydride of protected amino 1 acids (t-Boc AA's) in dimethylformamide was used in Dorothea L. Schiller, Felix Strumwasser , Brian T. Chait', Steplten B. H. Kent the first coupling, followed by in situ activation of A stereotyped behavioral array is associated with t-Boc AA's in dichloromethane during the second egg laying in A. califomica. Scheller et al. (1983) coupling step. Using quantitative Edman degradation postulated a coordinate release of a number of dif (preview sequencing), the yield of full length target ferent peptides from the polyprotein precursor which sequence was 84.5%, representing an average coupling contains ELH. Our goal was to determine whether yield of 99.65% per residue. The peptide was then ELH by itself can induce the full behavioral array cleaved and deprotected. This sample, when analyzed associated with egg laying and to determine the on HPLC (Vydac C4 column), showed a single major structural requirements for this activity. ELH, a 36- peak, representing 44% of the total product. The residue peptide amide, was synthesized using opti major peak was isolated using preparative HPLC. The mized manual and automatic protocols for solid-phase purified peptide had no biological activity at this stage peptide synthesis. Znjection of purified synthetic ELH and was refolded under controlled oxidative conditions (2-200 "g) induced normal egg laying (29/29 animals), in guanidinium hydrochloride. After refolding, several proving that ELH alone can induce the complete forms of TGF-a were apparent. They were separated behavioral array associated with egg laying. The from each other by preparative HPLC and their 49 activities measured. One peak was found to have for biological activity that approximates physiological activities indistinguishable from isolated natural levels. This disulfide probably stabilizes the tertiary murine EGF in receptor binding, mitogenic and soft structure of the protein to give a conformation that is agar colony formation assays. The purified product optimal for function. focused as a single band at pl = 6.2 on Immobiline gels 1The Biomedical Research Centre, University of and displayed a molecular weight of 5546.2 British Columbia, Vancouver, Canada. (Theoretical= 5546.3) by mass spectrometry. Refolding conditions have subsequently been 61. Structure-Function Studies of Human GM-CSF by Total Chemical Synthesis: Identification of a investigated and optimized. Analogs of the TGF-a Minimum Structure Required for Activity molecule have been synthesized in which all three 1 2 Ian Clark-Lewis , Angel F. Lopez , disulfide bonds (six cysteine residues) have been 2 2 Luen B. To , Matthew A. Vadas , 1 replaced with novel isosteric analogs. Preliminary John W. Schrader ", Stephen B. H. Kent circular dichroism studies have shown that the Human granulocyte-macrophage colony-stimulating resulting polypeptide folds to form a structure similar factor (hGM-CSF), a 127 amino acid protein, was to native human TGF-a. and which is equally resistant chemically synthesized using automated stepwise solid to denaturation by guanidine-HCl. This analog dis phase peptide methods. The unpurified synthetic played detectable biological activity in standard hGM-CSF had the same qualitative activities as the growth stimulation/morphogenesis assays. Further purified recombinant protein. The synthetic material studies are in progress to extend this work. stimulated: the formation of colonies of neutrophils, 1 Department of Medicine, University of California, macrophages and eosinophils from human bone marrow Los Angeles, CA. cells; the growth of acute myeloid leukemic cells; and 2 The Upjohn Co., Kalamazoo, Ml. 3Chemistry Department, Emory University, Atlanta, the function of mature neutrophils and eosinophils. GA. The structural requirements for the activities of synthetic hGM-CSF were examined by the design and 60. The Role of Cysteine Residues in Determining synthesis of fragments and analogs. The synthetic the Biological Activity of Interleukin-3 fragment, hGM-CSF (54-127), containing all four of 1 Ian Clark-Lewis , Stephen B. H. Kent the cysteine residues found in the intact protein, Total chemical synthesis of analog proteins was lacked detectable activity. Assays of fragments used to examine the requirement for specific disulfide shortened at the N terminus showed that residues 1-13 bridges for the biological activity of interleukin-3 were not required for activity, but that the integrity (IL-3), a growth factor that stimulates multiple of residues 14-25 was critical for biological activity. lineages of hemopoietic cells. Four structural analogs The 14-25 region is predicted to form the first alpha of the mature, 14-0 amino acid murine IL-3 molecule helix in hGM-CSF. Residues 16, 17 and l& were were synthesized in which specific cysteine residues identified as the most critical. However, synthetic were replaced by alanines. In a quantitative IL-3 peptides within the N-terminal 1-53-residue region assay, based on 3tt-thymidine incorporation into lacked detectable activity. Synthetic analog hGM-CSF !actor-dependent cells, the IL-3 analog with alanines (1-121), which lacks the C-terminal 6 residues, had substituted for all four cysteines, i.e., similar activity to hGM-CSF (1-127), indicating that [Alal7,79,&o,l40] IL-3, had 500-lold less activity than the residues 122-127 are not required for activity. An the molecule synthesized according to the native analog, [Ala88] hGM-CSF (14-96), which lacks the sequence. The two analogs [Cys17•79, Ala&O,l40l IL-3 hydrophobic C-terminal region and two cysteine and [Cys17•140, Ala79•80] IL-3 had similarly low residues, had low but readily detectable activity, activity, whereas the [Cys17,80, Ala79•1401 IL-3 suggesting that residues 14-96 are sufficient for analog had 2000-fold higher activity than these three detectable synthetic hGM-CSF activity, although the analogs and 3-lold higher than the molecule with the presence of residues 97-121 are required for lull native sequence. This shows that in IL-3 a single di activity. No dissociation of the multiple biological sulfide bridge, between cysteines 17 and &O, is required activities of hGM-CSF was detected. 50 'The Biomedical Research Centre, University of synthesis of these domains in pure form. A number of British Columbia, Vancouver, Canada. recent synthetic achievements, many from our own 'The Institute of Medical and Veterinary Science, Adelaide, Australia. laboratory, have demonstrated that this is not beyond 3 The Walter and Eliza Hall Institute of Medical the realm of possibility. At the present time, Research, Melbourne, Australia. however, the largest proteins reproducibly chemically synthesized in pure form are only on the order of 50 62. Total Chemical Synthesis and Enzymatic Activity of HIV-I Protease amino acid residues in length, such as insulin, epidermal growth factor, and transforming growth Jens Schneider, Linda Martin Selk, Stephen B. H. Kent factor alpha. These are the very smallest proteins. A protein corresponding to the putative protease of Larger, more typical proteins (100-140 residues) have the human immunodeficiency virus I (HIV-I) has been so far resisted the chemical approach in terms of the prepared by total chemical synthesis. The N- and C synthesis of pure defined molecular species. terminal residues of this synthetic protein were chosen We intend to take advantage of our ability to by comparison of sequence homologies with other routinely synthesize, in good yield, highly purified free known and isolated retroviral proteases and by the peptides 30-45 residues in length. Excellent methods assumption of an autocatalytic release of the protease exist for the purification (reverse phase HPLC, ion from the gag-pol precursor pl80. The two putative exchange chromatography) and high resolution cleavage sites were thought to be two Phe-Pro bonds, analytical (reverse phase HPLC, capillary zone one containing the N-terminal proline of the p66/51 electrophoresis) and molecular (mass spectrometry) reverse transcriptase and generating the C terminus of characterization of free peptides. It is our intention the protease, and the other containing a phenylalanine to develop methods for the ligation of these large 99 amino acids upstream generating the N terminus of synthetic peptides to form target long peptide chains. the protease. This 99-residue synthetic enzyme This approach will maximize the theoretical advan- showed proteolytic activity on fragments of the tages of fragment ligation (purification and charac natural gag precursor, and specifically cleaved terization of intermediates, ready purification of the synthetic peptide substrates, two of which released unfolded product protein), while avoiding the problems new fragments corresponding to the N and C termini that arise with maximally protected fragments of the protease molecule itself. Inhibition studies (frequent insolubility, difficult purification and provided direct evidence that the HIV-I protease characterization of the protected intermediates). belongs to the family of aspartic proteases. The Perhaps the most innovative approach to the frag availability of the HIV-I protease as a defined ment ligation synthesis of large peptides has been the molecular species has important implications for the recent work of James Blake (Blake, 1981; Blake and Li, design of specific inhibitors that do not interfere with 1983; Blake et al., 1986). In this approach, a peptide the host cell metabolism, as a possible route to resin linker is used which generates a peptide alpha antiviral agents against acquired immunodeficiency thiocarboxylate (a-COSH) upon strong acid cleavage syndrome (AIDS). Chemical synthesis provides an from the resin. This is the only such functionality in important new route to the study of this enzyme, and the reacting system, and can be specifically activated to the study of the structure and mechanism of the for reaction with an a!pha-NH group by treatment aspartate proteases in general. 2 with silver ions. This approach has the potential to be a powerful general approach to the total chemical 63. Total Chemical Synthesis of Proteins by the Chemical Ligation of Purified synthesis of protein domains. Unprotected Peptide Segments We are optimizing the synthesis of amino acyl Leigh E. Clawson, Stephen B. H. Kent thioester-resins for the chemical synthesis of peptide Proteins are made up of structural/functional alpha-thiocarboxylates by SPPS and exploring and domains that typically contain peptide chains I 00 to optimizing ligation reactions using these fragments. 200 amino acids in length. The challenge facing These methods will be applied to the total chemical synthetic peptide chemistry is the total chemical synthesis of proteins for structure-function studies, 51 especially in the AIDS virus (HIV-I, HIV-2) protease reporter groups. Thl·s w1·ll be an important contri systems. bution to studies in this system aimed at understanding the structural origins of the peculiar properties of this References: Blake J. (l98l)Int. J. Pept. Prat. Res. 17, 273-274. molecule. Blake: J. and Li, C. H. (1983) Proc. Natl. Acad. Sci. USA 80, 1556-1559. . Reference: Blake, J., Yamashiro, D., Ramasharma, K. and L1, C. Rose, K., Herrero, C., Proudfoot, A. E. I., Offord, R. H. (1986) Int. J. Pept. Prat. Res. 28, 468-476. E. and Wallace, C. J. A. (1988) Biochem. J. 249, 83- 88. 1 Department of Biochemistry, Dalhousie University, 64. Semisynthetic Studies on the Protein Halifax, Nova Scotia. Cytochrome c Using Chemical Peptide Synthesis 1 Paolo Mascagni, Carmichael J. Wallace , Stephen B. H. Kent 65. Location and Chemical Synthesis of a Essentially all protein semisynthesis has used Binding Site for HIV-! on the CD4 Protein fragments that were generated by cleavage of the Bradford A. Jameson, Stephen B. H. Kent, Patricia E. 1 2 2 parent molecule, is dated and subsequently modified, Rao , Lilly Kong , Beatrice H. Hahn , George M. Shaw 2 before religation. Current SPPS methods are easily The human immunodeficiency virus type l (HIV-I) capable of producing large numbers of analogs of such uses the CD4 protein as a receptor for infection of peptides, rapidly and in high purity. For example, six susceptible cells. A candidate structure for the HIV-! analogs of the 39-amino-acid peptide cytochrome c binding site on the CD4 protein was identified by (66-104) were produced in a matter of weeks and epitope mapping using a family of eight functionally reacted with the naturally-derived cytochrome c (1-65) distinct CD4-specific monoclonal antibodies in con homoserine lactone fragment in high yield to produce a junction with a panel of CD4-derived synthetic large family of mutant cytochrome c molecules with (-30 residue) peptides. All of the seven epitopes that interesting redox potentials and biochemical activities were located reside within two immunoglobulin-like (Kent, Mascagni and Wallace, manuscript in disulfide loops situated between residues 1 and 168 of preparation). the CD4 protein. The CD4-speci!ic monoclonal anti It is our intention to extend this approach, in body OKT4A, a potent inhibitor of HIV-I binding, collaboration with Wallace, to make the entire recognized a, site between residues 32 and 47 on the cytochrome c molecule accessible by chemical CD4 protein. By analogy to other members of the synthesis. The religation of natural fragments immunoglobulin superfamily of proteins, this particular corresponding to l-39 and 40-104 or 40-65 has already region has been predicted to exist as a protruding loop. been performed, using enzymatic ligation of an amino A synthetic analog of this loop (residues 25-58) showed acid active ester to the fragment 1-38 (Rose et al., a concentration-dependent inhibition of HIV-I-induced 1988). It is proposed to use a three-fragment cell fusion. It is proposed that a loop extending from approach: the fragment 66-104 will be prepared by residues 37-53 of the CD4 protein is a binding site for standard optimized SPPS; the fragment 40-65 homo the acquired immunodeficiency syndrome (AlDS) virus. serine lactone will be prepared using a novel synthetic Further studies are under way to more precisely define approach which we developed, using a Boe Hse(Bzl) the location of the binding site within this loop and to resin to directly generate the peptide Hse lactone; and define the importance of the residues within the site. the fragment 1-38 will be prepared by SPPS, religated This will allow the rational design of analogs of this with the heme, and converted to the 1-39 active ester region of the CD4 protein which could act as chemo by enzymatic ligation. therapeutic agents for acquired immunodeficiency An optimized approach of this type will open up the syndrome (AIDS). entire cytochrome C molecule to chemical modifica 1 tion at any specific site and will allow us to introduce Bio tech Division, OR THO Pharmaceuticals, Raritan, NJ. modified amino acids in any part of the molecule, 2 Division of Hematology/Oncology, University of including labeling with NMR probe nuclei or other Alabama at Birmingham, Birmingham, AL. 52 66. Identification of a Novel Retroviral Gene glycosylation in recognition of native HBV env proteins Unique to HIV-2 and SIVMAC by antipeptide antisera; 5) an understanding of the role 1 1 John C. Kappes , Casey D. Morrow', Shei-Wen Lee , of interaction between distinct domains of HB V env Bradford A. Jameson, Stephen B. H. Kent, 1 2 proteins in their immunologic recognition; and 6) George M. Shaw , Beatrice H. Hahn i, immunogens prepared by combining recombinant DNA Human and simian immunodeficiency-associated' retroviruses are extraordinarily complex containing at products with synthetic peptides. least five genes, tat, art, sor, R and J'orf, in addition 1The Lindsley F. Kimball Research Institute of the to the structural genes gag, pol and env. Recently, New York Blood Center, New York, NY. 2Pasteur Vaccins, Marnes-la-Coquette, France. nucleotide sequence analysis of HIV-2 and SIVMAC revealed the existence of still another open reading 68. Search for Antibodies Neutralizing the frame, termed X, which is highly conserved between lnfectivity of Hepatitis B Virus in these two viruses, but absent from HIV-1. We have Pre-S-Specific Antisera 1 2 1 demonstrated for the first time that the X open A. Robert Neurath , Belinda Seto , Nathan Strick , 3 reading frame represents a functional retroviral gene Karen P. Parker, Marc Girard , Stephen B. H. Kent For a detailed understanding of the protective in both HIV-2 and SIVMAC and that it encodes a immunity against hepatitis B virus (HBV) infection, it virion-associated protein of 14 and 12 kDa molecular is necessary to define those epitopes on the HBV weight, respectively. We also described the production envelope (env) protein that elicit virus-neutralizing of recombinant TrpE/X fusion proteins in E. coli and antibodies (VNAb). This can be accomplished by deter show that sera from some HIV-2 infected individuals mining the virus-neutralizing activity of antibodies specifically recognize these proteins. This opens the with known specificity, i.e., 1) with monoclonal anti way to development of a specific serological test distinguishing HIV-I and HIV-2 infections. bodies (McAb); 2) with polyclonal antibodies of pre determined specificity raised against segments of the 1 Department of Medicine, University of Alabama at Birmingham, Birmingham, AL. HBV env using either synthetic peptides or products 2Department of Microbiology, University of Alabama obtained by recombinant DNA techniques. Earlier at Birmingham, Birmingham, AL. studies demonstrated that antisera to the 5 and Pre-52 regions of the HBV env protein are virus-neutralizing 67. Biological Role of Pre-S Sequences of the Hepatitis B Virus (HBV) Envelope PrQtein and protective. Two anti-Pre-52-specific McAb reacting with non-overlapping epitopes on the Pre-52 1 1 A. Robert Neurath , Nathan Strick , sequence of the HB V env protein, and having a more Stephen B. H. Kent, Karen F. Parker, Chin Sook Kim, 1 1 Marc Girard', Harold E. Ralph , Jay Valinsky narrow specificity than the anti-peptide antisera used Studies with synthetic peptides permitted the before, failed to neutralize the infectivity of HBV as mapping of sites within the HBV envelope (env) pro measured in chimpanzees, but apparently reduced the teins involved in virus attachment to cell receptors titer of -infectious virus as suggested by prolongation and in eliciting virus-neutralizing antibodies (VNAb). of the incubation period of HBV-McAb mixtures as Such VNAb are elicited by each of the three regions of compared with untreated virus. VNAb were detected the HB V env protein: 5-protein, Pre-52 and Pre-51 in antiserum against the peptide Pre-5(21-47) from the sequences. We have carried out a research program Pre-SI region of the HBV env protein. Thus, not only that has resulted in: I) the localization of epitopes the S and Pre-52 regions of the HBV env protein, but within the Pre-S sequence involved in antiviral Ab also the Pre-51 region contain epitopes essential for binding (B-cell epitopes) and in immunogenicity (T-cell eliciting VNAb. Therefore, the incorporation of the epitopes); 2) definition of the immunological properties Pre-51 sequence or of appropriate portions thereof of hybrid synthetic peptides consisting of B- ana T-cell into hepatitis B immunogens should be considered in epitopes derived from distinct portions of the HBV env the design of improved hepatitis B vaccines. protein; 3) an understanding of the role of carriers and 1The Lindsley F. Kimball Research Institute of The adjuvants in eliciting immune responses to synthetic New York Blood Center, New York, NY. 2 peptides; 4) an understanding of the effect of 0ffice of Biologics, FDA, Bethesda, MD. 3 Pasteur Vaccins, Marnes-la-Coquette, France. 53 69. Characterization of the HBV X-Gene Product we have developed improved wet chemical sequencing methods to overcome these limitations. The key to Dorothee Wernicke-Jameson, Stephen B. H~ Kent these methods is the covalent attachment of the The hepatitis B virus (HBV) genome has four open peptide or protein sample to an insoluble support. reading frames, encoding: the core protein; the viral Protein samples were prepared in a form suitable for polymerase; the envelope protein; and the "X" protein. The X gene has the capacity to encode a 154-amino N-terminal sequence analysis by direct electrophoretic transfer out of SDS-polyacrylamide gels onto acid protein, whose biological function is unknown. We are interested in the structure and function of this chemically derivatized glass fiber filter paper, where the proteins became covalently attached by reaction protein and its potential role in the induction of hepatocellular carcinomas. of the lysine side chain amino groups. Peptides were attached to aminophenyl-glass fiber filter paper by Two peptides have been synthesized, corresponding to both the amino and carboxy termini of the X selective reaction at the side chain and alpha-COOH moieties. The protein was electroblotted onto nitro protein, and have been used to create monospecific antisera. In collaboration with Dr. Myron Tong cellulose, stained and cut out, digested in situ, and the {Huntington Memorial Hospital, Pasadena, CA), we resulting peptides were separated by narrow bore have obtained a continuous adherent hepatocellular HPLC and spotted onto aminophenyl-glass for sequence analysis. Extensive N-terminal and internal carcinoma cell line, which has HBV-DNA integrated in at least five different sites. Lysates of these cells sequence data could be obtained from a wide variety of proteins by a combination of these approaches. were probed in Western blot assays using the anti Covalent attachment of samples allows a much wider peptide antisera for the presence of HBV-X immuno range of more vigorous chemistries to be explored. logically cross-reactive proteins. Several proteins were consistently recognized, and we were able to This has resulted in efficient sequencing at the rate of 15 min per residue, and has allowed the use of block the recognition of a protein of an approximately 32 kDa protein with genetically engineered X protein enhanced sensitivity chromophore and fluorescent Edman reagents. A simplified, low-dead-volume expressed in E. coli. Since the predicted molecular weight of the HBV-X protein is 17 kDa, the nature of automated sequenator has been designed to exploit this approach to chemical sequence determination. Direct the 32 kDa proteins is currently under investigation. HPLC analysis of the released amino acid derivatives, together with an improved UV detector, will allow 70. Current Chemical Approaches to the Sequence Analysis of Peptides and Proteins subpicomole sensitivity. Sensitivity will be further improved by digital data acquisition and computer Ruedi Aebersold, Heinz Nika, Gary D. Pipes, enhancement. George Baklayan, Steven M. Clark, Wang Qin Chen, Stephen B. H. Kent Practical wet chemical approaches to the determi 71. Covalent Immobilization of Proteins for nation of the amino acid sequence in polypeptide High Sensitivity Sequence Analysis: Electroblotting onto Chemically Activated Glass chains are exclusively centered around the Edman from SDS-Polyacrylamide Gels degradation. For the past seven years, standard Ruedi Aebersold, Gary D. Pipes, Heinz N ika, sequencing technology has consisted of automated "gas Stephen B. H. Kent phase" Edman chemistry, followed by HPLC analysis of We report a new method for the preparation of the resulting amino acid derivatives. Limitations of proteins in a form suitable for high sensitivity N this approach include: awkward sample preparation; terminal am:ino acid sequence analysis. Proteins stepwise nature of the degradative process; awkward separated by polyacrylamide gel electrophoresis were chemistry (for fear of sample wash out); speed (45 electrophoretically transferred onto glass fiber filter minutes to one hour per residue); sensitivity (more paper chemically activated by the introduction of than 2-20 picomoles of sequenceable sample is phenyl isothiocyanate functional groups. The proteins needed); manual data acqu1s1t1on; and expensive became covalently coupled to the matrix during the instrumentation ($1&5,000). Over the past few years, electrotransfer process. Bands containing transferred 54 proteins were detected by fluorescent staining or auto 73. Determination of Phosphorylation Sites radiography, cut out from the glass fiber filter and in Proteins directly loaded into the cartridge of a gas-phase Richard E. H. Wettenhall, Ruedi Aebersold, sequenator. The covalent nature of the interactions Stephen B. H. Kent between protein and glass fiber support permitted the The phosphorylation of proteins by any one of a use of more vigorous solid-phase sequencing protocols number of distinct protein kinases is of fundamental and alternative sequencing reagents. This high importance in the regulation of a variety of cellular efficiency isolation and covalent coupling method processes. Identification of the site of phosphorylation provides the essential first step towards enhanced within these proteins is a necessary step in the sensitivity protein sequence analysis. The method has elucidation of the regulatory mechanisms involved. been successfully applied to the isolation of a wide Phosphorylation sites for individual protein kinases are variety of proteins from SDS-polyacrylamide gels and usually determined by enzyme-specific structural was shown to be compatible with both the standard signals contained within the adjacent amino acid Edman reagent phenyl isothiocyanate and alternative sequence (e.g., House et al., 1986). While there are sequeneing reagents such as N,N'-dimerhylamino some characteristic features of specificity determi azobenzene isothiocyanate (DABITC). nants for individual protein kinases, phosphorylation sites cannot be predicted with certainty from knowledge of the primary structure alone. The labeling 72. High Efficiency Covalent Immobilization of of phosphorylation sites with 32P-radioactivity Picomole Amounts of Peptides for Solid Phase Sequence Analysis provides a means of identification. However, attempts to introduce this approach into automated sequencing Ruedi Aebersold, Gary D. Pipes, Heinz Nika, George Baklayan, Stephen B. H. Kent have been largely unsuccessful mainly because of the We have developed a method for the covalent instability of the phosphorylated derivatives generated immobilization of picomole or subpicomole amounts of by the Edman degradation, the difficulty of recovering peptides in a form compatible with high sensitivity these derivatives from the sequencer, and the solid phase sequence analysis. Glass fiber filter paper generally poor efficiency of the Edman degradation of was derivatized with aminophenyl triethoxysilane and phosphorylated residues. peptide aliquots were applied to circular discs cut to l We have developed a new method for the identifi cm diameter. Peptides were covalently immobilized cation of phosphorylation sites during automated through their carboxy terminus or through the side sequencing which uses a modified Caltech-designed chain carboxyl groups of acidic amino acids by the sequencer (Hewick et al., 1981) and modified Edman water-soluble carbodiimide N-ethyl-N'-J(dimethyl degradation protocols. The method is designed for the aminopropyl) carbodiimide (EDC). Discs containing analysis of phosphopeptides covalently attached to coupled peptides were directly inserted into the aminophenyl-coated glass supports through their cartridge of a gas-phase sequenator for sequence carboxy-terminal residues (Aebersold et al., 1988). analysis. The coupling reaction was highly efficient Covalent attachment enabled the introduction of more (50-8596 yields), and peptides prepared in this way aggressive protocols for extracting the polar phospho could be sequenced through their carboxy-terminal derivatives and avoided the need for the widely used amino acid at extraordinarily low backgrounds. The ionic-based supports (e.g., polybrene) which trap covalent immobilization of peptide fragments allows phosphorylated derivatives. Having established that an extreme flexibility in sequencing conditions and is the method gave good recoveries of phosphorylated therefore the key to the use of alternative sequencing derivatives (greater than 5096), we were able to reagents with enhanced detectability. optimize the conditions for Edman degradation of phosphorylated amino acid residues. The resulting method has been used successfully to identify single and multiple sites in a variety of peptides phos phorylated at serine, threonine or tyrosine residues. 55 The method requires less than a nanocurie of 32P sequenceable proteins separated by SDS radioactivity per phosphorylation site and is effective polyacrylamide gel electrophoresis or two-dimensional with subfemtomole quantities of peptides. gel electrophoresis. In the present investigation, we describe methods to obtain N-terminal or internal References: Aebersold, R. H., Nika, H., Pipes, G. D., Wettenhall, sequence information of proteins separated by R. E. H., Clark, S. M., Hood, L. E. and Kent, S. B. isoelectric focusing in polyacrylamide gels with H. ( 1988) In: Methods in Protein Sequence Analysis 1988, Wittmann-Liebold, B. (Ed.), Springer-Verlag, immobilized pH gradients. For N-terminal sequence in press. _ analysis, separated proteins were electrophoretically Hewick, R. M., Hunkapiller, M. W., Hood, L. E. and Dreyer, W. J. (1981) J. Biol. Chem. 256, 7990-7997. transferred (electroblotted) onto activated glass fiber House, C., Wettenhall, R. E. H. and Kemp, B. E. (1986) sheets, a support compatible with Edman degradation J. Biol. Chem. 262, 772-777. chemistry. Transferred protein bands were detected 74. Accelerated High Sensitivity Solid Phase on the support, cut out and directly inserted into the Sequence Analysis cartridge of a gas-phase protein sequenator. For internal sequence analysis, separated proteins were Heinz Nika, Ruedi Aebersold, Stephen B. H. Kent electrophoretically transferred onto nitrocellulose. We have developed solid-phase sequencing protocols for the rapid degradation of low picomole Proteins were detected by staining, cut out and enzymatically cleaved on the support. The resulting amounts of peptide in a modified Caltech sequenator. cleavage fragments were recovered in the supernatant, Peptides are covalently attached to chemically separated by narrow bore reversed-phase high perfor modified glass fiber discs by their carboxyl groups. mance liquid chromatography, and the isolated peptide The sequencing protocols were compatible with the fragments were sequenced. The potential of this classical Edman reagent phenylisothiocyanate as well as with alternative, chromophoric (4-N,N-dimethyl methodology has been illustrated by the comparative peptide mapping of isoforms of bovine carbonic amino-azobenzene-4'-isothiocyanate) or fluorescent Edman reagents (4-(N-l-dimethylaminonaphthalene-5- anhydrase. sulfonylamino) phenyl isothiocyanate) (Chang et al., 1978; Jin et al., 1986). Clean sequencing results at the 76. Molecular Characterization of Plastin: A Human Leukocyte Protein Expressed in low picomole or subpicomole level with dramatically Transformed Human Fibroblasts reduced cycle times were obtained. The cycle time 1 Ruedi Aebersold, John Leavitt , Stephen B. H. Kent for sequence analysis with phenylisothiocyanate was 16-18 minutes and for chromophoric or fluorescent A powerful new approach to the study of biological phenomena consists of the application of quantitative sequencing reagents with subpicomole detection two-dimensional gel electrophoresis of complex sensitivities in the range of 26-28 minutes. protein mixtures and advanced methods of protein References: sequence determination with the standard techniques Chang, J.-Y ., Brauer, D. and Wittmann-Liebold, B. (1978) FEBS Lett. 93, 205-214, of genetic engineering. Using this approach, we set Jin, S.-W ., Chen, G.-X., Palacz, z. and Wittmann Liebold, B. (1986) FEBS Lett. 198, 150-154. out to establish the molecular identities of protein markers of the tumorogenic state in chemically transformed human fibroblasts. Initial attempts to 7 5. N-Terminal and Internal Protein Sequence sequence the most interesting of these proteins Analysis of Microgram Amounts of Proteins Electroblotted from lmmobiline Isoelectric (Plastin) after isolation by electroblotting from two Focusing Gels dimensional gels failed, leading to the conclusion that Ruedi Aebersold, Gary D. Pipes, Stephen B. H. Kent the protein was blocked at the amino terminal. The Isolation of microgram amounts of proteins and protein was then blotted onto nitrocellulose, digested peptides in a form suitable for sequence analysis is a in situ, peptide mapped and extensive sequence data key step in high sensitivity protein sequencing were obtained from the resulting peptides. This technology. Recently, methods have been described information was used to design and synthesize several that allow the recovery of microgram amounts of oligonucleotide probes which were used to isolate the 56 corresponding gene(s) from fibroblast cDNA libraries. that pl80 co-localized with clathrin although some Two full-length clones were obtained and sequenced, clathrin staining nearer the cell periphery was not and were found to code for highly related but non associated with pl80. So far, only a limited number of identical proteins. In vitro translation of the isolated proteins have been identified as localizing in coated genes and two-dimensional gel mapping analysis pits and these are characteristically receptor showed that one gene is normally expressed in lympho molecules, e.g., for growth factors, hormones, cytes, the other in fibroblasts. In tumor-derived fibro immunoglobulins, transferrin, LDL, a2-macroglobulin, blasts, both genes are expressed, i.e., the lymphocyte viruses, and toxins, etc. 300-400 pmoles of pl80 were Plastin protein is present in tumorogenic fibroblast isolated from membrane preparations of the cell line cells and is a marker of tumorogenicity. Sequence MG63 by affinity chromatography with a pl80-speclfic database searches revealed no homologous or analo monoclonal antibody bound to CNBr-activated gous proteins, so that the function of these proteins Sepharose. Eluted protein was further purified to remains unknown. This question is being approached apparent homogeneity by gel filtration on a Superose 6 by the generation of antisera, raised against synthetic FPLC column. peptides, specific for each protein. These antisera will The obtained, pure protein was digested by trypsin be used to study the occurrence of these gene and cleavage fragments were separated by narrow bore products, to isolate complexes with other proteins, reversed phase HPLC. Due to the large size of the leading to the identification of associated proteins, protein, the initial tryptic peptide map was very and to investigate the consequences of neutralizing the complex and single peptides for sequence analysis were proteins' activities. obtained by rechromatography of the initially 1 collected peaks on a narrow bore HPLC system using Institute for Medical Research, San Jose, CA. columns and buffer systems of different selectivities. Extensive internal sequence information was obtained 77. Structural Analysis of a 180 kDa (pl&O) Human and several degenerate oligonucleotide probes were Fibroblast Membrane Protein synthesized. Attempts to isolate and sequence cDNA 1 Ruedi Aebersold, Clare M. lsacke , Tony Hunter' clones coding for pl80 are currently under way. The pl80 was identified as a labeled protein of approxi complete primary structure of pl80 will help with the mately 180 kDa that was immunoprecipitated from determination of the function of this interesting 1251-surface labeled or 35s-methionine metabolically protein and open the possibility to study its involve labeled AGl523 human fibroblasts with monoclonal ment in protein kinase C-mediated signal transduction antibodies. In these cells, pl80 is constituitively processes. phosphorylated to a low level. Phosphorylation is 1The Salk Institute, San Diego, CA. dramatically increased if the cells are treated with the phorbol ester TPA for 5 minutes prior to lysis. This 78. Structural Analysis of Proteins Associated and other experiments suggest that pl80 is a physio with Creutzfeldt-Jakob Disease logical substrate for protein kinase C. pl80 is a Ruedi Aebersold, George Baklayan, glycoprotein that exhibits Endo F sensitivity; it does Michael Harrington 1 not undergo a mobility shift in non-reducing SDS gels Creutzfeldt-Jakob disease is a fatal, progressive and by a number of criteria it is distinct from EGF neurodegenerative disease affecting humans. A panel receptor, PDGF receptor and c-erbB-2 (cellular neu). of cerebrospinal fluids (CSF) from patients with It is present on a variety of cell lines including non Creutzfeldt-Jakob disease was analyzed by high established human fibroblasts but is absent from resolution two-dimensional polyacrylamide gel electro epitheloid-derived cells. By immunofluorescence phoresis. Comparison of these two-dimensional gel analysis of permeabilized or non-permeabilized human patterns with the patterns obtained from CSF from fibroblasts, pl80 has a punctate distribution reminis healthy donors or patients suffering from unrelated cent of that observed with clathrin. Double labeling neurological disorders revealed four protein spots, the experiments with an anti-clathrin antibody indicated expression of which was associated with Creutzfeldt- 57 Jakob disease. Two of these spots were also present in threonine-specific kinase and one a tyrosine-specific CSF of some patients suffering from multiple kinase; and iii) the transcriptional activation of _sclerosis, herpes simplex encephalitis, schizophrenia, selected genes such as the genes for interleukin-2 and Parkinson's disease or Guillain-Barre or Behc;et's interleukin-2 receptor. syndrome (Harrington et al., l 986). N-terminal Stimulation of the T-cell hybridoma AOIT.13.1, sequence analysis of the latter proteins isolated specific for hen egg lysozyme, through the receptor directly from two-dimensional gels by electroblotting with antigen, the clonotype-specific antibody F23. l, failed, whereas the proteins of comparable abundancy conconavalin A or independent of receptor with from the same blots could be sequenced. We therefore phorbol-12 myristate-13-acetate (PMA) and calcium concluded that the two proteins were blocked at the N ionophores produces activation of the T lymphocytes terminus. Additional protein was isolated by electro as monitored by the production of IL-2. blotting onto nitrocellulose for internal sequence We have used both receptor-dependent and analysis. Proteins were cleaved by trypsin on the receptor-independent cell stimulation models to begin nitrocellulose matrix and recovered peptide fragments to define the phosphorylation events associated with were separated by narrow bore HPLC for sequence T-cell activation. analysis (Aebersold et al., 1987). From both proteins, AOIT.13.l cells with a 32P-labeled intracellular sufficient internal sequence information could be ATP pool were activated with the T-cell receptor a generated for the synthesis of oligonucleotides. chain-specific monoclonal antibody F23.l, or with Attempts to isolate relevant DNA clones from PMA and calcium ionophores. Phosphoproteins of the appropriate cDNA libraries are currently under way. two activated cell preparations, and of non-activated The determination of the complete primary AOIT.13.1 cells, were separated by high resolution structure of the proteins associated with Creutzfeldt two-dimensional gel electrophoresis. The phospho Jakob disease will help in the diagnosis of this disease protein patterns of the two activated cell stats were and might provide insights into its origin and patho quantitatively and qualitatively compared to each physiology. other and to the pattern of nonstimulated cells by References: computerized analysis using the PDQUEST software Aebersold, R., Leavitt, J., Saavedra, R., Hood, L. E. system. The function of phosphoproteins involved in and Kent, S. B. H. (1987) Proc. Natl. Acad. Sci. signal transduction will be analyzed further, and USA 84, 6970-6974. Harrington, M. G., Merril, C. R., Asher, D. M. and selected proteins will be isolated from the two Gajdusek, C. (1986) New Eng. J. Med. 315, 279-283. dimensional gels for high sensitivity N-terminal or 1 Biochemical Genetics Section, Clinical Neurogenetics internal sequence analysis to define the molecular Branch, National Institute of Mental Health, Bethesda, MD. identity of these proteins. 79. Analysis of Phosphoproteins Involved in 80. The Optimization of Automated Fluorescence Signal Transduction in Murine T Cells Based DNA Sequence Analysis Lisa Larson, Ruedi Aebersold Jane Z. Sanders, Sara L. MacKellar, Barbara J. Otto, The activation of most T lymphocytes requires the Robert J. Kaiser Jr. interaction of a clonotypic antigen receptor on the T Automated fluorescence-based DNA sequencing, a eel! membrane with a foreign antigen and a gene technology developed by our group about two years ago product of the major histocompatibility complex (Smith et al., 1986) and subsequently commercialized expressed on the surface of antigen-presenting cells. by Applied Biosystems Inc. (AB!), represents a Multiple biochemical events follow occupancy of potentially very powerful technique for the rapid the T-cell antigen receptor. They include: i) rapid acquisition of DNA sequence information. We are thus rise in intracellular calcium and the release of water continuing to investigate a variety of parameters using soluble inositol phosphates, both of which are assumed the commercial AB! Model 370A DNA sequencer in an to be early events in intracellular signaling; ii) effort to determine the capabilities and limitations of activation of at least two kinase systems, one a serine/ the current commercial product, to adapt and optimize 58 existing sequencing protocols for use with the statistical analysis of peak height variability for these fluorescence-based methodology, and to further data and -have dem-6nstrated a strong correlation develop and improve the instrumentation and between the low degree of signal strength variability chemistry in order to realize the full potential of the characterizing the T7 enzyme and the observed higher technology. Specifically, we are interested in sequence accuracy. Unfortunately, the enzyme does lengthening the amount of interpretable sequence data exhibit other undesirable properties. The chemically obtained per run, in improving the accuracy of the modified form of the enzyme currently available still automated sequence analysis to consistently greater retains some 3'-5' exonuclease activity, and this leads than 99.9%, and to optimizing protocols in order to to a lack of consistency in the production of high assure consistent and reliable high quality output. We quality sequencing reactions. In particular, short are addressing these problems both at the analytical reaction times (under about 5 minutes), low enzyme level, by developing improved computer software (see concentration, or high salt concentration can lead to Abstract No. 82), and at the chemical level, by false terminations. However, long reaction times investigating the sequencing enzymology. result in the selective disappearance of correct The most common enzyme used in DNA sequencing terminations. Thus, the optimum window of reaction is the large fragment of E. coli DNA polymerase l conditions is quite smalJ, yet critical, causing the use (Klenow fragment). However, this enzyme is not of Sequenase in fluorescence-based DNA sequencing to optimal for use in fluorescence-based sequencing, due be less straightforward and reliable than one would to its propensity to greatly favor certain termination like. Nevertheless, the increase in sequencing accuracy sites over others. This results in signals varying in with this enzyme is impressive and its reliability intensity by as much as a factor of 60. Such variability should improve with the removal of the exonuclease severely complicates the analysis of the fluorescence activity through genetic engineering. data, since small signals are easily obscured by either We are also studying the use of Taq polymerase in background noise or by large adjacent signals. We are fluorescence-based DNA sequencing. Preliminary therefore investigating two alternative enzymes, a results indicate that this enzyme exhibits the uniform chemically modified DNA polymerase from bacterio distribution of signal intensities observed with phage T7 ("Sequenase"), and a DNA polymerase from Sequenase combined with a wider range of tolerated the thermophi!ic bacterium Thermus aquaticus ("Taq reaction conditions. An additional benefit of the Taq polymerase"). polymerase is its high temperature of optimal activity Our initial experiments with the modified T7 DNA (72°C) which should help destabilize vexatious polymerase using Ml3 as template indicated a much template secondary structure during the sequencing more even distribution of signal intensities in the reactions. We anticipate that this enzyme will prove fluorescent sequence data obtained using this enzyme. extremely useful in automated DNA sequence analysis. We have therefore developed an optimized protocol for Refereoce: the use of f!uorophore-labeled primers with the T7 Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P., Dodd, C, Connell, C. R., Heiner, C., Kent, S. B. H. enzyme and have systematically compared its perfor and Hood, L. E. (1986) Nature 321, 674-679. mance to that of Kienow on the AB! 370A, using the commercial data analysis software for automated base 81. Automated Fluorescence-Based Specific Primer identification and our own program for the measure Directed DNA Sequencing ment of peak positions and heights in these data sets. Sara L. MacKellar, Jane z. Sanders, We have performed sequence analyses on six different Robert J. Kaiser Jr., Raitl A. Saavedra Ml3 clones of predetermined sequence with each of The advent of commercial fluorescence-based these two enzymes and have observed a significant automated DNA sequencing instrumentation such as increase in the accuracy of the data analysis and the Applied Biosystems Inc. (AB!) Model 370A enables automated sequence determination for sequence biologists to consider undertaking very large (i.e., obtained from Sequenase as opposed to Kienow (manu megabase) DNA sequencing projects. Although most script in preparation). We have also performed a of the sequencing undertaken in such projects will 59 probably be done using a random or "shotgun" sub currently under investigation in our laboratory, thus cloning approach, it will most likely be necessary to making this strategy a powerful tool for large-scale utilize one or more directed approaches to obtain the sequencing projects. complete finished sequence. One such approach is Reference: specific primer-directed DNA sequencing (Strauss et Strauss, E. C., Kobori, J. A., Siu, G. and Hood, L. E. (1986) Anal. Biochem. 154, 353-360. al., 1986). This approach utilizes previously obtained sequence information about a given segment of DNA to generate a primer for continued enzymatic 82. Improvements in Automated Data Analysis in (dideoxy) sequencing of that segment. The complete Fluorescence-Based DNA Sequencing sequence of the segment can thus be obtained by Peter J. Hughes', Jane Z. Sanders, applying this strategy across its entire length in a Robert J. Kaiser Jr. progressive fashion. A key limitation to the length of accurately deter We are presently utilizing this technique in mined DNA sequence information that can be obtained conjunction with the AB! 370A to sequence two Ml3 automatically from the Applied Biosystems Model clones containing complementary 2.8 kb inserts 370A DNA sequencer is the loss of signal intensity and obtained from the untranslated region of the gene resolution as the sequencing run progresses. encoding the shark P 0 protein (see Abstract No. 48). Specifically, peaks representing fragments of length So far, we have obtained about 850 bases of new greater than about 350 bases are often poorly resolved, sequence, although not all of the primers chosen thus leading to errors in the automated interpretation of far have proven useful for the generation of DNA the data. This is contrary to our results obtained using sequence information. We are therefore investigating fluorophore-labeled primers in enzymatic DNA not only the efficacy of the instrument as a routine, sequencing and conventional radioisotopic- detection, in rapid, automated sequencing tool, but are also which clearly resolved bands are observed in the auto optimizing the chemistry for the rapid synthesis of the radiograph for fragments of at least 650-700 bases in required fluorescent primers as well as studying the length. sequence requirements for efficient pr1m1ng. In order to address this problem, we have obtained Currently, primer sequences (20 bases in length plus 5 a data acquisition program from Applied Biosystems bases of 5' non-hybridizing sequence to accommodate that allows us to bypass the current data analysis the software of the sequencer) are chosen to have less package used by the instrument and instead collect than 3596 complementarity to the known sequence of raw data directly. The instrument acquires raw the Ml3 vector, and are chosen in regions of high fluorescence data in l9lf. pre-defined "channels" across accuracy in the automatically determined prior the entire width of the 16-lane slab gel used for sequence. Oligonucleotides are then synthesized on an electrophoresis. Each lane spans seven or eight AB! 380A DNA synthesizer using standard support channels, of which only the three adjacent channels based phosphoramidite chemistry and then manually centered on the maximum signal intensity are used in derivatized to incorporate a reactive amino group at the current commercial data analysis scheme. This their 5' termini. The crude 5'-amino oligonucleotides choice represents a compromise aimed at obtaining obtained after standard cleavage and deprotection are maximum resolution with a minimum decrease in then reacted in aqueous solution with appropriately signal. However, it does discard much potentially activated derivatives of the four fluorescent dyes used useful data. in the automated sequencing strategy, and the We have developed methods of graphically dis products are purified first by gel filtration and then by playing the signal intensity data for the entire width of reverse phase HPLC. The entire synthetic process for a lane as a function of time, using a multicolor contour a single primer (four fluorophore-labeled oligo plotting approach. We have observed that, in many nucleotides) takes about 72 hours. We anticipate soon runs, the bands formed by the fluorescent fragments reducing this time to well under 24 hours through the undergoing electrophoresis are not horizontal across use of new and improved synthesis chemistries the width of the lane, but are instead skewed, resulting 60 in data that are shifted in time between channels. This sequencing reactions (A, C, G, T, A+G, and C+T phenomenon seems to worsen with increased time. specific) are then carried out on this synthesized When such data are averaged across three channels in strand to generate a- nested set of fragments, each an effort to improve the signal-to-noise ratio, ending in a known base or bases. A small, fluorophore significantly decreased resolution may result. We are labeled synthetic oligonucleotide is then enzymatically currently developing software to rapidly analyze the ligated to the 5' end of the fragments and the sequence shape of the bands in a given sequencing run, to determined by electrophoresis and fluorescence detec correct the time shift between channels in distorted tion using the commercial instrument (AB! 370A). bands, and then to average across the entire width of Although this approach has been successful, it is not the band as opposed to only a small portion. We optimal as it relies once again on the use of DNA poly anticipate that these changes will help to significantly merase. We are therefore investigating two alternative improve the accuracy and extent of the automated strategies: the ligation of fluorophore-labeled analysis of the fluorescence-based sequence data. oligonucleotides onto fragments having 5' cohesive - ends generated by restriction enzyme digestion of the target DNA, and the possibility of 3'-end labeling of 83. Automated Fluorescence-Based Chemical DNA Sequencing fragments with fluorescent 2',3'-dideoxynucleotide triphosphate derivatives using terminal deoxy Randolph B. Lipscher, Robert J. Kaiser Jr., Jane z. Sanders nucleotidyl transferase. Although the enzymatic method of DNA sequencing Reference: is very useful for the rapid acquisition of sequence Maxam, A. and Gilbert, W. (1980) In: Methods in Enzymology, Grossman, L. and Moldave, K. (Eds.), information, it does have limitations. These include Vol. 65, Academic Press, New York, pp. 499-560. the solution instability of the sequencing enzymes (DNA polymerases), their propensity for premature termination in regions of the template possessing 84. The Chemical Synthesis of Derivatized Oligonucleotides secondary structure, and their sensitivity to possible impurities in the sequencing reactions. Thus, in cases Robert J. Kaiser Jr., Ravi S. Vinayak where the enzymatic method yields unsatisfactory re We have continued our strong program in nucleic sults, it is necessary to employ the chemical procedure acids chemistry. We currently possess the capability pioneered by Maxam and Gilbert (1980), an alternative to synthesize a wide variety of derivatized oligo- sequencing methodology that is not dependent on DNA nucleotides. These include chemical 5' and 3' polymerase activity for the production of sequence phosphorylation, incorporation- of one or more reactive information. functionalities such as amino, sulfhydryl, carbonyl, and At present, fluorescence-based automated DNA maleimidyl at defined positions within the oligo sequencing (see Abstract No. 80) utilizes only the nucleotide sequence, and post-assembly derivatization enzymatic method to generate sequence information. witn molecular tags such as biotin, chromophores, and We are in the process of adapting the chemical fluorophores. Two powerful applications of such procedure to this new technology. This adaptation has derivatized oligonucleotides include fluorescence been complicated by the observation that the dyes based DNA sequencing (see Abstract No. 80), and gene used in the fluorescence-based sequencing technology analysis and detection (see Abstract No. 85). are unstable under the conditions of the chemical A primary focus of our research is the synthesis sequencing reactions, thus precluding pre-sequencing and application of DNAs (oligonucleotides and larger fluorescent labeling of the target DNA. Our current fragments) covalently coupled to solid matrices. We approach involves primer-directed enzymatic comple have developed several_ efficient procedures for mentary strand synthesis on a single-stranded template attaching derivatized oligonucleotides to solid supports to provide the desired fragment for subsequent such as glass beads, agarose beads, polyacrylamide chemical DNA sequencing. The primer in this case beads, polystyrene beads, and latex microparticles. bears a 5'-terminal phosphate. The chemical Our next goal is to develop efficient methods for the 61 attachment of larger DNA fragments such as plasmids only if the four nucleotides surrounding the junction and cosmids to these supports, and to fully investigate are perfectly base paired. The strategy is simple and and characterize such systems as applied to some of relatively insensitive to variations in the assay the common procedures of molecular biology. We conditions making it an ideal technique for automated anticipate that such systems will prove extremely gene analysis. In order to detect the ligation event, useful for the automation of DNA sequencing re one of the oligonucleotides employed is substituted actions, both chemical and enzymatic, in gene analysis with a retrievable ligand, biotin, and the other carries and detection, for cDNA synthesis, and as affinity a detectable moiety such as 32P. At the conclusion of ligands for the purification o_f nucleic acids and DNA the assay, the biotinylated oligonucleotides are im binding proteins. mobilized and unligated oligonucleotides are removed We are also investigating alternative chemistries by a filtration step. for the rapid production of synthetic oligonucleotides. In order to circumvent the requirement for radio In particular, the speed with which pure oligo active probes, we are currently exploring a class of nucleotides may be obtained at present is largely fluorescent compounds, rare earth metal chelates, that dictated by the time taken !or the post-assembly offer the potential for a greatly enhanced sensitivity deprotection of the exocyclic amines of the nucleoside over conventional fluorophores. These groups could be bases, and by the time required to purify the crude coupled to one of the oligonucleotides either directly product, especially in the case of oligonucleotides of via a polypeptide to permit a high degree of having more than about 30 bases. In addressing the substitution. former consideration, we are investigating the utility We are also investigating magnetic particulate of the protecting groups proposed by Schulhof et al. supports to avoid the filtration step. This would also (1987) which should reduce the required deprotection make the procedure more compatible with, on the one time from 12-16 hours to less than 4 hours. In hand, the polymerase chain reaction if target amplifi addressing the latter, we are examining a variety of cation is required, and automation employing a lab new chromatographic media such as the Waters robot on the other. GenPak HPLC column and the Pharmacia MonoQ A third application of the general detection FPLC column as alternatives to poiyacrylamide gel strategy involves attempts to simultaneously analyze a electrophoresis for the rapid, high resolution, high multitude of genetic loci in a given DNA sample. yield purification of long oligonucleotides. Applications of this approach would include genetic screening and linkage analysis. The strategy we have Reference: Schulhof, J. C., Molko, D. and Teoule, R. (1987) in mind is to immobilize clusters of identical oligo Nucleic Acids Res. 15, 397-416. nucleotides in separate areas on a support and by target-dependent ligation joining labeled oligo 85. An Oligonucleotide Ligation Assay for nucleotides to the immobilized oligonucleotides. Gene Detection Ulf Landegren, Robert J. Kaiser Jr. 86. A Simplified Approach to Subtractive Hybridization · Information is accumulating regarding the causal involvement of given DNA sequence aberrations in Ulf Landegren, Bernard V ernooy genetic diseases and malignancies. We have developed In the search for previously uncharacterized genes, a procedure to meet the need for an automatable a number of criteria may be employed such as shared strategy for gene detection that has the capacity to expression between two tissues and absence from a distinguish genomic sequences differing in even a third. In addition, a criterion of expected similarity single nucleotide position. The principle employed is with any of several characterized genes in, for to select the sequence of two synthetic oligo example, another species may be applied. We are nucleotides such that they can anneal in juxtaposition developing a strategy that will permit employing each on a target DNA strand. Upon addition of a DNA of these criteria in rapid succession at the level of ligase, the oligonucleotides are covalently joined if and cDNA. The principle is that for each population of 62 mRNA, a random primed cDNA version is manufac modified a Beckman Biomek 1000 robotic workstation tured in such a manner that two oligonucleotide to perform up to 24 dideoxynucleotide DNA sequencing sequences are added to the 5' and 3' ends of the cDNA. reactions in about one hour. The reactions are One of the cDNA populations is amplified by the performed in 96-well microtiter plates, using a polymerase chain reaction. A biotin group incorporated prepared reagent pack which includes primer, enzyme, in one amplification primer permits the sense strand to nucleotide mixes and radioactive label. The addition be immobilized on a streptavidin support. The anti of a thin heating unit on the instrument table sense strand of another cDNA population, prepared in facilitates the use of both single and double-stranded a similar manner but not amplified, may now be DNA sequencing procedures. Using standard gel hybridized to the support-bonded population to permit electrophoresis technology, we are able to resolve over isolation of shared or differing sequences at will. The 500 nucleotides per sequencing reaction in less than selected molecules can subsequently be amplified, five hours. Currently, we are able to perform three selected again if desired, and prepared for molecular runs of 24 samples each, with subsequent gel analysis cloning. per eight-hour period. This represents a daily data output of 36,000 base pairs. 87. A New Extended DNA Sequencing Method Kai Wang, Elaine F. Gese 89. A Novel Instrument for the Separation of Sequencing reactions using elongated and labeled Large DNA Molecules Using Pulsed Homogeneous Electric Fields primers have been developed commercially for both the modified Tl DNA polymerase (Sequenase) and the Charles F. Spence, Petros Arakelian, Eric H. C. Lai, Bruce W. Birren, Steven M. Clark Kienow fragment. This modification greatly increases We have developed a new instrument for the the information generated from a single sequencing separation of large DNA molecules. The magnitude, reaction. However, even with this modification, only 500 to 700 nucleotides can be read from a single orientation, homogeneity and duration of the electric field are all precisely controlled. Each parameter can reaction. A new sequencing approach has been tested. In general, the primer was extended 0.5 to 1 kb with be varied at any time during the electrophoretic process. This device has allowed us to dramatically DNA polymerase before the dideoxy sequencing reaction. After the sequencing reaction, the reaction increase resolution and speed of separation. The ability to fully control the electric fields has allowed mixture was cut with a specific restriction enzyme us to investigate the migration mechanism of large before being loaded onto the sequencing gel. With this DNA fragments during pulsed field gel electrophoresis. new sequencing method, 3 kb of sequencing informa The instrument . consists of three major tion have been generated by using just one specific components: a computer to store and recall field primer. parameters, a controller to generate the electrode voltages, and a gel box. The gel box consists of a 88. Automation of Dideoxynucleotide DNA Sequencing Reactions Using a square buffer container with 24 electrodes arranged in Beckman Biomek 1000 Robotic Workstation a closed hexagonal contour, coplanar with the gel. The choice of a hexagonal contour for the electrode array Richard K. Wilson, Steven M. Clark, Annette S. Yuen, Charle.• F. Spence, Petros Arakelian was based on convenience, and in principle, any other Recent proposals to undertake a massive human closed contour can be used. Electric fields are genome sequencing project have resulted in extensive generated by sending sets of data representing the discussions of required improvements to current DNA desired voltage values from the computer to the sequencing methods and instrumentation. In order to controller. In the controller the digital information is maximize overall data output as well as reduce the converted to analog voltages which are amplified by cost per nucleotide, it will be necessary to improve the high voltage amplifiers. The 24 high voltage existing DNA sequencing strategies and implement as amplifier outputs actively impress the desired voltages much automation as possible. As such, we have on the electrodes, thus determining the electric field. 63 The desired voltage values are determined from suggested that heating was desirable for some Poisson's equation. The ability to activate voltage couplings. In order to perform this type of experiment states in any sequence, at any time, has allowed us to during automated synthesis, a standard reaction ve_ssel execute all previous types of PFG electrophoresis, as was fitted with a heating device. This device can heat well as perform novel separations. the contents of the reaction vessel to 110°C from room temperature in less than three minutes. The 90. An Inexpensive Pulsed Field Gel system is a closed loop temperature controller and Electrophoresis Apparatus uses a thermocouple to measure temperature at a Charles F. Spence, Steven M. Clark location in intimate contact with the contents of the Although the technique of pulsed field gel reaction vessel. Temperature stability of ±1°C can be electrophoresis is very powerful and has widespread typically achieved and temperature accuracy can be as applications (see Abstract No. 89), we perceived that good as ±0.5°C. We are presently adapting this design its use was limited by the expense and complexity of to be used in conjunction with the new 20 ml reaction the instrumentation. In order to make pulsed. field gel vessel and rapid chemistries recently developed (see electrophoresis available to a wider group of Abstract No. 55). investigators, we designed an inexpensive ~pparatus. This machine uses the standard buffer chamber we 92. A High Sensitivity Solid Phase Protein developed for the more flexible apparatus, but differs Sequenator greatly in the electronics. The electronics for this Charles F. Spence, Petros Arakelian, Wang Qin Chen, instrument consists of resistors of the proper values to Steven M. Clark, Stephen B. H. Kent give homogeneous electric fields and diodes to isolate We are developing a simple protein sequenator for electrodes from undesired currents in opposing states. the high sensitivity sequence analysis of proteins and When combined with a commercially available powei peptides. This new instrument is based on the Edman supply and switching unit, this apparatus gives chemistry and uses the covalent sample attachment exceptionally straight lanes and good resolution. We technology developed by Aebersold et al. (see Abstract estimate that this instrument may cost several No. 71). This instrument represents an integrated thousand dollars less than a comparable commercial approach to microsequencing. All aspects of the instrument. Despite the fact that this instrument has sequence analysis process, from sample isolation and no flexibility in reorientation angle, a great variety of attachment to derivatized amino acid detection and separations can be done; thus, it represents a viable data analysis have been considered and drawn into one alternative for investigators who have some instrument. The new instrument offers increased electronics skills but are constrained by their budget. control of chemical delivery without the use of valves. All dead volumes, tubing lengths, and surface areas in contact with reagents have been minimized. The re 91. A Temperature-Controlled (Heated) Reaction action cartridge has been- redesigned to give a dead Vessel for the Chemical Synthesis of Peptides and Proteins volume of only 7 µL and to achieve radial flow through the sample. This design is meant to increase the Petros Arakelian, Karen F. Parker, Charles F. Spence, Steven M. Clark, Stephen B. H. Kent efficiency of washing steps and to act to concentrate We have developed a temperature-controlled, the cleavage product toward the outlet of the heated reaction vessel for use in the solid phase cartridge. Cleavage products are flushed directly onto chemical synthesis of peptides and proteins. This work a HPLC column for analysis; thus, all of the cleavage has evolved from experiments designed to explore the product is "injected" onto the analysis system. The effects of the formation_ of intermolecular aggregates absorbance detector has also been redesigned to in of protected peptide chains on synthetic yield (see crease sensitivity and eliminate low frequency noise Abstract No. 56). In order to disrupt intermolecular _and drift through the use of a phase-sensitive detec aggregation and increase salvation, heating during tion scheme. The data are digitized with a minimum manual synthesis was tried. Preliminary data resolution of 16 bits and stored. in the memory of the 64 sequenator-controlling computer for subsequent other than optimal filtering may be desirable. We analysis. The preliminary work on the data analysis think, at this time, that the major problem may be the system may be found in Abstract No. 93. first assumption. We are currently designing an im The design of this instrument is flexible enough proved HPLC absorbance detector which we hope will that, in the future,. it can be used with chemistries allow more accurate peak shape measurements due to employing other chromophores or fluorophores as decreased electronic noise and baseline drift, but it Edman reagents. may turn out that the peak shape variation is inherent in the nature of the chromatographic separation. 93. The Development and Evaluation of Algorithms for the Analysis of PTH-Amino Acid Derivative 94. A Chromosomal Mapper Chromatograms Charles F. Spence, Petros Arakelian, Eric H. C. Lai, Wang Qin Chen, Steven M. Clark, Stephen B. H. Kent Robert J. Kaiser Jr., Steven M. Clark The sensitivity of current sequencing techniques We are currently developing an instrument that we using the Edman reagent phenylisothiocyanate (PITC) call the chromosomal mapper. This instrument will is limited by the signal-to-noise ratio obtainable using allow us to automate the restriction mapping of large standard chromatographic absorbance detectors. In the genomic DNA fragments and cosmids. Our approach chromatographic data we routinely collect, our to labeling restriction fragments is based on the sensitivity appears to be limited by several noise technology that we have developed to synthesize sources: base line drift, background absorbance, and fluorescently-tagged oligonucleotides which are able electronic noise all make significant contributions. We to be ligated to specific cohesive ends. The felt that by using fast Fourier transforms and digital chromosomal mapper will be an instrument that uses filtering, we could enhance the signal-to-noise ratio of the pulsed field gel electrophoresis apparatus we have our data significantly, thereby increasing the sensi built (see Abstract No. 89) for fragment separation and tivity of our sequencing experiments. The algorithms is coupled to fluorescence excitation and detection we have developed, and continue to test, are based on optics. The control computer will be able to actively the use of optimal filtering (Weiner filtering). To take control the electric fields during the separation for this type of approach, we had to make several assump optimal resolution over the entire size range covered tions about the nature of the chromatographic and (1 kb to 7000 kb). The restriction digests may be detection processes. They are: !) the peak shape of . automated by using a laboratory robot (see Abstract each PTH-amino acid derivative does not vary from No. 88). The instrument will have real time data run to run when using the same gradient for elution, 2) acquisition capability and there may be custom, very the order of elution of the PTH-amino acid derivatives large scale integration (VLSI) integrated circuits in the is the same from run to run when using the same control computer to manipulate the large amounts of gradient, 3) because the signal is ideally only diffusion data we expect to gather. This instrument should broadened, the peaks will be roughly symmetrical, and prove to be a powerful tool for examining the 4) the overlap between adjacent peaks is less than half structure of both prokaryotic and eukaryotic genomes. a peak width. When there is peak overlap, we have used the left most data to reconstruct the shape of the 95. Structure-Function Relationships in the first peak and. we subtract that peak from the data to Transposition Protein B of Bacteriophage Mu find underlying peaks. This is less than optimal because 1 David B. Teplow, Chikao Nakayama , Pak C. Leung1, errors are built up as this operation is repeated for Rasika Harshey 1 several overlapping peaks. The B-protein of phage Mu, which is required for The result of this type of approach is that the high frequency intermolecular transposition in vivo, signal-to-noise ratio is increased and peak locations shows ATPase activity in vitro, binds nonspecifically are accurately found, but reliable relative peak heights to DNA and stimulates intermolecular strand-transfer. are not obtained. This indicates that one or more of To elucidate the structural bases for B-protein our assumptions is in error or that some technique function, it was subjected to limited proteolysis with 65 two different proteases, trypsin and chymotrypsin. the initiator methionine after a predicted signal The resulting fragments were mapped by amino acid sequence. A 31-residue region of extremely hydro sequencing. These data show that the B-protein is phobic amino acids near the carboxyl terminus may organized in two domains-an amino-terminal domain function to span cell membranes. The two most of 25 kDa and a carboxyl-terminal domain of 8 kDa. A intriguing features of the protein predicted from the fragment analogous to the amino-terminal domain, cDNA sequence are the occurrence of six produced by deleting the 3' end of a cloned B gene, immunoglobulin-like domains and three domains that proved to be insoluble and had to be renatured after are similar to type III units of fibronectin. elution from an SDS gel. The renatured protein retains 'Department of Neurology, University of Heidelberg. ATP-binding activity and to a lesser extent the DNA 2Zentrum fur Molekulare Biologie, University of binding activity of the Mu B-protein, but is unable to Heidelberg. hydrolyze ATP or function in transposition. Efficient DNA-strand transfer by the B-protein occurs even in 97. Purification and Properties of the Cellular and the absence of a detectable ATPase activity or in the Scrapie Hamster Prion Proteins 1 1 2 presence of A TPyS. David B. Teplow, Eric Turk , Stanley B. Prusiner ' 1 Department of Molecular Biology, Research Institute Scrapie is a progressive, fatal, neurodegenerative of Scripps Clinic, La Jolla, CA. disease of sheep and goats. The etiological agent of scrapie contains predominantly a single protein, with which no nucleic acids have been found to be 96. Molecular Biology of the Neural Cell Adhesion Molecule LI associated. This agent has been termed a "prion," to 1 1 David B. Teplow, Marion Moos , Roland Tacke , 1 differentiate it from classical viruses. During scrapie Herta Scherer', Klaus Fruh , Alfred Bach', Melitta Schachner' infection an abnormal isoform of prion protein (PrP), The neural cell adhesion molecule LI is involved in designated PrP5c, accumulates and is found to co the fasciculation of neurites and the migration of purify with infectivity. Both uninfected and scrapie granule cells in the developing mouse cerebellar cor infected cells synthesize a PrP isoform denoted PrPC tex. It mediates Ca2+-independent adhesion between which exhibits physical properties that differentiate it neurons, but does not appear to participate in inter from PrPSc. PrPC was purified by immunoaffinity actions between neurons and astrocytes. In the chromatography using a PrP-specific monoclonal anti peripheral nervous system, L l is found both on neurons body crosslinked to protein A-Avidgel. PrPSc was and Schwann cells. In the central nervous system, it purified by detergent extraction, polyethylene glycol has been detected only on post-mitotic neurons. precipitation and repeated differential centrifugation Ll is a glycoprotein with an apparent molecular of PrPSc polymers. Both PrP isoforms were found to weight of 200 kDa that undergoes proteolytic cleavage have the same N-terminal amino acid sequence which to yield an amino-terminal fragment of 14.0 kDa and a begins at a predicted signal peptide cleavage site. The carboxyl-terminal fragment of 80 kDa. LI is immuno first eight residues of PrPC were found to be chemically identical to NILE, which has been KKXPKPGG and the first 29 residues of PrPSc were suggested to be the murine equivalent of Ng-CAM. LI found to be KKXPKPGGWNTGGSXYPGQGSPGGN appears to be encoded by a single gene, which is RYPP. Arginine residues 3 and 15 in PrP5c and 3 in transcribed as a 6 kb mRNA. This message is expressed PrPC appear to be modified since no detectable signals only in those tissues containing L 1. To elucidate more (denoted X) were found at these positions during gas fully the structural properties of LI and its relation phase sequencing. Both PrP isoforms were found to ship to other molecules, we have sequenced cDNA contain an intramolecular disulfide bond, linking Cys clones encoding the Ll glycoprotein. 179 and Cys 214, which creates a loop of 36 amino Translation of the cDNA sequence produces a acids containing two N-linked glycosylation sites. protein sequence containing 1261 residues. The amino Development of a purification protocol for PrPC terminus of the mature protein begins 19 residues from should facilitate comparisons of the two PrP isoforms 66 and lead to an understanding of how PrPSc is Aebersold, R., Pipes, G., Hood, L. E. and Kent, S. B. H. (1988) N-terminal and internal sequence determi synthesized, either from PrPC or a precursor. nation of microgram amounts of proteins separated 1 in Immobiline isoelectric focusing gels. Departments of Neurology and 'Biochemistry and Electrophoresis, in press. Biophysics, University of California, San Francisco, Aebersold, R., Teplow, D. B., Hood, L. E. and Kent, S. CA. B. H. (1988) A novel approach to isolation of proteins for microsequence analysis: Electro blotting onto activated glass. In: Modem Methods 98. Improved Sequencing Yields for Proline in Protein Chemistry, L'Italien, J. J. (Ed.), Plenum Containing Samples Through Programmed Press, New York, in press. Increases in Cleavage Temperature Barry, R. A., Vincent, M. T., Kent, S. B. H., Hood, L. E. and Prusiner, S. B. (1988) Characterization of David B. Teplow, Haul Wong prion proteins with monospecific antisera to A recurring problem in automated protein sequence synthetic peptides. J. Immunol. 140, 1188-1193. Beall, S. S., Concannon, P., Charmley, P., McFarland, analysis using the Edman chemistry is incomplete H. F., Gatti, R. A., Hood, L. E., Mcfarlin, D. E. cleavage of the peptide bond between PTC-proline and and Biddison, W. E. (1988) The germ line repertoire of T-cell receptor beta chain genes in patients with its neighboring amino acid. This results in substantial multiple sclerosis. J. N euraimmunol., in press. praline lag, as well as lag from the amino acids in sub Birren, B. W., Lai, E., Clark, S. M., Hood, L. and Simon, M. I. (1988) Optimized conditions for sequent cycles. Combined with the normal increase in pulsed-field-gel electrophoretic separations of background observed during sequencing, due to internal DNA. Nucleic Acids Res. 16, 7563-7582. Boylan, K. B., Takahashi, N., Diamond, M., Hood, L. E. polypeptide chain cleavages, and with signal losses due and Prusiner, S. B. (1987) DNA length poly to sample washout, inc;::omplete praline cleavage places morphism located 5' to the human myelin basic protein gene. Am. J. Hum. Genet. 40, 387-400. severe limitations on the quantity and quality of Braciale, T. J., Braciale, V. L., Winkler, M., sequence information obtainable. Stroynowski, I., Hood, L., Sambrook, J. and Gething, M.-J. (1987) On the role of the trans Studies have been done of the effects of repetitive membrane anchor sequence of influenza hemag cleavage cycles, of time, and of temperature on glutinin in target cell recognition by class I MHC restricted hemagglutinin-specific cytolytic T praline cleavage efficiency, specifically, and on lymphocytes. J. Exp. Med. 166, 678-692. sequencing efficiency in general. These data were Clark, S. M., Lai, E., Birren, B. W. and Hood, L. ( 1988) A novel instrument for separating large DNA generated using liquid-phase cleavage in an Applied molecules using pulsed homogeneous electric fields. Biosystems Model 477 A instrument. The flexible Science, in press. Clark-Lewis, I., Hood, L. E. and Kent, S. B. H. (1988) programming capability of this instrument has allowed The role of disulfide bridges in determining the us to design a new cycle, used at positions containing biological activity of interleukin-3. Proc. Natl. Acad. Sci. USA, in press. proline, that markedly diminishes proline lag. This has Clark-Lewis, I. and Kent, S. B. H. (1988) Synthesis, substantially improved our ability to sequence proline purification and characterization of biologically active peptides. In: Receptor Biochemistry and containing samples. Methodology, Venter, J. C. and Harrison, L. C. (Series Eds.), The Use of HPLC in Protein Purification and Characterization, Kerlavage, A. R. (Vol. Ed.), Alan R. Liss, Inc., New York, in press. Clark-Lewis, I., Lopez, A., Luen, B., Vadas, M., PUBLICATIONS Schrader, J. W., Hood, L. E. and Kent, S. B. H. (1988) Structure-function studies of human Aebersold, R. H., Leavitt, J., Saavedra, R. A., Hood, granulocyte-macrophage colony-stimulating factor: L. E. and Kent, S. B. H. (1987) Internal amino acid Identification of amino acids required for activity, ~equence analysis of proteins separated by one- or and an 84--residue active fragment. J. Immunol., in two-dimensional gel electrophoresis after in situ press. protease digestion on nitrocellulose. Proc. Nat!. Clark-Lewis, I., Lopez, A. F., Vadas, M., Schrader, J. Acad. Sci. USA 84, 6970-6974. W., Hood, L. and Kent, S. B. H. (1988) Structure Aebersold, R., Pipes, G., Nika, H., Hood, L. E. and function studies of lymphokines by total chemical Kent, S. B. H. ( 1988) Covalent immobilization of synthesis. In: Proceedings of the 5th International proteins for high sensitivity sequence analysis: Lymphokine Workshop, Pierce, C. W. (Ed.), Humana Electroblotting onto DITC glass from SDS-PAGE. Press, New Jersey, in press. Biochemistry 27, 6880-6887. Clark-Lewis, I., Lopez, A. F., Vadas, M., Schrader, J. Aebersold, R., Pipes, G. D., Wettenhall, R., Nika, H., W., Hood, L. E. and Kent, S. B. H. (1987) Chemical Hood, L. E. and Kent, S. B. H. ( 1988) High synthesis of hemopoietic growth factors: An efficiency covalent coupling of picomole amounts approach to protein design. In: Protein Structure of polypeptides for solid phase sequence analysis. and Design, Oxender, D. (Ed.), New Series, Vol. 69, Biochemistry, in press. UCLA Symposia on Molecular and Cellular Biology, Alan R. Liss, Inc., New York, pp. 417-421. 67 Concannon, P ., Lai, E., Speiser, C., Klein, M., Barth, Lai, E., Concannon, P. and Hood, L. ( l 988) Conserved R. and Hood, L. ( 1988) Human T-cell receptor organization of the human and murine T-cell genes: Diversity, polymorphism, and a physical map receptor s gene families. Nature 331, 543-546. of the 8 locus. In: Recent Advances in Leukemia Landegren, U., Kaiser, R., Caskey, C. T. and Hood, L. and Lymphoma, New Series, Volume 60, UCLA (l 988) DNA diagnostics - molecular techniques and Symposia on Molecular and Cellular Biology, Gale, automation. Science, in press. R. P, and Golde, D. W. (Eds.), Alan R. Liss, Inc., Landegren, U., Kaiser, R., Sanders, J. and Hood, L. New York, pp. 3-12. (1988) A ligase-mediated gene detection technique. Fisher, D. A., Pecht, M. and Hood, L. (1988) DNA Science, in press. sequence of a class I pseudogene from the Tla Landegren, U., Siu, G. and Hood, L. (1987) Develop region of the murine MHC: Recombination at a B2 ment of T lymphocytes. In: Molecular Approaches Alu-like repetitive sequence. J. Mol. Evol., in to Developmental Biology, Firtel, R. A. and press. Davidson, E. H. (Eds.), Alan R. Liss, New York, pp. Hood, L. (1988) Biotechnology and medicine of the 439-452. future. JAMA 259, 1837-1844. Moos, M., Tacke, R., Scherer, H., Teplow, D. and Hood, L. (l 988) The role of chemistry. In: The Impact Schachner, M. ( l 988) The neural cell adhesion of Chemistry on Biotechnology, Phillips, M., molecule LI is a member of the immunoglobulin Shoemaker, S. P ., Middlekauff, R. D. and superfamily and shares binding domains with fibro Ottenbrite, M. (Eds.), American Chemical Society, nectin. Nature, in press. Washington, D.C., pp. 2-10. Neurath, A. R. and Kent, S. B. H. ( 1988) The Pre-S Hood, L. E., Hunkapiller, M. W. and Smith, L. M. (1987) region of hepadnavirus envelope proteins. In: Automated DNA sequencing and analysis of the Advances in Virus Research, Vol. 34, Maramorosh, human genome. Genomics I, 201-212. K., Murphy, F. A. and Shatkin, A. J. (Eds.), Jameson, B. A., Rao, P. E., Kong, L. I., Hahn, B. H., Academic Press, New York, in press. Shaw, G. M., Hood, L. E. and Kent, S. B. H. (l 988) Neurath, A. R., Kent, S. B. H., Strick, N. and Parker, Location and chemical synthesis of a binding site K. (1987) Biological role of Pre-S sequences of the for HIV-I on the CD4 protein. Science 240, 1335- hepatitis B virus envelope protein. In: Hepadna 1339. Viruses, Robinson, W. (Ed.), Alan R. Liss, Inc., New Kappes, J.C., Morrow, C. D., Lee, S.-W., Jameson,- B. York, pp. 189-203. A., Kent, S. B. H., Hood, L. E., Shaw, G. M. and Neurath, A. R., Kent, S. B. H., Strick, N. and Parker, Hahn, B. H. (1988) Identification of nova! retroviral K. (1988) Delineation of contiguous determinants gene unique to HIV-2 and SIV MAC" J. Viral., in essential for biological functions of the Pre-S press. sequence of the hepatitis B virus envelope protein: Kent, S. B. H. (1988) Chemical synthesis of peptides Antigenicity, immunogenicity, cell-receptor and proteins. (Review.) Ann. Rev. Biochem. 57, recognition. Ann. Inst. Pasteur/Viral. 139, 13-38. 957-984. Nicholson, B. J., Dermietzel, R., Teplow, D., Traub, Kent, S. B. H. and Parker, K. F. ( 1988) The chemical O., Willecke, K. and Revel, J.-P. (1987) Hepatic synthesis of therapeutic peptides and proteins. In: gap junctions are comprised of two homologous Therapeutic Peptides and Proteins: Assessing the proteins of MW 28,000 and 21,000. Nature 329, New Technologies, Proceedings of the Banbury 732-734. Center Conference at Cold Spring Harbor, Cold Passmore, H. C., Kobori, J. A., Zimmerer, E. J., Spring Harbor Press, New York, pp. 3-30. Spinella, D. G. and Hood, L. (1987) Molecular Kent, S. B. H., Parker, K. F., Schiller, D. L., Woo, D. characterization of meiotic recombination within D.-L., Clark-Lewis, I. and Chait, B. T. (1988) the major histocompatibility complex of the mouse. Synthesis and characterization of peptides and Mapping of crossover sites within the I region. proteins. In: Peptides: Chemistry and Biology, Biochem. Genet. 25, 513-526. Marshall, G. R. (Ed.), Proceedings of the 10th Popko, B., Puckett, C. and Hood, L. (1988) A novel American Peptide Symposium, ESCOM, Leiden, pp. mutation in myelin-deficient mice results in 173-178. unstable myelin basic protein gene transcripts. Klein, M. H., Concannon, P., Everett, M., Kim, L. D. Neuron l, 221-225. H., Hunkapiller, T. and Hood, L. (1987) Diversity Popko, B., Puckett, C. and Hood, L. (1988) The use of and structure of human T-cell receptor a.-chain molecular biology in the understanding, diagnosis, variable region genes. Proc. Natl. Acad. Sci. USA and treatment of central nervous system disorders. 84, 6884-6888. In: Neurosurgery: State of the Art Reviews, Korber, B., Hood, L. and Stroynowski, I. (l 988) Apuzzo, M. (Ed.), Henley and Belfus, Inc., Regulatory elements in the promoters of the H-2 Philadelphia, in press. · class I genes. In: Major Histocompatibility Genes Popke, B., Readhead, C., Dausman, J. and Hood, L. and Their Role in Immune Function, David, C. S. (1988) The production of transgenic mice and some (Ed.), Plenum Press, New York, in press. potential applications of the technique to questions Korber, B., Mermod, N., Hood, L. and Stroynowski, I. of neurobiological interest. In: N euromethods, ( 1988) Regulation of gene expression by Boultan, A. A., Baker, G. B. and Campagnoni, B. interferons: Control of H-2 promoter responses. (Eds.), Humana Press, New Jersey, in press. Science 239, 1302-1306. Puckett, C., Popko, B., Readhead, C., Shine, D. and Kuo, C.-L. and Hood, L. (l 987) Antigen/major histo Hood, L. (1988) Expression of the myelin basic compatibility complex-specific activation of protein gene in transgenic shiverer and mld mice. murine T cells transfected with functionally In: Discussions in Neurosciences (FESN), ISSN, rearranged T-cell receptor genes. Proc. Natl. Netherlands, in press. Acad. Sci. USA 84, 7614-7618. Saavedra, R. A. (19&&) On transition metal ions and protein interactions in chromatin. BioEssays 8, 32- 34. 68 Schneider, J. and Kent, S. B. H. (1988) Enzymatic Ziltener, H. J., Clark-Lewis, I., de St. Groth, B. F., activity of a synthetic 99 residue protein corre Orban, P. C., Hood, L. E., Kent, S. B. H. and sponding to the putative HIV-I protease. Cell 54, Schrader, J. W. (1988) Monoclonal antipeptide 363-368. antibodies recognize IL-3 and neutralize its bio Schrader, J. W., Clark-Lewis, I., Fazekas, B., Hood, L. activity in vivo. J. Immunol. 140, 1182-1187. E., Kent, S. B. H., Leslie, K. B., Schrader, S. and Ziltener, H. J. (1987) Structure and function of the panspecific hemopoietin interleukin-3. In: Integration and Control of Metabolic Processes: Pure and Applied Agpects, Lon, 0. L. (Ed.), Cambridge University Press, Cambridge, U.K., pp. 211-219. Smith, L. M., Kaiser, R. J., Sanders, J. z. and Hood, L. Professor: Elias Lazar ides E. (1987) The synthesis and use of fluorescent Senior Research Fellows: John V. Cox, Catherine M. oligonucleotides in DNA sequence analysis. Meth. Woods Enzymol. 155, 260-30 I. Research Fellows: Alexander Artiskevsky, Nigel R. Smith, L. M., Sanders, J. Z., Kaiser, R. J. and Hood, L. Burns, Marios A. Cariolou, John J. Ngai, Michael E. (1987) Automated DNA sequencing and the Rodriguez, Frank 0. Sangiorgi, Pantelis Tsoulfas analysis of the human genome. In: Biotechnology Graduate Student: Jeffrey H. Stack in Clinical Medicine, Albertini (Ed.), Raven Press, Research and Laboratory Staff: Debra A. Carlyle, New York. Louise Cloutier, Parvin Hartsteen, Ting Yi Lin Soloski, M., Einhorn, G., Hood, L. and Stroynowski, I. (1988) Biochemical and molecular characterization of Qa region gene products. In: Major Support: The work described in the following research Histocompatibility Genes and Their Role in Immune reports has been supported by: Function, David, C. S. (Ed.), Plenum Press, New American Heart Association York, in press. Australian Medical Foundation Fellowship Soloski, M. J., Hood, L. and Stroynowski, I. ( 1988) Qa The Camille and Henry Dreyfus Foundation, Inc. region class I gene expression: Identification of a John Douglas French Foundation second class I gene, Q9, encoding a Qa-2 poly The Anna Fuller Fund peptide. Proc. Natl. Acad. Sci. USA 85, 3100-3104. E. S. Gosney Fund Tacke, R., Moos, M., Teplow, D. B., FrGh, K., Scherer, Lucille P. Markey Charitable Trust H., Bach, A. and Schachner, M. (1987) Identifi Muscular Dystrophy Associations of America, Inc. cation of cDNA clones of the mouse neural cell National Institutes of Health, USPHS adhesion molecule LI. Neurosci. Lett. 82, 89-94. National Science Foundation Teplow, D. B., Nakayama, C., Leung, P. C. and The Procter & Gamble Co. Harshey, R. M. (1988) Structure-function relation ships in the transposition protein B of bacterio phage Mu. J. Biol. Chem. 263, 10851-10857. Turk, E., Teplow, D. B., Hood, L. E. and Prusiner, S. B. Summary: The Lazarides laboratory is focusing on the (1988) Purification and properties of the ceUular and scrapie hamster prion proteins. Eur. J. problem of how differential gene expression deter Biochem ., in press. mines the three-dimensional phenotype of a cell during Urban, J. L., Kumar, V., Kono, D. H., Gomez, C., Horvath, S. J., Clayton, J., Ando, D. G., Sercarz, E. specification, development, and differentiation of a E. and Hood, L. ( 1988) Restricted use of T cell lineage. The lineage of choice is the erythroid. The receptor V genes in murine autoimmune encephalo myelitis raises possibilities for antibody therapy. shape of the red blood cell is determined by a sub Cell 54, 577-592. membranous shell of interacting polypeptides, a Wilson, R. K., Lai, E., Concannon, P., Barth, R. K. and Hood, L. E. (1988) Structure, organization and poly system.of intermediate filaments, and a marginal band morphism of murine and human T-cell receptor a of microtubules. Where red blood cells remain and a chain gene families. Immunol. Rev. IOI, 149- 172. nucleated (e.g., the avia~ and amphibian species), all Wilson, R. K., Yuen, A. S., Clark, S. M., Spence, c., three structural domains are required for determina Arakelian, P. and Hood, L. E. (1988) Automation of dideoxynucleotide DNA sequencing reactions using tion of the shape of this cell. In species where red a Beckman Biomek 1000 robotic workstation. blood cells are anucleate (e.g., the mammalian Biotechniques, in ptess. Woo, D. D.-L. and Kent, S. B. H. (1987) Purification of species), only the submembranous membrane skeleton synthetic proteins (total chemical synthesis of is maintained. Our laboratory is focusing on various human transforming growth factor-alpha). In: aspects of the regulation in expression, assembly, and Protein Purification: Micro to Macro, Burgess, R. (Ed.), Vol. 68, UCLA Symposia on Molecular and topogenesis of components of the membrane-skeleton Cellular Biology, Alan R. Liss, Inc., New York, pp. 49-73. and intermediate filaments from very early progenitor Woolf, T., Lai, E., Kronenberg, M. and Hood, L. (1988) ceUs in the erythroid lineage to postmitotic cells. We Mapping genomic organization by field inversion and two-dimensional gel electrophoresis: are developing parallel in vitro (e.g., transgenic mice Application to the murine T-ceU receptor y gene and chickens) and in vitro expression systems where we family. Nucleic Acids Res. 16, 3863-3875. 69 can manipulate the dosage of any one component of found in pCHB3-l. Specific antibody and oligo- these domains and evaluate the resulting effect in nucleotide probes against the region resulting from the normal assembly and overall cellular morphogenesis. fusion of the segments 5' and 3' to this hydrophobic By analyzing these parameters in the developmental region have been used to study the expression and pathway of nucleated and anucleate red blood cells, we localization of the pCHB3-2 band 3 variant that is venture to establish how phenotype determines geno apparently generated by alternative splicing. Immuno typic expression and vice versa in development, and blotting and RNA blot analysis have shown that the the physiological advantages that have resulted from pCHB3-2 variant is approximately 50 kDa in size and is these patterns of expression in the evolution of this encoded by an mRNA of 1.9 kb. Sequence analysis in lineage. conjunction with primer extension studies further In parallel with these studies we are investigating a suggest that the pCHB3-2 transcript initiates at unique class of mutants that blocks erythroid differen nucleotide 763 in the cytoplasmic domain of pCHB3-l. tiation at the last cell division. We hope that these Translation from this variant transcript would be mutants will give us a lead into the control of cell predicted to initiate at the AUG at nucleotide 1105, division during differentiation of a lineage. resulting in a polypeptide of 52 kDa that lacks the Finally, we are investigating the molecular basis of entire cytoplasmic domain of the pCHB3-l variant. the pathobiology of Alzheimer's disease by concen This prediction is in good agreement with the estimate trating on the biochemistry and expression of 13- obtained for the pCHB3-2 polypeptide of 50 kDa by amyloid, a protein that has been implicated in the immunoblotting analysis. The absence of the cyto pathogenesis of this disease. We wish to establish how plasmic domain in the pCHB3-2 variant is also consis this protein forms abnormal amyloid deposits during tent with its inability to interact with the erythroid neuronal aging and whether they are directly or membrane cytoskeleton as assayed by its solubility in indirectly involved in the etiology of this disease. detergent-containing buffers. Preliminary immuno fluorescence studies indicate that the pCHB3-2 variant 99. Characterization and Expression of a Variant is localized to an as yet unidentified intracellular Erythroid Anion Transporter Polypeptide membrane compartment while pCHB3-l is localized to John V. Cox the plasma membrane. Finally, expression studies have The chicken erythroid anion transporter (band 3) is indicated that the pCHB3-2 variant, unlike pCHB3-l, composed of an N-terminal cytoplasmic domain that is detected at high levels in a variety of nonerythroid provides the membrane attachment site for the tissues including heart, kidney, brain and skeletal erythrocyte membrane cytoskeleton and a C-terminal muscle. Currently, we are attempting to isolate full membrane-spanning region that mediates the electro length cDNAs corresponding to the pCHB3-2 variant to neutral exchange of internal bicarbonate for external investigate questions regarding the structure and chloride. Previous studies using band 3 antibodies and function of this variant band 3 polypeptide in erythroid cDNA clones have revealed that chicken band 3 is pri and nonerythroid cell types. marily composed of two polypeptides of 100 kDa and 105 kDa that are encoded by a single size mRNA of 4.4 100. Manipulation of the Membrane Cytoskeleton of Erythroid Cells in Transgenic Mice kb. Sequence analysis of the erythroid band 3 cDNA, pCHB3-l, which contains the entire coding region of John V. Cox, Frank O. Sangiorgi the band 3 polypeptide, has indicated that the N The cytoplasmic domain of the chicken erythroid terminal portion of the molecule is very hydrophilic band 3, which is the major integral membrane protein whereas the C-terminal anion transport domain con of erythroid cells, provides the membrane attachment tains 10 hydrophobic regions that have been postulated site for the membrane cytoskeleton through its inter to span the membrane as many as 12 times. However, action with the peripheral membrane cytoskeletal the recent characterization of additional band 3 components ankyrin and protein 4.1. Previous studies cDNAs has revealed a variant clone of 1.3 kb, have demonstrated that the extent of assembly of the pCHB3-2, that lacks one of the hydrophobic regions membrane cytoskeleton of erythroid cells fluctuates 70 considerably during embryonic development. However, previously that these cells do express all the major the role of the band 3 polypeptide in generating these peripheral components of the MS at rates equivalent to various structural phenotypes has been difficult to the maximal rates observed during late erythroblast address. To begin examining the role of band 3 in stages of development, when the cells are actively regulating the extent of assembly of the peripheral accumulating this domain. However, very low steady membrane cytoskeleton during development, we have state levels of these proteins are observed in these introduced into the germline of mice chimeric genes in AEV and Sl3 cells due to the fact that, although these which the full-length chicken erythroid band 3 cDNA, proteins do assemble transiently under the plasma pCHBJ-1, is under the control of the mouse s-major membrane they are rapidly turned over, apparently as glob in promoter. The levels of expression of chicken a complex. Surprisingly these cells do not appear to band 3 in these murine erythroid cells will be varied express the erythroid 100/105 kDa anion transporter, a through the use of additional constructs that contain major transmembrane protein of the mature red cell the human s-globin promoter plus the 5' enhancer or that had previously been regarded as the major alternatively the entire human a-globin "mini" locus. transmembrane receptor for the underlying MS. Upon The effect of varying the levels of expression of band induction of these cells to differentiate, the 100/105 3 on the extent of accumulation of the band 3 poly kDa anion transporter begins to be expressed con peptides as well as the extent of assembly of the comitantly with hemoglobin. This correlates with an peripheral membrane cytoskeleton will be assessed. accumulation of the peripheral MS components, due to Similar constructs containing only the cytoplasmic their increased t1 of the assembled polypeptides at the domain of band 3 or regions of the molecule corre plasma membrane.' We have therefore hypothesized sponding to the ankyrin or protein 4.1 binding sites, that the anion transporter does not play a role in which we have defined from in vitro studies, are also initiating -association of the MS with the plasma being introduced into the germline of mice. These membrane but instead regulates the extent of their cytoplasmic band 3 peptide fragments will presumably assembly by conferring stability against catabolism compete with membrane-associated band 3 for cyto (Woods et al., 1986). skeletal binding sites. In this way we will determine In order to test this hypothesis we have attempted the role of the individual cytoskeletal interactions of to introduce the full-length cDNA for the mature band 3 in regulating the extent of assembly of the I 00/ 105 kDa erythroid anion transporter into these erythroid membrane cytoskeleton during development. cells so that the effects of expression of the anion These studies should also prove useful in beginning to transporter can be assayed independently of the other define the function of the membrane cytoskeleton in multitude of changes that occur upon erythroid the establishment and maintenance of erythroid cell terminal differentiation. Direct transfection by shape. various techniques of the AT cDNA into AEV cells proved too toxic to these cells. Consequently, we are now developing a series of retroviral vectors based on IOI. Expression of the 100/10.5 kDa Anion Transporter in Virally Transfonned Erythroid Progenitor the AEV proviral structure itself. This work is in Cells collaboration with Dr. Jacques Samarut (Ecole Catherine M. Woods, Elias Lazarides Normale Superieuve, Lyons, France). In these vectors The use of the avian erythroblastosis virus (AEV) the AEV oncogenes have been replaced with the neo ES4 strain and the 513 virus to transform avian early mycin resistance gene (neoR) and the erythroid anion erythroid progenitor cells and block their differentia transporter cDNA. We have succeeded in using RAVI tion has proved useful in analyzing events that occur helper virus-infected chick embryo fibroblasts as before the stages of terminal differentiation packaging cells to generate virus containing the cDNA (putatively the CFU-e stage) of this cell lineage. In for the AT and neoR. These will now be used to infect particular, we have focused on the expression, AEV cells and to analyze the effect of anion synthesis and subsequent assembly reactions of the transporter expression on the stability and hence erythroid membrane skeleton (MS). We have shown accumulation of the peripheral MS. In addition, we 71 should be in a position to analyze the effects of concluded that the protein ankyrin, which serves as the premature accumulation of this structural domain that major membrane-linking protein for the spectrin-actin is so characteristic of the mature post-mitotic red cell network through its interaction with the trans phenotype on the transformation state of these early membraneous anion transporter, assembles onto pre erythroid progenitor cells. a_ssembled anion transporter during the biogenesis of In related experiments we plan to introduce the the membrane skeleton. However, from our studies anion transporter cDNA in the antisense orientation with AEV and 513 cells, it is clear that ankyrin and into AEV cells that are transformed with the hence spectrin can assemble onto the plasma temperature-sensitive (ts) mutant of AEV. These cells membrane, albeit unstably in the absence of the anion can be induced to undergo terminal differentiation by transporter. The question then arises as to whether an a simple shift from normal growth temperature of alternative membrane-binding site exists for ankyrin in 37°C to 42°C. In theory, these cells carrying the these cells. Biochemical analysis of native ankyrin antisense vector should neutralize the expression of spectrin-actin complexes from the membrane has the endogenous anion transporter 100/105 kDa protein. failed to reveal the presence of any potential poly Then the effect of lack of expression of the 100/105 peptide candidate for an alternative binding site. An kDa anion transporter during terminal differentiation alternative possibility is that ankyrin itself interacts on the final erythroid phenotype can be evaluated. directly with the lipid bilayer. Previous studies from If we are successful in using these vectors to get this laboratory had shown that ankyrin is actively fatty efficient expression of the anion-transporter cDNA in acid acylated with palmitic acid in both immature and AEV cells, this will open up many avenues of research. mature red cells (Staufenbiel and Lazarides, 1986). We For example, since these cells are unique in that they have shown that ankyrin in transformed erythroid maximally express the peripheral components but are progenitor cells is likewise actively acylated with null in the anion transporter, we will be able to dissect palmitate once associated with the membrane. out functional domains of the anion transporter by Inhibitors of fatty acid biosynthesis appear to inhibit introducing the anion transporter cDNA that carries assembly of newly-synthesized ankyrin onto the deletions in, for example, the putative ankyrin or membrane in these cells. This in turn is associated protein 4.1 binding sites. In this manner we should be with inhibition of the assembly of newly-synthesized able to evaluate the role of these respective binding spectrin. These studies are being pursued further to interactions in conferring stability to the MS in vivo. determine the exact role that fatty acid acylation This system will also enable us to evaluate the role of plays in the initial assembly of ankyrin onto the plasma structural proteins that as yet play an unknown role in membrane and its mechanism. the biogenesis of the MS. For example, the protein Reference: gelsolin is down-regulated by several orders of Staufenbiel, M. and Lazarides, E. (1986) Proc. Natl. Acad. Sci. USA 83, 317-322. magnitude at the onset of terminal differentiation of these erythroid progenitor cells. The importance of this down regulation on the marked reorganization of 103 •. Molecular Mechanisms of Generation of actin that occurs concomitantly with this event can be Protein 4.1 Variants in Erythroid Development evaluated by introducing the gelsolin cDNA under AEV Jeffrey H. Stack LTR (see Abstract No. 105). Protein 4.1 exists in chicken as a set of poly Reference: peptides ranging from 77 kDa to 17 5 kDa. This diverse Woods, C. M., Boyer, B., Vogt, P. K. and Lazarides, E. set of proteins is derived from a single 4.1 gene and a (1986) J. Cell Biol. 103, 1789-1798. single size class RNA of 6.5 kb (Ngai et al., 1987). Alternative RNA splicing has also been demonstrated 102. The Role of Fatty Acid Acylation in Assembly of as a mechanism of generating this diversity. Other Ankyrin Onto the Plasma Membrane possibilities include alternative sites of transcription Catherine M. Woods or translation initiation and/or termination and From in vitro biochemical studies, it has been different polyadenylation sites. In order to address 72 this problem, protein 4.1 cDNA clones have been ternary complex with spectrin and actin. Using isolated from a •gtlO library made from erythroid purified protein 4.1, spectrin, and actin, it can be poly(At RNA enriched for 4.1 transcripts by sucrose shown that the 77 kDa variant found in mature chicken gradient fractionation. The unamplified library has erythrocytes is not capable of binding spectrin or yielded several hundred independent 4.1 clones. The forming the ternary complex between spectrin and entire 6.5 kb message has been isolated using over actin in vitro. A fragment of human protein 4.1 lapping partial cDNA clones and 45 kb of overlapping responsible for forming the ternary complex has been genomic clones representing 3.5 kb of the message sequenced at the amino acid level. This spectrin-actin have also been isolated. Comparison of cDNA clones binding domain has been identified in the chicken at the restriction map or sequence level in regions cDNAs isolated (Abstract No. 103). Using oligo known by Sl nuclease protection assays to contain nucleotide probes, a partial cDNA clone containing an multiple RNAs should reveal areas of sequence poly in-frame deletion of the spectrin-actin binding domain morphism. Isolation of full-length cDNAs and their in has been isolated. [n order to identify the particular vitro transcription-translation should also allow polypeptide variant encoded by this cDNA (presumably RNA-+polypeptide determinations in conjunction with the 77 kDa variant that cannot form the ternary sequence-generated translation. Monoclonal antibodies complex), a peptide will be synthesized corresponding specific for certain variants and subsets of variants to the junction amino acids in the deleted molecule (see Biology 1987, Abstract No. 91) should also be of and an antibody against this synthetic peptide will be use. Since protein 4.1 is known to associate with many raised in rabbits. Use of this antibody should establish erythrocyte polypeptides including spectrin, actin, the identity of the polypeptide derived from the RNA band 3, and glycophorin, it is an attractive hypothesis corresponding to this cDNA and allow determination of that these diverse variants are splicing in or out assembly characteristics and subcellular localization functional binding domains (see Abstract No. 104) and at the light and electron microscope levels. expression of particular variants is therefore capable Genomic clones corresponding to the spectrin-actin of having profound effects on the stability or binding domain have also been isolated. Sequence flexibility of the cell due to protein 4.1 's many known analysis indicates that this domain is composed of two cytoskeletal interactions. separate exons and therefore the deleted cDNA clone represents the coordinated removal of these two exons Reference: Ngai, J., Stack, J. H.,. Moon, R. T. and Lazarides, E. to form this RNA. SJ and RNase protection assays are (1987) Proc. Natl. Acad. Sci. USA 84, 4432-4436. being used to measure the relative abundance of this transcript during erythroid development and in other 104. Functional Differences in Protein 4.1 Variants: tissues known to contain protein 4. l (myeloid, A Variant Lacking the Spectrin-Actin Binding lymphoid, lens). Domain Reference: Jeffrey H. Stack, Nigel R. Burns Ngai, J., Stack, J. H., Moon, R. T. and Lazar ides, E. (1987) Proc. Natl. Acad. Sci. USA 84, 4432-4436. Protein 4.1 is known to function in the red cell as a component of a complex with the cytoskeletal proteins spectrin and actin, and its classical biochemical 105. Structural and Functional Analysis of Gelsolin definition is derived from its ability to promote the in Avian Erythroid Cells formation of this ternary complex between these poly Pantelis Tsoulfas peptides in vitro. Protein 4.1 in chickens consists of a Actin, the main protein of microfilaments, has a heterogeneous set of polypeptides ranging from 77 kDa central role in the structural proteinaceous network to 175 kDa that are derived from a single gene. underlying the plasma membrane of erythrocytes. Differential RNA splicing of protein 4.1 has been Actin is almost completely polymerized (filaments) demonstrated in the chicken (Ngai et al., 1987). under physiological ionic conditions, so that . the Biochemical data have been generated indicating that regulation of its assembly is mediated by the action of not all the 4.1 variants are capable of forming the specific binding proteins. One strong candidate of 73 2 microfilament assembly is gelsolin. Gelsolin is a Ca + 106. Identification of Vimentin Regulatory Sequences by Introduction of Chimeric Chicken-Hams~er and polyphosphoinositide-regulated actin-binding pro Vimentin Genes into Murine Erythroleukemia tein that is widely distributed in the cells of Cells -6 M C 2+ vertebrates. In the presence of >10 µ a , John J. Ngai gelsolin nucleates actin filament assembly, fragments We have shown previously that the extensive actin filament and blocks their fast growing (+} ends. diminution of vimentin mRNA levels during In vitro studies show that polyphosinositides inhibit differentiation of murine erythroleukemia (MEL) cells actin severing by gelsolin and dissociate actin-gelsolin is effected by both transcriptional and post complexes. Recently, a strong negative regulation of transcriptional mechanisms (Ngai et al., 1987). In gelsolin expression during chicken erythroid differen contrast, transfected chicken vimentin genes are up tiation has been shown (Hinssen et al., 1988). From regulated during MEL cell differentiation, and the quantitations of its steady-state molar ratio to actin, increase in chicken vimentin RNA approximates the gelsolin is abundant in early progenitor cells as increase in transcription of the transfected gene (Ngai revealed from avian erythroblastosis virus and 513 et al., 1987). The behavior of the chicken vimentin virus-transformed cells, which are arrested at the gene in MEL cells is similar to its observed induction colony forming unit erythroid (CFU-e) stage of in chicken erythropoiesis. In order to define the cis erythroid development. During chicken embryo acting elements responsible for the divergent expres development and maturation, the expression of gelsolin sion of avian and mammalian vimentin genes during 3 decreases by a factor of -10 in erythroid cells. This the respective erythropoietic programs, we have begun down regulation is independent from that of actin by constructing chimeric hamster-chicken vimentin which is considerably less. This suggests that gelsolin genes and studying their expression in differentiating in erythroid cells is involved in a negative fashion in MEL cells. Both hamster and chicken vimentin genes the assembly of the actin filaments present in the show a common structure of nine exons, with each membrane skeleton, and that it may provide for a exon-intron border corresponding to the same respec mechanism, by means of its severing action on actin tive amino acid codon. Chimeric hamster-chicken filaments, to extend the network of the spectrin-actin genes have been produced with the junction points in based membrane skeleton in erythroid cells during the large (-2.5 kb) second intervening sequence. In the erythropoiesis. To understand the molecular case of the 5' chicken-3' hamster vimentin construct mechanism of down regulation and the role of this (p5Ch3H), the junction lies -350 bp downstream of the protein in the assembly of the erythroid membrane second exon, and in the case of the 5' hamster-3' cytoskeleton, we are analyzing, with a recently cloned chicken vimentin construct (p5H3Ch), the junction human probe (Kwiatkowski et al., 1986), a cDNA resides -370 bp downstream of the second exon. Both library in AgtlO made from chicken early erythroid p5Ch3H and p5H3Ch have been successfully introduced progenitor cell mRNA. The next step will be to into MEL cells by calcium phosphate-DNA precipita subclone chicken gelsolin cDNA(s) in modified retro tion, and MEL cell clones currently are being analyzed viral vectors and infect early erythroid progenitor for exogenous vimentin gene expression in the cells transformed with a temperature-sensitive mutant presence or absence of chemical inducer. By a of avian erythroblastosis virus which can differentiate combination of steady state RNA analyses and in vitro by temperature shift along a normal pathway (see nuclear run-on transcription experiments, we expect to Abstract No. IOI). ascribe transcriptional and posttranscriptional roles to References: the 5' and 3' domains of the hamster and chicken Hinssen, H., Vandekerckhove, J. and Lazarides, E. vimentin genes in the erythropoietic environment. (1988) J. Cell Biol. 105, 1425-1433. Kwiatkowski, D. J., Stossel, T. P., Orkin, S. H., Mole, Following the results of these studies, the expression J. E., Colten, H. R. and Yin, H. L. (1986) Nature of a more detailed and exhaustive array of fusion 323, 455-458. genes and deletion mutant genes will be examined in transfected MEL cells, in order to more precisely 74 define the sequences responsible for the tran Reference: Giese, G. and Traub, P. (1986) Eur. J. Cell Biol. 40, scriptional and posttranscriptional regulation of 266-274. vimentin expression in erythropoiesis. Reference: 108. The Targeted Expression of an Exogenous Ngai, J., Bond, v. C., Wold, B. J. and Lazarides, E. Vimentin Gene in the Erythroid Cells of (1987) Mo!. Cell. Biol. 7, 3955-3970. Transgenic Mice Frank 0. Sangiorgi, John J. Ngai I 07. Inducible Vimentin Expression in Murine The hematopoietic system provides a useful model Myeloma Cells to examine the change in intermediate filament John J. Ngai organization during cellular differentiation. A Murine plasma cell tumors represent one of the few structural role for vimentin filaments in chicken examples where vimentin is not expressed in cultured erythrocytes has been inferred from morphological cells. However, upon exposure to 12-0-tetradecanoyl observations (Granger and Lazarides, 1982) and phorbol-13-acetate (TPA), MPC-11 myeloma cells have molecular biological analyses (Capetanaki et al., been shown to accumulate vimentin mRNA and 1983). These filaments form a network that attaches vimentin filaments (Giese and Traub, 1986). The rapid to the cell membrane and appears to anchor the and extensive induction of vimentin expression in TPA centrally located nucleus. In contrast, vimentin treated MPC-11 cells suggests a convenient oppor filaments are absent from mature mammalian erythro tunity for studying the transcriptional and post cytes, having been lost during the early to late transcriptional regulation of the vimentin gene in erythroblastic stages of erythropoiesis (Dellagi et al., hematopoietic cells. By quantitative primer extension 1983). This evidence leads to the hypothesis that analysis, we have found that vimentin mRNA increases enucleation during mammalian erythropoiesis is to -40 times control levels in MPC-11 cells after 6 hr facilitated by the loss of vimentin filaments. 8 exposure to 3 x 10- M TPA. Interestingly, in vitro To investigate the contribution of vimentin nuclear run-on transcriptions reveal little or no change filaments to erythroid morphogenesis in mammals, the in vimentin gene transcription under the same approach has been to direct the expression of chicken conditions. An analysis of nuclear and cytoplasmic vimentin to murine erythroid cells. Initial experiments RNA levels further shows that the large increase in entailed the introduction into the germline _of mice of cytoplasmic transcript lags behind a somewhat smaller a chimeric gene incorporating a full-length chicken increase in nuclear transcript, and that after 6 hr of vimentin cDNA under the transcriptional control of TPA induction, the level of nuclear transcript has not the murine a-major hemoglobin promoter. Recent yet reached a plateau. In contrast, cytoplasmic y work has resulted in the construction of a chimeric actin RNA levels increase almost immediately in minigene capable of expressing vimentin throughout response to TPA, showing an overall -2-fold induction the erythroblastic stages of red cell differentiation. by 4-6 hr of exposure to TPA, whereas nuclear y-actin This new minigene places the transcription of the RNA levels increase to a plateau value of 150% at 4-6 vimentin cDNA under the control of the Friend murine hr. Together these results suggest that TPA causes leukemia viral 3'-long terminal repeat (Fr MuLV LTR), changes in the rates of nuclear turnover, processing, an LTR that has a demonstrated tissue specificity for and/or nuclear-cytoplasmic transport of vimentin RNA erythroid cells both in vitro (Bosze et al., 1986) and in 3 in MPC-11 cells. In vivo H-uridine pulse-labeling and vivo (Chatis et al., 1984). The Fr MuLV LTR-vimentin pulse chase experiments will be needed to ascertain cDNA recombinant has been purified away from vector which of these mechanisms are responsible for the sequences and microinjected into fertilized mouse rapid increase in vimentin mRNA in MPC-11 cells oocytes. At present, six transgenic mice have been exposed to TPA. Following the results of these identified, with the copy number of the exogenous studies, it should be possible to define the responsive DNA ranging from one to three copies per haploid cis-acting sequences by transfection of altered or genome. Transgenic lines are now being developed mutated vimentin genes into MPC-11 cells. frotit these mice, and the offspring will be examined 75 for the expression of chicken vimentin throughout the demonstrated by two-dimensional gel electrophoresis different stages of mammalian erythropoiesis. In of metabolically labeled cells, was in agreement with addition, we anticipate that this approach may be used the Western blot and immunofluorescence results. with modified vimentin cDNAs so as to examine the Finally, the analysis of the vimentin mRNA level in effects of the alterations on the assembly and these cells by the primer extension technique depicted localization of these filaments in erythroid cells. a decrease in the amount of this particular RNA, paralleling the decline in vimentin synthesis. References: Bosze, z., Thiesen, H.-J. and Charnay, P. (1986) These data thus demonstrate the existence of a EMBO J. 5, 1615-1623. vimentin filament network early in the development of Capetanaki, Y. G., Ngai, J., Flytzanis, C. N. and Lazarides, E. (1983) Cell 35, 411-420. the primitive erythroid cells, followed by the eventual Chatis, P. A., Holland, L. A., Silver, J. E., disappearance of these filaments from day 12 onward. Frederickson, T. N., Hopkins, N. and Hartley, J. E. (1984) J. Virol. 52, 248-254. Acridine orange-flow cytometric analysis of these Dellagi, K., Vainchenker, W., Vinci, G., Paulin, D. and cells (performed at the Caltech Cell Sorting Facility) Bronet, J.C. (1983) EMBO J. 2, 1509-1514. Granger B. L. and Lazar ides, E. ( 1982) Cell 30, indicates that the above sequence of events occurs 263-275. while the cells are still mitotically active. The ·decrease in vimentin mRNA, and therefore of vimentin 109. The Intermediate Filament Cytoskeleton of subunits and filaments, is a programmed event in the Murine Primitive Erythrocytes relatively short lifespan of these nucleated erythro Frank 0. Sangiorgi, Catherine M. Woods cytes. An hypothesis may then be proposed that the During the embryonic and fetal development of the process of enucleation in the definitive lineage of mouse, there is a change in the site of erythropoiesis erythrocytes may require yet another cellular and the sequential appearance of two morphologically process( es), in addition to the- removal of intermediate distinct erythroid cell lineages. The yolk sac blood filaments, which is clearly absent in the primitive islands are the only source of red cells in the mouse erythroid generation. embryo from the 8th to the 12th day of development. Reference: Unlike the adult erythrocytes, this primitive genera Kovach, J. S., Marks, P.A., Russell, E. S. and Epler, H. (1967) J. Mal. Biol. 25, 131-11>2. tion consists of large nucleated red cells synthesizing predominantly embryonic hemoglobins. Large numbers llO. Control of Cell Division in Erythroid of enucleated erythrocytes of the definitive lineage Differentiation are subsequently formed in the fetal liver at 12 to 14 Elias Lazarides, Catherine M. Woods, Debra A. Carlyle days of development (Kovach et al., 1967). Steven E. Bloom 1 At a gross morphological level, the primitive What controls the number of cell divisions during erythroid cells of the mouse appear similar to the the differentiation of a lineage is unclear. We are mature erythrocytes of the chicken. On the basis of concentrating on analyzing biochemically and this comparison, murine primitive erythrocytes were molecularly a rare mutation that affects cell division examined with regard to vimentin, a constituent of the of turkey red blood cells. Hatched turkeys homozygous intermediate filament cytoskeleton. Initial Western for the bn gene display binucleated and large blot analyses of primitive red cells isolated at mononucleated red blood cells (RBCs) in peripheral different days of gestation revealed the decline in the blood. The binucleation is the result of cell division steady state level of vimentin by day 12, after which errors during the maturation of the RBC in the bone the protein was ·no longer detected. These observations marrow. The abnormal nuclear phenotypes observed in were confirmed and extended by immunofluorescence red cells are a result of nondisjunction of chromosomes microscopy of these cells in which vimentin filaments due to improper formation of the mitotic spindle were clearly visible from 8 to 12 days, followed by the apparatus and improper separation of duplicated collapse of these filaments into perinuclear bundles centrioles. We have identified a protein present in and elimination from the cells. The gradual decline in normal red blood cells and absent in mutant red blood vimentin synthesis from the 8th to the 11th day, as cells. We have succeeded in raising an antibody 76 against this protein and it confirms the presence of we intend to develop in vitro binding assays. We will this protein in normal RBCs and its absence from raise polyclonal antibodies to in vitro synthesized e mutant RBCs. This protein is expressed in a number of amyloid peptides and attempt to coprecipitate 6 terminally differentiated cells but not in un amyloid and other proteins from cellular extracts. An differentiated progenitor cells. We are in the process alternative approach will be to radioactively label e of cloning this protein as well as trying to immuno amyloid and use this to detect homophilic and localize it in cells. We hope that this protein will lead heterophilic interactions with other proteins bound to us to an analysis of the mechanisms of cell division nitrocellulose filters. during differentiation. Overall, this experimental approach is directed 1Department of Poultry Science, Cornell University, towards establishing the normal metabolism and inter Ithaca, NY. actions of the 6 amyloid protein and the role of this protein in the development of the major pathological features of Alzheimer's disease. 111. 8-Amyloid Expression in Transgenic Mice Michael Rodriguez Senile dementia of Alzheimer's type (SDA T) is PUBLICATIONS characterized by area-specific neuronal loss and the Cox, J, V. and Lazarides, E. (1988) Alternative primary accumulation of abnormal fibrillar structures within structures in the transmembrane domain of the neurones (neurofibullary tangles; NFTs), in the peri chicken erythroid anion transporter. Mal. Cell. Biol. 8, IJ27-IJ35. neuronal neuropil (amyloid plaque cores) and in the Cox, J, V., Stack, J, H. and Lazarides, E. (1987) walls of leptomeningeal and cortical vessels (congo Erythroid anion transporter assembly is mediated by a developmentally regulated recruitment onto a philic angiopathy). The pathogenesis o.f these preassembled membrane skeleton. J. Cell Biol. structures is unknown but they are all believed to 105, 1405-1416. Hinssen, H., Vandekerckhove, J, and Lazarides, E. contain a common peptide (A4) which is derived from a (1987) Gelsolin is expressed in early erythroid normal protein of unknown function (s amyloid). progenitor cells and negatively regulated during erythropoiesis. J. Cell Biol. 105, 1425-1433. To study the role of B amyloid in the pathogenesis Lazarides, E. (1987) From genes to structural morpho of these structures, we have constructed transgenic genesis: The genesis and epigenesis of a red blood cell. Cell 51, 345-356. mice and murine L cell lines harboring the a amyloid Ngai, J,, Bond, V. C., Wold, B. J. and Lazarides, E. cDNA under the control of the inducible mouse (1987) Expression of transfected vimentin genes in differentiating murine erythroleukemia cells metallothionine I promoter. Using these model reveals divergent cis-acting regulation of avian and systems, we hope to induce overproduction of the a mammalian vimentin sequences. Mol. Cell. Biol. 7, 3955-3970. amyloid protein and assess the effects on the normal Ngai, J., Stack, J. H., Moon, R.T. and Lazarides, E. pattern of expression, synthesis and turnover. (1987) Regulated expression of multiple chicken erythroid membrane skeletal protein 4.1 variants is We are also generating transgenic mice using the a governed by differential RNA processing and trans amyloid cDNA under the control of a neurone-specific lational control. Proc. Natl. Acad. Sci. USA 84, promoter (SCGIO). These studies will allow us to 4432-4436. Woods, C. W. and Lazarides, E. (1988) The erythroid determine whether over expression of B amyloid will membrane-skeleton: Expression and assembly during erythropoiesis. Ann. Rev. Medicine 39, 107- result in the production of A in vivo, how this process 4 122. is controlled as a function of aging and how amyloid fibril formation is initiated and propagated. We will also study the normal metabolism of e amyloid in various neuronal and non-neuronal cell lines. Both amyloid plaque cores and NFTs are composed of several proteins including tau, MAP2 and ubiquitin. Whether this represents normal or pathologic inter action is unclear. To investigate the normal inter actions between a amyloid and other cellular proteins, 77 Professor: Edward B. Lewis Collaborative studies with Dr. Welcome Bender's Senior Research Fellow: Susan E. Celniker laboratory at Harvard Medical School have identified Research Fellows: Leila M. Posakony, Sarah M. Smolik-Utlaut still another unusual property of at least one major Research and Laboratory Staff: Rollin H. Baker, regulatory region of the complex, the bithoraxoid (bxd) Lucia Jourdau-Tuccillo, Daniel J. Keelan, Scott L Rosenfeld region. Thus, within that region, the closer the break age point is to the next most proximal gene, Ultra Support: The work described in the following research bithorax (Ubx), the stronger is the loss-of-function in reports has been supported by: the bxd region. In other words inactivation of the bxd American Cancer Society March of Dimes region by chromosomal breakage points is polarized in Lucille P. Markey Charitable Trust a proximal to distal direction along the chromosome. National Institutes of Health, USPHS National Science Foundation We call this the polarized intragenic expression (PIE) effect. We still speak of bxd as a gene since it is a region that can initiate a family of transcripts even Summary: The Bithorax Gene Complex (BX-C) in though they do not appear to have protein-coding Drosophila controls much of the development of the ability (as shown by Lipshitz et al., 1987). abdominal and part of the thoracic regions of the We have been carrying out molecular studies of two organism (see Duncan, 1987 for a recent review). Vast regions of the abdominal or distal half of the BX-C. regions of the complex seem to be involved in One of these regions, infra-abdominal-7 (iab-7) codes regulating how the genes of the complex come to be for a protein and controls primarily development of properly expressed in space and time. These regions the seventh abdominal (A7) segment. [iab-7 is also cannot be readily studied by conventional genetic known as Abd-B; see Duncan, 1987 for a review and means since they seem not to code for proteins and as explanation of various systems of nomenclature in a result true point mutations within such regions current use.] The other region, iab-4, apparently does probably are rarely if ever accompanied by readily not code for a protein and controls primarily develop detectable mutant effects. On the other hand, ment of the 4th abdominal segment including the rearrangement breakage points within such regions somatic gonad. generally result in a number of unusual phenomena We are now using an improved screen from which that help define these regions as distinct from protein we generate new rearrangement breakpoints within the coding regions. Thus, the complementation patterns complex at an average rate of approximately two per between two rearrangements broken in adjacent genes week in the Ubx region and one per week in the of the complex are quite unorthodox. Such patterns do remaining portion of the BX-C. By having a plethora not resemble at all those found between two mutants of breakpoints within the BX-C, we hope to pinpoint within the same protein-coding region. Instead, the the DNA regions within the complex that are involved patterns are somewhat similar to those found for in initiating the CIN and COE effects. Similarly, we adjacent genes of bacterial operons; however, it is will use breakage points within a given region to highly unlikely that similar mechanisms are involved. determine the generality of the PIE effect which thus When mutants in adjacent genes of the BX-C are in far is well documented only for the bxd case. trans, (a + I + b), then although they fail to comple References: ment, the failure is entirely restricted _to being a Duncan, I. (1987) Ann. Rev. Genet. 21, 285-319. Lewis, E. B. (1985) Cold Spring Harbor Symp. Quant. reduction in function of the b + gene so that the Biol. 50, 155-164. phenotype is of the b type only. Usually, although Lipshitz, H. D. and Hogness, D. ( 1987) Genes & Dev. I, 307-322. possibly not invariably, b is the more distal of the two loci involved. We call this the cis-inactivation (CIN) 112. A New Type of infra-abdDminal-2 Mutant effect. Not only is there no loss-of-function of a+ in this case, there is frequently a detectable gain-of E. B. Lewis, Rollin H. Baker function of a+, or what we call a cis-overexpression Our global screen for rearrangements that suppress (COE) effect (Lewis, 1985) of a•. transvection in the region of the BX-C has yielded the 78 first, to our knowledge, fully penetrant and fully viable 111/. Molecular Analysis of the infro-abdaminal-7 (iab-7) and iab-8 Genes of the Bithorax Complex iab-2 mutant that is non-lethal. This iab-2671 mutant is associated with what appears to be a cytologically Susan E. Celniker, Daniel J. Keelan invisible duplication for the distal portion of the BX-C Mutations in the iab-7 gene of the complex cause commencing with iab-3 and including iab-8, since it is profound embryonic defects in the fifth through the viable and fertile opposite a deficiency' for the entire eighth abdominal segments. Mutations in the iab-8 complex (Df-P9). For the first time we have a useful gene primarily affect the proper development of adults means of detecting in the first generation new lethal resulting in animals with no internal or external alleles of iab-2 whether they be point mutants or re genitalia or analia, derivatives of the genital imaginal arrangements. Thus, by mutagenizing wild-type third disc composed of cells from the eighth, ninth and tenth chromosomes we can recover new iab-2 mutants as abdominal segments. Animals hetero.zygous for iab-7 heterozygotes with the iab-2671 allele. Such hetero and iab-8 show similar defects to iab-8 homozygous zygotes are expected to show an iab-2 phenotype, animals, suggesting that iab-7 mutants tend to cis namely, a transformation of the tergite and sternite of inactivate iab-8+ function. What is the molecular the second abdominal segment toward that of the first. basis for these complex developmental interactions Deficiencies of any size in the complex are expected between iab-7 and iab-8 genetic functions? To address to be readily recovered provided simply that they this question, we have investigated the iab-7 and iab-8 include the iab-2 locus. gene organization. Previously, we reported (Biology 1987, Abstract ll3. Derivation of New Breakage Points in the No. 347) the identification of two transcripts, 1/.7 and Bithorax Complex (BX-C) 3.2 kb in length, from the iab-7 region. With higher Rollin H. Baker, E. B. Lewis resolution electrophoresis, we now resolve five tran As we have previously reported (Biology 1987, scripts, a 7 .5 kb only weakly detectable at 1/-8 hr of Abstract No. 346), we use a novel genetic screen to embryonic development and doublet transcripts of 1/.7 detect chromosomal rearrangements, one of whose and 4.5 kb and 3.5 and 3.2 kb present throughout breakpoints falls within the Bithorax Complex (BX-C). Drosophila development. The screens depend upon finding rearrangements that Sequencing several cDNA clones (approximately disrupt pairing of homologous third chromosomes in 3 kb in length) corresponding to a portion of one of the the vicinity of the BX-C. Such disruption suppresses transcripts and the appropriate genomic DNA, we have transvection, a pairing-dependent type of complemen determined a partial gene structure composed of at tation that is easily assayed in the case of the BX-C least four exons and three introns spanning 6 kb repre (Lewis, 1951/). By bringing the BX-C region much senting the 3' end of the gene. The splice junctions of closer to the centromere than it normally is through all of the exons conform to the previously reported the use of an inversion, we are able to obtain a consensus sequences (Mount, 1980). relatively high yield (5%) of breaks within BX-C among In order to identify the 5' end of the gene and all rearrangements that suppress transvection within obtain full-length cDNAs representing each transcript, the BX-C. Thus far we have accumulated the following we have screened a size-selected embryonic Agt 11 numbers of rearrangements in the abdominal region of cDNA library (kindly provided by Kai Zinn) with the complex: eight b:rds, three iab-2s, seven iab-3s, genomic fragments of the BX-C walk, from +155 to seven iab-4s, nine iab-5s, five iab-6s and five lethals. +190 kb (Karch et al., 1985), and counterscreened with As yet we have not detected breakpoints within the a homeobox-containing fragment that maps to + 153 kb. iab-7 or iab-8 genes but some may occur amongst the We have isolated 110 new cDNAs. Four of the genomic lethal class that remains to be characterized. fragments (that do not crosshybridize with each other Reference: at high stringency) each detect a unique set of cDNAs Lewis, E. B. (1954) Amer. Nat. 88, 225-239. (the four sets containing 16, 3, 19 and 24 cDNAs, respectively), all of which contain the homeobox. This gene organization surprisingly resembles that of the 79 Antp gene (a homeotic gene outside the complex) cDNA library (kindly provided by N. Brown). Four rather than that of the Ubx gene found with the cDNAs were isolated. They correspond to RNAs that complex. are transcribed in a direction opposite to that of other known transcripts in the complex. Using the cDNAs as Reference: Karch, F., Weiffenbach,. B., Peifer, M., Bender, W., probes for Southern analysis, we have identified a 1.8 Duncan, I., Celniker, S., Crosby, M. and Lewis, E. kb intron. To determine the effect of the breakpoints B. (1985) Cell 43, 81-96. Mount, S. (1982) Nucleic Acids Res. 10, 459-472. in the iab-4 region on the expression of this transcript, it will be necessary to screen homozygous mutant 115. Production of Monoclonal Antibodies to the embryos with the iab-4 cDNAs. We have constructed a iab-7 Protein balancer chromosome (TM3) that carries the lacZ Susan E. Celniker, Daniel J. Keelan gene. This balancer will allow us to identify homo One of the goals of our studies is to determine how zygous iab-4 mutant embryos for the tissue in situ the genes of the bithorax complex are regulated in hybridizations. cis. The bithorax complex spans some 300 kb of DNA (Bender et al., 1983; Karch et al., 1985) although only PUBLICATION 12 kb are taken up by three genes coding for proteins containing a homeobox domain (Regulski et al., 1985). Lewis, E. B. ( l 988) The role of the bi thorax complex in controlling development. In: Molecular Mechanisms The most distal homeobox-containing gene, iab-7, in Cellular Growth and Differentiation, Bellve, A. generates five transcripts, the largest 7 .5 kb spanning R. and Vogel, H. J. (Eds.), Biomedical Sciences Symposia of the Columbia University College of 40 kb. By genetic criteria, the cis-regulatory region Physicians and Surgeons, in press. for this gene appears to span 100 kb of DNA. We have generated polyclonal antibodies and are generating monoclonal antibodies to a trpE/iab-7 fusion protein so that we can compare the distribution of iab-7 protein in wild-type animals with the corresponding distribu Assistant Professor: Howard D. Lipshitz tion in animals that have chromosomal rearrangements Research Fellows: Anne Frey, David R. Mathog, in the cis-regulatory regions of the complex. The Teresa R. Strecker Graduate Students: Dali Ding, Susan R. Halsell effect of breakpoints within such regions on the seg Laboratory Staff: James W. L. Allen Jr., William W. mental distribution of the iab-7 protein may help Fisher, Daniel S. Glantz, Quynh-Thu Le 1 delineate the molecular role of the cis-regulatory 1Undergraduate, California Institute of Technology. regions. References: Support: The work described in the following research Bender, W., Akam, M., Karch, F., Beachy, P. A., reports has been supported by: Peifer, M., Spierer, P ., Lewis, E. B. and Hogness, American Cancer Society, California Division D. (1983) Science 221, 23-29. California Foundation for Biochemical Research Karch, F., Weiffenbach, B., Peifer, M., Bender, W., Deutsche Forschungsgemeinschaft Duncan, I., Celniker, S., Crosby, M. and Lewis, E. Lucille P. Markey Charitable Trust B. (1985) Cell 43, 81-96. Li Ming Scholarship Regulski, M., Harding, K., Kostriken, R., Karch, F ., National Institutes of Health, USPHS Levine, M. and McGinnis, W. (1985) Cel! 43, 71-80. 116. The infra-abdominal-4 Region of the BX-C Summary: In multicellular organisms, the determi Sarah M. Smolik-Utlaut nation of anterior-posterior (A-P) embryonic polarity In order to understand the effects of the iab-4 is fundamental to subsequent development, since the mutations on the development of the gonad and ecto entire body plan is constructed relative to this axis. derm, we have continued our molecular analysis of the Little is known about the molecular mechanisms by iab-4 region (Biology 1987, Abstract No. 348). Using which embryonic polarity is established and how axial genomic DNA that spans the region disrupted by iab-4 information is transduced into cell fate. The major breakpoints, we have screened an embryonic plasmid focus of research in our laboratory is on the molecular 80 genetic analysis of A-P axis formation in Drosophila. unsegmented head (acron) and tail (telson) of embryos. There appear to be three major classes of genes that In contrast, females homozygous for the spliced are transcribed in the maternal germline and are mutation (kindly provided by T. Schupbach, Princeton) involved in establishing the A-P axis of the embryo: produce embryos that lack the central region (thorax the "anterior" genes that specify ant;rior segmented and abdomen), while the anterior and posterior ends regions, the "grandchildless-kn.irps" or "posterior" are present (T. Schupbach and E. Wieschaus, un genes that specify the abdominal region (as well as the published data). Using chromosomal deficiencies and a germline) and the "torso-like" or "terminal" genes that duplication for the torso gene (kindly provided by Prof. specify the unsegmented poles of the embryo-the E. B. Lewis), we have been able to show that the acron and telson. spliced mutation is a semidominant hypermorphic We have commenced a genetic and molecular ("over-activity") allele of torso, which we will refer to analysis of a number of these maternal effect loci: as tor'P1c. We have demonstrated that the to,.SP1C our major focus has been on particular representatives mutation can be dominantly suppressed by reduced of the terminal and posterior gene classes. We have activity mutations in the tor locus itself (i.e., also initiated a search for genes containing sequences to,.SPlc/tor-) or in certain other terminal class genes. homologous to the anterior class gene, bicoid. In Since the to,.Splc allele is temperature sensitive, we addition, we are interested in the possibility that have been able to determine the temperature-sensitive certain of the maternal pattern genes might encode period for the to,.Splc mutant phenotype and thus RNAs that are localized along the A-P axis of the egg, demonstrate that the tor gene product probably acts as well as in the molecular mechanisms by which RNAs during the first two hours of embryogenesis. These are localized in cells. Consequently, we are carrying results may assist us in determining the order in which out a search for cDNAs representing transcripts the terminal class genes act in a developmental hier localized to either the anterior or posterior pole of the archy, since genes with a temperature-sensitive period unfertilized egg. later than tor8PlC most likely are "downstream" of tor After the A-P axis is established, various genes act in the terminal gene hierarchy and those with an to subdivide the developing embryo into periodic earlier temperature-sensitive period are probably repeats and, ultimately, into segments. The homeotic "upstream." genes combine axial and periodic information in order Since mutations in tor and certain other terminal to specify the identity of certain structures specific to genes act as dominant to,.Splc suppressors, we have particular segments. We are studying the functions of been able to design selective genetic screens for P the transcripts encoded by the bithor=oid region of element transposon "tagging" of these loci. The the bithorax homeotic gene complex of Drosophila. molecular cloning and characterization of these genes will enable us to investigate directly their roles in establishing the anterior and posterior ends of the 117. Genetic and Molecular Analysis of Terminal Class ("torso-like") Genes embryo. Teresa R. Strecker, Susan R. Halsell, References: William W. Fisher, Howard D. Lipshitz Degelmann, A., Hardy, P., Perrimon, N. and Mahowald, A. (1986) Dev. Biol. 11.5, 479-489. The formation of the anterior and posterior ends of Lehmann, R. and Nusslein-Volhard, €. (1987) Nature the Drosophila embryo requires the activity of the 329, 167-170. Nusslein-Volhard, C., Frohnhiifer, H. and Lehmann, maternal and zygotic terminal (torso-like) class of R. (1987) Science 238, 1675-1681. genes (Schupbach and Wieschaus, 1986; Nusslein Schupbach, T. and Wieschaus, E. (1986) Roux's Archiv. Dev. Biol. 19.5, 302-317. Volhard et al., 1987) comprised of torso and trunk Strecker, T., Merriam, J, and Lengyel, J. (1988) (Schupbach and Wieschaus, 1986), fs(l)Nasrat Development 102, 721-734. (Degelmann et al., 1986), torso-like (H. Frohnhofer, ref, in Lehmann and Nusslein-Volhard, 1987) and tailless (Strecker et al., 1988): mutations in these genes result in the loss of structures comprising the 81 118. Molecular Cloning of the Posterior the cloning and molecular analysis of the vasa locus. ("grandchildless-knirp.'I'') Class Gene, vasa References: Susan R. Halsell, William W. Fisher, Nusslein-Volhard, C., FrohnhOfer, H. and Lehmann, R. Howard D. Lipshitz (1987) Science 238, 1675-1681. Robertson, H., Preston, C., Phillis, R., Johnson The seven identified posterior (grandchildless Schlitz, D., Benz, W. and Engels, W. (19&&) knirps) class maternal pattern genes specify the Genetics 118, 461-470. Schupbach, T. and Wieschaus, E. (1986) Roux's Archiv. abdominal region of the developing embryo, and five of Dev. Biol. 195, 302-317. these genes also play a role in the formation of the germline precursor cells at the very posterior tip of 119. P-Element Transposon Tagging of the embryo (Schupbach and Wieschaus, 1986; Nusslein Maternal Effect Pattern Genes on the Second Chromosome Volhard et al., 1987). We are interested in two aspects of the posterior class genes: the molecular basis for Howard D. Lipshitz, William W. Fisher, Susan R. Halsell, Anne Frey their role in embryonic pattern formation, and the possible interactions between the posterior class and We are Continuing our attempts to transposon "tag" maternal effect pattern genes on the second terminal class gene products. Such interactions seem likely since the regions of the embryo affected by chiomosome. Initially, we conducted standard hybrid dysgenesis-induced mutagenesis and found two mutations in the posterior class genes encompass the interesting maternal effect pattern mutants among the telson, which is removed by mutations in the terminal approximately 3,000 lines screened: a vasa allele (see class genes. Four of the five posterior class genes that play a role in both abdomen and germline specification Abstract No. 118) and a mutant we have designated HL79. Eggs laid by HL79 homozygous females appear reside on the second chromosome. We conducted a general P-element hybrid dysgenesis mutagenesis to be "ventralized": they lack dorsal appendages, and the dorsal follicle cell imprint pattern on the chorion screen for female sterile mutations on this resembles that normally characteristic of the ventral chromosome; 44 of 1,191 lines tested exhibited female side. We are in the process of recombination mapping sterility. Homozygous females from one line, 808, produce embryos with gross deletions of the abdominal this mutation and examining the ovaries for abnor malities. In addition to these mutations, we have and posterior thoracic segments while the head, anterior thorax, and telson structures are unaffected. isolated dysgenic alleles of two zygotic segmentation loci, Kruppel (K,1'3673) and odd-skipped (oddP2318). These embryos also lack pole cells. Based on these observations, we tentatively assigned this mutant to One problem with standard dysgenic screens is the instability of mutations in which a P element is still the posterior gene class and carried out allelism tests against the four second chromosomal posterior class resident at the locus of interest. This is a particularly troublesome problem for female sterile screens since loci (staufen, tudor, valois and vasa; alleles kindly one cannot test for sterility until the "G3" generation. provided by T. Schupbach, Princeton). 808 is a vasa A method of P-element mutagenesis that avoids this allele that we designate vasaP808. The vasa locus problem has recently been reported (Robertson et al., maps to the left arm of the second chromosome at 1988). We have now switched to the use of this "62-3" 35B&/9-Cl (Schupbach and Wieschaus, 1986; R. Lehmann, personal communication); we are using poly transposase method both for our general screens for second chromosomal female steriles, and for our tene chromosome in situ hybridization to determine whether a P element is inserted at this cytological directed mutagenesis of the terminal gene family (see Abstract No. 117). location. In addition, we are carrying out a screen for P-transposase-induced vasaPB08 revertants utilizing Reference: Robertson, H., Preston, C., Phillis, R., Johnson the "62-3 (99B)" transposon as a stable source of Schlitz, D., Benz, W. and Engels, W. (l 9&8) transposase (Robertson et al., 1988) in order to test Genetics 118, 461-470. whether a P element is resident at the vasa locus. If this proves to be the case, we plan to construct a genomic library from vasaP808 DNA and proceed with 82 120. RNA Localization in the Unfertilized Egg derm). Even rarer RNAs will be detected in the final, Dali Ding most sensitive screen which involves enriching for We are particularly interested in the possibility clones of interest via the construction of subtracted that certain of the RNAs that encode proteins involved [A-Pl and [P-A] cDNA libraries from our >.BOS A- and in specifying the A-P embryonic pattern might be non P-libraries. This last screen should enable us to detect uniformly distributed in the egg, as well as in the cDNAs representing localized RNAs present in mechanisms by which RNAs become asymmetrically amounts equivalent to 2 to 3 copies per A- or P-cell at localized in cells. The Drosophila egg is a giant, blastoderm. Confirmation of localization, as well as ellipsoidal cell whose major axis is 540 µm and whose information ·regarding the spatial and temporal expres minor axis is 200 µm. These features make the egg sion of these RNAs, will be obtained by tissue in situ uniquely suitable for a search for cDNAs representing hybridization to sectioned ovaries and early embryos. RNAs localized along the A-P axis. Using a miniature Subsequently, we plan to carry out molecular and guillotine, we have cut the anterior fifth off 7,500 genetic analyses on the loci encoding these RNAs. frozen eggs and the posterior fifth off another 7 ,500 References: frozen eggs. We have purified 100-200 µg of total RNA Frigerio, G., Burri, M., Bopp, D., Baumgartner, S. and Noll, M. (1986) Cell 47, 735-746. from each of these collections of A- and P-poles; this Palazzolo, M. and Meyerowitz, E. (I 987) Gene 52 will yield sufficient poly(A) RNA for the construction 197-206. ' of A- and P-cDNA libraries. Using a bicoid cDNA (Frigerio et al., l 986; kindly provided by Markus Noll, 121. Functional Analysis of the Early bithorozoid Transcripts Biocenter, Basel) to probe blots of this A- and P-RNA, Howard D. Lipshitz, Daniel S. Glantz we have shown that the bicoid RNA is, as expected, only detectable in our A-RNA preparation. The giant, 40 kb bithoraxoid (bxd) region of the bi Zn collaboration with M. Palazzolo in the thorax complex (BX-C) exerts cis-regulatory control Meyerowitz lab, we have modified and tested updated over the spatial and quantitative expression of the versions of >..SW AJ vectors, the ABOS vectors, for use homeoprotein-encoding Ultrabithorax (Ubx) transcripts in cDNA library construction and screens. The new (Hogness et al., 1985). We previously showed that the bxd region encodes a complex set of differentially vectors allow us to easily convert >- phage libraries into plasmid libraries and subsequently recover single spliced poly(A) RNAs that lack protein coding stranded DNA from these plasmids. Our strategy is to potential-the early bxd RNAs (Lipshitz et al., 1987). search for localized RNAs using three screens. The These RNAs are produced transiently at the time of first screen will be a standard differential screen of a transcriptional activation of the Ubx domain of the whole egg cDNA library in >.BOS using A- and P-probes BX-C. We showed that the early bxd RNAs are unlikely synthesized from poly(A) A-RNA and P-RNA. Only to be mediating the cis-regulatory functions defined by cDNAs representing relatively prevalent RNAs will be the bxd mutations (Hogness et al., 1985) and detected in this step (equivalent to RNAs present at speculated that these RNAs either lack functions or >250 copies per A- or P-cell at the blastoderm stage). implement functions in trans that cannot readily be In the second screen, a few thousand individual ABOS deduced from the bxd mutant phenotypes (Lipshitz et cDNA clones that do not show hybridization to A- or al., 1987). In order to determine any functions of P-probe in the first screen will be converted to these transcripts, we are thus forced to resort to plasmid clones and single-stranded DNA recovered. attempts to either inactivate or over-express the early Duplicate DNA dot blots will then be screened with A bxd RNAs without mutating the bxd region, since these and P-probes synthesized from poly(A) RNA. This mutations would cause cis-regulatory defects in Ubx method is roughly tenfold more sensitive than the expression. To this end, we have constructed two standard differential screen and should detect cDNAs P-element RNA expression vectors, pUChsneo-act and representing relatively rare RNAs (present in amounts CaSpeR-act, which utilize the cytoplasmic actin (actin equivalent to >25 copies per A- or P-cell at blasto- 5C) promoter (kindly provided by D. Price, Duke University) and terminator (Bond and Davidson, 1986); 83 any cDNA can be cloned between the promoter and cis-regulatory sequences for this gene, we have fused terminator for in vivo expression of either sense or the same 5 kb of flanking DNA and part of the late l>xd antisense RNA after P element-mediated germline open reading frame to the E. coli lacZ gene in con transformation. The actin 5C promoter appears to be structs for P element-mediated transformation. These a strong constitutive promoter; we have avoided using studies might provide the first direct link between the the heat shock (hsp 70) promoter in these constructions expression of a specific, non-homeodomain-containing since heat shock between 3 and 6 hours of development BX-C protein and a spatially and temporally localized (the period during which the early bxd RNAs are homeotic phenotype. synthesized) induces bithorax phenocopies. We have Reference: cloned two of the early bxd c~NAS in both sense and Lipshitz, H., Peattie, D. and Hogness, D. (1987) Genes antisense orientation into these vectors: cDNA 3601 & Dev. I, 307-322. (which comprises bxd exons l, 3, and 8) and 3600 (which comprises bxd exons 4, 6, and 7). Since these PUBLICATIONS are mutually exclusive exon combinations, any functions specific to these alternatively spliced RNAs Hogness, D., Lipshitz, H., Beachy, P., Peattie, D., Saint, R., Goldschmidt-Clermont, M., Gavis, E. and might also be revealed. We are in the process of Helfand, S. ( 1985) Regulation and products of the transforming these constructs into flies. Ubx domain of the bithorax complex. Cold Spring Harbor Symp. Quant. Biol. 50, 181-194. References: Lipshitz, H., Peattie, D. and Hogness, D. ( 1987) Novel transcripts from the Ultrabithorax domain of the Bond, B. and Davidson, N. ( 1986) Mol. Cell. Biol. 6, 2080-2088. bithorax complex. Genes & Dev. I, 307-322. Hogness, D., Lipshitz, H., Beachy, P ., Peattie, D., Saint, R., Goldschmidt-Clermont, M., Gavis, E. and Helfand, S. (1985) Cold Spring Harbor Symp. Quant. Biol. 50, 181-194. Lipshitz, H., Peattie, D. and Hogness, D. (1987) Genes & Dev. I, 307-322. Associate Professor: Elliot M. Meyerowitz Visiting Associates: Annemarie Hofmann, David R. 122. Molecular Analysis of the Late bithoraxoid Gene Smyth Senior Research Fellow: K. Vijay Raghavan Daniel S. Glantz, Howard D. Lipshitz Research Fellows: Anthony B. Bleecker, Hong Ma, Kevin G. Mossie, Michael J. Palazzolo, Patty Our previous studies of the transcriptional products P.-Y. Pang, Margaret Roark, Takeshi Todo, Martin of the 40 kb bxd region revealed that it encodes a F. Yanofsky Graduate Students: John L. Bowman, Caren Chang, single, 0.8 kb mRNA that probably codes for a 101 Mark D. Garfinkel, Bruce A. Hamilton, amino acid protein. This "late bxd gene" is expressed Christopher H. Martin, Peter H. Mathers Member of the Professional Staff: Karl J. Fryxell from the mid-third larval instar through the adult Research and Laboratory Staff: Arthur W. DeJohn, stages of development. We have presented arguments Susan M. Donnellan, Sherry A. Kempin, Carol A. Mayeda, Michael A. Whitney, Joe Williams in favor of the possibility that the late bxd protein might act together with the homeodomain-containing Support: The work described in the following research Ubx protein family, to specify the identity of a reports has been supported by: specific adult segment (parasegment 6) (Lipshitz et al., Biomedical Research Support Grant (NIH) The General Electric Foundation 1987). We have begun a detailed analysis of the spatial Life Sciences Research Foundation expression of the late bxd mRNA and protein in late Lucille P. Markey Charitable Trust National Institutes of Health, USPHS larvae, pupae, and adults. We are also carrying out a National Science Foundation functional analysis of the late bxd gene by analyzing The Procter & Gamble Co. Helen Hay Whitney Foundation the effects of BX-C mutations on its expression, as well as by means of P element-mediated insertion of a fully functional late gene back into the Drosophila Summary: The goal of the projects in our laboratory is germline. For the latter experiments, we are using P to understand the mechanisms by which cells deter element constructs that include 5 (or 8.5) kb of 5' mine their position in developing organisms, both flanking sequences. In order to begin to dissect the spatially and in developmental time. The result of 84 such cellular determinations is differentiation, which type in the developing brain. In addition, the genes in different cells can occur at different developmental that are hybridized by certain of the clones will be stages, and which follows different courses in cells targets for mutagenesis, to eventually determine the located in different positions. We use two organisms function of the brain-specific gene products. The in our studies, both chosen because of the simplicity second area of experimentation with the fly continues with which they can be cultured, and because the our long-term effort to unravel in detail the cis- and details of their life cycles and genomic organizations trans-acting factors involved in the expression of the make them convenient subjects for the manipulations Drosophila glue genes. These genes code for secretory of classical and molecular genetics. One is the proteins made by the larval salivary glands and are flowering plant Arabidopsis thaliana, a small weed in expressed in only one cell type, and at only one short the mustard family. The other is the insect Drosophila developmental stage, in Drosophila larvae. Recent melanogaster, the laboratory fly. progress includes a description of the cis-acting The plant projects in progress include a study of a sequences for the glue gene Sgs-3 at the resolution of series of Arabidopsis mutants in which homeotic single nucleotides. transformations occur in flowers. Our work to date indicates that the genes that give such mutations may 123. Toward the Cloning of Genes Controlling be involved in the earliest steps of differentiation of Development in Ara.bidopsis the cells that will later become the sepals, petals, John L. Bowman, Caren Chang, Sherry A. Kempin, stamens, and carpels of the flower. A considerable Hong Ma, Elliot M. Meyerowitz, Martin F. Yanofsky effort has been devoted to establishing a restriction Our goal is to isolate genes that control specific fragment length polymorphism (RFLP) map of suf developmental steps during floral development in ficient density to allow each of the homeotic genes to Arabidopsis. We have constructed a restriction frag be cloned by the method of chromosome walking. The ment length polymorphism (RFLP) map in Arabidopsis current map contains DNA markers within 270 kilobase providing molecular markers interspersed throughout pairs of more than 50% of the Arabidopsis genome, and its genome. Currently, this map consists of about 100 chromosome walks toward several of the floral markers within the five linkage groups with an average development genes are in progress. The plant work of less than 7 50 kb between cloned markers. The also includes a series of experiments designed to average distance from a known cloned marker to many provide mutations in genes whose products are trans genes of interest should be considerably less. These acting regulators of expression of embryo-specific markers provide starting points for chromosome genes, and experiments directed toward the molecular walking and should eventually allow the isolation of cloning of a gene whose product may be a receptor for any gene for which a phenotype exists. the plant hormone ethylene. A number of laboratories have isolated floral The fly work is divided into two areas. One involves specific mutations in Arabidopsis. Some of these studies of gene expression and action in the develop mutations may be termed homeotic since they result in ment and maintenance of the Drosophila eye and the conversion of one floral organ into another. We nervous system. In this work we have continued our have aligned the RFLP map with the positions of studies of the Drosophila R7 opsin gene, using it in several of these mutations and are currently walking part as a marker of cell type in eyes developing towards these mutations. To facilitate the isolation of abnormally as a result of lesions in other genes. In overlapping clones, we have constructed a plant addition, several years of development of new methods transformable cosmid vector. This vector contains for screening and sorting cDNA molecules has now SP6 and T7 bacteriophage promoters flanking the given us a collection of almost 500 non-cross insert DNA, allowing for the synthesis of end-specific hybridizing cDNA clones that represent RNAs present probes. Our Arabidopsis library in this vector contains in the adult Drosophila head and absent in early inserts with an average size of 30 kb. Identification of embryos. These clones, and antibodies directed against the complementing clone will be achieved by their protein products, will serve as markers of cell Agrobacterium-mediated transformation. 85 In addition to the molecular approach, which should after a few normal flowers with one large, multi soon provide us with the cloned genes, we are using a partite flower. genetic approach to learn more about each of the These mutants (and more being collected) are being mutations. Double mutants between each pairwise tested for allelism with each other and with known combination of single mutations have been constructed mutants of similar phenotype. They are being in order to determine if the mutants are epistatic to described in detail by dissection, sectioning and one another. In addition, some of these mutants scanning electron microscopy. Finally, their accurate display a temperature-sensitive phenotype, and this is location on the linkage map is being determined as being exploited to determine at what time during preliminary to their cloning by RFLP-assisted walks. floral morphogenesis the gene product is required. 125. Characterization of Arobidopsis Transformants 124. A Search for New Flower Mutants of Caren Chang Arabidopsis thaliana This work continues the characterization of the David R. Smyth Arabidopsis transformants obtained by Agrobacterium One successful approach to working out the mediated transformation (Biology 1987, Abstract No. mechanisms of development is to characterize genes 106). The wild-type ADH gene, linked to a chimeric that disrupt it when in mutant form. About 10 loci are gene that confers resistance to hygromycin, was intro known to date that specifically affect aspects of duced into wounded leaf cells of an Arabidopsis ADH flower development in Arabidopsis. We have begun a null mutant, and based on hygromycin resistance, nine large-scale search for more. independent transformed plants were regenerated from Seed was mutagenized with EMS (by Bob Pruitt and tissue culture. By analyzing inheritance patterns of Leslie Leutwiler), grown and Ml individuals allowed to ADH activity and hygromycin resistance in each of the self pollinate. Their progeny were then grown as M2 lines, it was determined that: tissue- and stage families and screened for segregating mutants that specific ADH activity was restored to the null mutant affect flower development. So far, 350 families (although in one line a subnormal level of activity (averaging 16 flowering sibs each) have been fully segregated from the wild-type level); ADH activity did screened and 20 interesting mutants recovered. These not necessarily co-segregate with hygromycin resis fall into two major categories, those whose individual tance; five lines were tetraploid (the parent line was floral organs are affected and those in which the diploid prior to the experiment); and transformation determination of the inflorescence itself is modified. events were inherited in a stable, Mendelian manner. Firstly, new flower organ mutants include one with Genomic DNA blot hybridizations confirmed the leaf-like sepals and petals, one in which the early presence of the transforming DNA in all of the trans stamens are reduced and carpel-like and one with formant lines. In some cases, DNA methylation or sepals somewhat like petals. Many others have DNA rearrangement were possible explanations for the phenotypes that resemble known mutants. These lack of co-segregation between ADH activity and phenotypes include agamous (many extra petals and no hygromycin resistance. The molecular analysis stamens or carpels, one recurrence), clavata (four revealed two other structural aspects of the integrated carpels instead of two, four recurrences), apetala-1 DNA: l) the introduced DNA could be joined to (petals absent and sepals elongate, two recurrences), genomic DNA at locations other than at the T-DNA pistillata (stamens absent, one recurrence) and flower right border sequence (which is normally the element development-2 (sepals replaced with carpels, two that directionally and physically defines the start of recurrences). integration), and 2) six transformants contained Secondly, inflorescence mutants identified so far insertions of greater than unit length. include one group of four that resembles the pin formed phenotype (0-5 flowers per apex instead of a larger, indeterminate number) and another group of four in which the inflorescence ends flower production 86 126. Tissue-Specific Expression of Reporter Gene 127. Characterization of an Arabidopsis Seed Gene With Seed Storage Protein Promoter in Arabidopllis thaliana Martin F. Yanofsky, Sherry A. Kempin Patty P.-Y. Pang Two distinct classes of genes were isolated from Seed storage proteins and the corresponding Arabidopsis thaliana using cDNA probes synthesized messages are very abundant and are only found in from RNA obtained from seed pods (R. Pruitt, Ph.D. developing plant embryos. Cis-acting elements Thesis, 1985). One of these classes represents the 125 required for seed storage protein gene expression have seed storage protein genes which have been charac been studied in many plant species. To further under terized in a variety of plant species. The other class stand the molecular mechanisms that control the encodes a 650 base RNA which shares no significant tissue- and stage-specific expression of 125 globulin homology to any previously characterized gene. Both genes, I would like to identify trans-acting regulatory of these classes of genes are abundantly expressed in elements by identifying and characterizing mutations the developing seed. However, the 650 base message in tram-acting regulatory genes, and to ultimately appears earlier in seed maturation and, in contrast to determine the functions of these factors. In order to the 125 gene message, is not detectable in the mature screen for such mutations, I have put the Arabidopsis seed (P. Pang et al., in preparation). This indicates alcohol dehydrogenase ADH gene under the control of that these genes are under different regulatory one of the 125 globulin promoters. One may select controls. against alcohol dehydrogenase with allyl alcohol. The We have focused on the gene encoding the 650 base alcohol dehydrogenase gene is normalJy expressed in RNA. This gene is present in three copies in the Arabidopsis seeds. Its enzymatic activity is stable Landsberg ecotype of Arabidopsis, all of which have throughout the seed desiccation period. These chimeric been cloned and sequenced. They share a high degree gene constructs have been introduced into an of homology at both the DNA and protein levels (90%) Arabidopsis strain that lacks ADH message and and encode an uncharacterized 148-amino-acid protein activity (R002A). The transformed seeds expressing product. In order to identify the cis-acting sequences the appropriate ADH enzymatic activity will be muta needed for tissue- and time-specific expression, and to genized, and progeny seeds resulting from selfing of more precisely localize the tissue in which expression these mutagenized plants will be selected for occurs, gene fusions were constructed. The presumed germination. In order to avoid mutations in the ADH 5' regulatory region was fused to each of two easily structural gene or in the cis-acting elements of the assayable markers: alcohol dehydrogenase (ADH) and 125 gene, strains to be mutagenized will be a-glucuronidase. These fusions were transformed into homozygous for two copies of the chimeric gene. an ADH null mutant of Arabidopsis using Agrobac At present, a translational fusion of the ADH gene terium-mediated transformation and transgenic plants (from the second codon) to amino acid 31 of one of the were obtained and characterized. Recent results 12S globulin genes has been constructed. This chimeric demonstrated that 450 bp of upstream sequence is gene fusion and 1.3 kb and 300 bp of the 5' upstream sufficient for proper regulation. Analysis of upstream region have been introduced into R002A. Preliminary deletion derivatives is currently in progress. The ADH results with RNA analysis of seed pods, and with histo and B-glucuronidase activities were localized in chemical staining for Adh activity in seeds from plants transgenic plants to the outer layer of the seed coat, transformed with both constructs, suggest that the indicating that it is in these tissues that the 650 base introduced chimeric gene is expressed and the RNA is specifically expressed. This contrasts with seed chimeric ADH enzyme is active. I am also constructing storage proteins, which accumulate in the developing transcriptional fusions by introducing an Ncol site at embryo and not in the seed coat. Work is currently in the ATG initiation codon of the ADH gene and the 125 progress to further characterize this gene family and storage protein gene followed by exchange of the both the cis- and trans-acting factors required for its coding regions. developmental expression. 87 128. Molecular Analysis of Ethylene-Insensitive last round(s) of cell division in the eye imaginal disc Mutants in Arabidopsis (Ready et al., 1976). These genes continue to be Anthony B. Bleecker expressed in the adult. I have isolated eight genes in 32 The plant hormone ethylene is involved in a number this class by differential screening with P-cDNAs of developmental processes and responses to environ derived from the heads of mutant flies of several mental stresses in higher plants. While numerous genotypes (Fryxell and Meyerowitz, 19&7). This screen physiological, biochemical, and genetic responses to was also used to identify the cell type(s) in which the ethylene have been catalogued, virtually nothing is genes were expressed. Further experiments are known about the initial molecular events that lead to planned to saturate this screen. this diversity of responses. The goal of our project is A detailed analysis of eye development will require to use a combination of genetics, molecular biology, the ability to uniquely identify each cell type, as well and biochemistry to elucidate the basis for ethylene as the ability to selectively kill each cell type. We are action. Mutants in Arabidopsis that either lack or close to solutions of both of these problems. We have have altered responses to ethylene are being selected, produced gene-specific antibodies to each of the four placed on both standard and RFLP linkage maps, and known Drosophila rhodopsins and characterized these physiologically and biochemically characterized. antibodies by immunofluorescence and radioimmuno Genes important to ethylene action will be isolated assay. These antibodies will be used in studies of eye based on the mutant phenotypes using the technique of development. We plan to selectively kill particular chromosome walking. Ethylene receptor mutants are cell types with the help of P element-mediated being identified using in vivo and in vitro ethylene transformation-we are fusing the A chain of binding assays. diphtheria toxin to specific Drosophila rhodopsin Current efforts are focused on one dominant promoters (Palmiter et al., 19&7). mutation, designated etr, which lacks a number of As described in last year's annual report, I have responses to ethylene that are present in the wild-type devised a new method of multiple amino acid sequence plant, including inhibition of cell elongation, promotion alignment, which is faster and more rigorous than of seed germination, enhancement of peroxidase previously available methods. have refined this activity, and feedback suppression of ethylene algorithm and added routines to draw phylogenetic synthesis by ethylene. Saturable ethylene binding in trees and identify conserved domains. This package leaf tissue of the etr mutant is fivefold lower than may be generally useful for studying the evolution of that in wild-type tissue, indicating that the etr gene families. In particular, it can identify domains mutation directly affects the ethylene receptor. that are strongly conserved within one branch of a Through appropriate genetic crosses, the etr mutation gene family but not another; these may represent has been placed on both the standard and RFLP linkage evolutionary changes of function. maps. A polymorphic lambda genomic clone which References: maps near the etr locus has been used to screen a Fryxell, K. J. and Meyerowitz, E. M. (19&7) EMBO J. 6, 443-451. cosmid genomic library. The cosmid clones obtained Palmiter, R. D., Behringer, R. R., Quaife, C. J., will be used to isolate additional overlapping clones Maxwell, F., Maxwell, I. H. and Brinster, R. L. (19&7) Cell 50, 435-443. from the library in an effort to clone the entire region Ready, D. F., Hanson, T. E. and Benzer, S. (1976) Dev. of the genome containing the ETR gene. Biol. 53, 217-240. 130. Developmentally Regulated Puffing of 129. Eye Development 68C-Derived Sequences Karl J. Fryxell Peter H. Mathers, Susan M. Donnellan Formation of the compound eye of dipteran insects One of the first demonstrated examples of requires the expression of many specialized genes. differential gene expression was studied in the poly Many of these genes are expressed soon after a series tenized chromosomes of insect salivary glands. Areas of morphogenetic events that are associated with the of highly active transcription have been found to be 88 present in regions of local chromosomal deconden forming a construct containing this region without any sation, or puffing, which are easily visible under the nearby transcription units or TATA boxes in an effort light microscope. These "puffs" have been found to be to distinguish between two models for puffing at 68C. the result of developmental gene expression, showing The first of these presents puffing as a direct result of time- and tissue-specific patterns of induction and transcription and the second involves puffing as a regression. In addition, puffs are also induced by result of a specific sequence (possibly an enhancer environmental stress and steroid hormone treatment. element) without transcription being necessary. By The 68C puff region is an example of a develop distinguishing between these two models, we should mentally regulated locus that responds to the steroid have a better understanding of puffing and its causes. hormone, ecdysterone, which activates and subse quently represses RNA transcript accumulation from 131. Cis-Regulatory Sequences of the Sgs-3 Gene the region. The 68C locus contains three of the salivary gland secretion genes, Sgs-3, Sgs-7, and Sgs-8, Margaret Roark, Carol A. Mayeda and their expression is coordinately restricted to the Required regulatory sequences of the Sgs-3 glue intermolt phase of mid-third instar larval salivary gene of Drosophila melanogaster have been defined glands. When actively transcribed, the 68C region is using a transient expression assay, in which Sgs-3/ decondensed, resulting in a visible increase in Alcohol dehydrogenase fusion genes are injected into chromosome diameter. This puffing is present at 68C embryos, and these animals are later analyzed for when salivary gland chromosomes first develop function of the injected gene by histochemical staining distinguishable banding patterns, and is found to for enzyme activity (Biology 1987, Abstract No. 98). regress upon endogenous and in vitro increases in the At least two regions of DNA upstream of the Sgs-3 ecdysterone tier. gene are required for expression of the gene at high Our goal is to determine what factors are levels. A proximal region, lying between -106 bp and necessary and sufficient for developmental puff the start of transcription (which is in a region shown to formation. Puffs have been classically thought to be sufficient for tissue- and stage-specific expression; result from high-level transcription at any given Crosby et al., 1986), must be present along with locus. Experiments in our lab have shown that highly further upstream sequences to give detectable expres active transcription and puffing are dissociable events. sion in the transient assay system. A distal region Germline transformants that carry the Sgs-3 gene and lying between -650 and -220 is also required for enough upstream DNA to allow nearly full-level expression in this assay. When this distal element is transcript accumulation fail to show any visible present in reversed orientation, expression is not seen. decondensation at the insertion site, thus showing one Low level expression, however, is not detectable in form of uncoupling between puffing and transcription. the transient assay: s-gal fusion genes with only the Another form can be seen in developmental mutants, proximal element present do not express in this assay, such as l(l)npr-1, where 68C transcript accumulation is but show very low level expression in germline trans blocked, yet a normal 68C puff is present. formants (Vijay Raghavan et al., 1986). Therefore, we We have used a variety of transformed constructs have continued our analysis of the Sgs-3/Adh fusion available in the lab to study the characteristics of the genes using P element-mediated germline transforma 68C region involved in puff formation. To date, puffing tion in order to quantitate and compare some of these is only seen in transformed lines that contain a portion genes. Multiple independent transformed lines of each of the intergenic region between Sgs-7 and Sgs-8. of four gene constructions were established: these Constructs that contain only Sgs-3 and its upstream four included, upstream of the Adh structural gene and region have failed to puff, despite being very actively 12 bp of Sgs-3 transcribed region, 2.76, 0.980, or 0.130 transcribed and producing greater than 6096 of the kb of Sgs-3 5' sequence, or 0.980 kb but with the region RNA mass of the endogenous locus. Experiments are between -130 and -980 inverted. Three homozygous, under way to delimit the region required for puffing viable, autosomal lines of each construct were even further. Once completed, plans call for trans- analyzed by histochemical staining of salivary glands, 89 and in a spectrophotometric assay for ADH enzyme 132. Mutagenesis of a Regulatory Element of Sgs-3 activity. It was found that all four show histochemical Takeshi Toda, Margaret Roark, K. Vijay Raghavan, staining only in the salivary glands of the third instar Carol A. Mayeda larva, as expected. For quantitation, enzyme activity The Sgs-3 upstream region contains at least three measured when 2.76 kb of upstream sequence is regulatory elements. One element, which lies within present was used as full level, or 100%, expression. It l 06 bp 5' of the mRNA start site of Sgs-3, is sufficient was found that 0.980 kb of upstream sequence gives for time and tissue specificity of Sgs-3 gene expres 8%, and 0.130 kb gives only 0.4% of full level. The sion. To define the time- and tissue-specific element 0.980 reversed construct expresses 4% of the full level at the nucleotide level, we have introduced point expression. mutations into this element and functionally tested the We can draw several conclusions from this analysis. altered element in the transient assay system (Biology First, our threshold of detection in the transient assay 1987, Abstract No. 98). Those that fail to express is somewhere between 4 and 8% of full expression, so would identify important nucleotides. that genes that are negative in the transient assay may Our saturation mutagenesis consists of two steps. nonetheless be expressing at low levels. Second, the First, by chemical mutagenesis (for details see Biology distal regulatory element (between -650 and -220) acts 1987, Abstract No. 99), point mutations are introduced more or less as a "classical" enhancer in that it confers at random. The sites remaining, not hit randomly, are a 20-fold increase in expression in one orientation, and mutagenized by site-directed mutagenesis. Using the works nearly as well (twofold less) in reversed orienta former method, we have isolated mutants in 47 of the tion. Lastly, one can conclude that additional enhancer 75 bp between positions -106 and -32 of the proximal element(s) must lie even more distally, upstream of element. All but six of the remaining sites have been -980 bp. One remaining question is whether the mutagenized using the latter method. proximal and distal elements are functionally distinct We have so far functionally tested the expression or equivalent; that is, does the distal enhancer alone of 58 mutants by replacing the proximal element of an promote tissue- and stage-specific expression (at a low Sgs-3-Adh fusion gene, which includes 980 bp of 5' level) in the absence of the proximal element. Experi sequence, with the mutant element and assaying for ments to address this are currently in progress. Adh activity in the transient expression assay. We have References: identified four mutants, with nucleotide substitutions Crosby, M. A. and Meyerowitz, E. M. (1986) Dev. at positions near -90, which fail to express (Figure 1). Biol. 118, 593-607. Vijay Raghavan, K., Crosby, M. A., Mathers, P. H. and Meyerowitz, E. M. (1986) EMBO J. 5, 3321-3326. site of non-expressing mutations -106 ~ * -32 ...... ··· .. ... -980 .. x • ••. ··.·.l~O ••. ···~~~~~·dehydrogenase r 999995> 0 5'99 5?95? 5 rpei: o/d"t::::::j;' s $ $ $ $ $ $ $ s $ $ $ S 3 -650 to -220 -110to+l2 distal proximal element element Figure 1. A regulatory element of the Sgs-3 glue gene. 90 Using this assay, genes that show activity below 50% established a number of transformant lines that are of the level shown by the wild-type construction with null mutants at the Adh locus, but carry a functional 980 hp of 5' sequence are classified as non-expressed Adh gene under Sgs-3 regulatory control. Selection (see the previous abstract). Therefore, to quantitate protocols using these transformants and various the effect on level of expression of each of these four alcohols are currently being developed. A number of mutants more precisely, we are establishing germline genetic screens utilizing alcohol selections may be transformant lines of each. One mutant shows 20% of possible. Selection for loss of function mutations, full-level expression. For the other three mutants, although difficult for autosomal loci, is more germline transformation experiments are still in straightforward for X-linked loci, as hemizygous males progress. will exhibit the mutant phenotype. Another approach These four mutants which have a larger than would be to select for gain of function, a dominant twofold effect on expression are located within an phenotype, at a stage of the life cycle other than third inverted repeat sequence (between -76 bp and -90 bp, instar, e.g., adult. Finally, it may be possible to use a see arrows in Figure 1). Similar inverted repeat germline transformant carrying a point mutation in the sequences are found upstream of other Sgs genes proximal regulatory element, which expresses at a (Mestril et al., 1986; Shore and Guild, 1987). It is very low level (insufficient for survival on ethanol), in possible, therefore, that this inverted repeat is a screen for second-site revertants. These revertants responsible for time and tissue specificity of Sgs gene would have a compensatory mutation in the gene expression. To test this assumption and to define the encoding a protein which binds the site of the point minimum sequence responsible for time- and tissue mutation. specific expression, small internal deletions and In a second approach, we are conducting a heterologous promoter fusions are now being molecular screen for DNA binding proteins that constructed and tested. specifically bind within this regulatory region. In the approach we are taking (Vinson et al., 1988), a >,gt 11 References: Mestril, R., Schiller, P., Amin, J., Klapper, H., cDNA library made from mid-third instar salivary Ananthan, J. and Voellmy, R. (1986) EMBO J, 5, gland poly(At is plated, induced, and the proteins 1667-1673. Shore, E. M. and Guild, G. M. (1987) Genes & Dev. l, bound to nitrocellulose. These proteins are then 829-839. renatured out of 6 M guanidine in situ. The filters are then probed with radiolabeled DNA of the regulatory 133. Screening for Trans-Acting Factors Required region (we are using the 70 bp between -41 and -110 5' for Sgs-3 Expression of Sgs-3) which has been ligated into a high molecular Takeshi Todo, Margaret Roark weight catenated form. Positive clones in this screen Sequences within the first 130 bp 5' of the Sgs-3 will represent genes whose product binds the proximal gene are sufficient to give correctly regulated regulatory element of the Sgs-3 gene. expression of the Sgs-3 glue gene. Fine structure References: mutational analysis of the region between -32 and -106 O'Donnell, J., Gerace, L., Leister, F. and Sofer, W. (1975) Genetics 79, 73-83. indicates that this region may contain a single Vigue, C. and Sofer, W. (1975) Biochem. Genet. I~, functional element (see above). We assume this to be 127-135. Vinson, C. R., LaMarco, K. L., Johnson, P. F., the binding site for a regulatory protein required for Landschulz, W. H. and McKnight, S. L. ( 1988) Genes expression of this gene. We would like to identify this & Dev. 2, 801-806. trans-acting factor, and we are taking two approaches to this goal, a genetic and a molecular, or "reverse 134. Identification of an Enhancer-Element for genetic" one. Expression of the 68C Glue Genes Selection schemes exist in which selection either Annemarie Hofmann, Mark D. Garfinkel for (using ethanol) or against (using pentynol) alcohol The 68C locus of the Drosophila melanogaster dehydrogenase activity has been achieved (O'Donnell polytene chromosomes contains three glue protein et al., 1975; Vigue and Sofer, 1975). We have structural genes, Sgs-3, Sgs-7, and Sgs-8. Two of '" these, Sgs-7 and Sgs-8, are divergently transcribed and 135. Regulation of Two Divergently Transcribed Genes That Share a Common Upstream Region separated by 475 base pairs. From this pair, histo chemically-assayable fusion genes were derived and Annemarie Hofmann reintroduced into D. melanogaster using P element The salivary gland secretion gene Sgs-4 of mediated gene transfer. In order to identify cis-acting Drosophila melanogaster is located on the X regulatory sequences required for full expression of chromosome at 3Cl I. Its regulatory elements have the genes, in vitro-synthesized deletions of the been intensively studied (Krumm et al., 1985; McNabb intergenic region have been tested for expression of and Beckendorf, 1986; Hofmann and Korge, 1987; the histochemically-marked fusion genes in the Hofmann et al., 1987; Shermoen et al., 1987). It has transient expression procedure and in germline been shown that 840 bp of upstream sequence are transformation (Biology 1987, Abstract No. 100). sufficient for normal stage, tissue, and quantity of Normal tissue, stage, and quantity of Sgs-8-lac Z Sgs-4 expression as well as for dosage compensation of fusion gene expression is observed when 432 bp of 5' the gene in males. These 840 bp also represent the flanking sequence are present; when 415 bp are upstream region for the divergently transcribed gene present, expression is reduced at least twentyfold. Pig-1 (pre-intermolt-gene) which has its transcription Normal tissue, stage, and quantity of Sgs-7-Adh fusion start site at approximately -840 bp 5' of Sgs-4. The gene expression is observed when 211 bp of 5' flanking RNA derived from that region is salivary gland sequence are present. An Sgs-7-Adh fusion gene with restricted as is the Sgs-4 RNA, but is present during 92 bp upstream is not functional. These results are larval life prior to the appearance of Sgs-4 RNA, in consistent with the presence of an enhancer-like the second larval instar and in early third instar. element acting in both directions and located within Sequence analysis of the Pig-I coding region shows two the overlapping region of the upstream sequences open reading frames covering sequences with several required for expression of the two genes, positioned CAA-repeats (Hofmann and Korge, 1987). This RNA asymmetrically within the intergenic region. was also detected, and the corresponding gene named In order to test the enhancer function of this Pig-1, by Peter Mathers (Biology 1984, Abstract No. regulatory region, we have now placed these 196 bp 5' 88; Biology 1985, Abstract No. 121) when analyzing of an Sgs-3-lac Z fusion gene lacking its own transcripts in salivary glands of third instar larvae in quantitative control sequences, containing only 130 bp the l(l)npr-1 mutant background. In that non of Sgs-3 upstream sequence which was shown to be pupariating mutant, expression of Pig-I continues sufficient for stage- and tissue-specific expression of during late third instar in salivary glands. Sgs-3 (Biology 1987, Abstract No. 98). The construct As the two genes are expressed in the same tissue containing only 130 bp of Sgs-3 upstream sequence and but at different developmental stages, analysis of their the Sgs-3-lac Z fusion gene is negative in the transient common upstream region could reveal some common expression assay, whereas we find that constructs and some different regulatory elements. As an which in addition contain the l 96 bp region in either approach for this analysis, I am currently constructing direction show s-galactosidase activity in the salivary histochemically assayable fusion genes of Sgs-4 and glands of surviving third instar larvae after injection Pig-1. The intergenic region can then be altered in into preblastoderm embryos. This shows that sequences vitro and expression of the genes can be analyzed after within these 196 bp can act as an enhancer on all three reintroduction into the genome of D. melanogaster by of the glue protein genes at the 68C locus. P-element transformation. Experiments are in progress to quantitate the The Sgs-4 gene shows variability in quantity of enhancement in germline gene transfers to further de expression in several wild-type stocks. In order to limit the sequences required for enhancement, and to analyze correlation to Pig-1 expression at this level, I test the enhancer quality on other glue protein genes. have tested 80 wild-type stocks including Sgs-4 under producers and non-producers. Pig-1 RNA is present in second instar larvae in all those stocks at nearly the same amount, and the RNA has the same size in all 92 stocks. As the Sgs-4 gene is located on the X chromo in larvae that carried the appropriate mutation. It was some, it undergoes dosage compensation in most of the determined that as little as 130 bp of DNA upstream wild-type stocks: although the gene is present in from the Sgs-3 start site, an amount sufficient for double dose in females and in single dose in males, correct tissue and time regulation but not for abundant both sexes produce the same amount of Sgs-4 RNA by RNA levels, was sufficient to block expression in a hyperexpression of the gene in males. In some wild l(l)npr-1 background. Expression was also blocked in type stocks this is not the case. Regulatory sequences constructs that contained as little as 12 bp of the 5' for this hyperexpression have been shown to lie within untranslated region of the RNA. In order to correctly the 840 bp upstream region (Hofmann et al., J987). define if the effects of the mutation were at the up Experiments are in preparation to quantify the stream initiation level versus the transcript processing amounts of Pig-1 RNA in males and females of Sgs-4 level, fusion genes using another glue gene, Sgs-4 compensating and non-compensating strains. (which is not under absolute l(l)npr-1 control), were constructed utilizing site-directed mutagenesis of the References: Hofmann, A. and Karge, G. (1987) Chromosoma 96, Sgs-3 start site. The resulting genes possessed the 1-7. upstream region from either Sgs-3 or Sgs-4 and the Hofmann, A., Keinhorst, A., Krumm, A. and Karge, G. (1987) Chromosoma 96, 8-17. transcription unit and downstream sequences from the Krumm, A., Roth, G. and Karge, G. (1985) Proc. Natl. other gene, giving chimeric genes referred to as 4/3 Acad. Sci. USA 82, 5055-5059. McNabb, S. L. and Beckendorf, S. K. (1986) EMBO J. 5, and 3/4. The expression of the 4/3 construct in a 2331-2340. l(l)npr-1 background suggests that no block exists in Shermoen, A. W., Jongens, J., Barnett, S. W., Flynn, K. and Beckendorf, S. K. (1987) EMBO J. 6, 207-214. the transcription unit of Sgs-3 which would prevent transcript elongation. The failure of the 3/4 construct 136. Regulated Expression of the Sgs-3 Gene by to express in the mutant background suggests that the Trans-Acting Factors interaction site of the npr + product is located 5' of the Peter H. Mathers transcription start site. Taken together with the At the 68C chromosome locus of Drosophila results discussed above from other constructs, the npr + melanogaster reside three glue genes, Sgs-3, Sgs-7, and product must be interacting, either directly or in Sgs-8, and the expression of these genes is directly, with the sequences in the proximal promoter coordinately regulated in a time- and tissue-specific element located in the -130 bp region. A more exten manner. Two factors are known to be required for the sive analysis of the actual sequences involved will expression of these three genes: the steroid hormone, require the development of a genomic sequencing ecdysterone, and the product of the X-chromosomal technique for this upstream region from salivary gland locus, 2B5. Mutations in the production of either of tissue of wild-type and mutant larvae. these factors result in a non-pupariating larval lethal phenotype. These types of mutations also have effects 137. Genes Expressed in the Embryonic Salivary Gland on the expression of the 68C glue genes. Larvae of Drosophila mutant for the production of the 2B5 product (e.g., Bruce A. Hamilton l(l)npr-1) or for the production of ecdysterone (e.g., We have begun an analysis of two non-cross l(l)su(f)ts67g) fail to accumulate to a detectable level hybridizing genes which are expressed in the salivary any of the 68C glue RNAs. These mutants also fail to glands of Drosophila melanogaster by mid express any transformed germline constructs con embryogenesis (J. Thomas, personal communication). taining regulatory elements from the 68C gene cluster. We have shown each of these genes to be single copy, It is this fact that has allowed us to analyze the each expressing a single abundant transcript in regions necessary for regulation by these factors of embryos which is not detected in either third instar one of these genes, Sgs-3. larvae or adult flies. These genes are rapidly evolving In an effort to determine what sequences are at the nucleic acid level, since genomic Southern blots involved in the regulation of Sgs-3 by the 2B5 product detect (single) bands only for flies in the subgenus (npr +), expression of germline constructs was analyzed Sophophora. Northern blots show that both genes are 93 active rather early in development (0-3 hr), suggesting Meyerowitz, E. M., Chang, C., DeJohn, A. W. and Bowman, J. L. (1987) Preliminary report on a that they may be turned on shortly after determination restriction fragment length polymorphism map for of the cells that give rise to the gland. We are now Arabidopsis. Arabid. lnf. Serv. 25, l l-14. Meyerowitz, E. M., Vijay Raghavan, K., Mathers, P.H. examining this early expression more closely using in and Roark, M. (1987) How Drosophila larvae make situ hybridization to sectioned embryos. glue: Control of Sgs-3 gene expression. Trends in Genetics 3, 288-293. Pang, P. P. and Meyerowitz, E. M. (1987) Arabidopsis 138. Headclones thaliana as a model system in plant molecular biology. Bio/Technology 5, 1177-ll 8 l. K. Vijay Raghavan, Michael A. Whitney, Pang, P. P.-Y., Pruitt, R. E. and Meyerowitz, E. M. Carol A. Mayeda, Michael J. Palazzolo (1988) Molecular cloning, genomic organization, We are characterizing a large number of cDNA expression and evolution of 125 seed storage protein genes of Arabidopsis thaliana. Plant Mol. clones that correspond to mRNAs differentially Biol., in press. expressed in the Drosophila head (Biology 1987, Abstract No. 103). These initial experiments will determine 1) the chromosomal locus that corresponds to each of the clones isolated, 2) the particular tissue and cell types in which each corresponding gene is Associate Professor: Ellen Rothenberg expressed, 3) the localization of the corresponding Research Fellows: Paul D. Boyer, Mariam M. encoded protein products, and 4) the effects on the Dohadwala, Kathleen L. McGuire Graduate Students: Thomas J. Novak, Julia A. Yang developing embryonic nervous system caused by a Associate Biologist: Rochelle A. Diamond deletion of the corresponding chromosomal locus. Research and Laboratory Staff: Moira A. Fearey, Parvin Hartsteen, Cherrie W, Leighton, Jill K. Most of our experiments involve standard Lewis, Karen A. Pepper techniques. However, to facilitate the generation of immunological .probes, we have developed a set of Support: The work described in the following research expression vectors that allow high-efficiency reports has been supported by: Biomedical Research Support Grant (NIH) directional phage ' cDNA cloning (with the protection Cancer Research Institute, Inc. of all internal sites), automatic genetic excision of a Lucille P. Markey Charitable Trust National Institutes of Health, USPHS plasmid form of the cDNA clone, oligonucleotide The Proctor & Gamble Co. directed frameshifting, and the generation of single University of California University-Wide Task Force on AIDS stranded forms of the cDNA sequence. PUBLICATIONS Summary: Our group is interested in understanding Bowman, J. L., Yanofsky, M. F. and Meyerowitz, E. M. how T lymphocytes develop functional competence. (1988) Arabidopsis thaliana: A review. In: Oxford One of the most significant new directions in Surveys of Plant Molecular and Cell Biology, Miflin, B. J. (Ed.), Vol. 5, Oxford Press, in press. immunology in the last five years has been the Chang, C., Bowman, J. L., DeJohn, A. W., Lander, E. elucidation of aspects of mature T-cell function. We S. and Meyerowitz, E. (1988) Restriction fragment length polymorphism linkage map for Arabidopsis now understand that mature T cells not only bear thaliana. Proc. Natl. Acad. Sci. USA 85, in press. specific receptors that allow them to recognize Martin, C. H., Mayeda, C. and Meyerowitz, E. M. (1988) Evolution and expression of the Sgs3 glue particular antigens, but also have the competence to gene of Drosophila. J. Mol. Biol. 201, 273-287. respond to environmental signals by de nova, transient Martin, C. H. and Meyerowitz, E. M. ( 1988) Mosaic evolution in the Drosophila genome. BioEssays 9, expression of restricted subsets of "response'! genes. 65-69. Such genes include those encoding T cell-specific Meyerowitz, E. M. ( 1987) Arabidopsis thaliana. Ann. Rev. Genet. 21, 92-l ll. polypeptide hormones, growth factor receptors, and Meyerowitz, E. M. (1987) In situ hybridization to RNA cytolytic apparatus. Different functional subclasses of in plant tissue. Plant Mol. Biol. Report. 5, 242-250. Meyerowitz, E. M. and Chang, C. (1988) Molecular T cells are competent to express different subsets of biology of plant growth and development: response genes, and this latent phenotype is stable Arabidapsis thaliana as an experimental system. In: Developmental Biology: A Comprehensive over many cell generations. Thus, a developing T cell Synthesis, Browder, L. (Ed.), Vol. 5, Plenum Press, must not only assemble a particular antigen-binding New York, pp. 353-366. 94 receptor but also become armed to serve a particular Abstract No. 142. This project is particularly function, by programming for inducibility of some, but important for the long term, because evolutionary not all, T cell-specific response genes. The ordered conservation would forcefully highlight those aspects gene rearrangements that result in T-cell receptor of lymphocyte developmental biology which are most assembly are now relatively well understood; the essential for a functioning immune system. mechanisms involved in commitment to a functional lineage have just become accessible for exploration. 139. IL2 mRNA Accumulation by Subsets of Murine T Cells We are working on several aspects of this process. The first is to define the basis upon which T cells Julia A. Yang, Kathleen L. McGuire, Ellen Rothenberg escape commitment to die while still differentiating in We have investigated the linkage between the thymus. Death preempts maturation for an C04/COS phenotype and programming for specific estimated ~95% of all newly-generated thymocytes, responses in primary I-cell populations. In general, T throughout the period of maximal T-cell production. cells that express the C04 cell-surface glycoprotein We are attempting to discover the timing of the fate are ''helper" or "amplifier" cells which respond to the determining event in developing cells by tracing recognition of antigen by secreting lymphokines, often evidence for functional changes prior to death, such as including the major T cell growth factor, interleukin-2 loss of interleukin-2 (IL2) receptor inducibility (see (IL2). Cells that express CDS include most killer T Abstract No. 145). Another event that may be related cells, and show little helper activity. We used the to commitment to die is the expression of a unique techniques of quantitative RNase probe protection pattern of trans-acting transcription factors in the analysis and in situ hybridization to measure the presumptively condemned cells, as assayed following accumulation of ZL2 mRNA in individual T cells transfection with different viral promoter constructs responding for the first time to different stimuli. This (see Abstract No. 144). approach revealed a strikingly broad phenotypic Our second major focus is the mechanism by which distribution of cells with intrinsic competence to precursors of different functional lineages of T cells express the IL2 gene, for many or most of CD8+ cells may diverge. We are examining the first appearance as well as CD4 + cells are fully competent under of competence to synthesize IL2 as a marker for type certain stimulation conditions. The accumulation of 1 helper T cells, correlated with phenotypic and other 1L2 mRNA in response to 24 hours of stimulation with functional evidence for possibly distinct precursors for the calcium ionophore, A231S7, and the phorbol ester, such a helper lineage (Abstract No. 147). We have also 12-0-tetradecanoyl-phorbol-13-acetate (TPA), was examined the regulation of type l helper activation in similar in individual C04 + and cos• cells. By analysis mature T cells, to ask whether different functional of populations of enriched T cells and of splenic popu response programs are always mutually exclusive lations eliminated for either CD4 + or cog+ cells, by (Abstract Nos. 139 and 140). Our results suggest that treatment with monoclonal antibodies against either commitment may follow a significant time after the C04+ or COS+ cell-surface glycoprotein followed acquisition of any particular type of competence, and by complement-mediated lysis, we determined that that virgin T cells may have considerable plasticity for almost all C04+ cells and over half of CDS+ cells function. We are now planning to manipulate the could express ZL2 mRNA. However, the two cell types expression of various functional programs in transgenic differ markedly in their kinetics of message accumula mice, as an approach to testing the regulatory or tion when stimulated via the T-cell receptor with developmental relationships between different concavalin A or an anti-CD3 monoclonal antibody. functional T-cell subclasses. Under these conditions, the CD8+ cells exhibit an Finally, we have begun to examine T-cell abortive ZL2 production response resulting in differentiation in an evolutionary context. A new substantially lower yields of IL2 mRNA per cell than is project in the group is to explore the steps leading to made by C04 + cells in response to the same stimuli. functional maturation in the thymus of Xenopus laevis. These data suggest that the difference between cells Our initial approaches to this work are presented in committed to '~L2-producing" and "non-IL2-producing" 95 lineages are not significantly different in their serine esterase genes will be determined by using the intrinsic abilities to initiate IL2 transcription, but that specific monoclonal antibodies CD4 and CD8 to signal transduction and/or RNA stabilization mediate complement elimination of the two classes of mechanisms may play a vital role in regulating a splenic cells bearing one or the other marker. Pre surprisingly plastic set of functional responses. liminary analyses using RNA gel blots have indicated We are currently interested in understanding the that the ability to express CCP 1 RNA may be present kinetics of IL2 mRNA accumulation in splenic T-cell in both CD4 + and CD8+ populations of virgin T cells, in subpopulations under different stimulation conditions. contrast to the expectation from cell lines. We hope Preliminary data indicate that unfractionated T cells to use the newly defined memory T cell marker Pgp-1 which are stimulated with anti-CD3 monoclonal anti to determine whether more rigid restriction of func body and TPA (to obviate the need for feeder cells) tional competence to phenotypically defined subsets is accumulate relatively high levels of IL2 message in a acquired as a function of conversion to a memory cell. monotonically increasing way over the first 12 hours of stimulation. We intend to perform in vitro nuclear 141. Expression of !L2 Receptor Subunits by run-on transcription experiments to examine the tran Subpopulations of the Thymus scriptional and posttranscriptional regulation of IL2 Patricia M. White', Ellen Rothenberg gene expression in different T cell subsets when stimu In response to stimulation, all mature T cells lated by calcium ionophore and phorbol ester or by express a high affinity receptor that binds and inter specific T-cell receptor ligands. In addition, we plan nalizes interleukin-2 (IL2). Recently, it has been found to examine the inverse correlation between IL2 RNA that this receptor is a heterodimer: a combination of accumulation and cell cycle progression in these a constitutively expressed medium-affinity chain, functionally divergent populations. called p70, and a low-affinity chain expressed only upon activation, called p55 or the Tac antigen. The 140. Expression of Serine Esterase Genes As A Marker p70 receptor is believed to be responsible for the of Commitment to Helper vs. Killer Lineage internalization of IL2. Mariam Dohadwala, Russell J. Hill, We are interested in determining when in T Ellen Rothenberg lymphocyte development this constitutive expression is Serine esterase genes are believed to be killer acquired. We are particularly interested in whether specific, as they are present in cDNA libraries of cyto cortical thymocytes, which usually die in vitro and toxic cell lines but not in helper cell lines. If so, they in vivo, possess this ability. We will separate may represent valuable lineage markers that identify a subpopulations by PNA panning, which enriches for T-cell population distinct from that which acquires the cortical thymocytes, by CD4- and CD8-mediated ability to express IL2. To determine whether three complement lysis, which eliminates cells bearing serine esterase-specific cDNAs are functionally killer either developmental marker, and by FACS analysis, specific, we are studying the expression of these genes and assay each subpopulation for expression of p70. in different killer cell lines (CTLL, MTL) and helper Since p70 has not been cloned, nor are there cell lines (EL4.El, BW5147, Dl0.G4, and others), in the antibodies specific for it, we assay cells by incubating absence or presence of the stimuli TPA and A23187. them with radioactive IL2, which binds specifically to Our preliminary results indicate strong expression of the receptors in a measurable, saturating fashion. To one such transcript, CCP 1 (encodes granzyme B, G, or demonstrate the presence of receptors, the cells are H), in the killer lines but not in EL4 or BW5147. For first incubated with varying concentrations of radio comparison with the expression of IL2 (Abstract No. active IL2, and the results are subjected to Scatchard 139), we would like to estimate the amount of mRNA analysis to show saturable, specific binding. Scatchard for serine esterase in various populations of splenic T analysis of radio-iodinated IL2 binding is relatively cells by using the quantitative RNase probe ptotection difficult because of the rapid decay of binding activity analysis and in situ hybridization techniques. The of the radiolabeled ligand and its high propensity to phenotype of the cells responsible for the expression of aggregate and stick to surfaces. We have thus far 96 successfully achieved reproducible Scatchard analyses which are plated in culture dishes can remain viable of medium-affinity receptors (p70 alone) on the for several days. Peripheral lymphocytes from blood surfaces of MLA-1'+4 (gibbon CD&+ lymphoma) cells. have also been cultured, but so far they have not been Under the conditions we have found to be optimal isolated to the same degree of homogeneity. Both cell for this medium-affinity binding, we plan to crosslink populations respond to the mitogen phytohemagglutinin bound 125r-IL2 covalently to the receptors. The (PHA). Cultures treated with 0.5 µg/ml PHA exhibit proteins will be separated by gel electrophoresis and blasting within 24 hr, becoming large and retractile. autoradiographed to detect bound 125I-IL2. This Under these conditions, Watkins and Cohen (1986) re method can determine the presence of p55, p70 or any port production of Xenopus IL2. RNA extracted at this other as yet undiscovered receptor specific for IL2. stage includes a species of approximately l kb that Controls for this experiment are the murine CD4 + hybridizes with the murine IL2 probe under conditions lymphoma EL4 and the gibbon CD&+ lymphoma. of reduced stringency. We are now constructing cDNA libraries from induced splenocyte RNA to attempt to 1Undergraduate, California Institute of Technology. determine whether the hybridizing sequences indeed represent a Xenopus homologue of IL2. ! lj.2. Search for Lymphokine Genes in Xenopus laevis Reference: Moira A. Fearey, Ellen Rothenberg Watkins, D. and Cohen, N. (1986) Dev. Comp. Immunol. 10, 126. We have initially attempted to determine whether a Xenopus IL2 homologue can be identified by hybridi zation with mammalian probes. Complete human and }lj.3. Studies on the Mouse lnterleukin-2 Gene Promoter mouse IL2 cDNAs and overlapping mouse genomic IL2 clones are available. A 411-bp mouse 1L2 cDNA frag Thomas J. Novak, Ellen Rothenberg ment was used to probe Southern blots of Xenopus We have cloned the mouse gene encoding genomic DNA. The probe contains 17& bp of coding interleukin-2 (IL2) and have constructed hybrid genes region and 233 bp of 3' untranslated sequence. Blots consisting of the IL2 gene promoter with various were hybridized at 65° in 6X SSC, with final washes in amounts of 5' flanking DNA linked to a recorder gene, 0.3X SET at 65°, to reduce background hybridization bacterial chloramphenicol acetyltransferase (CAT). to repeated sequences (possibly ribosomal DNA). A We described our preliminary results in last year's single band of 3.8 kb was seen with Xenopus DNA annual report (Biology 1987, Abstract No. 116). In digested with Hindlll, and a single band of 2.8 kb was these experiments, the hybrid genes were introduced seen upon EcoRI digestion with this probe. The human into lymphoid and non-lymphoid cell lines by protoplast 1L2 cDNA probe visualizes the identical bands under fusion. We have since repeated these experiments these conditions on a parallel blot, although it cross using a different transfection protocol, namely DEAE hybridizes only weakly with murine IL2 DNA. Three dextran facilitation, to eliminate the potential conclusions can be drawn from these experiments. artifactual carryover of bacterial proteins (including First, an IL2 homologue is likely to be present in the CAT) into the recipient cells. The results obtained Xenopus genome, as it is unlikely that both probes with DEAE-dextran differ somewhat from those pre would recognize the same adventitiously hybridizing viously obtained by protoplast fusion. !n summary, sequence. Second, the Xenopus IL2-like gene has EL4.E1 cells (a helper thymoma cell line) utilize the retained considerable sequence homology compared to IL2 promoter when stimulated with phorbo1 ester and the mouse and human genes. Third, the Xenopu.s IL2- calcium ionophore but do not express CAT from this Jike gene is probably single copy. promoter without stimulation. No other cell line has, In order to identify the transcript derived from the in our hands, been able to utilize this promoter Xenopus IL2 gene, we have been working to establish a whether the cells are stimulated or not. Cell lines primary spleen cell culture system in which IL2 tran tested include two CTL lines (MTL2.8.2 and CTLL-2), scripts can be induced upon stimulation. Gradient a B cell line (NS-I), a helper thymoma (BW5147), a purified splenocytes from juvenile female spleens premast cell (32D cl5), a macrophage line (P388D 1) a 97 type 2 helper T cell line (Dl0.G4.I) and a helper T-cell to a change in chromatin structure around the IL2R hybridoma (AO!T-2.l l). The lack of expression in gene or reflects a lack of necessary trans-acting BW5llJ.7 is puzzling because this line expresses its transcription factors. endogenous IL2 gene upon stimulation. This defect One way to evaluate the relative contributions of may be dominant since AOIT-2.ll, which is a fusion these two mechanisms is to introduce cloned genes between a BIO.AT cell clone and BW5l47, also fails to into the cells of interest and then assay for the express the exogenous IL2-CA T plasmids. Expression presence of the mRNA or protein encoded by that of IL2 by normal T cells, however, appears to be highly gene. We have begun to utilize mouse thymocytes as restricted by the cell cycle, and it is possible that the recipients in gene transfer experiments. We have used ability to take up exogenous DNA in these lines is DEAE-dextran facilitation to introduce either pRSV limited to a narrow window of time in the cycle that is CAT or pSV2-CAT into various thymocyte sub incompatible with induction of IL2 expression. populations. Twelve hours posttransfection, CAT In EL4.El cells, the 1L2 promoter containing !.& kb activity can be detected in both the PNA + (cortical of upstream DNA consistently gives rise to 5-lOX type) and the PNA- (pooled progenitor type and mature more CAT activity than constructs containing 2.8 kb cell) fractions. Preliminary results indicate that in or 325 bp of upstream DNA. This suggests that PNA+ cells, pSV2-CAT is more efficient than pRSV sequences required for maximal expression are located CAT by a factor of between 3 and 60. This pattern of between -325 and -1800 bp from the cap site, with expression represents a dramatic reversal with respect possible negative regulatory sequences between -1.8 to the rank order of preference in mature T cells and -2.8 kb. However, all three constructs are described previously (Novak and Rothenberg, 19&6). inducible by PMA and A23l&7. A small promoter frag On a per cell basis, PNA +cells express -10 more CAT ment containing only 100 bp of 5' flanking DNA is not from pSV2-CAT than do PNA- cells while pRSV-CAT expressed in these cells even after induction. expression is about equal in both cell types. We have Currently, we are examining expression of these also tested expression vectors driven by LTRs of constructs in primary mature and immature T cells endogenous murine MCF viruses. These viruses are from spleen and thymus, respectively. believed to be the proximal agents in the induction of thymic leukemia in mice. PNA + cells utilize their 144. Transient Expression of Transfected Genes in promoters 5-lOX better than the SV40 early promoter, Murine Thymocytes in keeping with the observation that in situ these Thomas A. Novak, Ellen Rothenberg viruses cause predominantly cortical thymomas. One of the goals of this lab is understanding the Analyses of total nuclear DNA present 24 hours post mechanisms by which thymocytes are selected either transfection demonstrate the presence of ~10 3 plasmid for terminal differentiation into mature T cells or, copies per cell over the entire population. alternatively, death. Ultimately, we wish to elucidate Initial experiments in which our IL2 promoter/CAT at the molecular level the way in which this decision is constructs were introduced into thymocytes (see imposed on these cells. Much work in this and other previous abstract) suggest that neither PNA- nor PNA + labs has demonstrated differences in the gene expres cells can utilize this promoter even after stimulation sion repertoire of various thymocyte subpopulations. with phorbol ester and calcium ionophore. These differences are seen both in constitutive Reference: expression and also following treatment of thymocytes Novak, T. J. and Rothenberg, E. V. (19&6) DNA 5, with activators of mature T cells, such as phorbol 439-451. ester and calcium ionophore. For example, most 145. IL2R Inducibility of Thymocyte Subpopulations cortical-type thymocytes are unable to induce expression of the interleukin-2 receptor (IL2R) gene Paul D. Boyer, Rachelle A. Diamond, Ellen Rothenberg after appropriate stimulation (Abstract No. 145) and The ability to respond to activation by expressing this defect occurs at the transcriptional level. surface IL2R is characteristic of mature T cells. In However, it is presently unknown whether this is due the course of our characterization of the acquisition of 98 T cell function during thymic maturation, we demon tigating whether these cells may have already become strated that fewer than 2596 of thymocytes possess committed to follow the death program manifested by this ability. Most of the responding thymocytes also most CD4+CD8+ postmitotic cells. exhibit other characteristics of peripheral T cells and are thus likely to represent a class of mature thymo 146. Developmental Regulation of IL2R Inducibility cytes. However, most cells belonging to another subset Paul D. Boyer, Ellen Rothenberg of thymocytes, which is known to possess precursor We have demonstrated that during T-cell type activity, are also contained in this inducible class. differentiation in the thymus, the gene encoding the If there is a developmental continuum between the p55 chain of the murine IL2R exhibits at least three IL2R-inducible precursor-type thymocytes and those regulatory modalities. Many "double negative" thymo with a mature T cell-like phenotype, developmental cytes, which are thought to include cells with the intermediates might be defined by ascertaining the earliest precursor activity, constitutively express the phenotypes of all IL2R-inducible cells in the thymus. p55 chain of the IL2R. This type of IL2R gene expres Alternatively, IL2R inducibility might be blocked in all sion is unusual in that it is not conserved throughout thymocytes in a potentially reversible way, at some phylogeny, and it is not characteristic of mature cells critical stage of differentiation. in the T lineage. A second type of IL2R gene expres It seems clear that mitotically active cells are the sion is found in most CD4+CD8- and postmitotic CD4- precursors of the small postmitotic cells that make up CD8+ thymocytes. This regulation requires activation the majority of IL2R-noninducible cells in the thymus. of the cells prior to p55 gene expression and most Most of the latter are thought to die in situ, within 3-4 closely resembles the regulation of this gene in mature days of their last mitosis. We reasoned, then, that T lymphocytes. Finally, most cortical-type thymocytes differentiating progeny of IL2R-inducible precursor appear to have lost the ability to express the p55 gene cells might be found in the dividing population. Using under any circumstances, and the few of those that centrifugal elutriation, we separated thymocytes into can still be induced to express IL2R do so at a blast fraction, which includes cells in G l' S, and G + 2 significantly lower levels. M phases of the cell cycle, and a postmitotic fraction, IL2R gene expression in the thymus thus serves as which is comprised almost entirely of cells in G . 0 an excellent model to study one aspect of the After stimulating these fractions for 20 hours in the molecular regulation of T-cell maturation in the presence of A23187 and TPA, we were surprised to thymus. Towards this end we have undertaken the find that fewer than 3096 of the blast cells responded molecular cloning of the IL2R p55 gene from a by inducing surface IL2R expression. genomic library from DBA mouse liver. Isolation of We fractionated these size classes further by this DNA should facilitate investigations to correlate complement-mediated lysis of cells expressing the changes in IL2R gene expression with structural surface markers CD4 and/or CD8. While nearly all changes in the gene and with changes in the DNA postmitotic CD4+CD8- and CD4-CD8+ thymoctyes are binding protein milieu in cells representing different IL2R inducible, the blast populations differ stages of T-cell development. It is our hope that in remarkably. CD4+CD8- blasts variably comprise about this way a more general understanding of the 296 of all thymocytes, but when they can be isolated mechanisms regulating critical fate determination they behave in a manner similar to their postmitotic might be achieved. counterparts. On the other hand, only about 3096 of CD4TD8+ blasts can induce surface IL2R expression 147. Relationship of Functional Commitment and Hormone Dependence in T-Cell Ontogeny using these conditions. Upon closer examination we found that these noninducible CD4-CD8+ blasts are Ellen Rothenberg, Karen A. Pepper, Julia A. Yang enriched for cells expressing little or no surface T-cell Lymphokine-secreting ''helper" T cells ultimately receptor. In addition, these cells rapidly differentiate diverge into two types: type I helpers, which can into CD4+CD8+ cortical-type cells in culture in the synthesize IL2, lymphotoxin and interferon-gamma; absence of inducing agents. We are therefore inves- and type 2 helpers, which synthesize none of the above but can instead produce IL4 and IL5. In the helper T Professor: Melvin I. Simon Visiting Associates: Vivian H. Cohn, Jesus Del Mazo, cell lines examined to date, the monokine Ill is Elsebet Lund required for stimulation or strongly co-stimulatory Senior Research Fellows: Thomas T. Amatruda, Ryn Miake-Lye, Kenji Oosawa with antigen in type 2 helper lines but not in type 1 Research Fellows: Manfred W. Baetscher, Bruce W. helpers. We have recently demonstrated that a signif Birren, Katherine A. Borkovich, Robert B. Bourret, Narasimhan Gautam, Anna C. Glasgow, icant fraction of double-negative thymocytes can Gregg G. Gundersen, John W. Hess, Kelly T. synthesize low levels of IL2 RNA and protein upon Hughes, Nachum Kaplan, Janis Lem, Nechemia Sar, Thomas Wilkie stimulation (McGuire and Rothenberg, 1987). To Graduate Students: Michael A. Lochrie, Murray 0. explore the relationship between these cells and Robinson, Michael P. Strathmann Special Graduate Student: Kelwyn H. Thomas mature type l helpers, we have assayed the effects of Research and Laboratory Staff: John A. DeModena, stimulation in the presence and absence of a high dose Pamela L. Eversole-Cire, Martha Fiallos, Henry K. W. Fong, Jane D. Goldsborough, Joyce Ito, (0.5 ng/ml) of recombinant ILia. Whereas bulk Carol C. Lee, Irma Ribeiro cultures of double-negative cells clearly exhibit increased viability and blastogenesis in the presence of Support: The work described in the following research IL!, there is no increase in the levels of lL2 mRNA reports has been supported by: American Cancer Society expressed. The same is true for cultures of thymo Anne P. and Benjamin F. Biaggini Professorship cytes that include all thymic subpopulations, or in Biological Sciences double-negative cells with either CD&+ cells or CD4+ Fulbright Grant Lucille P. Markey Charitable Trust (mature helper phenotype) cells. Thus, from the National Institutes of Health, USPHS National Science Foundation earliest stages where we can assay ability to produce Department of the Navy, Office of Naval IL2, this response is independent of IL!. We are Research Damon Runyon-Walter Winchell Cancer Fund presently using in situ hybridization and multi parameter phenotypic analysis to determine whether the IL2 gene is only programmed for inducibility in IL! Summary: During the past year we have made nonresponsive cells, i.e., whether pre-T cells that can progress in our efforts to understand the mechanisms give rise to type 1 helpers are already functionally involved in information processing and signal trans distinct from other pre-T cells at the double-negative duction, both in bacteria and in eukaryotic cells. stage, or whether it is merely the IL2 transcription Bacterial cells have complex sensory systems. They unit that can be activated in any cell type indepen are able to measure changes in a variety of physical dently of cellular events that are induced by ILi. parameters and in the relative concentration of Reference: approximately 50 different chemical compounds in McGuire, K. and Rothenberg, E. (19&7) EMBO J. 6, 939-946. their environment. This information is integrated, as a function of time, and transduced into a biochemical signal which regulates the frequency of reversal of the PUBLICAT!ONS bacterial flagellar motors. When bacterial flagella are Boyer, P. D. and Rothenberg, E. V. (1988) lnterleukin-2 rotating in one direction the cells swim smoothly. receptor inducibility is blocked in cortical-type thymocytes. J. Immunol. 140, 2&&6-2892. However, when these motors reverse direction the Kinnon, C., McGuire, K. L. and Rothenberg, E. V. (19&7) Differential regulation of T-cell receptor cells stop and tumble for a fraction of a second and gamma genes in immature thymocyte populations. then choose another swimming direction. By regulating Eur. J. Immunol. 17, 1265-1269. the frequency of flagella-rotation reversal, the cell McGuire, K. L., Yang, J, A. and Rothenberg, E. V. (19&&) Influence of activating stimulus on can modulate its behavior so that it swims toward functional phenotype: lnterleukin-2 mRNA accumulation differentially induced by ionophore higher concentrations of "attractant" compounds and and receptor ligands in subsets of murine T cells. away from higher concentrations of "repellents." We Proc. Natl. Acad. Sci. USA &5, 6503-6507. have isolated mutations and have mapped, cloned, and Rothenberg, E. V., McGuire, K. L. and Boyer, P. D. ( 19&&) Molecular indices of functional competence sequenced almost all of the genes that are directly in developing T cells. Immunol. Rev. 104, 29-53. relevant to the process of bacterial chemotaxis. However, the precise mechanisms whereby the JOO products of these genes integrate information have Signal transduction in animal cells appears to be eluded us. more complex than the systems that we have been In the past year we developed an hypothesis to studying in bacteria. Extensive work in many explain signal transduction in bacterial chemotaxis; it laboratories has demonstrated that G proteins, i.e., is illustrated in the diagram below. proteins that bind GTP (guanosine triphosphate) are directly involved in processing information from a wide variety of transmembrane receptors, including receptors that bind hormones, some growth factors, and neurotransmitters. G proteins are generally found R tor ~ CheA ,1' :\. as heterotrimers made up of three polypeptide ___ ., ~ I,." subunits, a, s and y. We have spent the last few years CH3, I @) defining the nature of the genes that encode these sub units in a variety of cells. One central question is how ~ many different genes are there that specify GTP binding a subunits? Is gene diversity the basis for the We found that the product of the CheA gene was an specific interaction of G proteins with hundreds of autophosphorylating kinase. It uses ATP to rapidly different transmembrane receptors and ion channels phosphorylate histidine residue 48 in the N-terminal found in all kinds of cells at different stages of portion of the protein. We believe that bacterial development and differentiation? It is clear that the transmembrane receptors sense the environment by different a subunits that are currently known are too binding specific ligands and regulate the rate of CheA few to account for this enormous range of interaction autophosphorylation. We found that CheA is able to and they are too abundant to correlate with the four or transfer the phosphoryl residue rapidly to either the five different kinds of second messenger generating CheY protein or the CheB protein. Previous work has systems. In the past year we discovered a new Ga shown that the CheB protein is a methylesterase that subunit that may couple specific receptors to proteins can modify the receptors by removing specific methyl that generate intracellular phospholipid signals. We groups from glutamic acid residues on the cytoplasmic are continuing to explore the hypothesis that the portion of all of the transmembrane receptor differentiated state of the cell specifies the nature molecules. Phosphorylation of the CheB protein and level of expression of different G protein subunits, activates its methylesterase activity and thus and that they in turn generate intracellular _networks regulates feedback to the receptor and controls its for integrating information from different cell surface ability to respond. Phosphorylation of the CheY receptors and ion channels. protein activates it and allows it to increase the Our struggles with the gene encoding the s subunits probability of flagellar motor reversal. Both the Che Y associated with the Ga subunits have led us to look for and the CheB proteins can be autodephosphorylated new methods of cloning, sequencing, and mapping relatively rapidly. Furthermore, the Chez protein genes that encompass large regions of DNA. The 13 accelerates the dephosphorylation of phosphoryl-CheY subunit gene probably involves a segment of DNA that and thus terminates the signaling pathway. This model is larger than I 00,000 base pairs. Therefore, together gives us a clear biochemical system to manipulate in with workers in Prof. Hood's laboratory, we have order to test the details of information processing in perfected an instrument involving pulse-field bacteria. Furthermore, the chemotaxis system shares electrophoresis that is capable of resolving DNA the process of phosphate transfer with a variety of molecules ranging in size from 10 megabase pairs to other sensory systems that regulate gene expression in 1000 base pairs on a single agarose gel electrophoresis bacteria; therefore, the mechanisms that emerge from run. We hope to exploit this instrument for further an understanding of chemotaxis may also help us to studies in gene mapping and for the characterization understand how cells regulate gene expression in of the SI and 82 genes. response to environmental changes. IOI One system in which sequential regulatory 148. Protein Phosphorylation of Chemotaxis Proteins processes control cellular differentiation is spermato John W. Hess, Kenji Oosawa, Melvin I. Simon genesis, and we have been exploring the nature of the Bacterial chemotaxis in E. coli requires six variation of G protein gene expression during cytoplasmic proteins, CheA, CheB, CheR, CheW, spermatogenesis in mice. This process is clearly CheY, and CheZ, for the integration and transmission divided into a number of cytologically discernable of environmental information gathered by trans stages. We prepared cDNA libraries from these dif membrane receptor proteins. We have discovered that ferent stages, demonstrated stage-specific activation phosphorylation is involved in this signaling pathway of gene transcription during spermatogenesis, and we and have begun to reconstitute the system in vitro. have isolated various DNAs corresponding to tran Once purified, the CheA protein becomes auto scripts that are expressed in a stage- and cell type phosphorylated, with one mole of phosphate per mole specific manner. Our initial work suggests that of enzyme, in the presence of MgCI2 and ATP. morphogenesis and meiosis are regulated and con Phosphorylated CheA can rapidly transfer its trolled in a sequential fashion by specific regulatory phosphate group to CheB, a protein involved in the mechanisms that involve gene activation. Our current adaptation to stimuli, or to CheY, a protein involved in work is aimed at elucidating these mechanisms. the excitation response. The phosphorylation of CheB We have also made good progress in understanding and Che Y are transient, i.e., they rapidly de how gene rearrangement occurs in bacterial systems. phosphorylate. We have also found that CheZ, a For the past 10 years we have been working on the protein that appears to antagonize CheY function in nature of site-specific recombination and particularly vivo accelerates the dephosphorylation of CheY. on the detailed mechanism involved in site-specific Therefore, it appears likely that signal transduction in recombination that -leads to inversion of a DNA bacterial chemotaxis involves the flow of phosphate sequence and, subsequently, to a new pattern of gene through a cascade of phosphorylated protein inter expression. We have clearly defined the nature of the mediates. The CheA protein appears to play a central DNA binding site by developing assays for binding of role in this process by serving as a branch point for the the Hin recombinase protein to specific sequences in excitation and adaptation pathways. Therefore, we vivo. We mutagenized all of the components of the Hin are undertaking a detailed analysis of the structure binding site and demonstrated the effect of specific and function of this protein. mutations on intracellular binding. Furthermore, we To examine the correlation between CheA phos characterized the in vitro binding of the Hin protein to phorylation and chemotaxis, cheA mutations leading to its site and have shown that the protein binds as a defects in chemotaxis were mapped and characterized. dimer to a site that contains an axis of dyad Mutant CheA proteins were purified and tested in vitro symmetry. We defined the nature of the enhancer site for phosphorylation. Four classes of mutants were and the enhancer protein that are required to drive the found. One class of mutants had no autophosphoryl recombination reaction. Furthermore, we have been ation activity. A second class of mutants was working together with Peter Dervan in the Division of autophosphorylated but at a much slower rate than Chemistry and with Suzanna Horvath of our wild type. A third class of mutants, clustered in the Biopolymer Synthesis Facility to prepare synthetic N-terminal quarter of CheA, was phosphorylated but peptides that correspond to the DNA binding region of had defects in their ability to transfer phosphate to the Hin recombinase. These peptides have been CheB and CheY. A fourth class of mutations had no equipped with EDTA-iron reagents that have DNA detectable defect; these mutants are presumably cleavage activity. We have been using these peptides defective in their ability to receive information from both to understand the specificity of Hin recombinase the transmembrane receptor proteins. This genetic binding and to further develop reagents that cleave analysis supports the proposal that phosphorylation is DNA at the sites that involve the recognition of involved in the signaling pathway. In addition to the sequences longer than I 0 bp. genetic analysis of cheA, partial proteolysis has shown 102 that CheA has an N-terminal domain of approximately attempt to obtain genetic evidence regarding the 18 kDa that retains the ability to transfer phosphate to in vivo intra- and intermolecular spatial relationships CheB and CheY but is unable to autophosphorylate. of the two transmembrane segments. Our current model for the structure-function of CheA Bacteria possess several environmental sensing is that it is composed of an N-terminal phosphate systems in addition to the one used in chemotaxis. To transfer domain, a central region involved in catalysis, address the generality of transmembrane signaling i.e., phosphorylation and protein stability, and a C mechanisms, chimeric proteins are being constructed terminal domain that receives input signals regulating that contain various portions of Tar and other sensor CheA activity. proteins: Rhizobium leguminosarum DctB (senses succinate), Agrabacterium tumefaciens VirA (senses 149. Transmembrane Signal Transduction in Bacterial compounds released from plant wounds), and E. coli Chemotaxis EnvZ (senses osmotic pressure). The chimeras will be Robert B. Bourret, Melvin I. Simon assayed for their ability to support a new hybrid Escherichia coli achieves chemotaxis by modulating function, e.g., chemotaxis of E. coli in response to swimming behavior in response to environmental stimuli normally sensed by DctB, Vir A, or EnvZ. stimuli. Information about the concentration of a subset of the various chemicals to which the bacteria 150. Heterologous Expression of Transducin can respond is transmitted into the cell by each of four a Subunits and Reconstitution of different species of transducer proteins. The trans Photoreceptor Signal Transduction ducers share a common topology, with a periplasmic Michael A. Lochrie, Melvin I. Simon (external) sensing domain connected to a cytoplasmic Our goal is to produce G protein a subunits in (internal) signaling domain by two transmembrane heterologous expression systems in order to carry out a segments. The multimeric state (i.e., monomer, dimer, mutational analysis of their function. A great deal is etc.) of transducer molecules in vivo is uncertain, as known and speculated about the structure and function the possible signaling role of changes in transducer of the a subunit of the bovine rod photoreceptor G' aggregation. To investigate the mechanism by which protein (also referred to as rod transducin a or TR a). these proteins transduce information across the cell This makes the photoreceptor signaling cascade a good membrane, we are modifying the structure of Tar (a choice for our studies and provides us with many transducer that senses aspartate) in several different logical targets and strategies for mutagenesis. ways and examining any resulting effects on function. We have analyzed the expression of T Ra in E. coli, Do the two transducer domains have to be yeast, and baculovirus/insect cell expression systems, covalently connected to one another in order to since the quantity and activity of proteins produced in function together? Transducer derivatives have been different foreign environments can vary greatly. In constructed that retain one domain and both trans yeast, vectors were constructed to direct the expres membrane segments, but delete the other domain. Is a sion of a full-length, unfused T Ra in the cytoplasm or cell containing a complementary pair of such proteins through the secretory pathway. However, in both capable of chemotaxis? Instability of the altered pro cases stable expression was undetectable. Using the teins has so far prevented us from obtaining an answer. baculovirus system we could produce I 0 mg TR a/L of Kenji Oosawa in this lab previously found that cells as a nonfusion protein and up to 500 mg/L (lO% introduction of a charged amino acid (Lysl 9) into the of total cell protein) in the form of a fusion protein middle of the hydrophobic first transmembrane seg with 12 amino acids of polyhedrin, an abundantly ment of Tar resulted in a nonfunctional protein, and expressed baculovirus protein, added to the amino that suppressor mutations creating Glu residues could terminus of T Ra. In E. coli we have most recently be isolated in both transmembrane segments. For utilized "dual cistron" vectors to boost expression of mation of a salt bridge between the two altered amino an unfused TR a to 2 mg/L. This represents a modest acids may explain the suppression. Additional I% of total cell protein but is a 1000-fold improve mutations and suppressors are being isolated in an ment over initial levels achieved with other types of 103 vectors. Almost all of the insect cell TR a. is insoluble, modification site, it may mediate transduction in but 50% of the E. coli TR a is soluble. Furthermore, E. signaling systems that are not blocked by the toxin. coli is easier to grow in large amounts than the insect There are several examples of receptor-mediated cells and the induction of TR a synthesis is more stimulation of phospholipase C that appear to involve reproducible in E. coli than via viral infection of the G proteins but are insensitive to the effects of insect cells. Consequently, we are purifying the E. pertussis toxin, including, for example, the action of coli TRa and determining its activity in various assays vasopressin, muscarinic agonists, and thyrotropin we have set up concurrent with the expression studies. releasing hormone in various cell types. Thus, one Besides foreign expression, we are also interested possible function of Gz may be to control phospho in cell type-specific expression of rod and cone pro lipase C activity in specific cells. The identification teins in the retina. As an initial step we have looked and characterization of Gz by molecular cloning for expression of these proteins in cell culture. In provides an important means to purify the G2 gene collaboration with Dr. Emil Bogenmann of the product and study its distribution, biochemistry and University of Southern California, we studied the function. expression of G protein and photopigment genes in human retinoblastoma cell cultures. Surprisingly, 152. The B and y Subunits of G Proteins these cells express cone cell-specific (red/green Narasimhan Gautam, Melvin I. Simon photopigment and T ca) but not rod cell-specific All G proteins possess three subunits, a., B and y. G (rhodopsin and T Ra) genes. We are now constructing proteins characterized so far possess one or both of vectors with the 5' genomic regions of these genes two kinds of a subunits identified on SDS gels as 35 fused to coding regions of the reporter protein CAT in kDa and 36 kDa molecular weight bands. The y sub order to delineate the DNA sequences sufficient for units seem more heterogeneous. The function of these expression in these cells. Among other things, these two subunits is unclear, although recent evidence studies may provide information useful for directing indicates that they might act as activators of the expression of proteins late in the retinal develop channels. ment of transgenic mice. Our aim has been to determine the role of these subunits in signal transduction, especially in the rod 151. A Novel Class of GTP-Binding Regulatory outer segments and to correlate their structure with Proteins their function. We are taking different approaches Henry K. W. Fong, Melvin I. Simon towards achieving this. We have shown in collaboration Recent molecular cloning of cDNA for the a sub with T. Amatruda that the two related cDNAs, a1 and unit of bovine transducin has revealed the presence of a2, isolated in this lab, code for the 36 kDa and 35 kDa two retinal-specific transducins, called Tr and Tc' B subunits. This was demonstrated by transcribing and which are expressed in rod or cone photoreceptor cells. translating these cDNAs in vitro and showing that they In a further study of G-protein diversity and signal look identical on SDS gels to purified a36 and a35 transduction in the retina, we have identified a novel associated with the G proteins Gi and G0 from bovine G-protein a. subunit by isolating a human retinal cDNA brain. Also, peptides made according to the predicted clone that cross-hybridizes at reduced stringency with amino acid sequences of the B cDNAs have been used bovine rod transducin a. cDNA. The deduced amino acid to raise antisera against the proteins, one of which is sequence of the novel o: subunit, which we refer to as specific to the 35K protein. We are now quantitating Gz, is lfl-67% identical with that of other known Ga the a 1 and a2 message levels in differentiated and proteins. However, the 355-residue G2 a. subunit lacks undifferentiated human blood cells. a consensus site for ADP-ribosylation by pertussis We have now succeeded in expressing the a36 sub toxin, and its amino acid sequence varies within a unit alone and together with the y subunit of trans number of regions that are strongly conserved amongst ducin in E. coli. The y subunit has also been expressed all of the other G-protein a subunits. alone. We have purified these recombinant proteins Since G2 does not contain a typical pertussis toxin and are now assaying them for their ability to catalyze 104 GTPy-s binding of the a subunit of transducin in the 60 cells, and measure the chemotactic response. At presence of bleached rhodopsin. present, we are attempting to transfect HL-60 cells by Since we would like to compare the function of the means of electroporation. In collaboration with Prof. 35 kDa and 36 kDa a subunits along with their y J. Baldeschwieler's group in the Division of Chemistry subunits, we are now attempting to isolate the y cDNA and Chemical Engineering, we are also developing a specific to G/G0 from the mammalian brain. M. lipsome-mediated transfection system. In the future, Baetscher and R. Aebersold have obtained a portion of we plan to screen cDNA libraries derived from the amino acid sequence of this y subunit. Using a set terminally differentiated myeloid cells for expression of mixed oligonucleotides from the predicted amino of novel, lineage-specific G-protein genes. acid sequence, we have obtained a number of putative y cDNA clones. These are now being characterized. 154. G-Protein Expression During Spermatogenesis 153. Expression of G-Protein Genes in Thomas Wilkie, Jesus del Mazo, Melvin I. Simon Human Myeloid Cells G proteins mediate signal transduction in nearly all Thomas T. Amatruda, Melvin I. Simon cell types that have been analyzed. They are hetero The myeloid cell lineage consists of a family of trimeric proteins consisting of an a, B and y subunit. discrete cell types derived from bone marrow stem The diversity among G proteins is thought to be cells, which act to induce inflammation and fight achieved by novel combinations of these subunits. So infection. A variety of membrane-acting stimuli far, the cDNAs of nine a, two B and a single y subunit modulate the physiological functions of these cells, have been cloned. and several of these act via G proteins. In order to We have analyzed the testicular expression of the a delineate the role of G proteins in the growth, and a subunits in mice. Both s subunits and all but one differentiation, and function of myeloid cells, we are a subunit are expressed in the testis. One interesting characterizing the G-protein genes that are expressed observation is that while the B genes are expressed in in human myeloid cells. all germ cells throughout spermatogenesis, the a genes We constructed a cDNA library from HL-60 human are apparently expressed only in spermatogonia and myeloid leukemia cells and screened this with oligo spermatocytes but not in spermatids. This expression nucleotide and cDNA probes for G-protein subunit pattern might reflect functional roles for G proteins in genes. Initially, we isolated cDNAs corresponding to germ cells on the basal side of the blood-testis barrier two a subunit genes, a1 and a2• The a 1 cDNA encoded which are lost later in spermatogenesis as the germ a protein that was identical to bovine transducin s, cells cross to the adluminal side of the barrier. while the a2 cDNA encoded a novel protein. In Why are the B genes expressed in spermatids if collaboration with N. Gautam and H. Fong, we found there is no expression of the a genes? Perhaps f3 that the a2 gene product was identical with the 35 kDa subunits are required for G proteins found in sperm component of the a35Ja 36 subunit of G proteins, while that have novel a subunits. The acrosome reaction can the al gene encoded the 36 kDa component. We are be blocked by pertussis toxin which implies a now measuring the levels of expression of the two s functional role for a Gia-like subunit (Endo et al., subunit genes in HL-60 cells induced to differentiate in 1987). Since none of the known Gia genes are vitro, using a probe protection assay. expressed in spermatids, we propose that a novel a We have found that the a subunits of Gi2 and Gi3 subunit mediates signal transduction during the are expressed in HL-60 cells and in HL-60 induced to acrosome reaction. We are presently screening testis differentiate to granulocytes by exposure to DMSO and and spermatid cDNA libraries with the known Gia retinoic acid, and we have isolated cDNA clones probes in an attempt to clone this novel gene. corresponding to these gene products. In order to The acrosome reaction may be blocked by cellular study the role of each of these G proteins in the expression of the pertussis toxin gene. Five lines of response of cells to chemotactic stimuli, we plan to transgenic mice have been made that carry the mutagenize the cDNA clones, transfect them into HL- pertussis toxin gene under the regulation of a 105 spermatid-specific promoter. Testicular expression of spermatogenesis have yet to be resolved. Morpho pertussis toxin and male germline transmission of the logical and biochemical changes in differentiating transgene is now being assayed. germ cells occur concomitant with alterations in the complement of constituent proteins and presumably Reference: Endo, Y., Lee, M. A. and Kopf, G. (1987) Dev. Biol. reflect differences in the mRNA populations coding 119, 210-216. for stage-specific proteins. The appearance of such cell type and stage-specific mRNAs has been demon 155. Gene Expression of LOH lsozymes During Meiosis strated by using cloned cDNAs isolated from testis and Spermiogenesis by In Situ Hybridization cDNA libraries. Temporal expression of these cloned Jesus del Mazo, Melvin I. Simon gene transcripts was analyzed by Northern blot Lactate dehydrogenase (LOH) is found as an iso analysis using poly(A}+ RNA obtained from the semi zyme system in vertebrates. There are three loci niferous epithelium of mice at different developmental encoding the three isoforms LOH-A, -B, -C. LDH-C is ages and with total RNA from purified populations of expressed in a tissue-specific manner in mammalian germ cells representing several morphological stages and avian testes. Using LOH probes, we have studied of spermatogenesis. These studies have identified four the accumulation of transcripts corresponding to LDH distinct phases of gene expression that occur within genes at specific cell stages during meiosis and the differentiating germ cells over the period of spermiogenesis. We developed an in situ hybridization spermatogenesis. These cDNA clones, therefore, technique using dispersed mouse testicular tubule provide molecular markers to follow stage-specific cells, cytocentrifugated onto coverslips. Anti-sense transcription during germ cell differentiation. In in vitro RNAs were transcribed from specific probes conjunction with other techniques such as in situ for sequences of individual LDH isozymes, labeled with hybridization and transgenic manipulations, these 35 s and hybridized in situ to specific mRNAs in probes become powerful tools for further studies monodispersed cell preparations, which were counter aimed at elucidating molecular mechanisms regulating stained with Hoechst 33258 after autoradiography. gene expression during spermatogenesis. We found that this method allows a more precise detection of radioactive signal in defined spermato 157. Testis-Specific Expression of Phosphoglycerate genic stages. Our results confirmed the presence of a Kinase-2, CAT, and Luciferase in high level of mRNA for LDH-C during meiotic pro Transgenic Mice phase, starting at the lep-zygotene stage and main Murray O. Robinson, Melvin I. Simon tained in the cytoplasm of the subsequent cell stages The maturation of male germ cells is a complex until the appearance of elongated spermatids. LDH-A process involving mitotic, meiotic, and haploid stages mRNA is also found in the stages from pachytene to of development. We are studying patterns of gene round spermatids, but at a significantly lower level expression during spermatogenesis in an attempt to than LDH-C. mRNA for LDH-B is essentially only define the elements responsible for controlling this detected in Sertoli cells at very low level. This study process. The testis-specific gene phosphoglycerate allows us clarification of the timing of expression of kinase 2 (PGK-2) is expressed in meiotic and haploid the different forms of LDH during spermatogenesis. germ cells and appears to belong to a class of genes This method could also be useful in the analysis of that are expressed with the same kinetics. The goal of other members of multigene families that are this study is to define the cis-acting elements expressed in mammalian testis. responsible for the tissue-specific and stage-specific expression of PGK-2. To study this gene in the correct 156. Differential Gene Expression During Mouse developmental context, we generated a series of trans Spermatogenesis genic mice containing various constructs of the human Kelwyn Thomas, Melvin I. Simon PGK-2 gene. The molecular mechanisms regulating cell-type In transgenic mice containing an 8 kb genomic specificity of gene expression during mammalian fragment of the human gene, expression of the trans- 106 gene is restricted to the testis and is developmentally can perform complete or partial restriction digestions, regulated. Expression first appears in meiotic size fractionate on agarose gels, and elute DNA spermatocytes and increases to a high level in later molecules over 2 Mb. 2) Improve the existing vectors stages of germ cell development, a pattern that and develop new vectors that will facilitate cloning parallels that of the endogenous PGK-2 gene. To and maintaining large DNA fragments. We are delineate the sequences responsible for this expression, currently working with the Yeast Artificial we have generated transgenic mice containing Chromosome (Y AC) vectors and additional systems to different truncated portions of the human PGK-2 improve our ability to generate and screen libraries promoter, each fused to the gene for chloramphenicol containing large DNA inserts. A library representing acetyl transferase (CAT). A fusion gene containing one copy of human chromosome 22 would consist of 500 bp of the human upstream region is sufficient to only 300 members if the average inset size is 200 kb. :firect CAT activity specifically to the testis. In 3) Evaluate strategies to rapidly establish an ordered addition, transgenic mice have been produced that array of clones representing chromosome 22. We will contain the PGK-2 promoter linked to the firefly initially pursue several mapping approaches simul luciferase gene, a reporter group that has proven to be taneously, including mapping outward from known extremely sensitive. In assays of dissociated trans markers as well as computer-based techniques for genic testis cells, we can detect bioluminescence from matching restriction patterns from randomly picked as few as 25 cells. These mice also express luciferase clones. protein only in the testis. Transgenic mice containing 1 Department of Biological Sciences, University of shorter upstream regions linked to reporter genes are Southern California, Los Angeles, CA. now being tested to further define the elements required for testis-specific expression. Furthermore, analysis of the developmental appearance of these 159. Optimized Conditions for Pulsed-Field Gel Electrophoretic Separations of DNA reporter proteins suggests the presence of a trans lational control mechanism which is currently being Bruce w. Birren, Eric H. C. Lai, Steven M. Clark, Leroy E. Hood, Melvin I. Simon investigated. Quantitative measurement of DNA migration in gel electrophoresis requires precisely controlled homogeneous electric fields. A new electrophoresis 158. Mammalian Chromosome Mapping system of our design has allowed us to explore several 1 Bruce W. Birren, Hiroaki Shizuya , Melvin J. Simon parameters governing DNA migration during Our work centers on developing physical maps of homogeneous field pulsed-field gel (PFG) electro the mouse and human genomes to compare the genetic phoresis. Migration was measured at different switch maps with the physical distances of DNA sequences in times, temperatures, agarose concentrations, and both species. We are interested in the molecular voltage gradients. Conditions that increase DNA mechanisms underlying eukaryotic genomic re velocities permit separation over a wider size range, arrangements and are focusing on human chromosome but reduce resolution. We have also varied the angle 22. Human chromosome 22 contains markers that have between the alternating electric fields. Reorientation been redistributed during evolution to at least three angles between 105° and 165° give equivalent different mouse chromosomes. In addition, a number resolution, despite significant differences in velocity. of loci on chromosome 22 participate in site-specific Separation of DNA fragments from 50 to greater than recombination events leading to altered patterns of 7000 kb can easily be optimized for speed and gene expression and function in normal development resolution based on conditions we describe. Additional and disease. Our primary goal is to construct a studies have explored electrophoretic techniques to restriction map of human chromosome 22. This effort maximize the separation of DNA fragments from 3 to includes the following. I) Expanding the techniques 50 kb. We are applying these methods to ongoing for preparing and handling large DNA fragments. By studies of eukaryotic gene organization. preparing DNA from cells embedded on agarose, we 107 160. Mapping the DNA Binding Domain of Hin 161. DNA-Binding Properties of the Hin Recombinase Recombinase by Using Synthetic Sequence- Specific DNA Binding and Cleaving Peptides Anna C. Glasgow, Melvin I. Simon 1 2 Inversion of a 996 bp DNA segment controls the James P. Sluka , Suzanna J. Horvath , 1 Anna C. Glasgow, Peter B. Dervan , Melvin I. Simon alternate expression of the flagellin genes of Considerable progress has been made in our under Salmonella typhimurium. The recombinase of this standing of the factors that influence interactions inversion system, Hin, mediates site-specific between proteins and nucleic acids together with our recombination between two 26 bp inverted repeat ability to design and synthesize peptides and their sequences (hixL and hixR) which bound the invertible derivatives that bind to specific DNA sequences and DNA segment. Characterization of the inversion cleave the DNA at these sites. reaction has involved defining the structure of the A synthetic 52-residue peptide based on the recombination sites and the nature of the interactions sequence-specific DNA binding domain of Hin between Hin and its DNA-binding sites. Comparison of recombinase (138-190) has been equipped with the crossover region of related inversion systems, Hin, ethylenediaminetetraacetic acid (EDTA) at the N Gin, Cin, and Pin, revealed a conserved 26 bp sequence terminus. In the presence of Fe(ll), this synthetic exhibiting dyad symmetry; it consists of two imperfect EDT A-peptide cleaves DNA at Hin recombination sites 12 bp inverted repeats separated by a 2 bp core. (Sluka et al., 1987). The cleavage data reveals that Nuclease and chemical protection studies demon the N terminus of the 52-mer is found in the minor strated that the recombinase binding site overlaps this groove of DNA near the symmetry axis of Hin 26 bp consensus sequence in hixL and hixR. The extent recombination sites. This work demonstrates the of the consensus sequence required for recombinase construction of a hybrid peptide combining two recognition was tested using mutant recombination functional domains: sequence-specific DNA binding sites (derived from synthetic oligonucleotides) in and DNA cleavage. nuclease protection studies and gel electrophoresis Seventeen additional peptides have been DNA binding assays. The essential bases for Hin synthesized corresponding to the DNA-binding domain recognition of the recombination sites are within the of Hin recombinase with and without EDT A attached sequence from base pairs 4 through 11 (numbered from at the N terminus. From MPE·Fe(ll) footprinting and the center of dyad symmetry). The results of chemical gel electrophoresis-DNA binding assays with six interference assays also indicate that the critical peptides and affinity cleaving of six EDT A peptides, contacts for Hin binding to the hix sites are in we have determined the significance of the Arg-Pro adjacent major and minor grooves of the DNA helix Arg-Gly (residues 49, 50, 51, 52) for sequence-specific within this 8 bp sequence of the inverted repeats. Hin binding of the N terminus of the DNA-binding domain will specifically recognize and bind an isolated in the minor groove of DNA. We have made the consensus half site (base pairs 1 through 13 from the interesting observation that the N-terminal Gly can be center of dyad symmetry) of hixL or hixR with only a removed without consequence. However, the removal slightly lower affinity than for the full hix sites. of the next Arg appears to decrease binding by at least Essentially no binding of Hin is seen with the isolated a factor of l O. Moreover, peptides 56 and 60 residues nonconsensus half site of hixR which deviates in length appear to have movable arms revealed by significantly from the consensus half site sequence. cleavage patterns on sequencing gels. This is our first The nature of the Hin-hir complexes in these insight on the "linker" region between the binding binding studies with the wild-type and mutant hix sites . domain and cleavage domain of HIN. indicated that Hin bound the recombination sites in a highly cooperative manner or as a multimer. The Reference: Sluka, J. P., Horvath, S. J., Bruist, M. F., Simon, M. I. results of binding and inversions assays with Hin and Dervan, P. B. ( 1987) Science 238, 1129-1132. isolated by gel filtration indicate that the predominant 1 Division of Chemistry and Chemistry Engineering, active binding species of the recombinase is a dimer. California Institute of Technology. 2 Preliminary results of circular permutation assays Biopolymer Synthesis Facility, California Institute of Technology. 108 which detect altered DNA structure suggest that the formation. Using this assay we found that two binding of Hin induces a bend in the center of the hix recombination-deficient, binding-proficient Hin site. We are presently studying the role of such altered mutants are unable to bring two hix sequences DNA structures in the recombination reaction. separated by 600 bp together in the DNA looping assay. These mutants are currently being sequenced to characterize the region of the Hin involved in 162. Characterization of Hin-Mediated, multimer formation. Site-Specific Recombination In Vivo Kelly T. Hughes, Carol C. Lee, Melvin I. Simon The Hin recombinase inverts a 996 bp segment of the Salmonella chromosome which includes a promoter for the H2 flagellin structural gene and the repressor PUBLICATIONS gene of the HI flagellin structural gene. Hin-mediated Amatruda, T. T. III, Gautam, N., Fong, H. K. W., inversion of this promoter results in the alternative Northup, J, K. and Simon, M. I. (1988) The 35- and 36-kDa s subunits of GIP-binding regulatory expression of HI and H2 flagellin. To carry out the proteins are products of separate genes. J. Biol. inversion reaction, Hin must recognize and bind two 26 Chem. 263, 5008-5011. Amatruda, T. T. III, Fong, H.K. W., Birren, B. w. and bp sequences, hix:L and hix:R, which flank the invertible Simon, M. I. (1988) Molecular cloning of a distinct form of the s subunit of GTP binding regulatory segment. We have characterized the in vivo binding of proteins. In: Signal Transduction, UCLA Hin to wild type and mutant hix: sites by treating Hin Symposium, in press. Birren, B. W., Lai, E., Clark, S. M., Hood, L. and as a repressor and the hi:r sequences as operator sites Simon, M. I. (1988) Optimized conditions for downstream of the ant promoter in bacteriophage P22. pulsed-field-gel electrophoretic separations of Hin-mediated repression results from Hin associating DNA. Nucleic Acids Res., in press. Blatt, C., Eversole-Cire, P., Cohn, V. H., Zollman, S., into multimers either prior to binding or during the Fournier, R. E. K., Mohandas, L. T ., Nesbitt, M., binding process at the hix: operator sites. The ability Lugo, T., Jones, D. T., Reed, R.R., Weiner, L. P., Sparkes, R. S. and Simon, M. I. (1988) Chromosomal of Hin multimers to repress transcription is eliminated localization of genes encoding G protein subunits in mouse and human. Proc. Natl. Acad. Sci. USA, in when the hix: 13 bp half-sites are rotated to opposite press. sides of the DNA helix by inserting four base pairs Blatt, C., Saxe, D., Marzluff, W. F., Lobo, S., Nesbitt, between them. Insertion of one base pair between half M. N. and Simon, M. (1988) Mapping and gene order of U2 small nuclear RNA, endogenous viral env sites reduces overall repression. Hin also binds one of sequence, amylase and alcohol dehydrogenase-3 on mouse chromosome 3. Somatic Cell and Molecular the hixL half-sites to repress transcription, but only Genetics 14, 133-142. when high levels of Hin protein are present in the cell. Bruist, M. F., Glasgow, A. C., Johnson, R. C. and Simon, M. (1987) Fis-binding to the recombinational Mutations have been identified in the hix sites that enhancers of the Hin DNA inversion system. Genes impair Hin binding. Five of the 26 bp in the hix sites & Dev. I, 762-777. are critical; sites with base pair substitutions at these Fong, H. K •. W., Yoshimoto, K. K., Eversole-Cire, P. and Simon, M. I. (1988) Identification of a GTP five positions show greatly reduced binding. Three binding protein: a subunit that lacks an apparent additional base pairs make minor contributions to ADP-ribosylation site for Pertussis toxin. Proc. Natl. Acad. Sci. USA 85, 3066-3070. binding. Glasgow, A. C., Hughes, K. T. and Simon, M. I. (1988) We have also initiated characterization of the Bacterial DNA inversion systems. In: Mobile DNA, Berg, D. and Howe, M. (Eds.), American Society of regions of Hin involved in specific steps of the re Microbiology, Washington, D.C., in press. combination reaction in vivo. The invertible segment Hess, J. F., Bourret, R. B., Oosawa, K., Matsumura, P., and Simon, M. I. (1989) Protein phosphorylation and was placed upstream of the lac operon and Hin bacterial chemotaxis. Cold Spring Harbor Symp. mediated switching monitored on lactose indicator Quant. Biol. 53, in press. Hess, J, F., Bourret, R. B. and Simon, M. I. (1988) The medium. Using this screen, we have isolated hundreds role of histidine phosphorylation and phosphoryl of Hin mutants unable to carry out the recombination group transfer in bacterial chemotaxis. Nature, in press. reaction. About 15% of these recombination-deficient Hess, J. F., Oosawa, K., Kaplan, N. and Simon, M. I. (1988) Phosphorylation of three proteins in the mutants are still able to bind to the hix: sites. A DNA signaling pathway of bacterial chemotaxis. Cell looping assay was set up to detect Hin multimer 53, 79-87. 109 Hess, F. J., Oosawa, K., Matsumura, P. and Simon, M. Assistant Professor: Paul W. Sternberg (1987) Protein phosphorylation is involved in Research Fellow: Leslie A. Barber, Jane E. Mendel bacterial chemotaxis. Proc. Natl. Acad. Sci. USA Graduate Students: Raffi V. Aroian, Russell J. Hill, 84, 7609-7613. Gregg D. Jongeward Hopkins, R. S., Stamnes, M. A., Simon, M. I. and Research and Laboratory Staff: Roberta M. Goldstein, Hurley, J. B. ( 1988) Cholera toxin and pertussis Andrea E. Holboke toxin substrates and endogenous ADP-ribosyl transferase activity in Drosophila melanogaster. Biophys. Biochem. Acta, in press. Support: The work described in the following research Johnson, R. C., Ball, C. A., Pfeffer, D. and Simon, M. reports has been supported by: l. (1988) Isolation of the gene encoding the Hin Lucille P. Markey Charitable Trust recombinational enhancer binding protein. Proc. National Institutes of Health, USPHS Natl. Acad. Sci. USA 85, 3484-3488. National Science Foundation Johnson, R. C., Glasgow, A. C. and Simon, M. (1987) Spatial relationship of the Fis-binding sites for Hin recombinational enhancer activity. Nature 329, 462-465. Johnson, R. C. and Simon, M. (1987) Enhancers of site Summary: Our laboratory uses a molecular genetic specific recombination. Trends in Genetics 3, 262- approach to study basic questions in developmental 267. Kaplan, N. and Simon, M. (1988) Purification and biology: What are the molecular mechanisms by which characterization of the wild-type and mutant cells interact with each other to establish a spatial carboxy-terminal domain of the Escherichia coli Tar receptor. Submitted to American Society of pattern of cell types? How can a cell divide and Microbiology Publications, J. Bacterial. 170, in produce two sister cells that differ in their press. Lochrie, M. A. and Simon, M. I. (1988) G protein developmental fates? How do several tissues undergo multiplicity in eukaryotic signal transduction concerted morphogenesis to form a structure that systems. Biochemistry 27, 4957-4965. Oosawa, K., Hess, J. F. and Simon, M. I. (1988) mediates a simple behavior? Our general strategy is Mutants defective in bacterial chemotaxis show to identify mutations that make cells or animals modified protein phosphorylation. Cell 53, 89-96. Oosawa, K., Mutch, N. and Simon, M. I. (1988) Cloning misbehave, and then use classical genetics to study the of the C-terminal cytoplasmic fragment of Tar and function of the genes defined by those mutations and its effects on chemotaxis in E. coli. Submitted to American Society of Microbiology Publications. J. molecular biology to study the structure, expression, Bacterial. 170, 2521-2526. and function of the genes and their products. Our Simon, M. I. ( 1988) A review of the structure of prokaryotic transmembrane transducers and GTP studies focus on two aspects of development of the binding proteins. In: Discussions of N euro nematode C. e1egans--induction of the hermaphrodite sciences: Sensory Transduction, Hudspeth, A. J., MacLeish, P. R., Margolis, F. L. and Wiesel, T. N. vulva, and maturation of the male tail. (Eds.), Foundation for the Study of the Nervous Our major effort this year has .been towards under System, Vol. 1V, No. 3, pp. 61-68. Simon, M., Belas, R., Mccarter, L., Bartlett, D. and standing the development of the vulva, a structure Silverman, M. (1988) Microbial role in bio which allows hermaphrodites to release eggs and to deterioration: Genetic approaches. In: Advanced Techniques Applicable to the Indian Ocean, mate with males. Vulval development in C. elegans is Thompson, M.-F., Saronjini, R. and a simple example of inductive pattern formation. A Nagabhushanam, R. (Eds.), Oxford & !BH Publishing Co. PVT. LTD., pp. 265-286 single cell in one tissue, the "anchor cell" of the gonad, Sluka, J. P., Horvath, S. J., Bruist, M. F., Simon, M. induces three of six cells in another tissue, the vulval and Dervan, P. ( 1987) Synthesis of a sequence specific DNA-cleaving peptide. Science 238, 1129- precursor cells (VPCs) of the epidermis, to generate 1132. the vulva. Each VPC has the potential to become any of three cell types (type I, 2, or 3), defined by the set of progeny cells generated by each precursor cell. Even though the VPCs are multipotent, an invariant pattern of cell types is established, 3-3-2-1-2-3. The pattern of VPC fates is established by two inter cellular signals: a graded inductive signal from the anchor cell, and a short-range lateral inhibitory signal from neighboring VPCs (see Abstract No. 163). To understand how the fate of each VPC is specified by these two signals, we have defined the following goals: 110 1) to elucidate the nature of the inductive signal; 2) to type 2, depending on their distance from the anchor understand how the inductive and inhibitory signals are cell (Sternberg and Horvitz, 1986). In this view, integrated to specify cell type; and 3) to identify cell anchor cell-proximal VPCs prevent more distal VPCs type-specific genes regulated by the intercellular from receiving a high level of signal simply by being in signals. We are currently studying three genes that the way. This year we have obtained evidence for an control key steps in vulva! induction. Two genes interaction between VPCs during vulval induction: necessary for induction, let-23 and lin-3, are defined type I cells prevent adjacent cells from also becoming by mutations that cause the VPCs to all be type 3 and type I. hence prevent formation of a vulva, the "Vulvaless" or Cell-cell interactions are examined by destroying "Yul" phenotype (Abstract Nos. 164, 165, and 167). A individual cells with irradiation from a laser micro gene that promotes the type 3 fate, lin-15, is defined beam and examining the fates of remaining cells. In by a mutation that causes VPCs to become type I or 2 lin-15 hermaphrodites whose anchor cells have been in the absence of inductive signi3.1, resulting in the destroyed, all six VPCs are type 1 or type 2, typically formation of extra vulva! tissue, the "Multivulva" or in an alternating pattern, e.g., 1-2-1-2-1-2. In no case "Muv" phenotype (Abstract Nos. 163 and 166). lin-3 are adjacent cells type I, while adjacent cells often acts at an early step in the induction pathway, possibly are type 2. These observations suggested that a type I in the production of the inductive signal. lin-15 and cell prevents its neighbors from being type I. To test let-23 act antagonistically in specifying the fates of this hypothesis, we destroyed the anchor cell and all the VPCs. but one VPC in eight lin-15 hermaphrodites. In all A new project focuses on the development of the eight animals, this VPC was type J. By contrast, in IO C. elegans male and its mating behavior (Abstract No. of II animals with all six VPCs intact, this VPC was 169). Our approaches are to isolate mutants defective type 2. Therefore, the "ground state" of a VPC in a in male development or behavior, to characterize lin-15 animal is to be type 1, and if a neighboring cell mating behavior, and to identify genes (as cDNA is type I, a VPC cell will become type 2. clones) specifically expressed during development of This inhibitory signal is more effective at short the male tail. range. In lin-15 animals with only two VPCs, if the two VPCs are close, one is type I and one is type 2. 163. Cell Interactions During Vulva! Induction However, if the two VPCs are distant, both are type 1. Since a product of the lin-12 locus is necessary for Paul W. Sternberg type 2 cell fates in lin-15 animals, lin-12 may play a According to the simplest model for pattern central role in this inhibition, a role consistent with its formation during vulval development, th_e inductive inferred structure, suggestive of a membrane-bound signal from the anchor cell is graded and directly molecule acting as signal or receptor (Greenwald, stimulates vulva! precursor cells (VPCs) to be type I or 1985). Anchor Cell VP~o 0 et."@ O"' '""" ~ ~ Inhibitory Signal 3 3 2 1 2 3 vulva Figure I. New model for cell interactions during vulva! induction. Ill The precision of the pattern formation process mutagenized chromosomes. Each mutation is tightly during vulval induction may result from the combined linked to let-23 and fails to complement syl and nl045 action of two intercellular signals: a graded signal for the Yul phenotype. Thus, the majority of the let-23 from the anchor cell differentially a!!ecting type I point mutations result in a lethal phenotype. Two of and type 2 cells, and a signal from type I cells to type these new alleles, sylO and syl2, are incompletely 2 cells inhibiting them from becoming type I and/or penetrant lethals, causing 80% and 90% of larvae to stimulating them to become type 2. die, respectively. The surviving worms show two new phenotypes: all hermaphrodites are sterile, and all References: Greenwald, I. S. (1985) Cell 43, 583-590. males have short, crumpled spicules and hence are Sternberg, P. W. and Horvitz, H. R. (1986) Cell 44, 761-772. incapable of mating. To determine which other cell types are specified by let-23, we are investigating the 164. Molecular Genetics of the let-23 Locus cellular bases of these phenotypes. We are pursuing two approaches to clone the let-23 Raffi V. Aroian, Paul W. Sternberg, Jane E. Mendel, Andrea E. Holboke locus: we are screening for transposon-induced alleles Perturbation of let-23 activity can have either of that !ail to complement syl, and we will use the over two e!!ects on the pattern of YPC fates, indicating 20 existing alleles to identify restriction fragment that let-23 plays a critical role in the specification of length polymorphisms (RFLPs) within a chromosomal VPC fate in response to the inductive signal from the walk. We have started walking from the right end of anchor cell. One let-23 mutation, n1045, causes over a megabase of cloned DNA mapping 0.1 centi opposite phenotypes as a !unction of temperature. At morgans (approximately 25 to 250 kb) to the left of 15°, nl045 animals are Yulvaless (or Yul), too few let-23 within a yeast artificial chromosome library YPCs are induced and di!!erentiate as type 3 cells. At prepared by R. Waterston at Washington University. 25°, too many VPCs respond to the inductive signal When we reach the breakpoints of any of three and di!!erentiate as type I or type 2 cells. This deficiencies in the genetic interval immediately to the phenotype, described in detail in the following right of let-23, we will be confident of having DNA abstract, is referred to as "Hyperinduced" or Hin. We spanning the locus. have carried out two screens for new let-23 mutations Reference: and have initiated the molecular cloning of the locus. Ferguson, E. L., Sternberg, P. W. and Horvitz, H. R. (1987) Nature 326, 259-267. Our first genetic screen to obtain new !et-23 alleles made use of the fact that the original let-23 mutation was the only Yul mutation of its class known 165. Hyperinduction of the Vulva to suppress the Muv phenotype of lin-15 (Ferguson et Paul W. Sternberg, Raff; V. Araian, al., 1987). We therefore isolated phenotypic rever Gregg D. Jangeward tants of lin-15(n309) that result in a Yulvaless (Yul) We have been studying a new class of mutations phenotype when crossed away from n309. Using this that perturb vulva! development. These mutations screen, we isolated syl, which maps to the let-23 locus result in hyperinduction of the vulva-four or five and fails to complement n1045 for the Yul phenotype. YPCs are induced rather than the normal three. For 93% of homozygous syl hermaphrodites are Yul. All example, rather than the wild-type 3-3-2-1-2-3 sy 1 homozygotes are viable in contrast to four other pattern, patterns such as 3-2-1-1-2-3 or 3-2-2-1-2-3 previously identified let-23 mutations. From can occur. This Hyper induced or Hin phenotype additional lin-15 reversion screens, we have isolated requires a signal from the anchor cell and thus is another Yul mutation linked to let-23. distinct from the Multivulva phenotype of lin-15. In Since hermaphrodites carrying syl in trans to a each case these mutations are alleles of genes (Zet-23, deletion of the let-23 locus are always Yul but are lin-2, and lin-7) that are necessary for a response to nonetheless viable, we screened for new EMS-induced the inductive signal as evidenced by other mutations in mutations that fail to complement syl. We have these same genes that have Vulvaless phenotypes. isolated 15 new let-23 alleles after screening 20,000 Although one would guess that these mutations would 112 result from increased activity of let-23, lin-2, and lin-15 locus. Our first effort has made use of three lin-7, we now have evidence that the Hin phenotype lin-15 mutations isolated in a strain with high results from a partial decrease in activity of these frequency of transposition of a family of transposons genes. This conclusion is based on two types of by Stuart Kim and Bob Horvitz (M!T). We have probed evidence. DNAs from these strains with probes for three Hyperinduction is caused by a particular level of different transposable elements (Tel, Tc3, and Tc4), let-23 activity, lower than wild type but higher than which are known to be activated in such mutator that in a Yul mutant of let-23. Complementation tests strains. To identify new transposon insertions indicate that the n1045 mutation is a slight hypomorph associated with lin-15 mutations, we have probed at 25° and a more severe hypomorph at 15°: n1045 is DNAs from extensively backcrossed versions of these recessive and results in a Yul phenotype in trans to a strains. In two strains, a new band was identified on a deficiency for the locus at all temperatures, Southern blot probed with Tel, indicating a new Tel suggesting that n1045 results in a decreased level of insertion linked to lin-15. We are now mapping this let-23 activity at all temperatures. The Hin phenotype insertion site more closely with respect to lin-15. If can be recreated without using n1045, using instead this insertion is inseparable from lin-15, we will clone syl and a lethal allele, mn224. the band from a size-selected library to obtain unique Moreover, combination of two hin mutations (one in flanking sequences at the lin-15 locus. each of two genes) results not in a more severe Hin phenotype, but in a Yul phenotype. This observation is 167. Genetic and Molecular Analysis of the lin--3 Locus consistent with each hin mutation lowering some activity (e.g., the activity of a second messenger Russell J. Hill system), and the combination of two mutations We have chosen lin-3 as a subject for detailed lowering activity below a threshold for induction. genetic and molecular analysis for several reasons. We propose that a slight defect in the response to Genetic experiments indicate that lin-3 acts early in the inductive signal allows cells to be type I or 2, but the vulval induction pathway and is thus a candidate precludes them from producing the Lateral Inhibitory for controlling production of the inductive signal. Signal ("US") described in Abstract No. 163. Moreover, a partial lowering of lin-3 activity results in Specifically, we propose that in wild type, the US is induction of only the YPC nearest the anchor cell, activated in VPCs in response to let-23, which in turn suggesting that lin-3 activity is necessary for how far is activated by the signal from the anchor cell but at a the inductive signal spreads. Furthermore, in addition higher level of let-23 activity than required for to Vulvaless alleles, there are lethal and sterile alleles becoming type 1 or 2. In a Hin animal, we argue, VPCs of lin-3, indicating that lin-3 is involved in processes are induced to becoming type I or 2 but fail to inhibit other than vulva! induction. their neighbors from also becoming type I or 2; hence, To determine whether lin-3 encodes separate more than three YPCs can become type 1 or 2. functions necessary for vulva! induction and growth, or whether the lethal phenotype is due to a more severe lowering of lin-3 activity than the Yul phenotype, we 166. Transposon Tagging of the lin--15 Locus are searching for more alleles and investigating their Andrea E. Holboke complementation properties. To generate alleles of In animals deficient in lin-15 activity, all six YPCs lin-3, we screened for new EMS-induced mutations generate vulval cells even in the absence of an that fail to complement an existing Yul allele. We inductive signal (Abstract No. 163). The lin-15 gene found three lethal alleles at a frequency of one in product normally acts antagonistically to let-23: 3000. On the basis of this screen and screens done mutants defective in both let-23 and lin-15 are more previously by other groups, we believe that lethality is like wild-type animals than either of the single the most common class of phenotype caused by a lin-3 mutants. To understand the molecular basis for the point mutant and is thus the null phenotype. antagonism of these two key genes, we are cloning the To study the expression and function of the lin-3 113 product, we are pursuing two complementary zygous syl hermaphrodites are vulvaless (Yul), <0.5% strategies to clone lin-3. We are trying to generate a of hemizygous syl hermaphrodites (syl/deficiency) are transposon-induced allele of lin-3. By backcrossing egg-laying proficient (Egl+), a plate assay for the this strain and preserving the lin-3 phenotype, most presence of a functional vulva. We have mutagenized extra transposons could be removed and we could then 2500 haploid genomes in a balanced hemizygous strain find lin-3 by cloning out sequences that flank the and screened the F 1 and F2 generations for eggs remaining transposons. A second approach, carried out (which are the result of the suppression of vulva in parallel, makes use of the fact that most of the lessness). Thus far, four mutants have been found. DNA in the lin-3 region is available as a set of One suppresses hemizygous syl from 0% Egl+ to about overlapping cosmid clones. Therefore, we are also 10% Egl+ and suppresses syl/syl homozygotes from 7% mapping lin-3 against RFLPs in the cloned DNA. to 43% Egl+. The suppressor mutation has no pheno These results will identify a small set of overlapping type in a strain that carries a wild-type allele of cosmid clones closely linked to lin-3. We will then let-23. The other three mutations allow 5-10% of search for RFLPs associated with the existing nine hemizygous sy 1 animals to be Egl+. lin-3 alleles, or a transposon-induced allele. These screens will be repeated and the mutants that are generated will be mapped to specific chromo 168. Genetic Approaches Towards Identifying the somal locations and genetically analyzed to determine Inductive Signal whether they act in the gonad (and hence are involved Gregg D. Jongeward in production of the signal) or in the VPCs (and hence In wild-type C. elegans vulva! formation, a signal are likely to be involved in the response to the signal). produced in one tissue (the gonad) induces three of the vulva! precursor cells (VPCs) to generate the vulva. The nature of this inductive signal is not known. 169. Male Mating: Development and Behavior Genes controlling production of the inductive signal Leslie A. Barber, Cheng T. Song 1 have never been identified (with the possible exception During development of the male tail of C. elegans, of lin-3), although five genes apparently required for the concerted morphogenesis of several tissues forms a the response to the inductive signal are known. It is complex structure mediating a simple behavior, male possible that nulls or hypomorphs of genes specifying mating. In addition to allowing study of cell-type the signal are lethal or that the gene is duplicated, determination during a cell lineage, several processes precluding the identification of such a gene. To can only be studied in the male tail. For example, circumvent this problem, we are screening for mutants programmed cell death by "murder" rather than by that have an elevated level of inductive signal. "suicide" only occurs in male-specific lineages. To One screen is the mutagenesis of wild-type C. identify genes necessary for normal male tail develop elegans to find mutants with hyperinduced phenotypes ment, we are screening for mutants defective in male (a functional vulva with a small pseudovulva near it). tail morphology or mating behavior. Because C. Four candidates were identified in a screen of 2000 elegans hermaphrodites are internally self-fertilizing, haploid genomes. These candidates have been back male mating is a completely dispensable function. A crossed and mapped to linkage groups. One mutation, mutation, him-5(e1490), which causes a high frequency sy16, defines a new complementation group on of X-chromosome nondisjunction, segregates 33% chromosome 5 and causes a defect in vulval morpho males, thereby allowing male phenotypes to be scored genesis that is apparently not due to elevated signal. in homozygous strains that are incapable of mating. The second screen is for phenotypic revertants of From examination of the males produced by 834 syl, an allele of let-23 which decreases but does not independent F 2 clones derived from mutagenized him- eliminate the VPC's ability to respond to the signal. 5 grandparents, we have obtained 27 mutant strains This screen should yield mutants that elevate the with abnormal male tail morphology. (An additional 15 signal, other types of suppressors of let-23, and strains have abnormal males, but also have hermaphro possibly new alleles of lin-15. While 93% of hemi- dite defects such as uncoordinated movement or 114 dumpy body shape and thus are probably alleles of PUBLICATIONS known genes.) We have examined the anatomy of males Ferguson, E. L., Sternberg, P. W. and Horvitz, H. R. of these strains and found that they fell into one of (1987) A genetic pathway for the specification of the vulval cell lineages of Caenorhabditis elegans. three classes: six mutants have gross tail defects Nature 326, 259-267. reflecting abnormalities in epidermal development; 26 Sternberg, P. W. (1987) Control of cell lineage and cell type in S. cerevisiae. In: Genetic Regulation have primarily defects in the proctodeum; and five of Development, Symposium of the Society for have defects in gonadogenesis such that the gonad does Developmental Biology, Vol. 45, Loomis, W. R. (Ed.), Alan R. Liss, New York, pp. 83-108. not connect to the proctodeum. Sternberg, P. W. (1988) Control of cell fates in A second class of mutants obtained in this screen equivalence groups in C. elegans. Trends in Neuroscience II, 259-264. are anatomically normal yet defective in copulation Sternberg, P. W. (1988) Review of Developmental (Cod- phenotype; "copulation defective"). A major Genetics of Higher Organisms: A Primer in Developmental Biology, Malacinski, G. M. (Ed.), class of mutants defective in a variety of behaviors Science 240, 228-229. including male mating fail to avoid high osmotic Sternberg, P. W. (1988) Lateral inhibition during vulva! induction in Caenorhabditis elegans. Nature, in strength media. We therefore tested all eight Cod press. mutants for this behavior. All mutants displayed wild Sternberg, P. W. and Horvitz, H. R. (1988) lin-17 mutations of C. elegans disrupt asymmetric cell type behavior, indicating that we have not just re divisions. Dev. Biol. 130, in press. isolated additional alleles of known genes. To better Sternberg, P. W., Stern, M. J., Clark, I. and Herskowitz, I. (1987) Activation of the yeast HO characterize these Cod mutants, we are developing a gene by release from multiple negative controls. set of assays for various steps in copulation: Cell 48, 567-577. attraction of males to hermaphrodites, location of the vulva, spicule insertion, and sperm transfer. 1Undergraduate, California Institute of Technology. MOLECULAR BIOLOGY AND BIOCHEMISTRY John N. Abelson Giuseppe Attardi Judith L. Campbell William J. Dreyer Herschel K. Mitchell James H. Strauss Barbara J. Wold 117 Professor: John N. Abelson Culbertson. We have now cloned the gene by comple Senior Research Fellows: Soo-Chen Cheng, Michael E. mentation and have hopes that this will lead us to the Cusick, Gloria Dalbadie-McFarland Research Fellows: Markus Aebi, Josette Banroques, isolatior:i and characterization of this enzyme. Tien-Hsien Chang, Michael W. Clark, Mahshid The second enzyme, tRNA ligase, is well charac Company, Patrizia Fabrizio, Susan Goelz, David Horowitz, David S. McPheeters, Reinhard Rauhut, terized. It has three activities: phosphodiesterase, Stephanie W. Ruby, N. Kyle Tanner, Qi Xu 1 ligase and polynucleotide ligase. Each of these has Graduate Students: Calvin K. Ho , George Komatsoulis, Jennifer Normanly, Vicente M. been shown to be in separate domains of the 90 kDa 1 Reyes , Usha Vijayraghavan, Shawn K. Westaway tRNA ligase protein. We can now purify large amounts Research and Laboratory Staff: John A. DeModena, Martha Fiallos, Jane D. Goldsborough, Joyce Ito, of ligase through engineered expression of its gene in Irma Ribeiro E. coli. Early attempts to crystallize the protein have 1Division of Chemistry and Chemical Engineering, not yet been successful but there are hopeful signs. California Institute of Technology. In mRNA splicing, the machinery is much more complicated. Before it is spliced, the pre-mRNA must Support: The work described in the following research reports has been supported by: be assembled into a large (40S) ribonucleoprotein American Cancer Society complex, the spliceosome. Five snRNPs, Ul, U2, Ut+, Merck Sharp & Dohme Research Laboratories National Institutes of Health, USPHS U5 and U6, are subunits of the spliceosome and each National Science Foundation plays a distinct (though not well understood) role in the Department of the Navy, Office of Naval assembly of the spliceosome and probably in the bio Research The Proctor & Gamble Co. chemical reactions of cutting and rejoining as well. Damon Runyon-Walter Winchell Cancer Fund Earlier we had shown that the spliceosome can be assembled in vitro by addition of exogenous pre-mRNA Summary: Eukaryotic genes often contain intrans that to an active yeast extract. This year we have been interrupt the continuity of the genetic information. In able to assemble most of the snRNPs in vitro by adding order for a gene containing an intron to be expressed, exogenous snRNA to an extract. This gives us an assay these sequences must be removed. This is done at the for which proteins and snRNA sequences are required RNA transcript level by the process known as RNA for assembly of these spliceosome subunits. splicing. We are trying to understand two kinds of We have developed a new affinity method for the RNA splicing reactions in detail at the molecular purification of the spliceosome. Using this technique level. These are tRNA and mRNA splicing. We study we have been able to study very early events in the splicing in the yeast Saccharomyces cerevisiae because assembly process. We have shown that the U I snRNP both biochemical and genetic manipulations are is required for an early and hierarchic step in the carried out with comparative ease in this system. assembly process and may mediate the folding of the In the case of tRNA splicing, two enzymes are precursor during the early steps, before any other required to remove the intron from a set of l 0 snRNP interacts with the complex. different pre-tRNAs, all of which contain a single We have continued our work on ts mutants that intron located just following the anticodon. The first affect mRNA splicing. Previously, a set of genes, enzyme, endonuclease, cleaves the precursor at the RNA2-11, were shown to code for proteins involved in splice junctions to r:elease the intron. This integral mRNA splicing. We have concentrated on the study of membrane protein has been difficult to purify but in three of these genes, RNA4, 5 and 11. RNA4 is very the last year we may have isolated a yeast mutant in likely an snRNP protein since antibody to the protein the structural gene for this enzyme. Screens of a precipitates the yeast U4, U5 and U6 snRNAs. RNA5 library of temperature-sensitive (ts) mutants for and RNAll participate in very early steps in the defects in tRNA splicing in vivo were performed by us assembly of the spliceosome, and we are now in a and by Winey and Culbertson at Wisconsin. We found a position to study those events using purified proteins mutant that seems to affect splicing only at the 5' and antibodies to those proteins. splice site. This mutation proved to be in one of two We have extended the collection of RNA mutants complementation groups isolated by Winey and by screening a new collection of yeast ts mutants for 118 mRNA splicing defects. This screen has identified a Trp) revealed in each instance accumulation of a 2/3 number of new complementation groups that (as in the intermediate of the anticipated size. Extract prepared case of ma2-11) accumulate precursors. Several of from the mutant possesses activities that partially these new genes have been cloned and are being splice a synthetic tRNA Phe precursor to yield the 3' characterized. In addition, two new kinds of mutants half-molecule and the 2/3 intermediate. The 5' half were found. One, ma17, accumulates the splicing molecule and intron are barely detectable in the in intermediates at the nonpermissive temperature. The vitro assay, suggesting that the tRNA splicing activity other, mal8, accumulates the larval intrans as a is defective in cleaving at the 5' exon/intron splice particle. These mutants give us a unique opportunity site. The defective activity copurifies with endo to study late events in the mRNA splicing process. nuclease active fractions throughout multiple steps We have continued our work on the mechanism by during partial protein purification. The mutation is which each aminoacyl tRNA synthetase recognizes and recessive and segregates 2:2 independently of tem correctly acylates the correct set of cognate tRNAs. perature sensitivity, but cosegregates with a pseudo This is done by determining the minimum number of cold-sensitive phenotype of retarded growth at 15°C. changes required to completely alter the identity of a We have tentatively named the mutation tacl for tRNA. We have now completed that experiment for tRNA !WO-thirds accumulator. Cloning of the TACl+ one transformation, E. coli tRNA Leu to tRNA Ser. A allele by complementation of the pseudo-cold-sensitive limited number of bases in the anticodon stem and the phenotype is in progress. The sequences of TACl+ and dihydro U stem appear to determine tRNA Ser identity. tacl are anticipated to shed light on the functional and It is gratifying that the techniques ;;nd approaches mechanistic aspects of their gene products. we have developed for approaching the problem of tRNA identity are now being used by others (Hou and 171. Structural and Functional Analysis of the Schimmel, 1988; McClain and Foss, 1988) to obtain Active Domains of Yeast tRNA Ligase exciting insights into the nature of tRNA identity. Qi Xu This is a problem that has been unsolved for nearly 30 Splicing of tRNA precursors in Saccharomyces years and with the renewed activity we expect to see cerevisiae proceeds in two distinct steps: excision of it solved in the near future (Schulman and Abelson, the intervening sequence, and ligation of the tRNA 1988). halves. The two enyzmes that catalyze this reaction are an endonuclease and a tRNA ligase. tRNJI: ligase References: Hou, Y.-M. and Schimmel, P. (1988) Nature 333, 140- is a 90 kDa protein with three independent activities 145. consisting of a polynucleotide kinase, a cyclic McClain, W. H. and Foss, K. (1988) Science 240, 793- 796. phosphodiesterase and a ligase (adenylyl transferase). Schulman, L. H. and Abelson, J. (1988) Science 240, We have proteolytically digested the 90 kDa ligase 1591-1592. protein and purified the three major fragments (65, 40 170. A Yeast Mutant that Accumulates Pre-tRNA and 25 kDa) to homogeneity on heparin-agarose and Splicing "2/3" Intermediates heptyl-agarose columns. The determined amino acid Calvin K. Ho, Reinhard Rauhut, Usha Vijayraghavan sequences of the 65 and 40 kDa fragments reveal that We have screened a collection of temperature these two fragments have the same amino terminus as sensitive yeast mutants for those defective in the 90 kDa ligase protein; in contrast, the 25 kDa processing intron-containing tRNA precursors in vivo fragment is located at the C terminus. We have by Northern analysis using oligonucleotide probes studied the adenylylation, kinase and cyclic phospho complementary to tRNA intron sequences. One mutant diesterase activities of the ligase and the three major was found to accumulate significant amounts of RNA fragments, and mapped these activities to specific molecules of the size expected for the "2/3" pre-tRNA domains within the protein. The active site for intermediate consisting of the 5' exon covalently adenylylation is located near the N terminus, the joined to the intron. Oligonucleotides directed against active site for the kinase activity is near the middle of several tRNA precursors (Ser-UCG, Ile-AVA, Leu3, the protein and the active site for the cyclic 119 phosphodiesterase activity is near the C terminus. tRNA ligase to begin a crystallographic study of the Adenylylation of the purified enzyme with a-32P-ATP, structure. We will clone the intact gene into various followed by trypsin digestion, yielded a radioactive 4 E. coli expression vectors in several different kDa peptide. We will purify and sequence this peptide. protease-deficient E. coli strains to increase yields. We have constructed a new E. coli strain (SW 1068) We are using a defined set of factorial solutions, that, upon IPTG induction, overproduces 18-fold more consisting of various combinations of different buffers, tRNA ligase than the previous strain utilized. Using salts, and precipitants, to id~ntify initial conditions for this new strain, we have purified 30 mg of the ligase crystal growth. Once appropriate combinations have from 300 g of E. coli paste by using heparin-agarose, been identified as important to crystallization, heptyl-agarose, hydroxylapatite and Sephadex G-150 conditions may then be optimized for growth of large columns. We have now initiated a crystallographic crystals suitable for X-ray diffraction studies. study of the tRNA ligase. References: Phizicky, E. M., Schwartz, R. C. and Abelson, J. (1986) J. Biol. Chem. 261, 2978-2986. 172. Yeast tRNA Ligase: Structure and Function Westaway, S. K., Phizicky, E. M. and Abelson, J. (1988) of the Domains J. Biol. Chem. 263, 3171-3176. Shawn K. Westaway tRNA ligase is one of the enzymes required for 173. Crosslinking Yeast tRNA Ligase to tRNA splicing in Saccharomyces cerevisiae. The Bromouridine- and Thiouridine-Incorporated enzyme is a single polypeptide of 95 kDa, and Precursor Transfer Ribonucleic Acid catalyzes four reactions that constitute three separate N. Kyle Tanner, Michelle M. Hanna 1 enzymatic activities involved in tRNA splicing: a Yeast tRNA ligase from Saccharomyces cerevisiae cyclic phosphodiesterase activity, a polynucleotide is one of the protein components that is involved in the kinase activity, an adenylylation reaction, and a ligase splicing reaction of intron-containing yeast precursor activity. The adenylylation activity is part of the tRNAs. [t is an unusual protein because it has three ligation step. tRNA ligase has been purified and its distinct catalytic activities. It functions as a poly gene has been cloned and sequenced (Phizicky et al., nucleotide kinase, a cyclic phosphodiesterase, and as 1986; Westaway et al., 1988). an RNA ligase. We have studied the binding inter We are studying these reactions by dissecting the actions between ligase and precursor tRNAs containing tRNA ligase protein into the domains responsible for two photoreactive uridine analogs, 4-thiouridine and 5- each activity listed above. Fragments from the tRNA bromouridine. When irradiated with long ultraviolet ligase protein have been isolated, each of which light, RNA containing these analogs can form specific contains only a few of the different activities of the covalent bonds with associated proteins. We found intact polypeptide (see Abstract No. 170). We are that 4-thiouridine triphosphate and 5-bromouridine constructing nested sets of deletions of the ligase gene triphosphate were readily incorporated into a sequence that has been fused to an E. coli promoter. precursor tRNAPhe that was synthesized, in vitro, By overproducing the peptide fragments in E. coli, we with bacteriophage T7 RNA polymerase. The analog remove any possibility of contamination by other containing precursor tRNAs were authentic substrates portions of the tRNA ligase protein. We will assay the for the splicing enzymes that were tested (endo purified cloned peptide fragments for each separate nuclease and ligase) and they formed spetific covalent enzymatic activity and for anti-tRNA ligase antibody bonds with ligase when they were irradiated with long recognition to verify the results obtained using intact ultraviolet light. We have determined the position of tRNA ligase. In this manner, we hope to locate the three crosslinks of the bromouridine-incorporated adenylylation site of tRNA ligase, as well as elucidate precursor tRNAPhe that were located within the the domains of tRNA ligase responsible for each intron and near the 3' splice site. Based on these data, activity. This approach may also reveal how the we have developed a model for the in vivo splicing protein is localized to the yeast nucleus. reaction in which tRNA ligase functions to transport We are interested also in producing enough purified the newly synthesized, and partially modified, 120 precursor tRNA from the nucleoplasm to the nuclear 175. The Organization of mRNA, rRNA and tRNA envelope. A ternary complex is then formed on the Maturation Pathways in the Yeast Nucleus nuclear envelope with yeast endonuclease. The Michael W. Clark precursor tRNA is spliced within this complex and the We are interested in the molecular events and mature tRNA is transported through the nuclear pore mechanisms responsible for the organization of the into the cytoplasm. eukaryotic nucleus. Recent data from Drosophila 1 larvae, mammalian neuronal cells and plant cells Department of Biological Chemistry, California College of Medicine, University of California, Irvine, indicate that there are cell type and cell cycle specific CA. arrangements of the chromosomes in these cells. These observations imply that other functions of the 174. Sequencing of ORF2: An Open Reading Frame nucleus might also have a particular arrangement. Our Upstream of the tRNA Ligase Gene research on the structural organization of the nucleus George A. Komatsoulis, Shawn K. Westaway of Saccharomyces cerevisiae supports this conclusion. Upstream sequences are required to rescue Our research focuses particularly on the mechanisms insertional knockout mutants of the tRNA ligase gene for arrangement of the enzymes involved in the from the baker's yeast Saccharomyces cerevisiae. mRNA, rRNA, and tRNA maturation pathways. The When the tRNA ligase gene was sequenced, the processing mechanism for the three major classes of upstream region was found to contain an open reading RNAs is distinct for each class. What the three frame, ORF2, which was subsequently bound to processing pathways have in common is an obvious produce 2.1 kb, polyadenylated mRNAs. This gene had temporal ordering of the steps of RNA maturation. four transcription start sites, the closest of which was We have determined the specific locations of a few of only l 25 bp from one of the two transcriptional starts these enzymes in the yeast nucleus and can correlate of the tRNA ligase gene. The close proximity of the these locations to a spatial grouping or alignment of two transcriptional start sites led us to speculate that these enzymes with the temporal ordering of the the ORF2 gene product was involved in processing of processing events seen biochemically. We have used pre-tRNA molecules (Westaway et al., l 988). antibodies directed against the following proteins in We sequenced the ORF2 gene by the dideoxy chain immune fluorescence and immune electron micro termination method in an effort to learn more about scopic techniques to map the spatial arrangement of its function (Komatsoulis et al., 1987). Analysis of the the three major RNA pathways: !) for tRNA sequence indicated that the open reading frame maturation - tRNA ligase (Clark and Abelson, 1987), a extended for 1872 bp and encoded a putative protein marker for tRNA splicing; 2) for mRNA maturation - product of 623 amino acids, with a molecular weight of RNA polymerase II and the yeast heat shock 71.2 kDa. Because the tRNA splicing endonuclease transcription factor (HSTF), used as markers for (whose gene had not been isolated) appears to be mRNA transcription (Clark, Wiederrecht, Parker and associated with the nuclear membrane, we made Abelson, manuscript in preparation), and two proteins, hydrophobicity plots of the putative protein, although RNA! l (Chang et al., 1988) and Sm-antigens, which no evidence was found that this gene product is an are intimately involved in mRNA splicing; and 3) for integral membrane protein. Homology searches at the rRNA maturation - RNA polymerase I large subunit protein level through the SNBRF and Swiss-protein and fibrillarin for markers of rRNA transcription databases revealed no significant homologies to any (Clark, Campbell and Abelson, manuscript in sequenced protein. Thus, the function of the ORF2 preparation) and SSB-1, thought to be involved in pre gene product is still in question. ribosome assembly (Jong et al., 1987). References: The overall conclusion we can derive from these Komatsoulis, G. A., Westaway, S. K. and Abelson, J. N. localizations is that the major events of RNA ( 1987) Nucleic Acids Res. 15, 9079. Westaway, S. K., Phizicky, E. and Abelson, J. N. (1988) maturation are in a nuclear subcompartment, that J. Biol. Chem. 263, 3171-3176. being the nuclear periphery. These results from the yeast nucleus correlated quite well with recent 121 evidence from the higher eukaryotes showing that ac mine if any catalytic properties are associated with tively transcribing genes, RNA polymerase II, hnRNP the snRNAs alone (or in combination) and by mixing proteins and Sm-antigens are also located in the the T7-snRNAs with yeast extracts to achieve proper periphery of the mammalian nucleus. The phenomenon assembly of snRNP particles in vitro. We would like to of compartmentalization of RNA processing events use these in vitro assembled snRNAPs to I) identify appears to be conserved throughout the evolution of the proteins associated with each of the individual the eukaryotes and must be directly involved with the snRNPs, 2) characterize the associations of the proper functioning of the eukaryotic nucleus. individual snRNPs with each other, 3) study the We are now in the process of linking this structural assembly of the snRNPs into the spliceosome, and 4) to data about the yeast nucleus to the biochemical and determine the roles each snRNP plays in pre-mRNA molecular events of the RNA maturation pathways. splicing. Several of the yeast RN A mutations Using the techniques of molecular biology and specifically affect pre-mRNA splicing and will be biochemistry available in yeast and the ability to make screened for defects in snRNP assembly. In addition, conditional, temperature-sensitive yeast mutants, in antisera against several of the yeast proteins involved concert with the techniques of cellular localization in pre-mRNA splicing are available. and yeast cell biology, we are beginning to dissect the Preliminary results indicate that when mixed in molecular events of nuclear compartmentalization and yeast splicing extracts, the T7-U6 and T7-U4 tran how it impacts on proper nuclear functioning. scripts assemble into heparin-resistant RNP particles which comigrate with the endogenous snRNPs in non References: Chang, T.-H., Clark, M. W., Lustig, A. J., Cusick, M. denaturing gel electrophoresis. At least two of the E. and Abelson, J. (1988) Mo!. Cell. Biol. 8, 2379- three endogenous U6 snRNP complexes comigrate with 2393. Clark, M. W. and Abelson, J. (1987) J. Cell Biol. 105, the complexes formed on the exogenous T7-U6 1515-1526. transcript and one of these complexes shows an ATP Jong, A. Y.-5., Clark, M. W., Gilbert, M., Oehm, A. and Campbell, J. L. (1987) Mo!. Cell. Biol. 7, 2947- dependent dissociation. In vivo, the mammalian U4 2955. and U6 snRNPs appear to associate with one another by base pairing of the U4 and U6 snRNAs. P. Siliciano 176. In Vitro Assembly of Yeast snRNPs and C. Guthrie (UCSF) have detected a stable complex Patrizia Fabrizio, David S. McPheeters between the yeast U4 and U6 snRNAs analogous to the The removal of introns from nuclear pre-mRNAs complex formed between their mammalian counter requires the action of numerous proteins and RNAs parts. We have detected also a complex between the assembled into a large complex termed the spliceo- T7-U4 and T7-U6 RNAs by non-denaturing gel electro some. Several small nuclear ribonucleoprotein phoresis and hope to utilize this complex to study the particles (snRNPs) are associated with the spliceosome structure and function of the U4/U6 complex in vitro. during pre-mRNA splicing. The spliceosome-associated The T7-U5 transcript also assembles with proteins snRNPs are each composed of a single small nuclear present in yeast splicing extracts to produce heparin RNA (snRNA) molecule associated with several resistant RNP complexes. One of the T7-U5 RNP proteins and represent µreassembled subunits of the complexes comigrates with an endogenous U5 snRNP, spliceosome. Consistent with this role in pre-mRNA while the formation of another of the T7-U5 RNPs is splicing, gene disruptions of the spliceosome dependent on the inclusion of ATP in the assembly associated snRNAs are lethal in yeast. The snRNPs mixture. probably dictate the folding of intron sequences into a Experiments are currently under way to demon proper conformation for intron excision and exon strate that the RNPs formed with the T7-snRNAs in ligation, and may possess catalytic properties as well. vitro represent complexes both structurally and We have subcloned the genes for the yeast Ul, U2, functionally homologous to those found in vivo. U4, U5 and U6 snRNAs under the control of Tl promoters and expressed the transcripts of these genes in vitro. Using these T7-snRNAs, we hope to deter- 122 177. Early Events in Spliceosome Formation 178. Spliceosome Assembly in Yeast Stephanie W. Ruby Sao-Chen Cheng We have studied yeast snRNP binding to pre-mRNA Spliceosome assembly was studied by electro during splicing in vitro using an affinity chromatog phoresis on native polyacrylamide gel. Four splicing raphy technique that we developed. In this technique a complexes, Al, A2-l, A2-2 and B, have previously been small, biotinylated "anchor" RNA complementary to identified. The order of assembly is B+A2-l+Al+A2-2. the 3' end of the pre-mRNA is first hybridized to the Northern blot analyses reveal that several snRNAs are pre-mRNA. The RNA hybrid is then bound to biotin associated with these complexes. U2 is found to be Sepharose with avidin and used as a substrate for in associated with all four complexes. U5 and U6 are in vitro splicing. Because the biotin groups are linked to complexes A2-l, Al and A2-2, whereas U4 is only in the anchor RNA by disulfide bonds, the RNA hybrid A2-l. and its bound components are easily and rapidly eluted A faster migrating complex, complex C, which with dithiothreitol. The snRNPs bound to actin pre might be associated with the splicing reaction, was mRNA during splicing were analyzed by both 3' end recently identified. Complex C did not contain any of labeling and Northern hybridization. the five snRNAs (U l, U2, U4, U5 and U6) involved in We found that U 1 snRNP binds first and in an ATP mRNA splicing. Since it formed with micrococcal independent manner. The other snRNPs (U2, U4, and nuclease-treated extract, no RNA components were the two forms of U5) bind in an ATP-dependent required. Complex C did not form with RNA con manner thereafter. (We are currently analyzing U6 taining no IVS sequence (antisense RNA or matured binding.) Removal of the 5' end of U 1 snRNP by message). However, transcript with single point oligonucleotide-directed RNAseH cleavage abolishes mutation in or deletion of any of the three consensus binding of all the snRNPs. Removal of the region of U2 elements (5' splice site, 3' splice site and TACTAAC snRNP complementary to the pre-mRNA UACUAACA box), although inactive for splicing, still formed sequence destroys U2 snRNP and prevents binding of complex C. This may indicate multiple interaction U5 and U4 snRNPs but has a minimal affect on U l sites of IVS sequence with the factor required for snRNP binding. Thus U 1 snRNP binding is required for complex C formation. Formation of complex C did not 2 subsequent binding of the other snRNPs and is the first require ATP and was stimulated by Mg +. Complex C critical step in spliceosome formation. formed instantaneously upon addition of the splicing We have further found that U 1 snRNP binding extract and disappeared with the appearance of other depends on both the 5' splice site and UACUAAC splicing complexes during the time course of the sequences of the pre-mRNA. Three 5' splice site splicing reaction, indicative of its involvement in the mutations that we analyzed (Al, Cl and A5) reduce Ul very early step of the splicing reaction. The order of binding and nearly abolish binding of the other snRNPs, the assembly of the spliceosome is therefore C+B+A2- most noticeably U2 snRNP. Two mutations (A256 and l +Al+A2-2. C259) in the UACUAAC sequence reduce U 1 binding Splicing reaction was inhibited by poly(U) at 10 µM. and severely diminish U2 binding. A third mutation Other polynucleotides inhibited the reaction only at (A257) prevents binding of both U 1 and U2 snRNPs as much higher concentrations. Analysis of complex well as the other snRNPs. A mutation (C303/305) in formation revealed that formation of complex B was blocked and complex C accumulated in the presence of the 3' splice site, on the oth~r hand, has no detectable affect on snRNP binding. These results suggest that poly(U). Addition of poly(A) prior to or after incu Ul snRNP binding also plays a critical role in splice bation with poly(U) reactivated spliceosome formation, site recognition and sequence alignment. U 1 snRNP indicating single-stranded poly(U) was required for the may associate with the UACUAAC sequence by inter inhibition. The inhibition by poly(U) could be comple acting with either the U2 snRNP, protein(s) bound at mented by micrococcal nuclease-treated extracts, or near the sequence, or the sequence itself. suggesting that the poly(U)-sensitive factor(s) did not have an essential RNA component. This complementa tion also provides an assay for isolation of the factor. 123 179. Identification of a Yeast snRNP Protein products are likely to be components of the Josette Banroques spliceosome, a multicomponent complex of the mRNA The gene products of the Saccharomyces cerevisiae splicing machinery. Not surprisingly, RNA4 and RNA8 genes RNA2 through RNA l l have been shown proteins are indeed associated with the snRNAs previously to exhibit a defect in splicing of precursor present in the spliceosome. We have previously mRNAs. The RNA4 gene product has been described demonstrated that the RNA! I protein is associated as an essential component of the splicing machinery in with the spliceosome in vitro and have also localized vitro. The gene, isolated by genetic complementation, the RNA! 1 protein in the nuclear periphery (Chang et has been obtained from J. Woolford at the University al., l 988). We now proceed to search for functions of of Pennsylvania. Cloned extra copies of RNA4 are the RNA 11 protein. able to restore the splicing activity of rna4 mutants at The RNA! l protein has a potential Zn finger motif restrictive temperature. The gene has been sequenced, (Chang et al., l 988). Bearing the correlation of the Zn and an open reading frame that could encode a 52 kDa finger and the nucleic acid binding activity in mind, we protein has been found. There is no sequence homology set out to look for the RNA I I-binding snRNAs. This, with the other RNA proteins already sequenced. The however, was not successful. We then decided to gene has been over expressed in E. coli and antibodies search for possible enzymatic activities linked to the have been raised against the gel-purified RNA4 RNAll protein. Under the tac promoter control, the protein. expression of the RNA 11 gene was induced with lPTG The RNA4--specific antibodies can completely and the RNA 11 protein was highly overproduced in E. inhibit mRNA splicing in vitro, which confirms that coli. Traditional column chromatography techniques RNA4 plays an essential role in splicing. Jmmuno were then applied to purify the RNA! I protein to near precipitations from splicing extracts have been used to homogeneity. We intend to assay for various enzymatic demonstrate that RNA4- protein is in stable association activities, such as ATPase, helicase, and nuclease with the small nuclear RNAs snRl4, snR7 and snR6; activities, in this purified fraction. these snRNAs are known to be required for splicing The discovery of the potential Zn finger in the and are present in the yeast spliceosome. The RNAl l protein is of great interest. In order to under association between RNA4 and snRNAs is not ATP stand the significance of this, deliberate mutations dependent. None of the other known snRNAs can be will be introduced into the Zn finger region to replace immunoprecipitated with these antibodies. the highly conserved amino acid residues and then the In conclusion, we have demonstrated that RNA4 complementation activity of the RNA! l protein will protein is a component of yeast snRNPs, containing be assayed. Subsequently, Zn depletion and re snR14, snR7 and snR6. The formation of such a snRNP constitution experiments will also be carried out to complex is consistent with current models for spliceo verify the identity of the Zn finger. Jn the end, we some assembly. Further immunological studies should hope to correlate the nucleic acid binding activity of allow us to determine if RNA4 protein is present in the the RNA! I protein with its potential enzymatic spliceosome and to better understand the function of activities and gain further insight into the functions of this protein in nuclear pre-mRNA splicing. the RNA! I protein in the mRNA splicing pathway. Reference: Chang, T.-H., Clark, M. W., Lustig, A. J., Cusick, M. 180. Functions of the RNA! 1 Protein E. and Abelson, J. (1988) Mo!. Cell. Biol. 8, 2379- 2393. Tien-Hsien Chang The yeast ma mutants, denoted ma2 to mal0/11, 181. Function of the Yeast RNA5 Protein in are a set of temperature-sensitive mutants in which Pre-mRNA Splicing the mRNA splicing is defective at the nonpermissive Gloria Dalbadie-McFarland temperature. Ample evidence has been accumulated Splicing of eukaryotic nuclear intrans requires to indicate that the RN A gene products are directly assembly of a spliceosome before covalent modifi involved in mRNA splicing. Therefore, the RN A gene cation of the pre-mRNA can occur. The yeast RN A5 124 gene product is required for spliceosome assembly (Lin Accumulation of the splicing intermediate in the et al., 1987), but the nature of its biochemical activity mutant strain malB allows an opportunity to define is not known. We have cloned and characterized the what component of the splicing machinery is needed to yeast RNA5 gene in order to examine its products and complement the phenotype both in vivo and in vitro. their roles in splicing. The use of in vitro heat-inactivated extracts followed The RN A5 gene was isolated from a yeast genomic by in vitro complementation would lead to information library by complementation of a temperature-sensitive about the role of this gene product. We have been able defect. DNA sequence analysis of the RNA5 structural to successfully inactivate splicing extracts prepared gene revealed an open reading frame that encodes a 4 7 from this mutant strain. Irreversible inactivation leads kDa predicted protein. Antisera against synthetic to the accumulation of the lariat intermediate and a peptides derived from this sequence, and against the consequent decrease in the mature mRNA and intron is 47 kDa protein expressed in E. coli, have been raised in observed. Complementation of in vitro can be achieved order to investigate the function of the yeast RNA5 with heat-inactivated extracts prepared from ma5 or protein. These antibodies inhibit splicing in vitro and mall strains. Fractions of wild-type extracts that therefore will be useful in determining the step(s) in possess complementing activity have also been identi the spliceosome assembly pathway for which RNA5 fied. Micrococcal nuclease-treated, wild-type whole protein is required. Spliceosome-associated RNAs, cell extracts retain complementing activity. This including pre-mRNA, splicing intermediates, and the suggests that an intact snRNP is probably not required intron in lariat form, can be immunoprecipitated with for complementation of this mutant phenotype. anti-RNA5 sera, suggesting that the RNA5 protein is Spliceosomes formed in heat-inactivated extracts from an integral component of the spliceosome. this mutant sediment at 405 on glycerol gradients, as Purification and characterization of the protein is expected, and contain the lariat intermediate and exon in progress in order to investigate the nature of its l. The intermediates in this assembled-mutant spliceo biochemical activity and function in the splicing path some can be chased into products upon addition of way, as well as to determine whether it acts as an appropriate fractions. A specific requirement of ATP independent protein factor or as part of a snRNP at this stage in the splicing reaction has been demon particle. strated for the first time. Complementation and Reference: chasing experiments with extracts from this mutant Lin, R.-J., Lustig, A. J. and Abelson, J. (1987) Genes & strain indicate that the mutant function is an extrinsic Dev. I, 7-18. component of the spliceosome required for the second splicing reaction, cleavage at the 3' splice site. Since 182. Biochemical and Genetic Characterization of ma17 and ma18, Mutants in mRNJ\ a co-segregation of the ts lethality and the lariat Processing Reactions accumulation was observed, this in vivo phenotype has Usha Vijayraghavan been used to obtain complementing clones from a The yeast RNA2-1 l genes are required for the yeast genomic library. Subclones derived from this processing of pre-mRNA in yeast. We had reported yeast genomic fragment have so far narrowed the last year the isolation of several new complementation complementing DNA fragment to a 2.5 kb fragment. groups of temperature-sensitive (ts) mutants that are Integration of the cloned copy has been done and defective in splicing in vivo. Apart from the isolation tetrad analysis indicates that the cloned copy is linked of new groups with the same biochemical phenotype as to the wild-type locus. Further subcloning and the ma2-11, we had reported the isolation of two novel sequencing of the clone will be done. phenotypes, one leading to the accumulation of the Accumulation of the lariat intron was the second splicing intermediate, lariat !VS-exon2 (ma18), and the novel phenotype isolated from the screen for mutants other where an accumulation of the released intron in RNA processing reactions. This phenotype is caused (mal 7) was observed. Further biochemical and genetic by a single nuclear recessive gene, but this phenotype characterization of these two novel mutants has been does not lead to ts lethality in vivo. Extracts prepared done and will be discussed. from this mutant strain (mal 7) when fractionated on 125 glycerol gradients indicates that the intron exists in a Protease digestion of p30 generated several proteo particle of sedimentation value of about 405, similar lytic peptides that were purified and sequenced. to that of the spliceosome. Comigration of this Corresponding degenerate oligonucleotides were intron-containing complex and some spliceosomal synthesized and used to clone the single-copy gene components, the snRNAs, was observed on glycerol from the yeast yCP50 plasmid library. Analyses of p30 gradients. Antibodies directed against the snRNAs or gene structure and sequence are under way. snRNPs precipitate snRNAs from mutant extracts as If the sequence confirms that a true hnRNP gene expected and also bring down some intron from the has been isolated, then further studies will continue to mutant extracts. These results imply an association of determine the function of hnRNP in yeast. Knockout the intron with spiceosomal components, the snRNPs. mutants and conditional mutants will be constructed to Assays will be attempted to determine if the activity observe the physiological function of the gene. The responsible for debranching the lariat intrans is protein will be overexpressed in yeast and E. coli to defective in this mutant. Attempts to determine if produce abundant protein both for physical chemical the accumulation of the intron can be associated with studies and to generate polyclonal antibodies. The any other conditional phenotype are also being done; antibodies will be used to examine the role of p30 in this could then be used for cloning of the wild-type mRNA splicing and to search for other proteins that gene product. may interact with p30. By these approaches, we hope to reach an understanding of the biological role of 183. The Search for Yeast hnRNPs hnRNP. Michael E. Cusick Heterogeneous nuclear ribonucleoproteins (hnRNPs) 184. Finding hnRNP Genes Using the RNPCore Consensus Sequence are those proteins that associate with the precursor mRNA in the cell nucleus to form 30-405 RNP Michael E. Cwiick complexes. HnRNP proteins are believed to play an All hnRNP proteins sequenced to date contain a essential role in mRNA splicing. Despite efforts by small conserved consensus sequence in their N several groups, they have yet to be identified and terminal portion that I call the RNPCore sequence. characterized in yeast. The sequence is: Lys/Arg-Gly-Phe-Gly-Phe-Val-X-Phe. Two approaches designed to find components of This sequence is presumed to represent the RNA hnRNP-like complexes in yeast have identified a binding domain of the protein. This sequence is also protein of 30,000 MW as a component. RNP complexes part of the yeast poly(A)-binding protein (PABP), a of 30-405 extracted from purified yeast nuclei protein that binds specifically to the 3'-poly(A) tract contained a single protein of 30,000 MW. In the second of mRNA. approach, formation in vitro of RNP complexes on Using a degenerate oligonucleotide (17-mer, 32- biotinylated pre-mRNA transcripts, followed by fold degenerate) corresponding to the RNPCore purification of these complexes by avidin-agarose sequence, I have selected several RNPCore-containing chromatography, also identified a protein of 30,000 clones from the yeast •gtl 0 Eco RI library. Those MW as a major component. This protein (p30) was clones that contained PABP sequences were elimi purified to homogeneity by its ability to bind non nated. Of the selected clones remaining, most turned specifically to single-stranded DNA and RNA. All out to contain ribosomal DNA sequences, for down known hnRNP proteins bind strongly to single-stranded stream of the 55 rRNA gene there is a coincidental DNA cellulose (ssDC). In fact, all proteins yet purified 14/17 match to the RNPCore oligonucleotide that I off ssDC are hnRNP and not ssb's (single-stranded used. As the ribosomal genes are 100-fold repetitive binding proteins) involved in DNA replication. in yeast, they would have been preferentially selected The amino acid composition of p30 is similar to over any single-copy gene. Eliminating these clones known hnRNP proteins, including a blocked amino has left me with one unique RNPCore-containing terminus. Because of the blo<;:ked amino terminus, clone. This clone is being mapped and sequenced to direct sequencing of p30 was not possible. Instead, V8 determine if it contains a previously unidentified hnRNP gene. 126 185. Changing the Identity of a tRNA information we have gained about serine tRNA identity as a result of the tRNA Leu to tRNA Ser Jennifer N ormanly conversion. Previously, we reported that we had converted an (a) A E. coli leucine-specific tRNA into a serine-specific c tRNA by making 12 base changes in a synthetic leucine c amber suppressor tRNA gene (Biology 1985, Abstract A-G pG-U -c No. 14). The mutant suppressor (tRNALeu-SerUAG) G+-C-G-C specifically inserts serine in response to amber A+-C-G-U C -G nonsense codons, verified by protein sequencing. While G -C G -C tRNALeu-SerUAG is clearly a functional serine sup A -U u G A D. C s4U CGCCC pressor, it is very weak, with a suppression efficiency A of l %. (The leucine-specific tRNA, prior to mutation, \oAAG\G 11111 c C GUG ~CGGG T >jt is 7 5% efficient.) Gm I 11 G Presently, we are attempting to determine the G CAC I UC minimum number of changes required to effect the DA GA l A CG/ I G Leu-Ser conversion. We speculated that some of the \ G A-U GC/;CG 12 alterations originally made might be responsible for /\ G -C G C U GA G-C UU the low efficiency of the tRNA. Figure la shows the G -C A - >jt 12 changes incorporated into tRNALeuCUA to yield >jt A ms216A the Leu-Ser mutant. We have examined the contribu u tion of each alteration by reverting them to the wild C U A type tRNA Leu sequence and asking whether the resultant tRNA inserts serine. For example, reversion (b) of the mutations in the acceptor stem (base pairs 1-71, • 3-70 and nucleotides 72, 73) while maintaining the changes made in the dihydrouridine (D) stem and loop G • -(c) yields a nonfunctional tRNA. The converse experi G-C ment, reversion of all the mutations in the D stem and (.II) A - U.(Ii) loop and maintenance of the changes in the acceptor . -. stem results in a suppressor which inserts pre dominantly glutamine and leucine (37% and 43%, -. ••••• • • respectively) and only 6% serine. However, if only the • • I 1 1 1 1 ... ' D loop is reverted while bp 11-24 and the acceptor • c. • stem mutations are maintained, the resultant tRNA • I 11 inserts exclusively serine at an efficiency of approxi • • G • / • • • • // . mately 40%. Therefore, bp 11-24 plays a crucial role • • . . -. . / • in serine identity. Reversion of nucleotide 73 as well . / as base pairs 2-71 and 3-70 individually, while main . - . taining only the alteration to hp 11-24 in the D stem . - . • • revealed that all of the changes in the acceptor stem were necessary (position 72 has not been verified yet). • • • Figure lb shows the nucleotides that we believe to be the minimum number required to convert a leucine Figure !. (a) tRNA LeuCUA with the chan9es specific tRNA into an efficient serine-specific tRNA. (indicated by arrows) proposed to confer tRNA er specificity. (b) The minimum number of nucleotides We are presently trying to convert a tyrosine-specific required to convert a leucine-specific tRNA into a tRNA into a serine-specific tRNA by utilizing the serine-specific tRNA. Nucleotides in parentheses are not yet verified. 127 186. Effect of Extra Loop Size on Recognition 187. Studies on the Recognition of tRNAs by of a tRNA by its Cognate Aminoacyl Aminoacyl-tRNA Synthetases tRNA Synthetase George A. Komatsoulis, Jennifer Normanly, Teresa O!lick1, Jennifer Normanly Sidney Hecht 1 Although tertiary structure is similar for all We have undertaken two different experimental transfer RNAs (tRNAs), there is one major approaches to study the mechanism by which tRNA distinguishing feature that warrants their division into molecules are specifically recognized by their cognate two types. Type I tRNAs have a small extra loop (4-5 aminoacyl-tRNA synthetases. In particular, we are nucleotide residues), while type II tRNAs have an extra attempting to locate the regions of aminoacyl-tRNA loop composed of 9-2 l nucleotides arranged in a synthetase proteins that allow them to interact double-helical segment and a small loop. In addition, specifically with their cognate tRNAs. certain base-pairing and tertiary interactions One approach involves the selection of second-site distinguish the two tRNA classes. revertants in an aminoacyl-tRNA synthetase which The differences between the two types of tRNAs complement defective tRNA species. Normanly (this present the question of whether they play a role in the volume) has generated a leucine-inserting amber recognition of a tRNA by its cognate aminoacyl tRNA suppressor tRNA that is a single base change away synthetase (AAS). One question to address is simply from being specifically recognized by the seryl-tRNA whether the size of the extra loop affects such synthetase. A cloned seryl-tRNA synthetase will then recognition. An experiment in which the large extra be mutagenized and individual mutants used to screen loop of a serine tRNA was replaced by a small extra for revertants able to charge this modified amber loop suggests such a role; the modified tRNA was suppressor tRNA, as measured by suppression of a s mischarged by glutamine AAS and only partially (5%) lactamase gene containing an amber codon at the charged by serine AAS. Similar studies of how extra active site serine. Once revertants are available, we loop size affects tRNA recognition will be carried out will sequence individual mutants to determine the using leucine and tyrosine amber suppressor tRNAs, nature of the change(s) and the residues responsible for also type II in E. coli. Amber suppressors are tRNAs the interaction with the area of the original mutation with anticodons altered to recognize an amber (UAG) in the tRNA. stop codon rather than the usual codons. Thus, The second approach involves an attempt to although the suppressors will insert leucine or tyrosine introduce novel amino acids into proteins at specific in response to an amber codon, all interactions with sites in vitro. The advantage of this system is that it the respective AASs will be the same. will allow us to specifically insert unusual amino acids Genes for the altered tRNAs will be constructed at a defined site within a protein. These amino acids using synthetic oligonucleotides. The extra loops will might be ones that do not exist in nature, or that are have the sequence AGGUC, a composite of all known spin labeled for NMR spectroscopy. In this procedure E. coli and phage T4 type I extra loops. Each gene will a cloned, alanine amber-suppressor tRNA is over be inserted into an E. coli vector and submitted to two expressed in E. coli and purified. In collaboration with tests. The first measures the tRNA activity regardless the laboratory of Sidney Hecht, the tRNA will be of the amino acid(s) being inserted in response to the chemically charged in vitro with the amino acid of amber codon; the second determines the exact choice. The novel, charged suppressor tRNA is then identities of the inserted amino acid(s). used in an in vitro rabbit reticulocyte transcription/ Completion of this experiment will provide us with translation extract to make protein from a gene of information on the effect of extra loop shortening in interest, in our case dihydrofolate reductase, which all the E. coli type II tRNAs. Through this we hope to contains an amber mutation at a specific position. We obtain a general picture of the role of this loop in have demonstrated the overexpression of the amber tRNA recognition. suppressor tRNA in E. coli and placed three E. coli dihydrofolate reductase genes, one wild type and two 1 Undergraduate, California Institute of Technology. with amber codons, at either amino acid 10 or 27 under 128 the control of the T7 phage promoter. Additionally, Support: The work described in the following research reports has been supported by: we have developed a coupled rabbit reticulocyte Biomedical Research Support Grant (NIH) transcription/translation system that specifically lstituto Veneta di Scienze, Lettere ed Arti-Fondazione Protti makes proteins from genes under the control of the T7 Italian Government Postdoctoral Fellowship promoter. Lucille P. Markey Charitable Trust National Institutes of Health, USPHS 1 Department of Chemistry, University of Virginia, The Procter & Gamble Co. Charlottesville, VA. The Rotary Foundation of Rotary International Grace C. Steele Professorship in Molecular Biology PUBLICATIONS Chang, T.-C., Clark, M. W., Lustig, A. J., Cusick, M. Summary: In the past year good progress has been E. and Abelson, J. (1988) RNAll protein associates with the yeast spliceosome and is localized in the made in the three main areas of research on the human periphery of the cell nucleus. Mal. Cell. Biol. 8, mitochondrial system in which our laboratory is 2379-2393. Cheng, S.-C. and Abelson, J. ( 1987) Spliceosome engaged: genetic manipulation of mitochondria, assembly in yeast. Genes & Dev. I, 1014-1027. mechanisms of mitochondrial gene expression, and Clark, M. W. and Abelson, J. (1987) Yeast tRNA ligase has a primary location at the inner membrane of nuclear control of mitochondriogenesis. the nuclear envelope. J. Cell Biol. 105, 1515-1526. The approach for mitochondria-mediated trans Ho, C. and Abelson, J. (1988) Testing for intron formation of mammalian cells previously developed in funct~n in the essential Saccharomyces cerevisiae tRNA;-;'gG gene. J. Mal. Biol. 202, 667-672. this laboratory has been extended to the successful KomatsoU11s, G. A., Westaway, S. K. and Abelson, J. ( 1987) Nucleotide sequence of ORF2: An open introduction into cells, by microinjection or cytoplast reading frame upstream of the tRNA ligase gene. fusion, of mitochondria without any selectable marker Nucleic Acids Res. 15, 9079. Masson, J.-M., Meuris, P., Grunstein, M., Abelson, J. in their DNA. This development has been made and Miller, J. (1987) Expressi5J\' of a set of possible by the isolation of human cell lines completely synthetic suppressor tRNA e genes in lacking mitochondrial DNA (mtDNA), obtained by Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 84, 6815-6819. long-term exposure of the parent cells to a low Reyes, V. and Abelson, J. (1987) A synthetic substrate for tRNA splicing. Anal. Biochem. 166, 90-106. concentration of ethidium bromide, a specific inhibitor Schulman L. H. and Abelson, J. ( 1988) Recent excite of mtDNA synthesis. These p 0 cell lines are ment in understanding transfer RNA identify. pyrimidine auxotrophs as well as pyruvate dependent, Science 240, 1591-1592. Tanner, N. K., Hanna, M. M. and Abelson, J. (1988) thus providing two valuable selectable markers for Crosslinking yeast tRNA ligase to bromouridine and thiouridine-incorporated precursor transfer mitochondria-mediated transformation. The possibility ribonucleic acid. Biochemistry, in press. of introducing any kind of human mitochondria into the Westaway, S. K., Phizicky, E. M. and Abelson, J. (1987) 0 Structure and function of the yeast tRNA ligase p cells opens exciting possibilities of discerning the gene. J. Biol. Chem. 263, 3171-3176. contributions of the mitochondrial and the nuclear Yamao, F. H., Inokuchi, H., Normanly, J., Abelson, h and Ozeki, H. (1988) Mischarging mutants of Su+ genomes as well as their reciprocal compatibility in glutamine tRNA in E. coli. Japan J. Genet. 63, the establishment of the respiratory competence of 251-258. mammalian cells. Furthermore, this approach will provide a powerful tool for the genetic analysis of mitochondrial diseases. In another context, the availability of human p 0 cell lines will allow an investigation of the changes in nuclear gene expression Professor: Giuseppe A ttardi induced by the lack of mtDNA. Visiting Associate: Serge Alziar i Senior Research Associate: Anne Chomyn In a related area, experiments have been started, in Research Fellows: Valeta A. Gregg, Michael P. King, collaboration with Dr. J. Sanford of Cornell Brigitte Kruse, Paola Loguercio Polosa, Nalini Narasimhan, Salil D. Patel, Giovanni Pauletti, University, with the purpose of extending to mar:n Ram Sharma Puranam, Cesare Rossi malian systems the ''biolistic" approach for intro Research and Laboratory Staff: Arger L. Drew, Dolores Guzman, Benneta T. Keeley, Rosina K. T. duction of DNA into mitochondria which has recently Kinzel, Susan Shu-Ai Tsai Lai, Lisette M. Teto been applied successfully to yeast. This approach 129 involves the use of a "gun" shooting tungsten particles 3'-untranslated region. cDNA clones for the 51 kDa coated with the DNA of interest into cells. The protein, the main catalytic subunit of the enzyme, successful development of this approach will open the have also been isolated. way to an experimental manipulation of mitochondrial A new area of interest which has emerged in our genes in vivo with important implication for the laboratory in the past year concerns the analysis of the dissection of the mechanisms of mtDNA expression molecular and genetic changes that occur in the so and replication. called "mitochondrial diseases." Molecular approaches, In the area of mtDNA transcription, strong efforts involving study of the synthesis and assembly of the are being pursued to identify the DNA sequences and enzyme complexes of the inner mitochondrial mem specific factors involved in the regulation of rRNA and brane and structural analysis of mtDNA, as well as mRNA synthesis in human mitochondria. In particular, genetic approaches using the mitochondria-mediated these studies aim at understanding the control of transformation discussed above, are being applied to initiation of transcription at the two sites detected in myoblast cultures derived from muscles of patients vivo on the heavy strand and the termination of the affected by mitochondrial encephalomyopathies. This rRNA gene transcription at the 3' end of the 165 rRNA work is expected to provide insights into the patho gene. Efficient in vitro transcription systems, genesis of these diseases, as well as a source of utilizing either a mitochondrial lysate programmed by valuable mutants, mitochondrial or nuclear, to be used exogenous mtDNA fragments or intact organelles, are to study problems related to mitochondrial enzyme being used in these studies. A search for DNA binding complex assembly. proteins able to interact with DNA sequences at or ln the other area of interest in our laboratory, near the critical transcription initiation and concerning the molecular mechanisms of drug-induced termination sites has been undertaken, using DNA gene amplication, the novel submicroscopic elements cellulose chromatography for the initial fractionation containing amplified genes for dihydrofolate reductase and assays based on gel retardation and footprinting. which have been detected by pulse-field gradient or An interesting development in the area of the control inversion field electrophoresis in some methotrexate of mitochondrial gene expression has been the identifi resistant human cell lines (Biology 1987, Abstract No. cation of a low molecular weight factor in the cyto 163), have been analyzed in their kinetics of plasm of HeLa cells which dramatically changes the appearance and in their stability in the absence of relative rates of synthesis of rRNA and mRNA in selective pressure. Particularly significant is the isolated human mitochondria by preferentially observation of an early appearance of these elements suppressing rRNA synthesis. The chemical nature of during the process of gene amplification, which points this factor as well as its mode of action, i.e., direct on to their possibly being precursors of the micro the transcriptional machinery or through a membrane scopically visible ''double minute" chromosomes. transducing phenomenon, are being investigated. The mitochondrial RNase P previously identified in HeLa 188. Regulation of Human Mitochondrial DNA Transcription In Vitro cells in this laboratory and which plays a crucial role in the processing of the polycistronic mtDNA tran N alini Narasimhan scripts has been purified extensively by a new We are investigating the regulation of initiation of approach, and its RNA and protein components are transcription of the rRNA genes and protein coding now being analyzed. genes and the termination of rRNA gene transcription The dissection of the genetic control of the at the 3' end of the 165 rRNA gene on the heavy strand respiratory chain NADH dehydrogenase has made rapid of human mitochondrial DNA. progress. The cDNA for the 24 kDa iron-sulfur subunit, Two distinct sites have been mapped in vivo for the first nuclear-encoded cDNA for this enzyme to be transcription initiation on the heavy strand. cloned, has been structurally analyzed. Particularly Transcription initiating at a site .... 20 nt upstream of interesting is the evidence that there are at least two the tRNA Phe gene terminates at the 3' end of the 165 mRNAs for this protein differing in the length of the rRNA gene and is responsible for the majority of the 130 rRNA synthesis. Transcription initiating at a second coding for the rRNAs and poly(A)-containing RNAs are site downstream from the first, near the 5' end of the in nearly every case contiguous at both ends to a tRNA 125 rRNA gene, continues beyond the 3' end of the 165 coding sequence. This genetic arrangement supports a rRNA gene to include the protein coding genes and model in which the heavy strand of mtDNA is tran most of the tRNA genes located on the heavy strand. scribed from either one of two promoters as a single The latter initiation site has not been active thus far polycistronic RNA. This transcript, punctuated by the in vitro in a soluble mitochondrial transcription tRNA sequences, is processed by precise endonucleo system. lytic cleavages to eventually yield the mature rRNAs, We are investigating various conditions for in vitro poly(A)-containing RNAs and tRNAs. According to the transcription to obtain transcription from this site. tRNA punctuation model of mitochondrial RNA The precise location of this site is being mapped in processing, the structure formed by the tRNA vitro. The regulatory factors/proteins involved in sequences provides the required recognition signal for controlling rRNA versus mRNA synthesis are being the processing enzyme(s) to cleave the primary characterized. transcripts. Substrate recognition by one of the mitochondrial RNA processing enzymes appears to be 189, Identification and Characterization of Human similar to that of E.coli RNase P, an enzyme that Mitochondrial Transcription and Replication generates the 5' termini of mature tRNAs by endo Factors nucleolytic cleavage at the appropriate sites in the Brigitte Kruse tRNA gene transcripts. The human mitochondrial genome is relatively Earlier work in this laboratory (Doersen et al., small, and its gene organization is extremely compact. 1985) has shown the presence of a ribonuclease P-like Both mtDNA strands are completely transcribed. activity in Hela cell mitochondria. This enzyme has There are several lines of evidence indicating that, been shown to process a precursor to E. coli suppressor in addition to the RNA polymerase, other DNA-binding tRNA Tyr at the same site as the E.coli RNase P, proteins are involved in transcription of mtDNA. producing the 5' end of the mature tRNA Tyr. This At present, we are investigating protein inter enzyme has RNA and protein components, which are actions with relevant mitochondrial DNA sequences. necessary for its function, as judged by the sensitivity We are purifyin!; DNA-binding proteins using DNA of its activity to micrococcal nuclease and pronase cellulose chromatography as a primary enrichment treatment, respectively. step. The different fractions are analyzed by gel A major problem in purifying the mitochondrial retardation assays using small fragments of mtDNA RNase P is its separation from the cytoplasmic RNase with putative protein binding sites. In addition, we are P and the nonspecific nucleases. To circumvent the trying to identify these binding sites by "footprinting" above problem we devised a new approach that gives a either with the partially purified fractions or with a 1000-fold purification of the mitochondrial enzyme. crude 5100 mitochondrial lysate. This protedure involves the preparation of mitoplasts Further purification of mitochondrial DNA-binding by digitonin treatment of mitochondria and the use of proteins will involve affinity chromatography with sequential chromatography through DEAE-Cellulose, chemically synthesized oligonucleotides corresponding DEAE-5epharose, Mono-5 and Mono-Q columns. The to the protein binding site. Finally, functional tests on enzyme obtained from the Mono-Q column, when sedi the purified protein will be carried out in an in vitro mented on a glycerol gradient, gives a highly purified transcription system that has been developed in this active fraction that is presently being used to identify laboratory. the RNA and protein components of the mitochondrial RNase P. 190. Characterization of RNase P from HeLa Cell Reference: Mitochondria Doersen, C. J., Takada, C. G., Altman, S. and Attardi, G. (1985) J. Biol. Chem. 260, 5942-5949. Ram S. Puranam Regions of the heavy strand of mitochondrial DNA ur 191. Transcriptional Control in Human Mitochondria greatly stimulates the synthesis of mitochondrial DNA-encoded proteins, this stimulation being very Cesare Rossi, George Gaines 1 sensitive to low concentrations of proteinase K. The Both strands of the human mitochondrial genome site of protein synthesis in this reconstituted system, are transcribed, and one of them (the heavy strand) as well as the role of the electrochemical gradient, are contains two overlapping transcription units, one for now being investigated. We are also presently testing the rRNAs and the other for most of the mRNAs and the translation in this system of the mRNA synthe tRNAs. sized in vitro from a modified gene for subunit II of We have found that cytoplasmic extracts from cytochrome c oxidase, which we have constructed by HeLa cells are able to change dramatically the fusion of a synthetic oligonucleotide and a restriction proportion of synthesis of rRNA relative to mRNA fragment containing most of the gene and inserted into when tested with an in vitro system using isolated mitochondria, previously developed in this laboratory a pGEM plasmid. (Biology 19&6, Abstract No. 20). This effect is at the level of transcription and is mediated by a small 193. Mitochondrial Gene Expression in Rat Brain Synaptosomes During Development and molecular weight (~ 1 kDa) factor(s). The factor(s) is Senescence heat resistant and is not destroyed by mild treatment Paola Loguercio Polosa with alkali or acids, is not extracted by organic solvents, and is not sensitive to treatment with Recent advances in the study of mitochondrial DNA informational content and transcriptional and proteases or nucleases. We have obtained active fractions after chroma translational events provide the basis for investigating the regulation of mitochondrial gene expression. tography of cytoplasmic extracts on phosphocellulose In previous work from this laboratory (England and columns, and we are now trying to assess if the Attardi, 1976), measurements of the incorporation of differential effect on the two transcription units can 3H-uridine into mitochondrial RNA in partially be attributed to an inorganic salt(s) or to an organic purified rat brain synaptosomes had revealed a fivefold molecule. decrease in 30-day-old rats as compared to 10-day-old 1 Argonne National Laboratory, Argonne, IL. rats. We intend to pursue the study of the effect of development and senescence on organelle-specific 192. Submitochondrial Translation System from protein and RNA synthesis in synaptic mitochondria, HeLa Cells because of their critical role in synaptic function. Serge Alziari For the purpose of this project, we are trying to With the aim of studying the mechanism and purify further the rat brain synaptosomal fraction by regulation of mitochondrial protein synthesis in testing different kinds of gradients (discontinuous mammalian cells, we are trying to develop a dextran/sucrose and continuous Percell/sucrose homologous submitochondrial protein synthesizing gradients). Our aim is to obtain synaptosomes that are system from HeLa cells capable of translating metabolically active and at the same time sufficiently exogenous mitochondrial mRNAs. free from other membrane contaminants. The purified By brief ultrasonic treatment of mitochondria, we synaptosomal fraction will be incubated in an can obtain submitochondrial particles that, in the appropriate medium containing 35s-methionine and presence of ATP, are capable of synthesizing proteins emetine, and the proteins will then be analyzed by slab whose electrophoretic profile is identical to that gel electrophoresis. To assess the contamination of obtained with the products of intact mitochondria. the synaptosomal fraction by free mitochondria, we The proteins synthesized under these conditions are to plan to measure the rate of protein synthesis in the a great extent resistant to proteinase K, as the presence or absence of ATP, since only protein proteins synthesized in intact mitochondria. This synthesis by free mitochondria would be expected to synthesis is presumably due to "inside-in" particles. be stimulated by exogenous ATP. We will then analyze Addition of mitochondrial matrix to this system the rate of synthesis of the mitochondrial translation 132 products in synaptosomes from brains of rats of shown to be mitochondrially encoded, and a further six different ages. The steady-state levels of the various iron-sulfur proteins of the enzyme demonstrated to be mitochondrial mRNAs will also be measured and will of a nuclear origin (Chomyn et al., l 985, l 986). be correlated with the protein synthesis capacity. Photoaffinity labeling analysis utilizing an NADH analog previously revealed one of these iron-sulfur Reference: England, J, M. and Attardi, G. (1976) J. Neurochem. proteins (51 kDa subunit) to contain the substrate 27, 895-906. binding site, and the association of the FMN prosthetic group with this subunit has also been inferred from 194. Isolation of cDNA Clones Encoding the other observations. Our aim is to clone and 24 kDa Subunit of NADH Dehydrogenase characterize the gene encoding this functionally Anne Chomyn important 51 kDa subunit. Antibodies raised to the The rotenone-sensitive NADH dehydrogenase, the bovine heart 51 kDa protein have been used to screen a first enzyme complex of the respiratory chain of the J.gtl l bovine heart cDNA library and clones have been inner mitochondrial membrane, is made up of 25 obtained. The sequence of short segments of the beef subunits, seven of which are encoded in mitochondrial heart protein is also being determined (in collaboration DNA. The remaining subunits are nuclear gene with Ruedi Aebersold and Stephen Kent) and corre products which are imported into mitochondria. To sponding oligonucleotides will be used to screen a study the regulation of assembly of this complex, we J.gtlO bovine brain cDNA library. In addition to have begun to isolate cDNA clones representing the providing data on the structure of this subunit, the various subunits. sequence of the cDNA clones should yield interesting We have already isolated cDNA clones for the 24 information regarding the existence and structure of a kDa subunit, one of the three subunits of the catalytic pre-sequence for the import of the subunit into core of the enzyme, from a bovine brain AgtlO library mitochondria. Moreover, the clones will provide a (gift of Ryn Miake-Lye). Two types of messenger RNA potentially useful genetic probe to study the so-called are represented by the clones we have isolated: these mitochondrial myopathies, many of which appear to be differ only in the length of the 3' untranslated region. due to lesions in the respiratory chain at the level of Our clones do not include sequences representing the 5' NADH dehydrogenase. end of the mRNA. Efforts are under way to isolate References: clones containing these sequences. Chomyn, A., Cleeter, M. W. J., Ragan, C. I., Riley, M., Doolittle, R. F. and Attardi, G. (l 986) Science 234, 614-618. Chomyn, A., Mariottini, P., Cleeter, M. W. J., Ragan, .195. Cloning of the Bovine cDNA(s) that Encode(s) C. I., Matsuno-Yagi, A., Hatefi, Y., Doolittle, R. F. the 51 kDa Subunit of NADH Dehydrogenase and Attardi, G. (!985) Nature 314, 592-597. Salil D. Patel NADH dehydrogenase is the first enzyme in the 196. Introduction of Mitochondria Into Normal and mtDNA-less (p 0 ) Human Cell Lines respiratory chain of the inner mitochondrial mem brane. Analysis of the enzyme, as isolated from beef Michael P. King heart, reveals a complex enzyme composed of up to 2.5 As an approach to simplify the analysis of the ;ubunits in the molecular weight range of 6-75 kDa. In molecular genetics of mammalian mitochondria, a addition, the enzyme contains an FMN prosthetic procedure was developed whereby intact, isolated group and a multiplicity of iron-sulfur centers. mitochondria are introduced into the cytoplasm of Recently, antisera raised to the holoenzyme and to recipient cells and selectively propagated within these its many functionally important subunits have been cells. Initially, genetically marked mitochondria were utilized in immunoprecipitation experiments with used in these experiments. In particular, isolated HeLa cells labeled with 35s-methionine in the human mitochondria containing a mitochondrial DNA presence or absence of mitochondrial or cytoplasmic (mtDNAl-coded chloramphenicol resistance marker protein synthesis inhibitors. By this means, seven were injected at an average dose of less than one into subunits of the HeLa cell NADH dehydrogenase were cells from two different human sensitive cell lines, 133 143BTK- and HTl080-6TG, which had been partially the transfer of functional mitochondria from several depleted of their mtDNA by ethidium bromide treat human cell lines. Large numbers of human mito ment. Under selective conditions, the mitochondria chondria were transferred into these cells by the became established in the recipient cells with a fusion of p 0 cells with cytoplasts (enucleated cells) frequency greater than 2 to 3 x 10-3. An analysis of from the HTIO&O cell line. Transformants were multiple mtDNA and nuclear DNA polymorphisms selected by their growth in the absence of uridine or revealed a rapid replacement of the resident mtDNA pyruvate. Other transformants have been obtained by by the exogenous mtDNA. By 6-10 weeks after micro injection of mitochondria isolated from two other injection, this replacement was complete in all but one human cell lines, Hela and CAP23, into 143BU206 of the HTI0&0-6TG transformants and near-complete cells. These transformants were selected by their in the majority of the 143BTK- transformants. The growth in the absence of uridine. The analysis of quantitative behavior of the mtDNA of the trans several mtDNA and nuclear DNA RFLPs has confirmed formants at very early stages of selection strongly the mitochondrial and nuclear origin of these suggests that intracellular mtDNA selection played a transformants. The biochemical properties of these crucial role in this replacement. transformants, including cytochrome c oxidase In order to eliminate the requirement for a selec activity, oxygen consumption and mtDNA content, are table marker, two human cell lines that completely being analyzed and compared with those of the lack mtDNA have been isolated. In particular, two parental cell lines. Other experiments are in progress independent cultures of the human cell line 143BTK in which mitochondria from muscle cell cultures were grown for an extended period of time in the derived from patients exhibiting various mitochondrial presence of ethidium bromide, a specific inhibitor of myopathies are being transferred into 143BU206 cells. mtDNA replication, and uridine. The analysis of the Since mitochondrial myopathies can be· due to defects two independent derivatives of 143BTK- cells isolated of either the nuclear or mitochondrial genome, the in this manner (designated 143BUIOI and l43BU206), biochemical analysis of these transformants should after removal of ethidium bromide, has shown that clarify what the contribution of the mitochondrial they contain no detectable mtDNA. ln addition, they genome is to the deficiencies found in these patients. are completely dependent upon both uridine and pyruvate for cell growth. These phenotypes have been 197. Involvement of mtDNA in Mitochondrial maintained in the two cell lines after one year in Encephalomyopathies culture. The uridine dependence occurs because Anne Chamyn dihydrooratate dehydrogenase, an integral membrane A class of muscle and nerve pathologies has its protein of the mitochondrial inner membrane, is etiology in deficiencies in mitochondrial function. dependent upon mitochondrial electron transport for Lesions in fatty acid metabolism and in the respiratory. its enzymatic activity.. The absence of electron chain have been described, but not yet analyzed at the transport caused by the lack of mitochondrial gene genetic level, except for one group of patients. Holt products in the po lines blocks the activity of et al. ( 19&&) have described large deletions in a portion dihydrooratate dehydrogenase and thus blocks de nova of the mtDNAs from muscle tissue of several patients pyrimidine biosynthesis. The biochemical basis for the suffering from mitochondrial myopathies. pyruvate dependence of these lines is being I am developing an approach using in vivo labeling investigated. Experiments in which the uptake of the of mitochondrially and cytoplasmically synthesized mitochondria-specific cationic dye rhodamine 123 has mitochondrial proteins in myoblast cultures from been visualized by UV microscopy and quantitated by patients with a suspected "mitochondrial" disease, in flow cytometry have revealed that the o0 cell lines particular those patients whose muscle tissues exhibit have a normal complement of mitochondria and that decreased respiratory chain enzyme activity, to these have the membrane potential required for the determine whether in these patients' mitochondrial uptake of the dye. protein synthesis or assembly of enzyme complexes of The p 0 cell lines have been used as recipients for the inner membrane is affected. We have available 1J4 many molecular probes, including cloned DNAs and correlation exists between the appearance of these specific antisera, that will aid us in localizing the submicroscopic amplicons and that of DMs in the !OBJ genetic lesion in these patients. line. Another aspect of this project is the study of the topology of these elements. To this end, controlled Reference: Holt, I. J., Harding, A. E. and Morgan-Hughes, J. A. exonuclease digestion and partial digestion with (1988) Nature 331, 717-719. octanucleotide-recognizing restriction endonucleases are being employed to discriminate between a super 198. Extrachromosomal Amplicons in coiled and a linear configuration of the two types of Methotrexate-Resistant HeLa Cells submicroscopic elements present in l 083 cells. Giovanni Pauletti, Eric H. C. Lai Reference: Extrachromosomal submicroscopic elements Maurer, B. J., Lai, E., Hamkalo, B. A., Hood, L. and Attardi, G. (1987) Nature 327, 4J4-4J7. bearing amplified genes have come to occupy an important role in studies of gene amplification in et.ikaryotic cells. In fact, besides being a novel PUBLICATIONS manifestation of this process, they may represent a Attardi, G. (1987) The elucidation of the human useful tool for unravelling the mechanism that leads to mitochondrial genome. In: Advances in the amplification of DNA segments in the chromosome Myochemistry, Benzi, G. (Ed.), John Libbey Eurotext Ltd., pp. 151-171. itself. Furthermore, they may constitute the "missing Attardi, G., Chomyn, A. and Mariottini, P. (1986) The link" between intrachromosomal amplification and the functions of the proteins encoded in human mitochondrial DNA. 7th lntemational Congress of previously recognized extrachromosomal manifestation lfuman Genetics, Vogel, F. and Sperling, K. (Eds.), of gene amplification, namely "double minute Springer Verlag, Berlin, pp. 165-176. A ttardi, G. and Schatz, G. (1988) The biogenesis of chromosomes" (DMs). Sucrose gradient fractionation mitochondria. Ann. Rev. Cell Biol., in press. and experiments of field inversion and pulse-field gel Chomyn, A. and Attardi, G. (1987) Heterogeneous efficiencies of mRNA translation in human electrophoresis have allowed the detection of extra mitochondria. ln: Cytochrome Systems: Molecular chromosomal submicroscopic amplicons of the dihydro Biology and Bioenergetics, Papa, S., Chance, B. and Ernster, L. (Eds.), Plenum Press, New York, pp. folate reductase gene (DHFR) in some methotrexate 145-152. (MTX)-resistant variants of the human cell lines HeLa Chomyn, A., Patel, S. D., Cleeter, M. W. J., Ragan, C. I. and A ttardi, G. (1988) The site of synthesis of the Bu25 and VArB (Maurer et al., 1987). Among them, iron-sulfur subunits of the flavoprotein and iron the HeLa Bu25 !OBJ line, a clone that does not contain protein fractions of human NADH dehydrogenase. J. Biol. Chem., in press. any homogeneously staining region and only a small Chomyn, A. and Attardi, G. 0987) Mitochondrial gene average number of DMs per cell, has been chosen for a products. Current Topics in Bioenergetics 15, 295- J29. quantitative analysis of the kinetics of appearance of Houldsworth, J. and Attardi, G. (1988) Two distinct these extrachromosomal DNA molecules at various genes for ADP/ATP translocase are expressed at the mRNA level in adult human liver. Proc. Natl. time points corresponding to increasing selective Acad. Sci. USA 85, J77-J81. pressure. At the same time, the stability of these Kim, J., Yang, J, S. and Attardi, G. (1988) Growth phase and tissue-specific variations in steady state elements after removal of MTX has been investigated. levels of individual mouse dihydrofolate reductase Preliminary data from Southern blot and dot blot mRNAs. Submitted for publication. King, M. and Attardi, G. (1988) Injection of mito analyses indicate a parallel increase in the number of chondria into human cells leads to a rapid replace the chromosomally located DHFR genes and those ment of the endogenous mitochondrial DNA. Cell 52, 811-819. present in the two types of extrachromosomal DNA Novitski, C. E. and Attardi, G. (1988) The rate of elements resolved by field inversion gel electro mitochondrial DNA replication shows a cell cycle dependence in mouse L cells. Submitted for phoresis (FIGE), the most abundant of them being -650 publication. kb in size. Furthermore, the kinetics of loss of these elements in absence of selective pressure is significantly slower than predicted by simple dilution of non-replicating molecules. At present, a cyto genetic analysis is being carried out to ascertain if any 135 Associate Professor of Chemistry & Biology: Judith L. library using the antibodies as probes. The first gene Campbell isolated was that of DNA polymerase a. This was an Senior Research Fellow: L. Elizabeth Bertani Research Fellows: Martin Budd, Colin Gordon, obvious choice, because it was not known when we Etienne-Pascal Journet, Peter R. Rhode, Rati began our work which of the four cellular DNA poly Verma, Karen Sitney 1 1 Graduate Students: Doreen Ma , Kevin S. Sweder , merases were required for replication. Gene disruption 1 1 Stephen Mayo , Hyejoo Yoon experiments indicate that polymerase I is essential for Research and Laboratory Staff: Don Derwin replication. During the past year we have isolated a 1Division of Chemistry and Chemical Engineering, battery of temperature-sensitive mutations in this California Institute of Technology. gene and have further explored the role of DNA polymerase I in the cell. We have also used the Support: The work described in the following research reports has been supported by: mutants to initiate studies of the role of a second DNA American Cancer Society polymerase, DNA polymerase II, in DNA replication. Centre National de la Recherche Scientifique March of Dimes New evidence suggests that this polymerase is involved National Institutes of Health, USPHS in replication in addition to DNA polymerase a. National Science Foundation Office of Naval Research and Defense Advanced As to the initial events in recognition of an origin Research Projects Agency of replication, we have extended our studies of the autonomously replicating sequence ARSI and of other Summary: Our laboratory is interested in the ARSs. We have identified three proteins that bind to regulation of replication of eukaryotic chromosomes. yeast ARSI. Two of these proteins bind to a site found Our studies use yeast because the small genome size at some but not all ARSs, mutations that reduce but do allows isolation of the DNA sequences essential for not abolish ARS function. The third protein binds to a such regulation and since all aspects of macro second consensus sequence, in which point mutations molecular synthesis are otherwise typical of all completely abolish ARS function. We have prepared eukaryotes. There are two levels of the regulation of antibody to one of these proteins and are instituting replication in eukaryotes. First, since replication the nreverse genetics" approach, described above for occurs only during a portion of the cell cycle, namely polymerases and SSBs, to these ARS binding proteins. S phase, there must be specific events controlling the The availability of these proteins should not only transition into S phase. At this cell cycle level, we improve the efficiency of in vitro replication systems, would like to establish the molecular basis for entry but isolation of the genes encoding these proteins into S phase. We are using various cell division, cdc, should yield important mutants in the regulatory mutants blocked at the beginning of S phase in order to aspects of yeast DNA replication. do this. The second level of control occurs within Another project has focused on the prokaryotic S phase. At this point, regulation is mediated at the model of DNA replication. The dnaA protein of E. coli level of initiation of replication within specific is analogous to the yeast ARS-specific proteins in that replicons, presumably involving specific protein-DNA it binds to the E. coli origin of replication and and protein-protein interactions at origins of DNA facilitates initiation there. We have studied the replication. Our approach to these problems is a initiation of plasmid replication in bacteria and are combined genetic and biochemical one that we call now investigating the role of the dnaA protein in that "reverse genetics." system (Conrad and Campbell, 1979). This offers a In the past we have used in vitro replication paradigm for the yeast work and is an interesting systems to identify the proteins involved in replication regulatory system in which a small RNA molecule and to demonstrate that ARS sequences are specific serves as a negative regulator of initiation through its origins of replication (Celniker and Campbell, 1982). action as an anti-sense inhibitor. Amplification of Recently, we have purified several proteins by bio genes within the E. coli chromosome is also being chemical assay that are thought to be involved in studied. replication. We have made antibody and cloned the Finally, we have instituted a program of in vitro corresponding genes by screening an expression vector mutagenesis of an unrelated protein, yeast iso-1- 136 cytochrome c, in collaboration with some of our binding studies and DNase I footprinting show that the colleagues in the Division of Chemistry. protein binds to a sequence about 80 bp away from the core consensus in domain B. To further investigate References: Celniker, S. E. and Campbell, J. L. (1982) Cell 31, whether the protein might have a function related to 201-213. the ability of ARSs to act as replicators, binding to Conrad, S. E. and Campbell, J. L. (!979) Cell 18, 61-71. another ARS was tested. The protein binds to the functional ARS adjacent to the silent mating type locus HMR, called the HMR-E ARS, about 60 bp from 199. Yeast DNA Replication Origins the core consensus sequence. Surprisingly, there is Kevin S. Sweder, Peter R. Rhode, Judith L. Campbell little homology between the binding site at the HMR-E Autonomously replicating sequences, or ARSs, act ARS and the binding site at ARSl. The 135 kDa protein as origins of replications in the yeast Saccharomyces has been designated ABF-I. There are approximately cerevisiae. Based on prokaryotic systems, it is 500 copies of ABF-I per cell. reasonable to assume that there exist proteins that A second DNA binding protein was separated from bind to specific DNA sequences in ARSs and initiate or ABF-I during later stages of the purification. This regulate DNA replication. We are using a combined protein, which we designate ABF-lll, also binds genetic and biochemical approach to characterize such specifically to the ARSl sequence, as shown by proteins and their roles in yeast DNA replication. DNase I footprinting, at a site adjacent to the ABF-I The ARSl sequence has been dissected using Bal3 l recognition site. Purification of these two ARS mapping (Celniker et al., 1984) and shown to consist of binding proteins should aid in our understanding of the three functional domains, which we have designated A, complex mechanisms that regulate eukaryotic DNA B, and C. Domain A consists of an II-base-pair (bp) replication. consensus sequence required for ARS activity on Antibody to ABF-l is currently being raised and will centromeric plasmids (Srienc et al., 1985). Domain B be used to screen a yeast DNA expression library in immediately flanks domain A and is between 46-109 order to isolate the gene encoding this protein. bp. Domain B also contains an 11-bp sequence con References: served at some ARSs, 88 bp 3' to the domain A Celniker, S., Sweder, K., Srienc, F., Bailey, J. and Campbell, J. (1984) Mo!. Cell. Biol. 4, 2455-2466. consensus.. Deletion of domain B drastically reduces Srienc, F., Bailey, J. and Campbell, J. (1985) Mal. Cell. the stability of the plasmids. Domain C, about 200 bp Biol. 5, 1676-1684. in size, flanks domain A on the opposite side from domain B. Outside of the consensus region, domains B 200. DNA Polymerase a Is Required For Mitotic and and C show little homology between different ARSs. Meiotic Replication But Not For DNA Repair in Our model for the function of the domains within Saccharomyces cerevisiae ARSl is that domain A is a protein recognition site Martin Budd crucial for DNA replication, analogous to the 9 bp Recently, a set of seven temperature-sensitive dnaA protein-binding site of E. coli, and the sites mutants in the DNA polymerase gene of recognized by the 0 protein of ). phage, the T antigen Saccharomyces cerevisiae has been isolated. To of SV40. Domain B may contain sequences required determine the in vivo roles of DNA polymerase I, the for proper temporal initiation during S phase, for yeast analog of mammalian DNA polymerase a, a transcriptional activation or for proper segregation. mutant containing the poll-17 allele, has been Deletions in domain C have been shown to affect characterized by examining mitotic DNA replication, stability of centromeric plasmids but its function sporulation, meiotic DNA replication, meiotic remains unknown. recombination and repair of X-ray-induced damage at Two proteins that bind to yeast ARS DNA have the nonpermissive temperature. The poll-17 mutant been purified using conventional and oligonucleotide blocks all chromosomal DNA replication immediately affinity chromatography. One has been purified to upon shift of a vegetatively growing culture to the homogeneity and has a mass of 135 kDa. Competitive nonpermissive temperature, as shown by velocity 137 sedimentation. Sporulation is also blocked by the polymerase accessory factors may bind the column as lXJll-17 mutation and results are consistent with a a complex in less stringent conditions than those used block in premeiotic DNA replication. An unexpected in the purification. finding is that fluorescence of acriflavin-stained DNA increases about 100-fold after sporulation. A 202. Purification of DNA Polymerase II From Yeast fluorescence change of this magnitude must be due to Martin Budd, Karen Sitney factors other than changes in chromosome content DNA polymerase [[ has been purified to near from 2N to 4N. Commitment to meiotic recombination homogeneity from a polymerase I-deficient mutant is severely defective. Consequently, neither DNA (po!l-17) previously isolated in this laboratory (Budd polymerase II nor III can compensate for the absence and Campbell, 1987). No DNA polymerase I activity is of DNA polymerase I in mitotic DNA replication and detectable in the mutant. meiosis. However, repair of X-ray-induced single Earlier efforts to purify this enzyme have resulted strand breaks is not defective in the poll-17 mutants. in less pure and less stable preparations, making Thus, DNA polymerase II and/or III presumably carry analysis of the polypeptide structure and physical out repair in the absence of polymerase I. properties of this enzyme difficult~ However, our finding that polymerase [[ is especially active on the 201. lmmunoaffinity Purification of Yeast DNA synthetic template poly dA500-dT 10, DTT, that Polymerase-Primase Complex concentrations of 30 mM more required for stability, Karen Sitney, Colin Gordon and the identification of at least two factors that A column containing an immunoadsorbent resin stimulate purified pol [[ have facilitated purification. prepared by coupling a monoclonal antibody against This enzyme differs from pol I in several ways. yeast DNA polymerase I to protein A Sepharose has Polymerase I is much less active on poly dA-oligo dT been used to purify the polymerase 1-primase complex than on activated DNA, while the opposite is true for to homogeneity in a single step. This procedure pol U. Polymerase [[ is resistant to N2(p-n minimizes handling of the protein, avoiding much of butylphenyl) 2'deoxyguansine-5'-triphosphate at the proteolysis inherent in multi-step procedures. concentrations that inhibit pol I. Pol H also copurifies We have used this column to partially characterize with a 3'-5' exonuclease activity. a polymerase lacking the first 113 amino acids of the Activity gels show that the ·minimum size of the total 1%8. This deletion has been fused to the DNA polymerase U polypeptide is about 180 kDa. inducible GALlO promoter, allowing up to 100-fold Bands are also seen at 130 kDa and 110 kDa. However, overexpression in strains grown on galactose medium. these are most likely active proteolytic fragments. The plasmid complements temperature-sensitive poll The only major brand on a silver stained gel from mutation, yielding transformants with growth rates purified preparation of polymerase [[ is 130 kDa and identical to non-mutant strains. The truncated the molecular weight determined by sedimentation polymerase appears wild-type in all aspects examined; through glycerol gradients is 130-140 kDa. polymerase activity, drug sensitivities, template On hydroxylapatite, two distinct peaks of DNA preference and chromatographic properties are polymerase activity are observed. One activity elutes normal. Interaction with primase does not appear to at 0.075 M phosphate and the other elutes at 0.35 M be compromised, as the two polypeptides bind the resin phosphate. The high salt activity has not been as a complex, with relatively high salt required to observed previously. It copurifies with pol II in all our elute the primase separately. Polyclonal antibodies are other chromatographic procedures and has very similar being prepared to both proteins as reagents for properties in terms of drug sensitivities, associated studying changes in their levels throughout the mitotic exonuclease, and size. We are currently preparing cell cycle. monoclonal antibodies against each protein in order to It should be possible to use the immunoaffinity establish whether they are two forms of the same column to look for other proteins that associate with enzyme or are distinct, and with the eventual goal of polymerase. Helicases, initiator proteins or other cloning the gene(s). 138 We are further characterizing the aforementioned Herpes DNA polymerase gene. Sequence analysis of stimulatory activities. One of these factors does not several of these mutants confirms that they alJ contain bind to phosphocellulose while the other binds to P-cell single amino acid substitutions within conserved but not to DEAE. These may be analogous to regions, called II, III, and V, which are proposed to mammalian polymerase o accessory factors such as constitute the functional active site required for PCNA, which also fails to bind to P-cell. deoxynucleotide interaction. We wished to isolate similar mutants of a cellular Reference: Budd, M. and Campbell, J. L. (l 987) Proc. Natl. Acad. DNA polymerase, yeast DNA polymerase 1, and con Sci. USA 84, 2838-2842. firm the predictions of sequence conservation. It was first necessary to manipulate the yeast to use various 203. Cell Cycle Regulation of the DNA nucleoside, nucleotide, and pyrophosphate analogs. Polymerase I Gene Both the permeability barrier and the fact that yeast Colin Gordon contains no thymidine kinase had to be dealt with. A Replication of DNA occurs during a discrete strain was obtained from Sclafani and Fangman (1986) period, termed S phase, in all eukaryotic cell cycles. that is able to grow on low concentrations of In S. cerevisiae, there are several examples of genes exogenous thymidine (TdR), 2 µg/ml. This strain required for S phase showing cell cycle regulation. contains a tut mutation and is auxotrophic for dTMP or The histone genes, CDC9 (encoding DNA ligase) and TdR owing to a mutation in TMPl gene, encoding CDC21 (thymidylate synthetase), are all cell cycle thymidylate synthetase, thus reducing endogenous TTP regulated. The gene coding for DNA polymerase I was pools. The strain also carries a high copy number recently cloned in this laboratory and because it is plasmid containing an active TK (thymidine kinase) intimately involved in DNA replication, it would seem gene from the Herpes simplex virus, allowing an ideal candidate to be periodically expressed during exogenous TdR to be converted to dTMP and then the cell cycle. enter the de novo pathway of dTTP formation. We To test this possibility, RNA was obtained from then constructed a pollts derivative of this strain. synchronous cultures prepared size selection from an The plasmid pBM150-264, carrying the POLI gene, elutriating rotor and subjected to Northern blot was used as the target for DNA polymerase mutations. analysis using the cloned DNA polymerase I gene as a pBM150-264 was treated with hydroxylamine and then probe. These studies showed that the POLI transcript used to transform the appropriate strain. URA+ was cell cycle regulated reaching a peak during late transformants arising at 23°C were replica plated onto Gl. To determine the cis-acting sequences involved in medium containing the nucleoside analog, ara T, or the this regulation, deletion analysis of POLI promoter is pyrophosphate analog, phosphonoacetic acid and being carried out using Zaz fusion strategies. screened for growth at 37°C. Incubation at 37°C eliminated the temperature-sensitive polymerase and 204. Isolation of Yeast DNA Polymerase I Mutants left the plasmid pBMl 50-264 as the only source for a Resistant to Nucleoside/Pyrophosphate Analogs functional polymerase I. Of 375 transformants Doreen Ma screened, one was resistant to araT. We are at present The gene encoding yeast DNA polymerase I was screening for more mutants and characterizing the isolated in our lab by screening a >.gt! 1 yeast library initial araTR mutant. DNA sequencing of the and has been shown to be a single copy essential gene mutations should allow functional identification of the by gene disruptions (Johnson et al., 1985). Recently, nucleoside recognition site. the gene has been sequenced and analyzed by Wong et References: al. (1988) revealing six regions of striking similarity to Johnson, L. M., Snyder, M., Chang, L. M. S., Davis, R. human DNA polymerase a and other eukaryotic DNA W. and Campbell, J. L. (1985) Cel! 43, 369-377. Sclafani, R. A. and Fangman, W. L. (1986) Genetics polymerases. Mutations of Herpes simplex virus 114, 753-767. conferring altered anti-viral drug sensitivity have been Wong, S. W., Wahl, A. F., Yuan, P. M., Arai, N., Pearson, B. E., Arai, K. I., Korn, D., Hunkapiller, mapped to se1eral of the conserved regions of the M. W. and Wang, T. S. F. (1988) EMBO J. 7, 37-47. 139 205. ht Vitro Initiation of DNA Replication of the C DC7 gene shows strong homology to conserved Etienne-Pascal Joumet sequences in many protein kinases (Patterson et al., Our goal is to design an in vitro replication system 1986). Whatever the function of CDC7 is, it must be from Saccharomyces cerevisiae that would perform of importance in the control of the cell division cycle efficient replication on ARS bearing plasmids. and/or in the mechanism of yeast DNA replication. Basically, the components are: a protein extract from Because of the low background of protein phosphoryl rapidly dividing cells, on DNA template carrying an ation in Escherichia coli and the unique properties of ARS sequence, and possibly, additional purified factors prokaryotic protein kinases, we introduced the C DC7 gene into E. coli to characterize its putative protein that would highly improve the efficiency of the in vitro system, playing a role comparable to large T kinase activity. An in vitro autophosphorylation assay antigen in the SV40 system. Working with yeast, the and other protein kinase assays showed that E. coli assembly of the replication complex at the initiation contained an endogenous autophosphorylatable protein site seems to be also a critical step (Celniker and of the same molecular weight as the CDC7 protein. Campbell, 1982). The recent purification of several We therefore tried to purify the CDC7 protein before ARS-binding factors in our laboratory gives an oppor assessing its activity and succeeded in its partial puri tunity to trigger efficient initiation of replication by fication by using its own radioactive form as a probe. reconstitution experiments. The T7 expression system described by Tabor and Two approaches have been tried: 1) preparation of Richardson (1985) was used to clone the C DC7 gene in DNA-free protein extracts from cystolic and nuclear E. coli. In this system, the CDC7 protein represented fractions obtained with a new gentle method of yeast the major band on SDS-polyacrylamide gels when the 35 spheroplast function; 2) preparation of semipermeable E. coli cells were labeled with s-Met in the presence cells, where membranous systems have been of rifampicin. However, the high-temperature permeabilized for the diffusion of proteins, while the induction did not work and the CDC7 protein was not general cellular structure remains intact. The produced at high levels in the T7 system. replication intermediates, obtained in significant The gene was recloned into the tac expression amounts, are being currently characterized. system and was overexpressed in E. coli after IPTG induction. The CDC7 protein, however, was obtained Once obtained, this in vitro system should yield very valuable information about the various proteins as an insoluble fraction of the whole cell lysate. To required in the initiation of replication, allowing a dissolve the protein, a high concentration of urea was step-by-step reduction of the protein extracts to a set used. After chromatographies on DEAE cellulose and of purified proteins. The biological role of the ARS phosphocellulose, those fractions containing the CDC7 binding factors and the unknown products of several protein were loaded on SDS-polyacrylamide gels, CDC genes could be also determined. visualized by CBB staining, and pooled to immunize two rabbits. Antipeptide antibodies raised against the Reference: last eight amino acids of CDC7 reacted with several Celniker, S. E. and Campbell, J. L. (i 982) Cell 31, 201-213. proteins in yeast extracts. The renatured protein showed no protein kinase activity. CDC7 may not be 206. Studies in the CDC? Protein of Yeast functional in E. coli because the primary translation Hye-Joo Yoon product requires modification by other proteins of The cdc7 mutation of Saccharomyces cerevisiae yeast to be activated and/or substrate proteins of arrests cells at the late Gl/S phase, just prior to the CDC7 are absent in E. coli. Experiments are under initiation of mitotic DNA synthesis (Hereford and way to overproduce CDC7 in yeast and characterize Hartwell, 1974). Although protein synthesis is required its enzyme activity. for initiation of DNA replication in wild-type cells, References: reciprocal shift experiments show that after CDC7 has Hereford, L. M. and Hartwell, L. H. (1974) J. Mol. Biol. functioned, no further protein synthesis is required for 84, 445-461. Patterson, M., Sclafani, R. A., Fangman, W. L. and the onset of DNA replication. The nucleotide sequence Rosamond, J. (1986) Mo!. Cell. Biol. 6, 1590-1598. 140 208. Mechanisms Underlying Gene Amplification References (continued): Tabor, S. and Richardson, C. C. (1985) Proc. Natl. in E.coli Acad. Sci. USA 82, 1074-1078. 1 L. Elizabeth Bertani, Giuseppe Bertani , Judith L. Campbell 207. The Effect of dnaJ\ Protein and n' Sites on the In prokaryotes, gene amplification seems to be Replication of Plasmid Co!El initiated by a rare recombination event that produces Doreen Ma, Judith L. Campbell a duplication (Anderson and Roth, 1977). In the The role of the dnaA protein in the replication of presence of selective pressure, the duplicated genes plasmid ColEl and its derivatives was examined. WiJd may be further amplified, presumably through type and mutant Co IE I plasmids were compared as to recombination between misaligned daughter chromo their ability to replicate in an in vitro replication somes. In eukaryotes, there is some evidence that system supplemented with ammonium sulfate unscheduled replication over a limited region of the fractionated extracts from a dnaA overproducing chromosome might play a role in creating the original strain. Synthesis on plasmid templates containing the duplication (Schimke, 1982). wild-type origin of replication was stimulated 1.3-fold In studying DNA amplification in E. coli, we have by addition of the dnaA-overproducing extract. A used a 9-kb vector that consists of the integration larger effect was observed after deletion of the system of the temperate phage P2 cloned into the primosome assembly site, the n' site, on the leading plasmid pBR322 (Ljungquist and Bertani, 1983). When strand. On the latter template, synthesis was only introduced into a suitable host, the vector integrates about one-half that observed with the wild-type very efficiently at the bacterial attachment site templates, but synthesis could be restored to normal specific for this phage. Elimination of the extra levels by addition of the dnaA overproducing fractions. chromosomal copies of the plasmid leaves a strain When the n' site on the lagging strand of pBR322 was carrying a single, integrated copy of the vector deleted, synthesis in the in vitro replication system (Bertani and Bertani, 1985). As part of the study of was reduced to less than 10% of levels seen with intact this structure, the regions including the junctions templates. dnaA overproducing extract did not restore between the vector and the host ONA were cloned and activity since the dnaA site was also deleted on these sequenced (Yu et al., in preparation). The integrated plasmids. To verify that the observed stimulation of vector was found to be delimited by repeats of 27 bp, wild-type and leading strand n' site mutants was due to presumably the core sequence of the phage-host the dnaA protein, dnaA protein was purified to greater chromosomal attachment sites. These might provide than 50% homogeneity and antiserum was prepared. potential sites for the recombination event leading to The purified protein stimulated synthesis on the gene duplication and would be expected to generate a plasmid templates to the same extent as the over repeat unit of 9 kb. producing extracts, and dnaA antiserum blocked In situ amplification of the integrated vector can stimulation both by extracts and by the purified be obtained by cultivating the strains carrying a single protein. Thus, dnaA protein, and, by inference, the copy in gradually increasing concentrations of the dnaA recognition site at the ColEl origin of replica selective antibiotic. Replication arising from the tion seem to be important for ColEI replication. The pBR322 plasmid was avoided by keeping the cultures at effect of dnaA protein is enhanced when the n' site is the temperature nonpermissive for plasmid replication. defective, suggesting that the dnaA protein plays a A total of seven independent in situ amplifications role similar to that of the proteins i, n, n', and n" in have been obtained in this way. In every case, the directing primosome assembly, as proposed by Seufert amplified repeat was greater than 30 kb in size; i.e., and Messer (1987). much larger than the 9 kb expected if the repeat had originated from the 27 kb regions. In two such strains Reference: Seufert, W. and Messer, w. (1987) Cell 48, 73-78. that were studied in more detail, the repeats were found to be 42 and 47 kb, respectively; i.e., not only large, but also different in size. These observations 141 make it unlikely that the amplifications can be Professor: William J, Dreyer Staff Associate: Janet M. Roman accounted for by a simple recombination mechanism. Graduate Student: Jon Faiz Kayyem Rather, the sequences of DNA involved may have some Research and Laboratory Staff: Naomi A. Barker, Jennifer K. Kim unusual features that facilitate recombination or some mechanism other than recombination-for example, Support: The work described in the following research replication-might be involved in generating the reports has been supported by: original duplication. Lucille P. Markey Charitable Trust National Institutes of Health, USPHS References: Department of the Navy, Office of Naval Research Anderson, R. P. and Roth, J. R. (l 977) Ann. Rev. Microbial. 31, 473. Bertani, L. E. and Bertani, G. ( l 985) Abstract in Plasmids in Bacteria, Plenum Press, New York. Summary: The programmed growth of retinal axons to Ljungquist, E. and Bertani, L. E. (1983) Mo!. Gen. Genet. 192, 87. specific target areas in the brain has been observed for Schimke, R. T. ( 1982) Gene Amplification, Cold Spring over a century. Many of the behavioral characteristics Harbor Laboratory, New York. of this system have been identified. We know that a 'The Energy Conservation and Utilization Technology multitude of extracellular matrix molecules, soluble Division of the Department of Energy. factors and cell surface molecules must be involved in guiding the axons to their appropriate targets. But the PUBLICATIONS nature of specific guidance cues remains a mystery. We have initiated a new research program aimed at Budd, M. and Campbell, J, L. (1987) Temperature sensitive mutations in the yeast DNA polymerase I understanding the genetic and molecular basis of gene. Proc. Natl. Acad. Sci. USA 84, 2838-2842. pattern formation in this system. Budd, M., Gordon, C., Sitney, K., Sweder, K. and Our approach to this problem has been to utilize Campbell, J. L. (1988) Yeast DNA polymerases and ARS binding proteins. In: Cancer Cells: Eukaryotic the technological advances available at the Caltech DNA Replication. Cold Spring Harbor Symp. 6, 347-357. Microchemical Facility to attempt to identify cell Budd, M. E., Wittrup, K. D., Bailey, J, E. and surface proteins that have the biochemical structure Campbell, J. L. (1988) DNA polymerase I is required for premeiotic DNA replication and sporu typical of cell surface receptors. We began by lation but not for X-ray repair in Saccharomyces purifying cell surface molecules and separating them cerevisiae. Mol. Cell. Biol., submitted for publication. into fractions according to their molecular weights. Campbell, J, L. (1988) Eukaryotic DNA replication We then produced monoclonal antibodies to these yeast bares its ARSs. TIBS 13, 212-217. Campbell, J. L., Budd, M., Burbee, D., Sitney, K., various fractions. The antibodies are now being used Sweder, K. and Heffron, F. (l 988) Reverse genetics to analyze the pattern of expression of the molecules and yeast DNA replication and repair. Proceedings of the DNA Replication and Mutagenesis meeting, in developing embryos (see Abstract No. 209). In these November 8-12, 1987, in press. studies we ask questions such as when and where Jong, A., Clark, M. W., Gilbert, M. and Campbell, J. L. particular antigens are expressed, and we look for (l 987) Yeast SSB-l and its relationship to nucleolar RNA binding proteins. Mol. Cell. Biol. 7, 2947- those antigens that are only expressed on subsets of 2955. cells and, thus, may be involved in conferring cellular Ma, D. and Campbell, J. L. (l 988) A rapid purification of the dnaA protein and its effect on the replica specificity. We also use the monoclonal antibodies to tion of plasmid ColE!. J. Biol. Chem., in press. isolate molecules of interest and analyze them biochemically (see Abstract No. 210), Such studies, especially when N-terminal amino acid sequence is determined, can reveal whether the molecules we are studying are identical or homologous to others of known function, or whether they are unique. This biochemical information often provides clues as to the potential function of an unknown molecule. For example, one of the molecules we have sequenced has an N-terminal sequence homologous to a molecule 142 known to serve as a potent substrate for neurite looking for expression of our neural antigens in the extension. Hence, the newly identified protein is thymus and/or bursa because of the very intriguing and expected to have a similar but different function. still mysterious antigenic and functional associations Functions of this type may be tested by studying the sometimes observed between the nervous and immune purified molecule in an in vitro culture system (see systems •. Abstract No. 211). Our approach, therefore, has been to begin by using 210. Biochemical Analyses, Including Amino-Terminal Sequencing of Selected Retinotectal Molecules recent technology to study those cell surface mole cules that, based on evolutionary considerations, are Jon Faiz Kayyem, Janet M. Roman likely to be mediators of cell-cell specificity. These Biochemical characterization has begun on selected studies are then combined with classic histologic and retinotectal molecules that show interesting patterns functional tests to investigate potential roles of iso of tissue expression. Our initial studies have been lated molecules in the developing retinotectal system. restricted to molecules with molecular weights of 100 This area of research is now progressing with to 135 kDa. Molecules have been analyzed for their increased momentum in our laboratory and several ability to be recognized on Western blots and to be others. We feel that the methods and instruments now quantitatively purified from tissue Iysates using im available for genetic and molecular studies will soon munoabsorbants. The reduced and nonreduced molec start producing definitive answers to some very old ular weights of isolated molecules have been compared and fascinating questions. and their immunological cross-reactivity determined. Using combinations of immunoabsorbants, gels, and 209. Histological Analyses of Retinotectal Molecules HPLC techniques, four of our antigens have been highly purified and their amino-terminal sequences William J. Dreyer, Jon Faiz Kayyem, Jennifer K. Kim, Naomi A. Barker determined. One of these (5-1E12) appears identical From our original series of fusions, about one dozen to the chicken homologue (G4) of mouse cell adhesion monoclonal antibodies were selected for detailed his molecule LI. Another (5-2F 12) is the same molecular tological studies. Additionally, we continue to select weight (135 kDa) as 5-1El2, but does not cross-react one or two more antibodies per month from our frozen immunologically with 5-1El2, and has an N-terminal library to subclone and analyze. The decision to sequence, which is nonidentical but homologous to analyze an antibody more thoroughly is based upon its 5-1El2. A third antigen, 4-59011, which exhibits a expression in stained tissue sections in a restricted different pattern of histological staining than 1E12, in pattern on a subset of cells, thus suggesting a possible fact shares identical N-terminal sequence with 1El2. role of the corresponding antigen in some specialized, The molecular basis for this different staining pattern specific function. For example, one of our antibodies remains to be elucidated. A fourth antigen, 7-14H5, is stains only a portion of the fiber-tract area stained by 100 kDa, noncross-reactive with 5-1El2, 5-2Fl2, or the well characterized molecule G4 (the chicken 4-49011, stains sections as if it were restricted to a homolog of mouse LI antigen). Another antibody stains small subset of retinal ganglion cell fibers with developing retinal fibers in distinctively different different targets, and has an N-terminal sequence patterns on nasal and temporal sides of tissue sections. unrelated to any molecule yet found by us or reported Still another antibody appears to label a small subset to the computer data banks. of ganglion cell neurons, axons that innervate the brain in a very different pattern than the majority of optic 211. Establishing In Vitro Culture Systems to fibers. Study Expression and Function of These antigens are now being studied, as well as Retinotectal Molecules several others, to determine when and where during Janet M. Roman, Jon Faiz Kayyem development they are expressed. We are examining, in Two in vitro systems are being evaluated for use in addition to the retina and tectum, cross-sections of analyzing expression and/or potential function of spinal cord and cerebellum. Newer studies also include retinotectal molecules. The first of these involves 143 procedures that permit surgery to be performed on Professor Emeritus: Herschel K. Mitchell embryos at designated stages of development, and then allowing subsequent development to proceed. Embryos Support: The work described in the following research reports has been supported by the National Institutes may remain in their shells, or to facilitate surgery at of Health, USPHS. later stages, may be cultured on their yol~s in dishes. Eyes may be enucleated as early as day L-! of embry onic development, resulting in eyeless animals whose Summary: continue with a limited portion of our tectae may be studied to answer such questions as program in developmental biochemistry that has been whether certain antigens are produced by tectal cells in progress for several years. The basic system makes or only by incoming retinal fibers. Tectal regions may use of differentiating wings in the pupal stages of also be ablated and resulting animals used to answer Drosophila. This system presents material that shows questions concerning the fate and antigenic phenotype extensive differentiation in the absence of cell of retinal fibers which do not find appropriate targets. division. The program was initiated here several years The second in vitro system involves slicing or dis ago in collaboration with Dr. Nancy S. Petersen and rupting tectae or retinae and culturing them in vitro. the collaboration continues. Substances known to serve as effective substrates for neurite outgrowth (such as laminin, collagen or fibro 212. Epithelial Differentiation in Drosophila Pupae nectin) are spotted onto culture dishes coated with Herschel K. Mitchell, Nancy S. Petersen 1 nitrocellulose. The nature of cells that grow and pro The construction of cell hairs on the wings in duce cellular processes on these substrates is tested by developing pupae of Drosophila provides a unique staining with antibodies specific for neurons or astro system for studies on the regulation of differentiation cytes or epithelia, etc. Growth of neurites on these without the complication of cell division. An early materials will then be compared with that on the step in hair construction is the deposition of the retinotectal molecules isolated using our monoclonal external impervious layer called cuticulin. Present antibodies. Also, growth inhibition by the appropriate evidence indicates that two abundant proteins (50 kDa monoclonal antibody will be tested. This system also and 65 kDa) provide structural material. Both have serves as a convenient means of determining whether a been isolated in a pure state and from terminal specific molecule is actually expressed on the cell sequences they are not like any known polypeptides. surface (by staining unfixed cultures) or is an internal Preparations of antibodies and DNA probes are in molecule (observed when fixed tissue is stained) or is progress. secreted onto the surrounding matrix in large amounts. 1 Department of Molecular ·Biology, University of Wyoming, Laramie, WY. SUGGESTED REFERENCES Although several manuscripts are in preparation, 213. Spontaneous Fragmentation of Pupal Proteins 04r results from this new project have not yet appeared in print. The following references are sug Herschel K. Mitchell, Nancy S. Petersen 1 gested for more information on this field of research: We showed previously that the 70 kDa heat shock Purves, D. and Lichtman, J. W. (Eds.) (1985) The protein of Drosophila undergoes spontaneous molecular basis of neuronal regulation. In: degradation in acrylamide gels in the presence of SDS. Principles of Neural Development, Sinauer Assoc. Inc. Pubs., Sunderland, MA, pp. 251-270. We show now that several other proteins in eukaryotic Cowan, W. M. and Hunt, R. K. (1985) The development tissue also have a potential for apparent self of the retinotectal projection: An overview. In: Molecular Bases of Neural Development, Edelman, degradation. We have demonstrated also that the G. M., Gall, W. E. and Cowan, W. M. (Eds.), John same set of proteins that degrade in gels also degrade Wiley & Sons, New York, NY, pp. 389-429. Rathjen, F. G. (1988) Aneurite outgrowth-promoting in extracts and in vivo. Further studies in relation to molecule in developing fiber tracts. TINS 11, 183- normal turnover of proteins in vivo are anticipated. 184. 1 Department of Molecular Biology, University of Wyoming, Laramie, WY. 144 214. Heat Shock Protection Against Cold Shock Support (continued) Natural Sciences and Engineering Research 1 Nancy S. Petersen , Herschel K. Mitchell Council of Canada Gordon Ross Medical Foundation We demonstrated earlier for Drosophila that a 30- World Health Organization minute treatment of larvae at 34°C would protect against the lethal effects of a 30-minute shock at 40.5°. This phenomenon (thermotolerance) has been Summary: Our work concerns two groups of human shown to be universal in all plants and animals tested. pathogens, the alphaviruses and the flaviviruses. Much We now show that the same treatment that protects of the molecular characterization has been done with against heat also protects against cold (5 to 15 hr at 0° the type alphavirus, Sindbis, which is nonpathogenic for Drosophila larvae). These findings make it less for man, and with the vaccine strain of the type likely that protein denaturation is involved in the heat flavivirus, yellow fever, but as discussed below and shock response since the heat shock proteins are described in the individual reports, we have also induced by cold as well as heat. studied a number of other alphaviruses and flaviviruses as well. 'Department of Molecular Biology, University of Wyoming, Laramie, WY. Sindbis virus is an enveloped virus with a genome of plus polarity RNA 11,703 nucleotides in length. The PUBLICATIONS genomic RNA is an mRNA encoding the four non structural proteins of the virus, which are responsible Burton, v., Mitchell, H. K., Young, P. and Petersen, N. S. 0988) Heat shock protection against cold stress for RNA replication. The structural polypeptides (a in Drosophila melanogaster. Mol. Cell. Biol. 8, capsid protein C and the two integral membrane 3550-3552. Eberlein, S. and Mitchell, H. K. 0987) Protein proteins E2 and El) are encoded in a subgenomic 26S synthesis patterns following stage-specific_ heat mRNA. Both the nonstructural and structural proteins shock in early Drosophila embryos. Mo!. Gen. Genet. 210, 407-412. are translated as polyprotein precursors, which are Mitchell, H. K. and Petersen, N, S. (1988) Epithelial proteolytically processed to the final products. differentiation in Drosophila pupae: Abundant pro teins and cuticulin deposition. Dev. Biol., in press. Several approaches have been used for the charac Mitchell, H.K. and Petersen, N. S. 0987) Spontaneous terization of alphaviruses and the elucidation of their fragmentation of several proteins in Drosophila pupae. J. Biol. Chem. 262, 14298-14304. replication. We have used temperature-sensitive (ts) Petersen, N. S. and Mitchell, H. K. (1987) The mutants, strains of Sindbis that differ in virulence, and induction of a multiple wing hair phenocopy by heat shock in mutant heterozygotes. Dev. Biol. 121, comparative sequencing of different members of the 335-341. alphavirus genus. As described last year (Biology 1987, Abstract No. 178), we have a cDNA clone of the entire Sindbis genome from which can be transcribed in vitro infectious RNA. Using this clone, it is possible to perform site-specific oligonucleotide-directed muta Professor; James H. Strauss genesis, or to substitute restriction fragments in the Senior Research Associate: Ellen G. Strauss clone with the corresponding fragment of cDNA from Visiting Associates: Rafi Ahmed, Shlomo Lustig Research Fellows: Richard J, Kuhn, Hubert G. M. previously characterized mutants, and then examine Niesters, Yukio Shirako the resulting phenotype in viruses rescued by RNA Graduate Students: Chang Sao Hahn, Young Shin Hahn, 1 W. Reef Hardy , Frank Preugschat, David W. transfection. Studies of this kind include the mapping Ruff, Kang-Sheng Wang of ts mutants, location and modification of residues Research and Laboratory Staff: Edith M. Lenches important for the capsid autoprotease function, 1 Department of Chemistry and Chemical Engineering, mapping of the nonstructural protease, mutagenesis of California Institute of Technology. conserved nucleotide domains at the 3' and 5' regions of the genome, and dissection of the contributions of Support: The work described in the following research reports has been supported by: certain amino acid substitutions to neurovirulence in E. S. Gosney Fund mice. Many of the domains that are being treated in National Institutes of Health, USPHS National Science Foundation this way were identified originally by comparative 145 sequencing of different strains of Sindbis virus and of 215. The Function of the 3' Nontranslated Region of Sindbis Virus different alphaviruses such as Middelburg, Western equine encephalitis, Ross River, and O'Nyong-nyong. Richard J. Kuhn Such comparative studies have also led to the The 3' nontranslated region of Sindbis virus (SIN) is remarkable finding that Western equine encephalitis 322 nucleotides in length exclusive of the genomically virus arose by recombination in the alphaviruses. This encoded poly(A) tract. Comparative sequence analysis comparative approach continues in the studies on of the 3' end of different alphaviruses has identified a Ockelbo virus and on antigenic escape variants of highly conserved region of 19 nucleotides immediately Sindbis viruses. In addition, we are interested in preceding the poly(A). This sequence has been proposed identifying the Sindbis receptor on host cells by using to play a role in replicase recognition of the 3' end of anti-idiotypic antibodies. the viral RNA. In addition, the first 50 nucleotides The family Flaviviridae contains about 70 mem adjacent to the poly(A) tract are extremely A+U rich bers, many of which are important human pathogens. (86%). Further upstream of the A+U-rich domain, Nucleotide sequencing studies from our laboratory (on short sequences of repeated nucleotides can be found the 170 vaccine strain of yellow fever virus, the that show considerable conservation among closely virulent Asibi parent of that vaccine strain, and the Sl related viruses. The function of these sequences is candidate vaccine strain of dengue virus type 2) have currently unknown. illuminated the genome organization of flaviviruses. In order to understand this region better, we have Flaviviruses are also enveloped viruses with a single generated a series of deletion viruses in the 3' non RNA molecule of plus polarity as their genome. The translated region using an "infectious" cDNA clone of genomic RNA is the only viral mRNA and has a single Sindbis virus. The largest deletion spans 293 nucleo long open reading frame which encodes· the structural tides and leaves the 3' 25 nucleotides and the poly(A) proteins at the 5' end followed by a series of non intact. This virus grows only slightly slower than the structural polypeptides whose functions have not been parental wild type. Removal of only the 3' 25 nucleo defined. The resultant translation product is a poly tides and the poly(A) produces a lethal lesion. We are protein which is processed by both cellular and viral currently investigating the effects these deletions protease activities. Most of our current flavivirus have on virus replication. work involves expressing dengue proteins from vac Site-specific substitutions and deletions in the 19- cinia recombinants, attempting to locate the viral nucleotide conserved sequence element have produced protease activity in the dengue genome, and con mutants exhibiting various phenotypes. We have structing a full-length and hopefully infectious clone isolated a subset of these mutants that exhibit a of a flavivirus. Once an infectious clone can be conditional lethal phenotype. Second-site revertants obtained, parallel experiments to those outlined above to these mutants are being selected. It is assumed for alphaviruses can be performed to determine the that some of these second-site revertants will be functions of particular regions of the genome, to map located in the protein that interacts with the 19- virulence determinants, and ultimately to engineer nucleotide conserved sequence element. Such safe and efficacious flavivirus vaccines. revertant viruses will be cloned and their mutations We wish to understand on a molecular level many mapped. In addition, we are attempting to define the aspects of alphavirus and flavivirus replication, important elements of this conserved sequence and including the interactions of the proteins with one how they relate to virus replication. another for virus assembly and with the host cell for infection, the nature and location of determinants 216. Analysis of 5'-Terminal Sequences of important for pathogenesis, and the details of their Sindbis Virus RNA RNA replication. Furthermore, we are interested in Hubert G. M. Niesters determining the relationships between current viruses Comparative studies of alphaviruses have shown at the nucleotide sequence level, and in understanding that at the very 3' end of the negative strand, some RNA virus evolution. sequence homology is apparent. All of the studied 146 RNAs can form a stable and similar stem-and-loop into U in the second hairpin is lethal for the virus. structure. The function of this terminal structure on This mutation does not drastically change the free RNA replication and its interaction with other energy of the hairpin, but brings an extrahelical A into conserved sequence elements or proteins is not the structure itself. Changing the adjacent base pair understood, but it could be used by the replicase as a AU into GC apparently has no effect on the virus. binding site for initiation of plus-strand transcription This indicates that the structure of the hairpin itself is from the minus-strand template. more important than the sequence in this region. To study the function of this structure and its All the other mutations introduced have a limited sequence requirements more carefully, a number of effect on the virus. Of these mutations, the change of mutations and deletions have been introduced in an G150 and c173 lowers the free energy of the first "infectious" cDNA clone of Sindbis virus. After in hairpin drastically and results in a stable, large plaque vitro RNA syntheses from these mutated cDNA clones, phenotype. Growth kinetic studies of these mutated the RNA was transfected into secondary chicken viruses will give us information as to whether these embryo fibroblasts. Several mutant viruses have now changes result in a selective advantage or dis been rescued and characterized. Surprisingly, large advantage for the virus. deletions (up to 15 nucleotides) in the first 54 nucleotides of the viral genome were tolerated. 218. Fine Mapping of Sindbis RNA- ts Mutants: However, deletions of the G8c36 base pair and Lesions Responsible for changes of nucleotide Gg resulted in temperature Complementation Group F Mutants sensitive viruses. We plan to isolate revertants from Young S. Hahn, Charles M. Rice' the temperature-sensitive viruses that restore wild Temperature-sensitive (ts) mutants of complemen type replication. It can be expected that a number of tation group F, ts6, tsllO and tsll8, are defective in these revertants will be second-site revertants, which RNA synthesis at the nonpermissive temperature. The enables us to identify the protein that interacts with best characterized member, ts6, ceases genomic, sub this terminal structure. genomic, and minus-strand RNA synthesis upon shift to the nonpermissive temperature, and for this reason it 217. Analysis of the Conserved 51-Nucleotide was postulated that ts6 may have a defect in the Element within nsP 1 elongation activity of the replicase. cDNA clones of Hubert G. M. Niesters group F mutants as well as their revertants have been Within the nonstructural protein nsP l of all alpha constructed. To assign the ts phenotype to a specific viruses, a highly conserved sequence of 51 nucleotides locus in the viral genome, restriction fragments from is found. This sequence can form two stable hairpin the mutant cDNA clones were used to replace the structures but its function is unknown. Reasonable corresponding regions of the cDNA clone TotollOl of hypotheses are that it might serve as a nucleation site Sindbis virus. These plasmids were transcribed in vitro for encapsidation or as a replication element. by SP6 RNA polymerase to produce infectious tran To study the function of these structures, a number scripts which were then assayed for the production of of site-directed mutations have been introduced in an ts virus. The nucleotide sequence of the restriction "infectious" cDNA clone of Sindbis virus. RNA can be fragment conferring the ts phenotype was then transcribed in vitro from these mutated cDNA clones obtained. In this way the ts lesion of each virus was using SP6 RNA polymerase and subsequently trans mapped to a specific nucleotide. fected into secondary chicken embryo fibroblasts. This analysis indicated that ts6 and ts! 10 each have Virus can then be rescued from the cul tu re single base substitutions in nsP4 resulting in a replace supernatant. The mutations were chosen to have an ment of Gly by Glu at position 153 or position 234 of influence on the theoretical free-energy within the nsP4, respectively. ts118 is a double mutant. It hairpin, but to produce no change in the amino acid contains a single base substitution in nsP2 resulting in sequence of nsP l itself. a replacement of Val by Ala at position 425 of nsP2, Of the studied mutations, only the change of A 188 which is responsible for a minute plaque phenotype but 147 not a reduction in the plaque number at the non reduced levels of 265 RNA upon shiftup, suggesting permissive condition. A lesion in nsP4, Gln-93 to Arg, that group A or group G or both may be required to while having no apparent effect by itself, leads to initiate 26S RNA synthesis. In addition, ts! 7 (A), ts24 temperature sensitivity and reduction in plaque (A), and tsl8 (G) are temperature sensitive for the number at 40° when combined with the nsP2 change. proteolytic cleavage of the nonstructural proteins. Viral RNA synthesis after infection by the rescued Both group A and group G mutants have been mapped viruses, which have a defined mutation in an otherwise to nsP2. ts? (G) has two independent ts mutations. uniform background, was studied to demonstrate that One mutation is in nsP2 and the other is in nsP3. We the RNA - phenotype at the nonpermissive temperature are currently analyzing the contribution of each of was the result of the mutations mapped. It is of these mutations separately for their effects on RNA interest that the ts6 and tsllO defects, as well as one replication and on proteolytic processing. of the lesions in tsl 18, are in nsP4. This protein is homologous to certain plant virus replicases, and 220. Deletion Mapping of the Putative Nonstructural shares apparent homology with the poliovirus RNA Viral Protease of Sindbis dependent RNA polymerase, as well as those of other W. Reef Hardy, Milton Schlesinger 1 plus-stranded viruses, consistent with the hypothesis It is a common strategy among nonsegmented, that nsP4 is the viral RNA polymerase. single-stranded RNA viruses to encode their non 1Department of Microbiology and Immunology, structural proteins in a polycistronic message that, Washington University School of Medicine, St. Louis, MO. upon translation of a polyprotein precursor, is processed to yield the mature nonstructural proteins. 219. Studies on the Sindbis Virus Replicase: For example, Sindbis virus uses this scheme to produce Mapping of RNA - Mutants in Complementation its four nonstructural proteins, nsPl, nsP2, nsP3 and Groups A, B, and G nsP4, from their precursor through the action of a Young S. Hahn putative viral protease. We are attempting to map this The genome of Sindbis virus is a single-stranded protease activity to a domain in one of the nonstruc RNA of 11,703 nucleotides. During RNA replication, tural proteins and to determine whether it acts pre the genomic 49S RNA is transcribed into full-length, dominantly incisor in trans to effect the cleavages. minus-strand RNA which is used as a template for Using an SP6 transcription system to transcribe synthesis of both genomic 49S RNA and a subgenomic copies of full-length viral RNA from a complete cDNA 265 RNA. Nonstructural proteins involved in viral clone of Sindbis virus has enabled us to assay protease RNA replication are translated as a polyprotein from function in an in vitro translation system. This affords the 5' end of the genome and cleaved to produce nsP 1, us greater control over the conditions present during nsP2, nsP3, and nsP4 by a viral protease encoded in proteolytic processing as well as the ability to tailor this region. the viral genome. Furthermore, the use of mono To determine the function of each nonstructural specif ic antibodies to each of the nonstructural protein, we have localized the lesions in ts mutants proteins has helped us to characterize the proteolytic belonging to the four RNA - complementation groups: processing of these deleted constructs. Presently, we A, B, F, and G. The localization and characterization have transcribed and translated several clones that of the Group F mutants have been described in the have a deletion in some region of each of the non preceding abstract. Using the same strategy, we are structural protein genes5 From analyzing the gel now mapping the mutants in groups A, B, and G. patterns of these in vitro translations, we suggest that The single member of complementation group B the protease activity maps to some domain in nsP2. (tsl 1) ceases minus-strand synthesis on shiftup to the Finer deletion mapping is now in progress to resolve nonpermissive temperature and is therefore presumed what region of nsP2 may contain the protease. to be defective in a factor for initiating minus-strand 1Department of Microbiology and Immunology, synthesis. It has been mapped to nsP 1. Group A (ts 17, Washington University School of Medicine, St. Louis, ts21, ts24) and group G (ts?, tsl8) mutants synthesize MO. 148 221. Characterization of a Posttranslational directed, site-specific mutagenesis. Ser-215 has been Modification of nsP3 of Sindbis Virus changed to Thr, lie or Cys; His-141 has been changed 1 G. Li , w. Reef Hardy, Charles M. Rice' to Pro; and Asp-147 has been changed to His or Tyr. In pulse-chase experiments with Sindbis-infected The effects of these changes were tested by placing CEF cells, we observed a smear of 35s-methionine each of the mutations into a plasmid containing a labeled products that were precipitable with antibodies cDNA copy of the Sindbis mRNA encoding the struc specific for nsP3 and that were apparently larger than tural proteins. RNA was transcribed in vitro using T7 nsPJ appearing coincident with the disappearance of RNA polymerase, the RNA translated in vitro in a nsPJ during long chases. If instead we labeled with rabbit reticulocyte translation system, and the extent 32P-inorganic phosphate, we found two predominant of cleavage of capsid protein monitored. The change species containing radioactive phosphates with of His-141 to Pro led to complete loss of proteolytic apparent molecular masses of 79 and 113 kDa after activity. The two changes at Asp-147 had no detec immunoprecipitation with anti-nsP3 antibody. This table effect on proteolytic activity in this system, suggests that the posttranslational modification that with 100% of the capsid protein being released. The changes the electrophoretic mobility of nsPJ (from 76 changes at Ser-215 had effects that differed with the kDa just after synthesis) is phosphorylation. mutation induced. The change to Cys resulted in a loss We intend to localize the portion of the protein(s) of only 20% of the protease activity in this system being modified by analyzing labeled tryptic peptide (that is, 20% of the polyprotein molecules were not fragments using micro-peptide sequencing. To deter cleaved to produce capsid protein). The change to Thr mine the nature of the phosphate moiety(ies) that is resulted in the loss of 90% of the activity, whereas the attached, we will use reagents that will differentiate change to lie resulted in total loss of proteolytic between simple protein phosphorylation and the activity. In a- second test for the effect of these addition of nucleic acid. mutations, they were placed in a full-length cDNA We are also attempting to determine whether this copy of Sindbis virus RNA from which infectious RNA modification will occur in vitro in a rabbit reticulocyte can be transcribed in vitro. The resulting RNA was translation system programmed with genomic RNA found to be nonviable, that is, no virus could be from Sindbis virus, Semliki Forest virus and Ross River recovered after RNA transcription, indicating that all virus to examine the generality of this modification of the changes are lethal. This indicates that either among alphaviruses. production of infectious virus is a more sensitive 1 measure of proteolytic activity than the in vitro Department of Microbiology and Immunology, Washington University School of Medicine, St. Louis, cleavage assay, or that these residues have necessary MO. functions in addition to their role in proteolysis. 222. Site-Directed Mutagenesis of the Proposed Catalytic Amino Acids of the Sindbis Virus 223. Molecular Basis of Sindbis Virus Neurovirulence Capsid Protein Autoprotease in Mice Chang S. Hahn 1 Shlomo Lustig, Alan C. Jackson , Chang s. Hahn, 1 The structural proteins of Sindbis virus, consisting Diane E. Griffin , Ellen G. Strauss of a capsid protein and two envelope glycoproteins, are We have examined a variety of strains of Sindbis translated as a polyprotein precursor that is cleaved virus for the genetic changes responsible for posttranslationally. The first cleavage event releases differences in neurovirulence for mice. A low passage the capsid protein from the N terminus of this poly of the AR339 strain of Sindbis virus (SY), a neuro protein in a process believed to be autoproteolytic, and adapted Sindbis virus (NSV), and two laboratory strains we have previously postulated that His-141, Asp-147 of Sindbis virus (HRSP and TotollOI) were examined. and Ser-215 of the capsid protein form a catalytic NSV causes a severe encephalomyelitis with hind limb triad similar to that found in serine proteases. To test paralysis and high mortality after intracerebral this hypothesis, each of these amino acids has been inoculation in weanling mice. In contrast, SV causes replaced with other amino acids using oligonucleotide- only mild, nonfatal disease in weanling mice; however, 149 in suckling mice SV causes a fatal encephalomyelitis containing glycoprotein El from SY showed an after either intracerebral or subcutaneous inoculation. identical pattern with SY. Glycoprotein El of SY and The two laboratory strains used have greatly reduced NSV di!!er at two positions: Val-72 and Gly-313 in SY neurovirulence for suckling mice and are avirulent for are Ala-72 and Arg-313 in NSV. Further studies of weanling mice. The nucleotide sequences and encoded which amino acid residue is important for pH amino acid sequences of the structural glycoproteins dependent fusion activity is being analyzed by of these four strains were compared. Hybrid genomes constructing recombinant viruses that separate these were constructed by replacing restriction fragments in amino acids. a lull-length cDNA clone of Sindbis virus, from which 1Department of Medicine and Neurology, The Johns infectious RNA can be transcribed in vitro, with Hopkins University School of Medicine, Baltimore, MD. fragments from cDNA clones of the various strains. These recombinant viruses allowed us to test the 225. Studies of Membrane Fusion During the Entry of Sindbis Virus by Saturation Mutagenesis importance of each amino acid difference between the various strains for neurovirulence in weanling mice and Young S. Hahn, Chang S. Hahn suckling mice. Glycoproteins E2 and El were of para Sindbis virus-infected cells undergo pH-dependent mount importance for neurovirulence in adult mice. membrane fusion which occurs after a brief exposure Recombinant viruses containing the nonstructural to low pH and subsequent return to neutral pH. This protein region and the capsid protein region from an acid-induced fusion of viral and cellular membranes is avirulent strain and the El and E2 glycoprotein regions thought to be important for the release of alphavirus from NSV were virulent, although less virulent than nucleic acids from the virion into the cell to initiate NSV. Furthermore, changes in either E2 (His-55 in infection. Sindbis virus has two major membrane NSV to Gln in SY) or in El (Ala-72 in NSV to Val in SY glycoproteins, E2 and El. Membrane fusion is believed and/or Asp-313 in NSV to Gly in SY) would reduce to be mediated by the El glycoprotein (see the virulence. For virulence in suckling mice, we have preceding abstract). found that a number of changes in E2 and El can lead All but two of the amino acids between positions 78 to decreased virulence and, in fact, a gradient of and 97 of glycoprotein El in Sindbis virus are hydro virulence exists. phobic. This domain is highly conserved among alpha 1 viruses, with a sequence of 10 invariant hydrophobic Department of Medicine and Neurology, The Johns Hopkins University School of Medicine, Baltimore, MD. residues (GVYPFMWGGA) in the middle. It has been proposed that this hydrophobic domain is responsible for membrane fusion. We would like to determine the 224. Low pH-Dependent Sindbis Virus-Induced Fusion of BHK Cells contribution of these amino acids to fusion by performing saturation mutagenesis on this domain, to Chang S. Hahn, William M. Boggs', Ellen G. Strauss, Diane E. Griffin 1 generate large numbers of mutants. Mutants Two strains of Sindbis virus, wild-type strain containing the various phenotypes can be rescued by AR339 (SY) and neuroadapted strain (NSV), which replacing restriction fragments in a lull-length cDNA differ in virulence for weanling mice, were studied for clone of Sindbis virus from which infectious RNA can pH-dependent fusion of infected BHK-21 cells. SY be transcribed in vitro with the corresponding fused cells maximally alter shifting to pH 5.4, while fragments from the site-directed mutants. Various NSV did not achieve maximal fusion until pH 4.&. This mutants, including lethal mutants, will be charac di!!erence was localized to the glycoprotein E 1 by terized for the membrane fusion activity to determine studying recombinant viruses that contained glyco the importance of each amino acid in the hydrophobic proteins for either SY or NSV. Glycoprotein E2 failed domain. to show any relationship with pH-dependent fusion activity. pH-dependent fusion activity of recombinant viruses containing glycoprotein· El from NSV showed an identical pattern with NSV, and recombinant viruses 150 226. Sindbis Virus tsl03 Has A Mutation in 227. Western Equine Encephalitis Virus Glycoprotein E2 That Leads to Defective Is A Recombinant Virus Assembly of Virions Chang S. Hahn, Shlomo Lustig, Ellen G. Strauss, 1 Chang s. Hahn, Charles M. Rice , Ellen G. Strauss, Jam es H. Strauss Edith M. Lenches The alphaviruses are a group of 26 mosquito-borne We have determined that a mutation in glyco viruses that cause a variety of human diseases. Many protein E2 of Sindbis virus tsl03 is the change that of the new world alphaviruses cause encephalitis leads to defects in the late stages of maturation and to whereas the old world viruses more typically cause formation of multi-cored particles. The mutant pheno fever, rash, and arthralgia. The genome is a single type was mapped to glycoprotein E2 by constructing stranded non-segmented RNA molecule of plus recombinant viruses between the parental strain of polarity; it is about 11,700 nucleotides in length. Sindbis virus and the mutant. To accomplish this, we Several alphavirus genomes have been sequenced in replaced restriction fragments in a full-length cDNA whole or in part, and these sequences demonstrate that clone of Sindbis virus from which infectious RNA can alphaviruses have descended from a common ancestor be transcribed in vitro with the corresponding by divergent evolution. We have now obtained the fragments from cDNA clones of ts103. Viruses were sequence of the 3'-terminal 4288 nucleotides of the rescued from these recombinant clones and only RNA of the New World alphavirus Western equine recombinant viruses containing glycoprotein E2 of encephalitis virus (WEE). Comparisons of the tsl03 were phenotypically tsl03, !orming minute nucleotide and amino acid sequences of WEE with plaques at 30° or 40°, growing slowly to low yield, and those of other alphaviruses clearly show that WEE is forming multi-cored particles. Sequence analysis of recombinant. The sequences of the capsid protein and tsl03 and of its parent (HR) showed that there was of the (untranslated) 3'-terminal 80 nucleotides of WEE only one difference in glycoprotein E2 between the are closely related to the corresponding sequences of two strains: a change of alanine to valine at position the New World alphavirus Eastern equine encephalitis 344. A partial revertant of tsl03, called tsl03R, was (EEE) virus, whereas the sequences of glycoproteins E2 also mapped and sequnced. These studies clearly and El of WEE are more closely related to those of an showed that tsl03R is a second-site revertant in which Old World virus, Sindbis (SIN) virus. Thus, WEE a change in glycoprotein El from lysine to methionine appears to have arisen by recombination between an at position 227 partially suppresses the phenotypic EEE-like virus and a SIN-like virus to give rise to a effects of the change at E2 position 344. The assembly new virus with the encephalogenic properties of EEE defect in tsl 03 appears to result from a weakened but the antigenic specificity of SIN. There has been interaction between the virus membrane glycoproteins speculation that recombination might play an impor and the nucleocapsid during budding. Both the E2 tant role in the evolution of RNA viruses. The current mutation leading to the defect in virus assembly and finding that a widespread and successful RNA virus is the suppressor mutation in glycoprotein El are in the recombinant provides support for such an hypothesis. domains external to the lipid bilayer and thus in domains that cannot interact directly with the nucleo capsid. This suggests that in tsl03, either the El-E2 228. A Study of the Interactions ~etween _the Nucleocapsid and Cytoplasmic Domains of the heterodimers or the trimeric spikes (consisting of Envelope Proteins From Hybrid Genomes three El-E2 heterodimers) have an aberrant configura Chang S. Hahn tion, and thus cannot interact properly with the Alphaviruses mature when preassembled nucleo nucleocapsid. capsids acquire an envelope by budding through the 1 Department of Immunology and Microbiology, plasma membrane. During evolution, certain domains Washington University School of Medicine, St. Louis, MO. of the glycoproteins of a particular virus must have been selected for maximal specific interaction with the capsid of that virus. In a recombinant virus that contains the capsid protein from one virus and the 151 glycoproteins from the other, the interaction during reverse transcriptase. The results indicate that l) the budding might not be optimal. During passage of such 3' untranslated regions of the isolates investigated a recombinant virus, selection pressure would favor vary only a few nucleotides in length, caused by variants in which the nucleocapsid and glycoprotein several deletions and insertions, and contain three interactions were improved. This hypothesis is highly conserved, 40-nucleotide-long repeat blocks supported by analysis of the genome of Western equine with exactly the same arrangement as the type strain; encephalitis (WEE) virus which is a recombinant virus 2) on the basis of nucleotide sequence outside of the between a SIN-like virus and an EEE-like virus three repeat blocks, the isolates are divided into two (Abstract No. 227). By generating recombinant viruses subgroups, one of which includes South African, between Sindbis and WEE using the full-length cDNA Ockelbo and Karelian isolates which show less than 5% clone of Sindbis virus, it is possible to make viruses difference in nucleotide sequence with the type strain, that contain either the envelope proteins from the whereas the other includes the Indian and Australian WEE virus and the rest of the genome from the Sindbis isolates which differ more than 20% in sequence from virus, or the capsid protein from WEE and the rest of AR339; and 3) the nucleotide differences between the the genome from the Sindbis virus. By subsequent two subgroups seems to be independent of the place, passages and monitoring sequence changes in the the year and the host of isolation. carboxy-terminal half of the capsid protein and the cytoplasmic domain of glycoprotein E2, it should be 230. Structure of Ockelbo Virus Genome and Its possible to identify which amino acid residues are Relatedness to Sindbis Virus interacting. Yukio Shirako Ockelbo virus was isolated in the early I 980s in 229. Comparative Study of 3' Untranslated Nucleotide Sweden as the causal agent of a disease characterized Sequences of Sindbis Virus Isolates by arthritis, rash and fever in humans. Similar types Yukio Shirako of diseases have also occurred in Finland and the It has been reported that the 3' non-coding regions Karelian region of the Soviet Union. Ockelbo virus of alphavirus RNAs contain repeated sequence blocks, was shown to be antigenically related to Sindbis virus around 50 nucleotides in length, of unknown function. which is the type virus of the alphavirus genus and is The nucleotide sequence and the number of repeats not pathogenic for humans. However, no nucleotide differ among the members of the alphavirus genus, in sequence data for the Ockelbo virus genome had been contrast to a block of 19 nucleotides adjacent to the available for the comparative study of the two viruses. poly(A) tract that are highly conserved in all alpha Therefore, this work was conducted to determine the viruses. Comparative study of Ross River virus isolates nucleotide and translated amino acid sequences of the has indicated that significant divergence in the number Ockelbo virus genome so as to determine the related and arrangement of the repeat blocks exists even ness of Ockelbo virus to Sindbis virus at the genomic among geographic variants. In this study, the 3' level and to make clear the taxonomic position of untranslated nucleotide sequences of Sindbis virus Ockelbo virus in the alphavirus genus. isolates differing in the place, the year, and the host Almost full-length cDNA clones of Ockelbo virus of the isolation were determined and compared with RNA genome (I I .7 kb) were constructed from the that of the type Sindbis virus (AR339, isolated in 1952 genomic RNA. The nucleotide sequence data obtained from mosquitoes in Egypt). The virus isolates inves so far show that Ockelbo and Sindbis viruses share a tigated include a South African isolate (the year of high degree of nucleotide and amino acid sequence isolation, 1963; the source, human), an Indian isolate identity, with only 5.296 and 2.2% divergence in (1953; bird), an Australian isolate (1975; mosquito) and nucleotide and translated amino acid sequences, the recently identified, human-pathogenic strains respectively, in the nsPl region, 6.5% and 6.996 in the causing Ockelbo disease and Karelian fever in Europe nsP3 region, 6.296 and 2.4% in the nsP4 region, 6.2% ( 1980s). The nucleotide sequences were determined by and 1.2% in the capsid protein region, 6.1 % and 2.6% the dideoxy method using a primer dT 12dGdA and in the glycoprotein E2 region, and 3.1 % and 1.4% in 152 the glycoprotein El region. The nucleotide divergence amino acid sequence conservation, we have inserted in the 3' untranslated region, excluding the poly(A) restriction sites, which are now common to both tract, was 5.096. This result indicates that Ockelbo viruses. These restriction sites will allow us to make virus can be considered as a human pathogenic strain recombinant cDNA clones from the two viruses, and of Sindbis virus, since the sequence differences are using SP6 or T7 RNA polymerase, we hope to generate less than those found in many RNA viruses that are chimeric viruses. Initially, the nonstructural region considered strains of one another. will be the target region for engineered recombi nations since this region is more highly conserved. It 231. Construction of Full-Length cDNA Clones of is likely that some of the chimeric viruses wi11 exhibit Ross River Virus a conditional lethal phenotype depending upon the site Hubert G. M. Niesters, Richard J. Kuhn of recombination. Such viruses will prove useful in Ross River virus (RRV) is an Australian alphavirus studying replication and will allow us to examine how that frequently causes outbreaks of epidemic viral proteins interact with each other and with viral polyarthritis in humans. cDNA clones have been specific RNA. We will also exchange regions coding constructed for the virulent strain T48, which together for the structural proteins of the viruses in order to contain almost the entire nucleotide sequence of the study their role in virus pathogenicity. In a preliminary viral genome. We are currently constructing a full experiment, the 3' non-translated region of RRV has length cDNA clone of the virus next to the promoter replaced the corresponding sequence in SIN. Although of T7 RNA polymerase using a synthetic adaptor. This the RRV sequence is 524 nucleotides in length as will enable us to transcribe RRV RNA in vitro and to compared with 322 nucleotides in SIN, a virus was transfect the RNA into susceptible cells. Isolation of recovered that has growth characteristics similar to infectious virus from these cDNA clones will enable us the parental SIN. to study viral replication and pathogenesis using a molecular genetic approach. These cDNA clones will 233. Complete Nucleotide Sequence of also be used for constructing hybrid genomes between O'Nyong-nyong Virus Sindbis virus and RRV to study various aspects of Randy S. Levinson, Ellen G. Strauss transcription and translation. We have sequenced the nsP3/nsP4 region of O'Nyong-nyong virus and shown that, as for Semliki 232. Generation of Chimeric Viruses Between Forest virus, there is between nsP3 and nsP4 of Sindbis Virus and Ross River Virus O'Nyong-nyong virus an arginine codon (CGA) in the Richard J. Kuhn, Hubert G. M. Niesters same position as there is in Ross River, Sindbis and The use of molecular genetics in the study of RNA Middleburg viruses an opal codon (UGA) (Strauss et al., viruses has only recently become practical due to 1988). construction of infectious cDNA clones. The In the past year we have nearly completed the availability of these clones together with comparative nucleotide sequencing of the nonstructural domain of sequence data allow one to suggest pathways of RNA O'Nyong-nyong, which contains 7577 nucleotides. It virus genome evolution and to directly test how viral has been found that the degree of sequence identity in proteins evolve to suit their specific virus-host the nonstructural region among the alphaviruses varies requirements. As described above, full-length clones not only between the different moieties but also within of Ross River virus (RRV) have been assembled and are a given polypeptide. Thus, the N-terminal half of nsP2 being tested for infectivity. An infectious cDNA clone and the middle third of nsP4 are highly conserved, of RRV will complement the studies currently being while the C-terminal half of nsP3 contains no carried out using the infectious cDNA clone of Sindbis homology. virus (SIN). At present, we are finishing the sequencing of the Although RRV and SIN are rather distantly related structural region of O'Nyong-nyong. Currently, 2,681 alphaviruses, there are certain regions that share nucleotides out of approximately 4,236 nucleotides (or considerable sequence identity. In regions of high 6396) have been sequenced in the structural region. 153 Recently, a subclone has been obtained that contains Mab 49 appears to belong to a non-overlapping the one large remaining gap (- l.2 kb) in our sequence, epitope. A resistant variant, v49, appears to have a which should facilitate the completion of the change from E to V at position 23 in glycoprotein E2, sequence. which is in a quite separate domain of E2. It is interesting that these results are compatible Reference: Strauss, E. G., Levinson, R., Rice, C. M., Dalrymple, J. with the localization of the epitopes by a comple and Strauss, J. H. (1988) Virology 164, 265-274. mentary, but quite separate analysis, that of :>.gtll libraries, screened for reactivity with various NMabs 234. Characterization of Antigenic Variants of (see the following abstract). These altered residues Sindbis Virus fall within or close to the regions encoded by the :>.gtl 1 Ellen G. Strauss clones which react with the respective Mabs. A number of years ago, Dr. Alan Schmal john We are in the process of completing the sequence isolated a panel of monoclonal antibodies directed of each variant throughout the E2 and El regions, to against purified glycoproteins of Sindbis virus. When establish that these are the only alterations in the these were tested, a number of the E2-specific anti glycoproteins. It appears that in each case, the actual sera and one EI-specific antiserum were found to epitope is a very small region on the glycoprotein. neutralize infectivity. He used these neutralizing monoclonal antibodies (NMabs) to select for antibody 235. Mapping Neutralization Epitopes on Glycoprotein resistant virus variants, by growing Sindbis in the E2 of Sindbis Virus presence of the antibody. For a few of these variants, Kang-Sheng Wang he was also able to isolate revertants that were once Sindbis virus contains two species of virally more sensitive to neutralization. He has made all of encoded integral membrane glycoproteins, El and E2, these variants, their revertants and several in the viral envelope. The virus "spikes," which play a sequentially-selected multiple variants available to us, central role in the attachment of Sindbis to the host as well as the original monoclonal antibodies. The cell, are trimers of heterodimers of E2 and El. We most highly characterized are NMabs //49, 1150, 1123, have obtained a number of monoclonal antibodies 1151 and their resistant variants v49, v50, v23, etc. We specific for E2 which interfere with attachment, and have been sequencing the variants using cytoplasmic we want to map the epitopes With which these RNA from infected cells, reverse transcriptase, and antibodies react. synthetic oligonucleotide primers for chain We constructed a :>.gtl 1 library of randomly primed termination sequencing. cDNA from Sindbis genomic RNA containing small Although we have not completed sequencing the inserts on the order of 100-200 nucleotides in length. entire glycoprotein region for each of these variants, About 500,000 clones from this library were screened it has become clear that the majority of the altera using the neutralizing Mabs as the primary antibody tions found map to one central domain of the glyco and 1251-conjugated sheep anti-mouse IgG as the protein E2 in the vicinity of the second glycosylation secondary antibody. Clones recognized by five site at position 196. The residues changed in some of individual Mabs have been isolated and the inserts these variants are as follows: sequenced to determine the domain of E2 encoded. v50, two independent isolates, have changes at NMab 49 recognizes a clone encoding amino acids 1-16 residue 190, from K (in AR339) to M in v50, and to N at the N terminus of E2, while clones identified with in v33/50. Mab 42 encode amino acids 173-204, those for NMab v23, two independent isolates, have changes at 23 encode amino acids 155-257, and those for NMab 50 residue. 216: from K (in AR339) to E in v50/23 and to encode amino acids 141-189. We are currently con N in v33/50/23. (in the latter case this change structing a second xgtl 1 library with smaller inserts in generates a new glycosylation site which is modified order to define the limits of the epitopes more in vivo, and this is presumably the cause of the escape exactly. from neutralization with Mab 23.) Mabs 23 and 50 cross-react to some degree. 154 236. Isolation of the Sindbis Virus Receptor from kDa. By transcribing these clones with RNA poly Chicken Fibroblasts merases in vitro and translating the mRNA produced in Kang-Sheng Wang vitro, I hope to delineate the viral product responsible The entry of Sindbis virus into a host cell is for proteolytic processing of the polyprotein. It is reported to be via receptor-mediated endocytosis. clear from comparative sequence analysis that cellular However, the initial interaction between virus and signalases are involved in processing the structural and receptor may be characterized by low affinity, Anti possibly at least some of the nonstructural proteins of idiotypic antibodies (to antiviral antibodies) have been flaviviruses. By translating the dengue mRNA in the proposed as specific receptor probes, with the idea presence and absence of microsomal membranes, we that these reagents would faithfully mimic the can determine whether or not these internal signal receptor-ligand interaction, but with enhanced sequences are utilized in vitro. affinity. Preliminary results from in vitro translation of A set of neutralizing monoclonal antibodies structural region clones show that large polyproteins specific for Sindbis glycoprotein E2, and anti-idiotypic can be produced and that the internal signal sequences antibodies to these monoclonal antibodies, were are inefficiently recognized by commercially available received from Dr. Alan Schmaljohn (see Abstract No. pancreatic microsomal membranes. Translation of 234). These anti-idiotypic antibodies were used to nonstructural region clones also indicates that internal immunoprecipitate sucrose gradient-purified signal sequences are difficult to translate through and membranes from chicken embryo fibroblasts. Analysis process; this is particularly true for the signal of the immunoprecipitates by acrylamide gel electro sequence at the carboxy terminus of NS4a. The phoresis showed that a single protein band, with an position of the translational start site appears to apparent molecular weight of 55 kDa, was specifically influence the amount of readthrough of internal signal precipitated by the anti-idiotypic antibody to Mab 49. sequences. It is possible that in order for efficient We have also constructed a ;gt! I library of cDNA translational readthrough to occur, the nonstructural to chicken cellular mRNA and screened this library polyprotein must start and fold as close as possible to with the same anti-idiotypic antibody to Mab 49, Four its in vivo position and conformation. This hypothesis positive clones were found. We are currently trying to is currently being tested by fusing clones that exhibit analyze these clones and determine whether they efficient readthrough with those that do not. encode surface proteins which could serve as the I have complemented the in vitro translation Sindbis virus receptor. analysis of dengue polyprotein cleavage with an in vivo approach using the the baculovirus Autographa 237. Processing of Dengue 2 Polyproteins califomica (AcNPV) to overexpress the structural and Frank Preugschat nonstructural proteins. Several nonstructural region The four serotypes of dengue viruses constitute a clones and a complete structural region clone were serological subgroup of the Flaviviridae. We have been constructed in the transplacement vectors pAc610/6l l working with the SI candidate vaccine strain of the and Spodoptera frugiptera (Sf9) cells were transfected Prl59 isolate of dengue type 2. A library of over with these constructs and wild-type AcNPV DNA. lapping cDNA clones for SI has been obtained and the These recombinant baculoviruses are currently being complete sequence determined (Hahn et al., 1988). characterized. The genome contains a single long open reading frame Reference: of 3388 amino acids that is translated and processed in Hahn, Y. S., Galler, R., Hunkapiller, T., Dalrymple, J. M., Strauss, J. H. and Strauss, E. G. (1988) infected cells to yield approximately 11 different viral Virology 162, 167-180. proteins. Various clones from the library have been combined 238. Expression of Dengue 2 Stroctural Proteins by A to give clones encoding either the entire structural or Recombinant Vaccinia Virus nonstructural region of the genome, with the potential Youngs. Hahn, Edith M. Lenches, Joel M. Dalrymple' to encode polyproteins of approximately JOO to 320 Infections by dengue viruses (types I, 2, 3, 4) 155 continue to pose a major public health problem in and analyzing mutants via a transfection assay has many geographic areas, especially in Southeast Asia, become a cornerstone of modern molecular virology. the South Pacific, the Caribbean and in Central and ln order to better understand the molecular biology of South America. Dengue infection can also cause flaviviruses, we have undertaken the construction of a haemorrhagic fever and shock with a high mortality full-length infectious cDNA clone of the SI vaccine rate. To date there is no commercial vaccine available strain of dengue 2 virus. Historically, the construction for any dengue serotype. Antibodies to the envelope of full-length genomic clones of RNA viruses has been protein E of flaviviruses have been shown to confer a difficult task. In alphaviruses, the extreme 5' protection. We would like to express dengue 2 E sequence has to closely conform to that found in protein from the cloned DNA sequence using vaccinia genomic RNA. The addition of a few extra G's at the virus as a vector as a first step towards the possible 5' end of the genome can reduce the biological activity development of a safe and efficacious vaccine. of the RNA by several orders of magnitude. In flavi The genome of dengue 2 virus consists of a viruses, full-length clone construction has been molecule of positive-strand RNA (10,703 nucleotides in plagued by the generation of deletion mutants during length). The dengue genome codes for a polyprotein cDNA cloning. In addition, silent lethal mutations in that is cleaved to generate the structural proteins C, cloned cDNA have proved to be common in RNA pr(M), and E from the N terminus and the non viruses. structural proteins NS!, ns2a, ns2b, NS3, ns4a,4b, and Currently, the dengue genome is in two stable NS5 from the C terminus. The 2.7 kb DNA fragment pieces: a structural region clone that encodes nucleo from the 5' terminus of dengue 2 (S l candidate vaccine tides 15-2505 of the genome, and a nonstructural strain) cDNA which contains the coding region for the region clone that encodes nucleotides 1945-10,703. A structural proteins was inserted into the VV5.l BstXI site in the region of overlap can be used to fuse vaccinia expression vector. In this construct the these two clones together. In the event that these two dengue coding sequence was placed under the tran clones can not be fused to yield a viable plasmid, it is scriptional control of the vaccinia 7 .5 kDa promoter. possible to simply ligate them together in vitro and Dengue-specific proteins expressed during infection transcribe full-length RNA from the ligation product. with the recombinant vaccinia virus were analyzed by The 5' and 3' ends of dengue cDNAs are being immunoprecipitation with dengue 2 hyperimmune sera. engineered to conform to authentic genomic RNA. The results indicated that the dengue structural Several unique restriction sites are being created in proteins expressed from the recombinant were very silent codon positions, and several multiple restriction similar to those found in dengue-infected cells. The sites are being eliminated by site-directed muta expressed glycoproteins pr(M) and E were cleaved and genesis. This will facilitate swapping in pieces of glycosylated the same way as during dengue virus cDNA in the event that a "perfectly" engineered clone infection. This recombinant vaccinia virus has been is biologically inactive. Once an infectious full-length used to immunize mice and their immune responses are cDNA is available, it will become possible to dissect in currently being evaluated. detail the molecular biology of flaviviruses. 1Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, 240. Organ-Specific Selection of Viral Variants Frederick, MD. During Chronic Infection Rafi Ahmed, Chang S. Hahn, James H. Strauss 239. Construction of A Dengue Infectious A fundamental aspect of viral pathogenesis is that cDNAClone different isolates of a particular virus can differ in FrankPreugschat their ability to cause disease. It is now firmly The application of cDNA technology has established that virulence is genetically determined, revolutionized RNA virus genetics. The process of that viruses can undergo rapid mutation, and that manipulating RNA viruses at the DNA level using site changes in the viral genome can produce dramatic directed mutagenesis, transcribing infectious RNA, changes in pathogenicity. However, we know much 156 less about the selective pressures involved in the Hardy, W. R. and Strauss, J. H. (1988) Processing of the nonstructural proteins of Sindbis virus: Study emergence of viral mutants. We have recently of the kinetics in vivo using monospecific documented the importance of host tissues in the antibodies. J. Viral. 62, 998-1007. Lustig, S., Jackson, A., Hahn, C. S., Griffin, D. E., selection of viral variants during chronic lymphocytic Strauss, E. G. and Strauss, J. H. (1988) Molecular choriomeningitis virus (LCMV) infection (Ahmed and basis of Sindbis virus neurovirulence in mice. J. Viral. 62, 2329-2336. Oldstone, 1988). Our studies have shown that LCMV Rice, C. M., Dalgarno, L., Galler, R., Hahn, Y. S., undergoes mutation during chronic infection in its Strauss, E. G. and Strauss, J. H. (1988) Molecular cloning of flavivirus genomes for comparative natural host, and there is organ-specific selection of analysis and expression. In: Mod.em Trends in viral mutants. LCMV isolates with different biological Virology, Bauer, H., Klenk, H.-D. and Scholtissek, C. (Eds.), Proceedings of the International properties are present in the central nervous system Symposium, June 1986, Giessen, Springer-Verlag, and lymphoid tissues of persistently infected mice. Berlin, in press. Rice, C. M., Levis, R., Strauss, J. H. and Huang, H. V. LCMV clones isolated from brains of carrier mice (1987) Production of infectious RNA transcripts behave like the original Armstrong LCMV strain and from Sindbis virus cDNA clones: Mapping of lethal mutations, rescue of a temperature-sensitive induce potent virus-specific cytotoxic T cell and marker, and in vitro mutagenesis to generate delayed type hypersensitivity responses in adult mice defined mutants. J. Viral. 61, 3809-3819. Strauss, E. G., Levinson, R., Rice, C. M., Dalrymple, J. and the infection is rapidly cleared. In striking and Strauss, J. H. (1988) Nonstructural proteins contrast, LCMV clones derived from spleens of carrier nsP3 and nsP4 of Ross River and O'Nyong-nyong viruses: Sequence and comparison with those of mice cause persistent infections in adult immuno other alphaviruses. Virology 164, 265-274. competent mice. This chronic infection is associated Strauss, J. H. and Strauss, E. G. (1988) Evolution of RNA viruses. Ann. Rev. Microbial. 42, in press. with suppressed virus-specific T-cell responses. Strauss, J. H. and Strauss, E. G. ( 1988) Replication of Experiments are currently in progress to define the the RNAs of alphaviruses and flaviviruses. In: RNA Genetics, Vol. I, Ch. 4, Domingo, E., Holland, genetic and cellular bases of the organ-specific J. and Ahlquist, P. (Eds.), CRC Press Inc., Boca selection. A molecular analysis of these organ-specific Raton, pp. 71-90. variants will be of value not only in understanding the mechanisms of viral persistence and immuno suppression, but may also provide insight into the mechanisms by which viral variants emerge in nature. Reference: Assistant Professor: Barbara J. Wold Ahmed, R. and Oldstone, M. B. A. (1988) J. Exp. Med. Graduate Students: Paul A. Garrity, Jeffrey H. Miner, 167, 1719-1724. Paul R. Mueller, David W. Ruff, Sean Tavtigian, Roger A. Wagner Special Graduate Student: Jane E. Johnson Research and Laboratory Staff: v. Craig Bond, Steve PUBLICATIONS Luber Griffin, D. E., Hahn, C. S., Jackson, A. C., Lustig, S., Strauss, E. G. and Strauss, J. H. (1988) The basis of Support: The work described in the following research Sindbis virus neurovirulence. In: Cell Biology of reports has been supported by: Virus Entry, Replication and Pathogenesis, Rita Allen Foundation Compans, R., Helenius, A. and Oldstone, M. (Eds.), Biomedical Research Support Grant (NIH) UCLA Symposia on Molecular and Cellular Biology, Lucille P. Markey Charitable Trust Vol. 90, Alan R. Liss, Inc., New York, in press. National Institutes of Health, USPHS Hahn, C. S., Hahn, Y. S., Rice, C. M., Lee, E., National Science Foundation Dalgarno, L., Strauss, E. G. and Strauss, J. H. (1987) Conserved elements in the 3' untranslated region of flavivirus RNAs and potential cyclization sequences. J. Mol. Biol. 198, 33-41. Summary: We are interested in several aspects of Hahn, C. S., Lustig, S., Strauss, E. G. and Strauss, J. H. (1988) Western equine encephalitis virus is a RNA physiology and its regulation in animal cells. In recombinant virus. Proc. Natl. Acad. Sci. USA 85, one set of studies we are focusing on molecules that 5997-6001. play key roles in directing cell proliferation and Hahn, Y. S., Galler, R., Hunkapiller, T., Dalrymple, J. M., Strauss, J. H. and Strauss, E. G. (1988) differentiation. These related molecules are cMyc and Nucleotide sequence of dengue 2 RNA and com parison of the encoded proteins with those of other MyoDI. Both are nuclear phosphoproteins and they flaviviruses. Virology 162, 167-180. share some sequence features. Their mechanisms of 157 action are not yet known, but it is clear that they can we have been studying the basis of the metal response direct significant changes in cellular phenotype which by in vivo footprinting and promoter titration experi include changes in the expression of other genes. We ments. The footprinting experiments by Paul Mueller would like to understand how these regulatory path and Steve Salser have allowed us to observe and define ways interact in the developmental context of muscle the patterns of protein DNA contacts that are determination and differentiation. In this system, as associated with basal level expression and with metal in some other cell lineage pathways, withdrawal from induction, and these now lead us to test models for the the cell division cycle is found to be coupled with interaction of different sets of factors by site-directed terminal differentiation. It is not understood how the mutagenesis. The footprinting technology worked out crucial switch to the differentiated state is made. in this system has also been adapted to the muscle Jeff Miner has been investigating the problem by differentiation problem where we are characterizing studying the effects of altered levels of cMyc the in vivo DNA:protein contacts associated with each expression on MyoD-mediated differentiation. step in the developmental progression from fibroblast We are also studying the effects of altered levels to myocyte. With respect to tissue-specific gene of myc in nonmyogenic cells. To do this, Sean regulation, Paul Garrity made the wholly unexpected Tavtigian has set up and characterized cell lines and observation that the mouse MT-I gene transcribed in transgenic mice that express altered levels of cMyc. an entirely different fashion, using different start In the cell lines, effects of elevated Myc on specific sites, in the male germ line, and has further defined genes have been studied under different growth the tissue specificity of this form of MT regulation. conditions in order to define which genes are affected, directly or indirectly, by alterations in Myc levels. A 241. Conditional Expression of Cellular Myc (c-myc) in Tissue Culture crucial problem here is clarifying from a complex literature, which genes are actually affected by Myc. Sean V. Tavtigian We are using a similar approach to study the function Several lines of evidence indicate that the c-myc of MyoDI. When a gene coding for this protein is proto-oncogene plays an important role in cell growth transfected into a wide variety of cells, including some and proliferation. Deregulation of c-myc expression of ectodermal and endodermal origins as well as by transposition, amplification, or proviral insertion mesoderm, some of the transfected cells will become has been observed in a variety of tumors. In tissue determined myoblasts. That is, they have acquired the culture, c-myc overexpression relaxes the growth capacity to differentiate into muscle when a second factor requirements of primary cell lines and increases set of signals is provided. These are signals given by the frequency with which they become established. Its mitogen withdrawal. Key questions are what does transient overexpression can also drive G0-arrested MyoD do in proliferating myoblasts; is it required for cells through a round of DNA replication which is maintenance of the differentiated myocyte phenotype; normally dependent on growth factor stimulation. In and how is MyoD itself regulated? Our approach has cell transformation studies, adenovirus Ela proteins involved making hormone-dependent myoblasts by behave in a manner analogous to c-myc. Further, they introducing into fibroblasts a MyoD gene under the are known to regulate the expression of both viral and control of a hormone-inducible promoter. These cells cellular genes including endogenous HSP 70s and 8- permit us to investigate the consequences of transient tubulins as well as the activity of several enhancers. MyoD expression in either proliferating, un In transient cotransformation experiments, c-myc differentiated cells, or in differentiated myocytes. An appears to stimulate the expression of one of two important part of this effort has involved further Drosophila HSP 70s and one human HSP 70. Also, characterization of a muscle-terminal differentiation c-myc proteins are primarily nuclear in localization gene, muscle creatine kinase, by Jane Johnson in our and bind to DNA cellulose in vitro. Although these collaboration with Steve Hauschka. data suggest that c-myc is involved, directly or A different sort of regulatory problem is presented indirectly, in regulation of . gene expression, its by the metal responsive metallothinein genes. Here mechanism of action remains unknown. 158 In order to study the role of myc activity, we have 242. c-myc Effects on Myogenesis prepared NIH JT3 cell lines containing a gene in which Jeffrey H. Miner the MMTV glucocorticoid regulated enhancer and MT-1 The ability of ectopic c-myc expression to drive metallothionein promoter have been fused to a quiescent cells into S phage indicates an association of minimal c-myc coding sequence. In these cells, tran c-myc expression with cellular proliferation (see scription of the myc transgene is transiently induced Abstract No. 241). Furthermore, cellular differen five- to tenfold by dexamethasone and more stably tiation in myogenic and hematopoietic systems has induced up to twentyfold by zinc or cadmium. In situ been shown to be associated with a transient antibody staining indicates that protein synthesized repression of c-myc expression. We wish to further from these transcripts is localized in the nucleus and investigate the importance of the level of c-myc accumulates to much higher steady state levels than expression during the proliferation and differentiation does the endogenous c-myc protein. phases of myogenic cells using two classes of cells. We are using these cell lines to study several The first is an immortal cell line (NIH JTJ) aspects of myc activity. By growing the cells in carrying a metal inducible c-myc gene and a defined media containing different concentrations of constitutively expressed MyoD 1 gene. MyoD 1 converts various growth factors while adding zinc or dexa some fibroblasts to myoblasts, apparently by making methasone to regulate the level of c-myc expression, them competent to express muscle-specific genes we can dissect the interactions between growth factor when mitogens are withdrawn. It is interesting that stimulation and myc expression which lead to both c-myc and MyoD l are homologous along a 22-amino DNA replication and cell division. Because the acid span. Initial experiments with one clonal line kinetics of myc accumulation and decay upon addition show that in the presence of elevated c-myc, the or removal of zinc are quite rapid, we can also look at percentage of cells that differentiate and express the effect of different durations of myc over myosin is 14--fold lower than in its absence. I am now expression in DNA replication. Initial experiments of in the process of quantitating mRNA expression of this sort have demonstrated that a J-hour pulse of myc c-myc, MyoD L, and muscle-specific genes during the expression is not sufficient to propel Go-arrested cells course of differentiation in the presence and absence into S phase, while a 20-hour pulse is. of forced c-myc expression. Data from these studies define growth conditions The other cells to be investigated are pri under which expression of the myc transgene in our mary myoblasts derived from transgenic mice carrying cell lines has the demonstrable biological effect of a metal-inducible c-myc gene (see Abstract No. 249). inducing DNA synthesis. Cells grown under these Since primary myoblasts, unlike immortal myoblast conditions in turn allow us to look at the effect of lines, are derived directly from cells carrying out a regulated myc overproduction on the expression of normal developmental program, these experiments other genes including endogenous and transfected HSP should clarify whether the Myc effects observed in 70s, c-myc, metallothionein, several a-tubulins, p53 JTJ-MyoD cells also apply to bonafide myoblasts. tumor antigen, a-interferon, and EGF receptor. These An important goal of this study is to determine particular genes have been chosen either because of whether c-myc has a direct effect on differentiation the timing of their expression during the cell cycle or by inhibiting muscle-specific gene expression or because of indications in the literature that their whether it has an indirect effect by preventing expression might be myc regulated. Should any of withdrawal from the cell cycle. We are now testing these genes turn out to be regulated by c-myc, a whether the latter is true and will use the ability to comparison of the kinetics of their transcriptional transiently elevate and then reverse c-myc over regulation and cytoplasmic accumulation will deter expression to test the former hypothesis. Also, should mine the step at which c-myc acts in the production of forced c-myc expression initiated after the onset of the message. myogenesis (withdrawal from the cell cycle, synthesis of muscle-specific proteins) inhibit muscle-specific 159 gene expression, it would provide evidence for an 244. Analysis of Muscle Creatine Kinase . Transcriptional Regulatory Elements m effect of c-myc on muscle gene expression indepen Transgenic Mice dent of typical cell cycle effects. 1 Jane E. Johnson, Stephen D. Hauschka , Barbara Wold Skeletal muscle development involves an initial 243. Conditional Myoblasts period of myoblast replication, followed by a phase in Barbara Wold which some myoblasts continue to proliferate while MyoDl is a gene product whose expression can others undergo terminal differentiation. The latter cause a fibroblast to behave as if it is a skeletal myo process involves the permanent cessation of DNA blast. That is, continuous expression of MyoD from a synthesis, activation of muscle-specific gene expres heterologous, transfected gene apparently confers sion, and fusion of single cells into multinucleated myogenic determination. These cells do not express muscle fibers. The muscle-specific isozyme creatine terminal differentiation muscle genes until a second kinase (MCK) can be used as a model to study the condition is also met. This is provided by the with mechanisms regulating the activation of the muscle drawal of mitogens from the medium. In several specific genes. existing myoblast cell lines, MyoDl is expressed in Several muscle-specific genes including MCK are both proliferating myoblasts and in differentiated known to be activated transcriptionally during myo myocytes at the RNA level. We now want to find out genesis. In earlier work, the regulatory elements 5' to what MyoD is doing at each step in the developmental the transcription start site of the mouse MCK gene progression. To do this, a chimeric gene was con that specify its activation during myogenesis in culture structed. It places expression of the MyoDl cDNA have been identified. Two muscle cell type-specific sequence, originally isolated by Davis, Weintraub and enhancers responsible for high level expression were Lassar, under the control of the hormone-inducible identified, one between 1050 and 1256 nucleotides (nt) promoter of the mouse mammary tumor virus (MMTV). upstream of the transcription start site, the other Transfection of fibroblasts with this gene produced within the first intron. Even in the absence of the cell lines that express heterologous MyoDl in the enhancers, low level expression from 800 nt upstream presence of added dexamethasone, a synthetic gluco sequence retains some muscle specificity. In addition corticoid. Muscle differentiation is observed in these to these positive regulatory elements, there is some cells only in the presence of Dex and the absence of evidence for negative sequence elements which act in mitogens. An initial experiment in which hormone was proliferating myoblasts. either retained in the medium after differentiation or In this work we have generated transgenic mouse removed for varying lengths of time showed that the lines containing various MCK promoter-deleted genes continued expression of MyoD appears to be required that enable us to study the expression from the MCK for continued accumulation muscle creatine kinase regulatory sequences through development in many (MCK) expression. This suggests that MyoDl is tissues. For example, do the regulatory elements required to maintain the differentiated state. Induced identified in culture act in a similar manner when expression of heterologous MyoDl does not, however, integrated into the germline of a mouse? Is the trigger expression MCK prior to mitogen removal, enhancer limited to activity in skeletal muscle or is it consistent with a model in which signals dependent on also active in cardiac muscle and smooth muscle? Are mitogen withdrawal have combinatorial effects with sequences responsible for tissue specificity separable MyoD on muscle-terminal differentiation genes such as from those responsible for quantitative control? MCK. The conditional MyoD cells are now being used We have made 25 independent transgenic mouse to identify and define genes that are affected by MyoD lines containing one of six different MCK 5' sequences in the earlier proliferative myoblast-like state. fused to the bacterial chloramphenicol acetyl Finally, this inducible MyoD gene allows us to inves transferase (CAT) protein coding region. Analysis of tigate the effects of heterologous MyoDl expression CAT activity from a variety of tissues from these on the endogenous gene. animals has indicated that each of the positive 160 regulatory elements described above is capable of a MCK gene. Preliminary results show a myogenic remarkable level of skeletal muscle specificity. CAT specific footprint over an AP2 site in the enhancer. activity is three to five orders of magnitude greater in This sequence is not protected in other mesodermal skeletal muscle than in non-muscle tissues such as lines such as BALB/c 3T3 fibroblasts. Surprisingly, spleen, kidney, and liver. The contribution of these these fibroblasts do have a specific footprint just 5' to positive regulatory factors to the expression of MCK the enhancer which is not seen in the myogenic or in cardiac muscle is not clear. It appears that an protein-free DNA samples. We are presently extending element located between 3300 and 1256 nt upstream of the analysis to cover the entire enhancer sequence on the transcription start site may be required for high both strands. level expression in cardiac muscle. In addition, only Fibroblasts can be converted to the myogenic the 5' enhancer element between nt 1050 and 1256 and lineage by the expression of the MyoDl gene. MyoDl not the intragenic enhancer appears to function in is normally expressed in both myoblasts and myocytes. cardiac muscle. These data suggest potential dif It appears to play a pivotal role in conferring myogenic ferences in utilization of regulatory sequences located potential because when it is transfected into many throughout the MCK 5' flanking region and first intron nonmyogenic lines, it converts them into myogenic between skeletal and cardiac muscle. cells. A planned experiment will be to see if the conversion of BALB/c 3T3 fibroblasts into myoblasts 1Biochemistry Department, University of Washington, Seattle, WA. and then myocytes is accompanied by a corresponding change in the chromatin structure of the MCK 245. Protein:DNA Interactions in the Muscle Creatine enhancer, and whether this chromatin change requires Kinase Enhancer the continued expression of MyoDl. Paul R. Mueller, Jane E. Johnson As a myoblast differentiates into a myocyte, many 246. Regulation of Metallothionein Gene Expression changes take place, including the cessation of DNA Paul R. Mueller synthesis, fusion of single cells into multinucleated Eukaryotic genes can be regulated at a variety of muscle fibers, and activation of muscle-specific gene levels including the transcriptional, post expression. Muscle creatine kinase (MCK) is among the transcriptional, and translational levels. All of these terminal differentiation genes known to be activated forms of regulation are thought to involve the inter transcriptionalJy during this process. A DNA sequence action of cis-acting sequence elements in and around element confers tissue-specific expression as a 256 bp the gene with trans-acting factors, and I am interested enhancer. This enhancer contains homologies to the in understanding how these trans-controlling elements SV40 and lg enhancers as well as to muscle-specific are influencing gene expression. The metallothionein elements such as the "CArG" box. We are using (MT) gene provides a good model system to ask this genomic footprinting to examine the developmental question. MT is a highly conserved housekeeping gene changes in the protein:DNA interactions over the MCK that can be induced by a variety of agents (metal, enhancer as myoblasts differentiate into myocytes. glucocorticoids, phorbol esters, etc.) above an We have previously used genomic footprinting to appreciable basal level of expression. Three indepen characterize the MT-1 promoter. The method used for dent lines of experiments have been undertaken to that analysis indirectly labeled the footprinted DNA by better understand the regulation of MT. primer extension. It had a minimal requirement of -20 At least part of the inducibility of MT is controlled copies of the target sequence per mammalian genome at the transcriptional level. Our present understanding and was therefore limited to promoters that were of transcriptional regulation suggests that it is depen amplified. By using the thermal stable enzyme Taq dent on the interaction of promoters and enhancers polymerase to extend specific primers in place of with transcription factors, and such interactions can reverse transcriptase, we have increased the be visualized by DNA footprint analysis. I have used a sensitivity of this method -30 fold. We have adapted modified genomic sequencing procedure to footprint this method of footprinting to visualize the single copy the MT promoter in its native state, i.e., with 161 transcription factors bound to actively transcribing (perhaps the MREs), I would expect to observe de DNA. By this type of analysis I have observed two creased in vivo binding to these elements upon metal patterns of protein:DNA interactions in the MT induction. The binding of such limiting factors could promoter. The first is observed over DNA sequences be assayed by in vivo footprinting. thought to be involved with basal level expression (the SP! and MLTF) binding sites), and these footprints do 2~7. Tissue-Specific Expression of Mouse not change upon metal induction. The second pattern Metallothionein Genes is observed over the genetically defined metal Paul A. Garrity responsive elements (MREs), and these footprints are The mouse metallothionein genes (MT-1 and MT-2) dependent on heavy metal stimulation. That the basal encode highly related 61-amino-acid, cysteine-rich footprints do not change upon induction suggest that proteins (20 cysteines per molecule) that bind to a the MREs are not interacting through these elements variety of metals-Zn, Hg, Cu, Pb, Cd, etc. Exposure to increase transcription. to heavy metals leads to an increase in steady-state Some of my !ootprinting results suggest that RNA and protein levels in many tissues. Such exposure dillerent factors might be interacting with the same has been shown to increase the rate of transcription region of DNA in vivo. The sequence around MRE-D from the mouse MT-1 gene in liver and kidney. At the contains a consensus element for both MRE and SP 1. RNA level, MT-1 expression varies tissue specifically In vitro-purified SP 1 binds to this region, but in in vivo and developmentally. The response to heavy metal the footprint pattern is clearly that of an MRE. exposure is similarly heterogeneous. These phenomena Perhaps under different in vivo conditions, the identity lie at the focus of our investigation. of the factor occupying this region is switched. Point The promoter of the mouse MT-I gene has been mutants in this region are being constructed to analyzed in detail to identify the sequence require ascertain the optimal sequence requirements for SP 1 ments necessary for basal and induced transcription. and MRE binding. The in vivo patterns of DNA-protein interactions on In an independent set of experiments, I have asked the promoter in the absence and presence of metal how induction is controlled. Specifically, is induction have been outlined as well. This wealth of information controlled by positive or by negative trans-acting makes the MT-I promoter particularly tractable for factors? This was done by limiting the availability of the study of transcriptional regulation (and its small such factors by stably titrating them out with size, under 400 nt, could make it an attractive increasing copies of cis-acting elements. In the substrate for studies of posttranscriptional regulation). presence of several hundred copies of the MT promoter The presence of the similarly expressed and inducible and the 3' nontranscribed regions, the inducibility of MT-2 gene also allows for useful comparison. the endogenous MT genes is reduced to 25% of wild MT-l and MT-2 RNA levels increase in all tissues type levels. This shows that induction is controlled at (except testis) examined upon CdS04 exposure. ln the least in part by a limiting positive trans-acting testis the high basal level of both messages is un factor. Basal level expression (in the absence of changed by Cd. The MT-2 gene RNA start site is inducers) is unaffected by the increased gene dosage, essentially invariant in all tissues examined and in which suggests that the factors essential for basal cultured L cells. However, the MT-1 gene shows two level expression alone are present in relative specific patterns of multiple upstream start site usage: abundance and that these factors can function one is shared by testis, L cells, brain, spleen, intestine, independently of the metal responsive factors. and skeletal muscle; the other is shared by kidney, Presently, I am investigating whether the factor(s) liver, and intestine. None of the upstream start sites I have titrated is acting at the transcriptional or post are a!!ected by Cd in these tissues, though some are transcriptional level. Titration at the transcriptional repressed by Cd in L cells. The species of transcript level should be evident in in vivo transcriptional assays exhibiting the classical +l start site is the one that (nuclear run-ans). In addition, if the titration is of a increases upon Cd exposure in all non-testis samples. factor that binds the metallothionein promoter The upstream start site RNAs are seen in 162 quantities approaching those of the classical start only in testes in a recent series of experiments, including in testis, where upstream RNAs outnumber + 1 RNAs single cell assays and immunostaining, to clarify the by about 5:1. The presence of a multitude of starts in pattern of myc expression in germ cells. Using in situ several major clusters in the -20 to -130 upstream hybridization on cell spreads from mouse testes, I have region mimics that of SP-I-dependent, TATA-less identified several cell types containing c-myc RNA. promoters and corresponds with the positioning of SP-1 These are the Sertoli cells, as expected, as well as the binding sites and the lack of a TAT A homology in the premeiotic cells, and to a lesser extent the early region. We have used a full-length RNase protection meiotic stages. No c-myc transcripts are observed in assay and Northern blots to demonstrate that all the various stages of spermiogenesis. The in situ detectable MT-1 RNAs are spliced and undergo evidence has been corroborated by RNA protection poly(A)-site cleavage as previously described for MT-I studies using RNA from purified cell types. The pre RNAs. We are currently investigating the distribution meiotic cells show the highest levels of c-myc RNA of the messages in the various cell types of the testis with decreasing amounts in early meiotic cells and and during testis development. Our data indicate that none detected in spermiogenic cells. the level of classical +I MT-I RNA remains essentially I have also looked at the distribution of c-myc constant as the germ cells proceed through spermato protein in the mouse testes with a panel of anti c-myc genesis, but that the upstream start site RNAs antibodies. In a number of experiments, including increase greatly at the pachytene stage of meiosis and Westerns and immunostaining (ICAs), several persist into the post-meiotic spermatids. MT-1 interesting observations were made. The c-myc expression in the accessory (non-germ) cell types of protein, which has a real molecular weight of 40-50 the testis is now being investigated. We are also kDa, has an aberrant mobility of 62-67 kDa. In most studying the response of the MT genes to other tissues, we see the 62-67 kDa protein. However, in the inducing agents (Zn, hormones). testes the 62-67 kDa protein is missing and we find a protein of 40-45 kDa. In agreement with the RNA 248. c-myc Expression During Spermatogenesis data, the ICAs show a discreet subpopulation of cells V. Craig Bond, Ray Koski 1 staining for the c-myc protein. They consist of C-myc expression is usually associated with spermatogonia and/or Sertoli cells. And, when we growing, undifferentiated somatic cells. In many cell examined c-myc protein in samples over a range of lineages, differentiation is coupled to strong down ages from 6 days to adult, a change in the mobility regulation of myc mRNA and protein levels. One from a higher apparent molecular weight to the 40-45 possible example of this takes place during spermato kDa molecule is observed. The protein data suggest genesis. The premeiotic cells (spermatogonia) can be that 1) in the testes, the c-myc protein is not identical considered undifferentiated somatic cells and would be to the predominant forms in other tissues; 2) c-myc ~s expressing c-myc. When these cells move into their developmentally regulated from juvenile to adult; and meiotic phase and are committed to becoming germ 3) the protein is expressed in the spermatogonia and/or cells (sperm), they can be considered differentiating, the Sertoli cells. It is possible that the protein we and c-myc expression would be down regulated. observe in the testes is not c-myc but a related However, because meiosis is a unique process, with molecule. However, the consistency of the ICA data respect to the cell cycle, it is possible that a testes with the in situ studies lends credence to the protein specific myc (t-myc) is involved instead of c-myc, or being c-myc. This relationship as well as other that no myc is involved at all. One prior study of c questions of c-myc expression are currently being myc RNA in testes cell populations led Stewart et al. pursued. (1984) to conclude that only the accessory cells Reference: (Sertoli) express c-myc. Issues of cell population Stewart, T. A., Bellve, A. R. and Leder, P. (1984) purity left open the possibility of myc expression in Science 226, 707-710. germ cells. 1 AMGen, Thousand Oaks, CA. I have examined the status of myc RNA and protein 163 249. MT /c-myc Transgenic Mice and differentiation as well. It is presently thought that these proteins act, at least in part, by altering the Jeffrey H. Miner, Jane E. Johnson, Sean V. Tavtigian, Jessica A. Dausman rate of transcription from a selected subset of genes. We have produced 13 lines of transgenic mice In mammals, the gene family consists of at least three which contain the entire c-myc protein coding region (and probably more) distinct members whose expres under the control of the metallothionein promoter. sion is specific for different cell types and tissues. Several of these lines express the cDNA transgene Our interest in the function of these proteins in the upon acute stimulation with cadmium. RNA is most context of normal growth and differentiation has led prominently expressed in liver, intestine, and kidney, us to use Xenopus as a model system. as is generally expected for metallothionein-promoted I have isolated cDNA clones for Xenopus c-myc, genes. Of these, two independent lines have been one of three distinct myc gene family members that subjected to long-term induction by adding 50 mM zinc have been observed in mammals. I am presently using to the drinking water. One possible outcome of the cloned myc gene, along with myc immune chronic expression would be an increased occurrence reagents, to characterize the expression and activity of tumors, but following mice on zinc for up to 6 of the gene and its products in oogenesis and early months has not yet revealed increased embryogenesis. Northern blot and quantitative RNase tumorigenicity. However, we have observed some protection assays show that maternal c-myc message lethality in pups at about two weeks of age when zinc is present in large quantities in stage VI oocytes and in had been administered to the mother since before early embryos. I ts prevalence falls until mid-blastula conception, and the basis of this lethality is under transition, at which time newly activated embryonic study. transcription supplants the maternal stores. The un Several additional noteworthy featt:ires of the usually high level of c-myc message in the mitotically MT /myc mice are found in the genetics of the trans inactive oocyte and in the early embryo contrasts gene. For example, the 13 lines are derived from only sharply with the pattern of myc RNA expression in all eight different founder mice. We base this conclusion cell types examined previously. In those cases, myc is on Southern blot banding pattern and intensity dif expressed only in mitotically active cells and the RNA ferences among offspring of individual founder mLce. is extremely unstable, with a half-life of less than 30 Moreover, one of these founders has produced two minutes. In contrast to this, I have shown that in early different lines which appear to carry the transgene on Xenopus development the myc RNA has a half-life of the Y chromosome, itself a rare occurrence. approximately four hours; as a result of this unusual These transgenic mice should provide us with cells stability, the oocyte contains a very high level of myc containing a c-myc gene that is inducible in tissue RNA not found in other non-mitotic cells. The struc culture. We can then examine the effects of ectopic ture of myc RNA suggests that translational control c-myc expression on cells that have carried out a mechanisms may affect the stability of the message, normal developmental program. For example, primary and thence the availability of the gene product. Tests myoblasts can be routinely recovered from the mice, of the role c-myc and related genes may play in oocyte and we have established a myoblast cell line from one maturation and subsequent fertilization and cell of the expressing transgenic lines. We can now ask division are being performed. what effects c-myc overexpression will have on the 251. Self-Cleaving RNA differentiation of these myoblasts into multinucleated myotubes (see Abstract No. 242). Roger A. Wagner Self-cleavage of RNA is an important step in the 250. Xenopwr myc-Family Genes rolling circle replication mechanism of several plant Roger A. Wagner viroids and virusoids and has been implicated in the The myc family of nuclear phosphoproteins is transposition mechanism of the C. elegans transposon thought to influence normal and aberrant cell Tc6. In the viroids, autocatalytic cleavage of a proliferation and perhaps play a role in commitment circular RNA transcript occurs at two sites to produce 164 a "plus" and a "minus" strand. In vitro, this reaction is associated with the injection of deoxyoligonucleotides protein independent and requires only the presence of that, in conjunction with endogenous RNase H, can be a divalent cation, usually Mg++. Comparison of used to achieve the same goal. cleavage sites from the viroids, transposon, and self Reference: cleaving transcripts of newt satellite DNA reveals a Uhlenbeck, 0. C. (1987) Nature 328, 596-600. consensus sequence that may form what is termed the ''hammerhead" structure, PUBLICATIONS Bond, C. and Wold, B. J. (1987) Poly-L-ornithine nC:G mediated transformation of mammalian cells in culture. Mo!. Cell. Biol. 7, 2286-2293. A:U A Johnson, J., Wold, B. and Hauschka, S. ( l 988) Analysis GA Ate/ of muscle creatine kinase sequence elements regulating skeletal and cardiac muscle expression - ••••• N N N N N N N---- in transgenic mice. Genes & Dev., in press...... N'N'N' CN'N'N'N'------Mueller, P., Salser, S. and Wold, B. (1988) Constitutive A U and metal-inducible protein: DNA interactions at G GNA the mouse metallothionein I promoter examined by in vivo and in vitro footprinting. Genes & Dev. 2, 412-427. Ngai, J., Bond, C., Wold, B. and Lazar ides, E. ( l 987) where N is any nucleotide and N' is its complement, Expression of transfected vimentin genes in with cleavage occurring at the arrow. The reaction differentiating murine erythroleukemia cells reveals divergent cis-acting regulation of avian and produces 5' hydroxyl and 2',3' cyclic phosphate termini. mammalian vimentin sequences. Mal. Cell. Biol. 7, Uhlenbeck ( 1987) has shown that two in vitro 3955-3970. Preugschat, F. and Wold, B. (1988) isolation and synthesized transcripts capable of interacting to form characterization of a Xenopus laevis C protein an intermolecular hammerhead core structure with cDNA: Structure and expression of a hnRNP core protein. Proc. Natl. Acad. Sci. USA, in press. five nucleotide "arms" promote rapid cleavage of the "substrate" upper strand of the structure and that the "enzymatic" lower strand is capable of catalyzing many such reactions. We have demonstrated that cleavage can occur in two-stranded hammerhead structures which contain longer hybridizing arms with non-hybridizing sequence at each end, and are further optimizing the reaction to allow the use of specifically tailored enzymatic strands as "RNA restriction enzymes" with which to cleave full-length mRNA molecules. These short RN As are easily produced . in large quantity from synthetic oligonucleotide templates with T7 RNA polymerase, and can be capped and polyadenylated to enhance stability in vivo. After characterization in vitro, sequence-specific enzymatic strands will be microinjected into Xenopus oocytes and embryos with the aim of eliminating or greatly diminishing developmentally interesting mRNA populations. The proven ability of antisense RNA molecules and DNA oligonucleotides to form stable duplexes with mRNA in vivo indicates that accessibility of messages is not severely limited. The use of this "ribozyme" to cleave mRNA in a sequence specific fashion might also avoid the toxicity CELLULAR BIOLOGY AND BIOPHYSICS Charles J. Brokaw Scott D. Emr John J. Hopfield Jean-Paul Revel 167 Professor: Charles J. Brokaw containing the flagellar image at 1024 by 512 pixels Research Fellow: Dan Eshel (16 pixels per µm) with 8 bits of grey level information. Research and Laboratory Staff: Ted Apel, Birgitta R. 1 Jentoft-Nilsen , Laurence G. Jones, Sandra N. Software has been developed to determine the head Nagayama axis and to track the center line of the flagellum, 1 Undergraduate, California Institute of Technology. avoiding the subjective biases that can be introduced by manual digitization. Support: The work described in the following research The first result to emerge from these new analyses reports has been supported by the National Institutes is evidence that when active sliding is initiated in a of Health, USPHS. new bend that has been formed at the base of a flagellum, the initial rate of sliding is low, and the Summary: The bending of eukaryotic flagella and cilia sliding rate builds up gradually over a period of is generated by active sliding between the doublet approximately 0.1 beat cycle before a steady sliding microtubules which are the dominant structural rate is achieved. The straight regions between bends feature of these organelles. The active sliding process are therefore generated by a difference in sliding rate must be regulated in some manner to provide for the between successive bends, combined with a limitation other features of flagellar motion-oscillation and on the growth of bend angle. This view contrasts with bending wave propagation-and to explain the diversity the previous conclusion that the straight regions were of flagellar bending patterns. generated by a delay in the time of initiation of sliding Much of our experimental study of flagella exploits in a new bend. the ATP-reactivated movements of demembranated Further study is required to decide whether this flagella, which can be exposed to diverse environ starting transient is revealing properties of the cross ments. These movements can be photographically bridge mechanism that generates active sliding, or a recorded with high spatial and temporal resolution. higher level control mechanism. Computer-assisted analysis of the photographic images Just before the initiation of sliding in new reverse allows us to obtain extensive quantitative data on bends, there is often a relaxation of curvature associ flagellar behavior. Our recent work has emphasized ated with lengthening of the bend and corresponding to some higher-level regulatory mechanisms involving passive sliding which might serve as a trigger for the cAMP-dependent phosphorylation, calcium and initiation of active sliding in the same direction. calmodulin, with the aim of finding how these regulatory mechanisms interact with critical control 253. Direct Visualization of Sliding Between points in the basic mechanisms for oscillation and bend Microtubules in Beating Flagella propagation. Charles J. Brokaw Sliding between outer doublet microtubules has 252. Initiation of Sliding in New Flagellar Bends: been assumed to occur during, and to be responsible A Starting Transient for, the bending of cilia and flagella. This has been Charles J. Brokaw inferred previously from observations of sliding dis We have been exploiting the large amplitude, low placements by electron microscopy of fixed flagella, frequency, bending waves that can be obtained with and from direct visualization of sliding disintegration demembranated sea urchin sperm flagella reactivated of protease-treated, demembranated flagella. at low MgATP concentrations in the presence of 10 Sliding between flagellar outer doublet micro mM LiCl to examine the initiation of flagellar bends tubules in actively beating flagella has now been with high time resolution (approximately 30 photo verified by observing the relative movements of 40 nm graphic images per beat cycle). The bending waves gold beads attached to the outer doublet microtubules generated under these conditions have unusually long of demembranated sea urchin sperm flagella. In straight regions between bends propagating along the optimal cases, where two beads attached to different flagellum. Photographs have been analyzed by using a doublets are only about 1 µm apart, relative movement digitizing camera to digitize the region of the film of the two beads can be detected visually, using dark- 168 field illumination and slowly beating flagella. Exten 255. Effects of Phosphorylation on Extraction of Outer Dynein Arms sive data can be obtained by photographic recording, with the bead positions measured by computerized Birgitta R. Jentoft-Nilsen image analysis methods. The results not only confirm A brief exposure to high salt concentrations (e.g., the sliding microtubule hypothesis, but show that there 0.5 to 0.6 M KC!) has been shown by others to is a distribution of relative sliding velocities which is specifically extract the outer row of dynein arms from not consistent with the hypothesis of a restriction to demembranated sea urchin sperm flagella, resulting in sliding between only two groups of doublets. preparations that beat with approximately 1/2 normal These observations have also been facilitated by beat frequencies when reactivated with MgATP. I set the use of LiCI to modify the bending of flagella at out to examine the properties of these outer arm very low MgATP concentrations, so that very large depleted flagella, in combination with procedures bend angles (and large sliding displacements) are previously developed in this laboratory for activation obtained, with .the bends separated by relatively long of full sperm motility by cAMP-dependent phosphoryl straight regions where the measurement of sliding ation. An unexpected result was obtained: KCl displacement can be made along a straight line. concentrations of 0.6 to 0.7 M KCI could be success fully used to extract outer arms (monitored by beat 254. Wavelength-Determining Mechanisms in frequency decrease) before exposure to cAMP. How Ciona Sperm Flagella ever, after brief exposure to cAMP under conditions Charles J. Brokaw favorable for phosphorylation, KC! concentrations of Under many circumstances, the wavelength of only 0.42 M were sufficient, while exposure to higher flagellar bending waves acts as if it were determined KC! concentrations (0.56 M) destroyed the capability by the same physical interactions that determine the for reactivated motility. This observation may provide wavelength of passively propagated bending waves on a new avenue for determining the targets for cAMP an inert elastic filament. The wavelength decreases dependent phosphorylation and the mechanisms for with increased viscosity, and decreases when the activation of motility by this phosphorylation. frequency is reduced at constant viscosity. Two spermatozoa swimming with their f.lageUa stuck together show increased wavelength, because two PUBLICATIONS flagella have twice the elastic bending resistance, but almost the same viscous resistance as a single Brokaw, C. J. 0987) A lithium-sensitive regulator of sperm flagellar oscillation is activated by cAMP flagellum. dependent phosphorylation. J. Cell Biol. 105, 1789- Demembranated spermatozoa from the tunicate 1798. Brokaw, C. J. (l 987) Regulation of sperm flagellar Ciona intestinalis have unique properties. In contrast motility by calcium and cAMP-dependent phosphorylation. J. Cell. Biochem. 35, 175-184. to sea urchin spermatozoa, which become non-motile Brokaw, C. J. (l 988) Bending wave propagation by at pH values below 7 .6, Ciona spermatozoa can be microtubules and flagella. Math. Biosciences, in reactivated with MgATP to show good motility over a press. Eshel, D. and Brokaw, C. J. ( ! 988) Determination of wide pH range, at least from pH 6.8 to 8.0. At a the average shape of flagellar bends: A gradient curvature model. Cell Motility and the MgATP concentration of 0.125 mM, the beat frequency Cytoske!eton 9, 312-324. is about 18 Hz and is independent of pH. However, the wavelength decreases gradually from about 57 µm at pH 8.0 to 41 µm at pH 6.8. A viscoelastic explanation would require a fourfold reduction in bending elasticity of the flagellum to explain this reduction in wave length. Independent measurements of the elastic bending resistance of these flagella as a function of pH may be able to test this explanation. 169 Assistant Professor: Scott D. Emr the course of these studies. It seems likely that a Research Fellows: David M. Bedwell, Daniel J. Klionsky, Thomas A. Vida subset of gene functions may be shared among each of Graduate Students: Elliot Altman, Lois M. Banta, Kurt these different processes. Progress toward a molecular Eakle, Paul K. Herman, Jane S. Robinson, Scott Strobel understanding of any one of these may shed light on Research and Laboratory Staff: John A. DeModena, the mechanisms contributing to another. Martha Fiallos, Jane D. Goldsborough, Irma 1 2 During the past year, we have continued our Ribeiro, Kyuson Yun , Sangsu Yun analysis of the sequence signals and protein sorting 1Undergraduate, California Institute of Technology. machinery that direct protein delivery through the 2Undergraduate, University of California, Los Angeles. yeast secretory pathway to the lysosome-like vacuole (ER->Golgi+Vacuole) (Figure 1). In addition, we have Support: The work described in the following research undertaken a detailed molecular analysis of the amino reports has been supported by: terminal leader sequence on a mitochondrial protein American Cancer Society General Electric Foundation which directs mitochondrial targeting and import of Lucille P. Markey Charitable Trust the protein. T award an understanding of protein National Institutes of Health, USPHS National Science Foundation, "Presidential sorting to the vacuole, our accomplishments of the Young Investigator Award" Natural Sciences and Engineering Research past year include the following. 1) We have continued Council of Canada our application of the SUC2 (codes for secreted The Procter & Gamble Co. invertase) gene fusion approach to map the vacuolar Sear le Scholars Program, The Chicago Community Trust protein sorting information contained in the vacuolar Helen Hay Whitney Foundation glycoprotein proteinase A (Pr A). As yet, no significant primary sequence similarities have been detected between this sorting signal and the vacuolar sorting Summary: Research in the lab is directed at answering signal we have mapped previously in carboxypeptidase a fundamental problem in cell biology: How are the Y (CPY). Clearly, our present efforts to map and constituent proteins of a given organelle directed from mutate additional vacuolar sorting signals will be a common site of synthesis in the cytoplasm to a critical for identification of the functionally relevant unique site of function in the appropriate intracellular features contained in this class of secretory protein compartment. Among the potential experimental sorting signals. 2) We have generated synthetic systems that can be employed to address this question, peptides based on the PHO& gene sequence, coding for we have chosen to use the yeast Saccharomyces vacuolar alkaline phosphatase (ALPase), and used them cerevisiae as our model system: l) because of the to raise antisera in rabbits that specifically recognizes wealth of genetic, molecular, and biochemical yeast ALPase. We are presently using these antisera techniques that readily can be applied in this simple to study the synthesis, sorting, and processing of this eukaryote, and 2) because the general pathways that vacuolar enzyme. 3) We have continued to employ the convey proteins from the cytoplasm to their correct CPY-Invertase fusion-based selection scheme to organelle destinations appear to be highly conserved isolate yeast mutants that exhibit defects in vacuolar among all eukaryotes. protein targeting (vpt mutants). The vpt mutations The protein sorting problem includes within it many have been assigned to 33 different complementation other interesting questions. Because the functional groups indicating the involVement of many gene and structural features of a given organelle are functions either directly or indirectly in the process of conferred, in large part, by the unique set of proteins vacuolar protein sorting. Biochemical characterization that reside within it, it follows that an understanding of the vacuolar sorting defects associated with repre of how protein sorting is regulated should provide sentative vpt mutants has indicated that most of the important insights into how organelle biogenesis itself mutants affect the sorting of only a subset of vacuolar is controlled. In addition, we expect that the question proteins. Some of the mutants, however, appear to of how organelles faithfully replicate, divide, and exhibit general defects in the sorting of both soluble segregate during mitosis also may be addressed during and me1T1brane-associated vacuolar proteins. 170 Morphology studies indicate that biogenesis of the export apparatus that direct protein targeting and vacuole compartment also is defective in this latter translocation across a biological membrane (analogous set of vpt mutants. 4) We have recently cloned five of to protein transfer across the ER membrane in the VPT genes by complementation in yeast and have eukaryotic cells). begun molecular characterization of these genes. Our goals are to sequence the VPT genes, raise specific antisera for detecting the VPT gene products, analyze their biosynthesis, and locate their site of action in the yeast cell. 5) Toward the ultimate goal of defining the precise biochemical function of certain of the VPT gene products, we are attempting the in vitro re constitution of distinct steps in the vacuolar protein sorting process. Cell extracts derived from the different vpt mutants will be tested for biochemical complementation of the different vacuolar protein sorting events that can be reconstituted in the in vitro reaction. 6) We have completed the sequencing of the Figure I. Intracellular protein delivery pathways in SECl8 gene. Mutations in this gene result in a the yeast Saccharomyces cerevisiae. In dividing cells, much of the secretory protein traffic is directed temperature-conditional block in the movement of toward the bud (at right) which ultimately will develop secretory proteins between the endoplasmic reticulum into a new daughter cell containing a complete organelle complement similar to that shown in the and the Golgi complex (see Figure I). Antisera raised mother cell (at left). against the SEC18 protein has been used to show that this protein is not glycosylated and appears to associate with a high-speed pellet fraction, possibly 256. Analysis of Vacuolar Targeting Signals in Several Yeast Hydrolases corresponding to the transport vesicles that shuttle membrane and protein between the ER and Golgi. Daniel J. Klionsky, John A. De Modena In our efforts to identify the critical sequence and The yeast vacuole contains a variety of hydrolytic structural features of a mitochondrial leader sequence enzymes including proteinase A (PrA), carboxy that enable it to specifically and efficiently guide peptidase Y (CPY), proteinase B (PrB) and alkaline protein import into mitochondria, we have: 1) defined phosphatase (ALP). Extensive work has been done on redundant mitochondrial protein import information at CPY and PrA to determine how these proteins are the amino terminus of the F 1-ATPase a-subunit pre targeted to the vacuole. We have undertaken cursor protein. Three separate sequence regions each additional studies combining gene fusions and deletions contain functional mitochondrial protein import infor in the wild-type proteins to analyze delivery of PrB mation; and 2) used an oligonucleotide cassette muta and ALP to the vacuole in Saccharomyces cerevisiae. genesis scheme to saturate one of the functiona11y Fusion of the gene encoding alkaline phosphatase, redundant sequence domains with single, double, and PH08, to the SUC2 gene, coding for the normally triple mutations. The mutant sequences were secreted yeast enzyme invertase, results in the positioned in front of a a-subunit gene lacking all its production of a hybrid protein that retains invertase mitochondrial import information. Based on the import act1v1ty. The invertase activity serves as a useful competence or incompetence of the various mutant marker to follow the localization of the hybrid protein. signals, we have been able to define a set of PH08-SUC2-encoded hybrid proteins that contain 67 characteristics that are crucial for the normal or more N-terminal amino acid residues of ALP are functioning of this import signal. efficiently directed to the vacuole. This is similar to Finally, our lab has maintained its interest in the result seen for CPY and PrA. We will use deletions bacterial protein export as it serves as a "simple" in the wild-type ALP protein to determine if the N genetic model for analyzing the requisite signals and terminal sorting signal is necessary, as well as 171 sufficient, for vacuolar localization. We are currently media at 37°C; in the case of vpt3, very small colonies examining the biosynthesis of alkaline phosphatase and are formed at 37°C. The approximate map locations of have data suggesting that it may be delivered to the two of the ts vpt mutants have been found. Tetrad vacuole by a mechanism different from that used in analysis has shown that vpt3 is linked to the ADE2 the transport of CPY and PrA. We also have begun an locus and thus maps to chromosome I 5R, and vptl 5 is analysis of the vacuolar targeting signal in proteinase linked to LYS2 and consequently maps to chromosome B. Preliminary data indicate that the targeting signal 2R. in PrB may not be located at the N terminus of this Surprisingly, the ts mutants did not exhibit protein. This would be in contrast to the results seen additional vpt-associated phenotypes (such as altered with CPY, PrA and ALP. Additional studies with ALP vacuolar morphology or more severe localization and PrB will be necessary to allow a more precise defects) at restrictive growth temperature (37°C), as identification of their sorting signals and should add to compared with permissive growth temperature (26- our understanding of the nature of the vacuolar 300C). It would be useful both for morphological and targeting information. genetic studies to have vpt alleles that exhibit temperature conditional phenotypes. For this reason 257. Isolation, Characterization, and Cloning of we have initiated the screening of a bank of ts yeast ts Alleles of the vpt Mutants mutants generously provided by Usha Vijayragavan. Jane S. Robinson, Sangsu Yun All of these mutants are being crossed with each of Using a selection for spontaneous mutants that the ts vpt mutants and the resulting diploids tested for "mislocalize" a vacuolar carboxypeptidase Y-Invertase complementation of the two ts defects in the cross. (CPY-Inv) fusion protein to the cell surface, vacuolar Thus far, we have identified one potential new ts allele protein targeting (vpt) mutants in 25 new vpt of vptl8 and one of vptl6. complementation groups have been identified. Among the ts vpt mutants, vpt18 is of particular Additional alleles of the previously identified vptl interest to us because of its extreme vacuolar protein through vpt8 genes were also obtained. Representa localization defect. In addition to mislocalizing the tive alleles of each of the 33 vpt complementation soluble vacuolar enzymes CPY, Pr A and PrB, some groups have been shown to mislocalize the native alleles of vptl8 may also mislocalize the vacuolar vacuolar proteins CPY, proteinase A (Pr A) and membrane marker, a-mannosidase. Another reason for proteinase B (PrB) to varying extents. importantly, our interest in vptl8 is that by all staining and the lack of significant leakage of cytosolic markers microscopic procedures used, a vacuole cannot be from the vpt mutant cells indicates that the vacuolar detected in these mutants. protein sorting defects associated with these mutants We have obtained a vptl8 complementing clone do not result from cell lysis. In addition, the from a yeast genomic library. Approximately 12,000 observation that the precursor rather than the mature transformants of vptl8 with the YCP50 library B forms of CPY, Pr A, and PrB are secreted from the vpt (URA+) were screened for acquisition of temperature mutants is consistent with their release from the resistance. One plasmid, pJRl8-7, which complements vacuolar protein delivery pathway at the level of the three of the vptl8-linked defects (temperature Golgi complex (Bankaitis et al., 1986). Seven of the sensitivity, mislocalization of CPY-Inv fusion proteins, new vpt complementation groups contain alleles that and vacuole morphology defect), was obtained in this lead to a conditional lethal phenotype, temperature screen. Integrative mapping, restriction analysis, and sensitive (ts) for vegetative cell growth. This ts subcloning of the ,,,zo kb insert are in progress. phenotype has been shown to be recessive and to We are also interested in investigating vpt3 cosegregate with the vacuolar protein sorting defect in because of its fragmented vacuolar morphology, its each case. The vpt complementation groups for which clumpy growth phenotype in liquid medium, and its we have obtained ts alleles are the following: vpt3, relatively severe CPY localization defect. As 11, 15, 16, 18, 29, and 33. In all cases except vpt3, the discussed above, vpt3 is tightly linked to ade2 so we ts alleles exhibit a complete lack of growth on rich are attempting to clone this gene by selecting for ade2 172 complementing plasmids from a yeast genomic library osmoregulatory role for the vacuole. The morpho with large (20-30 kb) inserts, and then screening the logical and growth phenotypes observed indicate that ADE2+ plasmids for complementation of the vpt3 the vpt mutants define a variety of functions required defects. for vacuole protein sorting and/or vacuole assembly. We hope that an in-depth genetic and biochemical In an effort to elucidate the roles played by some analysis of the VPT3 and VPTl8 genes and gene of the VPT gene products, we have cloned the genes products will lead us to a better understanding of the defined by two of the vpt mutants. The class A construction and maintenance of the yeast vacuole. mutant vpt28 accumulates Golgi-related structures and is weakly defective in the processing of two Reference: Bankaitis, V. A., Johnson, L. M. and Emr. S. D. (1986) vacuolar hydrolases. vpt33 is a class C mutant and Proc. Natl. Acad. Sci. USA 83, 9075-9079. exhibits severe defects in the localization of vacuole membrane, as well as lumenal, proteins. Efforts to 258. Characterization of Yeast Mutants Defective characterize these clones, including gene mapping, in Vacuole Assembly and Protein Sorting gene disruption, and DNA sequencing of the genes, are Lois M. Banta in progress. These studies, coupled with the generation Yeast vacuole grotein !argeting (vpt) mutants of specific antibodies to the encoded gene products, exhibit defects in the sorting and processing of should provide some insights into the function of these multiple vacuolar hydrolases. In order to evaluate the proteins in vacuole biogenesis and protein targeting. impact these vpt mutations have on the biogenesis and functioning of the lysosome-like vacuole, we have 259. Cloning and Molecular Characterization of VPT29 and VPT15 employed light and electron microscopic techniques to analyze the vacuolar morphology in the mutants, These Paul K. Herman observations have permitted us to assign the vpt Ongoing studies within this laboratory have led to mutants to three distinct classes. The class A vpt the identification of :--:acuolar Erotein !argeting (vpt) mutants (26 complementation groups) contained l-3 mutants in the yeast Saccharomyces cerevisiae (see large vacuoles that were morphologically in Abstract Nos. 257 and 258). The vpt mutants isolated distinguishable from those in the parental strain, thus far have been assigned to at least 33 different suggesting that only a subset of the proteins destined complementation groups, suggesting that a rather for delivery to this compartment was mislocalized. large number of gene products may be involved, Four class A mutants, however, accumulated aberrant directly or indirectly, in the sorting of proteins to the organelles, including Golgi-related complexes and yeast vacuole. We are interested in understanding how vesicles, in addition to the normal vacuole. Mutants in these different VPT gene products interact within the the three class B vpt complementation groups cell to bring about the proper localization of vacuolar exhibited a fragmented vacuole morphology. In these proteins. Towards this end, we have initiated efforts mutants, no large normal vacuoles were observed. to clone specific VPT genes and to characterize their Instead, many (I0-30) smaller vacuole-like organelles gene products. accumulated. The class C vpt mutants, which We have chosen to investigate a pair of mutants, constitute four complementation groups, exhibited vpt29 and vptl5, which share a number of interesting extreme defects in vacuole biogenesis. The mutants phenotypes. Both mutants exhibit severe defects in the lacked any organelle resembling a n9rmal vacuole, but localization of vacuolar proteins and are extremely accumulated other organelles, including vesicles, sensitive to osmotic stress. As well, vpt29 and vpt 15 multilamellar membrane structures, and Golgi-related cells possess a morphologically abnormal vacuole, structures. Heterozygous class C zygotes assembled which suggests that vacuole biogenesis may also be normal vacuoles rapidly, indicating that some of the perturbed within these mutants. Finally, both accumulated aberrant structures may be intermediates complementation groups contain several alleles that in vacuole formation. These class C mutants also cause a temperature-sensitive (ts) growth phenotype. exhibited sensitivity to osmotic stress, suggesting an The VPT29 and VPT 15 genes were cloned by 173 complementation of the appropriate ts-yeast strains. Golgi complex, identify the movement of CPY and Pr A The VPT29 complementing activity has been shown through these two distinct organelles. Arrival at the to reside within a 2.8 kb DNA fragment which is vacuole is concomitant with proteolytic cleavages that tightly linked to the vpt29 defect. A null allele of convert CPY and PrA from zymogens to active VPT29 was constructed by replacing a 1.0 kb fragment, enzymes. within the complementing fragment, with the yeast We are attempting to reconstitute the reactions T RP l gene. Interestingly, this null allele produced a ts signifying movement of CPY or Pr A from the ER to growth phenotype; i.e., the V PT29 gene product is only the Golgi complex and on to the vacuole. To required for vegetative growth at elevated accomplish this, we are using a slow-freezing temperatures. The implications of this finding for technique that alters the plasma membrane of yeast normal vacuole function are currently under study. spheroplasts. This procedure generates semi-intact DNA sequence analysis of both VPT29 and VPTl5 is cells that are depleted of endogenous cytosol, currently in progress, and it is hoped that this will permeable to proteins added exogenously, and contain provide some insight into the possible roles of the intact, functional organelles. The precursor of the respective gene products in the vacuolar protein yeast pheromone, prepro-a-factor (ppaF), is able to sorting problem. posttranslationally translocate across the ER membrane, become glycosylated with core oligo 260. Reconstitution of Yeast Vacuolar Protein saccharides in the ER lumen, and receive mannose Delivery In Vitro residues in the Golgi complex, when added to semi Thomas A. Vida intact yeast cells. Thus far, we have only been able to The eukaryotic secretory pathway comprises show ER translocation/glycosylation for CPY and PrA several distinct organelles that- allow for an ordered in semi-intact cells. A combined in vivo/in vitro movement of certain proteins from their site of approach is under way that will attempt to trap the ER synthesis in the cytoplasm to their final organellar, or and Golgi complex intermediates of CPY and Pr A in extracellular destinations. Specific proteins enter the intact spheroplasts. These will then be converted to pathway after translocation across the endoplasmic semi-intact spheroplasts by slow-freezing or osmotic reticulum (ER) membrane. Proteins not destined to stress and the final steps of vacuolar protein delivery remain in the ER exit this organelle and travel to the will be attempted in vitro. Golgi complex where they either remain or are sorted and delivered to lysosomes and vacuoles, the plasma 261. Characterization of a Component of the Yeast membrane, or extracellular locations. Temperature Secretion Machinery: Identification of the SEC18 Gene Product sensitive sec mutants of the yeast Saccharomyces cerevisiae, which have phenotypic blocks at different Kurt Eakle stages along the secretory pathway, have allowed for SEC18 gene function is required for secretory analysis of many general aspects of protein movement protein transport between the endoplasmic reticulum during secretion in vivo. To characterize the bio and the Golgi complex. We have cloned the SECl8 chemical details that govern passage of proteins gene by complementation of the seclB-1 mutation. through the eukaryotic secretory pathway, the various Deletion/disruption of this gene has shown that SECl8 organelle-to-organelle steps need to be reconstituted is essential for yeast cell growth. Sequence analysis of in vitro. the gene revealed a 2271 bp open reading frame which We are interested in defining the molecular could code for a protein of 83. 9 kDa. The predicted mechanism(s) of protein delivery to the yeast vacuole. protein sequence showed no significant similarity to Vacuolar proteins such as carboxypeptidase Y (CPY) other known protein sequences. In vitro transcription and proteinase A (Pr A) traverse both the ER and Golgi and translation of SEC!& led to the synthesis of two complex before they reach the vacuole. Addition of proteins of approximately 84 and 82 kDa. Antisera core oligosaccharides in the ER, and further addition raised against a Secl8-~-galactosidase fusion protein of mannose residues to the core oligosaccharides in the also detects two proteins (collectively Secl&p) in 174 extracts of 355-labeled yeast cells identical in size to redundant regions, encoded in the first 14 amino acids those seen by in vitro translation. Mapping of the 5' of the B subunit presequence (see Figure 2). A end of the SEC18 mRNA revealed only one major start synthetic oligonucleotide was made that encodes this site for transcription, which indicates that the 14-amino-acid sequence. During its synthesis, certain multiple forms of Sec18p do not arise from mRNAs strategic positions were spiked with a mix of nucleo with different 5' ends. Pulse-chase experiments tides so that both wild-type and mutant amino acids indicate that the two forms of Secl8p are not the could be encoded at each amino acid position. The result of posttranslational processing. We suggest that ratio of the nucleotide mixes was carefully controlled translation initiating at different in-frame AUG start so that the probability of one missense mutation codons is likely to account for the presence of two encoded per molecule was optimized. This pool of forms of Secl8p. Hydrophobicity analysis indicates oligonucleotides encoding both wild-type and mutant that the proteins are hydrophilic in nature and lack any forms of the minimal targeting sequence was then region that would be predicted to serve as a signal converted to a double-stranded molecule and cloned sequence or transmembrane anchor. Although potential into a plasmid carrying a S gene in which all the sites for N-linked glycosylation are present in the mitochondrial protein import information had been Sec18p sequence, the sizes of the in vivo SEC18 gene deleted. In the resulting constructs, the only products are unaffected by the drug tunicamycin, mitochondrial protein import information is encoded indicating that Secl&p does not enter the secretory by the oligonucleotide sequence, and the import pathway. These results suggest that Sect&p resides in efficiency of each mutant form of the targeting signal the cell cytoplasm. While cell fractionation studies can be analyzed in a straightforward manner. show that Secl&p is not associated with ER or Golgi A pool of these recombinant molecules was trans compartments, association with a 100,000 x g pellet formed into E. coli and 233 random isolates were fraction has been observed, suggesting that Secl&p sequenced. From this collection, 32 unique single and may bind transiently to small vesicles such as those 46 unique double mutant forms of the gene were presumed to participate in secretory protein transport isolated in a total collection of 103 different mutants. between the ER and Go!gi. Yeast strains unable to efficiently target the s subunit to mitochondria cannot grow on non-fermentable 262. Saturation Mutagenesis of a Yeast carbon sources. Therefore, to test the import Mitochondrial Protein Import Signal properties of the mutant targeting signals, each of the David M. Bedwell, Scott Strobel, Kyuson Yun isolates was transformed into a yeast strain in which Greater than 90% of the proteins found in the chromosomal copy of the a-subunit gene was mitochondria are encoded by nuclear genes. Since the deleted. One class of the mutant a-subunit precursors protein species found in mitochondria are distinct from was still capable of efficiently importing into those found in other cellular locations, specific mecha mitochondria. A second class of the mutant proteins nisms must exist that facilitate their transport from was temperature sensitive for growth on a non the cytoplasm to their final mitochondrial location. fermentable carbon source, while a third class of Most proteins destined for import into mitochondria mutant proteins did not import into mitochondria to an are initially synthesized with a transient amino extent sufficient to restore growth on a non terminal extension that facilitates the binding and fermentable carbon source at any temperature. Bio import of these proteins into mitochondria. chemical analysis of the cellular distribution of the Previously, we have demonstrated that the mito mutant a proteins revealed that the growth chondrial import signal of one such protein, the s characteristics closely paralleled the amount of s in subunit of the F 1-ATPase complex, contains the mitochondria of the mutant strains. functionally redundant mitochondrial protein import Computer analysis of the physical properties of information (Bedwell et al., 1987). We have now these mutant targeting signals indicates that their utilized a cassette m utagenesis approach to carry out import properties in vivo are a strong function of their a saturation mutational analysis of one of these predicted amphiphilicity. These results demonstrate 175 that amphiphilicity is an important feature of mito chondrial protein import signals. In addition, both acidic amino acid residues and helix-breaking residues are in almost all cases detrimental to presequence function. Taken together, these results have increased our understanding of the important molecular charac teristics of a mitochondrial protein import signal, and are leading to further studies aimed at addressing additional molecular details of the mitochondrial protein import process. Reference: Bedwell, D. M., Klionsky, D, J, and Emr, S. D. (1987) Mo!. Cell. Biol. 7, 4038-4047. 10 20 30 40 + + + + ++ ~ Subunit Redundant Mitochondrial MVIPRL YTATSRAAFKAAK QSAPLLSTSWKRCMASAAQQS Targeting lnfonnation FZZZ72Z! EZZZ.I VZZZZZ2I LI.I ll.2 ll.3 Synthesize Oligonucleotide F.ncoding Minimal Targeting Sequence (mutagenize sequence during synthesis) Hindlll Sall >' GGAAGCTTAAAAATAAAAAAAAGA ATGGTICTACCAAGACTATAT ACAGCT ACAAGTCGTGCTGCTCTGTCGACCC 3' M v L p R L y T A T s R A A A p L I p D I D I c H D D Porential [ Amino Acid D Q Q T Q H K G K G L G G Substitutions G R R K R N R v R R p v v -Oligooucleotide Primer !-Kienow Fragment -dNTPs HindIJI Sall I I s· GGAAGCTTAAAAATAAAAAAAAGA ATGGTTCTACCAAGACTA TAT ACAGCT ACAAGTCGTGCTGCTCTGTCG ACCC ,._~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~AGACAGCTGGGs• -Digest with Hindlll, Sall -Clone into A11'2 Vector (minus targeting signal) HindIII Sall t t ATP2 Promoter - M 3S ATP2Gene Figure 2. Schematic diagram illustrating the cassette mutagenesis approach used to characterize the important features of a mitochondrial protein import signal. 176 263. SecB, A Component of the Host Protein References: Export Machinery Bankaitis, V. A., Altman, E. and Emr, S. D. (1987) In: Bacterial Outer Membranes: A Model System, Elliot Altman Inouye, M. (Ed.), John Wiley and Sons, Inc., New York, pp. 75-116. An observation has been made in E. coli that the Bankaitis, V. A. and Bassford, P. J. (1981/) J. Biol. cytoplasmic synthesis and accumulation of a normally Chem. 19, 12193-12200. Collier, D. N., Bankaitis, V. A., Weiss, J. B. and exported protein harboring a defective signal sequence Bassford, P. J. (1988) Cell 53, 273-283. interferes with the export of other secreted proteins (Bankaitis and Bassford, 1981/; Bankaitis et al., 1987). This interference has been shown to be the result of PUBLICATIONS binding secB, a component of the cell's export Banta, L. M., Robinson, J. S. and Emr, S. D. (1988) machinery, thus limiting its availability to function in Organelle assembly: Characterization of yeast mutants defective in vacuole biogenesis and protein the secretory process (Collier et al., 1988). sorting. J. Cell Biol., in press. We have mapped the interference site (l.S.) in Bedwell, D. M. and Emr, s. D. (1988) Mutational analysis of the yeast F 1-ATPase a-subunit LamB, an E. coli outer membrane protein, and found it mitochondrial protein import signal: Evidence of to reside between amino acid residues 320 and 370 of functional redundancy. In: Molecular Biology of Intracellular Protein Sorting and Organelle the mature protein (mature LamB contains l/.21 amino Assembly, Alan R. Liss, New York, NY, pp. 161- acids). Two related observations indicate that the I.S. 171. Bedwell, D. M., Klionsky, D. J. and Emr, S. D. (1987) was successfully identified: I) the synthesis of an The yeast F 1-A TPase s subunit precursor contains export-defective LamB protein harboring an l.S. functionally redundant mitochondrial import information. Mol. Cell Biol. 7, 1/038-1/01/7. deletion does not interfere with the export of other Bedwell, D. M., Strobel, S., Yun, K., Jongeward, G. and secreted proteins (MBP, OmpA, etc.), and 2) the Emr, S. D. (1988) Characterization of the essential molecular features of a mitochondrial protein synthesis of an export-defective MBP protein no longer import signal using saturation cassette muta interferes with the expOrt of LamB protein when it genesis. Submitted for publication. Eakle, K. A., Bernstein, M. and Emr, S. D. (1988) lacks the I.S. Surprisingly, however, when the I.S. is Protein secretion in yeast: Characterization of the deleted from LamB there is little effect, as the export SECl8 gene and gene product. Mol. Cell. Biol., in press. rate of this LamB protein is only marginally slower Johnson, L. M., Bankaitis, V. A. and Emr, S. D. (1987) than that of wild type. Distinct sequence determinants direct intracellular sorting and modification of a yeast vacuolar This incongruity led us to a direct comparison of protease. Cell 1/8, 875-885. secB's effect on LamB and MBP, a periplasmic protein. Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988) Intracellular sorting and processing of a yeast Whether secB was limited for by producing an export vacuolar hydrolase: The proteinase A propeptide defective protein or deleted through the use of a null contains a vacuolar targeting signal. Mol. Cell. mutation, the result was the same. MBP suffered a Biol. 8, 2105-2116. Klionsky, D. J., Banta, L. M., Robinson, J. S. and Emr, permanent export block and only 50% of the protein S. D. (1988) Vacuolar protein targeting and organelle biogenesis in yeast. In: Molecular Biology could be exported. LamB, however, suffered only .a of Intracellular Protein Sorting and Organelle transient export block and l 0096 of the protein was Assembly, Alan R. Liss, New York, NY, pp. 173- 186 •. eventually exported. Malehorn, D. E., Greene, R., Emr, S. and Bankaitis, V. These facts can be explained if secB has two A. (1988) Identification of the S. cerevisiae SEC14 gene product: A polypeptide that exhibits elements functions in export: a recognition function, and an un of conservation across wide phylogenetic folding function as described by Collier et al. (1988). boundaries and is required for yeast golgi function. Both LamB and MBP would be recognized by secB in an Mol. Cell. Biol., submitted for publication. Robinson, J. S., Klionsky, D. J., Banta, L. M. and Emr, early sorting event, and thus both are effected by the S. D. (1988) Protein sorting in yeast: Isolation of mutants defective in the delivery and processing of lack of secB. Because MBP is a soluble periplasmic multiple vacuolar hydrolases. Mal. Cell. Biol., in protein, secB is also required as an unfolding agent to press. prevent MBP from folding into an export-incompetent form. However, LamB, a hydrophobic membrane pro tein, does not require secB as an unfolding agent since LamB can never fold into an export-incompetent form. 177 Professor: John J. Hopfield In vision, Dong is working on the problem of synapse modification rules for forming the known pre Support: The work described in the following research processing of visual signals. Synaptic organization for reports has been supported by the Department of the Navy, Office of Naval Research. center-surround and orientation neurons is present at both in mammals. It has been surmised that this system is self-organized, rather than given in detail by Summary: The area of interest is the "computation" or genetics. Dong is seeing whether this can be done in information processing done by biological brains, the the context of realistic anatomy and cell types. (This modeling of such systems, and trying to capture the work is being done in conjunction with Prof. C. Koch.) essence of biological computation in artificial neural 1Division of Physics, Mathematics and Astronomy, networks which can be implemented as computer California Institute of Technology. programs, as analog neural hardware, or in special purpose digital systems. To understand neurobiological 265. Learning to Process Auditory Signals function, it is increasingly necessary to bring a compu tational viewpoint to the understanding of anatomy John J. Hopfield, K. Unnikrishnan', D. W. Tank' and electrophysiology, and behavior. At the other One way to ask the right set of research questions as to how "neural networks" compute is to try to apply extreme, it is very difficult to get the digital computers of today to perform effectively in problems them to solving real proble~s from the natural world. Identifying a small vocabulary of words in continuous such as visual or acoustic pattern recognition, and biology must have some relevant lessons for research speech is an appropriate problem. The natural variation of voice and the absence of indicators of the in this area. ends of words in the sound system (elision) makes this pattern recognition problem difficult. Yet it is a 264. Problems in Olfactory and Vision Systems problem that a dog or cat can solve. We are making a 1 1 Dawei Dong , Zhaoping Li , John J. Hopfield neural network approach to solving this problem. It Olfaction is an ancient sense and is simple in takes three important features from biology-the concept compared to vision and audition. An immense known spatial map of frequency early in our auditory amount of the visual system is devoted to pre system, the center-surround organization typical of processing, to computing significant features from the visual processing, and the use of time delays as a primary sensory information. In olfaction, the protein processing element from the auditory systems of owls receptor in the sensory epithelium binds-and thus and bats. We surmise that an early cortical area, directly measures-a molecule that formerly belonged perhaps even the first one, must have delayed signals to the distal object. It is only two synapses from represented in it, for delays up to a few tenths of a sensory cell to cortex! We are involved in modeling second. It combines these aspects into a network, the olfactory bulb, the region that does the initial many of whose synaptic strengths are determined processing of the signals from the sensory cell. Unlike through a learning procedure which we constructed to most areas of the brain, olfactory bulb is driven into capture the probabilities of various interpretations of high frequency 40-60 Hz oscillation by the sensory the sound. In case of ambiguity, this probability is signal. This oscillation must both analyze and encode more useful than a simple yes-no decision. The system the information for the prepiriform cortex. Our is 9896 r~liable in working with the continuous speech approach is based on the general structure of the of a single speaker. The feature set used by the "front anatomy of the olfactory bulb, but it endeavors to end" of the system is rudimentary and will have to be keep the correct style of neural activity rather than improved in order to deal with the larger differences all its wealth of detail. In that fashion, an analytical between speakers. mathematics as well as computer simulation can be 1 brought to bear. Li believes she understands the basic AT&T Bell Laboratories. mechanism of oscillation, though simulations of larger systems will be necessary to confirm this. 178 PUBLICATIONS against the first 20 amino acids of the sequence binds to intact junctions by immunocytochemistry. There Denker, J., Schwartz, D., Wittner, B., Solla, S., Howard, R., Jackel, L. and Hopfield, J. J. (1987) fore, the N terminus is exposed to the cytoplasm. This Large automatic learning, rule extraction, and is supported by the finding that the same antibodies, generalization. Complex Systems I, 877-922. Hopfield, J. J. ( 1987) Learning algorithms and when injected into cultured heart myocytes block the probability distributions in feed-forward and feed transfer of dyes (R. Lal). S. John and S. B. Yancey back networks. Proc. Natl. Acad. Sci. USA 84, 8429-8433. have now shown that there is a third region recognized Hopfield, J, J. (1987) Networks, computations, logic by one of our polyclonals. The existence of three and noise. Proceedings from IEEE First International Conference on Neural Networks, Vol. cytoplasmic regions, including the N and C termini, is IV, San Diego, CA, June 1987, pp. I-109-1-142. Tank, D. and Hopfield, J. J, (1987) Collective understandable if there were four transmembrane computation in neuron-like circuits. Sci. Am. 255, segments, as can also be predicted on the basis of the 104-114. known amino acid sequence. We are now trying to Tank, D. W. and Hopfield, J. J. (1987) Concentrating information in time: Analog neural networks with define the function of various regions of the molecule. applications to speech recognition problems. One approach is, of course, electrophysiological; Proceedings from IEEE First International Conference on Neural Networks, Vol. IV, San another is to express junction molecules in yeast, so Diego, CA, June 1987, pp. IV-455-IV-468. that we can test the results of in vitro mutations. K. Puranam, S. B. Yancey and J. Hoh have been hard at work on the preliminary steps toward this project. 266. Topological Analysis of the 45 kDa Professor: Jean-Paul Revel Heart Gap Junction Protein Senior Research Associate: S. Barbara Yancey Research Fellows: Scott A. John, Ratneshwar Lal, Scott A. John, Brian J. Austin, S. Barbara Yancey, Kasturl L. Puranam Jean-Paul Revel Graduate Student: Jan H. Hoh The major constituent of rat heart gap junctions is Research ahd Laboratory Staff: Brian J. Austin, Jon R. Backstrom, Alexander S. Battaglia, Johnson C. believed to be a protein of 45 kDa. We have raised 1 1 Chung , Jean E. Edens, John R. Hoskins , Patrick site-specific antibodies to a synthetic peptide corre F. Koen sponding to the first 20 amino acids of the protein and 'Undergraduate, California Institute of Technology. polyclonal antibodies to electroeluted 45 kDa protein. These two antibodies have been used to elucidate the Support: The work described in the following research reports has been supported by: location and structure of the 45 kDa protein. Biomedical Research Support Grant (NIH) Isolated junctions are composed of two closely Lucille P. Markey Charitable Trust National Institutes of Health, USPHS associated membranes with their extracellular faces & The Procter Gamble Co. apposed, leaving only their cytoplasmic surfaces Albert Billings Ruddock Professorship accessible to proteases. Enzymatic cleavage of isolated junctions with endoproteinase Glu, which Summary: This year we have made considerable cleaves at Glu and Asp residues under the conditions headway in elucidating the organization of the cardiac used, and subsequent immunoblotting shows a -15 kDa gap junction protein in situ. Using both site-specific fragment which binds both the si le-specific and the and polyclonal antibodies on intact isolated junctions affinity-purified antibodies. However, digestion with and junctions that had been attacked by specific TPCK trypsin produces a -13 kDa fragment that only proteases allows us to reach the following conclusions: binds the site-specific antibody. Thus, a polyclonal A carboxy-terminal moiety of 17 kDa is easily antibody binding site can be mapped to an enzyme removed from intact junctions by several proteolytic accessible region of -2 kDa. Digestion with endo enzymes. Since only cytoplasmic groups are expected proteinase Lys produces a fragment -18 kDa that binds to be accessible in intact junctions, this means that both antibodies. This provides evidence for a cyto the C terminus is cytoplasmic. S. B. Yancey has also plasmic loop of at least 5 kDa, which carries a poly shown that a site-specific antibody which is directed clonal antibody binding site. The cleavage pattern 179 suggests that the heart gap junction protein has at dye-coupled pairs, an identical injection of pre least two membrane domains separated by a cyto immune serum had unequivocally no effect on the plasmic loop. Since there is evidence (see Abstract transfer of the second dye. The remaining three No. 268 and Manjunath et al., 1987) suggesting that instances were questionable for various reasons. Thus, both amino and carboxy termini are cytoplasmic, one our results are consistent with the notion that the can construct a model with four membrane-spanning 45 kDa protein (or another cross-reacting protein) is an regions, which finds circumstantial support in the important component of the heart gap junction recently published cDNA sequence (Beyer et al., 1987). channels mediating cell-cell communication. Further, our finding that the intracellular injection of site References: Beyer, E. C., Paul, D. L. and Goodenough, D. A. ( 1987) specific antibody disrupts dye coupling indicates that J. Cell Biol. 105, 2621-2629. the amino terminus of the protein resides in the cyto Manjunath, C. K., Nicholson, B. J., Teplow, D., Hood, L., Page, E. and Revel., J.-P. (1987) Biophys. Res. plasm and that this portion of the molecule may play a Commun. 142, 228-234. role in regulating channel functions. 267. Antibodies to the 45 kDa Gap Junction Protein Block Cell-Cell Communication Between 268. Immunolocalization of a 4 5 kDa Protein to Gap Myocardial Cells Junctions in Heart Ratneshwar Lal, S. Barbara Yancey, Brian J. Austin S. Barbara Yancey, Jean-Paul Revel Rat heart gap junctions are characterized by the Gap junctional membranes can be isolated from rat presence of 45 kDa proteins. Our current studies pro heart in highly purified fractions as assayed by vide evidence that antibodies raised to this protein negatively-stained preparations viewed by electron block intercellular communication between pairs of microscopy. Analyzed by SDS-PAGE, there is a pre neonatal rat myocardial cells in culture. Two kinds of dominant band at 45 kDa as well as a few minor bands antibodies were used: a site-specific antibody raised representing polypeptides that run higher and lower on against a synthetic peptide corresponding to the first the gel. Some of the lower bands have been shown by 20 amino acids of the 45 kDa heart gap junction pro amino acid sequencing (Biology 1986, Abstract No. tein, and a polyclonal antibody raised to electroeluted 200) to represent breakdown products of the ~5 kDa 45 kDa protein. All experiments were conducted at protein. In order to determine the intracellular room temperature, between 3-6 days of culture. In localization of the 45 kDa protein and to establish isolated pairs, one cell was iontophoretically injected further that it is a component of the gap junctions with 5% Lucifer Yellow CH (LY) or 0.2% Texas Red which interconnect cardiac muscle cells, we have used (TR) in 150 mM LiCI. Dye transfer to the other cell of both a polyclonal and a site-specific antibody raised to the pairs indicated normal coupling between myo a peptide representing the first 20 amino acids of the cardial cells in culture. In one cell of a dye-coupled protein to localize the protein in frozen sections and in pair, site-specific or polyclonal antiserum diluted 1:4 plasma membrane and gap junction-enriched fractions in 150 mM LiCl buffered to pH 7.6 with 10 mM HEPES isolated from the heart. By immunofluorescence and was iontophoretically injected by a large (-100 nA) immunogold-silver enhancement techniques applied to hyperpolarizing pulse at 1 Hz for 5 sec. After 3-5 min, frozen sections of heart ventricle, both antibodies the other cell of the pair was injected with the second show binding in the region of the intercalated disc, a dye (TR or LY). In 27 of 30 dye-coupled cell pairs, the site of interaction between heart cells shown by injection of the site-specific antiserum was followed electron microscopy to be rich in gap junctions. In the by unequivocal blockage of the second dye. The re isolated fractions labeled by the immunogold tech maining three instances were questionable for various nique, both antibodies bind with high specificity to gap reasons. Another 23 dye-coupled pairs were injected junctions, identified as double membrane structures in with the polyclonal antibody. Of these, the transfer of which the membranes are separated by a very narrow the second dye was blocked in 11 cell pairs, was un gap with only their cytoplasmic surfaces accessible to affected in four cell pairs and was uninterpretable in antibody binding. Both antibodies must therefore the remaining eight cell pairs. In 22 of another 25 recognize regions of the 45 kDa protein that are ex- 180 posed at the cytoplasmic surface of the gap junction. communication and are commonly assayed by the Binding of the site-specific antibody demonstrates that presence of dye or electrical coupling between cell the amino terminus of the protein must be cytoplasmic pairs or aggregates. Such an assay, which involves the as has been shown earlier by other means for the injection of cells with dye, is a fairly tedious process carboxy terminus (Biology 1986, Abstract No. 200). depending also on the manual dexterity of the experi menter. We are trying to devise a simple assay that 269. Expression of Gap Junction Protein in Yeast can be used to look at a large population of cells at one time. The assay consists of loading cells with a Kasturi L. Puranam, S. Barbara Yancey, Jan H. Hoh fluorescent dye and, after incubation with unlabeled Although extensive investigations over the last 20 years have led to the elucidation of a number of cells, subjecting the entire population to a flow cytometric study. physical and biochemical characteristics of gap We use Novikoff cells which grow easily in junction proteins, there are still many unanswered suspension and have a tendency to aggregate. The dye questions. We are attempting to introduce and express the 1.5 kb cDNA corresponding to the 27 kDa liver used is Lucifer Yellow VS (L YVS) which we have found can be loaded into cells by a freeze-thaw procedure. protein (Paul, 1986) in the bakers' yeast Saccharo myces cerevisiae. The expression of this protein in There is no dye leakage. The labeled cells are incubated with unlabeled cells after which they are yeast will make it feasible to study the 27 kDa protein in greater detail, for instance, its biogenesis, its fixed (with l % paraformaldehyde) and run on the flow cytometer. The cells are analyzed based on their size topology in the membrane, its role in formation of channels, etc. (forward scatter) and the amount of dye in them (fluorescence). Using such an assay, the transfer of The vector we use for yeast transformation is the plasmid pSEYC58 (gift from Prof. S. Emr) which con dye can be observed as an increase in the population of labeled cells and a concomitant decrease in number of tains an autonomously replicating sequence coupled to a centromere gene. The selection marker is the uracil unlabeled cells. That the dye transfer being observed is in fact via gap junctions is borne out by the obser gene and the cDNA introduced is under the influence of the galactose promoter. Yeast transformation using vation that a larger molecule (FlTC-albumin) is not transferable between cells. We intend to further the re-engineered plasmid was carried out using the lithium acetate procedure. The plasmid DNA re standardize this assay by doing double labeling experi ments wherein one dye will transfer and the other will covered from the transformed yeast was amplified by transforming E. coli to increase the copy number of not due to its size. the plasmid. The plasmid DNA from E. coli was analyzed by restriction digestions followed by Southern 271. Production and Characterization of Monoclonal Antibodies to the Heart Gap Junction Protein hybrldization using the anti-sense transcription product of the 1.5 kb cDNA. The presence of mRNA Brian J. Austin, S. Barbara Yancey, Jean-Paul Revel As described last year (Biology 1987, Abstract No. corresponding to the cDNA was verified by isolating the polyadenylated RNA from total yeast RNA and 222), our objectives include characterization of the heart gap· junction protein, including orientation within probing it with the anti-sense RNA on a Northern blot. We are now in the process of trying to detect and the membrane, and the identification of important functional regions. To aid in these studies, we have localize the protein ln yeast. produced monoclonal antibodies against the 45-47 kDa Reference: rat heart gap junction protein. After splenic cell Paul, D. L (1986) J. Cell Biol. 103, 123-134. fusion, a total of 405 hybridoma supernatants were screened by immunoreactivity versus Western blots of 270. A Novel Flow Cytometric Assay for Gap Junction Proteins gap junction preparations, producing 103 positives-. Of these, a number were selected for subcloning. Upon Kasturi L. Puranam, Jean-Paul Revel, Jean E. Edens, Patrick F. Koen subclone analysis, 13 hybridomas were selected for Gap junction proteins are involved in intercellular further study based on their differing immuno- 181 reactivity versus rat heart gap junctions. To date, 273. Characterization of the Gap Junction Gene Family eight subclones have been characterized to be lgM and one to be IgGl. Nine are immunoreactive against gap Jan H. Hoh, Jean-Paul Revel junction preparations as judged by ELISA. These 13 To date, at least four members of the gap junction subclones will be further characterized, among other gene family have been identified. These proteins have methods, by: characterization of possible antibody been identified by examining one tissue or organ at a binding sites as determined by immunoreactivity time. To better understand the size and organization against enzymatic digestion fragments of the 45-47 of the gap junction gene family, we are continuing our kDa protein; immunolocalization of antibodies on rat characterization of genomic clones obtained by low heart papillary muscle sections at both the light and stringency hybridization with a cDNA from the rat electron microscopic levels; and the effects, upon liver 2& kDa protein. Initial indications are that at intracellular injection, on the electrical and dye least some of the genes are relatively compact with coupling between myocardial cells in culture. few and small introns if any. 272. Isolation of a mRNA Encoding a Gap Junction Protein From Rat Brain and Cerebellum PUBLICATIONS Brian J. Austin, S. Barbara Yancey, Jean-Paul Revel Dermietzel, R., Yancey, S. B., Traub, 0., Willecke, K. and Revel, J.-P. (1987) Major loss of the 28 kDa The existence of a family of gap junction proteins protein of gap junction in proliferating hepato has been demonstrated in a variety of tissues. The cytes. J. Cell Biol. 105, 1925-1934. Nicholson, B., Dermietzel, R., Teplow, D., Traub, 0., proteins isolated from heart and liver share some Willecke, K. and Revel, J.-P. (l 987) Two degree of homology. Western blot analysis of whole homologous protein components of hepatic gap junctions. Nature 329, 732-734. brain and cerebellum homogenates with the heart 45 Revel, J.-P. (l 988) The oldest multicellular animal and kDa polyclonal antibody indicates immunoreactivity of its junctions. In: Gap Junctions, Hertzberg, E. L. and Johnson, R. G. (Eds.), Alan R. Liss, New York, a 45 kDa peptide. A 1.4 kb cDNA encoding the 45 kDa pp. 135-149. gap junction protein from heart has been isolated Yancey, S. B. (1988) MIP gene expression during development. In: Gap Junctions, Hertzberg, E. L. (Beyer et al., 1987). This cDNA, G2, containing the and Johnson, R. G. (Eds.), Alan R. Liss, New York, entire coding sequence and 202 bases of 5'-noncoding pp. 199-206. Yancey, S. B., Koh, K., Chung, J. and Revel, J.-P. sequence (but little of the 3'-untranslated sequence) ( 1988) Expression of the gene for main intrinsic has been cloned into Bluescript Ml3 KS+, so that polypeptide (MIP): Separate spatial distributions of MIP and beta crystallin gene transcripts in rat lens transcription from T7 and T3 promoters may provide development. J. Cell Biol. 106, 705-714. message in both sense and anti-sense orientations. Total RNA has been prepared from rat whole brain and from cerebellum using the lithium chloride-urea extraction procedure, and enriched in polyadenylated mRNA by oligo(dT) column chromatography. We intend to transcribe anti-sense message from G2 to probe Northern blots of brain and cerebellum polyadenylated mRNA under both high and low stringency conditions, in an attempt to identify a gap junction encoding mRNA. We will also probe the RNA blots with anti sense RNA transcribed from cDNAs encoding the 21 and 28 kDa gap junction proteins present in liver. Reference: Beyer, E. C., Paul, D. L. and Goodenough, D. A. (1987) J. Cell Biol. 105, 2621-2629. CELLULAR NEUROBIOLOGY Mary B. Kennedy Henry A. Lester I85 Associate Professor: Mary B. Kennedy the subunits in a holoenzyme causes the entire Research Fellows: Robert F. Bulleit, Debra A. S. holoenzyme to acquire a partially calcium-independent Leonard, Karen A. Ocorr 1 Graduate Students: Thomas K. Brown , Bruce L. activity. This activity remains after the removal of Patton, Stephen G. Miller, Sean S. Molloy 2 the initial calcium signal. In a test tube, the kinase Research and Laboratory Staff: Jay Higley , Venise L. Jennings, Horst Simon 3 can perpetuate its activity in the presence of ATP by 1 continuing the process of autophosphorylation. In a Division of Chemistry and Chemical Engineering, California Institute of Technology. similar way in vivo, the kinase could delay its own 2Undergraduate, California Institute of Technology. inactivation by protein phosphatases. Such a 3Visiting Student, Swiss Technological Institute, Zurich. "molecular switch" seems appropriate to mediate certain forms of regulation of synaptic strength. Support: The work described in the following research This year we have completed a study of the reports has been supported by: Biomedical Research Support Grant (NIH) primary structure of the kinase subunits. A cDNA en Joseph Drown Foundation coding the a subunit has been selected and sequenced. Lucille P. Markey Charitable Trust The McKnight Foundation Functional domains have been partially defined by National Institutes of Health, USPHS comparison of the sequences of the two subunits and Pew Memorial Trust Gustavus and Louise Pfeiffer Research by homologies to other protein kinases. We have used Foundation biochemical methods to identify the important auto phosphorylation sites and place them within the Summary: The structure and function of neurons and primary sequence. We are in a position to begin their synapses in different specialized brain regions generating mutant forms of the kinase for studies of varies in ways that can affect signaling. These its physiological roles and have selected cDNAs from differences in synaptic structure can influence infor Drosophila that may encode an homologous fly kinase mation processing and storage in important ways. One on which we could carry out genetic studies. We have goal of modern neurobiology is to explain the func also examined the other side of the regulatory tioning of different brain regions both in terms of the equation by determining the sensitivity of the organization of their neuronal networks and in terms autophosphorylation sites to phosphatases that de of the unique molecular structures of their neurons. phosphorylate the kinase and its substrates. We have Important differences among neurons occur in their begun a study of the structures of other proteins in regulatory machinery. These differences produce CNS postsynaptic densities to help place the kinase in different modes of regulation of the strength and the context of synaptic function. One important future effectiveness of synaptic connections and of other goal is to define intact cellular systems in which we functions such as axonal transport or dendritic shape. can study regulation by the kinase in vivo. This lab has pioneered studies of a brain regulatory protein (type II calcium and calmodulin-dependent 271f. Sequence of the "Subunit of Brain Type II protein kinase) that is a major specialized component CaM Kinase of many central nervous system neurons. A related Robert F. Bulleit family of protein kinases, distinct in structure from Brain type II CaM kinase is a large holoenzyme the brain kinase, is present in much lower quantities in composed primarily of two related subunits, a (50 K) other tissues. The type II CaM kinase is particularly and s (60 K). In the forebrain, the holoenzyme has a highly expressed in the telencephalon where it is ratio of 9a : 3a, whereas in the cerebellum the ratio is present throughout the neurons, but appears to be 2a : 8s. The amino acid sequence of the 8 subunit was concentrated in specialized synaptic structures called deduced from the sequence of cDNA clones (Bennett postsynaptic densities. and Kennedy, 1987). We now report the selection, The kinase is an oligomeric holoenzyme composed cloning and sequencing of cDNAs encoding the a of approximately 12 structurally-related 50,000 and subunit. 60,000 dalton subunits. We have shown that calclum The cDNAs were selected with two independent dependent autophosphorylation of a small number of probes. The first probe was a 45-nucleotide "guessmer" 186 based on partial amino acid sequence of an a subunit generated from an alternatively spliced product of the chymotryptic peptide. The guessmer hybridized, at a-subunit gene (Bulleit et al., 1988). A comparison of high stringency, to a 5.0 kb band of poly(A)' RNA that the amino acid sequences of the three subunits was more abundant in forebrain than cerebellum. This suggests that they can be divided into several regions is consistent with the distribution expected for a based on the extent of their conservation and their message encoding the a subunit. The second probe was proposed functions (Figure !). generated from a restriction fragment containing the region encoding the amino-terminal half of the a sub C2 DI11DI2 DI3 unit. At reduced stringency this probe also hybridized Cl C3 p lcOOH to the 5.0 kb putative a subunit message. These probes were used to screen a rat brain cDNA library, inserted ""' into pBR322. A single clone (CK4-Jo) was selected p· COCH that hybridized to both probes. A second rat brain ~v cDNA library, inserted into AgtlO, was screened with ""' probe generated from CK4-la and 17 additional clones NHI Ji/ COCH " were selected. The longest of these clones (>.2-2) was sequenced by the dideoxy chain termination method. The sequence revealed a 1434-nucleotide open reading frame that encodes a 478-amino-acid protein of molecular weight 54,123, close to that predicted for Figure I. Diagram of conserved and variable regions in the subunits of neuronal Type [J CaM kinase. The the a subunit from its mobility on SOS-PAGE. The three domains marked C ( l, 2, and 3) are highly con sequence of the chymotryptic peptide is contained served in all the subunits. The domains marked DI are within this deduced amino acid sequence. The amino missing in some of the subunits. 013 is deleted in the B' subunit, apparently by alternative splicing. All three terminal half of the protein contains the "kinase DI units are deleted from a, domain" present in all members of the protein kinase family and the putative ATP binding residues. Next to Region Cl extends over the amino-terminal half of this region is a calmodulin-binding domain. The each subunit and contains the protein kinase domain carboxy-terminal one-third of the protein, which is not and the calmodulin-binding domain. This region is homologous to other protein kinases, likely contains highly conserved, with 91 % amino acid identity domains with functions specific to the Type fl CaM between the a and a subunits. CJ comprises the kinase. carboxy-terminal one-third of the subunits. This Reference: region is also well conserved, with 7696 amino acid Bennett, M. K. and Kennedy, M. B. (1987) Proc. Natl. identity between a and s. Three segments that are Acad. Sci. USA 84, 1794-1798. deleted (or inserted) in different subunits are termed 275. Comparison of the Sequences of a, B, and a' Oii, 0!2 and 013. 013 is deleted in the a' subunit while Subunits of the Type II CaM Kinase all three segments are deleted in the a subunit. A Robert F. Bulleit continuous 77-residue region composed of Oii, C2, 012 Zn the forebrain isoform of type fl CaM kinase, the and 013 contains most of the variation in the structure a subunit predominates, while the s subunit pre among the subunits. A comparison of hydrophobicity dominates in the cerebellar isoform. A third minor and predicted secondary structure of the subunit subunit, a' (58 kOa), which is structurally related to proteins reveals that deletion of 013 in S' shortens a the s subunit, is also present in small amounts in all neutral segment with a predicted coil structure that brain regions but is more abundant in the cerebellum. connects two hydrophilic domains in s. The further Recently we have identified and sequenced cONAs deletion of Oii and Dl2 from a joins these two encoding the three subunits of the kinase. The hydrophilic domains forming a new larger hydrophilic sequences reveal that a and s subunits are encoded by domain which may perform a new function in a. The distinct genes, while the a' subunit appears to be sequences contained within segments Oii, 012, 013, C2 187 and C3 show no homology to other protein kinases. resulting kinase is phosphorylated only at aThr-286/ These may include domains important in subunit aThr-287 and remains significantly Ca2+-independent. association or association of the kinase with cyto These experiments indicate that aThr-382 is not 2 skeletal components. required to maintain Ca + -independent kinase activity. Reference: Reference: Bulleit, R. F., Bennett, M. K., Molloy, S. S., Hurley, J. Bulleit, R. F., Bennett, M. K., Molloy, S. S., Hurley, J. B. and Kennedy, M. B. (1988) Neuron I, 63-72. B. and Kennedy, M. B. (1988) Neuron I, 63-72. 2 277. Location of "Slow" ea + /CaM-Dependent V6. Sequences of the Autophosphorylation~ites in Autophosphorylation Sites in Type II CaM Kinase Type II CaM Kinase That Generate Ca + - Independent Activity Stephen G. Miller Stephen G. Miller, Bruce L. Patton In the previous abstract we described the Autophosphorylation of type II CaM kinase in the identification of "rapid" autophosphorylation sites in presence of Ca2+ and calmodulin generates a partially the type II CaM kinase that correlate with the 2 Ca2+-independent form of the kinase. This change in production of a Ca +/CaM-independent form of the activity occurs after phosphorylation of only a few of kinase. When autophosphorylation is carried out for 2 the 12 subunits in a holoenzyme. We have been longer times (in the continuous presence of Ca +/ interested in determining the locations of these CaM), several "slow" sites are autophosphorylated in critical autophosphorylation sites for two major both the a and s subunits. These sites are ultimately reasons: I) to localize the autophosphorylation sites phosphorylated to significant stoichiometric levels but within the primary structure of the kinase subunits require several minutes to achieve maximal incor relative to putative functional domains, and 2) to poration of P04• We have used the methods described enable us to generate antibodies that are specific for in the previous abstract to determine the location of the critical sites using synthetic peptides. These these sites. antibodies would be useful in determining whether the The a subunit contains two "slow" autophosphoryl Type II CaM kinase undergoes regulation by auto ation sites, aThr-253 and aSer-279. Both of these are phosphorylation in vivo. We have used the methods of located between the catalytic and calmodulin-binding reverse phase HPLC tryptic peptide mapping and gas domains. The a subunit is phosphory lated to significant phase microsequencing, described in a previous Annual levels on three ''slow" autophosphorylation sites, aSer- Report (see Biology 1987, Abstract No. 233), to isolate 280, aSer-343, and aSer-371. aSer-280 is at a position and sequence the peptides containing the phosphoryl homologous to the a subunit site aSer-279. aSer-343 is ation sites responsible for the generation of ca2+ - just C-terminal to the CaM-binding domain. aSer-37 l independent kinase activity. is in a region of the a subunit that is not present in the When autophosphorylation occurs in the presence of a subunit. 2 Ca +/CaM, homologous threonine residues (aThr-286/ Phosphorylation of these "slow" autophosphoryl aThr-287) are rapidly phosphorylated in both the a and ation sites is not required for the production of a 2 a subunits. They are located near the N-terminal Ca +/CaM-independent form of the kinase. We have boundary of the calmodulin-binding domain. The a not yet observed any further regulation of kinase subunit contains a second rapidly phosphorylated activity as a result of modification of the "slow" sites. threonine, aThr-382. It is in a region of the a subunit It is possible that modification of these sites is that is not present in the a subunit and that appears to involved in other aspects of kinase function, such as be specifically deleted in the a' subunit by mRNA interaction with other cellular components. It is also splicing (Bul!eit et al., 1988). Purified protein possible that their phosphorylation has no physiological phosphatase 2A dephosphorylates aThr-382 at a higher relevance and is part of the "noise" that is generally rate than either aThr-286 or aThr-287. Partial present in protein phosphorylation systems. dephosphorylation of the kinase with protein phospha tase 2A completely dephosphorylates aThr-382. The 188 278. ca2+-lndependent Autophosphorylation Sites in References (continued): Type II CaM Kinase That Suppress Stimulation Hashimoto, Y., Schworer, C .. M., Colbran, R. J. and By Calmodulin Soderling, T. R. (1987) J. Biol. Chem. 262, 8051- 8055. Bruce L. Patton, Stephen G. Miller Jn the presence of Ca2• and calmodulin, aThr-286 279. Dephosphorylation of CaM Kinase and aThr-287 of the type II CaM kinase are rapidly Autophosphorylation Sites By Protein autophosphorylated (see previous abstracts). This Phosphatases-1 and -2A 2 generates a partially ca •-independent form of the Bruce L. Patton kinase and also aUows the autophosphorylation of The activity of the neuronal type II CaM kinase in 2+ 2 additional sites to proceed after the removal of Ca . the presence and absence of Ca + and calmodulin 2 Continued autophosphorylation in the absence of Ca + (CaM) can be regulated by autophosphorylation. A 2 does not reduce Ca + -independent kinase activity, but complete understanding of the regulation of kinase results in the loss of stimulation of kinase activity by activity in vivo requires a description of the calmodulin (Hashimoto et al., 1987; and our own endogenous brain phosphatases and their specificity for observations). This loss in calmodulin stimulation is the various kinase autophosphorylation sites. Shields et reversible by dephosphorylation with the catalytic al. (1985) reported that most of the phosphatase subunit of protein phosphatase 2A. activity in synaptic terminal preparations can be We have used reverse phase HPLC tryptic peptide classified as protein phosphatases-1 or -2A. We have mapping and gas- phase microsequencing to identify the purified the catalytic subunits of these phosphatases sites that are responsible for loss of stimulation by from rabbit skeletal muscle by the method of Tung et calmodulin. The kinase was autophosphorylated first al. (1984) and determined their specificity for the . 2+ T . in the presence, then in the absence of Ca . rypt1c kinase autophosphorylation sites. 32P-phosphate re phosphopeptides that appeared after the removal of maining at individual sites after dephosphorylation was ca2+ were isolated and sequenced. We identified two determined by liquid scintillation counting of iden new sites on each of the a and s subunits. Phosphate tified tryptic phosphopeptides separated by reverse was incorporated into peptides containing Ser-315 and phase HPLC (see Abstract No. 276 and Biology 1987, Thr-306,-307 in the a subunit and into homologous Abstract No. 233). peptides from the a subunit (containing Ser-314 and As described in the previous abstracts, CaM kinase Thr-305,-306). These sites are located within the rapidly autophosphorylates a Thr-286, aThr-287 and calmodulin-binding domain. The threonine residues are aThr-382 in the presence of Ca2•;caM, and more located within the 5-amino-acid sequence defined by slowly autophosphorylates Ser-280, Ser-343 and Ser- 2+ Hanley et al. (1988) as critical for calmodulin binding. 371 on the a subunit. Subsequent removal of Ca The time courses of autophosphorylation of aSer- allows autophosphorylation of several additional sites 314 and the a and s threonine sites are similar and in the CaM-binding domain including aSer-314, a correlate well with the loss of stimulation of kinase peptide containing aThr-305,-306, and the homologous 2 activity by Ca +/calmodulin. However, the serine a subunit sites (aSer-315, aThr-306,-307). Protein sites are resistant to dephosphorylation by the cata phosphatase-2A rapidly dephosphorylated aThr-382. lytic subunit of protein phosphatase 2A. Comparison This site is in a region that is absent in both the a and 2 of the time course of dephosphorylation of the Ca •• a subunits. Phosphatase-2A dephosphorylated aThr- independent autophosphorylation sites with the con 286/aThr-287, and the slower sites on the $subunit at 2 current recovery of Ca + /calmodulin stimulation a moderate rate. Phosphate incorporated into the 2 suggests that autophosphorylation of the threonine aThr-286/aThr-287 sites is responsible for Ca •;caM• sites alone is responsible for inhibition of effective independent activity (see previous abstract). Among binding of calmodulin. the ca2• -independent sites, dephosphorylated at a References: moderate rate, the serine residues (a-314, s-315) were Hanley, R. M., Means, A. R., Kemp, B. E. and relatively resistant to dephosphorylation. Preliminary Shenolikar, S. (1988) Biochem. Biophys. Res. Commun. 152, 122-128. results indicate that protein phosphatase-! has a 189 similar relative specificity for kinase auto Total RNA from three rat brain regions, forebrain, phosphorylation sites. lower brain, and cerebellum, was also analyzed by RNA blotting. The relative level of a to B subunit References: Shields, S. M., Ingebritsen, T. S. and Kelly, P. T. (1985) message was highest in the forebrain, intermediate for J. Neurosci. 5, 3414-3422. the lower brain and lowest in the cerebellum. This Tung, H. Y. L., Resink, T. J., Hemmings, B. A., Shenolikar, S. and Cohen, P. (1984) Eur. J. correlates with the observed subunit composition of Biochem. 138, 635-641. the holoenzyme in these regions. These results suggest that the average composition of the holoenzyme is 280. Distribution of Messages Encoding Subunits of Type II CaM Kinase in Brain Regions and Tissues regulated by the level of message for each subunit. of the Rat 2 Sean S. Molloy 281. Type II Ca + /Calmodulin-Dependent Protein Kinase in Drosophila The type II CaM kinase is differentially expressed in various tissues and brain regions of the rat. Also, Debra A. S. Leonard distinct brain regions contain isoforms of the kinase Drosophila melanogaster contains a protein kinase with characteristic subunit compositions. The fore bearing considerable homology to the rat brain type II brain form has an average of 9a : 3f3 subunits while the CaM kinase (Leonard et al., 1987). To estimate the cerebellar form has a corresponding ratio of 2a : 8f3. extent of homology at the nucleic acid level, we have This suggests that the expression of each subunit may used cDNAs encoding the cloned rat kinase a and B be independently controlled. We investigated the subunits to identify homologous sequences in Southern abundance of messages encoding the a and B subunits blots of Drosophila genomic DNA. Drosophila DNA (5.0 kb and 4.1 kb, respectively), as well as related was digested with one of five different restriction transcripts in several tissues and brain regions. enzymes. The fragments were separated by electro Total RNA from rat liver, kidney, spleen, testes, phoresis through agarose gels and then blotted by pancreas, lung, intestine, skeletal muscle and heart alkaline transfer to charged nylon membranes. Blots was isolated and subjected to RNA blot analysis. The were probed, under several different stringencies, with blots were hybridized with a radiolabeled probe labeled cDNAs encoding either the a or B subunit of generated from either a or f3 subunit cDNA. We the rat brain kinase. One 6.5 kb fragment of Hirtdlll estimated both the apparent size and relative digested Drosophila DNA was labeled, under different abundance of cross reacting bands by comparison to low stringency conditions, by both rat kinase probes. standards. The messages for the a and B subunits in This restriction fragment appears to bear stronger brain were 5.0 kb and 4.1 kb, respectively. Significant homology to the rat brain a-subunit cDNA, since this levels of these brain a and B subunit messages were not probe, but not the a subunit probe, labels the fragment found in any of the other tissues. Several tissues under more stringent hybridization conditions. contained transcripts homologous to one or both Additional, non-overlapping fragments are also labeled probes. The most prominent was a 4.3 kb band in in each digest, but by probes encoding only one of the skeletal muscle which appears to share a high degree two rat kinase subunits. Therefore, like the rat kinase, of homology with both subunits. High stringency the fly type II CaM kinase may be composed of related hybridizations indicate that this 4.3 kb message is subunits encoded by distinct genes. more closely related to the B subunit. Skeletal muscle We have used cloned rat kinase cDNAs to screen also contained a smaller band (2.7 kb) which only Drosophila head cDNA libraries for clones that encode hybridized with a subunit probe. Intestine, a source of subunits of the fly kinase. We have selected and smooth muscle, contained a 2.9 kb band apparently purified a 2.7 kb clone which contains sequences that related to the a subunit. There were several weaker are labeled by probes made from both N-terminal and bands of various sizes in other tissues which may C-terminal portions of both of the rat subunits. reflect the presence of rare, highly homologous Bulleit et al. (1988) recently showed that N-terminal transcripts or abundant but only slightly homologous portions of both rat kinase subunits include highly messages. conserved kinase and calmodulin-binding domains, 190 whereas C-terminal portions contain sequences unique protein appears to be located in postsynaptic densities, to the type II CaM kinase. Thus, the fly cDNA clone we will make synthetic oligonucleotides that encode appears to encode a large portion of one of the fly the known sequences and screen a brain cDNA library kinase subunits. We are sequencing this clone to for cDNAs encoding the entire protein. Its amino acid determine if it does, indeed, encode a kinase subunit. sequence will be deduced from the DNA sequence. A number of additional structural and functional studies References: Bulleit, R. F., Bennett, M. K., Molloy, S.S., Hurley, J. will be possible once the cDNAs and antibodies are in B. and Kennedy, M. B. (1988) Neuron l, 63-72. hand. Leonard, D. S., Wall, J. B., Pugh, P. C. and Kennedy, M. B. (1987) Soc. Neurosci. Abstr. 13, 559. References: Aebersold, R. H., Leavitt, J., Saavedra, R. A., Hood, L. E. and Kent, S. B. H. (1987) Proc. Natl. Acad. Sci. USA 84, 6970-6974. 282. Structure of CNS Postsynaptic Densities Carlin, R. K., Grab, D. J., Cohen, R. S. and Siekevitz, P. (1980) J. Cell Biol. 86, 831-843. Thomas K. Brown, Mary B. Kennedy Cotman, C. W., Banker, G., Churchill, L. and Taylor, The postsynaptic density is a densely-staining, D. (1974) J. Cell Biol. 63, 441-455. fibrous specialization of the cytoskeleton that is located underneath the postsynaptic membrane in most 283. Inhibition of Type II CaM Kinase by Sphingosine central nervous system synapses. Cell biologists have developed ways to purify and study a subcellular Venise L. Jennings, Mary B. Kennedy structure that appears to be the postsynaptic density We examined the inhibition of purified type II CaM (Cotman et al., 1974; Carlin et al., 1980). Although kinase by two classes of protein kinase inhibitors that several of the many proteins in this structure have are commercially available. The "H-series" of iso been identified, most of them have not and its function quinolinesulfonamides have been advertised as potent remains unknown. and selective protein kinase inhibitors (Hidaka et al., We have initiated a study of the postsynaptic 1984). They are especially useful because they can density with the aim of learning more about its struc partition across cell membranes and inhibit intra ture and thereby, its function. Specifically, we plan to cellular activity. In particular, H-7 is often referred determine the sequence of several of the proteins that to as a potent and selective inhibitor of the C-kinase copurify with the postsynaptic density fraction and although the K1 of this compound for the C-kinase (6 also determine whether or not they are part of the µM) is roughly the same as its K1 for the cAMP density in vivo. We have identified several individual dependent protein kinase (3 µM). HA-1004 has a K1 of proteins that are present in densities regardless of the 40 µM for the C-kinase and 2.3 µM for the cAMP method by which the densities were purified. Some of dependent protein kinase. Thus, inhibition of a process these proteins are glycoproteins, indicating that they by H-7 but not by HA-1004 at the same extracellular span the membrane and may be particularly interesting concentration has been said to indicate involvement of to characterize. Others are rapidly phosphorylated by the C-kinase. This presumption does not take into the type II CaM kinase, which itself comprises about account a possible difference in the ability of the two 20% of the total postsynaptic density protein. Our compounds to cross membranes (HA-1004 is far more strategy in studying these proteins will be to frac basic than H-7). We determined the K1 for inhibition tionate isolated postsynaptic densities by SDS-PAGE, of type II CaM kinase by H-7 and HA-1004. The K1 of transfer the proteins to synthetic filters, digest them H-7 is -30 µM, while that of HA-1004 is -16 µM. The with a protease by the method described by Aebersold significance of these numbers for inhibition of type II et al. ( 1987), fractionate the peptides by microbore CaM kinase-mediated processes in vivo remains to be HPLC and sequence them by gas-phase sequencing. determined. Anti-peptide antibodies raised against synthetic The lipid precursor sphingosine has been shown to peptides based on these sequences will be screened for be a potent inhibitor of the C-kinase in vitro and in specificity on Western blots, and then we will use them vivo (Hannun et al., 1986). N-acetyl sphingosine is to determine the location of the protein in situ. If the completely without effect. These two compounds have 191 been widely used to implicate the C-kinase in cellular Professors: Henry A. Lester, Jerome Pine 1 Norman Chandler Professor of Chemical Biology control mechanisms. We have found that sphingosine Emeritus in Chemistry and Chemical Engineering also potently inhibits the purified type II CaM kinase and Biology: Norman Davidson Visiting Associate: Bernardo C. Rudy with a K1 nearly identical to that for the C-kinase. N Senior Research Fellows: Alan L. Goldin, Hermann acetyl sphingosine is without effect. This similarity Lubbert, Terrance P. Snutch Research Fellows: Pierre Charnet, W. David Crank, between the two kinases was not expected because Tung Ming Fong, Jeffrey H. Hoger, Douglas S. sphingosine is known to act at the regulatory domain Krafte, John P. Leonard, Reid J. Leonard, Fedora Sutton, Alfred E. Walter, Lei Yu of the C-kinase. The results imply a similarity Member of the Professional Staff: Cesar G. Labarca 1 1 between the structures of the two kinases that was not Graduate Students: Chi-Bin Chien , John R. Gilbert , Tina J. Kramer, Wade Regehr', John H. Thompson heretofore appreciated. They also suggest that caution Research and Laboratory Staff: Amit Agarwal, is in order in the interpretation of experiments Chulbul Ahmed, Mary Ann Buckles, Linda L. Czyzyk, Annie Gouin, H. Marie Krempin, involving sphingosine application to cells. Catherine Lin, Hieu T. M. Nguyen, Floyd G. Shon, Becky G. Tanamachi Refereix:es: Hannun, Y. A., Loomis, C.R., Merrill, A. H. and Bell, 1Division of Physics, Mathematics and Astronomy, R. M. (1986) J. Biol. Chem. 261, 12604-12609. California Institute of Technology. Hidaka, H., Inagaki, M., Kawamoto, S. and Sasaki, Y. 2 Division of Engineering and Applied Science, (1984) Biochemistry 23, 5036. California Institute of Technology. Support: The work described in the following research PUBLICATIONS reports has been supported by: American Cancer Society Bulleit, B. F., Bennett, M. K., Molloy, S. M., Hurley, J. American Heart Association B. and Kennedy, M. B. (1988) Conserved and Biomedical Research Support Grant (NIH) varjable regions in the subunits of brain type 11 Caltech President's Fund Ca +/calmodulin-dependent protein kinase. Neuron Joseph Drown Foundation I, 63-72. James Irvine Foundation Kennedy, M. B. (1987) All things in modulation. (Book The Esther A. and Joseph Klingenstein Fund, Inc. review of N euramodulation. The Biochemical Lucille P. Markey Charitable Trust Control of Electrical Excitability, Kaczmarek, L. Muscular Dystrophy Associations of America, Inc. K. and Levitan, I. B., Eds.), Cell 50, 329-330. National Institutes of Health, USPHS Kennedy, M. B. (1987) Molecules underlying memory. National Science Foundation News and Views, Nature 329, 15-16. The Procter & Gamble Co. Kennedy, M. B. (1988) Structures of neuronal protein System Development Foundation kinases. In: Molecular Biology of the Human Brain, Unisys Corporation UCLA Symposia on Molecular and Cellular Biology, The Del E. Webb Foundation New Series, Vol. 72, Jones, E. G. (Ed.), Alan R. Liss, Inc., New York, pp. 79-93. Kowall, N. W., Kennedy, M. B. and Kosik, K. S. (1988) Allocortical projection neurons predisposed to neurofibril~ry tangle formation are enriched in Summary: We continue to focus our research on the type II Ca +/calmodulin-dependent protein kinase. proteins-receptors, ion channels, and pumps-that Abs. American Association of Neuropathologists, in press. underlie the excitability of biological membranes. We Leonaizj, D. S. and Kennedy, M. B. (1988) Type 11 approach this field with the tools of heterologous Ca +/calmodulin-dependent protein kinase in Drosophila. Soc. Neurosci. Abstr. 14, 839. expressi9n, particularly in Xenopus oocytes. Individual Miller, S. G., Patton, B. L. and Kennedy, M. B. (1988) researchers divide their time between biophysical An eajly autophosphorylation site in neuronal type II Ca +/~lmodulin-dependent protein kinase pro measurements and nucleic acid molecular biology; duces Ca +-independent activity. Soc. Neurosci. thus, we call ourselves ''The Electric Cloners." This Abstr. 14, 107. Patton, B L., Miller, S. G. and Kennedy, M. B. (1988) year our biophysical expertise has been broadened to A Ca 2+-independent autophosphorylation site in 2 include dye measurements of intrac~llular Ca + neuronal type II CaM kinase suppresses stimulation by calmodulin. Soc. N eurosci. Abstr. 14, 107. concentrations. Heterologous expression allows us to approach three major topics. First, like any reconstitution system, the oocyte allows one to define the components necessary for expression of the original properties. Thus, we use RNA fractionation and RNA 192 synthesized in vitro from cDNA clones to reconstruct progress on a family of silicon microdevices designed the kinetics, pharmacology, and voltage dependence of to make long-term electrical contact with cultured membrane excitability, or to confirm successful neurons. These devices are intended to facilitate long cloning of an excitability molecule. We have made term studies of network plasticity using only electrical progress in t;1is area for electrically excitable Na methods. Finally, the group is continuing to work with channels, for amino-acid receptors, and, in others in developing techniques for using ultra-soft x collaboration with the Tanouye laboratory, for K+ ray microscopy to reveal synaptic ultrastructure in channels encoded at the Drosophila Shaker locus. cultures. Second, this reconstitution can also be used as an 284. A Rat Brain Na Channel a Subunit with Novel assay system to screen for cDNA clones that encode Gating Properties. excitability molecules. In past years we have 1 Vanessa J. Auld , Alan L. Goldin, Douglas S. Krafte, employed such strategies for serotonin receptors; and 1 1 John Marshall , James M. Dunn , 2 we are now beginning similar studies with K+ channels William A. Catterall 2, Robert J. Dunn and with excitatory amino-acid receptors. We have constructed a full-length rat brain Na Finally, once cDNA clones are in hand for all sub channel a subunit cDNA. Transcription of the cDNA in units of an interesting excitability molecule, one can vitro and injection into Xenopus oocytes resulted in employ oocyte expression to test hypotheses about the the synthesis of functional Na channels. Although the relationship between amino-acid sequence, structure, single-channel conductance of the channels resulting and function. This topic is now being approached for from cloned cDNA was the same as that of channels acetylcholine receptors and for electrically excitable resulting from injection of rat brain RNA, we observed Na channels. two significant differences between the gating The group has other interests in molecular neuro properties of the channels. The Na currents from biology. Unique kinetic and mechanistic information cloned cDNA displayed much slower macroscopic has been obtained with a series of specially designed inactivation compared to those from rat brain mRNA. light-activated molecules. Some of these molecules In addition, the current-voltage relationship for resemble synaptic transmitters, such as acetylcholine; currents from cloned cDNA is shifted 20-25 mV in the other "caged" molecules release intracellular depolarizing direction compared to that from rat brain messengers, such as cyclic nucleotides or Ca, in RNA. Coinjection of low molecular weight rat brain response to light flashes. Experiments on these RNA restored the normal inactivation of the channels molecules thus involve the tools of photochemistry, produced from the cloned a subunit, but did not affect organic synthesis, and of course, electrophysiology. In the current-voltage relationship. Thus, low molecular the context of the graduate option in Computation and weight rat brain RNA encodes a component, either a Neural Systems, other projects have included structural subunit of the channel complex or a theoretical studies of synaptic function and extensive modifying enzyme, that is necessary for normal gating software development. of the channel. Jerome Pine, Professor of Physics, is also 1 Department of Medical Genetics, University of associated with the research group. Professor Pine's Toronto, Toronto, Ontario, Canada. 'Department of Pharmacology, University of interest is in the patterns of connections formed by Washington, Seattle, WA. neural networks and the effects of activity on connectivity. His group has developed techniques for 285. Inactivation Kinetics of the Rat Brain noninvasively studying the electrical connections in Na Channel llA a Subunit cultured neural networks so that they may be studied 1 Alan L. Goldin, Douglass. Krafte, Vanessa J. Auld , as a function of time. Cultures are grown in dishes Robert J. Dunn 1 which embody microelectrodes for stimulation. We have investigated the macroscopic and single Optical recording techniques based on the use of channel properties of Na channels induced in Xenopus voltage-sensitive fluorescent dyes are used for oocytes by in vitro transcripts of the rat brain ZIA a recording from these cultures. In addition, work is in subunit cDNA clone. Our data show that the steady- 193 state voltage dependence of inactivation is shifted by from those induced by injection of poly(A) rat brain LO mV in the depolarizing direction relative to that for RNA with respect to inactivation. Although normal Na currents induced by injection of rat brain poly(A) rapid inactivation is restored, the voltage for RNA. In addition, the rate of recovery from in maximum inward current is not. This may have activation is altered for rat I!A channels. When a train interesting implications for state models of the Na of depolarizing pulses is given from a holding potential channel. We have begun single-channel recording from of -LOO mV to +LO mV at 10 Hz, there is no change in Na channels induced by injection of rat UA RNA plus the peak amplitude of Na current in oocytes injected low MW rat brain RNA. Preliminary results indicate with poly(A) RNA. In oocytes injected with rat HA that the probability of re-opening is returned to values RNA, there is a marked reduction in current amplitude similar to those measured for Na channels induced by during the train. Pulsing at LO Hz reveals two kinetic rat brain poly(A) RNA. We are currently employing a components in the rat IIA currents. One component has functional cDNA cloning strategy using the low MW a slow inactivation rate and is completely eliminated RNA fractions to isolate a specific cDNA clone that at this frequency while the other inactivates rapidly modifies the rat brain a. subunit. and is not removed at 10 Hz. The slow component is 1 Department of Medical Genetics, University of attenuated even for stimulation frequencies as slow as Toronto, Toronto, Ontario, Canada. 1 Hz. The rate of recovery from inactivation of this slow component is voltage dependent. There is less 287. At Least Two mRNA Species Contribute to the attenuation of current if the holding potential is -120 Properties of Rat Brain "A"-Type Potassium Channels Expressed in Xenopas Oocytes mV as opposed to -80 mV. We have begun a quanti tative characterization of the single-channel Bernardo C. Rudy, Jeffrey H. Hoger 1 properties of Na channels induced by rat HA RNA. At Fast transient K channels ("A" channels) were the single-channel level we see a decreased open time expressed in Xenopus oocytes injected with rat brain relative to Na channels from poly(A) RNA and an poly(A) RNA. The expressed channels activate and increased probability of reopening at a given potential. inactivate at very negative membrane potentials. 1 Department of Medical Genetics, University of Thus, they belong to the group of A channels that Toronto, Tor onto, Ontario, Canada. operate in the subthreshold region for Na action potential generation and therefore play an important role in producing delayed excitation and in regulating 286. Low Molecular Weight RNA-Encoded Protein(s) Modifies Rat Brain Na Channel Function firing frequency. Inactivation of the A currents is 1 incomplete during pulses of 150-300 ms as observed for Douglas S. Krafte, Alan L. Goldin, Vanessa J. Auld , Robert J. Dunn 1 some A currents in vivo. Sucrose gradient We have investigated the inactivation properties of fractionation of the poly(A) RNA separates mRNAs Na channels induced in Xenopus oocytes by co encoding A currents from mRNAs of relatively large injection of low molecular weight (MW) RNA and RNA molecular size. A currents expressed from transcribed from the rat brain HA a subunit cDNA fractionated mRNA have different kinetics and clone. Na channels induced by injection of rat UA RNA pharmacology than A currents expressed with total alone demonstrate 2- to t+-fold slower inactivation, a mRNA. Inactivation during the pulse is complete in 10 mV shift in the steady-state voltage dependence, oocytes injected with the 6-8 kb fraction. This type of and a 20-25 mV shift in the voltage at which maximum A current kinetics has been observed in some cells. inward current occurs compared to channels induced The original properties of the A current can be by rat brain poly(A) RNA. A low MW sucrose gradient reconstituted when small mRNAs (2-4 kb) are added to fraction of rabbit brain RNA from l-2.5 kb or a the large mRNA fraction. The results demonstrate fraction <4 kb from rat brain restores the rate and that the properties of the A currents expressed with steady-state voltage dependence of inactivation to total poly(A) RNA depend on the presence of more normal. These changes render the currents induced by than one mRNA species. mRNA(s) present in the large rat UA plus low MW RNA essentially indistinguishable mRNA fraction must encode channel subunits since 19~ they express an A current by themselves. The small has been measured at both the whole cell and single mRNA(s) may encode a second subunit(s) or a factor channel levels. The same modification to the a subunit such as an enzymatic activity which alters the (of which there are two in the functional AChR) properties of the channel. These data suggest a new reduces the effectiveness of the block by twice as mechanism to generate A channel diversity. much. Furthermore, the effects of the mutations to 1 Division of Chemistry and Chemical Engineering, the o and a subunits add when both mutated subunits California Institute of Technology. are present in the same AChR. 288. Structure-Function Studies of the Nicotinic 289. Beta Subunit of Mouse-Torpedo Hybrid A~hRs Acetylcholine Receptor Expressed in Xenopus Oocytes Determines Sensitivity to a Non-Competitive Inhibitor Reid J. Leonard, Cesar G. Labarca, Pierre Charnet, Linda L. Czyzyk Reid J. Leonard We are applying the technique of site-directed One strategy for examining structure-function mutagenesis to identify specific amino acids of the relationships of the nicotinic acetylcholine receptor mouse nicotinic acetylcholine receptor (AChR) that (AChR) is to study the effects of structural changes on determine the physiological properties of the normal the activity of non-competitive inhibitors (NCis), receptor. We express mRNAs encoding each of the because the primary site of action of many NCis four subunits of the mouse AChR in Xenopus oocytes appears to lie within the ion channel of the AChR. We and examine the properties of the assembled proteins have used N-p-phenyl-azo-phenyl-carbamylcholine in the membrane by a combination of two-electrode (EW-1), which acts as a light-activated open channel voltage clamping and patch clamp single-channel blocker on synaptic AChRs at the EZectrophorous recording. Our previous studies using this system were electroplax. Oocytes were injected with AChR subunit limited to examination of the effects of substituting mRNAs transcribed in vitro from cDNAs of mouse one or more of the mouse AChR subunits with those of BC3HI cells or Torpedo electric organ to express the Torpedo californica. Those studies revealed "MOUSE," "TORPEDO," or "HYBRID" (mixtures of several interesting differences between receptors subunit mRNAs from both species) AChRs in their composed of all four mouse subunits and "hybrid" surface membranes. Oocytes were voltage clamped receptors composed of a mixture of subunits from the and subjected to potential jumps in the presence of 0-1 two species. One striking difference was in the µM ACh and the effect of EW-1 on the resultant sensitivity to non-competitive inhibitors of the AChR, current relaxations was examined. such as channel blocking drugs. For example, For "MOUSE"-type AChRs, flash isomerization substitution of the mouse s subunit by its homologue (trans+cis) of I or 5 µM EW-1 caused a reversible, from Torpedo increases the sensitivity to voltage-dependent decrease in the ACh-activated chlorpromazine by at least 400%. Studies by others currents, as though the flash created a transient show that such non-competitive inhibitors interact increase in the concentration of open channel blocker. with specific serine residues present in the same "TORPEDO"-type channels, however, were blocked position on each of the Torpedo subunits. Such data >90% by the trans isomer of EW-1, and the effect of suggest that those residues define an axis of symmetry isomerization to the cis form was to relieve the block in the oligomeric receptor; and it is often suggested at positive voltages. The sensitivity to trans-EW-1 in that this axis of symmetry is the actual ion channel "HYBRID" AChRs was determined by which "parent" pore of the AChR. Through site-directed mutagenesis, contributed its a subunit. At the appropriate EW-1 we have modified the serines in the mouse subunits concentration, either flash-activated blocking or which occupy positions homologous to those labeled by unblocking could be observed in "Torpedo"-like blockers in the Torpedo. We have found that the HYBRIDS, but unblocking was not observed in modification of a single serine to alanine in the o HYBRIDS that contained a a subunit from MOUSE. subunit decreases the magnitude of channel block by The effect of a subunit on sensitivity to the local anesthetic analog QX-222 by one half. This ch!orpromazine follows the same pattern: the 195 presence of a B subunit from Torpedo increases the +60m V was used as an index, because previous work sensitivity to block by a factor of four. showed that the channel open time contributes the most to the voltage sensitivity of the whole-cell 290. Acetylcholine Receptors: Subunit Roles in conductance (Biology 1987, Abstract No. 240). For the Single-Channel Conductance, Channel Open eight receptors studied at the single-channel level, the Duration, and Voltage Sensitivity voltage sensitivity follows the same order as deter Lei Yu, Reid J. Leonard mined at the whole cell level (Yoshii et al., 1987), For a protein composed of multiple polypeptide therefore supporting our previous hypothesis that the B chains such as the pentameric nicotinic acetylcholine subunit plays a major role in AChR voltage sensitivity receptor (AChR), do different subunits play a role in and that the o subunit interacts with the B subunit to controlling different properties of the receptor? We modify it. tried to address this question by expressing wild-type Reference: and hybrid receptors from mouse and Torpedo AChRs Yoshii, K., Yu, L., Mixter-Mayne, K., Davidson, N. and in oocytes and examining the single-channel properties Lester, H. A. (1987) J. Gen. Physiol. 90, 553-573. of these receptors. The AChR subunits from the two species have both a high degree of homology and a 291. Structure-Function Studies of a Voltage-Gated Potassium Channel certain amount of difference at the sequence level. Likewise, the two wild-type receptors share Reid J. Leonard, Linda E. Iverson, Mark A. Tanouye qualitative similarities of ion channel functions but The Shaker locus of Drosophila encodes a family of have quantitative distinctions in their channel voltage-gated potassium channels. The mRNA synthe properties. We hoped to establish a correlation sized from one cDNA clone isolated and characterized between the changes of single-channel properties and in the Tanouye lab at Caltech directs the synthesis of the identity of subunit sources. AChR subunit cDNA a K+ channel that appears remarkably similar to that clones were used to synthesize mRNAs in vitro, and found in Drosophila larval muscle (see Tanouye lab the mRNAs for all four subunits were combined for abstracts). Because the formation of the channel oocyte microinjection. By substituting the mRNA for requires injection of only a single mRNA species, the a particular subunit from one species with its channel is presumably homo-multimeric. Whether this homologue from that of the other species, hybrid is the normal structure of the channel in flies has not AChR receptors were generated. The following eight been determined. Nevertheless, the availability of a AChR receptors, two wild types and six hybrids, have single clone that directs the synthesis of a functional been examined for their single-channel properties: voltage-gated K+ provides an opportunity to begin aTBTYT 0P aMBMYM 0M• aMBTYT 0P structure-function studies using a combination of site aTBTYT 0M• aMBTYM 0M• aMBTYT 0M• directed mutagenesis and electrophysiology. We intend aMBMYT 0M•aTBMYT6M• to investigate the high selectivity of the channel for K+ ions over Na+ ions, even though they are very The results of single-channel recordings were analyzed similar electrostatically. One hypothesis to explain and the following patterns emerged. For single-channel such selectivity is that the ions are discriminated on conductance, both a and o subunits are important, the basis of their hydrated diameters, with the channel probably reflecting an interaction between the two. acting as a molecular sieve. We shall test hypotheses For channel open dui;:ation, both ciM and receptors containing both aM and oM (aMBTyMoM and 292. Mouse Brain Serotonin Receptor-Mediated aMBTYToM) have very long open times, while in the Responses in Xenopw1 Oocytes: Ionic Mechanisms of Calcium-Activated Chloride Currents presence of BM (aMBMyMoM and aMBMyToM), they have shorter ones. For the voltage sensitivity of the Lei Yu AChR, the ratio of channel open times at -60 m V and Serotonergic responses can be induced in Xenopus 196 oocytes injected with mouse brain RNA, as a result of Two yeast genes, STE2 and STE3, have been cloned the expression of the mouse 5-HT 1c serotonin that, by criteria of genetic analysis in yeast, may code receptors. The response consists of a two-phase Ca++ - for the mating pheromone receptors. In this study, we activated CC current. The first phase is a fast used the cloned STE2 gene, the putative receptor gene transient inward current, followed by a sustained for a-factor, and expressed it in Xenopus oocytes by plateau in the second phase. The CC current in microinjection of in vitro synthesized mRNA. Surface mRNA-injected oocytes can be induced under three binding experiments were performed with 35s-labeled conditions: l) addition of serotonin in low Ca++ ( 1 Department of Biochemistry, University of 293. Expression of Yeast a-Factor Receptor in California, Berkeley, CA. Xenopus Oocytes 1 1 Lei Yu, Kendall V. Blumer , Jeremy Thomer 294. Two Functional Types of Acidic Amino Acid Yeast cells are unicellular eukaryotic organisms. Receptors Are Encoded By Different mRNA Two "sexes" do exist, however, in the haploid cells of Populations many yeast strains.. Cells of opposite "sexes," known Tung Ming Fong as mating types, are able to "mate" with each other The Xenopus laevis oocyte expression system was and fuse to form a diploid cell. To prepare for the used to study the molecular composition of mRNAs coming event of mating, a cell goes through drastic encoding acidic amino acid (AA) receptors from rat changes of its physiological states, including a brain and the functional properties of the response to dramatic change in the overall pattern of gene several agonists and antagonists. Xenopus oocytes expression, an arrest in the G l phase of the cell injected with poly(A)+ mRNA acquire two general division cycle, and a morphological change of the cell, classes of membrane AA receptors. One class includes "shmooing." All these physiological changes are AA-gated cation channels. Responses are evoked by triggered by the stimulation of oligo-peptide mating N-methyl-D-aspartate (NMDA) and kainate, or to a pheromones secreted by the cell of the opposite smaller extent by L-glutamate or quisqualate. The mating type. The two mating types of the yeast cells second class of receptor activates intracellular second are called a and a, and they secrete different mating messengers leading to a Ca++ -activated Cl pheromones, known as a- and a-factors. It has been conductance; and it can be activated by L-glutamate hypothesized that these mating factors exert their and quisqualate. DL-2-amino-5-phosphonopentanoic effect by interacting with specific receptors on the acid or D-a-aminohexanedioic acid inhibits the AA cell membrane of the recipient cell. This interaction gated conductance activated by NMDA, and less sends a signal, through an unidentified pathway of weakly that induced by kainate, but not the second intracellular signal transduction, to the cellular messenger-inducing AA receptor. Dose-response regulatory mechanisms. analyses revealed that the kainate-activated 197 conductance requires the highly cooperative binding of the Ins l,4,5P3-sensitive pool without stimulating the two agonist molecules. Responses to NMDA are production of inositol phosphates. Phase II may also enhanced by micromolar levels of glycine and are require the opening of a voltage-sensitive calcium inhibited by Mg 2+, by Zn2+, or by MK 801; thus the channel. We will test this possibility by voltage NMDA receptor expressed in oocytes retains many clamping the oocytes while monitoring intracellular hallmarks of the response in neurons. The mRNAs calcium with fura-2. were further size-fractionated by denaturing agarose gel electrophoresis to study the molecular 296. Development and Plasticity of composition. About 20-fold purification in specific Small Neural Networks activity (nA/ng of mRNA injected) of mRNAs encoding Chi-Bin Chien, W. David Crank, Becky G. Tanamachi, the second messenger-inducing AA receptor has been Jerome Pine achieved. In contrast, very slight enrichment of the Neural networks can be grown in culture. We are mRNAs encoding the AA-gated channel was interested in studying the patterns of synaptic observed. This suggests that AA-gated cation channels connections that develop normally and the changes are encoded by multiple species of mRNAs or by induced by specific patterns of imposed electrical mRNAs whose size distribution is heterogenous. stimulation. Initial studies are being made with sympathetic neurons from rat superior cervical 295. Inositol Trisphosphate Triggers a Two-Phase ganglion, after which brain neurons will be used. Increase in Intracellular Calcium We have developed a system for studying the Alfred E. Walter electrical connectivity of networks without damaging We have assembled a microspectrofluorometer the cells. We are studying small networks, of two to capable of rapidly alternating between two excitation ten neurons, isolated from other cells and growing in wavelengths while focused on a cell under electro culture dishes which incorporate 61 stimulating elec physiological control. Such a system can be used to trodes in a region about 0.5 mm in diameter. Neuron monitor changes in intracellular calcium or hydrogen microcultures are grown over these electrodes, which ions with the fluorescent probes fura-2 and BCECF, are used to stimulate single neurons. The response of respectively. Our experiments with fura-2 have shown the culture to stimulation is determined by a voltage that injection of inositol 1,4,5 trisphosphate sensitive dye recording system. The culture is stained (Ins l,4,5P3) into Xenopus oocytes triggers an increase with a fluorescent dye that dissolves in the cell plasma in intracellular calcium which consists of two phases. membrane, and whose fluorescence changes linearly Phase I results from a release of calcium from intra with membrane potential. By observing the variation cellular stores. In contrast, Phase II requires the entry in fluorescence from the cell body, both action of extracellular calcium. Investigators using other potentials and postsynaptic potentials can be observed. types of cells have provided evidence that during Initial experiments have been done with Phase I Ins l ,4,5P 3 releases calcium from intracellular sympathetic neurons, and the use of the dishes for stores directly. Just how the plasma membrane stimulation of these cultures has been found to be becomes permeable to calcium during Phase II is not problematic. Stimulation of a cell by antidromic known. A specific kinase converts Ins l,4,5P3 to stimulation of its neurites does not always occur, inositol tetrakisphosphate (Ins l,3,4,5P4), which may because there appears to be conduction failure of the increase the permeability of the plasma membrane to nerve impulse at one of the frequent bifurcations of calcium. In addition, there is evidence that the these axons. The stimulation of a cell body is also Ins l,4,5P3 kinase is regulated by calmodulin. Thus, to technically difficult. As a result, experiments are now test whether Phase II requires the formation of being done in microcultures of sympathetic neurons by Ins l,3,4,5P4, the activity of the kinase will be stimulating cells with a loose patch pipette and inhibited by the application of a calmodulin inhibitor, recording with the fluorescent dye system. In this way such as calmidazolium. As an additional test, we plan the connectivity of a culture can be successfully to use thapsigargin, which can discharge calcium from mapped. The effects of chronic stimulation of one or 198 two chosen cells can then be studied for periods of are placed, and in which they are trapped by an over several hours. hanging grid. Each hole has an electrical contact To proceed to studies of brain neurons, we have which provides two-way communication with its cell. developed a hippocampal culture system. These Neurons placed in the holes grow normally and suffer neurons are particularly interesting for studies of no observable ill effects. The neurochips are now plasticity since they exhibit the phenomenon of long being equipped with recording and stimulating elec term potentiation both in vivo and in slices. The tronics for experiments to study the effect of patterns growth and geometry of these neurons make it more of activity on the growth of individual cells and on the likely that the electrode dishes will be easy to use, and connectivity of networks. that difficulties such as those encountered with A new phase of this project is to modify the neuro sympathetic neurons will not occur, making possible chip system for use as a "neuroprobe." This will be an long-term stimulation experiments. implantable substrate which can be inserted into an intact nervous system after being loaded with appro 297. Neuron-Microdevice Connections priate dissociated cells. The plan is to use the cells in the probe to establish synaptic communication with Wade Regehr, Tina J. Kramer, John Thompson, Becky G. Tanamachi, Jerome Pine the host, while maintaining electrical communication New techniques for maintaining long-term two-way between the probe neurons and outside electronics. In electrical communication with cultured neurons are this way, multichannel stimulating and recording may being developed. The goal of this work is to provide be possible which has great advantages in specificity purely electrical non-invasive methods for stimulating over more conventional multielectrode probes. and recording with cultured neurons. The first of a family of new devices positions a single electrode in intimate contact with the top of a 298. Soft X-Ray Microscopy cultured neuron. It is at the end of a long, flexible Jerome Pine "diving board," supported by a pedestal glued to the It is not presently possible to visualize the synapses bottom of the culture dish. Diving board electrodes of a cultured neural network without destroying it by micromachined from silicon have been made and thin sectioning and electron microscopy. With this successfully used to record and stimulate from technique it is still not practical to see more than a sympathetic neurons approximately 20 microns in fraction of the synapses in even a small network. The diameter. Long-term contact with the diving board development of X-ray microscopy offers a promising electrode does not appear to cause any damage to the alternative. During the past three years we have neuron. Experiments have begun, in collaboration with worked with a group from SUNY Stony Brook and the Stan Kater at Colorado State University, in which IBM Watson Labs to use their scanning transmission X these electrodes are used with identified snail ray microscope (STXM, or "sticksum") with cultured neurons. In preliminary studies, the electrodes have cells. been used to monitor the changing spontaneous The STXM uses X-rays of wavelength approxi activity of growing neurons over a period of four days, mately 3 nanometers, which defines the ultimate and to stimulate a neuron for up to 48 hours with no resolution limit of the device. However, X-ray optical observable side effects. We plan to continue this work technology and radiation damage effects are expected to study the effects of selected patterns of stimulation to limit the resolution to about 10 times this value, on the way identified snail neurons grow and connect which is nonetheless 10 times better than the best in culture. light microscopy. Furthermore, the properties of the While the diving boards are appropriate for X-rays provide structural contrast without staining for experiments with up to four neurons, a second type of whole wet cells, and should allow live cells to be device, the "neurochip," is being built for experiments imaged. If this capability is indeed realized, the with larger numbers of cells. Here, a flat substrate is microscope will become an important tool for cell micromachined to produce holes into which neurons biologists. 199 During the past year the Brookhaven microscope could be used to pick up signals from two or more has been dismantled for extensive rebuilding, and it is neighboring ganglion cells, distinguished by pulse size expected to become functional again at the end of and shape as well as by response properties to the light 1988. At that time it is expected that a resolution of flashes. We are now building a computer-based system 50-75 nanometers will be achieved, and that a much for simultaneously recording from all 61 dish higher intensity of X-rays will be available so that electrodes and expect to be able to simultaneously pictures can be taken in minutes or even less. We will observe the individual responses of at least 100 then explore the radiation damage to live neurons ganglion cells over an area of about 0.2 square which have been used for high resolution microscopy, millimeters. The behavior of the ganglion cell as well as the use of immuno-labeling of fixed whole population when stimulated by various light intensities wet cells with gold-labeled second-antibodies. and geometrical patterns will allow direct observation Preliminary immunolabeling experiments have been of retinal information processing. done this year in collaboration with Dennis Bray of the 1Department of Neurobiology, Stanford University MRC Cell Biophysics Laboratory in London. The Medical Center, Stanford, CA. microscope at Daresbury, near Manchester, was used to successfully image intermediate filaments, a neuron-specific surface protein, and an intracellular PUBLICATIONS growth-associated protein. The resolution was only Auld, V., Goldin, A. L., Krafte, D. S., Marshall, J., about 250 nm, because the British microscope is at an Dunn, J. M., Catterall, W. A., Davidson, N., Lester, H. A. and Dunn, R. J. (1988) A rat brain Na channel early stage of development, but the gold >econd a subunit with novel gating properties. Neuron 1, antibodies were clearly found to be useful for 449-461. Auld, V., Goldin, A., Krafte, D., Marshall, J., Dunn, J., localization of specific proteins. Catterall, W., Lester, H., Davidson, N. and Dunn, R. (1988) Cloning and characterization of a novel voltage-gated sodium channel. Soc. Neurosci. Abstr. 14, 835. • 299. Information Processing in the Retina Chien, C.-B., Crank, W. D. and Pine, J. (1987) Non 1 1 invasive techniques for measurement and long-term Markus Meister , Jerome Pine, Denis Baylor monitoring of synaptic connectivity in micro The microcircuit culture dishes originally cultures of sympathetic neurons. Soc. Neurosci. Abstr. 13, 1426. developed for stimulation of cultured neurons can also Fong, T. M., Davidson, N. and Lester, H. A. (1988) be used for extracellular recording. One application is Properties of two classes of rat brain acidic amino acid receptors induced by distinct mRNA popula to record from a brain slice or other thin layer of tions in Xenopus oocytes. Synapse, in press. neural tissue in close proximity to the electrode array, Fong, T. M., Davidson, N. and Lester, H. A. (1988) Two functional types of excitatory amino acid receptors which provides large extracellular signals. The synthesized from rat brain mRNAs. Biophys. J. 53, ganglion cell layer of a retina is a particularly 638a. Goldin, A. L., Krafte, D. S., Auld, V. J., Dunn, R. J., attractive cell population. Davidson, N. and Lester, H. A. (1988) A rat brain During this year we made preliminary studies with Na channel a subunit with altered inactivation properties. Soc. Neurosci. Abstr. 14, 598. Markus Meister and Denis Baylor at Stanford Hoffman, B. J., Lubbert, H., Nguygen, H., Hartig, P. University, using whole retinas placed ganglion-cells R., Lester, H. A. and Davidson, N. (1987) Analyses of cloned serotonin 5-HTIC receptor cDNAs. Soc. down in the microcircuit culture dish. Methods for Neurosci. Abstr. 13, 33. removing the vitreous humor and for maintaining the Iverson, L., Tanouye, M. A., Lester, H. A., Davidson, N. and Rudy, B. (1988) Expression of A-type retina in close contact with the dish bottom have been potassium channels from Shaker cDNAs. Proc. developed, and very good extracellular recordings from Natl. Acad. Sci. USA 85, 5723-5727 Kirschenbaum, B., Snutch, T., Lester, H., Greene, L. individual ganglion cells have been made. Retinas A., Davidson, N. and Rudy, B. (1987) Induction of from frog and tiger salamander have been used. Na channels and Na channel mRNA by NGF in PC12 cells. Soc. Neurosci. Abstr. 13, 795. During tests, simultaneous recordings were made Krafte, D. S., Snutch, T. P., Leonard, J. P., Davidson, from up to eight electrodes while the retina was N. and Lester, H. A. (1987) More than one RNA species is involved in controlling inactivation of rat stimulated by weak light flashes. The preparation brain Na channels expressed in Xenopus oocytes. remained viable for at least one hour. Each electrode Soc. Neurosci. Abstr. 13, 91. 200 Krafte, D. A., Snutch, T. P., Leonard, J.P., Davidson, Pine, J., Gilbert, J. and Regehr, W. (1987) Micro N. and Lester, H. A. (1988) Evidence for the devices for stimulating and recording from cultured involvement of more than one mRNA species in neurons. In: Artificial Organs, VCH Publishers, controlling the inactivation p_rocess of rat and New York, p. 573. rabbit brain Na channels expressed in Xenopus Regehr, W. G., Chien, C.-B., Kramer, T. J., Crank, W. oocytes. J. Neurasci. 8, 2859-2868. D., Rutledge, D. B. and Pine, J. (1988) Progress in Krafte, D. S., Goldin, A. L., Auld, V. J., Dunn, R. J., long-term electrical connections to cultured Lester, H. A. and Davidson, N. (1988) Low MW neurons using integrated circuit technology. In: RNA encoded protein(s) modifies the functional Proceedings of the 1988 IEEE Canf erence on properties of the rat brain Na channel. Soc. Synthetic Microstructures, Airlie House, Virginia, Neurosci. Abstr. 14, 598. in press. Krafte, D. S. and Lester, H. A. (1988) Expression of Regehr, W. G., Kater, S. B. and Pine, J. (1987) A functional sodium channels in stage II-III Xenopus chronic in vitro microdevice-neuron connection. oocytes. J. Neurosci. Meth., in press. Soc. Neurosci. Abstr. 13, 1426. Leonard, J. P., Snutch, T. P., Davidson, N. and Lester, Regehr, W. G., Pine, J. and Rutledge, D. B. (1988) A H. A. ( 1987) Ca channels induced in Xenopus chronic in vitro neuron-microdevice connection. oocytes by rat brain mRNA: Size fractionation and IEEE Trans. Biomed. Engr., in press. physiological studies. Soc. Neurosci. Abstr. 13, Rudy, B., Hoger, J., Lester, H. A. and Davidson, N. 795. ( 1988) At least two mRNA species contribute to Leonard, R. J., Labarca, C., Davidson, N. and Lester, the properties of rat brain "A"-type potassium H. A. (1988) Beta subunit of mouse-Torpedo hybrid channels expressed in X en opus oocytes. Neuron, in acetylcholine receptors expressed in Xenopus press. oocytes determines sensitivity to a non Sutton, F., Davidson, N. and Lester, H. A. (1988) competitive inhibitor. Biophys. J. 53, 639a. Tetrodotoxin-sensitive voltage-dependent Na Leonard, R. J., Labarca, C., Charnet, P., Davidson, N. currents recorded from Xenopus oocytes injected and Lester, H. A. (1988) Serines in the M2 region of with mammalian cardiac muscle RNA. Mol. Brain nicotinic receptors participate in binding an open Res. 3, 187-192. channel blocker. Submitted for publication. Sutton, F ., Yoshii, K., Davidson, N. and Lester, H. A. Lester, H. A. (1988) Heterologous expression of (1987) TIX-sensitive Na channels expressed in excitability proteins: Route to more specific Xenopus oocytes injected with rabbit heart RNA. drugs? Science 241, 1057-1063. Soc. Neurosci. Abstr. 13, 91. Lester, H. A., Snutch, T. P., Leonard, J. P., Nargeot, Yoshii, K., Yu, L., Mixter-Mayne, K., Davidson, N. and J. and Davidson, N. (1988) Expression of mRNA Lester, H. A. (1987) Equilibrium properties of encoding rat brain Ca channels in Xenopu.s oocytes. mouse-Torpedo acetylcholine receptor hybrids In: The Calcium Channel: Structure, Function, and expressed in Xenopus oocytes. J. Gen. Physiol. 90, Implications, Morad, M., Nayler, W. G., Kazda, S. 553-573. and Schramm, M. (Eds.), Springer-Verlag, in press. Lubbert, H., Hoffman, B. J., Snutch, T. P., van Dyke, T., Levine, A. J., Hartig, P.R., Lester, H. A. and Davidson, N. (1987) cDNA cloning of a serotonin 5HT1C receptor using electrophysiological assays of mRNA-injected Xenopus oocytes. Soc. Neurosci. Abstr. 13, 33. Mayne, K., Yoshii, K., Yu, L., Lester, H. A. and Davidson, N. ( 1987) Expression of mouse-Torpedo acetylcholine receptor subunit chimeras and hybrids in Xenopus oocytes. Mol. Brain Res. 2, 191-197. DEVELOPMENT AL NEUROBIOLOGY David J. Anderson Seymour Benzer James M. Bower Masakazu Konishi Paul H. Patterson Mark A. Tanouye 203 Assistant Professon David J. Anderson or a chromaffin cell (Anderson and Axel, 1986). Research Fellows: Nozomu Mori, Susan Taplitz, David J. Vandenbergh, Carol W. Wuenschell Apparently, these precursors develop into neurons Graduate Students: Arie M. Michelsohn, Derek L. unless they migrate into the adrenal gland, where the Stemple, Benton N. Yoshida Research and Laboratory Staff: Li-Ching Lo, Judith high, local concentration of glucocorticoids diverts Rosenthal them to an endocrine pathway of differentiation. Importantly, the differentiation of a chromaffin cell is Support: The work described in the following research not an irreversible development event: work by Prof. reports has been supported by: Biomedical Research Support Grant (NIH) P. Patterson and his colleagues has clearly demon Lucille P. Markey Charitable Trust strated that individual chromaffin cells can, in the National Institutes of Health, USPHS National Science Foundation absence of cell division or DNA synthesis, convert into The Rockefeller Foundation cells indistinguishable from sympathetic neurons when Damon Runyon-Walter Winchell Cancer Fund Searle Scholars Program, Chicago Community exposed to Nerve Growth Factor (NGF) (Doupe et al., Trust 1985a). (Once made, this switch appears irreversible; however, these noradrenergic sympathetic neurons are Summary: Two striking and functionally important able to undergo a further conversion to cholinergic properties of vertebrate nervous systems are the neurons if exposed to a glycoprotein secreted by heart diversity of different cell types they contain and the cells.) Taken together, therefore, these data support phenotypic plasticity exhibited by these cells. We are the notion that chromaffin cell plasticity may be interested in the developmental mechanisms that viewed as the expression of an alternative develop generate this diversity and plasticity. The neural crest mental fate originally available to the embryonic presents an attractive system in which to investigate precursor (Doupe et al., l 985b). these mechanisms at both the cellular and molecular Current studies are concerned with two principal levels. The entire peripheral nervous system (including aspects of this developmental process. At the cellular sensory and autonomic neurons, glia, and level, we wish to understand the lineage in more detail neuroendocrine cells), melanocytes and mesenchymal and the factors that control this decision. Is there a cells constituting the facial bones, all develop from "point of no return" along the neuronal pathway, and if the neural crest. This transient precursor population so, when does it occur and what is its basis? What therefore generates a diverse array of both neuronal environmental factors other than NGF and gluco- and non-neuronal differentiated derivatives. Further corticoid control the decision? When does the more, many of these differentiated cell types retain sympathoadrenal lineage first segregate from other, the potential to express alternate developmental fates, neural crest-derived lineages? At the molecular level, in response to specific extracellular signals. The we wish to understand the intracellular regulatory repertoire of these alternative fates is not infinite, but circuits which control the expression of these two rather, is highly restricted, in a way that reflects the alternative cell fates during development and the developmental history of these cells. conditions that permit plasticity later in life. To do At the moment, we have focused on the develop this, we have had to analyze in detail the structure and ment and plasticity of two major neural crest-derived regulation of expression of some of the genes we have cell types: chromaffin cells of the adrenal medulla used as markers of cell fate. (which are endocrine cells), and sympathetic neurons. References: Using a battery of molecular markers (both cDNA Anderson, D. J. and Axel, R. (1985) Cell 42, 649-662. Anderson, D. J. and Axel, R. (1986) Cell 47, 1079-1090. probes [Anderson and Axel, 1985] and antibodies), Doupe, A. J., Landis, S. C. and Patterson, P.H. (l 985a) which discriminate these two cell types, we have J. Neurosci. 5, 2119-2142. Doupe, A. J., Patterson, P.H. and Landis, S. C. (19&5b) traced the migration and differentiation of these cells J. Neurosci. 5, 2143-2160. in intact embryos and reconstituted their development in primary cell culture. These studies have identified an embryonic neuroendocrine precursor cell with the potential to develop into either a sympathetic neuron 204 300. Neural-Specific and NGF-Inducible Expression taining both the proximal and distal domains (but not of SCGIO-CAT Constructs in Transfected Cells the proximal domain only) appear to be induced by Nozomu Mori NGF. This suggests that the transient expression The SCGIO gene encodes a neural-specific mRNA assays do not faithfully reconstruct the NGF which is induced during the transdifferentiation of regulation of the endogenous gene, and that true NGF chromaffin cells into sympathetic neurons, and thus regulation may require the same distal region that provides a molecular marker of chromaffin cell pheno seems to confer neural-specific expression. typic plasticity. In order to understand the molecular conditions-that endow chromaffin cells with the poten 301. Expression of SCGIO Promoter-CAT Fusion Constructs in Transgenic Mice tial to express this gene (in response to NGF), we must first learn about the molecules that control its Carol W. Wuenschell expression in neurons. To this end we have undertaken To complement and extend the analysis of SCG 10 an examination of some of the cis-acting sequences in regulatory sequences being performed in transfected the SCGlO gene that control its specific expression. cell lines, some of the same SCG l 0-CA T constructs SCG!O is transcribed from a large (-40 kb) tran used in those studies have been analyzed in transgenic scription unit, but at least some of the cis-acting mice. CAT4, which contains a promoter and constitu sequences controlling neural-specific expression tive enhancer in 0.6 kb 5' to the transcription start appear to be located within a region 2 kb upstream of site, is expressed at similar levels in all tissues so far the (multiple) transcription start sites. We have examined in one transgenic mouse line. This is consis dissected this region into a 0.6 kb proximal segment, tent with the observation that this same construct which contains a constitutive promoter/enhancer, and shows only minor quantitative differences in expres an adjacent 1.4 kb upstream segment which appears to sion between cell lines representing different lineages. suppress expression in non-neuronal cells. This result Interestingly, however, preliminary data suggest that has been obtained by both transient and stable trans the CAT4 transgene appears to undergo the appro formation assays using PC12 and SY5Y neuroblastoma priate down-regulation in expression during postnatal as neuronal recipients, and HeLa and NIH 3T3 cells as CNS development that occurs for the endogenous non-neuronal recipients. Preliminary competition SCG 10 gene. This implies that although CAT4 does experiments suggest that the suppression mediated by not contain information for correct lineage-specific the 1.4 kb element in non-neuronal cells reflects a expression, it may exhibit at least some aspects of negative trans-activator which is non-titratable; in SCGIO temporal regulation. contrast, expression in neuronal cells does depend upon In contrast to CAT4, the construct CA T37 (which a titratable factor. Although the proximal (0.6 kb) contains 4 kb of 51 flanking information) is more promoter/enhancer region is by itself insufficient for efficiently expressed in neuronal than in most non neural-specific expression, in vivo it contains two neuronal cell lines examined~ However, expression is lineage-specific DNAase I-hypersensitive sites, and it observed in some non-neuronal cell lines such as cannot be substituted by a heterologous promoter/ Schwannoma cells, whereas the endogenous SCG l 0 enhancer (e.g., SV40) to achieve specific expression. gene is not detectably expressed in any non-neural Taken together, these data suggest that specific tissues. In marked contrast, CA T37 in transgenic mice expression is achieved by a collaboration between the is expressed in brain but not detectably in any non proximal and distal 5' domains, and involves both posi neural tissue so far examined (adrenal, kidney, liver, tive and negative transcriptional regulatory elements. lung, and heart). This result has been obtained for two We have also investigated the NGF-inducibility of independent integration sites derived from the same these constructs in PC 12 cells. In transient expression founder mouse; in these two animals the absolute level assays, not only all SCG l 0-CA T constructs but all of CAT37 expression in brain differs dramatically, but control constructs tested are induced to some the tissue specificity of expression is the same. These (variable) degree by NGF. ln contrast, in pools of results suggest that CAT37 in fact contains the stable transformants, SCG l 0-CA T constructs con- necessary information for neural-specific expression, 205 but that the fidelity with which this information is chromaffin cells during their subsequent proliferation decoded depends upon the assay system used. At the and expression of an endocrine phenotype. This view present time, CAT37 represents (to our knowledge) the would imply that, in terms of the SCGIO gene at least, first example of a neuron-specific promoter/enhancer chromaffin cells can be thought of as stably deter that functions in transgenic mice. mined neuronal precursors. As an additional means of analyzing lineage-related changes in SCGlO chromatin 302. The Molecular Basis of Plasticity in the structure, we are mapping differences in the Sympathoadrenal System methylation pattern of the DNA to look for specific David J. Vandenbergh sites that may be unmethylated when the gene is The ability of adrenal chromaffin cells to convert placed in a potentially active configuration. to a neuronal phenotype depends on both the presence Our analysis of chromatin structure by criteria of of an appropriate environmental signal (NGF) as well hypersensitivity and methylation state may allow us to as the cell's ability to respond to the signal. We have use SCG 10 as a means to identify the molecules re asked whether, in addition to NGF receptor and intra sponsible for the initial activation of the SCGlO gene. cellular messengers, chromaffin cells must maintain An important question is whether these molecules play neural-specific genes in a conformation that permits a role in the commitment of early multipotent neural their activation by NGF in the absence of DNA synthe crest cells to the sympathoadrenal sublineage. sis and cell division, and thus allows for their pheno typic plasticity. The SCGIO gene, which is expressed 303. Structure, Regulation and Possible Function of in sympathetic neurons but not in adrenal chromaffin the SCG 10 Protein cells, serves as a model to address this question. 1 Reuven Stein , Nozomu Mori, Li-Ching Lo, As an initial step in examining the chromatin struc David J. Anderson ture of the SCGIO gene, we have probed the 5' end of In order to gain more insight into both its the gene for sensitivity to DNase I. Two sites that are developmental regulation and possible function, we hypersensitive to DNase [ are located around the tran have identified the protein product of the SCGIO scription initiation site in neuronal nuclei. In addition, gene. Sequence and nuclease Si protection analyses a region located further upstream, which is known indicate that the SCG I 0 gene encodes a novel, 22 kDa from independent functional studies to be important protein which is translated from two different mRNAs for controlling expression in neurons, shows a high that differ solely in their choice of cleavage/ degree of general sensitivity to DNase I. In adrenal polyadenylation site. Immunocytochemical localization medullary tissue the same two hypersensitive sites are experiments using an affinity-purified antibody (raised present in the transcription start region, but the region against an SCG!O-Trp E fusion protein) reveal is not generally sensitive to DNase I. Neither the accumulations of punctate staining in the perinuclear hypersensitive sites nor the general sensitivity is seen cytoplasm, axons and growth cones of cultured neurons in liver tissue or in fibroblast cell lines. Thus, the (Stein et al., 1988). Cell-fractionation experiments pattern of sensitivity in the adrenal medulla, or at suggest that the protein exists in two pools: one least in a subset of the medullary cells, appears inter soluble, the other tightly membrane-associated. mediate to that in nonexpressing tissue (liver) and However, the SCGIO polypeptide is clearly not an expressing tissue (brain). PC12 cells, which pheno integral membrane or secretory protein. The accumu typically resemble sympathoadrenal precursors, also lation of the protein in growth cones and its tight contain tht:: two hypersensitive sites in the tran membrane association suggest that SCGlO may be scription start region, but do not show general sensi bound to vesicles that undergo fast axonal transport tivity. The similarity of SCG IO chromatin structure in during neurite elongation. Consistent with this, SCG!O adult adrenal medullary cells and in PC12 cells is maximally expressed in the spinal cord during suggests that this structure may reflect an initial step embryogenesis, at the time of axon outgrowth, but is in the ontogenetic activation of the gene that occurred absent in the adult spinal cord. SCG I 0 also appears to in early precursors, and then was stably inherited by be induced during peripheral nerve regeneration, in 206 experiments done in collaboration with Paul Henion tide sequence homology. The homology is apparently and Story C. Landis (Case Western Reserve Medical insufficient, however, to produce stable DNA:RNA School). This circumstantial evidence is consistent hybrids under stringent conditions. with a role for SCGlO in some process related to axon These results suggest that non-neuronal cell lines elongation. In all of the above respects, SCG l 0 appears express RNAs and proteins homologous to the neuron similar to the protein GAP-43; however, the sequences specific SCG 10 product. To determine whether this of the two polypeptides are unrelated. It will be of diversity reflects tissue-specific alternative RNA interest to determine whether SCG 10 is expressed by processing, or a multi-gene family, low stringency the same subpopulation of adult brain neurons that Southern blots were performed. cRNA, but not cDNA, express high levels of GAP-43, since it has been probes from the coding region detected faint bands in suggested that the latter marks neuronal populations addition to those predicted from the structure of which are structurally more plastic than others. SCGlO genomic clones, suggesting a multigene family. Experiments are in progress to confirm this suggestion Reference: Stein, R., Mori, N., Matthews, K., Lo, L.-C. and by isolating and sequencing cDNA clones representing Anderson, D.J. (1988) Neuron 1, 463-476. the several non-neuronal cross-hybridizing RNAs. 1 Department of Biochemistry, Tel Aviv University, Tel Analysis of these homologous proteins in non-neuronal Aviv, Israel. cells may yield some insight into the possible function of the SCG 10 protein in neurons. 304. Characterization of Non-Neuronal Reference: SCGlO-Related Transcripts Stein, R., Mori, N., Matthews, K., Lo, L.-C. and Anderson, D. J. (1988) Neuron 1, 463-476. Benton N. Yoshida SCGlO mRNAs (2.2 kb and 1.1 kb) are expressed 305. Monoclonal Antibodies to the SCG 10 Protein only in nervous tissue and in cell lines of neuronal or Li-Ching Lo, David J. Anderson neuroendocrine origin. Polyclonal antibodies to the [n order to have unlimited quantities of highly SCGlO protein, however, detect proteins of similar specific antibodies for immunocytochemical and molecular weight to the neuronal SCG 10 protein in biochemical studies, we have prepared monoclonal several non-neuronal cell lines (mouse L cells, rat antibodies to the SCG 10 protein, using the SCG 10- Schwannoma, human melanoma, buffalo rat liver TrpE fusion protein as immunogen. Preliminary cells). This result has been obtained both by Western experiments indicated that the TrpE (bacterial) portion blotting and by immunoprecipitation of radiolabeled of the fusion polypeptide was much more immunogenic proteins, and suggests that non-neuronal cells than the (rat) SCGlO portion. To overcome this synthesize a protein structurally related to SCG 10 problem, we have applied a recently-developed (Stein et al., 1988). immunization protocol in a novel way. Mice were first This hypothesis is supported by the identification of immunosuppressed against TrpE alone by simultaneous RNA transcripts related to SCGlO in these same cell inoculation with cyclophosphamide. Subsequently, the lines. cRNA (but not cDNA) probes detect one RNA same mice were immunized with fusion protein. This species of 1.2 kb in L cells, Schwannoma and liver "intramolecular" immunosuppression technique worked cells, and a second of 2.2 kb in melanoma cells. These well, in that a high proportion of the hybridoma lines RNAs are not detected with probes containing only the derived from these mice produced antibodies that 3' non-coding region of the neuron-specific SCG l 0 reacted only with the SCGlO portion of the fusion mRNA, and therefore are distinct from it (Stein et al., protein. Immunocytochemical localization studies 1988). However, they are detected with two different indicate that at least some of these antibodies react adjacent, non-overlapping probes derived exclusively with the SCGlO antigen in fixed, frozen sections. In from the protein-encoding region. Weak hybridization addition one antibody reacts with the protein on signals are obtained even at high stringency; moreover, Western blots. The protocol used to produce these use the hybrids are in part resistant to RNAase A diges ful reagents may be helpful in other cases where fusion tion, suggesting perhaps a small region of high nucleo- proteins are used to produce monoclonal antibodies. 207 306. Basic Fibroblast Growth Factor Acts As A Reference: Differentiation and Proliferation Factor For Stemple, D. L., Mahanthappa, N. K. and Anderson, D. Adrenal Chromaffin Cells J. (1988) Neuron 1, 517-525. Derek L. Stemple, Nagesh K. Mahanthappa David J. Anderson ' 307. A Quantitative Assay for an Adrenergic Differentiation Factor To define further the molecules that control sympathoadrenal differentiation, we have investigated Derek L. Stemple During their migration, neural crest cells the effects of FGF, NGF and glucocorticoid on cultured neonatal rat adrenal chromaffin cells. Basic eventually become committed to specific sublineages, such as those producing glia, melanocytes and FGF, like NGF, induces cell division and neurite out growth from these cells. Dexamethasone inhibits the catecholamine-containing neurons and endocrine cells. A major unsolved question is whether this neuronal differentiation but not the proliferation process is stochastic or rather is affected by induced by bFGF. Unlike NGF, bFGF will not support environmental signals. Several laboratories have the survival of chromaffin cell-derived sympathetic provided evidence that the appearance of cells neurons. However, bFGF induces a dependence on committed to the sympathoadrenal lineage can be NGF (Stemple et al., 1988). The overlapping but influenced by environmental signals. We are distinct responses to NGF and FGF may underlie a interested in isolating and if possible molecularly sequence of events in sympathetic differentiation. cloning such a signal(s). FGF (or another factor) may act locally in developing Previously, the appearance of adrenergic ganglia to stimulate mitotic expansion and initial axon (sympathoadrenal) cells in avian neural crest cultures outgrowth. Subsequent survival and maturation are had been assessed qualitatively, using catecholamine then controlled by NGF which is provided by peripheral histofluorescence. As this assay proved inadequate for targets of innervation. This model, if true, would fit quantitation of so-called adrenergic factor activities, well with the observation that NGF is not synthesized an improved assay was developed. This assay relies on by peripheral targets of sensory and sympathetic the fact that as cells commit to the adrenergic innervation until the time that growing axons have sublineage, they express the marker enzyme tyrosine entered these targets. The mitogenic activity of FGF hydroxylase. Recently, monoclonal antibodies to avian on chromaffin cells suggests that in the adrenal gland tyrosine hydroxylase have become available. We have (which is known to be a source of FGF), this factor used these antibodies to measure the percentage of may amplify the developing chromaffin population; our total neural crest cells in a culture that express this results suggests that the high local concentration of marker in response to various factors. To do this glucocorticoid in the adrenal would permit this accurately, we have first removed neural crest cells proliferation while simultaneously blocking neuronal from the culture dishes with trypsin, adhered them to differentiation. poly-D-lysine-coated slides and fixed them with para Preliminary observations suggest that the response formaldehyde. This modification solves two problems. properties of chromaffin cells to bFGF and NGF may First, since primary neural crest cultures grow as indeed reflect the response properties of embryonic explants, counting individual stained cells accurately sympathetic precursor cells. bFGF stimulates in situ is difficult. Second, the assay minimizes neuronal differentiation in cultures of El4.5 para variability from explant to explant, since cells from vertebral (ganglia) as well as El4.5 superior cervical three different dishes each containing three explants sympathetic ganglia (J. Carnahan, personal communi are pooled for each assay point . cation), a stage at which these cells are neither . Using this approach, we have begun to characterize responsive to nor supported by NGF. In addition, bFGF in more detail a soluble factor present in 11-day chick appears to be mitogenic for E 14.5 adrenal medullary embryo extract that promotes adrenergic differen precursors in the presence of dexamethasone (A. tiation (Howard and Bronner-Fraser, 1985). We have Michelsohn). It remains to be determined whether confirmed that this activity has a molecular weight of bFGF is present at the right times and in the right less than 10 kDa, by membrane ultrafiltration. places in vivo to perform the roles we have suggested. 208 Preliminary data suggest that the activity is sensitive introduced gene. Work is now under way to grow out to digestion with proteinase K. This improved assay cell lines from preCursor cells infected with the v now presents a more reliable method to determine myc, SV40 T-antigen and Adenovirus ElA genes. Once whether the acti;~}ty is secreted by Xenopus oocytes established, these lines will be characterized on the injected with 11-day embryonic brain RNA. If it is, basis of neural and chromaffin-specific markers to this would open the way to an expression-cloning of define their position in the developmental pathway. this factor. The expression and chromatin structure of cloned neural and chromaffin-specific genes can then be Reference: Howard, M. J. and Bronner-Fraser, M. (1985) J. examined. Cell lines will also be established from still Neurosci. 5, 3302-3309. earlier stages of neural crest cell differentiation in order to examine the developmental pathway leading 308. Immortalization of Embryonic Sympathoadrenal to the sympathoadrenal lineage. Progenitor Cells Susan J. T aplitz 309. Control of PNMT Expression in Cultured Embryonic Adrenal Chromaffin Cells The neural crest gives rise to a variety of cell types including the chromaffin cells and sympathetic Arie M. Michelsohn neurons of the sympathoadrenal lineage. Adult chrom The epinephrine-synthesizing enzyme phenyl affin cells are capable of transdifferentiating into ethanolamine N-methyl transferase (PNMT) is mature sympathetic neurons in the presence of nerve expressed by adrenal chromaffin cells but not by growth factor (NGF). This process is reminiscent of sympathetic neurons. Glucocorticoids (GC), produced the developmental choice between a neuronal and a in the adrenal gland by the cortex which surrounds the chromaffin cell phenotype made by sympathoadrenal chromaffin cells, are required in the adult for the precursor cells in the early embryo. We are interested maintenance of PNMT expression; the PNMT gene has in examining the relationship between the plasticity of been shown by others to be steroid inducible. We are the adult chromaffin cell and the differentiation of the interested in the ontogenetic control of this steroid embryonic precursor. In order to obtain the large inducibility, which is first detectable on El?. We wish numbers of embryonic cells needed for this study, I am to know what controls the time of appearance of this attempting to establish immortalized cell lines from PNMT inducibility. Last year we established an in precursor sympathoadrenal cells by retroviral vitro system in order to address this question. infection. Precursor cells are obtained from rat Cultured adrenal cells from El4.5 embryos will express embryonic adrenals. Cells are labeled with surface PNMT on schedule if maintained in the presence of antibodies specific to the sympathoadrenal lineage and GC. We have since shown that this timing is exhibited isolated with a fluorescence-activated cell sorter. by a purified, sorted population of sympathoadrenal Antibody markers are available which define early and precursors suggesting that it reflects a cell late stages in the sympathoadrenal lineage. The HNK- autonomous mechanism. 3tt-Thymidine-labeling 1 antibody stains cells that can develop into either experiments indicate that the induction of PNMT does chromaffin cells or neurons. The B2 antibody stains a not reflect a clonal expansion of a small pool of developmentally later population which is pre PNMT+ cells; rather, TH+, PNMT- precursors are dominantly restricted to neuronal differentiation. Thus recruited to become PNMT+. We have asked whether it should be possible to isolate cell lines that span the the appearance of PNMT is delayed as a consequence developmental transition between chromaffin and of delaying the time at which cultures are exposed to neuronal cell types. Precursor cells are infected with GC; if so, this would strongly suggest that GC control a recombinant retrovirus containing either an the time of onset of PNMT inducibility. Our results immortalizing oncogene or a marker gene. Preliminary indicate that a one- or two-day delay in GC presen experiments using the lacZ marker gene have tation does not seem to delay the time of initial demonstrated infection of the sympathoadrenal appearance of PNMT. However, the yield of PNMT+ precursor cells and efficient expression of the cells is reduced. This result would be expected, since 209 earlier data indicate that GCs are necessary to pre Forskolin (which induces the synthesis of myelin vent the differentiation of precursors into sympathetic proteins in cultured rat Schwann cells) is absolutely neurons which cannot express PNMT. Thus a delayed necessary for the in vitro development of these chick exposure to GC allows some cells to differentiate into Schwann cells. The Gale+ cells in these cultures seem neurons, and hence effectively decreases the pool of to appear at the same absolute time whether the potential PNMT+ precursors. Apparently, however, in cultures are plated from 8-day or I I-day embryos. those precur:sor~ that escape neuronal differentiation, Thus, we seem to be able to obtain chick Schwann cell the "clock" controlling PNMT expression continues to differentiation in vitro from precursor cells present in run in the absence of GC. In an independent series of late embryos. In cultures of early (s~age 27) limb bud, + .,. experiments, we have found that EJ4.5 sympathetic however, the number of HNK-1 cells declines over 4 ganglia contain cells that express PNMT on schedule if days, and these cells so far have not developed GalC maintained in the presence of GC. This suggests that immunoreactivity. We suspect that the development the timing of PNMT inducibility may be an intrinsic of these very early putative neural crest precursors feature of sympathoadrenal precursors irrespective of requires the presence of axons, and co-culture their initial location in the embryo. experiments are in progress to test this hypothesis. If it can be demonstrated that the early HNK-1 + 310. When Do Neural Crest Cells Commit to the cells are indeed Schwann cell precursors, the next step Schwann Cell Lineage? will be to transplant these cells back to the neural Carol W. Wuensche!!, David J. Anderson crest of an earlier host embryo, and ask whether they The development of Schwann cells in the chick limb migrate exclusively back to the limb bud and differen bud provides a good system in which to address the tiate into Schwann cells, or whether they also give rise question of .vhether neural crest cells commit to a to cells of other phenotypes in other locations. This particular sublineage during or after migration. Cells will be accomplished by first isolating the cells by that express the neural crest surface marker HNK-1 sorting with HNK-1, and then labeling them with the appear in the limb bud mesenchyme as early as stages lipid-soluble dye diI, in order to easily distinguish them 25-28 in chick development. Schwann cells appear from host cells. many days later. We wish to know I) whether these early HNK-1+ cells are in fact Schwann cell precursors that have emigrated from the neural crest; and 2) if PUBLICATIONS they are, can they be diverted to any other pathway of Anderson, D. J. (1988) Cell fate and gene expression in the developing neural crest. In: Cellular and neural crest differentiation by exposure to the Molecular Aspects of Neural Development and appropriate environment? The ease with which limb Regeneration, Gorio, A. et al. (Eds.), Springer buds may be dissected at this early stage makes an in Verlag, Heidelberg, pp. 187-198. Stein, R., Orit, s. and Anderson, D. J. (l 988) The vitro analysis of this system possible. Moreover, the induction of a neural-specific gene, SCGlO, by number of HNK-1+ cells in limb bud suspensions (ca. nerve growth factor in PC 12 cells is tran scriptional, protein synthesis-dependent and 596) makes it relatively easy in principle to isolate this glucocorticoid-inhibitable. Dev. Bjol. 127, 316-325. Stein, R., Mori, N., Matthews, K.', Lo, L.-C. and subpopulation by fluorescence-activated cell sorting. Anderson, D. J. (1988) The NGF-inducible SCGlO A critical prerequisite to a study of this nature is mRNA encodes a novel membrane-bound protein to be able to identify Schwann cells as such once they present in growth cones and abundant in developing neurons. Neuron 1, 463-476. differentiate. In control experiments, we have shown Stemple, D. L., Mahanthappa, N. K. and Anderson, -0. J. (1988) Basic FGF induces neuronal differen that a monoclonal antibody to Galactocerebroside tiation, cell division and NGF dependence in (GalC), which has been used as a Schwann cell marker chromaffin cells: A sequence of events in sympathetic development. Neuron I, 517-525. in rat, will specifically label chick Schwann cells. Cultures of 8- to ll-day chick peripheral nerve contain HNK-1 + cells which do not express GalC, but after 7- 10 days in vitro in the presence of forskolin, many of these HNK-1+ cells also express Ga!C on their surface. 210 Professor: Seymour Benzer l) characterization of mutations that affect the Visiting Associates: David R. Hinton, Carol A. Miller initiation of the array, the formation of its pattern, Bantrell Senior Research Fellow: Dennis G. Ballinger Senior Research Fellows: Utpal Banerjee, John Archie and the sequential activation of associated gene Pollock products; 2) starting with a specific mutation such as Research Fellows: Roger W. Hackett, David R. Hyde, Kirk Mecklenburg sevenless, in which photoreceptor R7 is absent in each Graduate Students: William M. Leiserson, Patricia J. group of eight, cloning the gene and studying the Renfranz, Erich M. Schwarz Research and Laboratory Staff: Judy R. Adams, timing and localization of its expression, using in situ Frances B. Aguirre, Marika F. Anderson, Julia W. Chang, Eveline Eichenberger, Renny Feldman, hybridization and monoclonal antibodies to a fusion Jenny Tzu-1 Mao, Rosalind Young protein (Banerjee et al., 1987); 3) the reverse procedure, i.e., starting with a monoclonal antibody Support: The work described in the following research that identifies a photoreceptor-specific antigen, using reports has been supported by: Myron A. Bantrell Fellowship the antibody to purify the protein, sequence it, clone Bionational Agricultural Research and the corresponding gene, map its site, and induce local Development mutations to identify the function (Zipursky et al., The James G. Boswell Professorship in Neuroscience 1984); 4) isolation of mutants in which the projections Lawrence A. Hanson Foundation Life Sciences Research Foundation of the photoreceptor axons to the optic ganglia are Lucille P. Markey Charitable Trust altered; and 5) isolation of cDNA clones that are National Institutes of Health, USPHS National Science Foundation specifically expressed in the eye and the optic lobes. Gordon Ross Medical Foundation An exciting development in the work has opened up Damon Runyon-Walter Winchell Cancer Fund wide possibilities, namely, the discovery that a large The Del E. Webb Foundation Weizmann Fellowship fraction of the monoclonal antibodies (MAbs) against the Drosophila nervous system also cross-react with various components of the human nervous system Summary: A simple neural system that is amenable to (Miller and Benzer, 19&3; Hinton et al., 1987; Miller et analysis is the developing Drosophila eye. The adult al., 1987). The group is currently investigating eye is a modular structure of some 800 similar homologies at the gene level between the two species. ommatidia, each containing only eight photoreceptor These experiments are being done in collaboration with neurons of three kinds: R 1-6, R7, and R8. They differ Dr. Carol Miller, who is a visiting associate at Caltech in their precise positions, their action spectra, and in and, as chief of neuropathology at the University of the way their axons terminate. Rl-6 neurons send Southern California School of Medicine, has ready axons to the first optic ganglion (the lamina), whereas access to human brain material. the axons of R7 and R8 pass through the lamina to References: synapse in the second optic ganglion (the medulla). Banerjee, U., Renfranz, P. J., Pollock, J. A. and Benzer, S. (1987) Cell 49, 281-291. This is, in effect, a nervous system of eight neurons of Banerjee, U., Renfranz, P. J., Hinton, D. R., Rabin, B. three specificities, reiterated 800 times. Genetic A. and Benzer, S. (1987) Cell 51, 151-15&. Hinton, D. R., Henderson, V. W., Blanks, J. C., mosaic experiments have shown that the eight cells in Rudnicka, M. and Miller, C. ( 1988) J. Comp. each ommatidium are not derived from a single mother Neurol. 267, 398-408. Miller, C. A. and Benzer, S. (1983) Proc. Natl. Acad. cell; they appear to arrive at their specific identities Sci. USA &O, 7641-7645. by epigenetic interaction. Development of the cluster Miller, C. A., Rudnicka, M., Hinton, D., Blanks, J. and Kozlowski, M. ( 1987) Proc. Natl. Acad. Sci. USA occurs in the eye imaginal disc, during the third larval 84, 8657-&661. instar, in the wake of a morphogenetic furrow that Ready, D. F., Hanson, T. E. and Benzer, S. (1976) Dev. sweeps from posterior to anterior across the disc. Biol. 53, 217-240. Zipursky, S. L., Venkatesh, T. R., Teplow, D. B. and Ahead of the furrow, the cells are unpatterned; behind Benzer, S. (1984) Cell 36, 15-26. it, they form into a regular array of a cluster of five (R2, 3, 4, 5 and &). RI, 6 and 7 are added shortly afterward (Ready et al., 1976). This system is being approached on several levels: 211 310. Expression of Four Distinct Opsins in the Three different from those of the compound eye cell types. Visual Organs of Drosophila Electroretinograms of the ocellus, combined with John Archie Pollock, Seymour Benzer adaptation studies using different wavelengths, suggest Drosophila and other Dipteran flies have three that there is only one photopigment, with maximal different kinds of visual organs: in the adult a pair of sensitivity in the near UV and blue, that is responsible compound eyes and three dorsal ocelli, in the larva a for its electrical response (Hu et al., 1978). The pair of internal photoreceptor organs. They develop in predominant use of Rh2 in the ocellus is presumably distinct ways, yet have certain features in common. related to its function. It is unlikely that the ocellus is All three organs use retinal-derived chromophores used for image formation, since the focal plane of its coupled to distinct opsins, providing a diversity of lens lies far below the level of its rhabdomeres. spectral sensitivities. Four opsin genes have been However, the wiring of the three ocelli to the brain identified thus far in Drosophila: Rh!, Rh2, Rh3 and and their responsiveness to small changes in light Rh4 (O'Tousa et al., 1985; Zuker et al., 1985; Cowman intensity may allow the trio to act as a simple et al., 1986; Fryxell and Meyerowitz, 1987; Montell et detector for shadow motion and direction. The al., 1987; Zuker et al., 1987). We have used in situ maximal sensitivity to blue and ultraviolet light might hybridization to study the mRNAs expressed by these serve this purpose well under the blue sky of the four opsin genes in all three visual organs (Pollock and normal environment. Benzer, 1988). Rhl, Rh3 and Rh4 are known to be We thank Charles Zuker for generously supplying expressed in different subsets of cells in the compound the opsin DNA probes. eye. We_ found that, in contrast, opsin Rh2 is the References: Cowman, A. F., Zuker, C. S. and Rubin, G. M. (1986) predominant opsin expressed in the ocelli. Further Cell 44, 705-710. more, we showed that in the larval photoreceptor Fryxell, K. J, and Meyerowitz, E. M. (1987) EMBO J. 6, organ, opsins Rhl, Rh3 and Rh4 are expressed but not 443-451. Hu, K. G., Reichert, H. and Stark, W. J. 0978) J. Rh2. Comp. Physiol. 126, 15-24. Montell, C., Jones, K., Zuker, C. S. and Rubin, G. M. In Drosophila, the three visual organs contain (1987) J. Neurosci. 7, 1558-1566. certain common antigens, recognizable by monoclonal O'Tousa, J.E., Baehr, W., Martin, R. L., Hirsh, J., Pak, W. L. and Applebury, M. L. (1985) Cell 40, 839-859. antibodies, indicating that some genes are expressed in Pollock, J. A. and Benzer, S. (1988) Nature 333, 779- all three (Zipursky et al., 1984). For example, 782. Van Vactor, D., Krantz, D. E., Reinke, R. and monoclonal antibody (MAb) 24B 10 recognizes a photo Zipursky, S. L. (1988) Cell 52, 281-290. receptor cell-specific membrane protein, chaoptin, Zipursky, S. L., Venkatesh, T. R., Teplow, D. B. and Benzer, S. (1984) Cell 36, 15-26. which is found in all three visual organs and has been Zuker, C. S., Cowman, A. F. and Rubin, G. M. (1985) shown to be required for normal morphogenesis of the Cell 40, 851-858. Zuker, C. S., Montell, C., Jones, K., Laverty, T. and adult rhabdomeres (Van Vactor et al., 1988). An Rubin, G. M. (1987) J. Neurosci. 7, 1550-1557. interesting question is whether, in addition to a set of genes essential for all three photosystems, there are 311. Comparison of the Developmental Expression of genes that are specifically transcribed in each, of Three Eye Genes in Drosophila Development: chaaptic, sevenless and ninaE opsin Rh! which sevenless (specific to the developing compound eye) and opsin Rh2 (specific to the ocellus) would be Jo'hn Archie Pollock, Seymour Benzer two examples. The presence of transcripts of opsins The molecular expression of three eye-specific Rhl, Rh3 and and Rh4 in the larval photoreceptor Drosophila genes was studied in the larval photo indicates that the larva can see a broad spectrum of receptor organ, the developing and mature adult light. The larval photoreceptor may be made up of compound eye and the adult ocellus. Localization of distinct cell types as is the compound eye. It will be mRNAs for all three genes was studied by hybridi of interest to determine the specific organization of zation of cloned DNAs in situ. The gene chaoptic these cells and to determine which mutations that (whose protein product was defined by MAb 24Bl0) is affect the compound eye also affect the larval organ. expressed exclusively in photoreceptors and their The spectral sensitivity of the ocellus appears to be axons in all three kinds of visual organs (Zipursky et 212 a!., 198~), and is required for morphogenesis of Tomlinson, A., Bowtell, D. D. L., Hafen, E. and Rubin, G. M. (1987) Cell 51, 143-150. sevenless rhabdomeres (Van Vactor et a!., 1988). The Tomlinson, A. and Ready, D. (1986) Science 231, 400- gene is required for differentiation of photoreceptor 402. Van Vactor, D., Krantz, D. E., Reinke, R. and cell R7 (Tomlinson and Ready, 1986), while the Rhl Zipursky, S. L. (1988) Ce!! 52, 218-290. opsin gene, ninaE, is required for phototransduction Zipursky, S. L., Venkatesh, T. R., Teplow, D. B. and Benzer, S. (198~) Cell 36, 15-26. (O'Tousa et al., 1985; Zuker et a!., 1985). Zuker, C. S., Cowman, A. F. and Rubin, G. M. (l 985) Analysis of two chaoptic mutant alleles identified Cell 40, 851-858. by Van Vactor et a!. (l 988) revealed abnormal distribu tions of mRNA in the adult retina, the deficit being 312. The Identification and Characterization of more severe proximally, as is the developmental 60 Drosophila cDNA Clones Expressed defect caused by this lesion in rhabdomere formation. in the Visual System In the developing photoreceptor clusters of the eye David R. Hyde, Kirk Mecklenburg, imaginal disc, the sev + mRNA is localized apically in John Archie Pollock, Seymour Benzer the cells (Banerjee et a!., l987a). The protein Genetic screens, utilizing mutations, have been detected by the anti-sev monoclonal antibody is used previously in our laboratory to identify genes similarly localized in the apical region of the cells on responsible for the development and maintenance of the membrane microvilli (Banerjee et al., l 987b; the Drosophila compound eye. In collaboration with Tomlinson et a(., 1987). These two independent our colleagues Michael Palazzolo, K. Vijay Raghavan examples suggest that the subcellular distribution of and Elliot Meyerowitz (Hyde et a!., 1987), we have the transcript may affect local cell differentiation. used a complementary approach. We synthesized anti In addition to its subcellularly localized expression sense cRNA probes from 443 individual head-not-early in the developing compound eye, sevenless was found embryo Drosophila cDNA clones and probed Northern to be expressed in the brain cortex throughout pupal blots of poly(A)+ RNA prepared from late embryo, development and adulthood. What relationship this body, wild-type heads and heads from the mutant eyes expression has to the development and differentiation absent (eya). We categorized the clones into eight of the brain is completely unknown. groups based upon their expression patterns in these The analysis of ninaE showed that the opsin tran different tissues. Over 50 individual cDNAs detect script appears only after the rhabdomeric membranes transcripts expressed in wild-type heads, absent in begin to form in the developing retinal photoreceptors, bodies, and reduced or missing in the eyeless mutant. during pupal day three. However, in the chaoptic Therefore, at the level of Northern analysis, these mutant allele chp2, where very little rhabdomeric represent visual clones specifically expressed in the membranes form, the opsin mRNA was abundantly ex visual system. pressed and evenly distributed throughout the retina. Further analysis has confirmed that these cDNA Thus, while the opsin gene is regulated not to begin clones represent transcripts expressed in the expression until the rhabdomeric site of protein Drosophila visual system. Cross-hybridization experi localization is developing, there does not appear to be ments demonstrated that the previously characterized a feedback mechanism telling the cell how much rhab opsins, Rhl and Rh4, are represented in our set of domeric membrane is present for the opsin protein. cDNAs. Localization of endogenous mRNAs by in situ The expression of the three genes in chaoptic-, hybridization for several of these clones confirmed sevenless-, and ninaE-mutant backgrounds indicates that they are expressed in the retina. Chromosomal in that they are independently regulated. situs demonstrated that the genes are scattered References: throughout the Drosophila genome, confirming earlier Banerjee, U., Renfranz, P. J., Pollock, J. A. and results that these clones correspond to many different Benzer, S. (1987a) Cell 49, 281-291. Banerjee, U., Renfranz, P. J., Hinton, D. R., Rabin, B. genes. Some are located near or at previously A. and Benzer, S. (l987b) Cell 51, 151-158. identified eye mutant loci. We examined expression of O'Tousa, J.E., Baehr, E.W., Martin, R. L., Hirsh, J., the cDNAs in several developmental stages and found Pak, W. L. and Applebury, M. L. (l 985) Ce!! 40, 839-850. that some transcripts peak in mid-pupal stages and 213 decrease in adult heads, suggesting that they may play localize the expression of the protein in the eye disc a role in the development of the visual system. Some by immuno-EM (Banerjee et al., l 987b). The protein of the transcripts are relatively rare, being expressed localizes to the apical cell membranes and microvilli 2 at levels I0- to 10-3 of the abundance of the major of cells during development and appears coincident opsin. Many of these clones may correspond to pre with the initial formation of clusters. It also appears viously uncharacterized genes that are important for in all the developing photoreceptor cells and in the eye development and function. Currently, we are accessory cone cells at a time prior to the overt making polyclonal antibodies against fusion proteins to differentiation of R7. This result is consistent with localize protein expression, and we are trying to iden the multi-potentiality of cells in the eye disc, in that tify which cDNAs rescue known mutations by cosmid any cell in the eye disc appears to have the potential transformation. to become an R7. However, the apical and microvillar expression is surprising, in that this region is away Reference: Hyde, D. R., Palazzolo, M. J., Mecklenburg, K. L., from the bulk of the cell-cell contacts often cited as a Vijay Raghavan, K., Meyerowitz, E. M. and Benzer, likely region for information presentation and S. (1987) Cold Spring Harbor Conference on Molecular Neurobiology of Drosophila, p. 52 processing. Tomlinson et al. ( 1987), using a polyclonal (abstract). antibody to a synthetic peptide derived from the sequence of the sevenless gene, also found that the 313. Biochemical Characterization of the protein is expressed in other cells beside R7. sevenle.'IS Protein We have begun the work necessary to analyze the Patricia J. Renfranz, Utpal Banerjee, Seymour Benzer biochemical activity of the sev+ protein. First, During development of the Drosophila eye, cells various MAbs were tested by protein immunoblots and within the eye disc assume different fates, presumably immunoprecipitations. MAb I 50C3 identified two via information in their environment and cell-cell bands on a Western blot that were always absent in the contacts. From the analysis of genetically mosaic null allele sevp 1. These migrated at apparent eyes, it appears that any cell in the eye disc can adopt molecular weights of 250,000 and 60,000 daltons. The the characteristics of any of the cell types in the latter protein is suspected to be a product of protein mature eye. These fates include one of three types of degradation during extraction, although other photoreceptor cells and non-neuronal accessory cells possibilities have not been eliminated. By Western such as cone cells and pigment cells. The sevenless blot analysis, these sev+ proteins were found in gene product appears to play a role in the expression homogenate supernatants in amounts with concen of one of these possible fates; when the gene is tration of detergent, indicating that the protein is mutated, the phenotype is the lack of one of the membrane associated. It was best extracted with l % pattern elements, photoreceptor cell R7. The defect CHAPS, a zwitterionic detergent. The protein was in sev mutants had been traced to an early event in found not only in developing eye discs, but also in development, and had also been shown in genetic developing optic lobes and in the adult brain. mosaics to be autonomous to R7. As a means of better Of the 14 anti-sev MAb producing lines that were understanding the information flow necessary for the established, 64% showed staining of the sev + proteins differentiation of the cells in the developing disc, we on Western blots, four of them strongly. All the MAbs sought to characterize the gene and its protein that did work also cross-reacted with other proteins product. that were present in the null allele sevp 1. The ability As published last year (Banerjee et al., l 987a), the of these MAbs to immunoprecipitate depended on sev + gene was cloned by P-elerrtent transposon tagging extraction conditions. At relatively low detergent and found to encode an 8.2 kb transcript, expresses in concentration (0.25% N-P40 + 0.1% Na Laury! sarco the developing eye disc and in adult heads. Hafen et sine), only one MAb, 147H2, immunoprecipitated the al. (1987) also cloned the gene by a different method. 250 kDa and 60 kDa sev+ proteins. However, it also By raising monoclonal antibodies (MAbs) against a sev precipitated other, cross-reacting species; the three a-galactosidase fusion protein, we were able to major ones migrated to approximately 280, 220 and 97 214 kDa. With high detergent extraction conditions (1 % 314. An Early Expressed, Photoreceptor-Specific Drosophila Antigen, Ag 72H5 CHAPS), all 14 MAbs allowed for precipitation. Unfortunately, none specifically precipitated the sev+ Dennis G. Ballinger, Seymour Benzer bands; all cross-reacted to varying degrees with the The antigen recognized by monoclonal antibody three other major bands. Some seemed to prefer (MAb) 72H5 is expressed very early in photoreceptor entirely to precipitate the 97 kDa band over the sev+ development, within 2 hours of the first detectable ones. At first glance, these results seemed surprising, morphological differentiation, and it persists through in that every MAb see~ed to cross-react with the adulthood. lt is expressed in the eye disc at about the same set of proteins, yet they displayed varied same time as the earliest known general neuronal individual characteristics. However, it must be noted antigens (e.g., Ag 22Cl0 - Zipursky et al., 1984), but is that the MAbs were raised against a fusion protein the earliest known one that is photoreceptor-specific, derived from a region of the gene that has since been being expressed about 30 hours earlier in development shown to have strong homology with other proteins. than Ag 24Bl0, the chaoptic antigen (Zipursky et al., Halen et al. (1987) showed that the putative intra 1984). cellular domain of the protein has regions of very The gene encoding Ag 72H5 is interesting since its strong homology with protein tyrosine kinases like the cell-type specificity and time of expression suggest oncogenes sarc and ros, and the EGF and insulin that it may play a role in the di!!erentiation of photo receptors. receptors from other neuronal cell types. A study of In order to immunopurify the sev+ protein, an its regulation might shed light on the genes that affinity column was constructed using purified MAb control cell-type decisions in the developing eye. 147H2. Protein from 10 g of wild type heads was MAb 72H5 identifies a protein of molecular weight extracted with buffer containing 1% CHAPS. The approximately 180 kDa in extracts of adult heads. A supernatant from a 100,000 x g spin was passed over set of head cDNA clones, expressed in ).gt! 1, each this column, and the specifically bound proteins were making a fusion protein recognized by MAb 72H5, has eluted. Approximately 5 ng of protein were recovered, been isolated. These cDNA inserts are homologous to distributed among five proteins, as discussed above. each other and are of two size classes. All identify a Work will continue on fractionating these proteins to head-specific RNA of about 3 kb. separate the sev+ bands from the cross-reacting Experiments are in progress to confirm whether contaminants. these cDNAs encode Ag 72H5. These include the We also have attempted to demonstrate kinase production of polyclonal antibodies against the fusion activity associated with the sev + protein. Comparison proteins, microsequence analysis of immunopurified of phosphorylated proteins after immunoprecipitation Ag 72H5, and the comparison of the protein and DNA and phosphorylation reactions showed that phosphoryl sequences. Once the gene has been unambiguously ation did occur in the immunoprecipitates. However, identified, a mutation will be isolated in the gene to wild-type and mutant preparations have, thus far, address the issue of its function. produced indistinguishable results. Direct proof of a Reference: kinase function of the sevenless protein is still lacking Zipursky, S. L., Venkatesh, T., Teplow, D. B. and Benzer, S. (1984) Cell 36, 15-26. and many questions remain about the role of sev+ in the differentiation of the compound eye. References: 315. Subcellular Localization of mRNAs in Drosophila Banerjee, U., Renfranz, P. J., Pollock, J. A. and Developing and Adult Compound Eye Revealed Benzer, S. (1987a) Cell 49, 281-291. by Light and Electron Microscopic In Situ Banerjee, U., Renfranz, P. J., Hinton, D. R., Rabin, B. Hybridization A. and Benzer, S. (1987b) Cell 51, 151-158. 1 John Archie Pollock, Thomas Deerinck , Hafen, E., Basler, K., Edstroem, J.E. and Rubin, G. M. 1 (1987) Science 236, 55-63. Mark H. Ellisman , Seymour Benzer Tomlinson, A., Bowtell, D. D. L., Hafen, E. and Rubin, The subcellular distribution of the mRNAs may be G. M. (1987) Cell 51, 143-150. a mechanism for developmental control. By utilizing light microscopic (LM) autoradiographic in situ 215 hybridization for the localization of endogenous neurons for each cluster in a normally developing eye. mRNAs, we have studied the distribution of the mRNA We are therefore cloning the Star gene by transcripts for the Drosophila visual system genes, "walking" from a chromosomal rearrangement dis sevenless, chaoptic and ninaE (opsin Rh!). lnformation covered by E. B. Lewis (1945) which juxtaposes Star obtained with LM indicating a differential distribution with the already cloned bithorax complex. Our future of mRNAs in both developing and mature photo work will include a detailed characterization of the receptors stimulated us to develop a new, higher phenotypes of several different Star alleles in the resolution procedure for in situ hybridization. This developing eye at both the onset of metamorphosis and technique involves mild aldehyde fixation of dissected in the fully developed eye, using a panel of monoclonal tissue, sucrose cryo-protection, and cryo-sectioning on antibodies recognizing distinct antigens specific to an ultramicrotome. Probe DNA, labeled by nick trans neurons or photoreceptors, to characterize the lation with biotinylated nucleotides, is size-selected morphology and gene activity of mutant photoreceptor for optimal probe length. Hybridization and detection cells. Cloning of the Star gene should, in turn, allow are performed on the sectioned tissue. The tissue is us to determine the chemical structure of the Star then post-treated for EM visualization in a manner gene product and determine the location of its similar to immunolabeling. High voltage electron expression in the developing visual system. microscopy (IMeV) enables the use of thicker sections, Reference: 0.5-1.0 "m, which provide greater stability through the Lewis, E. B. (1945) Genetics 30, 137-166. subsequent steps of immunodetection and colloidal gold labeling. Using this technique, we have obtained 317. The eyes absent Gene of Drosaphila: evidence that supports the LM observation of a non A Developmental Trigger for Eye Disc Differentiation? uniform distribution of sevenless mRNA in the developing eye imaginal discs, and of the chaoptic Roger W. Hackett, Seymour Benzer mRNA in normal and mutant adult compound eyes. Morphogenesis in the developing eye imaginal disc The abundant opsin transcript was also studied as a of Drosophila begins midway through the final larval control in compound eye photoreceptor cells. This stage and advances in a posterior-to-anterior direction technique should aid further investigations into the across the immature disc epithelium, creating clusters mechanisms for control of cell polarity in development of cells that will form the individual ommatidia of the that may involve non-uniform distributions of mRNAs. compound eye. In an attempt to understand the 1 molecular mechanisms that trigger this synchronous Department of Neuroscience, Laboratory of Neuro cytology, University of California at San Diego, La wave of differentiation, we are studying a mutation, Jolla, CA. eyes absent (eya), that completely blocks eye development (Biology 1987, Abstract No. 266). 316. Cloning and Characterization of the Star Gene We have isolated new temperature-sensitive alleles of eya by genetic complementation. Analysis of one Erich M. Schwarz, Dennis G. Ballinger, Seymow- Benzer such mutant, using reciprocal temperature shifts, Over 200 mutant loci in Drosophila can disorder the suggests that the wild-type eya function is required adult eye. Many, when examined histologically, cause only during the late larval period, concomitant with the number of neurons per cluster to decrease from the wave of eye disc morphogenesis. the normally constant number of eight; some, in The eya gene may be transiently expressed only addition, cause these reduced clusters to fuse. The during eye disc morphogenesis in eye precursor cells, Star mutation, in contrast to this, appears to cause and may play a key role in the initiation and/or individual clusters to fluctuate both above and below maintenance of a synchronous genetic program for the the norm, with 4-9 neurons per ommatidium in an terminal differentiation of eye disc epithelial cells. individual eye of a Star mutant fly. It is therefore Isolation of a candidate eya gene is the first step in possible that Star mutations perturb the machinery addressing this hypothesis. whereby cells somehow count out exactly eight 216 )llL A Generation oi Drosopltilo Eye Mutants that brain areas in man. On Western blot analysis, the Are Perturbed in Their Developmental Pathway antibody reacts with a 35-36 kDa doublet in both William M. Leisersoo, Utpol &!ilerjeec, SeymllW' Benzer species. The antibody was used to isolate four Most recessive eye developmental mutations independent, cross-hybridizing clones from a human currently available are sex-linked, since it is easiest to brain l._gtll expression cDNA library (Clontech). RNA isolate X-chFomosome mutations in males. 5ince the proloes are being utilized in Southern and Northern blot autosomes constitute approximately 4/5 o·f the genome analyses and tissue in situ hybridization. The second of Drosophilo, we would like to screen them for approach involves screening a collection of Drosophila mutations. £trains necessary t<> set U!> lines of head-specific cDNAs (Hyde et at., 1987; Palazzolo et hom<>z.ygosed, mutated aut<>Somes have been ol•. , 1987) by Northern blot analysis to detect tissue- constructed. The mutations are affected by mobilizing specific. cross-hyb£idizing RNA species. Of 10 probes a defective P element onto the autosomes using a already tested, three show specific. bands both in fly second P element that acts as. a strong source. of head and bovine retina and/or mouse brain. The iden- transpos.ase,. but does l'lOt moi>ilize itself. This tifica tion ol a panel of new nervous system-specific technique was pioneered in. the laboratory of W. E.l'lgels homologous fly-vertebrate genes will provide infor (Robertson et a!., 19'8&}. The mutant lines generated mation concerning the extent of genetic c<>nservation in this scheme are tested by a rapid, deep pseudopupil between these species and may allow the use of the fly meth 1 Carol A. Miller, Maria Rudnicka , G. Perry', David: R. Hintoo, M. Koz!.olllski. 1 319. lde!'ltiiiCatlon of Retina- and Brain-Specific Genes~· Between Dro8opl1ilcl imd Man Moooclooal antibody (MAb) 3A4, obtained using Drosophila tissue as imrnunogen, identifies. cytoplasmic David: R. Hinton, Kirk Mecklenburg, Carol A. Milter, s ..ymaurc Benzer material within the neurons underg0ing degeneration in Two. complementary methods are being used t<> the cerebrum in Alzheimer's disease (AD). In this identify retina- and brain-specific genes hom<>logous study, the topographical distribution ol antigen (Ag) between !'lrosopki.!a """' verteb<"ate species. The first 3A4 in autopsy tissues was analyz.ed immun<> employs a pamel <>I monoclonal. antibodies. made against cytochemically at the light and EM levels and by the Dn>sopl>Ua nerV-O>JS sys.tern (Fujita e:t a!., 1982} that Western blats. 5erial sections <>f neocortex and cross reacts with neuronal subp<>pulatioos in hl.llililJ> !Uppocampus of nine AD and five control cases were retina and brain {Hinton et al., 19'88). Qne <>f the s.tained with ABC immuooperoxidase andlor Thioilavin antibodies,. &Cl, reacts with ~il regiOIThS in the 5 (Thia}. The dlJration of the clinical <:Ot.J£se ranged optic !aloes and central brain of Dr060f)l:tika ancl. the fr<>m one to 16 years from the ans.et ol dementia. In i"""' plexiform layer of retma. and selective cortical tissue sections, MAb 3A4. was not si!l"ilicantiy 217 reactive in controls, but recognized a phosphory!ated library prepared from normal human brain will be used antigen most abundantly distributed ln hippocampal to isolate cDNA clones recognized by MAb 3Fll. The neurons of patients who succumbed after a short corresponding antigen(s) produced as a fusion protein(s) clinical course (up to 3 years). In this group, fewer will be tested on Western blots. To check antigenic tangle-bearing neurons contained Thio reactive expression of the positive clones, plus-minus screening material. Hippocampal tissue from patients surviving utilizing poly\A) mRNAs from neuronal and non longer (up to 16 years) showed minimal or absent neuronal sources as well as in Situ hybridiZatlon MAb JAii reactivity and abundant Thia-positive experiments on tissues will be performed. tangles, but MAb 3A 4 reactivity was noted in References: pyramidal cells in association and primary neocortex. Miller, c. A., Rudnicka, M., Hinton, D. R., Blanks, J. In all sites, the distribution of Ag 3A4 differs from C. and Kozlowski, M. (1987) Proc. Natl. Acad. Sci. USA 84, 8657-866 l. that of MAb Alz-50, anti-pair-helical filament (PHF), Moon, R. T., Ngai, J., Wood, B. J. and Lazarides, E. or Thio reactivity. Ultrastructurally, MAb 3A4 reacts (1985) J. Cell Biol. 100, 152-160, with PHF in isolates and within some tangles in tissue. 1Department of Pathology, University of Southetn California School of Medicine, Los Angeles, CA. Immunoblots show no MAb 3A4 reactivity with purified normal human neurofilament or bovine tau proteins. These results suggest a possible molecular modifica 322. Axonal Transport of Neuronal Antigens tion of the neurofibrillary elements in AD over time. Characteristic of Subpopulations of CNS Neurons 1 Reference: Roscoe D. Atkinson , Carol A. Miller, Miller, C. A., Rudnicka, M., Hinton, D. R., Blanks, J. Judith A. Gamer 1 C. and Kozlowski, M. (1987) Proc. Natl. Acad. Sci. Certain monoclonal antibodies (MAbs) identify USA 84, 8657-8661. nervous system antigens that are localized to neuronal 1 Department of Pathology, University of Southern subpopulations and that may undergo change during the California School of Medicine, Los Angeles, CA. 'case Western Reserve University, Cleveland, OH. course of neurodegenerative diseases, such as Alzheimer's disease (Atkinson et al., 1987). We have 321. Identification of an Alzheimer's Disease-Related examined the axonal transport of four of the corre Neuronal Subset-Specific Protein sponding antigens for two reasons. First, neuronal Maria Rudnicka 1. Carol A. Miller forms of the antigens can be identified by their axonal Monoclonal antibody (MAb) 3F 12, generated in transport. Second, each of the three major axonal mice immunized with Drosophila heads, stains a subset transport rate components is thought to convey a sub of large pyramidal neurons in normal brain cortices. cellular structure within the axon: the fast component Recently, we have found that MAb 3Fl2 reactivity is (FC) provides membranes and membrane proteins, selectively lost in Alzheimer's disease (AD) tissues. while the two slow components (SCb, SCa) convey the Molecular characterization of the 3F 12 antigen cytoplasmic matrix and cytoskeleton, respectively. might reveal another, yet unidentified molecule(s) Association of an antigen with a particular rate differentially expressed in the vulnerable neurons in component may give insight into its intracellular AD. Western blots of the soluble fractions of normal functions and its structural nature. and AD cortical homogenates reveal a pattern of Radioactive amino acids were injected unilaterally immunoreactive bands of molecular weights 60, 49 and into the vitreous of the eyes of guinea pigs. Radio 45 kDa. The 60 kDa band is localized to CNS tissues, labeled proteins synthesized in retinal ganglion cells particularly in corpus callosum-enriched preparations, were axonally transported into the optic nerve and while non-neuronal tissues have contained only the 49 tract. After appropriate intervals permitting and 45 kDa bands. The 60 kDa protein may thus be the separation of the rate components in the axons due to best candidate for a neuron-specifc component. To their unique transport rates, animals were sacrificed. prove the neuronal subset specificity of the protein, Optic nerve containing radioactive proteins charac we plan to identify the 3F 12 antigen by screening a teristic of single rate components and contralateral brain-specific expression library. A ~gtll cDNA control nerves were removed and subjected to 218 immunoadsorption with each of the four MAbs. grey nuclei. Neuronal displacement in ALS cases Visualization of radiolabeled antigen was by gel frequently exceeded 1 mm from the margin of the electrophoresis followed by fluorography. grey. Four of five ALS cases had, in some areas, more All four MAbs identified antigens specifically than five ectopic neurons per 100 µm of spinal cord. associated with single axonal transport rate Controls showed no neuronal displacement in ventral components. Three MAbs (3Fl2, 44.1, 8CJ) specifically outflow regions and intermediolateral grey regions; identified polypeptide bands from tissue containing one of five normal controls showed minimal ( 100 µ ) radioactive SCb proteins. Another MAb (22Cl0) displacement in the lateral corticospinal tract area of identified two polypeptide bands from tissue that the lumbar cord. contained radioactive SCa proteins. None of the MAbs Although it is unknown whether these ectopic identified antigens from tissue containing radioactive neurons are functional and maintain appropriate FC proteins. synaptic contacts, their abnormal positions may Assignment of these antigens or antigen subunits to contribute to depletion of the pool of spinal cord specific subcellular systems has permitted their motor neurons to numbers below the threshold required characterization as putative cytoplasmic matrix for normal motor function. proteins (JF12, 44.1, 8CJ) or cytoskeletal proteins Reference: (22C 10). The roles these antigens may play in the Hinton, D. R., Henderson, V. W., Blanks, J. C., Rudnicka, M. and Miller, C. A. (1988) J. Comp. nervous system during normal axonal function and Neural. 267, 398-408. during neuropathogenesis can now be further 1Department of Pathology, University of Southern examined. California School of Medicine, Los Angeles, CA. Reference: Atkinson, R. D., Miller, C. A. and Garner, J. A. (1987) Soc. Neurosci. Abstr. 13, 1515. 324. Selective Vulnerability of a Subpopulation of 1 Cortical Neurons in Pick's Disease Departments of Anatomy and Neuropathology, University of Southern California School of Medicine, 1 2 Los Angeles, CA. Maria Rudnicka , G. Perry , Carol A. Miller Pick's disease (PD) is a rare, dementing neuro degenerative disorder of unknown etiology. Gross 323. Ectopic Spinal Cord Neurons in Amyotrophic Lateral Sclerosis atrophy and neuronal loss occur in the frontal and 1 1 temporal cortex, and Pick bodies (argyrophilic Carol A. Miller, M. Kozlowski , Celia Williams , David R. Hinton inclusions) are seen in the cytoplasm of affected The hallmark of amyotrophic lateral sclerosis neurons. Using a panel of monoclonal antibodies (ALS), a motor neuron disease of unknown etiology, is (MAbs), we have recently shown selective vulnerability selective vulnerability of the alpha-motor neuron. In a of a subpopulation of pyramidal neurons in Alzheimer's recent study, monoclonal antibodies (MAbs) have disease (AD). In these neurons, there was cytoplasmic immunocytochemically identified a subpopulation of reactivity of paired helical filaments with MAb JA4. neurons in the normal spinal cord (Hinton et al., 1988). In this study, we have used MAb JA4 to identify Spinal cord sections from five ALS, five normal neurons vulnerable in PD. Either formalin fixed or control, and four Alzheimer's disease (AD) patients frozen sections were examined with immunoperoxidase were examined immunocytochemically with MAb 44.1. or immunogold techniques. Tissues were obtained from Multiple 8 µ cryostat sections at cervical, thoracic, and frontal, parietal, and occipital cortex of five cases of lumbar levels were stained with the ABC immuno PD and a total of ten AD and normal controls. ln all peroxidase technique. Along with the expected alpha cases of PD, MAb 3A4 reactivity in neurons was pre motor neuron loss, ectopically located neurons dominantly in layers 2, 5 and 6 of the frontal cortex. reactive with MAb 44.l were observed in the white In parietal and occipital regions, only rare neurons matter of all ALS spinal cords, particularly in lateral were stained. These results are in contrast with AD corticospinal tracts, ventral root outflow regions, and tissues where pyramidal neurons in layers 3 and 5 show the white matter adjacent to the intermediolateral the characteristic tangles. PD tissues were com- 219 parably reactive with Bielschowsky stain; but, unlike Assistant Professor: James M. Bower AD tissues, were non-reactive with Thioflavin S. Visiting Associate: M. Hadi Shojaeian-Zansani Senior Research Fellow: Mark E. Nelson Ultrastructurally, MAb 3A4-conjugated particles Research Fellows: Girija Gundappa-Sulur, Michael G. Paulin decorated 12-15 nm straight filaments associated with 1 Graduate Students: Christopher Assad , Jasho Jiban 1 2 the Pick bodies. Our results suggest that the neurons Banik , Upinder S. Bhalla, Maurice Yao-Tze Lee , 3 2 1 Brian Rasnow , Matthew A. Wilson , Isaac Wong affected in PD show a topographical distribution 4 Research and Laboratory Staff: Golda Bernstein , distinct from that of AD, and Pick bodies share a novel David H. Bilitch, Susan B. Kallenbach, Patti M. L. common antigenic determinant with' neurofibrillary Koenig, Joan Roach, Jo Beth Schlottman 4, John Uhley tangles. Project SEED Staff:5 Thomas G. Brinck\ Diana C. Chu\ Claire Griffith, Michael Y. Meckler', 1Department of Pathology, University of Southern Charles J. O'Brien California School of Medicine, Los Angeles, CA. 2Case Western Reserve University, Cleveland, OH. 1 Division of Engineering and Applied Science, California Institute of Technology. 2Computation and Neural Systems Graduate Student, California Institute of Technology. PUBLICATIONS 3Division of Physics, Mathematics and Astronomy, California Institute of Technology. Ballinger, D. G. and Benzer, S. (1988) Plwtophobe 'Undergraduate, California Institute of Technology. (Ppb): A Drosophila mutant with a reversed sign of 5 The SEED Project is supported by funds from the phototaxis; the mutant gene shows an allele Education Foundation of America and TRW Corp. specific interaction with sevenless. Proc. Natl. Acad. Sci. USA 85, 3960-3964. Banerjee, U., Renfranz, P. J., Hinton, D. R., Rabin, B. Support: The work described in the following research A. and Benzer, S. (1987) The sevenless+ protein is reports has been supported by: expressed apically in cell membranes of developing Earle C. Anthony Fellowship Drosophila retina; it is not restricted to cell R7. Apple Computer, Inc. Cell 51, 151-158. Biomedical Research Support Grant (NIH) Hinton, D. R., Henderson, V. W., Blanks, J. C., Directors Developmental Fund, JPL Rudnicka, M. and Miller, C. A. (1988) Monoclonal Joseph Drown Foundation antibodies react with neuronal subpopulations in Educational Foundation of America the human nervous system. J. Comp. Neural. 267, Joint Tactical Fusion Program 398-408. Lockheed Corporation Miller, C. A., Hinton, D. R. and Rudnicka, M. (1987) Lucille P. Markey Charitable Trust Molecular approaches to Alzheimer's disease. In: National Institutes of Health, USPHS Molecular Neuroscience: Expression of Neural National Science Foundation Genes, Chapt. 14, Alan R. Liss, Inc., New York, pp. Department of the Navy, Office of Naval 141-146. Research Miller, C. A., Rudnicka, M., Hinton, D. R., Blanks, J. TRW Corporation C. and Kozlowski, M. (1987) Monoclonal antibody The Del E. Webb Foundation identification of subpopulations of cerebral cortical The Whitaker Foundation neurons affected in Alzheimer's disease. Proc. Natl. Acad. Sci. USA 84, 8657-8661. Pollock, J. A. and Benzer, S. (1988) Transcript localization of four opsin genes in the three visual Summary: In general, our research efforts continue to organs in Drosophila; RH2 is ocellus specific. be directed toward understanding two different regions Nature 333, 779-782. of the nervous system: the cerebellum and the olfactory cortices. Our approach to both involves a combination of neuroanatomical, neurophysiological, and neuromodeling techniques. In the last year, we have added several behavioral experiments to our battery of techniques. The lab is organized in such a way that these different approaches mutually re inforce each other in our quest to understand how these structures work. Progress over the last year has been very good in each of these areas. In addition, we are involved in a series of develop mental projects designed to understand the origin of the specific patterns of peripheral projections to 220 cerebellar cortex. This research also combines several developed that simulates physiological responses different technical approaches including neuro obtained using a variety of recording methods (Wilson anatomy, neurophysiology and neurogenetics. Several et al., 1986). The model consists of a two-dimensional of these projects have been brought very near array of several thousand pyramidal cells inter completion over the last year. connected by a highly divergent/convergent system of associational fibers. Excitatory input is delivered to 325. A General Purpose Software Package to the cells along an afferent pathway containing Realistically Simulate Neural Networks multiple independent fibers. These fibers are capable Upinder S. Bhalla, Mark E. Nelson, Matthew A. Wilson, of carrying complex spatial/temporal patterns with James M. Bower characteristics similar to the lateral olfactory tract For the last 1-1/2 years, we have been working to projection of piriform cortex from the olfactory bulb. develop a general-purpose, neural network simulator to A dendritic model of the pyramidal cells allows for support the fabrication of structural models of neural spatial interaction of activity generated along systems. Over the past year, the use of the simulator different segments of the pyramidal cell dendrite. has expanded to include models of several neural Two additional populations of interneurons included systems ranging from invertebrate pattern generators are each responsible for different forms of inhibition: to networks of thousands of neurons in the vertebrate a feedforward, long latency, long duration hyper CNS. A library of simulations performed on the polarizing potential, which simulates the K+-mediated system is being established. These include simulations potential observed in piriform cortex, and a feedback, of the pyriform cortex, the olfactory bulb, the short latency, current shunting type inhibition cerebellum, the inferior olivary nucleus and several simulating the well known Cl--mediated process. The invertebrate pattern generators. simulation incorporates the different propagation In its present and still evolving form, the general velocities of the separate fiber pathways, synaptic purpose simulator consists of 1) a flexible, graphical delays, refractory periods, time constant estimates for front end for interfacing with the simulator and inhibitory and excitatory influences. The model is specifying networks; 2) the simulator base code which capable of simulating a variety of known intracellular is sufficiently general to run detailed, single-cell and extracellular responses including odor-like models, as well as large networks and is written to run oscillatory bursts, characteristic shock responses, and efficiently on serial as well as parallel (hypercube) epileptiform activity. Simulation results have machines; and 3) a set of routines for graphical display revealed the presence of propagating waves of activity of the simulation output in the form of electro across the cortex which are driven by afferent input physiologically relevant parameters like intracellular and carried by both afferent and association pathways. potentials which can be analyzed by the same package Using connections consistent with the known circuitry (BDA) that we use to analyze our real data. The of piriform cortex and a learning rule that modifies general-purpose simulator will shortly be made avail synaptic strengths as a function of physiological able for general distribution and will also serve as the variables, the model can successfully store and recall base for a course on "methods in computational neuro spatially encoded patterns. Discrimination of such science" to be taught by Ors. Bower and Koch at the patterns is hypothesized to be the basis for classifying Marine Biological Laboratory in Woods Hole, MA. olfactory inputs to the cortex. Recently, a model of the olfactory bulb has also 326. A Computer Simulation of a Three-Dimensional been developed that incorporates the three primary Model of Piriform Cortex with Functional Implications for Storage and Recognition of cell types of the bulb-principle mitral cells that Olfactory Patterns project to the piriform cortex, granule and peri Matthew A. Wilson, James M. Bower glomerular cells. This model will eventually serve as Using parameters obtained from anatomical and the front end to the model of olfactory cortex. physiological experiments (Haberly, l 986), a computer References: model of piriform (olfactory) cortex has been Haberly, L.B. (1986) Chem. Senses 1, 219-238. 221 References (continued): 328. Silicon-Based Probes for Multichannel Recording Wilson, M. A. and Bower, J. M. (1988) Im Neural in Cerebellar Cortex Information Processing Systems, Anderson, D. (Ed.), AIP Press, New York, in press. Jasho J. Banik, Mark E. Nelson, Brian Rasnow, Wilson, M.A., Bower, J.M., Chover, J. and Haberly, L. James M. Bower B. (1986)Soc. Neurosci. Abstr. 12, 13~8. We have developed a new technique which allows u::; to make simultaneous extracellular recordings from a 327. Structural Simulations of the Inferior Olivary large array of cerebellar locations using multiprong, Nucleus multisite, silicon-based recording probes. The key to Maurice Lee, James M. Bower the new technique is our development of a miniature The function of the inferior olivary nucleus (IO) is JO-channel silicon-based microelectrode with excellent tied to, and will probably be explained in terms of, its recording characteristics. Using photolithography and oscillatory, spatially correlated patterns of output anisotropic etching techniques, we are able to shape (Llinas apd Yarom, 1981). For the last several months, the silicon substrate into a structure which supports a we have been developing a computer model of the high density of recording sites while at the same time mammalian IO, based on anatomical and physiological being no larger than standard glass pipettes. The data, to explore the possible cellular- and network probes are a comb-like structure with 5 teeth per level mechanisms underlying the correlated climbing comb. At its widest point, the shank of each tooth is fiber-mediated activity observed by recording complex approximately 24 µ x 12 µ in cross-section and tapers spikes from multiple Purkinje cells in rat cerebellum to a sub-micron point at the end of its 1.5 mm length. (Bower and Llinas, 1983). The teeth are spaced 150 µ apart and there are three In the model, IO neurons are simulated as coupled recording sites on each tooth. We have recently oscillating low-pass filters. Active membrane completed construction of a new 100-channel, properties are generated by a somatic Na+ computer-controlled amplifier system, to allow us to 2 conductance, a high-threshold dendritic ca • after process data from multiple probes. depolarizing conductance and accompanying long For our cerebellar studies, we have positioned the lasting K+ afterhypolarizing conductance, and a low recording sites on each tooth to simultaneously record 2 threshold somatic Ca + rebound conductance (see climbing fiber responses at the dendritic level, simple Ltinas and Yarom, 1981; Bernardo and Foster, 1987). spikes at the somatic level, and granule cell responses Networks of these model neurons are constructed in the underlying granule cell layer. The upper two according to known microanatomical features recording sites on each tooth form a "stereo pair" including, for example, the synaptic glomeruli, in which provides extra discrimination and localization of which dendrodendritic electrical synapses modulated neural signals that are detected at both recording by afferent excitation and feedback shunting inhibition sites. We are using the probes in Crus Ila of the rat are prominent. The model also simulates dendritic cerebellar cortex to record spontaneous activity and thickets of serial chemical synapses. responses to tactile stimulation of the face. This work A simplified version of this model has been is part of our ongoing effort to understand the implemented on Hypercube architecture and its output processing and representation of information in the will be compared to responses recorded in cerebellar cerebellar cortex, and, in particular, the possible cortex. functional significance of the observed fractured References: somatatopy of the mossy fiber inputs. Bernardo, L. S. and Foster, R. E. (1987) Brain Res. Future developments on the technical side will Bull. 17, 773-784. Bower, J. M. and Ltinas, R. (1983) Soc. Neurosci. include the incorporation of signal processing Abstr. 9, 607. electronics directly onto the same silicon substrate as Ltinas, R. and Yarom, Y. (1981) J. Physiol. 315, 549-567. the recording array. To this end, we are beginning to use CMOS technology to fabricate circuitry for pre amplification and multiplexing of neural signals. The miniaturization of the front-end electronics will make 222 these devices ideal for chronic implantation, allowing cell responses on the anatomical map of Qll3-positive the possibility of making simultaneous recordings from Purkinje cells has been done, but the two types of multiple single neurons in awake, behaving animals. patterns cannot be aligned. We have already begun work on a chronic recording References: system using standard surface-mount components for Hawkes, R., Collonier, M. and Leclerc, N. ( 1985) Brain Res. 333, 359-365. the front-end electronics. We are also developing new Shambes, G. M., Gibson, J, M. and Welker, W. (1978) VLSI hardware for on-line spike classification based on Brain Behav. Evol. 15, 94-140. a template matching algorithm which has been found 1 Computation and Neural Systems Graduate Student, capable of recognizing and classifying over lapping Division of Engineering and Applied Science, California Institute of Technology. waveforms (Wong et al., 1988). This technique could conceivably double or triple the number of individual neurons that can be reliably isolated and identified 330. Role of Cell Autonomous Factors in Establishing Sensory Maps in Cerebellar Cortex using these probes. 1 M. Hadi Shojaeian-Zansani, Karl Herrup , Reference: James M. Bower Wong, Y., Banik, J. and Bower, J.M. (1988) ln: Neural Information Processing Systems, Anderson, D. We are continuing our work of the last two years (Ed.), AIP Press, New York, in press. aimed at trying to determine how the patchy, fractured somatotypic patterns of tactile projections 329. A Comparison of Physiological and Anatomical to cerebellar cortex are established during develop Maps in Cerebellar Cortex ment. This work involves comparing maps of Purkinje 1 Joan L. Roach, Sylvie Ryckebusch , James M. Bower cell lineage established with mouse chimeras with Tactile physiological input via mossy fibers to the physiological maps determined with micromapping granule cell layer of the rat cerebellum is somato techniques. Our mapping experiments have shown that topically arranged in patches (Shampes et al., 1978). chimeric mice, like regular mice and rats, have a In Crus IIa, for example, there is a large patch near fractured somatotypic pattern of tactile projections to the center of the dorsal area of the folium responsive Crus II of the hemispheres of the cerebellum. Further, to touch of the ipsilateral upper lip. Smaller patches separate experiments have shown that the two distinct responsive to contralateral upper lip and ipsilateral lineages of Purkinje cells seen in chimeric mice are lower lip are found medial and lateral to the ipsilateral highly nonrandom in distribution in l 0 of the 11 cases upper lip area. Anatomically, an antigenic subset of analyzed. Further, we have found that cells of like Purkinje cells is seen when frozen sections of lineage are grouped into patches of variable size, cerebellum are incubated with the antibody Qll3 similar to those found with physiological mapping (Hawkes et al., 1985). The subsets of stained cells techniques. Experiments currently in progress will present a banded pattern when the antibody is linked make direct comparisons between these maps in the to a marker visible in the light microscope. We same animal. wanted to know if there is any relationship between 1Yale University School of Medicine. these physiological and anatomical patterns. The crown of folium Crus Ila was first mapped electro 331. Cerebellar Map Formation - Trigeminal Nerve physiologically and boundaries between different Section in Neonates Leaves Holes in Cerebellar patches marked with India ink. Then, the rat brains Granular Layer Tactile Maps of Adult Rats were sectioned and processed immunocytochemically Michael G. Paulin, James M. Bower with the Q 113 antibody. The positions of stained The granule cell layer of Crus Ila of the rat Purkinje cells in QI 13-treated individual sections of cerebellar cortex contains a fractured somatotopic Crus II were marked using a computer-linked micro map of perioral tactile receptive fields (lips, vibrissae, scope. Individual tracings were transferred to an IRIS teeth, etc.). Because non-neighboring sections of the graphics workstation and aligned so that the staining body surface project to neighboring regions (patches) pattern of all Crus II Purkinje cells was visualized. in the cerebellar cortical map, we are interested in Superimposition of the physiological map of granule how the map is established ontogenetically. In 223 anesthetized rats ranging from 2 to l l days postnatal, by computational strategies on the sensory side. we ligated the trigemina1 nerve unilaterally and Concurrent with these behavioral experiments, we are sectioned it distal to the ligation. At age 2-3 months, measuring the electrical properties of the fish's body we used glass microelectrodes to map multi-unit and electric organ. With this data, we hope to responses in the granule cell layer of Crus !fa to quantitatively simulate the sequence of electrosensory tactile stimulation of the perioral regions. The images entering the central nervous system as the majority of rats had no responses, or very weak, non result of the fish's exploration of its environment. specific responses in the regions normally occupied by Using these "images" as input to a model of the upper lip projections. In some rats we found weak peripheral electrosensory processing structures may responses to receptive fields near the corner of the enable us to predict and understand the response mouth and just under the nose. These receptive fields characteristics of neurons in the fish's cerebellum. are not seen in the maps of control rats. Non-upper lip Study of the system as a whole is expected to provide projections to adjacent regions of the cerebellar insight into the fish's active sensing of its environment cortex appeared normal in all respects. These results and in turn may also illuminate the role of the support the view that upper lip regions of the map are cerebellum in mammals. specified or reserved for the upper lip during develop ment, and that, in general, the overall patch-like 333. A New Approach to Teaching Science to Elementary School Children organization of tactile maps in cerebellar cortex may be established inflexibly during development. As such, James M. Bower, Brian Rasnow, Mark E. Nelson, Charles J. O'Brien, Jerome Pine 1 the data suggest that tactile maps in the cerebellum In addition to the scientific work described above, are much less plastic than those found in somato various members of the lab are also involved in a sensory (cerebral) cortex (Merzenich et al., l 984). project to implement a new approach to elementary Reference: Merzenich, M. M., Nelson, R. J., Stryker, M. P., school science education, The program is based on a Cynader, M. S., Schoppmann, A. and Zook, J. M. hands-on approach to teaching science and is now in (l984)J. Comp. Neural. 224, 591-605. place in four schools (64 classrooms) in the L.A. area 332. Object Discrimination, Body Position, and (two in Pasadena and two in Los Angeles County). The Self-Generated Electric Fields in the basic hands-on materials are augmented by personal Weakly Electric Fish, Gnathonemus petersii computer-based animated simulations derived from the Brian Rasnow, Mark E. Nelson, Michael G. Paulin, hands-on materials. The program also involves Christopher Assad, James M. Bower automated information retrieval for elementary school Gnathonemus petersii are in an unusual family of students. Last summer, 6 undergraduate SURF teleost fish characterized by their ability to use self students and 18 teachers participated in the program. generated electric fields to detect objects in their environment. They are unusual in the animal kingdom 1Professor of Physics, California Institute of Technology. at large because of their greatly enlarged cerebellar cortex. We have begun an investigation of the electric motor-sensory system in these fish, and the role of the enlarged cerebellum in their behavior. Our first PUBLICATIONS experiments on these fish are behavioral and designed to test whether body position and the timing of the Atiya, A. F. and Bower, J. M. (1988) Optimal neural spike classification. In: Neural Information electric organ discharge are related during exploratory Processing Systems, Anderson, D. (Ed.), AlP Press, activity. Finite element computer simulations have New York, in press. Bhalla, U. S., Wilson, M., Banik, J. J., Uhley, J, D. and been built and used over the last year to document Bower, J, M. (1988) Integration of computer simu that body position has a strong influence on the lations and multi-unit recording in the rat olfactory system. Soc. Neurosci. Abstr. 14, 1188. electrosensory "images" detected by the fish's electro Lee, M. and Bower, J. M. (1988) A structural receptors. In the brain, these positional effects are simulation of the inferior olivary nucleus. Soc. Neurosci. Abstr. 14, 1~4. likely compensated for either by motor control and/or 224 Nelson, M. E., Rasnow, B., Banik, J. J. and Bower, J. The main goal of the songbird project is the M. (1988) Spatial and temporal patterns of Purkinje neuronal correlates of song learning. Since song and granule cell activity recorded simulataneously in the rat cerebellum using silicon microelectrodes. learning requires auditory feedback, we began a Soc. Neurosci. Abstr. 14, 759. Rasnow, B., Nelson, M. E. and Bower, J. M. ( 1988) systematic survey of auditory pathways that lead to Measurement of the electric field of Gnathonemus the song motor control system. We also began to study petersii and reconstruction of fields generated the development of the song control system by cellular during exploratory activity. Soc. Neurosci. Abstr. 14, 204. and molecular methods. Wilson, M. A., Bhalla, U.S., Uhley, J. O. and Bower, J. M. ( 1988) A general purpose neural network simulator for implementing realistic models of 334. Processing of Interaural Level Differences in the neural circuits. Soc. Neurosci, Abstr. 14, 260. Inferior Colliculus of the Barn Owl Wilson, M. and Bower, J. M. (1988) A computer simulation of olfactory cortex with functional Ralph Adolphs implications for storage and retrieval of olfactory Barn owls use interaural differences in sound pres information. In: Neural Information Processing Systems, Anderson, 0. (Ed.), AIP Press, New York, sure level (ILD) to compute location of the source in in press. Wong, Y., Banik, J. J. and Bower, J.M. (1988) Neural elevation. I investigated the origin of neuronal selec networks for template matching: Application to tivity for !LO in the medial shell (MS) of the central real-time classification of the action potentials of nucleus of the inferior colliculus, presumptive input real neurons. In: Neural Information Processing a Systems, Anderson, 0. (Ed.), AIP Press, New York, stage to spatial elevation coding in the external in press. nucleus (!Cx). Anatomical connectivity was demonstrated by retrograde labeling with horseradish peroxidase. Neurons of MS receive direct massive projections from Professor: Masakazu Konishi the contralateral nucleus angularis, nucleus ventralis Visiting Associate: Allison J. Ooupe lemnisci lateralis pars posterior (VLVp), lateral region Research Fellows: Catherine E. Carr, lchiro Fujita, Susan F. Volman, F. Hermann Wagner of the superior olive, and sparse projections from Graduate Students: Ralph Adolphs, Richard 0. contralateral MS. Mooney, Larry Proctor Member of the Professional Staff: Eugene Akutagawa All above nuclei show stimulus-response curves Staff Associate: Terry T. Takahashi sensitive to ILD and generally insensitive to interaural Research and Laboratory Staff: John C. Wathey time differences OTO), culminating in typically very sharp "EI" response curves in MS neurons: they are Support: The work described in the following research reports has been supported by: excited by ILOs favoring the contralateral ear, and Bing Professorship in Behavioral Biology inhibited by ILOs favoring the ipsilateral ear. Lucille P. Markey Charitable Trust The McKnight Endowment Fund for Neuroscience Preliminary data from lidocaine injections into the National Institutes of Health, USPHS projecting nuclei suggest that both VLVp and MS make Max Planck Society Evelyn Sharp Fellowship inhibitory contralateral connections to MS. This is Gordon Ross Medical Foundation consistent with predictions made on the basis of Uehara Memorial Foundation connectivity and !LO-response character. Summary: We continued our studies of the auditory 335. The Role of Commissural Projections in the and vocal control systems of birds. Our experimental Representation of Bilateral Auditory Space in the Barn Owl's Inferior Colliculus subjects are owls and songbirds. We began three new projects with owls. The first project is a comparative Terry T. Takahashi, F. Hermann Wagner, Mark Konishi The central nucleus of the barn owl's inferior study of the auditory system in different owl species that use hearing for prey capture in different degrees. colliculus contains a representation of both the ipsilateral and contralateral auditory hemi-fields. The The second concerns the organization of the intensity processing pathway in the barn owl. The third deals representation of ipsilateral space is found in the with the role of inhibition in the genesis of neuronal "core" of !Cc, a subdivision defined by the terminal selectivity for interaural time difference. field of nucleus laminaris, the avian analogue of the 225 medial superior olivary nucleus. The representation of 337. GABAergic Inhibition in the Inferior Colliculus contralateral space is found in the "lateral shell" of of the Barn Owl !Cc, a subdivision defined by nucleus angularis, one of lchiro Fujita, Mark Konishi the cochlear nuclei. The representation of ipsilateral The barn owl uses interaural time differences (!TD) space in the core of !Cc is due to a crossed projection for localizing the azimuthal position of sounds. from nucleus laminaris, which contains a represen Neuronal selectivity for !TD fit:'it appears in the ~,l;<: tation of contralateral space. nucleus laminaris and improves in~ the central nucleus We found that the representation of contralateral "core" (!Cc) and the external nucleus (!Cx) of the space is due to a commissural projection from the core inferior colliculus. Tonal stimuli cause both ICc and of one side to the lateral shell of the opposite side. ICx neurons to respond maximally not only to one Thus, for example, the left !Cc core, which contains a particular !TD (the characteristic delay), CD, but also representation of the left hemi-field, innervates the to CD + nT, where T is the tonal period and n an right lateral shell, endowing it with a representation of integer. This phenomenon, phase ambiguity, does not the left, or contralateral hemifield. The representation occur when ICx neurons are stimulated with noise. of contralateral space in the lateral shell is ultimately Both ICc and ICx of the barn owl contain neurons conveyed to the external nucleus of the inferior and terminals that are immunoreactive to antibodies colliculus. to y-aminobutyric acid (GABA) or to an antibody to glutamic acid decarboxylase, the synthesizing enzyme 336. Commissural Projections Mediate Inhibition in a for GABA. These neurons and terminals are supposed Lateral Lemniscal Nucleus of the Barn Owl to exert inhibition on postsynaptic cells. Terry T. Takahashi, Mark Konishi. lontophoretically applied bicuculline methiodide Nucleus ventralis lemnisci lateralis pars posterior (BM!, a selective GABAA antagonist) decreased the (VLVp) is the first site in the owl's auditory system at !TD selectivity of !Cc neurons. The effects were which are found neurons sensitive to interaural level identical for tone- and noise-evoked responses. In ICx, difference, the owl's cue for sound-source elevation. BM! decreased !TD selectivity to tones only in neurons VLVp cells are excited and inhibited by stimulation of tuned to frequencies below 5 kHz. BM! led to loss of contralateral and ipsilateral ears, respectively. The !Cx neurons' ability to signal uniquely their CD. The excitation arrives via a contralateral input from results suggest that under physiological conditions nucieus angularis, the cochlear nucleus specialized for GABAergic inhibition sharpens !TD selectivity in !Cc coding sound level. Present tracer studies revealed neurons and ICx neurons tuned to below 5 kHz, and commissural projections from one VL Vp to the other eliminates phase ambiguity in ICx by interaction which can account for the ipsilateral inhibition. between the converging frequency bands. Specifically, inhibitory cells in, say, the right VLVp are driven via the left nucleus angularis and project JJ&. Comparative Physiology of Auditory Localization commissurally,. thus enabling the left ear to inhibit the in Owls ipsilateral (left) VL Vp. As a test of this hypothesis, we SUM11 F. ·Volman, Mark Konishi recorded from neurons in VLVp while locally anesthe Bilateral ear asymmetry has evolved independently tizing VLVp of the opposite side (18 neurons, 3 owls). in several phylogenetically distinct groups of owls. Injection of anesthetic (0.Z µI) rendered the biaural Barn owls are known to use their ear asymmetry for neurons insensitive to ipsilateral stimulation, making two-dimensional sound localization. Azimuth is them monaural. Recovery took about 20 minutes if computed from the interaural time differences (!TD) injection and recording sites had the same best arising from the horizontal separation of the two frequencies. Otherwise, recovery was quicker, ears.. Elevation is determined from interaural suggesting that the projection is tonotopically intensity differences (IID) created by the vertical organized. No convincing evidence of other inhibitory asymmetry. In a part of the barn owl's inferior sources was observed. colliculus (!Cx), neurons tuned for !TD and HD are topographically arranged into a map of auditory space. 226 We recorded from ICx in three additional species of the correct phrase elements of adult song and appear owls. The three species comprise a range of auditory to be matching their own vocalizations to a memory of adaptations: great horned owls have large heads and song (the acquired song template) heard 8-10 months symmetrical ears, but they are closely related to some earlier, shortly after they have fledged. Several asymmetrical species; burrowing owls are small and possible mechanisms might account for the rather symmetrical, and they are classified among a group of rapid appearance of selectivity in HVc. In juvenile owls that are all symmetrical and presumably the most hirds, the auditory responses often habituate rapidly primitive; long-eared owls are somewhat smal1er than and are sometimes inhibitory. Thus, the neuronal barn owls and have asymmetrical ears. In each species connections underlying song selectivity may already we found a map of azimuth roughly similar to that in exist in HVc, having been established during template barn owls and entirely dependent on !TD. Azimuthal formation, and simply become unmasked when singing width of receptive fields in the great horn approached begins. A second possibility is that the several hours a those in the barn owl and were somewhat narrower day of exposure to song, when a bird is learning to than in the long-eared owl. The burrowing owl, consis sing, may be sufficient to produce the tuned auditory tent with its small head size, had the poorest spatial responses. Alternatively, auditory feedback received resolution. In the symmetrical owls, ICx neurons were during singing may be required. Two sets of insensitive to elevation; the long-eared owl had weak experiments have helped distinguish among these elevation tuning, probably based on IID. Curiously, in mechanisms. the symmetrical owls IID tuning was similar to that in Female sparrows do not normally sing. They will the barn owl. The cells required binaural stimuli, sing, however, if given testosterone, or, as we although they all preferred nearly equal interaural fortuitously found out, if they are housed in pairs, one intensity, whereas the barn owl has a range of best female sometimes spontaneously develops song. In IIDs. In all of these species, ICx neurons are responsive these pairs, which had been kept in sound attenuation to a broader range of frequencies than are cells in the chambers, both the singing and non-singing female had other parts of IC. Among these owls, however, the ICx exactly the same amount of exposure to song. Yet HVc cells had a variety of frequency ranges: burrowing neurons in only the singing birds were song selective; owl, 2-4 kHz; great horned, 2-5 kHz; long-eared, 2.5 in the other bird, the auditory responses were exactly kHz; and barn owl, 3-8 kHz. like those all other pre-singing juvenile birds. These data suggest three generalizations about the For the second experiment, male birds were neural basis of auditory spatial processing in owls. temporarily devocalized just before the onset of 1) All owls probably use !TD alone to code azimuth. plastic song. Devocalization-a relatively minor 2) The use of IID cues .in asymmetrical owls correlates surgery in which the interclavicular air sac is opened with their hearing in a higher frequency range in which was repeated every 5-7 days when the air sac healed their ears are more effectively directional. 3) The and vocalizations became audible. In these birds, existence of binaurally exclusive IID tuning in sym plastic song advanced somewhat despite the fact that metrical owls may have pre-adapted the owl !Cx for they could rarely hear themselves sing. For the most the evolution of asymmetry. part, however, the neurons in HVc did not become selective. 339. Auditory Experience and the Development of These experiments indicate that a bird must hear Neuronal Song Selectivity its own song to develop the adult pattern of auditory Susan F. Volman responses. They further suggest that song selectivity In adult white-crowned sparrows, auditory in HVc may not be necessary for song development. responses in the song-control nucleus HVc are selec References: tive for an individual bird's own song (Margoliash, Margoliash, D. (1986) J. Neurosci. 6, 1643-1661. I 986). Neuronal song selectivity is not present in Volman, S. F. and Konishi, M. (1986) Soc. Neurosci. Abstr. 12, 954. juvenile birds that have not yet sung (Volman and Volman, S. F. and Konishi, M. (1987) Soc. Neurosci. Konishi, 1987). In this phase, the birds sing many of Abstr. 13, 870. 227 3'10. Non-Classical Auditory Projections to the efferent motor pathway controlling song. In the Songbird Forebrain male zebra finch, innervation of RA by HVc is delayed: Allison J. Doupe, Mark Konishi although HVc axons arrive at the dorsal border of RA Birdsong is a complex learning behavior that within 15 days after hatching, they do not enter the requires auditory experience and feedback during its nucleus until two weeks later. The initiation of song development. The classical thalamo-telencephalic behavior closely coincides with the innervation of RA auditory projection in songbirds is from nucleus by HVc. In the female, the pattern of development is ovoidalis to Field L. In addition, projections from initially similar, but HVc afferents remain Field L to the vicinity of hyperstriatum ventrale, pars permanently restricted from RA. Female RA neurons caudale (HVc) and the robust nucleus of the archi begin to atrophy and die at the same time their male striatum (RA) are known. counterparts first receive input from HVc, and the Using single and multi-unit electrophysiological adult female is incapable of producing song. recordings, we have found a wide distribution of Our experiments indicate that RA receives an auditory responses in other areas of the forebrain of excitatory input before it is innervated by HVc. adult male Bengalese finches. These units were located Furthermore, anatomical tract tracing techniques, in anterior portions of au layers of the hyperstriatum, using carbocyanine dyes, show that the forebrain song as well as in anterior neostriatum and lobus parol nucleus MAN has terminals within RA throughout the factorius (LPO). In LPO some of the recording sites time during which HVc terminals are restricted to a were within the song nucleus X. The auditory units zone outside RA. We are in the process of clarifying had response latencies of 20-30 msec, preferred whether the excitatory PSPs we observe correspond to complex stimuli such as white and narrow band noise, the input from MAN. and were broadly tuned to frequency. Preliminary Initial experiments, again employing intracellular results of horseradish peroxidase (HRP) injections into recordings from RA in vitro, are characterizing the these auditory areas showed retrograde label in the pharmacological nature of the excitatory synaptic posterior dorsal thalamus. potentials elicited in RA upon stimulation of the These results demonstrate a large area of auditory afferent fiber tract. In several cases, prior to the responsiveness in the songbird anterior forebrain, and arrival of input from HVc, EPSPs are selectively raise the possibility of a separate thalamo: antagonized by kynurenic acid, a glutamate antagonist. telencephalic auditory pathway, parallel to the We are in the process of characterizing which classical pathway through nucleus ovoidalis and glutamate receptor subtypes are present at these Field L. synapses. 3'11. Morphological and Pharmacological Correlates of Song System Development PUBLICATIONS Richard D. Mooney Takahashi, T., Carr, C. E., Brecha, N. and Konishi, M. ( 1987) Calcium binding protein-like immuno Unlike many animal vocalizations, birdsong is a reactivity labels the terminal field of nucleus learned behavior. Normal song production depends laminaris of the barn owl. J. Neurosci. 7, 1843-1856. upon early postnatal exposure to a tutor song, a Wagner, H., Takahashi, T. and Konishi, M. (I 987) subsequent plastic period during which the bird uses Representation of interaural time difference in the central nucleus of the barn owl's inferior auditory feedback to match its own song to this model, colliculus. J. Neurosci. 7, 3105-3116. and a "crystallization" period during which the song becomes fixed and independent of auditory feedback. Our goal is to understand the neuronal correlates, both in terms of connectivity and intrinsic cellular properties, that underlie the development of this behavior. HVc and RA are two forebrain nuclei that are in 228 Professor: Paul H. Patterson precursor of all of the cells of this lineage. Also in Research Fellows: Sigrun Korsching, Ana I. Millaruelo, progress is an attempt to produce MAbs that define Hiroyuki Nawa, Toshihiko Suzue, Tetsuo Yamamori subpopulations of premigratory neural crest cells. Graduate Students: Nagesh K. Mahanthappa, Thus, this area of work involves the delineation of Mahendra Rao, James H. Sabry Special Graduate Student: Josette f. Carnahan commitment vs. plasticity at the various stages that Research and Laboratory Staff: Joann Imrich, Doreen crest cells and their derivatives make phenotypic McDowell choices. This goal necessitates the identification, purification and study of the molecular action of cues Support: The work described in the following research reports has been supported by: in the embryonic environment that influence pheno Alzheimer's Disease and Related typic decisions. We are also making use of the ability Disorders Assoc., Inc. American Heart Association to control phenotypic choices in order to produce Biomedical Research Support Grant (NIH) catecholaminergic and cholinergic neurons from Albert and Kate Crutcher Fellowship fund Joseph Drown foundation adrenal chromaffin cells for neural grafting experi Lucille P. Markey Charitable Trust ments involving rat models of Parkinson's and Helen G. and Arthur McCallum Fund The McKnight Foundation Alzheimer's diseases. Medical Research Council of Canada Muscular Dystrophy Associations of America, Inc. We have identified a number of neuronal macro National Institutes of Health, USPHS molecules, surface-bound and secreted, which mediate National Science Foundation axonal growth, and several of these are being studied Gustavus and Louise Pfeiffer Research Foundation Gordon Ross Medical Foundation in antibody perturbation experiments and with mutant cell lines. The neuronal surface glycoprotein, Thy-I, is found on certain lymphocytes and neurons. Since it Summary: The interests of this laboratory concern shares sequence homology with immunoglobulins, Thy- two aspects of the development of the nervous system: 1 has been postulated to play a role in adhesion or factors that control the choice of phenotype, and recognition in the nervous system. We have used molecules involved in axonal growth and the formation antibody perturbation and the generation of Thy-1- of specific synaptic connections. Much of our effort in deficient, mutant cells to obtain evidence that Thy-I the first area has centered on sympathetic neurons plays a role in neurite outgrowth or sprouting. As for developing in cell culture. These neurons can neuronal secreted molecules, we previously determined differentiate synapses that utilize catecholamines or that plasminogen activator and its naturally occurring acetylcholine as the neurotransmitter, and a glyco inhibitor can control the rate of axonal outgrowth in protein secreted by heart cells can control this culture. An in vivo project is attempting to assess the transmitter choice without affecting neuronal growth role of these proteins in nerve regeneration in the or survival. Recent evidence suggests that there is a adult and embryonic animal. group of distinctive differentiation factors that A novel method for producing monoclonal control individual neuropeptide phenotypes as well. antibodies against rare antigens is being used to We are cloning the gene for the cholinergic investigate the mole· :ular basis of the specificity of differentiation signal, and antibodies that block its synaptic connections in the spinal cord innervation of function are being injected into neonatal rats in sympathetic neurons. This innervation displays a attempts to perturb development. The role of positional bias, with rostral cord neurons preferring to hormones and growth factors has been extended to innervate rostral sympathetic neurons, as well as other phenotypic choices in this lineage, and the rostral skeletal muscle. In a search for surface interconversion of adrenal chromaffin cells, SIF (small molecules that might mediate this positional bias, intensely fluorescent) cells and neurons has been monoclonal antibodies were generated that bind demonstrated in culture. We are also studying the preferentially to membranes from rostral neurons. relationships of these cells during normal development The cellular localization and the molecular nature of in viva and have recently generated a set of mono the corresponding antigens are being investigated. clonal antibodies (MAbs) that bind to the probable Thus, this second area of work involves the identifi- 229 cation of molecules that play roles in axon outgrowth, were isolated that spec.ifically stain chromaffin cells regeneration and specific synapse formation. but not SIF cells or neurons. Most importantly, all of the MAbs stain most, if not all, of the cells in the 3/f2. Phenotypic Commitment and Plasticity in the early embryonic sympathetic ganglion. Staining is Neural Crest first apparent at the end of crest cell migration and James H. Sabry correlates with the onset of tyrosine hydroxylase Neural crest cells arise from the dorsal margin of expression. By embryonic day 15, most of the staining the neural tube and migrate throughout the body. has disappeared in the ganglion, but is maintained in Following migration, crest cells differentiate into an the developing adrenal medulla. Thus, these MAbs enormous variety of phenotypes, including sensory and define a putative sympathoadrenal precursor that autonomic neurons and glia, adrenal chromaffin cells, shares several traits with chromaffin cells. Experi melanocytes, odontoblasts and facial mesenchyme. It ments are in progress to determine the plasticity of is not yet clear how much of this diversity is generated the immunoreactive cells in culture. by strict lineage relationships and how much depends on intercellular interactions. We would like to 3/f4. Molecular Cloning of a Neuronal Cholinergic Differentiation Factor elucidate this issue further by asking whether subpopulations of cells can be identified in the Tetsuo Yamamori, Sigrun Kors~hing, Ruedi Aebersold premigratory crest on the basis of surface antigens. We have been cloning the cDNA of a neuronal The identification of distinct groups of cells before differentiation factor that changes the neuro migration would support certain lineage models and transmitter phenotype of sympathetic neurons from would enable us to test the phenotypic commitment noradrenergic to cholinergic (Fukada, l 985). In and plasticity of purified populations of cells. We are collaboration with Drs. S. Kent and L. Hood, J l N attempting to produce monoclonal antibodies specific terminal amino acids of the protein were sequenced. for cells of the quail mesencephalic crest by first Dr. S. Horvath used this sequence to produce a syn tolerizing mice against cells from the lumbar crest and thetic peptide and oligonucleotides. The peptides were then injecting membranes from mesencephalic cells. coupled to carrier proteins and antisera were obtained that block the activity of the factor (Fukada, 1986). The sequence was also used for making oligo 343. The Precursors of the Sympathoadrenal Lineage nucleotides for cDNA screening. A heart cell cDNA Josette F. Carnahan, Paul H. Patterson library was screened with two 32-mers containing Adrenal chromaffin cells, sympathetic neurons and inosine substitutions at several third positions, as well small intensely fluorescent (SIF) cells are all derived as with 14-mers containing all possible sequences from the neural crest, but they each are characterized derived from the central 5 amino acids. We found in by distinct morphological and biochemical properties. frame homologies of 5-7 (out of l l) amino acids, but Manipulation of the environmental cues in culture has not the precise sequence of interest. Apparently the revealed that these cell types are interconvertible and N-terminal sequence does not provide sufficient raised the possibility that they are derived from a specificity due to the low abundancy of the mRNA and common precursor. To identify and characterize this the high ambiguity of the codons. Therefore we precursor, it would be advantageous to have highly obtained more (internal) amino acid sequence infor monoclonal antibodies (MAbs) directed against its cell mation using a recently developed two-step method for surface. Since there is suggestive evidence that the obtaining peptide fragments from picomole quantities precursor shares properties with SIF and chromaffin of proteins. Several fragments were successfully cells, we used the immunosuppression method to obtain sequenced and a heart cell cDNA and a rat genomic such MAbs. Mice were tolerized to neurons by library were screened with several sets of oligo injections of membranes from adult rat sympathetic nucleotides corresponding to these internal sequences. ganglia and cyclophosphamide, and then injected with Several clones that hybridize under high stringency membranes from neonatal adrenal medulla. Six MAbs conditions are being characterized. 230 References: determine if the differentiation factor discovered in Fukada, K. (1985) Proc. Natl. Acad. Sci. USA 82, 8795- the culture work also plays a role in the noradrenergic 8799. Fukada, K. (l 986) Soc. Neurosci. Abstr. 12, 378. to-cholinergic switch observed in the innervation of the sweat gland. 345. Evidence for Distinct Factors Affecting 1Case Western Reserve Medical School, Cleveland, Transmitter and Neuropeptide Phenotypes OH. Hiroyuki Nawa, Paul H. Patterson The over 30 neuropeptides that have been 347. Neural Grafts in Disease Models identified thus far are found in an enormous variety of 1 James H. Sabry, Fred Gage , Paul H. Patterson combinations with classical transmitters. The Parkinson's disease is a degenerative disease that specification of these transmitter phenotypes poses a results in severe motor disability. Although there are difficult developmental problem. An instructional drugs that can temporarily ameliorate the symptoms signal that specifies one transmitter phenotype of the disease, there is an inexorable progression to a (acetylcholine) has been purified to homogeneity from drug-resistant state. This has stimulated efforts to heart cell conditioned medium (CM) (Fukada, 1985). examine the feasibility of neural grafting as a poten We find that unfractionated heart cell CM also induces tial therapy. Recent clinical studies using auto grafts the expression of several neuropeptides and their of adrenal chromaffin cells into the brain have yielded mRNAs in rat sympathetic neurons: substance P (SP), controversial results. Since we have previously shown somatostatin (SOM), vasoactive intestinal polypeptide that chromaffin cells can be converted into catechol (VIP) and dynorphin, but not neuropeptide Y. A aminergic neurons in culture, we are examining the different pattern of peptide induction was observed for possibility of using autographs of adrenal-derived CM from skin fibroblasts. The inducing activities for neurons in a rat model of Parkinson's disease. SP, SOM and VIP are separable from each other and Another major degenerative neurologic disease is from the cholinergic activity by ammonium sulfate Alzheimer's disease. One of the key deficits in this precipitation and ion exchange chromatography. These disorder is a loss of cholinergic neurons in the basal observations support the possibility that a large forebrain. Since we have shown that the appropriate number of distinct factors may influence the choice of environmental signals can convert adrenal chromaffin transmitter phenotype in developing neurons. cells into cholinergic neurons, we are using autographs Reference: of these adrenal-derived neurons in attempts to Fukada, K. (l 985) Proc. Natl. Acad. Sci. USA 82, 8795- 8799. ameliorate cholinergic deficits in the rat brain induced by surgery or by normal aging. 346. The Role of the Cholinergic Factor ht Vivo 'University of California at San Diego Medical School. 1 Mahendra Rao, Story Landis , Paul H. Patterson A minority population of neurons in sympathetic 348. Thy-I and Neurite Outgrowth ganglia use acetylcholine as their transmitter, and Nagesh K. Mahanthappa, Paul H. Patterson they innervate particular target organs such as the Thy-1 is a major cell surface glycoprotein of mouse sweat glands of the rat foot pad. These neurons switch T lymphocytes and certain neurons of all vertebrates. their transmitter phenotype from noradrenergic to While its sequence homology with the immunoglobulins cholinergic after their axons innervate the sweat is intriguing, the function of Thy-1 remains a mystery. glands during the second postnatal week. In culture, Monoclonal antibodies (MAbs) against Thy-I can noradrenergic sympathetic neurons can be converted activate lymphocytes and increase free cytoplasmic to the cholinergic phenotype by growth in the presence calcium levels. We find that when anti-Thy-I MAbs of a 45 kDa glycoprotein produced by cultured heart bind to the surfaces of several neural crest derivatives cells. Antisera that block the activity of this factor (sympathetic neurons, adrenal chromaffin cells and have been produced and affinity purified. We are PC12 cells), neurite outgrowth is enhanced. As in the injecting these antibodies into neonatal rats in order to lymphocyte studies, antigen cross-linking is necessary 231 for this effect, and control MAbs against other surface promote axon growth, this antigen could play a role in antigens do not have this effect. In an independent the rostrat preference displayed by rostral spinal cord approach to this problem, we have mutagenized PC12 axons. cells and selected for Thy-I-deficient cells. Surprisingly, most of these cells sprout neurites 350. Role of Ptasminogen Activator and Its Inhibitors in Axonal Outgrowth and Regeneration In Vivo spontaneously, unlike the cells that retained Thy-I expression. These results suggest the hypothesis that Ana I. Millaruelo Thy-I normally exerts an inhibition of sprouting, A role for plasminogen activator (PA) and its perhaps by stabilizing cell shape, and cross-linking the inhibitors (PA-I) in neurite outgrowth has been protein or removing it by mutagenesis releases this demonstrated in cell culture experiments. Sympathetic inhibition. and sensory neurons in culture release PA from their In pursuing the mechanism of the cross-linking distal processes and growth cones, and inhibition of effect, we have obtained evidence that Thy-1 can bind this PA activity by natural or synthetic inhibitors very tightly to itself, forming high molecular weight increases the rate of neurite outgrowth (Pittman and aggregates. This raises the possibility that Thy-I, Patterson, 1987). The involvement of PA and PA-I in either within the plane of the membrane, or between neurite outgrowth in vivo is being tested in the adjacent cells, can form very stable bonds that reinnervation of the adult rat iris after destruction of stabilize intercetlutar contacts and/or membrane its sympathetic fibers by systemic injection of 6- structure. hydroxydopamine. Regeneration is monitored by specific uptake of 3H-noradrenaline by the iris. Various methods of effectively administering affinity 349. Monoclonal Antibodies That Define Rostro Caudal Position in the Mammalian Nervous purified IgGs against the PA-I, protease nexin, are System being tested. Toshihiko Suzue, Joann lmrich, Paul H. Patterson Reference: Transplantation experiments have shown that spinal Pittman, R. N. and Patterson, P.H. (1987) J. Neurosci. 7, 2664-2673. cord neurons can distinguish rostral vs. caudal sympathetic ganglia, as well as rostral vs. caudal intercostal muscles, when the muscles are transplanted in place of the ganglia. This raises the possibility that PUBLICATIONS the ganglia and the muscles share a motecule(s) that Carnahan, J, and Patterson, P. H. (1988) Markers for has a differential distribution along the rostro-caudal the early sympathoadrenal lineage. Soc. N eurosci. Abstr. 14, 319. axis, and that the molecule is involved in specific Defreitas, M. F., Bleisch, W. V., Matthew, W. D. and synapse formation or axon guidance. In an attempt to Patterson, P. H. (l 988) Altered neurite outgrowth in mutant PC! 2 cells with reduced levels of identify molecules with such a distribution, we specific neuronal surface proteins. Soc. Neurosci. employed the immunosuppression technique. Mice Abstr. 14, 272. Nawa, H. and Patterson, P. H. (1988) Evidence for were first injected with membranes from newborn, distinct factors affecting transmitter and neuro caudal sympathetic or dorsal root ganglia, followed by peptide phenotypes. Soc. Neurosci. Abstr. 14, 302. Patterson, P. H. (1987) Molecular control of pheno injection of the immunosuppressant drug cyclo typic decisions in the sympathoadrenal lineage. phosphamide. After injection of membranes from Ann. N.Y. Acad. Sci. 493, 20-26. Patterson, P. H. (1988) On the importance of being rostral ganglia, hybridomas were generated. Many inhibited, or saying no to growth cones. Neuron 1, MAbs were produced which preferentially bind to 263-267. Pittman, R. N. and Patterson, P.H. (1987) Characteri rostral ganglia, and some of these also stain the nerves zation of an inhibitor of neuronal plasminogen that innervate intercostal muscles. The staining of activator released by heart cells; J. Neurosci. 7, 2664-2673. one of the MAbs is highest in the rostrat nerve and it Stemple, D. L., Mahanthappa, N. K. and Anderson, D. declines in a graded manner in the caudal segments. J. (1988) Basic FGF induces neuronal differen tiation, cell division, and NGF dependence in Surprisingly, this MAb appears to stain glial cell chromaffin cells: A sequence of events in surfaces rather than axons. Since glial surfaces can sympathetic development. Neuron I, 517-525. 232 Suzue, T., Imrich, J. and Patterson, P. H. (1988) criteria. This approach was necessary due to technical Monoclonal antibodies that define rostro-caudal difficulties associated with the biochemical position in the mammalian nervous system. Soc. Neurosci. Abstr. 14, 596. purification of potassium channel molecules. Central to the cloning of Shaker was that we had previously obtained and genetically mapped mutations for virtually every gene in the vicinity of Shaker. The availability of such a detailed map allowed a categorical allotment of cloned DNA segments to sites Assistant Professor: Mark A. Tanouye Research Fellows: Medha Gautam, Mathew K. either flanking or within the Shaker locus. Mathew, Jonathan D. Pollock, William W. Shaker was isolated as part of a 350 kilobase (kb) Trevarrow, Julie C. L. Tseng-Crank Graduate Students: James T. Campanelli, Alexander chromosomal walk. It is an extremely large gene Kamb, Kenneth J. McCormack, Mani Ramaswami Staff Associate: Linda E. Iverson encompassing over 100 kb of genomic DNA. Expression Research and Laboratory Staff: Ali R. Lashgari, Ross of Shaker is complex: differential processing yields at J. McMahon least nine distinct types of transcripts and Shaker could potentially encode 24 or more products. To Support: The work described in the following research reports has been supported by: provide direct evidence that Shaker encodes potassium Lucille P. Markey Charitable Trust channels, we have synthesized Shaker transcripts in The McKnight Foundation National Institutes of Health, USPHS vitro and expressed them in Xenopus oocytes. Gustavus and Louise Pfeiffer Research Different Shaker RNAs express functionally different Foundation potassium currents as assayed by electrophysiological Evelyn Sharp Fellowship Alfred P. Sloan Foundation methods. The Del E. Webb Foundation Shaker is a good example of how alternative splicing of one gene can generate a diverse number of functionally different potassium channels. lt is clear, Summary: The nervous system is the most complex however, that not all potassium channels are encoded biological tissue containing a large number of different by Shaker; it is likely that a family of genes must exist neurons which vary in structure, electrical properties, to account for the full range of potassium channel and patterns of interconnections. We are concerned types seen in the nervous system. We are interested in with basic molecular and genetic mechanisms under- defining two different ion channel gene families in lying this complexity. Our approach is to study Drosophila, the potassium channel gene family and the Drosophila genes necessary for proper nervous system sodium channel gene family. We would like to deter structure and function via a combination of method mine how many members are present in each family, ologies, classical and molecular genetics, behavior, define the range of channel functions represented in electrophysiology, and neuroanatomy. The abstracts the families, and determine evolutionary relationship presented here focus on two types of genes: 1) genes among the family members. Because of its small underlying the generation of different electrical genome, Drosophila is a good organism within which to signals, and 2) genes responsible for the development define such gene families. We have been using cDNAs and stable maintenance of neuronal connections. from potassium channel and sodium channel genes to Our study of excitable membrane function has screen genomic DNA libraries under relaxed hybridi concentrated on potassium-selective ion channels. zation stringencies to define these families. Much of the diversity in excitable membrane function Our study of neuronal connectivity developmental appears to be generated by the differential distribution genetics has concentrated on connections in the of potassium channel classes that vary greatly in a Drosophila giant fiber system. The giant fiber is a number of physiological properties. To approach the command interneuron that drives an escape response. molecular biology of potassium channels, we undertook The interneuron receives input from visual centers and the cloning of the first potassium channel structural has two major outputs. The first is to the jump muscle gene, the Drosophila Shaker gene, using genetic via a monosynaptic connection with the jump muscle 233 motoneuron; the second, a disynaptic pathway to the where variable 3' and 5' ends are spliced onto a central wing depressor muscle. Mutations that disrupt trans constant region to yield different cDNA types. mission in the giant fiber pathway to the jump muscle The diversity of Shaker cDNA 5' ends is extensive; are relatively easy to select using behavioral criteria. six different types have been observed. Three major Giant fiber system connectivity defects may then be classes account for 15 of the 21 cDNAs. Three other identified using simple electrophysiological assays. By cDNAs have unique 5' ends which may constitute isolating a large series of mutations that disrupt the additional classes. Four major classes account for 18 connection between the giant fiber and the jump of the twenty-one 3' ends. There are enough combi muscle motoneuron, one has a reasonable chance of nations of ends represented in the collection to suggest determining how the genome acts to build neuronal that the variable 5' ends may assort independently with connections, using this particular identified synapse as the variable 3' ends. an example. We have concentrated on one such The different Shaker cDNAs encode predicted mutation called bendless. proteins with distinct structural features; however, there are two basic forms of proteins. The more common form contains seven potential membrane 351. Multiple Products of the Shaker Gene spanning domains, six hydrophobic domains and one Alexander Kamb, Julie C. L. Tseng-Crank amphipathic 54 domain. The other form contains three Potassium channels are known through electro potential membrane-spanning hydrophobic domains. physiology and pharmacology to be an exceptionally Reference: diverse group of channels with individual classes that Kamb, A., Iverson, L. E. and Tanouye, M. A. (1987) Cell 50, 405-413. vary greatly in kinetics, voltage dependence, pharma cology, and other properties. We have determined that part of this variability in Drosophila apparently arises 352. Expression of A-Type Potassium Channels from Shaker cDNAs via differential processing of the Shaker gene. The Shaker gene was isolated as part of a 350 kb Linda E. Iverson, Bernardo c. Rudy 1 chromosomal walk (Kamb et al., 1987). A combination Several lines of evidence suggest that the of methods was used to identify the Shaker gene: l) Drosophila Shaker locus is the structural gene for a several genes were eliminated as candidates by P potassium channel. Voltage clamp of muscle membrane element-mediated germline transformation and inter indicates that all Shaker mutations eliminate or alter genic and intragenic recombination using restriction one class of potassium channel, the A channel. Pheno fragment length polymorphisms as markers; and 2) the types vary from mutants that completely lack A locations of Shaker mutations were determined by in current (ShKS133, Shl02, ShM, LC, W32) to mutants situ hybridization of cloned sequences to polytene that possess reduced levels of A current (ShE62, chromosomes and restriction fragment length poly ShrK0120; B55) and one mutant that shows alterations morphism analysis. in channel kinetics and voltage sensitivity (Sh5). Analysis of multiple products from the Shaker gene Structural features of predicted Shaker gene products was prompted by results from our laboratory and provide additional evidence: the deduced amino acid others that showed variability among Shaker cDNAs. sequence of Shaker cDNAs reveals a number of hydro We compared 21 Shaker cDNAs in an attempt to phobic domains indicative of a membrane-spanning understand the origin, the extent, and the significance protein, and several products contain a putative of the variability. Restriction mapping, genomic amphipathic helix (54) believed to be involved in mapping, and nucleotide sequencing showed that voltage-dependent gating of channels. Interestingly, Shaker cDNA diversity is extensive: cDNAs repre sequence analysis of Shaker cDNAs indicates that the senting at least nine distinct types are described; there gene encodes a number of distinct transcripts that are no more than three examples of any one type; and arise via an alternative splicing mechanism that may Shaker could potentially encode 24 or more different account for the diversity among some potassium products. This diversity, however, fits a simple pattern channels. 234 In this study we provide direct evidence that 353. Spatial and Temporal Expression of Shaker is a potassium channel structural gene by Alte!"""tively-Spliced Shaker Transcripts Studied By In Situ Hybridization showing that transcripts express A-type potassium currents when injected into Xenopus oocytes. Four Julie C. L. Tseng-Crank different Shaker cDNAs (H4, H37, El, and H2) were I am interested in examining whether the subcloned into the Bluescript plasmid expression mechanism of alternative splicing of Shaker RNA is vector. Capped, full-length transcripts for each of the regulated in a tissue-specific and developmental stage cDNAs were synthesized in vitro and injected into specific manner. Several observations suggest that Xenopus oocytes. Macroscopic currents were recorded this might be the case. From electrophysiological and using a two-microelectrode voltage clamp. In some pharmacological studies, different potassium channel cases single channel records were obtained with the classes are known to vary among different neuronal outside-out configuration of the patch clamp cell types and in subcellular distribution. Northern technique. blots of Shaker transcripts using head and body Transcripts from two structurally different Shaker poly(A)' RNA have suggested that the distribution of cDNAs (H4 and H37) successfully expressed distinct A various types of Shaker transcripts may be tissue type potassium currents. Both currents are voltage specific (Schwarz et al., 19&&). The expression of sensitive, activating at -4'0 to -30 mV. Potassium ions Shaker may also be regulated among the different carry the currents as indicated by tail current analysis. developmental stages, since I have done a develop The potassium channel blocker 4-aminopyridine mental Northern blot analysis showing that Shaker eliminates both currents at millimolar concentrations. transcripts are most abundant at the 96-hour pupal The currents are similar in their conductance-voltage stage. curves. Steady-state inactivation curves are similar in I am examining differential expression more their steepness and position on the voltage scale, directly using the technique of tissue in situ 3 indicating a similar voltage dependence of macro hybridization. Antisense H-labeled Shaker RNA scopic inactivation. The apparent single channel probes are prepared that correspond to specific 5' and conductance is 10-13 pS for the H4 current. 3' variable cDNA end classes. Shaker transcripts The different Shaker RNAs express A currents with containing class i and iv 3' ends are detected in the distinct kinetic properties: the time constant of cortex region of the optical lobe, central brain, and inactivation at -10 mV is 6.5 msec for the H4 current ganglia, as well as in the photoreceptor cells of the and 95 msec for the H37 current. In addition, the retina. Transcripts with class II 5' ends were also currents differ markedly in the time required to re detected in the thoracic ganglion. Preliminary results cover from inactivation. For the H4 current at 100 have shown that in neurons, transcripts containing mV, 5096 of current is recovered in 25 msec and 9596 in class iv 3' ends are most abundant in 96-hour pupae, 165 msec. The H37 current recovers much more consistent with Northern blot analysis. Expression in slowly, only 7096 of the current is recovered in 1.5 the retina in 96-hour pupae is concentrated around sec. An analysis of structure-function relationships photoreceptor cell nuclei. Later, in 1 d adults, retinal shows that the conserved central region of Shaker expression is lower and more diffuse. In muscle, weak polypeptides determines ion sensitivity, voltage expression has been detected in 96-hour pupae with dependence, and overall channel behavior, while the class i 3' probes. I have not yet detected abundant divergent amino and carboxyl termini can modify muscle expression, but such expression might be channel kinetics. expected at an earlier stage (55- to 72-hour pupal, Salkoff, 1983). 'New York University Medical Center, New York, NY. References: Salkoff, L. (1983) Cold Spring Harbor Symp. Quant. Biol. 48, 221-231. Schwarz, T. L., Tempel, B. L., Papazian, D. M., Jan, Y. N. and Jan, L. Y. (19&&) Nature 331, 137-142. 235 354. Characterization of Lethals in the Shaker References: Complex Locus of Drosophila Kamb, A., Iverson, L. E. and Tanouye, M. A. (1987) Cell 50, 405-4 !J, Medha Gautam Kirchgessner, T. G., Svenson, K. L., Lusis, A. J. and Several lethal complementation groups closely Schotz, M. C. (1987) J. Biol. Chem. 262, 8463-8466. linked to the Shaker (Sh) locus have been identified in the l 6F region of the X chromosome of Drosophila (A. 355. Drosophila Homologs of Vertebrate Sodium Ferrus, unpublished). Although these loci have not Channel Genes been well characterized, some of them have been Mani Ramaswami, Ali R. Lashgari implicated in altering membrane excitability (M. Several mutations affecting neural excitability Tanouye, unpublished). have been identified in Drosophila. Mutations that The genomic region corresponding to the expected affect specific classes of potassium channels (Shaker, positions of two of these loci, called lethal ether a go go, slowpoke and hyperkinetic) typically complementation group-2 a2J and lethal complemen cause behavioral and physiological abnormalities tation group-3 (l3), was isolated during the associated with an increase in membrane excitability. chromosomal walk to clone Sh. 12 was subsequently Conversely, most mutations that affect sodium mapped to a 8.8 kb genomic fragment by P element currents (para ts, map ts and tip-E ts) cause an overall mediated gene transfer (Kamb et al., 1987). A 4.5 kb decrease in membrane excitability. The precise transcript corresponding to the expected position of z3 functions of the genes affected by these mutations is has now been mapped to within 9 kb in that region. The unknown, but it is clear that they do affect relatively transcript appears to be developmentally regulated. specific aspects of electrical signaling in the nervous That it corresponds to l 3 will be confirmed by gene system of Drosophila. To complement these genetic transfer experiments. approaches in order to identify genes involved in mem cDNA clones corresponding to the transcript were brane excitability, we have used molecular techniques isolated from a screen of Drosophila embryonic and to identify a family of ion channel genes in Drosophila pupal cDNA libraries. The cDNAs together appear to melanogaster that are homologous to vertebrate contain DNA corresponding to the entire transcript. sodium channels. The same experiments may help to Sequencing of the cDNAs is in progress. Limited determine the diversity of sodium channel genes in a sequence data indicate that the transcript has an open "simple" organism like Drosophila. They would also reading frame that shows striking regions of homology help to further the.understanding of the structure and with members of a gene family of lipases, consisting of evolution of ion channels. several enzymes involved in the metabolism of lipo After many successive screens, we have identified proteins (Kirchgessner et al., 1987). The homology is five transcription units whose sequences are not only strongest in what corresponds to the conserved similar to a rat sodium channel mRNA but also con "central homology region" of lipases of known served in a phylogenetically distant species of sequence, and also in peptide sequences that have been Drosophila, D. virilis. We have sequenced cDNA clones implicated in lipid binding. To our knowledge this is for two of these transcription units and they both the first gene homologous to members of the lipase appear to encode distinct Drosophila sodium channels. gene family to be identified in Drosophila. From this The partial sequente of one of these transcription analysis, however, any interaction of this transcript units has been previously reported, and the gene has with Sh, or its relation to membrane excitability been named "DSC," for "Drosophila sodium channel" remains unclear. If it indeed corresponds to z3, an (Salkoff et al., 1987). We have cytogenetically examination of tissue distribution of the transcript and localized the other to map position l 4C/D on the X 1 electrophysiological analysis of flies mutated in 3 chromosome, close to the location of the gene might be an approach to finding the exact function of paralyzed (para). Mutations in para appear to this gene. specifically affect sodium channels in the central and peripheral nervous systems of Drosophila. In collaboration with Kate Loughney and Barry Ganetzky 236 at the University of Wisconsin, we have shown that tances and a stereotypic sodium channel. Potassium genomic sequences that we isolated map between channels have also been implicated in short-term chromosomal lesions that uncover para mutations. It modulation of neuronal activity and there is evidence so appears that the second gene we have cloned is for their activity being modulated by second para, and that para encodes a sodium channel. messenger systems. This diversity and plasticity make The sequence of para, predicted from the cDNA them an extremely attractive subject for study. sequence, is more closely related to the known verte Until recently, the only ion channels to be studied brate sodium channels than it is to DSC. This might at the molecular level were the voltage-gated sodium imply that two distinct sodium channel genes existed channel and the acetylcholine receptor channel. The before the divergence of vertebrate and invertebrate cloning of the Shaker gene from Drosophila melano species, and that DSC defines a subfamily of gaster in this and other labs has added a potassium vertebrate sodium channel genes that are yet to be channel to that list. We propose to use the Shaker molecularly identified. To understand the significance gene to search for other members of the potassium of the variant structure of DSC, we are going to channel gene family. Expression of these genes in analyze the kinetic properties of the DSC channel. We Xenopus laevis oocytes (see Abstract No. 352 for are now constructing a full-length cDNA for DSC. experimental detail) will be used to study the function RNA, transcribed in vitro from this construct, will be of the gene products. injected into Xenopus oocytes that are capable of We have screened genomic libraries from translating the mRNA and assembling functional Drosophila melanogaster with a Shaker cDNA probe at channels in its membrane. The currents in the oocyte reduced stringencies and obtained 23 distinct clones. membrane will be electrophysiologically analyzed Restriction digests of these clones yielded at least one (Abstract No. 352 describes these techiques in more fragment apiece that hybridized to the starting probe. detail). Of these hybridizing fragments, two have been shown We are also currently sequencing cDNA clones to be conserved in D. virilis, a distantly related species from the other three transcription units to see if they of fruitfly. Testing of the other fragments is under encode additional ion channel proteins. A detailed way. Fragments conserved in D. virilis will then be analysis of all these clones should provide further used to screen cDNA libraries. Full-length cDNAs will insights into ion channel diversity, structure and be transcribed and tested in the Xenopus oocyte function. system while being sequenced for structure-activity Reference: correlations. Salkoff, L., Butler, A., Wei, A., Scavarda, N., Giffen, Some structure-activity correlations for potassium K., !lune, C., Goodman, R. and Mandel, G. (1987) Science 237, 744-749. channels are already available in the Shaker system (see Abstract No. 352). It seems reasonable to expect that more than one type of potassium conductance is 356. Investigating Potassium Channel Genes in represented among the 23 clones we have isolated. Drosophila melanogaster Comparison of structure and activity among a series of Mathew K. Mathew closely related channels should allow the formulation Action potentials in nerve cells are generated by of working hypotheses as to the regions of the proteins rapidly increasing the permeability to sodium ions, responsible for ion selectivity, voltage sensing and which depolarizes the cells, followed by turning off the kinetics. These hypotheses can then be tested by sodium flow and turning on potassium flux to re studying the effects of making suitable modifications polarize the cell. These ionic fluxes are postulated to on the channels. It may even prove feasible to occur through protein channels that span cell mem synthesize designer channels once the various aspects branes. The precise form of the action potential can of channel structure and function are thoroughly be varied by a suitable choice of the properties of the understood. ion channels used. It turns out that most of the fine tuning uses variation in potassium channel conduc- 237 357. Analysis of the bendl08B Gene transcripts from the same gene. Thus, ben may be a gene complex or a complex gene that is differentially Kenneth J. McCormack, Ross J. McMahon, William W. Trevorrow expressed in different cells. The connectivity mutant bendless (ben), which The ben mutation maps within the deficiency putatively exerts its effects through either pathfinding HA92. We are presently attempting to locate it more or cell recognition events during development, is being accurately within this region. We have also initiated a studied in a number of ways. This mutant was first chromosomal walk to clone the gene and will generate isolated based upon its Jack of jumping behavior in breakpoint mutations in order to delimit the location response to a lights-off startle stimulus. In wild-type of the gene molecularly. flies, the cervical giant fiber (GF) extends from the A number of suppressors of ben- have previously brain to the thoracic ganglion. In the thoracic been isolated in our laboratory. Most of these act as ganglion, the GF contacts the jump muscle motor dominants and may be revertants, but two are second neuron and an interneuron which drives wing depressor site and recessives. These recessive suppressors are motor neurons. The GF also has outputs to three wing particularly interesting and will be investigated elevator muscles. This neuron, when stimulated, anatomically. drives a jump and flight response. In ben - flies, the GF We are now analyzing anatomically, behaviorally, does not make its characteristic final lateral bend and physiologically the various ben alleles to which would normally bring it into contact with the determine if the effects on different cells can be jump muscle motoneuron. As a result, the GF only dissociated. We are beginning to work on cloning the weakly stimulates the jump muscle motor neuron, gene in order to characterize its structure, understand while the other outputs remain normal (Thomas and its regulation, and determine how it influences the Wyman, 1982), indicating that ben is specifically development of neuronal connectivity between specific affecting only a subset of the outputs from the GF. cells in development. Further analysis of ben flies has shown that Reference: connectivity defects are not limited to the GF-jump Thomas, J. B. and Wyman, R. J. (1982) Nature 298, 650-651. muscle motor neuron synapse. Behaviorally, ben- flies show an abnormal preference of visible over UV light 358. Long-Term Regulation of Potassium Channels in and have an associated abnormality in some of the PCl2 Pheochromocytoma Cells by Nerve Growth axon terminals from the retina (Benzer and Tanouye, Factor unpublished). In addition, ben- flies are in general less 1 Jonathan D. Pollock, Marie Krempin , active, indicating that the gene may have other Bernardo C. Rudy 1 effects on the nervous system for which we currently PC12 cells are a clonal celJ line isolated from a have no assays. transplantable rat pheochromocytoma (Greene and Five new alleles of ben have been isolated that do Tischler, 1976), In the presence of nerve growth not complement the original ben mutation (ben 1), for factor (NGF), PCl2 cells cease cell division and jumping. These flies do not jump in response to the differentiate from chromaffin-like cells to lights-off stimulus, however the GF is physiologically sympathetic-like neurons. As PC12 cells differentiate, normal. This discrepancy may be explained by an the amount and types of sodium and calcium channels abnormality in the visual system, since flies that carry expressed change (Rudy et al., 1982; Kongsamut and the new alleles of ben seem to make abnormal photo Miller 1986). We therefore asked the question whether choices. This suggests that although the anatomy of the amount and types of potassium channels expressed the GF may be normal, that of the retinal cells may in PC12 cells is altered after long-term NGF not be. Dissociating these two different anatomical treatment. and behavioral features of the mutants would indicate A ten-day NGF treatment of PC 12 cells increased that the ben1 mutation effects either two different the net outward current fourfold without changing the closely linked genes, two different transcripts from current density. However, a significant change in the same gene, or two differentially processed potassium current kinetics is observed after a ten-day 238 treatment with NGF. Undifferentiated PC12 cells current in bFGF cells starts to activate at -50 mV and show a transient outward current that is elicited by peaks at about -10 mV. The midpoint for steady-state commands to 0 mV or greater from a holding potential inactivation of the sodium current is around -70 mV of -90 mV. The current decays by 31.3 ± 1.0296, n = and can be completely blocked with 1 µM TTX. Single 30, at the end of a 400 ms step to 30 mv. The channel recordings of sodium channel currents suggest transient component is sensitive to 200 µM TEA. We a single channel conductance of 10-11 pS. On the have identified a 21 pS channel whose ensemble other hand, 300 µM treatment with CPT-cAMP for ten average resembles the macroscopic current observed days failed to induce sodium currents. in undifferentiated cells. This transient component is These results suggest that sodium channel is a final no longer apparent in PC12 cells treated with NGF for common pathway of late gene expression induced by ten days and appears to be replaced or obfuscated by a bFGF and NGF but not cAMP. Moreover, any possible more slowly inactivating current. In these cells the elevation of cAMP by NGF or bFGF is not by itself macroscopic potassium current decays on average by sufficient for the induction of sodium channels in PC12 12.9 ± 1.896, n = 16, at the end of a 400 ms step to 30 cells. mV. We have observed a 12.5 pS channel whose References: ensemble average resembles the macroscopic current Greene, L. A. and Tischler, A. S. (1976) Proc. Natl. in NGF differentiated cells. Acad. Sci. USA 73, 2424-21'28. Leonard, D. G. B., Ziff, E. B. and Greene, L. A. (1987) References: Mol. Cell. Biol. 7, 3156-3167. Greene, L. A. and Tischler, A. S. (1976) Proc. Natl. Rudy, B., Kirchenbaum, B. and Greene, L.A. (1982) J. N eurosci. Acad. Sci. USA 73, 2424-2428. 2, 1405-1411. Neurosci. Kongsamut, S. and Miller, R. J. (1986) Proc. Natl. Rydel, R. and Green, L.A. (1987)J. 7, 3639- Acad. Sci. USA 83, 2243-2247. 3653. Rudy, B., Kirchenbaum, B. and Greene, L.A. (1982) J. 1 Neurosci. 2, 1405-1411. New York University School of Medicine, New York, NY. 1New York University School of Medicine, New York, NY. PUBLICATIONS 359. Human and Bovine bFGF But Not cAMP Induce Iverson, L. E., Kamb, A., Ramaswami, M., Tseng Sodium Channels in PCl2 Pheochromocytoma Crank, J. and Tanouye, M. A. (1987) Ion channel Cells genes. Cold Spring Harbor Laboratory Meeting on Molecular Neurobiology of Drosophila, p. 21. Jonathan D. Pollock, Bernardo C. Rudy 1 Iverson, L. E., Tanouye, M. A., Lester, H. A., Davidson, N. and Rudy, B. (1988) A-type potassium Nerve growth factor (NGF) has been previously channels expressed from Shaker locus cDNA. Proc. reported to induce neurite outgrowth and sodium Natl. Acad. Sci. USA, 85, 5723-5727. Kamb, A., Tseng-Crank, J. and Tanouye, M.A. (1988) dependent action potentials in PC12 cells (Greene and Multiple products of the Drosophila Shaker gene Tischler, 1976; Rudy et al., 1982). The effect of NGF may contribute to potassium channel diversity. Neuron, I, 421-430. on neurite outgrowth can be mimicked with human and Ramaswami, M. and Tanouye, M. A. (1988) Two bovine basic fibroblast growth factor (bFGF) (Rydel homologs of vertebrate sodium channel genes in Drosophila: Implications for channel diversity. and Greene, 1987). Other substances such as EGF and Proc. Natl. Acad. Sci. USA, submitted for cAMP lead to some of the early events elicited by publication. NGF but not to later differentiating events (Leonard et al., 1987). Since induction of sodium channels is a key feature of the late neuronal-like differentiation of PC 12 cells by NGF, we asked the question whether bFGF or cAMP also induces sodium channels in PC12 cells. A ten-day treatment of PC12 cells with either 50 ng/ml human bFGF or 10 ng/ml bovine bFGF caused neurite outgrowth and a significant increase in sodium current and sodium current density. The sodium NEUROBIOLOGY AND BEHAVIORAL BIOLOGY John M. Allman Bela Julesz Christof Koch Marianne E. Olds R. W. Sperry David C. Van Essen 2~1 Professor: John M. Allman Finally, Pat Wright has discovered a new species of Visiting Associates: Leslie Brothers, Patricia C. Wright primate, the golden bamboo lemur, Hapalemur aureus, Senior Research Fellow: Martin !. Sereno in the eastern rain forest of Madagascar. The golden Members of the Professional Staff: EveLynn McGu1nness, Francis M. Miezin bamboo lemur has a remarkable ecological and diges Graduate Students: Colin T. McDonald, David W. tive specialization in that it is capable of utilizing the Sivertsen, Humbert H. Suarez 1 Research and Laboratory Staff: Josephine Macenka rich food source provided by the new shoots of the Miriam L. Rusch, Kristi Wilson ' bamboo Cephalostachyum cf. vigueri even though this 'Computation and Neural Systems Graduate Student, food source contains high concentrations of cyanide. California Institute of Technology. 360. In Vivo Functional Localization of the Human Support: The work described in the following research Visual Cortex Using Nuclear Magnetic Resonance reports has been supported by: lmagmg and Positron Emission Tomography Biomedical Research Support Grant (NIH) Gordon Trust Bassem N. Mora', John M. Allman Lawrence. A. Hanson Foundation Nuclear magnetic resonance (NMR) imaging and Lucille P. Markey Charitable Trust National Institutes of Health, USPHS positron emission tomography (PET) were combined to Alfred P. Sloan Foundation generate a map of the human visual cortex delineating functional areas detected by PET superimposed onto anatomical areas observed by NMR. NMR imaging was Summary: In the past year we have succeeded in performed at the Huntington Medical Research combining two techniques for mapping the human Institutes in Pasadena, in collaboration with Bradley brain, positron emission tomography (PET) and nuclear and co-workers. PET images of regional cerebral magnetic resonance (NMR) imaging. This combination blood flow of the same subject were obtained at enables us to determine with greater precision the Washington University in St. Louis in collaboration sites in the brain of changes in cerebral blood flow with Raichle, Fox, Miezin and collaborators. Stimula evoked by visual stimuli. We have also used NMR tion of the visual cortex using different eccentricities imaging to identify the densely myelinated cortical of a red-and-black checkerboard annulus elicited area, MT, in the brain of a baboon, and expect that it responses in visual cortex, which were observed more will be possible to use NMR to identify area MT in the clearly following subtraction of background brain human brain. activity information (Fox et al., 1986, 1987). We have continued our studies on the development The orientation of the PET scans with respect to of cerebral cortex and have found a monoclonal various brain structures was determined from an X-ray antibody (13C3) that binds to a subset of astroglia and radiograph, taken at the time of scan with the to a population of neurons in cortical layer 5 in the subject's head in the PET scanner. This information newborn macaque monkey. This antibody may help to was used to convert the PET scans to the NMR co illuminate the interactions between astroglia and ordinate space, resulting in the alignment of the PET neurons during corticogenesis. and NMR images. In addition to responses in visual We have begun to use a new technique for tracing cortex, responses in the pulvinar area of the thalamus neural connections. The C fragment of tetanus toxin were observed (Allman et al., 1972). (TTC) retains its parent molecule's ability to cross The superposition of the PET and NMR images synapses retrogradely, but lacks its toxicity. We are allows for greater accuracy and easier interpretation able to inject a small quantity of TTC into a muscle, of the PET response locales in the brain. In addition, and within a day it travels back up the axons to the individual brain variability is taken into account using chain of neurons controlling the muscle. Using a this method, thus avoiding discrepancies arising from monoclonal antibody, the location of TTC in the brain averaging of PET responses from several individuals as can be identified using immuno-peroxidase methods. has been done in the past (Fox et al., 1986, 1987). We plan to use this technique to investigate the neural References: Allman, J.M., Kaas, J. H., Lane, R. H. and Miezin, F. control of the muscles of facial expression. M. (1972) Brain Res. 40, 291-302. 2~2 References (continued): Two patients have been reported in the literature Fox, P. T., Miezin, F. M., Allman, J.M., Van _Essen, D. with lesions that include TOPP. The first has a selec C. and Raichle, M. E. (1987) J. Neurosci. 7, 913- 922. tive impairment of perception of motion (Zihl et al., Fox, P. T ., Min tun, M. A., Raichle, M. E., Miezin, F · 1983) and the second was unable to accurately saccade M., Allman, J. M. and Van Essen, D. C. (1986) Nature 323, 806-809. to moving targets (Thurston et al., 1988). Based on the above findings, we hypothesize that TOPP corresponds 'Undergraduate, California Institute of Technology. to the location of MT in human visual cortex. 361. A Region in Human Cortex Sensitive to References: Low Contrast Moving Dots and High Temporal Kaplan, E. and Shapley, R. (1982) J, Physiol. 330, 125- Frequencies 143. Thurston, S. E., Leigh, R. J., Crawford, T., Thompson, 1 2 Francis M. Miezin, Peter T. Fox ' , A. and Kennard, C. ( 1988) Ann. N eurol. 23, 266- 1 2 3 Marcus E. Raichle ' ' , John M. Allman 273. Tootell, R. (1988) J. Neurosci., in press. MT, a cortical visual area extensively studied in Zihl, J., von Cramon, D. and Mai, N. (1983) Brain 106, monkeys, is selectively activated by low (less than 313-340. 10%) luminance contrast stimuli with relatively little Departments of . 1 Neurology ~nd Neurosurgery activation of the surrounding cortical tissue (Tootell, (Neurology) and 'Mallinckrodt Institute of Radiology, and 3 McDo~nell Center for Studies of Higher Brain 1988). The lower levels of the major pathway that Function, Washington University School of Medicine, projects to MT is also sensitive to low contrast (Kaplan St. Louis, MO. and Shapley, 1982) and is characterized by short latencies and transient responses to visual stimuli. MT 362. Secondary Discontinuities in the Retinotopic has also been implicated in the processing of Organization of Owl Monkey Visual Areas DLp, temporally varying stimuli. Consequently, it should DLi, and DLa respond to higher rates of stimulus change. Can a Martin I. Sereno, Colin T. McDonald, John M. Allman region be found in human visual cortex that possesses The representation of the upper and lower visual the response characteristics of MT? fields in carnivore and primate cortical areas are often Positron emission tomography (PET) scans were separated by a primary discontinuity at the horizontal performed at Washington University Medical School to meridian. V2, for example, is drawn into a long strip monitor neuronal response changes, as reflected by with a dorsally located lower field representation increased blood flow, while human subjects viewed a almost completely separated from a ventrally located video display. An initial group of subjects viewed a upper field representation. In the course of mapping low contrast array of dots. In each subject, both a the dorsolateral surface of the occipital lobe of owl control scan (stationary dots) and a test scan monkeys, we found several additional discontinuities in (coherently moving dots) were acquired; the two scans the cortical representation of the visual hemifield. were subtracted producing a net response image which Electrophysiological mapping experiments revealed shows the cortical responses due only to the low that the region between dorsal V2 and MT originally contrast dot pattern motion. A statistically significant identified as the lower field representation of area DL response buried in a sulcus between the temporal and actually contains three separate representations of the occipital lobes on the lateral wall of the hemisphere lower field, DLp, DLi, and DLa. We mapped this area (TOPP) is present in the net response image. in great detail, using a spacing of 200 microns or less In a second group of subjects, PET scans were ob between electrode penetrations. We noticed that tained while each subject viewed an array of flashing although reversals in receptive field sequences often lights. In each subject, a scan was obtained at each of occurred at the vertical or horizontal meridians, six flicker rates (I, 4, 8, 15, 33 and 61 Hz) and during sometimes they occurred more than 30° away from an unstimulated interval. The unstimulated scan was one of these meridians. Analysis, however, showed subtracted from each of the stimulated scans. For the that the part of the visual field between the reversal higher frequencies, a distinct punctate response is and the meridian was not, in fact, missing. Rather, it again present in the same location in TOPP (Figure 1). was often accounted for by the receptive fields from 243 an adjacent electrode track, otherwise containing receptive field sequences at a greater or lesser eccentricity (Figure 2). This suggests that the border of the visual area in the region of a non-meridian reversal is an opened-up cut in the quadrant representation that runs perpen dicular to the meridian, approximately along an iso- eccentricity line. These secondary discontinuities occur at similar points in the visual field in adjoining areas, suggesting that they may reflect developmental constraints in tiling together a large number of visual areas. Thus, the multiple visual areas in extrastriate cortex are still characterized by precise local retinotopic ordering, but seem more content to allow multiple discontinuities between retinotopic patches as one progresses further into the system. FIXATION 32Hz 60Hz STROBE BRAIN MAP FROM TALAIRACH ET. AL., ATLAS OF STEREOTAXIC ANATOMY OF THE TELENCEPHALON. PARIS, 1967. Figure 1. The anatomical locations for three cortical responses obtained using positron emission tomography (PET) are displayed on a lateral view of the left hemisphere of the human brain. The star denotes the cortical location for a response focus when the subject viewed low contrast moving dots. The bullet marks the focu~ location when viewing a pattern that is flashing at a high rate. Notice the close correspondence between the locations of the two foci. Both of these responses are discussed in an accompanying abstract (see Abstract No. 361) and both are actually buried in a sulcus and not on the lateral surface of the hemisphere. The triangl< corresponds to the location of a superior parietal response activated during fixation on a target and also during volitional saccades in the dark (Biology 1987, Abstract No. 312). Superimposed on the brain outline are the approximate locations of Brodmann's cortical areas. The intersections of the thick horizontal line and two thick vertical lines denote the locations of the anterior anc posterior commissures which determine the stereotactic coordinate system used in these studies. This work wa~ done at the Washington University Medical School in collaboration with Peter Fox and Marcus Raichle. 244 to see structure-from-dot-motion suggests that the o1'.''* J' I I \ A g I 1 I visual system requires patterned input from the visual 0 I I l ~~..... world in order to properly organize itself. It has rarely \ t,.?: \ \ f~:' )011;.1: been doubted that the visual system must experience § : ' I \ I ~·~o~~--- 0 I 1) " ~~ ') §~lJ complex artificial visual stimuli-like chairs in order to g ' \('' ' ' - .g ; i: "K1 - be able to visually recognize them. However, the g~· .. o I 1 I o l 1 I visual system may also learn lower-level "natural 8 I r I *N':o I I '-.LY g r l I I g I I I constraints" by example. ~ One problem for the visual system-the so-called VISUAL CORTICAL FIELD AREA "aperture problem"-is to recognize the true direction of pattern motion using local detectors that are only capable of detecting the component of motion perpen B dicular to the orientation of the moving edge, which is often not the same as the pattern direction. To test whether unsupervised learning might be sufficient to solve this problem, I constructed a feedforward net work model with several consecutive layers, each of - which projects in a topographic fashion (with a .rN.' gaussian divergence) to the next layer. Each between ' ' S g0 t' i ' I layer synapse is updated according to a simple multi plicative Hebb rule. The model is similar to the CORTICAL orientation model of Linsker, except that I model all ELECTRODE RF SEQUENCES TRACKS IN VISUAL FIELD cells explicitly and apply a non-random input. The input consisted of a set of stimuli, each of Figure 2. Schematic illustration of secondary which was a full-field set of oriented contours at discontinuities in the cortical representation of the lower visual hemifield in the owl monkey. In A, the random orientations moving in a particular direction. transformation from the lower visual field to its The units in the input layer were given direction and cortical representation is illustrated in two stages. The first stage shows the effect of the expanded speed tuning curves similar to those recorded from VI representation of the center of gaze. This results in cells in layer 4B that project to V2 and MT. Starting the vertical meridian (small circles) coming to lie parallel to the horizontal meridian (thick dashes). The with small random weights, the network was trained on second stage shows how secondary discontinuities hundreds of such patterns, until most weights were might arise as "pulled open" cuts in a continuous representation. Notice that no part of the lower visual near maximal values. A proportion of the units in the field representation is lost. In B, five electrode tracks second layers show the same tuning curve peak to across such a cortical area are illustrated along with the expected sequence of visual receptive fields from gratings as to plaids, resembling pattern-direction a series of recording sites in each track. selective units, which only appear in primate MT. Successful learning required that the effects of 363. Learning the Solution to the Aperture Problem direction tuning predominate over the effects of speed for Pattern Motion with a Hebb Rule tuning in the input unit outputs. Martin I. Sereno Some response properties of neurons in primary 364. A Novel Primate Astroglial Marker: Immunocytochemical Characterization visual cortex, e.g., orientation selectivity, are known to arise spontaneously in utero without patterned Colin T. McDonald, John M. Allman visual experience. Less is known about the develop We report here on a novel marker, monoclonal ment of visual responses in areas beyond VI. Evidence antibody (MAb) 13C3, which labels a subset of that several months of binocular deprivation after astroglia in the newborn and adult macaque central birth in monkeys produces permanent behavioral blind nervous system, along with a subset of neurons ness and that human babies of less than 6 months fail transiently expressing the antigen in the newborn 245 cerebral cortex (see Table 1). of astrocytes, MAb 13C3 further underscores the bio chemical heterogeneity of primate neuroglia and may serve as a developmental probe to assay that subset of Table 1 glial progenitors destined to become the astrocytes of Comparison of Glial Antibody Staining in layer 1 and the white matter of primate cerebral Primate Cerebral Cortex cortex. Finally, the transient staining of a neuronal subset during development may help to illuminate the MAb 13C3 anti-Vimentin anti-GFAP interactions between glial cells and neurons during corticogenesis. Blood vessels + ++ Lepto-meningeal + ++ References: cells and fibers Matthew, W. D. and Patterson, P. H. (1983) Cold Spring Harbor Symp. Quant. Biol. XLVIII, 625-631. Bergmann glia + ++ ++ McDonald, C. T., Thai, T. and Allman, J. M. (1986) (cerebellum) Soc. Neurosci. Abstr. 12, 130. White matter + ++ astrocytes 365. Monoclonal Antibodies as Markers of Layer 1 fibers + + + Cortical Connectivity Layer 2 cells ++ ++ Colin T. McDonald, John M. Allman Cortical plate ++ astrocytes In the previous abstract, we described a MAb fusion Layer 4/5 neuron + using adult macaque striate cortex as the primary (newborn) immunogen. We report here on the further characteri zation of a second marker from this fusion, MAb 6C2, MAb 13C3, generated in an earlier fusion using which labels in the adult primate cerebral cortex, the newborn (PO) macaque striate cortex as the primary membranes of a subset of neuronal fibers with a immunogen and a modification of the immuno discrete laminar specificity. suppression protocol of Matthe.w and Patterson (1983), In the adult macaque cortex, immunoreactive recognizes in the newborn and adult cerebral cortex an fibers are seen in a tangential band in the upper antigen associated with the membranes of astrocytes portion of layer 1 with very little label seen in the in the underlying white matter as well as cells and lower portion of layer 1 and layer 2. Immunoreactive fibers in cortical layer I. Unlike anti-GFAP fibers are arrayed in a radial fashion in the lower (Boehringer), MAb 13C3 does not appear to recognize layers of cerebral cortex with the heaviest labeling the numerous astrocytes present within the cortical seen in layer 3. In cerebellar cortex, punctate profiles plate. MAb L3C3 does, however, stain a vimentin are observed throughout the granule cell layer, around positive, GFAP-negative population of lepto-meningeal the Purkinge cells and extending only to the deepest cells and fibers. portions of the molecular layer. MAb 13C3 also recognizes the membranes of a In contrast to the adult situation, the newborn subset of neurons in layers 4 and 5 in many parts of macaque shows MAb 6C2 staining confined to the newborn cerebral cortex. This antigen does not appear white matter underlying cerebral cortex, with to be recognized on these cells in the adult macaque, immunoreactive fibers seen infrequently in the lowest suggesting that it is either downregulated or modified layers of cortex. In advantageous sections, MAb 6C2 sometime after birth. is clearly seen staining a subset of fibers in the A previous fusion, using adult macaque striate underlying white matter. The newborn macaque cortex as the primary immunogen, demonstrated the cerebellum shows a staining pattern similar to the existence of an antigen (MAb 6F2) present in the glial adult condition. fibers of layer 1 in the primate cerebral cortex along At birth, the fibers of the thalamo-cortical tracts with a transient fiber population associated with the have already assumed their adult positions in the germinal zone below cortex in the infant monkey vertebrate cerebral cortex after having undergone an (McDonald et al., 1986). With specificity to a subset extensive waiting period in the underlying white 2% matter (Shatz and Luskin, 1986), Therefore, MAb 6C2 two synapses. The major problem with this technique marks a second population of late arriving cortical is that it can be difficult to differentiate between fibers, possibly long association fibers, and so may be a simple transneuronal transport and transport across good candidate to assay the genesis of cortical more than one synapse. Used in conjunction with other connectivity in the early postnatal monkey. anatomical tracing methods, however, this should prove to be an extremely useful technique. Reference: Shatz, C. J, and Luskin, M. B. (1986) J. Neurosci. 6, The research described above is part of a long-term 3655-3668. project to map out the representation of the facial muscles in the primate brain. We are using rats to 366. Transneuronal Retrograde Transport of Tetanus Toxin C Fragment from Injections in the Facial perfect the methodology, but will eventually perform Muscles similar experiments on primates in combination with EveLynn McGuinness, John M. Allman small injections to the facial nucleus itself. In earlier The C fragment of tetanus toxin (TTC) retains the work in this lab, we mapped motor cortex in macaque parent molecule's ability to cross synapses but lacks its monkeys using microstimulation and studied the repre toxicity. We are able to inject a small quantity of sentation of the facial muscles in the brainstem facial concentrated TTC into a muscle or brain region, and nucleus using other anatomical techniques. within a short period of time it travels back up axons Reference: and collects in neurons at several levels in the system. Evinger, C. and Erichsen, J, T. (1986) Brain Res. 380, 383-388. Using the monoclonal antibody to TTC developed by Evinger and Erichsen (1986), its locations in the brain can be identified using immune-peroxidase techniques. 367. Single Neuron Responses to Socially Relevant Stimuli in Monkeys In this study, we injected the vibrissal region of the rat face with TTC. Following a 24.-hour survival Leslie Brothers, EveLynn McGuinness, John M. Allman period, the rats were perfused with 4% paraformalde The Primate order has evolved complex social hyde, the brains sectioned at 40 ll and reacted with the structures, necessitating a highly developed ability to antibody which we obtained from Evinger. In all cases, perceive and respond correctly to social signals of con dense labeling was seen in the lateral and, to a lesser specifics. Neurons in the superior temporal sulcus and extent, intermediate region of the facial nucleus ipsi amygdala of alert macaque monkeys have been shown lateral to the injection site; neurons in the motor to respond selectively to pictures of specific physical nucleus of the trigeminal nerve, which control nearby features of other monkeys, especially to faces, and in jaw-closing muscles, were also often labeled. The. some cases to modify their responses when facial densest labeling of neurons from trans-synaptic trans expression varies. The detection of facial expression port was seen throughout the reticular formation; is assumed to be relevant to the interpretation of clearly labeled cells were also seen in the nucleus of emotional signals, a capacity that is highly developed the solitary tract, mesencephalic trigeminal nucleus, in humans but whose neurophysiological basis is and principal sensory trigeminal nucleus ventrolateral. unknown. In addition, scattered but clearly labeled cells were We have prepared a laser disk from videotapes of seen in the central grey; and diffuse transport, which an outdoor colony of macaques. The disk contains a was not obviously in neurons, was seen in the inter large variety of postures, expressions, movements and ocular nuclei. In some cases there was dense labeling physical features of monkeys of various ages and both of neurons in the contralateral red nucleus, and in sexes. Stimulus sets and individual stimulus segments other cases the labeling was lighter and more diffuse. are able to be modified over a wide range during Most surprising was the consistent light-to-medium recording sessions, so as to maximally probe cell labeling of neurons in the portion of motor cortex response characteristics. In addition, we are using a corresponding to the vibrissal representation. This new, non-invasive method for the detection of eye projection is mediated by neurons in the reticular position and pupil size: calculations performed on a formation, and the TTC molecule presumably crossed CCD-detected image of the pupil yield two- 247 dimensional eye position to within two minutes of arc Possible advantages for a change in activity pattern and pupil diameter to within one-one hundredth of a could be avoidance of predators, avoidance of severe millimeter of accuracy. weather conditions, access to more food. The diel During stimulus presentation, single unit activity pattern was seen in both fruit eaters and bamboo will be recorded from amygdala and temporal cortical eaters of a medium body weight (2 kg). The nocturnal regions. Analysis of the data will focus on I) unit primates were small, weighing between 60 grams and l response characteristics to a wide variety of social kg, but ate a variety of foods from insects to leaves. stimuli, including vocalizations; 2) response selectivity The largest lemur was diurnal and ate leaves and for emotional expressions; and 3) the participation of fruits, but the other, strictly diurnal lemur weighed l autonomic changes, as reflected in pupil size changes, kg. The food eaten most often at night by the die! in the perception of emotional content of stimuli. species were flowers and nectar in large trees that gave no protection from hawks and eagles during the 368. Circadian Rhythms of Rain Forest Lemurs in day. The reason that these previously described as Madagascar "diurnal" lemurs can forage at night is that they have a Patricia C. Wright Tapetum lucidum. This visual asset allows them the My recent field work in Madagascar during the cold flexibility to choose their activity periods according to winter months documented that within the community varying ecological conditions. Further field studies of 11 sympatric lemur species there are four types of may determine why some of these species are diel, activity patterns. In the field site at Ranomafana, two while others are less flexible, despite the fact that all species are strictly diurnal, three species are strictly have a Tape tum lucidum. nocturnal, four species are diel (active six hours during the day and six hours during the night), one species 369. The Consumption of Cyanogenic Bamboo by a goes into torpor for four months, and the last species Newly Discovered Species of Bamboo Lemur has not yet been studied. Patricia C. Wright In 1986 and 1987 we observed six of the 11 species In 1987 three species of bamboo-eating lemurs for 24-hour observation periods. The largest species (8 were found to be sympatric in the southeastern rain kg), the diademed sifaka, began its activity at 0800 forest of Madagascar. Sympatric species usually differ hours, rested for 1.5 hours midday, and ceased activity in body size, habitat utilization, or diet, but these at 1700 hours. The other diurnal species was the gray, three closely related lemurs have approximately the gentle bamboo lemur (1 kg) which began activity at same body mass, live in the same strata of the habitat, 0630, rested 2.5 hours midday, and stopped activity at and all consume bamboo. An investigation of the niche 1730 hours. No nocturnal activity was observed. The separation of these three species revealed that all woolly lemur (1 kg) was nocturnal, beginning activity three were eating two of the five species of bamboo in after sunset, foraging on leaves until midnight, resting the region. However, each lemur species was feeding for three hours, foraging until predawn. No daytime on different plant parts. The greater bamboo lemur activity was seen. The four remaining species (Hapa!emur simus) eats the pith of the mature culms studied-the golden bamboo lemur, the greater bamboo (stalks) of Cephalostachyum cf. vigueri. The gray, lemur, the red-fronted lemur, and the red-bellied gentle bamboo lemur (Hapalernur griseus) eats the leaf lemur-began activity before dawn (0430 hours), and bases of a closely related bamboo, C. perrieri. The foraged and traveled until 1030 hours. Activity ceased golden bamboo lemur (Hapa!ernur aureus), first until about 1630 hours. Between 1630 and 2230 hours, described as a new species by us in 1987, consumes the the animals fed and traveled again. soft, white tissue located beneath the sheaths of new In non-human, primate communities in Asia, Africa shoots and the growing tips of the bamboo plants (C. and the Americas, two types of circadian rhythm cf. vigueri). (nocturnal and diurnal) occur. I began this investigation A chemical and nutritional analysis was done on to discover what ecological factors would select for different parts of the bamboo. The culm pith of the two additional lifestyles--diel and winter torpor. bamboo is extremely fibrous and contains 3-5% pro- 248 tein. The leaves contain 13-15% protein, and the new Allman, J. M. (1988) Primate visual cortex. In: Comparative Primate Biology, Vol. 4, The Neuro shoots contain 26-30% protein. The amino acid content sciences, Steklis, H. and Erwin, J. (Eds.), Alan R. of bamboo shoots is well balanced, except for the Liss, New York, pp. 279-326. Allman, J. M., McDonald, C. T. and Sereno, M. I. especially low content of the sulfur containing amino (1987) Multiple visual areas between V2 and MT in acid methionine. In addition to these nutritional the owl monkey. Soc. Neurosci. Abstr. 13, 625. Allman, J. M., McDonald, C. T. and Sereno, M. I. differences, the portions of C. cf. vigueri eaten (1988) Myeloarchitecture of human extrastriate exclusively by the golden bamboo lemur (Hapalemur cortex: Possible location of area MT. Manuscript in preparation. aureus) contained cyanogenic glycosides. Allman, J. M., McDonald, C. T. and Sereno, M. I. As indicated by the Feig! Anger test, the material (1988) Organization of owl monkey extrastriate cortex. Manuscript in preparation. eaten by Hapalemur aureus is strongly cyanogenic. Allman, J. M., Miezin, F. and McGuinness, E. (1988) The free hydrogen cyanide content of the soft stem The effects of background motion on the responses of neurons in the first and second visual areas (V-1 and growing tip material of C. cf. vigueri eaten by and V-Il). In: Signal and Sense, a symposium of the golden bamboo lemurs in May, and again in December, Neuroscience Research Program, accepted for publication. 1987, was 15 mg/100 g fresh weight as determined by Fox, P. T., Miezin, F. M., Allman, J.M., Van Essen, D. extraction in the field and subsequent colorimetric C. and Raichle, M. E. (1987) Retinotopic organi zation of human visual cortex mapped with positron determination of hydrogen cyanide in the laboratory. emission tomography. J. N eurosci. 7, 913-922. Neither the mature culms nor the leaves of any of the Fox, P., Petersen, S., Miezin, F., Raichle, M. and Allman, J. (1987) Superior parietal cortical activa five species of bamboo tested contained cyanide. tion during visual and oculomotor tasks measured My field observations indicate that individuals of with averaged PET images. Association for Research in Vision and Opthalmology, supplement the golden bamboo lemur eat 800 grams per day of new to Investigative Ophthalmology 28, 315. shoots of bamboo, or more than 40-200 times the Glander, K., Wright, P., Seigler, D., Randrianasolo, V. and Randrianasolo, B. (1988) Consumption of lethal dosage of cyanide for a human (scaled for body cyanogenic bamboo by a newly discovered species mass). Investigations of mechanisms of detoxification of bamboo lemur. Science, submitted for publication. will begin this year. The other two species of bamboo Kay, R., Plarcan, M., Glander, K. and Wright, P. (1988) eating lemur were never observed to eat the cyanide Sexual selection in New World monkeys. Am. J. Phys. Anthropol., in press. containing shoots. Koop, B., Siemieniak, D., Slightam, G., Goodman, M., Bamboo is a plentiful resource, but relatively few Dunbar, J., Wright, P. and Simons, E. (1988) Tarsius delta and beta globin genes: Conversions, evolution mammals and no other prosimian primates utilize it and systematic implications. J. Biol. Chem., in for food. These three lemur species have specialized press. McNab, B. K. and Wright, P. C. (1987) Temperature to the extent of dividing up the bamboo-eating niche regulation and oxygen consumption in the based on the chemical and nutrient content of plant Phillippine tarsier (Tarsius syrichta). Physiol. Zoo!. 60, 596-600. parts. Niche partitioning at such a fine-tuned physio Meier, B., Rumpler, Y., Peyrieras, A., Albignac, R. and logical level has rarely been reported in primates. Wright, P. (1987) A new species of Hapalemur in southeastern Madagascar. Folia primatalogia 48, 211-215. Miezin, F. M., Fox, P. T ., Raichle, M. E. and Allman, J. M. (1987) Localized responses to low contrast PUBLICATIONS moving random dot patterns in human visual cortex monitored with positron emission tomography. Soc. Allman, J. M. (1987) Evolution of the brain in Neurosci. Abstr. 13, 631. primates. In: Oxford Companion to the Mind, Miezin, F. M., Fox, P. T., Raichle, M. E. and Allman, Gregory, R. (Ed.), Oxford University Press, Oxford, J.M. (1988) An extrastriate region in human visual pp. 633-639. cortex sensitive to low contrast moving dots and Allman, J. M. (1987) Maps in context: Some analogies high temporal frequencies. Association for between visual cortical and genetic maps. In: Research in Vision and Ophthalmology, p. 326. Matters of Intelligence, Vaina, L. (Ed.), Reidel, Miezin, F. M., Petersen, S. E. and Allman, J. M. (1987) Holland, pp. 347-371. Segregation of information flow in four extra Allman, J. M. (1987) Visual system, organization. In: striate areas of the owl monkey. Association for Encyclopedia of Neuroscience, Adelman, G. (Ed.), Research in Vision and Opthalmology, supplement Vol. 2, Birkhauser, Boston, pp. 1283-1287. to Investigative Ophthalmology 28, 124. Allman, J. M. (1988) Variations in visual cortex Peterson, S. E., Miezin, F. M. and Allman, J. M. (1988) organization in primates. In: Neurobiology of Transient and sustained responses in four extra Neocortex, Rakic, P. and Singer, W. (Eds.), Dahlem striate visual areas of the owl monkey. E:rp. Brain Conference, Berlin, pp. 29-40. Res. 70, 55-60. 249 Royden, C., Baker, J, and Allman, J, (1988) Illusions of preattentive texture discrimination, using textures of depth produced by moving random dots. Perception, accepted for publication. constrained stochastic properties. Sereno, M. I. (l 987) The visual system. In: While most of these studies are done psycho Organization of Neural Networks, Seelen, I. W. v., Leinhos, U. M. and Shaw, G. (Eds.), Weinheim, physically in our group at Caltech and at AT&T Bell VCH Verlagsgesellschaft, pp. 176-184. Laboratories, some of the texture discrimination work Sereno, M. I. (1988) Review of J. Young, Philosophy z. extends to the searching for texton gradient detectors and the Brain. Quarterly Review of Biology 63, 115-116. in various cortical areas of the monkey in Sereno, M. I, (1988) Connectionism needs a theory of concept assembly in working memory. collaboration with Prof. D. Van Essen's group. (Commentary on Smolensky, in Behavioral and Brain Sciences, in press. Sereno, M. I. (1988) Four analogies between biological 370. Texton Theory of Preattentive Vision and cultural/linguistic evolution. Biology and Bela Julesz, Ben J. A. Krase Philosophy, submitted for publication. Sereno, M. !., McDonald, C. T. and Allman, J, M. In recent years we showed (Julesz, 1981; 1986; (1987) Multiple visual areas between V2 and MT in Julesz and Bergen, 1983) that preattentive (i.e., the owl monkey. Soc. Neurosci. Abstr. 13, 625. Sereno, M. I. and Ulinski, P. S. (1987) Caudal topo scrutiny-free) discrimination of textures is often based graphic nucleus isthmi and the rostral non on the spatial density variation of a few local features topographic nucleus isthmi in the turtle, Pseudemys scripta. J. Comp. N eurol. 261, 319-346. (called textons). The main textons are elongated Wright, P., Daniels, P., Overdorf!, D., Meyers, D. and Rabeson, B. ( 1987) A census and study of blobs, particularly line segments, with certain Hapalemur and Propithecus in southeastern attributes such as contrast, orientation, width, length, Madagascar. Primate Conservation 8, 84-88. Wright, P. C., Haring, D., Izard, M. K. and Simons, E. etc. The preattentive system cannot perceive the L. (1988) Nocturnal primates in captivity. In: positional relations between these textons, but instead Psychological Well Being of Primates in Captivity, Segal, E. and Scollay, P. (Eds.), in press. detects differences between adjacent textons (texton Wright, P ., Simons, E. and Andan, P. ( 1987) gradients) and may direct a narrow search-light of Conservation perspectives. Primate Conservation attention to these gradients, provided that these 8, 51-54. gradients are large. Current interest is to study the nature of the textons and to which extent these textons can be extracted by spatial filters. References: Julesz, B. (l 981) Nature 290, 91-97. Visiting Professor: Bela Julesz Julesz, B. (1986) Biological Cybernetics 54, 245-25!. Research Fellow: Ben J, A. Krose Julesz, B. and Bergen, J. R. (1983) Bell Syst. Tech. J. Research and Laboratory Staff: Pravin Tulachan 62, 1612-1643. Support: The work described in the following research reports has been supported by: 371. The Control and Speed of Shifts of Attention AT&T Bell Laboratories Fairchild Scholars Program Ben J. A. Krase, Bela Julesz MacArthur Foundation It is often conjectured that, in order to detect an Department of the Navy, Office of Naval Research inconspicuous target pattern in a display of background patterns (such as a "T" among "L"s), the observer uses an attentive mechanism that serially processes each Summary: Our group is interested in the processing of element in the display (Treisman and Gelade, 1980; information by the human visual system. Psycho Bergen and Julesz, 1983). We measured the detect physical experiments over 25 years at Bell ability of a target pattern (a "T") in a display Laboratories and now simultaneously at Caltech are consisting of 12 elements ("L "s) in a circle around the conducted to study early human vision using computer central fixation point. The display was briefly generated stimuli. Investigations cover two main presented and after a variable time followed by a topics: l) the study of binocular depth and monocular mask. Performance increased with mask delay, which movement perception using random-dot stereograms may indicate a fast serial, attentive-processing and cinematograms; 2) the development of a theory of mechanism for target detection. To study the nature 250 of this mechanism, we carried out a series of experi presence of even a single distractor elevated RTs. ments. We found that presenting a pre-cue, which This effect depended on the distance of the distractor designates the target position, facilitates target from the target. This lateral interaction between detectability. Attention is directed to the cued target and distractor increased with increasing number location. When the observer has to detect a (second) of distractors. If the target was surrounded by more target among the non-cued elements, performance at distractors, at distances outside the range of lateral locations close to the cue is not significantly different interactions, then RT was further elevated, indicating from performance at locations further away. that the position of the target was no longer known Apparently, there is no "scan-path" or proximity_ with certainty - despite the image stabilization. effect. We also found that the identification of the References: cued element delayed the detectability of the target Eriksen, B. A. and Eriksen, C. W. (1974) Perception and with more than 160 ms. In another series of experi Psychophysics 16, 143-149. Treisman, A. M. and Gelade, G. (l 980) Cognitive ments, we studied the control of attentional shifts. Psychology 12, 97-136. We found that, for short mask delays (lOO, 160 and 260 1Visual Sciences Program, SRI International, Menlo ms) the observer is unable to selectively process Park, CA. elements that are not physically cued but defined by their position relative to the cue. When we increase PUBLICATIONS the positional uncertainty of the target by increasing the number of cues, performance drops up till five Julesz, B. and Krase, B. J. A. (l 988) Visual texture elements but levels out afterwards. We infer that, perception: Features and spatial filters. Nature 333, 302-303. even though the target is very similar to the back Julesz, B. and Papathomas, T. V. (1988) Asymmetries -ground, a parallel mechanism for the extraction of in binocular motion perception from disparity and rivalry differences. Supplement to Investigative stimulus features designates prospective target Ophthalmology and Visual Science 29, 266 (Abstract). locations which may be subsequently checked by a Krase, B. J. A. and Julesz, B. ( l 988) Evidence against (slow) attentional process. rapid voluntary shifts of attention to non-cued target locations in a visual search task. References: Supplement to Investigative Ophthalmology and Bergen, J. R. and Julesz, B. (1983) Nature 303, 696- Visual Science 29, 400 (Abstract). 698. Smets, G. J. F., Stappers, P. J. and Krase, B. J. A. Treisman, A. M. and Gelade, G. (l 980) Cognitive (l 988) Form detection: Features or invariance. Psychology 12, 97-136. Perceptual and Motor Skills, in press. 372. Spatial Interactions in Rapid Pattern Discrimination Ben J. A. KrOse, Christina A. Burbeck1 A decreasing performance with increasing number Assistant Professor of Biology & Engineering and of display elements in a visual search task is often Applied Science: Christof Koch 1 1 Graduate Students: Chong Chen , John G. Harris , considered as a strong indication for a serial 1 2 Andrew J. Moore , Frank A. Perez processing mechanism (Treisman and Gelade, l 980). Special Graduate Student: Michael D. Speight However, even if the target is presented at a fixed Research and Laboratory Staff: Mathew J. Avalos, Nigel Goddard, Jin Luo, John Uhley, Udo position, the addition of distractor elements on the Wehmeier, Walter M. Yamada III display appears to affect the performance (Eriksen and 'Computation and Neural Systems Graduate Student, Eriksen, l 974). California Institute of Technology. 2 We measured reaction times (RTs) for identifi Division of Engineering and Applied Science, California Institute of Technology. cation of a target among distractors under stabilized image conditions in which the positions of the target Support: The work described in the following research and the distractors were constant within a single reports has been supported by: experimental session, meaning that the observer did Biomedical Research Support Grant (NIH) Directors Developmental Fund, JPL not need to search for the target. We found that the Hughes Aircraft Fellowship 251 Support (continued): extending the use of the line processes technique to Joint Tactical Fusion Program the problem of computing optical flow in the presence National Science F ounda tion Department of the Navy, Office of of numerous moving objects. On the basis of a Naval Research powerful mathematical technique (Markov Random Ralph M. Parsons Foundation Charles Lee Powell Foundation Fields), it can be shown that these problems can Rockwell International always be formulated in terms of optimization Alfred P. Sloan Foundation problems which can be mapped onto simple electrical networks with local connections and a mixed analog and hybrid hardware. We are collaborating with Prof. Summary: Work in my laboratory is concerned with Carver Mead in Computer Science (Division of two different but related topics. Work on the "bio Engineering and Applied Science, Caltech) to physics of computation" seeks to enumerate, simulate, implement these networks in VLSI circuits using analog and understand the different biophysical mechanisms sub threshold cMOS technology. We are also starting a underlying information processing in the nervous robotics laboratory (with special purpose, real-time system. For instance, detailed computer simulations of image processing hardware and a roving robot). Its simple vertebrate cells, based on voltage- and current major emphasis is on designing a network-based vision clamp data, lead to a better understanding of how system for navigation of an autonomous vehicle. The these cells process the incoming synaptic signals and Jet Propulsion Laboratory is drawing up detailed pattern their output accordingly. Studying specific mission plans for such a vehicle to navigate semi computations in the nervous system, e.g., direction autonomously the surface of the planet Mars in the selectivity in the retina, LTP in the hippocampus or late 1990s. the function of the cortico-geniculate feedback, via computer simulations leads to a number of predictions 373. Computing Optical Flow in the Primate's Visual System: A Network Model that can be tested physiologically. Collaborations with experimentalists are therefore essential for this Christo{ Koch, Taichi Wang 1 , Bimal Mathur 1 approach, lest it looses its biological relevance. Computing motion on the basis of the time-varying Current projects include studying the integrative intensity brightness is an important but difficult properties of single vertebrate cells (bullfrog problem for both artificial intelligence and biological sympathetic ganglion cells, rodent CAI and CA3 vision. We here map a classical computer vision hippocampal pyramidal cells and both in vitro and in motion algorithm onto the primate's visual system. vivo cells in the cat lateral geniculate nucleus) with The aperture problem is solved by a smoothness special emphasis on free, intracellular calcium; we are constraint: the final optical flow should be I) currently building models of single cells on parallel compatible with the measured data, and 2) the machines of the Hypercube type (with up to 1024 smoothest in a certain sense. Direction-sensitive cells powerful processors). At the system level, we are in V l use the time derivative of the retinal image studying the computations underlying motion and convolved with a Difference-of-Gaussians receptive disparity selectivity in the cat and primate cortex and field to compute local velocity estimates (component studying the function and implementation of selective selectivity). Sixteen cells at each location code for visual attention (via psychophysics, physiology, and motion in 16 different directions. In a second stage, models). assumed to be located in the deep layers of area MT, The second major research effort in my laboratory the smoothness constraint is used to compute the involves the analysis of early vision from a compu smoothest optical flow. The resulting network is tational point of view. Tasks such as detecting motion implemented using simple threshold neurons and a and computing depth and color seem effortless to us population coding scheme: the final optical flow is but are quite difficult to reproduce on a machine. obtained by a weighted average of the vector Based on earlier work done at MIT's Artificial contributions from the 16 cells coding for different Intelligence Laboratory (regularization theory), we are directions of motion in each location. 252 If a plaid pattern, consisting of two gratings activation and inactivation values of both sodium moving at right angles to each other, is projected onto currents as well as the geometry of the axon. This the retina, cells in the model MT respond to the represents yet the most detailed model of the resultant coherent motion (pattern selectivity), in electrical properties of a nerve cell. agreement with psychophysical and electro 'Howard Hughes Medical [nstitute, SUNY at Stony physiological studies. Our system also displays motion Brook, NY. capture: the motion of random dots is perceptually captured by a nearby moving grating and other visual illusions, such as motion coherence and y-motion. Depending on stimulus conditions, our MT cells can l c respond to motion both perpendicular and parallel to the moving contour, suggesting that the type I and type II cells reported by T. Albright in MT represent a continuum of cells. 1Science Center, Rockwell International, Thousand Oaks, CA. Pericxonal Membrane Space 374. Modelling Electrical Excitability in the Cell Body and Axon of Type B Bullfrog Sympathetic Ganglion Cells l ntracel lular Space Walter M. Yamada, Christof Koch, Paul R. Adams 1 Buffer Using conventional microelectrode techniques, seven voltage-, calcium-, and time-dependent currents Ionic Channels have been characterized in type B sympathetic and Pumps ganglion cells. Previously, we presented an electrical model of these cells based on voltage-clamp data. The model incorporates all seven ionic currents as well as Figure I. Electrical and geometrical layout of the cell calcium diffusion, buffering and pumping, and body of a type B, bullfrog sympathetic ganglion cell. describes the electrical behavior of these cells under Eight distinct channels are modeled as well as the diffusion, pumping and binding of calcium. various protocols (e.g., current clamp, hybrid clamp) (Figure 1). 375. Measuring Velocity Discrimination Thresholds Several outstanding problems remain. In particular, under the assumption of a spherical soma, the experi Teri B. Lawton 1 , Carlos Ramirez 2 , Christo( Koch mentally measured value of whole cell capacity The two major models for computing motion on the corresponds to an anomalously high value of specific basis of the time-varying intensity, correlation or membrane capacity (8 µF /cm2). Furthermore, patch second-order models and gradient models, predict clamp data support the notion of two distinct different responses to moving sine gratings of varying populations of sodium channels, one in the cell body contrast. For small contrast values, Reichardt-type proper with a high voltage threshold for action correlation models predict a quadratic dependence of potential generation and an axonal sodium current with the response on stimulus contrast. We used drifting a much lower threshold. Accordingly, we added an "n sine gratings, projected onto a monitor, to determine compartment" nonmyelinated axon to our cell body the temporal-frequency needed to see drifting test which includes the sodium and delayed-rectifying gratings moving faster than a comparison sine grating potassium and currents characterized by of the same spatial frequency. The contrast of the Frankenhaeuser and Huxley in the frog node of gratings was varied between I and 2096. Test and Ranvier. Timing of axonal and somatic action comparison patterns were presented for 200 msec to potentials was studied by varying the midpoint prevent eye movements. For 5 and 10 eye/sec, 253 velocity discrimination thresholds were independent of contrast. For 15 and 20 eye/sec, where flicker, but not left-right movement was seen, there was some dependence on contrast. Velocity discrimination thresholds are thus in agreement with gradient-like models of movement discrimination, but do not support the formal Reichardt-type correlation models. 1 Robotics Research Group, Jet Propulsion Laboratory, Pasadena, CA. 2SURF student. Figure 2. Three-dimensional receptive field profile of 376. Simulating Cat Visual Cortex: Circuitry the ON part of a simple cell. Underlying Orientation Selectivity Udo J. Wehmeier, Christo( Koch, David E. Van Essen Two types of inhibitory' projections, cross The responses of cells in primary visual cortex of orientation and inhibition among similar oriented cells mammals exhibit a number of salient properties such with spatially displaced receptive fields, superimposed as orientation selectivity, direction tuning, etc. Our on a Hubel and Wiesel type scheme, are effective in computer model of the early visual system in the adult discriminating orientation. Due to the massive cat represents a continuing long-term effort to study inhibitory feedback among our cortical cells, each cell neuronal activity based on the detailed anatomy and can be highly orientation selective and no non-oriented electrophysiology in this well-studied system. interneurons are required. Simulation results indicate Our computer model of the early visual system in that presentation of low contrast bars, while not being the adult cat simulates the dynamics of neurons within discriminated by the classical Hubel and Wiesel feed a small (2° by 2°) patch of visual angle in the retina, forward model due to their lack of a gain control its projection to LGN and its subsequent projection to mechanism, elicit responses once inhibitory feedback layer !Ve in primary visual cortex (area 17). Images is introduced (Figure 3). are projected onto the retina, consisting of a hexagonal array of X ON retinal ganglion cells. The spatial receptive field of each ganglion cell is 0 described by the difference between two Gaussians, while their temporal response is given by the -10-· difference between two low-pass filters, in· agreement -15 with electrophysiology. Each retinal cell innervates -20 four geniculate cells. The output of individual -25 geniculate cells projects to a circular patch in layer -30 !Ve, such that a single geniculate cell projects to about .35 250 cortical cells. Conversely, each cortical cell v'""-h-40 receives input from about 30 geniculate cells. ...s Individual cells were described by passive RC elements -SO in parallel with the synaptic-induced time-varying -ss conductance changes in series with the synaptic -eo reversal battery. An extension to our simulator -65 permits detailed modelling of individual cells. This -70 makes possible a study of interactions within the 0 50 too 1so 200 250 dendritic tree and permits intracellular recording of Time(maec) one of our simulated cortical units (Figure 2). Figure 3. Intracellular potential of a simple cell in response to a horizontal and vertical bar. 254 377. Analog Sub threshold VLSI Circuits for Koch, C. (1988) Computing motion in the presence of Interpolating Sparsely Sampled 2-D Surfaces discontinuities: Algorithm and analog networks. Using Resistive Networks In: Neural Computers, EckmiHer, R. and von der Malsburg, C. (Eds.), Springer Verlag, Heidelberg, Jin Luo, Christof Koch, Carver Mead 1 pp. 101-110. Koch, C. (1987) The action of the corticofugal pathway Interpolating and smoothing sparsely sampled and on sensory thalamic nuclei: A hypothesis. noisy surface data is a well-known problem in Neuroscience 23, 399-406. Koch, C. (1988) Mathematical aspects of Hodgkin computer vision. It can be shown to be equivalent to Huxley neural theory: A review of Jane Cronin's minimizing a quadratic variational functional. This book. Trends in N eurosci. 11, 284-285. Koch, C., Luo, J., Mead, C. and Hutchinson, J. (i 988) functional maps onto very simple resistive networks, Computing motion using resistive networks. such that the steady state voltage distribution corre American Institute of Physics, in press. Koch, C., Luo, J., Mead, C. and Hutchinson, J. (1988) sponds to the interpolated and smoothed surface. We Computing motion using resistive networks. Society have implemented such a network on a 20 by 20 of Photo-Optical Instrumentation Engineers, in press. hexagonal grid using analog, subthreshold CMOS VLSI Poggio, T. and Koch, C. (1987) Synapses that compute technology and report here for the first time its full motion. Sci. Amer. 256, 46-52. Poggio, T. and Koch, C. (1987) The dynamics of free two-dimensional operation using real data. Since a calcium in dendritic spines in response to repetitive number of proposed resistive networks for early vision synaptic input. Science 236, 1311-1315. Poggio, T. and Koch, C. (1987) Wie Synapsen Bewegung problems, such as computing optical flow on the basis verrechnen. Spektrum der Wissenschaft, July, of the changing image intensity, have a structure very 1987, pp. 78-84. Poggio, T., Torre, V. and Koch, C. (1987) Compu similar to the surface interpolation network, the tational vision and regularization theory. In: results we present here are very encouraging as they Readings in Computer Vision, Fischler, M. A. and Firschein, 0. (Eds.), Morgan Kaufmann Publishers, demonstrate the feasibility for carrying out such Los Altos, California, pp. 220-240. operations within dedicated analog circuits which are Sejnowski, T. J., Churchland, P. S. and Koch, C. (1988) What is computational neuroscience? In: robost, use very little power ( lead to a dramatic increase in the output of efferent increase in the firing rate of non-DA efferent neurons non-DA neurons in substantia nigra and ventral of the substantia nigra and the ventral tegmentum, tegnrentaJ area. But since these agents, given by the two structures containing the cell bodies of the DA systemic route, influence dopaminergic activity neurons implicated in motor regulation. In a follow-up throughout the CNS, the neural responses did not study, it was observed that the increase in the firing reveal the respective contribution of striatum and rate of these neurons to DA agents can be blocked in accumbens to the responses of these neurons. the substantia nigra, but not in the ventral tegmentum, Therefore, in the present study, the subjects were still by striated injections of the DA receptor blocker halo given the DA agonists by the systemic route, but only peridol. In the present study we sought to determine after pretreatment with haloperidol injected bi the role of the DA terminal field in nucleus accumbens laterally either in striatum or accumbens. Haloperidol to the excitatory responses of substantia nigra non-DA is an antipsychotic agent believed to owe its thera efferent neurons to DA agents not by the blocking DA peutic properties to its blocking of DA receptors. receptors but by directly activating the DA receptors Thus, the goal was to determine whether blocking DA in accumbens implicated in locomotion. The basis for receptors in accumbens blocked the response of non selecting accumbens is that its contribution to the DA efferent neurons in the ventral tegmental area to pattern of information flow in the putative DA output systemically-given DA agonists, and whether blocking pathways of substantia nigra and ventral tegmentum is the DA receptors in striatum blocked the excitatory not yet understood. Direct, localized activation of the responses of non-DA afferent neurons in substantia DA receptor seemed a valid approach to gain insight nigra. into the relation between the accumbens DA terminal Our findings show that these experimental fields and the excitatory responses of substantia nigra procedures in striatum reduced the oral stereotypy and and ventral tegmentum non-DA neurons. the excitatory neural response in substantia nigra to We are at present analyzing the data collected thus systemic DA agonists, but not in the ventral tegmental far. Preliminary analysis indicates that the number of area. Blocking the DA receptors in accumbens with responsive cells is smaller and the duration of the haloperidol reduced the locomotor response to excitation shorter than under the conditions of systemic DA agonists and selectively reduced the generalized DA activity. Apparently, a selective excitatory neural response in ventral tegmental area, group of non-DA efferent neurons in these two ventral but not in substantia nigra. These findings support the midbrain structures receive, integrate, and convey to notion that different populations of efferent non-DA other mesencephalic pre-motor nuclei, information neurons in substantia nigra and ventral tegmentum relative to locomotion induced by activation of the DA function to convey different DA-motor-related infor receptors in accumbens. mation to motor nuclei. This suggests a specialization of function among these putative non-DA output 380. The Role of the Dopamine Afferents to neurons similar to that noted for the A9 and AlO DA Accumbens and Frontal Cortex in Reinforcement Supported by Medial Forebrain Bundle Stimulation neurons in the regulation of motor activity. Marianne E. Olds Brain stimulation of the medial forebrain bundle 379. Effects of Activating the DA Receptor in Accumbens on Motor Activity and on the Output (MFB), one of the principal fiber systems linking the of Neurons Receiving Afferents from Accumbens hindbrain with the forebrain via the hypothalamus, is Marianne E. Olds highly rewarding. Rats implanted with electrodes In the initial study of this series, our aim was to whose tips terminate in this bundle at the level of the identify the output pathways for central dopaminergic lateral hypothalamus will work for hours, days, and activity related to the motor function. It was even weeks to obtain a brief electrical shock applied observed that peripherally-given DA agents promoting via the implanted electrode. The MFB contains a release of dopamine (DA) throughout the CNS led to ascending and descending axons originating at various behavioral activation and, concurrently, to a dramatic brain levels including the ascending axons of the two 257 main dopamine (DA) cell groups, both originating in stimulatory effects of other anorexic agents. However, the ventral mesencephalon. Since electrical several reports describe a toxic action of fenfluramine stimulation is unspecific with respect to the type of specifically on the B9 group of serotonin neurons. This neural elements excited, axons and cell bodies lying action permanently destroys the B9 neurons but leaves under the tip of the electrode containing different other serotonergic neuronal groups unaffected. transmitters are excited. The problem has been to Our preliminary results show that treatment of rats identify from this pool the elements critical for the with this substance leads to a drastic reduction in the reinforcing effect. The available evidence strongly lever-pressing behavior maintained by rewarding implicates the DA axons, but as these terminate in stimulation. The blockade lasts approximately 48 several telencephalic regions, one important question hours and is followed by a gradual recovery. A second is to identify the terminal field(s) and the DA target treatment with fenfluramine is followed by a more neurons that are part of the reinforcing circuit. We prolonged blockade of the rewarded behavior. These have approached this question by comparing the findings are interpreted to mean that procedures effects of activating the DA receptors present on the inimical to normal serotonergic transmission in the intrinsic neurons of two forebrain structures, the mammalian brain lead to a reduction in the re nucleus accumbens and the frontal cortex. Both of inforcement produced by direct stimulation of these structures are recipients of massive DA dopamine-rich brain sites. projections originating from the group of DA neurons Inasmuch as biochemical data show that fenflur designated as the AlO cell group. Our findings indicate amine depletes permanently the brain serotonin levels that the projecting branch to accumbens is a critical and transiently the brain dopamine levels, one of our component of the reinforcing circuit but that the next tasks is to determine whether the attenuation of branch to frontal cortex is not. The evidence for this the brain-rewarded behavior reflects the interference conclusion is that the selective activation of the DA with serotonin on dopamine transmission. Another receptors in accumbens produced by the injection of objective is to determine whether it is possible to DA agents in this nucleus facilitates the behavior block the behavioral and biochemical effects of maintained by rewarding MFB stimulation, whereas fenfluramine with dopamine agonists. these same agents injected in frontal cortex depressed 1 Chief, Neurobiochemistry Laboratory, The Brentwood the behavior. Neuropsychiatric Veterans l:lospital, Los Angeles. 381. The Role of Serotonin Neurons in Reinforcement Produced by Brain Stimulation PUBLICATIONS Marianne E. Olds, Arthur Yuweiler 1 Olds, M. E. (198&) Amphetamine-induced increase in Although the evidence linking central serotonin motor activity is correlated with higher firing rates of non-dopamine neurons in substantia nigra and neurons with reinforcement is not compelling, it ventral tegmental area. Neuroscience 24, 477-490. Olds, M. E. (19&&) Correlation between the discharge nevertheless includes reports that electric stimulation rate of non-dopamine neurons in substantia nigra via electrodes implanted in the dorsal and median and ventral tegmental area and the motor activity induced by apomorphine. Neuroscience 24, 465-476. raphe nuclei, the two structures containing the cell Olds, M. E. (19&8) Enhanced dopaminergic activity in bodies of the serotonin neurons, is rewarding to the accumbens but not frontal cortex facilitates self rat. The issue is whether the activation of the stimulation of medial forebrain bundle. Brain Res., submitted for publication. serotonin neurons is necessary for the rewarding effect Olds, M. E. (198&) Enhancement of DA activity in of brain stimulation or whether the reward derives accumbens but not frontal cortex facilitates self stimulation in MFB. Soc. N eurosci. Abstr. 14, 663. from the stimulation of fibers en passage in the raphe Olds, M. E. (1988) The response of non-dopamine neurons in substantia nigra and ventral tegmental nuclei, fibers that contain other transmitters. We area to amphetamine and apomorphine: The striatal have approached this question pharmacologically by influence. Brain Res. 452, 237-254. treating the self-stimulating animal with fenfluramine. This substance has gained widespread usage in man as an anorexigenic agent because it lacks the central 258 Professor Emeritus: Roger W. Sperry in behavioral science is judged to be the more valid Senior Research Associate: Charles R. Hamilton foundation for all science, not just behavioral science. Visiting Associates: Polly Henninger Pechstedt, Eran Zaidel Staff Associate: Betty A. Vermeire Research and Laboratory Staff: Patricia A. Anderson, Erika M. Erdmann, Jessica L. Madow 382. Hemispheric Specialization for Spatial Discrimination in Monkeys Support: The work described in the following research Charles R. Hamilton, Betty A. Vermeire reports has been supported by: Monkeys find discriminations involving spatial Biomedical Research Support Grant (NIH) National Institute of Mental Health relationships easier to learn with their left hemi Natural Sciences and Engineering Research spheres, which complements their better performance Council of Canada C. Ed Nix Fund on facial discriminations with their right hemispheres Ralph L. Smith Foundation (Biology 1986, Abstract No. 273). We are now deter Doris Jones Stein Foundation mining how similar the monkeys' spatial abilities are to those lateralized in human subjects, and we are Summary: Experimental work remains focussed on attempting to examine the extent and magnitude of hemispheric specialization in human subjects and spatial lateralization in monkeys. Two different tasks rhesus monkeys with surgical disconnection of the are being used: one requires discriminating the cerebral hemispheres. The discovery of complementary relative position of a dot within a square frame of specialization in monkeys received additional reference and the other requires discriminating the confirmation this year, and it seems increasingly likely relative orientation of a line within a circle. For both that the functional hemispheric differences for facial tasks, an easy version of the problem is learned first, perception in monkeys- and humans are homologous, a then the difference between the relevant cues is finding which would greatly facilitate the study and reduced in order to determine the discrimination understanding of the fundamental basis of cerebral threshold for each hemisphere and to test for lateralization. Work continues with human patients on generalization of the learning to new situations. processing facial information by the two hemispheres Generalization is of interest because with facial and on interfering effects of cognitive conflicts within stimuli, hemispheric differences were more pro each hemisphere. Visiting investigators from Canada, nounced with generalization testing than with original New Zealand, and elsewhere in the U.S. also have learning or memory. continued to test our population of split-brain patients, To date, only a few monkeys have learned the examining particularly the differential capabilities of entire series of discriminations of dot position. No the two hemispheres for imagery and related cognitive significant dominance was evident for original learning functions. (X = 6.87, t = 0.49), but the average dominance index The recent shift in behavioral science to the for the most difficult test of generalization was signif current new mentalist paradigm (in which mental icant (x =46.44, t =3.66, p <.05). This tentative result states are given an ineliminable causal role in brain confirms our earlier extensive results in a new setting, processing) is found, on analysis, to represent a funda and it supports the suggestion that hemispheric mental conceptual shift to a different form of causal specialization is more evident for more central levels determinism. Traditional microdeterministic views of of information processing. science have been overthrown in favor of an explana tory scheme that gives primacy to macrodeterminism 333. Hemispheric Specialization for Discriminations of Inverted Monkey Faces and the downward control of the higher, more evolved forces in nature over the lower. As a result, we have Betty A. Vermeire, Charles R. Hamilton in science today two major conflicting doctrines of Monkeys find discriminations between faces of causal control, two conflicting scientific descriptions other monkeys easier to learn, remember, generalize, of the kinds of forces that govern ourselves and the and perform with the right hemisphere of their brains world. Of the two, the new "macromentalist" outlook than with the left (Biology 1987, Abstract No. 327). 259 This suggests that the right hemisphere of monkeys sample stimulus to one of five possible choices. may be homologous to the right hemisphere of human Stimuli are photographs of 40 human faces, 40 houses, beings in its superior ability to process facial and 40 monkey faces presented either upright or information. As we reported last year, we are inverted to one hemisphere at a time. Two different undertaking two further investigations to see how presentation durations short enough to prevent close the homology might be. confounding effects from eye movements, 50 msec and Stimulus inversion is especially disruptive to visual 180 msec, are being used in case stimuli presented recognition in human subjects, an effect that is much very briefly favor right hemisphere processing, as has more pronounced with faces than with other classes of been reported in similar experiments. stimuli that are usually seen upright, such as houses or To date, three split-brain and three normal subjects cars. We are assessing the ability of split-brain have completed testing. All stimuli were more monkeys to discriminate inverted monkey faces with difficult to recognize inverted than upright, with the each hemisphere using two tests. In the first, monkeys effect somewhat more pronounced for human faces, as that have already learned upright discriminations are expected. However, the inversion effect was only tested with the same stimuli inverted, and in the greater in the right hemisphere for the normal second, monkeys are taught new discriminations subjects; the split-brain patients were more affected presented either upright or inverted. If monkeys are by inversion in the left hemisphere. Furthermore, all similar to human subjects, the right hemisphere should subjects performed all tests better with the left be more disrupted by the inversions than the left. hemisphere, in contrast to most results with facial Sixteen monkeys that performed inverted discrimi stimuli. Until these peculiarities are resolved and the nations previously learned upright showed no overall remaining subjects are tested, we cannot realistically hemispheric advantage for the inverted stimuli, in interpret differences associated with the key experi contrast to a significant right hemisphere advantage in mental variables of hemisphere, inversion, and stimuli learning and remembering the upright problems. This and their interactions. indicates that the right hemisphere was more disrupted 1Montreal Neurological Institute. by inversion than the left, just as occurs with human subjects. 385. Commissurotomy Subjects Show Stroop Effect Twelve monkeys who learned new face discrimi in Both Hemispheres nations either upright or inverted found inverted Polly Henninger Pech.'ltedt, discriminations more difficult to learn than upright Rebecca Rockford Ramlose 1 problems. However, since many of these monkeys so A Stroop test in which words denoting one color are far have learned only a few of the new problems, final printed in another, a procedure which interferes with conclusions regarding learning rates and hemispheric performance in normal subjects, was presented to superiorities await additional data. three complete commissurotomy subjects (L.B., N.G., A.A.) with the lateral limits technique for the following purposes: to investigate the conditions under 384. Facial Processing by Split-Brain and Normal Human Subjects which interference occurs; to compare findings to those using tachistoscopic presentation (Levy and Charles R. Hamilton, Betty A. Vermeire, Justine Sergent 1 Trevarthen, 1981) which indicated a right hemisphere Facial stimuli are often thought to be processed by preference for the ink color and a left hemisphere neural mechanisms specialized for the analysis of preference for what the word said; and to investigate facial information. One line of evidence for this is the the nature of subcortical transfer by seeing whether reported greater difficulty in recognizing inverted words, colors or both could be cross-matched. faces than in recognizing other inverted stimuli, as Stroop words and an array of color patches were mentioned in the previous abstract. We are testing presented in a single hemifield and subjects were asked each hemisphere of four split-brain patients and four on three testings to select I) the color that matched normal human subjects for the ability to match a (free choice instruction), 2) the color the word said, 260 and 3) the color of the ink that the word was printed Pechstedt, P. H. (1988) Musical trammg improves processing of tonality in the left hemisphere. in. Subjects responded by pointing or orally. Cross Music Perception, in press. matching tests consisted of Stroop words presented in Pechstedt, P. H. (I 988) Commissurotomy subjects show lateralized difference between manual and oral each hemifield with choices presented in the contra responding. Cortex, in press. lateral hemifield; subjects pointed to their choice. Sergent, J. (1987) A new look at the human split brain. Brain 110, 1375-1392. All subjects could read the colors and match the Sperry, R. W. (1987) Consciousness and causality. In: color patches in both visual fields. When responding The Oxford Companion to the Mind. Greegory, R. (Ed.), Oxford University Press, Oxford, pp. 164-166. manually to the Stroop words, accuracy was greatest Sperry, R. W. ( 1988) Psychology's mentalist paradigm for the "said" condition in the RVF and for the "ink" and the religion/science tension. Amer. Psychologist, in press. condition in the LVF. However, subjects selected what Sugishita, M., Hemmi, I. and Hamilton, C. R. (1988) the word said more often than the color of the ink Same-different judgment of bilateral letter stimuli in commissurotomy subjects. Neuropsychology under all instructions in both visual fields. When Satellite Symposium, in press. responding orally and in the cross-match conditions, Vermeire, 8. A. (1988) Differential discriminability of monkey facial identity and expression in Macaca subjects responded to the instructions. Right/left mulatta and Homo sapiens. J. Comp. Psycho!., differences were not strong; further testing is submitted for publication. Vermeire, B. A. and Hamilton, C. R. (1988) Laterality necessary to see if they are reliable. in monkeys for discriminating inverted faces. Soc. These results suggest two cognitive processors Neurosci. Abstr. 14, 1139. within a hemisphere, one that responds to the visual stimulus and reads it, and a second that selects the response appropriate to the instructions. It appears that when the response is manual, competition between these processors arises and the habitual Professor: David C. Van Essen response to the sensory information dominates. When Visiting Associate: Charles H. Anderson Senior Research Fellows: Edgar A. DeYoe, Daniel J, the response is oral, or the stimulus information is to Felleman be transferred subcortically, this processor is inhibited Research Fellows: Jaime F. Olavarria, Harry S. Orbach 1 Graduate Students: Ronald G. Benson , 6 jvind J. and the subject responds to the instructions. This 1 Bernander , Edward M. Callaway, George J. finding suggests that the content of what is trans Carman, James Fox, James J. Knierim, E. Karina Schimmerling, James M. Soha ferred results from a selective process in which the Research and Laboratory Staff: David H. Bilitch, perceived requirements of the task play a causal role. Susan B. Kallenbach, Kathleen Tazumi Reference: 'Computation and Neural Systems Graduate Student, Levy, J. and Trevarthen, C. (1981) N europsychologia California Institute of Technology. 19, 523-541. 1Graduate student, Illinois State University, Normal, Support: The work described in the following research IL. reports has been supported by: Lucille P. Markey Charitable Trust Helen G. and Arthur McCallum Fund PUBLICATIONS National Institutes of Health, USPHS National Science Foundation Corballis, M. C. and Sergent, J. (1988) Imagery in a Department of the Navy, Office of Naval commissurotomized subject. N europsychologia 26, Research in press. Ralph M. Parsons Foundation Hamilton, C. R. and Vermeire, B. A. (1988) Facial Gustavus and Louise Pfeiffer Research Foundation processing and lateralization in monkeys. J. Clin. Exper. Neuropsycho!. 10, 50. Hamilton, C. R. and Vermeire, B. A. (1988) Cognition Summary: Our research program includes two major ,not handedness, is lateralized in monkeys. foci, one aimed at studying the development of Behavioral Brain Sci. II, irr press. Hamilton, C. R. and Vermeire, B. A. (1988) Comple neuromuscular connections, and the other aimed at mentary hemispheric specialization in monkeys. Science, submitted for publication. understanding how information is processed in the Pechstedt, P. H. (1986) Suppression of ipsilateral mammalian visual cortex. In both cases our long-range auditory pathways increases with increasing task goal is to obtain an integrated perspective that links load in commissurotomy subjects. Bull. Clin. Neurosci. 51, 73-76. experimental approaches (mainly physiological and 261 anatomical) with computational approaches (based on experiments are just getting under way. We have also neural models and simulations). begun to explore the feasibility of using electronic Our studies on the visual cortex are concentrated shifter circuits for solving analogous problems faced on the macaque monkey, whose visual system is very by artificial image processing systems. similar to that of humans. From work done in our Our studies of neuromuscular development are laboratory and elsewhere, it is apparent that there are directed at understanding the phenomenon of synapse numerous visual areas in the cerebral cortex-more elimination during early postnatal development. In than two dozen by the latest reckoning. These areas recent years we have had a particular interest in the can be arranged in a well-defined hierarchy on the role of nerve and muscle activity in synapse basis of anatomical connectivity patterns. Our elimination. Last year we reported that inactive research in the past year has addressed three major synapses are at a disadvantage when competing against themes that build upon this baseline description. normally active synapses on the same muscle fiber, The first theme concerns the way in which indicating that differential activity on the presynaptic information is distributed from the three distinct side can affect the outcome of the competition. This stripe-like compartments that have been identified year we present evidence that changes in postsynaptic anatomically in visual area V2. Our results point to a (muscle) activity also have an effect on synapse high degree of segregation in the projections to several elimination. However, postsynaptic activity appears higher areas. At the same time, though, we also find to modulate the rate at which synapses are lost evidence for cross-talk between processing streams. without directly affecting the outcome at a given end We suspect that both cross-talk and feedback are very plate. We also have shown that many aspects of this important for understanding how the system functions. process can be incorporated into a computer model These observations have been derived from standard that successfully simulates a variety of phenomena anatomical and physiological techniques, but we have associated with normal and experimentally perturbed also succeeded recently in using voltage-sensitive dyes synapse elimination. as a "real-time neuroanatomy" probe for studying the connections between cortical compartments. 3&6. Concurrent Processing Streams in Visual Areas A second theme is to understand how information V2 and V4 of the Macaque Monkey about complex visual patterns is extracted and repre Edgar A. DeYoe, Daniel J. Felleman, sented at the level of single neurons. In particular, we James J. Knierim, Jaime F. Olavarria have studied the responses of cells in visual area MT to Each of the many separate areas within the visual moving texture patterns. Our results provide valuable cortex has traditionally been regarded as a information about the textured cues that are effective homogeneous structure, carrying out a specific set of. in activating MT neurons. Surprisingly, though, we tasks that contribute to perception. This notion has have found that single unit activity does not always been subject to major revision in recent years, based provide a simple measure of the direction in which a mainly on anatomical and physiological findings of pattern is moving. functional heterogeneity within the primary and The third theme concerns the coordinate frame in secondary visual areas (V l and V2). Each of these which neural computations are carried out. Last year areas is broken into a mosaic of distinct compartments we proposed that visual processing in the cortex might (in a patch-like or stripe-like arrangement) that differ involve an initial stage of dynamic remapping of the in their connectivity and in the receptive field retinal inputs by way of neural structures called properties of their constituent neurons. In the present "shifter circuits." This putative remapping process study we have addressed the question of whether would represent an early pre-processing stage that in higher cortical areas, in particular area V4, also principle should greatly simplify subsequent stages of contains a mosaic of functionally distinct subregions. analysis for motion, depth, and form. The hypothesis We addressed this problem by placing separate makes strong predictions that are amenable to injections of different tracer substances (different experimental testing, and the critical physiological fluorescent colors) into nearby locations in V4. The 262 tracers were taken up by synaptic endings in the and MT. In order to ascertain the organization of V2 immediate vicinity of each injection and transported projections to these other areas, various combinations back to the cell bodies of projection neurons in V2 (as of distinguishable retrograde tracers were injected well as in other visual areas). In V2, we often found into identified sites in areas V3, V3A and V4t, as well clusters of cells labeled exclusively by one tracer or as in areas V4 or MT. the other. Mo'reover, these clusters were often Injections into areas VJ and VJA labeled elongated segregated into the different stripe-like subregions of clusters that were associated with the thick stripe V2, which could be independently identified by using a subregions of V2. The latter were independently histochemical technique to reveal the activity of the identified by their patterns of cytochrome oxidase enzyme cytochrome oxidase, and also by an immuno (CO) staining and/or dense CAT-JOl logical assay for cells reactive to an antibody known as immunoreactivity. The projection from V2 thick CAT-JOI. Specifically, we found that some V~ injec stripes to VJ fits nicely with the fact that both VJ and tions preferentially labeled the "thin stripes''- of V2, thick stripes are targets of layer 4B in VI, which in whereas other Vt/. injections labeled the "interstripes" turn receives its major inputs via the magnocellular of V2; none of the V~ injections labeled the "thick (M) stream of the retina and lateral geniculate stripes" of V2, which instead project to several other nucleus. In some cases, sparser labeling from V3 or visual areas (see following abstract). V3A extended over a wider region than thick stripes At first, we wondered whether the two V2 path and thus encroached on interstripe and/or thin stripe ways might simply project to two different visual compartments. The V4t injection yielded sparse areas within a region of cortex previously thought to labeling concentrated in but not limited to thick comprise a single area. However, detailed analysis of stripes. Thus, areas V3, V3A, and V4t appear to have tracer injections from several animals revealed that major input from the M stream, but each has sub both V2 subregions could be labeled from the same stantial cross-talk with one or both components of the general vicinity (posterior, middle or anterior thirds} parvocellular (P) stream as well. of the prelunate gyrus. This suggests that the incoming We also found that in some animals, the CO stripe terminals from V2 are segregated into a mosaic of pattern was irregular and difficult to discern. In such relatively small compartments, each perhaps 2-3 mm animals, distribution of projection cells to different across, that are scattered throughout V4. Since the V2 target areas correlated better with the CAT-JOl projection cells in the thin- and interstripe subregions pattern than the CO pattern. Retrograde labeling have been reported to respond differently to colors and within a V2 stripe was often patchy or irregular, and contours (the exact differences remain controversial), there was little overlap of clusters projecting to a reasonable hypothesis is that their projection pattern different target areas. These observations support engenders a mosaic of functionally distinct subregions evidence from other laboratories that V2 compart within V4. It remains to be determined how these ments are internally heterogeneous with respect to subregions contribute to different visual tasks such as both connectivity and metabolic activity. color or shape perception. 388. Optical Studies of Cortical Connectivity in Primate Visual Cortex J87. Compartmental Organization of Projections from V2 to Extrastriate Areas V3, V3A, and V4t Harry S. Orbach, Daniel J. Felleman in Macaque Monkeys Changes of absorption and fluorescence of certain membrane-bound dyes are proportional to changes in Daniel J. Felleman, Edgar A. De Yoe, James J. Knierim, Jaime F. Olavarria membrane potential. Based on this, optical methods Area V2 is characterized by a distinctive pattern of can be used to measure activity in the mammalian compartments known to have specific patterns of brain. Average electrical activity in many adjacent inputs from Vl and outputs to areas V4 and MT (see areas can be monitored by projecting an image of the preceding abstract). It is known, however, that V2 has brain onto a square array of about 100 photodiodes and several other targets in extrastriate cortex besides V4 measuring the photodetector outputs. 263 We have set up such an optical system and are We found that extrastriate visual areas in the rat currently using it to trace connectivity in squirrel are richly interconnected with each other. Injections monkey visual cortex. A large expanse of striate and into AL, LM or PL produced discrete labeled fields extrastriate cortex is stained with a potential sensitive within 5-6 visual areas in lateral extrastriate cortex, dye and imaged onto the array. Fluorescence changes plus 2-3 visual areas in medial extrastriate cortex. are monitored in response to short trains of electrical These interconnections were retinotopically organized stimulation applied through electrodes placed in and were consistent with previous maps of the visual striate cortex. representation in extrastriate visual areas. In We have seen large optical responses with brief particular, representations of the vertical meridian current pulses, as low as 10 J..!amp in amplitude. Within contained in callosal-recipient regions of both striate striate cortex, local responses extended several milli and extrastriate areas were interconnected, as were meters from the stimulation site; the full-width at callosal-free regions representing the horizontal half-height was 1-2 mm. Responses in the periphery of meridian and periphery. Data from injections into Vl, this zone began 4 msec or more after those in the AL, LM, and PL suggest that the newly identified center, which presumably reflects conduction and/or rostrolateral area (RL) in the region of the anterior synaptic delays. callosal ring connects preferentially with regions In two hemispheres, responses were seen at the representing lower fields. expected topographic location in extrastriate area V2. Our findings reveal a highly distributed intra These were well separated from the VI stimulation cortical network, in which the degree of connectivity site and began with a delay of 5-8 msec. The region of between visual areas is greater than that described in activation in these instances included all three visual cortex of monkeys, and probably also of cats. It cytochrome-oxidase stripes (thick, thin and inter remains to be determined whether processing within stripe). this network involves principles of hierarchical We expect this paradigm will be valuable for organization and parallel streams akin to those probing the topographic (and hopefully also compart characteristic of the primate visual pathway. mental) organization of cortical visual areas. 390. Neural Responses to Moving Texture Patterns in Visual Area MT 389. Cortico-Cortical Connections Among Extrastriate Visual Areas in the Rat Jaime F. Olavarria, Edgar A. DeYoe, 1 Jam es J. Knierim David J. Bruning , Jaime F. Olavarria, Daniel J. Felleman As visual observers, we are remarkably good at In the rat, area 17 is known to project to 10 locating objects or surfaces that are defined extrastriate visual areas. In order to understand more exclusively by differences in texture or texture about how information flows among these areas, we motion. In an effort to determine- the neural correlates studied connectivity patterns revealed by injections of of such abilities, we have been studying the capacity fluorescent tracers into several extrastriate areas, of neurons in different visual areas to respond including the lateromedial (LM), anterolateral (AL) and selectively to static and moving textures. Recently, posterolateral (PL) visual areas. In order to improve we have analyzed the responses of neurons in the the ease and accuracy of the analysis, histological Middle Temporal area (MT) of the macaque monkey, an sections were cut tangential to the surface of the area that is noted for its high incidence of direction flattened· cortex, and the connectivity patterns were selective cells when tested with standard bright or reconstructed on a computerized neuroanatomy dark moving bars. We have quantitatively studied system. In addition, we obtained an independent set of responses from 116 MT neurons to bar-like figures de landmarks for locating the various visual areas by fined by motion, texture, and/or luminance cues. One analyzing the pattern of callosal connectivity after of our goals was to determine how effective each type making large injections of horseradish peroxidase of cue was in activating cells of MT; another goal was (HRP) into the opposite hemisphere. to determine whether the direction selectivity of a 264 cel1 depends on the nature of the cues used to define a be accomplished by computing the local velocity field moving target. and using this information to induce a compensatory In three anesthetized macaques, we measured shift that would effectively stabilize the image responses to stimuli moving across the receptive field representation in the cortex. Psychophysical evidence in four orthogonal directions, using a video graphics provides two types of evidence consistent with this monitor to induce apparent motion of the stimulus by hypothesis. First, vernier acuity judgments of moving frame-to-frame displacement. Solid bright bars or images can be correctly made for speeds up to several texture bars (containing numerous line elements of degrees per second, without interference by motion identical orientation) could be surrounded by a blank blur. Second, motion is more readily perceived when it field or by a texture field of the same average bright occurs relative to nearby reference cues. Related to ness. The orientation of the surround texture elements this is the phenomenon of induced motion, where was either identical or orthogonal to the elements in perceived motion of a stationary central target can be the texture bar. induced by actual motion of a surrounding reference As expected, nearly all MT neurons were direction frame. Based on the known anatomy of the visual selective to solid bars, and we found that texture bars system, the most plausible location for shifter on a blank field were just as effective. In addition, circuitry mediating motion compensation would be in most cells (88%) responded well to moving texture bars primary visual cortex (area V 1), specifically involving on a static texture background, and many (53%) were layers 4 and 6. selective to their orientation or direction of motion. We have started electrophysiological recording However, both response magnitude and direction selec experiments from anesthetized monkeys aimed at tivity were often reduced by a static texture back testing this proposal~ Penetrations are made with a ground, and in a few cases the preferred direction of microelectrode through all of the cortical layers in motion was reversed. We also found that texture con VI. Single cells in Vl are tested for responsiveness to trast alone (i.e., a difference in orientation between flashed or moving bars of light, and the classical the texture bar elements and the background elements) receptive field (CRF) borders are determined. Suitable contributed little to cell responses. In agreement with cells are further examined using a family of stimuli work from Prof. John Allman's laboratory, we found designed to test for the stability of the receptive field that half of the cells responded better to a motion bar and the sensitivity to relative motion. The stimulus on a static background than to uniform motion consists of a central target (within the CRF), which throughout the texture field. Thus, moving texture can be stationary, oscillating, or absent altogether, patterns are usually effective stimuli for MT neurons, plus a surround region containing a field of random but tuning characteristics sometimes depend on the dots (outside the CRF), which also are stationary, cues used to delineate motion. oscillating coherently, or absent altogether. By testing various combinations at center and surround, 391. Testing for Shifter Circuits in Monkey we plan to characterize the responses to simple Striate Cortex targets and to ascertain if and how these are 1 James M. Fox, Tobias Delbruck , Charles H. Anderson modulated by the surround. Last year, Anderson and Van Essen (1987) proposed If the simplest, most rigorous version of the shifter that neural circuits capable of dynamically shifting the hypothesis were correct, the motion of the background representation of retinal images might be used by the should in effect cause the receptive field of cortical visual system as a pre-processing step, prior to the cells to oscillate in synchrony with the background. In analysis of motion, depth, and other types of infor that case, background motion with a stationary target mation. A specific aspect of this hypothesis is that should be equivalent to target motion with a stationary such "shifter circuits" might compensate for the background. In other words, a stimulus that causes motion of images across the retina that occurs, for induced motion for a human observer should result in a example, during locomotion, thereby improving the phasic oscillation in the activity of the cell, as if the resolution of detailed patterns and shapes. This could target element was sweeping across the CRF and back. 265 If our results support the basic notion of shifter electronics. [t becomes interesting when put into a circuits, we will proceed to analyze how the process is larger context such as an image stabilizer, which is the mediated and controlled, and also the spatial and next stage of the research (see Figure l). In vision, an temporal range over which it can effectively operate. image stabilizer can be used to compensate for motion If, on the other hand, our evidence argues against blur. The velocity of the image is detected and is used shifter circuits in area V1 of the anesthetized monkey, to automatically control the shifter. The faster the we will have three major options to pursue. One is to image moves, the more rapidly the shifter will switch, study alert, rather than anesthetized monkeys. with the goal of producing a stable image represen Another is to study other visual areas (V2 or MT) based tation at the output. on the possibility that shifter circuits operate only at higher levels of the visual pathway. The third is to formulate and test alternative hypotheses that could k account for the relativistic aspects of motion perception and the suppression of motion blur. i I motion detector ~ Reference: Anderson, C. and Van Essen, D. C. (1987) Proc. Natl. Acad. Sci. USA 84, 6297-6301. 'Computation and Neural Systems Graduate Student, California Institute of Technology. 392. Shifter Circuits in Electronic VLSI Hardware Ojvind J. Bernander output: stable image The concept of neural shifter circuits in the primate visual system has been discussed in the Figure 1. Circuit diagram for an image stabilizer. preceding abstract. The purpose of the shifter is to A VLSI stabilizer circuit has been designed, but not dynamically change the receptive field of a neuron, yet implemented. It uses the motion detector circuit i.e., choosing what inputs the neuron should have. This devised by Tanner (1986) to compute a signal corre function could have several uses in visual processing, sponding to the velocity of the image. This signal is e.g., for motion blur compensation, stereoscopic align integrated and fed into an up/down counter, which in ment of two images, and directing visual attention. turn supplies the control signals to the shifter. A chip Motivated by the shifter hypothesis, I have with the stabilizer on it will hopefully be completed by designed and built an integrated VLSI barrel shifter the fall of 1988. (dashed box in Figure I). The input to the shifter is a one-dimensional linear array of 31 phototransistors. Reference: Tanner, J. E. (l 986) Ph.D. Thesis, California Institute Hence a one-dimensional image has to be focused of Technology. directly onto the chip. The phototransistors produce a voltage at each pixel that is logarithmically related to image intensity. To the output of the chip, 16 contig 393. Slowing of Synapse Elimination by Postsynaptic Activity Block uous pixels are routed by the shifter. The shifter can be thought of as providing a 16-pixel-wide window Edward M. Callaway through which part of the input can be observed. The A number of studies have addressed the influence position of this window is controlled by four digital of activity on the rate of neuromuscular synapse signals. These control signals cause shifts of 1, 2, ~. elimination. If activity is increased by chronic and 8 pixels, respectively. Hence, for each of the 16 electrical stimulation of either the nerve or both nerve settings of the control signals, 16 different segments and muscle, the rate of elimination is increased. of the image will be relayed to the output. Conversely, a presynaptic activity blockade slows the The concept of a barrel shifter is not new in rate of elimination. However, none of these experi- 266 ments has clearly resolved the question of whether it unfolds. The model simulates the dynamic interaction is the presynaptic or postsynaptic activity level (or of presynaptic nerve terminals as they compete for both) that regulates the rate of elimination. limited space at each of an ensemble of muscle fiber To examine the role of postsynaptic activity in endplates. Three potential mechanisms have been regulating the rate of neuromuscular synapse studied: 1) a synaptic stabilization molecule elimination, contractile activity in the neonatal rabbit (scaffolding); 2) a muscle-derived trophic factor; and soleus muscle was decreased by chronic superfusion of 3) intrinsic limitations on the metabolic capacity of a-bungarotoxin (a-BGT) over the muscle surface. motor neurons. Superfusion was begun at 6 days postnatal and Several interesting findings have emerged. Orderly continued for a variable duration (2 to 5 days) before synapse elimination can be simulated independently by muscles were analyzed. The percentage of poly each of the three mechanisms tested. Motor unit sizes innervated fibers was assessed both physiologically and develop appropriately, and no denervated endplates anatomically for a-BGT-treated muscles and their appear. The only two assumptions required to produce contralateral muscles, in addition to normal and orderly synapse elimination under normal conditions control (saline-superfused) muscles of the same age. are that terminals compete for limited endplate space, Within muscles exposed to a-BGT for 5 days, an and that all terminals experience a bias favoring average of 55% of endplates remained polyinnervated growth over retraction. The likelihood of terminal based on either assay. This value was significantly growth may vary systematically according to relative greater than for normal, control treated, or contra terminal size. The model suggests that a competitive lateral muscles of the same age. The anatomical assay advantage for larger terminals may be critical for further revealed that the retention of polyinnervation synapse elimination to occur within a realistic interval in a-BGT-treated muscles was most pronounced near of time under the trophic factor and scaffolding the muscle's surface, but endplates at the center were mechanisms. The time required to achieve single also affected. This finding, coupled with the obser innervation also does not appear to depend heavily vation that only a small percentage of the muscle upon the initial degree of polyinnervation, which is fibers were completely inactivated, suggests that the consistent with an unexpected experimental finding effect on muscle activity was also most pronounced previously reported from our laboratory. near the surface and relatively low at the muscle's The model is also able to simulate the response of center. The percentage of endplates at which synapse the process to various experimental perturbations. For elimination was delayed was greater than the example, a blockage of all neural activity is known to percentage whose activity was completely blocked, retard synapse elimination. The model suggests that suggesting that synapse loss was slowed even in muscle this effect might arise from an increase in each fibers retaining some postsynaptic activity. These terminal's bias toward growth, reflecting, for example, observations are consistent with the possibility that an increased postsynaptic synthesis of scaffolding or the rate of synapse elimination can be regulated trophic factor. By consistently impeding each other's independently at individual endplates in response to growth, terminals are retained longer. The competitive graded changes in activity. advantage conferred to inactive terminals following a partial activity block can be simulated by appropriate 394. Computer Modeling of Neuromuscular presynaptic mechanisms. The model demonstrates that Synapse Elimination some of these same processes may act under normal James M. Saha, Edward M. Callaway conditions to match the sizes of motor units to their The postnatal removal of excess neuromuscular recruitment thresholds, consistent with the pattern synapses occurs during a complex competitive process. found in adult animals. Finally, only the neural Experimental evidence suggests that a variety of metabolic mechanism was effective in simulating the mechanisms and cellular interactions are involved. We distribution of motor unit sizes that develops followihg have developed a computer model of synapse partial denervation. elimination to aid in analyzing how this process The model was written in a flexible manner, and is 267 intended to evolve. Further simulations, involving nearby spinal filaments, which would be indicative of additional candidate mechanisms, are planned. topographic organization in the projection from spinal cord to muscle. 395. Quantitative Measurements of Multiple Innervation 396. Synapse Loss on Fast Versus Slow Muscle Fibers E. Karina Schimmerling During postnatal maturation, the rabbit soleus Edward M. Callaway muscle undergoes an orderly process of synapse Analysis of motor unit twitch responses from elimination which leaves muscles singly innervated by neonatal rabbit soleus muscle reveals a biomodal about postnatal day 15. The time course of synapse distribution of twitch rise times. This distribution elimination has been studied using tension recordings suggests that fast and slow motor unit populations are and intracellular endpla te recordings. intracellular distinct from one another and overlap rather little, recording yields estimates of the percentage of muscle even in heavily polyinnervated muscles. To the extent fibers innervated by more than one terminal. It is that this is the case, competition for endplate sites difficult, however, to determine the precise degree of during synapse elimination should occur within polyinnervation by this method, when there are more populations, but not between them. Thus, the rabbit than two inputs per fiber. The number of inputs to soleus allows a test for differences in the rate and/or each muscle fiber has been estimated using tension extent of synapse elimination for fast versus slow recordings by comparing the tension generated in the motor neurons to a single muscle. polyinnervated state to that generated in the singly We have estimated the degree of polyinnervation innervated state. This type of estimate is also limited on fast and slow fibers at three different ages: early insofar as its accuracy is compromised -by possible (4-5 days, when the rabbit soleus is heavily poly changes in relative tension of fast and slow fibers. We innervated), intermediate (8-9 days), and late (l l-15 have designed experiments to more accurately days, when virtually all the muscle fibers have become quantify the number of inputs to each muscle fiber and singly innervated). Estimates were obtained by examine the change in the number over the course of dividing mean motor unit twitch sizes (motor unit synapse elimination. In addition, we plan to compare tensions normalized to percentage of whole muscle the relative strengths of inputs to individual fibers, in twitch tension) at early and intermediate ages by the order to see if there are systematic changes during appropriate fast or slow late age value. We estimate synapse elimination. that at the early age slow fibers are innervated by an Rabbit soleus muscles and their nerve supply are average of 3.4 different motor neurons, but fast fibers dissected back to the spinal roots. The roots are by only 2.1. These values decrease to 1.9 and 1.6 for divided into a few filaments, such that each filament slow and fast fibers, respectively, at the intermediate generates roughly the same amount of tension when age. Both values are assumed to be unity at the late stimulated. The muscle is then cut to prevent age on the basis of the lack of polyinnervation when contraction and pinned. Endplate potentials (e.p.p.'s) assessed anatomically and with intracellular are measured with a glass intracellular electrode, and recordings. Thus, it appears that slow muscle fibers the number of inputs from each filament contributing are initially more heavily polyinnervated than fast, but to the e.p.p. is determined by graded stimulation of that both reach the singly innervated state at about the filament. the same time, as reported by Gordon (1984). Preliminary data from these experiments on the The validity of these estimates is dependent on the number of inputs per fiber are consistent with previous assumption that the ratio of the tension generated per estimates from tension recordings. We plan to fast fiber versus that per slow fiber does not change continue these experiments and also to quantitatively from early to late ages. To determine whether this is study input strengths. Such studies should also enable the case, and if not, to what extent our estimates need us to determine whether or not multiply innervated to be normalized, we have begun studies aimed at fibers tend to receive their inputs preferentially from determining the amount of tension generated per fiber 268 for each fiber type at each age. These values will be Olavarria, J., DeYoe, E. A., Knierim, J. and Van Essen, D. C. (1988) Neural responses to texture patterns in obtained by measuring the twitch tension of a motor macaque visual area MT. Soc. Neurosci. Abstr. 14, unit by our standard in .vitro method, and subsequently 457. Orbach, H. S., Felleman, D. J. and Van Essen, D. C. depleting of glycogen all the fibers in that unit by (I 988) Pathway tracing in primate visual cortex chronic stimulation. The glycogen-depleted fibers will using voltage sensitive dyes in vivo. Soc. N eurosci. Abstr. 14, 898. be identified in PAS-stained cross sections and their Soha, J. M., Callaway, E. M. and Van Essen, D. C. fiber type identified in adjacent sections stained for (1988) A computer model of neuromuscular synapse elimination. Soc. N eurosci. Abstr. 14, 179. actomyosin A TPase. Simply dividing the number of Saha, J. M., Callaway, E. M. and Van Essen, D. C. fibers in the unit by its twitch tension will yield the (1988) Lack of fiber type selectivity during reinnervation of neonatal rabbit soleus muscle. average tension per fiber. Further analysis will allow Dev. Biol., submitted for publication. determination of the ratio of slow over fast tension Van Essen, D. C. and Anderson, C. H. (1987) Reference frames and dynamic remapping processes in vision. per fiber at each age. The glycogen depletion results In: Computational Neuroscience, Schwartz, E. will also allow assessment, independent from bimodal (Ed.), MIT Press, in press. twitch rise time distributions, of the degree of fiber type homogeneity of motor units in polyinnervated muscles. Reference: Gordon, H. (1984) Ph.D. Thesis, California Institute of Technology. PUBLICATIONS Bruning, D. J., Olavarria, J., Felleman, D. J. and Van Essen, D. C. ( 1988) Cortico-cortical connections among extrastriate visual areas in the rat. Invest. Ophthalmol. Vis. Sci. 29, 115 (Suppl.). Callaway, E. M., Soha, J. M. and Van Essen, D. C. (1988) Differential loss of neuromuscular connec tions according to activity level and spinal position of neonatal rabbit soleus motor neurons. J. Neurosci., submitted for publication. Callaway, E. M. and Van Essen, D. C. (1988) Slowing of synapse elimination by a-bungarotoxin superfusion of the neonatal rabbit soleus muscle. Neuron, submitted for publication. Callaway, E. M. and Van Essen, D. C. (1988) Synapse elimination is slowed by partial postsynaptic activity activity blockade in the neonatal rabbit soleus muscle. Soc. Neurosci. Abstr. 14, 179. DeYoe, E. A., Felleman, o. J., Knierim, J. J., Olavarria, J. and Van Essen, D. C. (1988) Heterogeneous subregions of macaque visual area V4 receive selective projections from V2 thin stripe and interstripe subreigons. Invest. Ophthalmol. Vis. Sci. 29, 115 (Suppl.). DeYoe, E. A. and Van Essen, D. C. (1988) Concurrent processing streams in monkey visual cortex. Trends in Neurosci. !I, 219-226. Fe11eman, D. J., DeYoe, E. A., Knierim, J. J., Olavarria, J. and Van Essen, D. C. (1988) Compartmental organization of projections from V2 to extrastriate areas V3, V3A, and V4t in macaque monkeys. Invest. Ophthalmol. Vis. Sci. 29, !15 (Suppl.). Maunsell, J. H. R. and Van Essen, D. C. (1987) The topographic organization of the middle temporal visual area in the macaque monkey: Represen tational biases and the relationship to caUosal connections and myeloarchitectonic boundaries. J. Comp. Neurol. 266, 535-555. FACILITIES 271 BIOPOL YMER SYNTHESIS FACILITY Supervisor: Suzanna J. Horvath Staff: Christine A. Acklin, Joseph E. Curtis, In addition to deoxyoligonucleotide and peptide Vicky L. DeLoff, Peter C. W. Gaines, Jill W. Jenik synthesis, high molecular weight nucleic acids have We have continued to provide sophisticated been isolated from plasmid, blood and various cells and chemical synthesis of biologically active molecules to tissues by using our automated Nucleic Acid Extractor the scientific community of Caltech, both on routine (AB!, Model 340A). In collaboration with Prof. L. bases and through a number of successful collaborative Hood's group, the instrument has been extensively research projects (Table 1). Special effort has been tested and now it is available for a wide variety of made to further improve the performance of our applications. The instrument-reagent system with our automated synthetic and analytical techniques and to modified procedure has provided high quality purified find novel, creative utilization of synthetic bio DNA-preparations as a result of 534 extractions polymers in biological and chemical research. carried out in the past year (Table I and Table 2). Table 1 Biopolymer Synthesis and DNA Extraction (April 1987 - April 1988) Deoxyoligonucleotide synthesis: 1,748 oligos %,243 bases (109 mix: 107 I, 4 BIO, 2 doped; 26 LRG SC) Peptide synthesis: 153 peptides 3,532 amino acids DNA extraction: 534 extractions mix: degenerate bases; I: deoxyinosine; BIO: biotinylated; LRG SC: large scale. Table 2 Sample Results of AB! DNA Extractor Amount Total Purity Loaded for DNA OD unit * DNA Cell Types Extraction Yield (x = 260/280) Sizes 6 130-150 µg 1.7-1.8 EBY Transformed B Lymphocytes 10 x 10 cells 25-40 kb 23-30 x 106 cells 300-350 µg 1.6-2.0 Mice Tumor T Cells 3 x 107 cells 200-250 µg 1.7-1.8 Range of 200-1200 kb Peak at 600 kb • Theoretical value: 1.8 272 CELL SORTING FACILITY order to obtain a purified population of sympatho Supervisor: Ellen Rothenberg adrenal precursor cells from day 14.5 embryonic rats, Staff: Rochelle A. Diamond, Patrick F. Koen to study the ontogeny of expression of the epinephrine pathway enzyme phenylethanolamine-N-methyl The Cell Sorting Facility provides sophisticated transferase, a marker of chromaffin cell instrumentation as well as advisory assistance and differentiation. Carol Wuenschell of the Anderson collaboration for cellular analysis and separation group has sorted out a subset of chick embryo limb bud methodologies. We utilize multiple correlated cells that stain with HNK-l against the neural crest parameters such as one- and two-color fluorochrome cell-surface antigen. Derek Stemple of the Anderson detection, forward light scatter to measure size, side group has used HNK-1 to sort premigratory neural angle light scatter to measure granularity, and crest cells from quail embryos. He has found that propidium iodide uptake to allow dead cells and debris some of the progeny of these cells are capable of to be excluded from the analysis. In addition, we now acquiring the adrenergic phenotype, an early event in routinely sort up to two populations based on any of sympathoadrenal differentiation. Derek has also used these parameters With high-efficiency recoveries of HNK-1 and the monoclonal antibody B-2 to sort cells viable cells. at a later stage from rat sympathetic ganglia, and has During the past year, the facility has collaborated found that B-2+ cells are almost entirely neuronal with several investigators to extend the practical whereas HNK-1 + cells have the capacity to become application of flow cytometry to their laboratories. sympathetic neurons or adrenal chromaffin cells in Donna Livant of the E. Davidson group is currently culture. Gary Holt of the Anderson group is using the sorting the pigment cells of dissociated 72-hour sea sorter to quantitate expression of NG-CAM, a cell urchin embryos, on the basis of their endogenous red surface molecule that is expressed at low levels in the pigment that emits fluorescence at 734 nm when cell line PC-12 and that is inducible by Nerve Growth excited at 488 nm with the Argon laser. She hopes to Factor (NGF). The Rothenberg group is using flow understand their developmental fate in the embryo and cytometry extensively to characterize specific ultimately to isolate specific mRNAs of these cells. subpopulations and to examine inducibility of certain Two distinct pigment cell populations have been cell-surface receptors in the developing mouse thymus observed. Michael King of the Attardi group has and spleen. stained human cell lines with Rhodamine 123 to We are endeavoring to upgrade our current measure uptake of the dye into mitochondria. Kasturi capabilities by modifying our present cytofluorograph Puranam of the Revel group has been measuring gap to detect third and fourth color parameters. We also junction function in Novikoff cells using the dye hope to provide IBM compatibility for list mode data lucifer yellow to measure transfer from loaded cells to reduction via the Bionet local area network in the virgin cells. Joan Goverman of the Hood group has Biology Division. Research and development of these looked at cell surfACe expression of chimeric T-cell projects is under way. In addition, a second state-of receptors, replacing the V region with the the-art sorter is now contemplated. immunoglobulin V region in order to make T-cell receptors specific for soluble ligand. Jim Urban of the Hood group has been looking at V -specific antibodies MONOCLONAL ANTIBODY FACILITY 8 to analyze clones specific for myelin basic protein. Supervisor: Paul H. Patterson Susan Teplitz of the Anderson group is establishing cell Staff: Ker-Hwa Ou, Julianna Krist lines from embryonic sympathoadrenal precursors by Monoclonal antibodies (mAbs) of defined specificity sorting rat embryonic adrenal gland cells with an provide exquisite probes in biomedical research. antibody that stains the sympathoadrenal lineage During the past year we have successfully generated (HNK-1). The cells are then infected with a retrovirus mAbs for the following groups: Carl Parker containing an immortalizing oncogene. Arie (Drosophila heat shock factor); Keith Harshman (yeast Michaelson of the Anderson group is using the sorter in enhancer protein !); David Anderson (SCG I 0, by 273 applying the cyclophosphamide suppression method to research to biologists. It is now possible to study gene fusion protein SCGlO-TrpE and suppress against TrpE); regulation in the intact animal as well as in cultured Jim Bower (adult rat crus II region of the cerebellum, cells. Embryologists have used transgenic mice to by applying the cyclophosphamide suppression method identify genes that play a crucial role in to suppress mouse against occipital cortex); Carol development. Transgenic animals may also serve as Miller (Drosophila melanogaster ganglia); Jean-Paul models for the study and treatment of genetic Revel (47 kD rat heart tight junction protein). diseases. In addition, we are also working with Kevin Sweder, The process by which foreign genes are introduced Linda Iverson, James Sabry, Warren Kibbe, Karen into the germline of mammals involves several Sitney, Martin Budd, Sigrun Korsching, Karina intricate manipulations. Fertilized eggs (80 µm) are Schimmerling, Bill Dreyer, and Herschel Mitchell, harvested from the mouse oviduct about 16 hours postfertilization at a time when the male and female pronucleus have swollen but not yet fused. DNA is injected into one of the pronuclei with a finely (I µm) APPLIED SEQUENCING FACILITY drawn out glass pipette. Eggs surviving the injection develop into two-cell embryos in a period of about 12 Supervisor: David B. Teplow to 16 hours. The injected two-cell embryos are then Staff: John Raes, Haul Wong, Tammy Bauer transferred to the oviduct of a pseudopregnant foster The applied sequencing facility celebrated its first female. Three weeks after birth, the pups are year of existence in March 1988. During our first year screened for the integration of the foreign DNA. Our we have sequenced more than 250 peptides and collective data indicates that 0.7% of the injected proteins and performed thousands of amino acid eggs develop into transgenic animals that express the analyses. We have also consulted on a large number of transgene, where the total number of eggs injected projects involving protein/peptide structure analysis, was 14,000. especially those in which protein modifications were Researchers wishing to participate in the program being studied. We have begun providing limited submit a research proposal to the Steering Committee peptide mapping services but expect to expand this who then allots them time on the work stations as well service substantially in the coming year. We will also as a training period With Jessica Dausman. The work be able to provide computerized protein sequence stations each consist of a dissecting microscope, a analysis services. In addition, we hope to double our Nikon inverted microscope with Nomaski optics and a protein sequencing capacity. We encourage active left and right hand micromanipulator. The researchers collaboration between ourselves and our users so that are charged based on the number of mice they are appropriate methods may be applied and/or developed keeping. This charge, which is subsidized, includes the to answer each user's unique question(s). With these cost of training, supplies and, mice needed for the interactions, and our own research efforts (see experiment. It should be noted that embryos from Abstract Nos. 95-98), we expect to provide established transgenic lines can be cyopreserved using consistently superior analytical capabilities to the our speciaFzed equipment, thus minimizing the number research community. of mice that need to be maintained. The research groups presently using T AFC!T are: Anderson, Lazarides, Hood, Simon and Wold (see individual TAFCIT: The Transgenic Animal Facility reports). So far, 12 postdoctoral fellows and two Supervisor: Carol Readhead graduate students have been trained in the facility. Steering Committee: Melvin Simon (Chairman), Although it is tempting to allow a few skilled Barbara Wold and Lee Hood/Readhead Staff: Jessica Dausman, Eef Goedemans, Anita technicians to produce transgenic mice "to order," we Ackerman, Jorge Mata felt it was more important to serve as a teaching as The ability to introduce novel genes into the well as a research facility. mammalian genome has opened up exciting areas of Recently, we set up a laboratory in TAFClT for 274 producing transgenic mice using embryonic stem cells. This is an alternative to the microinjection method but it has much greater potential. Embryonic stem cells (ES) are transfected with the DNA of interest tagged with a selectable marker. Cells that have been positively idientified as having integrated the foreign DNA are then injected into a blastocyst where they become part of the developing embryos, contributing to all the tissue types including the germ cells. Recently, it has been shown that exogenous DNA, having sequences in common with its target, can be usd to correct (Smithies et al., 1985; Doetschman et al., 1987) or disrupt (Thomas and Capecchi, 1987) a gene. In both studies a gene was modified in pluripotent embryonic stem cells. This work opens the way to targeting the genes and manipulating the mammalian genome in predetermined ways. References: Doetschman, T ., Gregg, R. G., Maida, N., Hooper, M., Melton, D., Thompson, S. and Smithies, 0. (1987) Nature 330, 576-578. Smithies, 0., Gregg, R. G., Boggs, S. S., Koralewski, M. A. and Kucherlapati, R. S. (1985) Nature 317, 230-234. Thomas, K. and Capecchi, M. (!987) Cell 51, 503-512. GRADUATES FINANCIAL SUPPORT 277 GRADUATES Twenty students in Biology were awarded the B.S., M.S. or Ph.D. degree in June 1988. Names, degrees conferred and titles of doctoral theses are as follows: Bachelor of Science David John Bruning, B.S. Ali Reza Lashgari, B.S. with honor Tylis Y. Chang, B.S. with honor Phyllis Cheri Pugh, B.S. with honor David Michael Goedecke, B.S. Jason Edward Stewart, B.S. Adam Kalmon Greenblatt, B.S. with honor Jeffrey Decker Tekanic, B.S. with honor Kristine R. Koh, B.S. with honor Miriam Sharon Zucker, B.S. Master of Science Keith A. Matthews, M.S. Doctor of Philosophy Edward Matthew Callaway, Ph.D. Regulation of Michael Paul King, Ph.D. Studies of human mito competitive interactions during neuromuscular chondria. I. Steady-state levels and metabolic synapse elimination. properties of the mitochondrial tRNAs. II. Injection of mitochondria into human cells leads Caren Chang, Ph.D. Molecular genetic studies in to a rapid replacement of the endogenous mito Arabidopsis tha!lana: I. Complementation of an chondrial DNA. alcohol dehydrogenase mutant by transformation. II. A restriction fragment length polymorphism map Christopher Hayes Martin, Ph.D. Evolution and of the genome. expression at the 68C glue gene cluster of Drosophila. Mark David Garfinkel, Ph.D. Structural and functional studies of the 68C glue protein gene cluster of Stephen G. Miller, Ph.D. Brain type II calcium and Drosophila melanogaster. calmodulin-dependent protein kinase: Characteri zation of a brain region-specific isozyme and Chang Soo Hahn, Ph.D. Structure-function relation regulation by autophosphorylation. ships in the structural proteins and in the RNAs of alphaviruses and flaviviruses. James Martin Soha, Ph.D. Specificity and competition during maturation of neuromuscular synapses. Alexander Kamb, Ph.D. Molecular biology of Shaker, a Drosophila gene that encodes multiple potassium channel components. 278 FINANCIAL SUPPORT The financial support available for the work of the Division of Biology comes from many sources• the Institute' general ~udget and e.ndowment. a~d special endowment funds; from gifts, grants or contracts f~om individualss corporat1ons, foundations, assoc1at1ons, and U.S. gov:ernment agencies. ' Rita Allen Foundation John Norris Curry Gordon and Alzheimer's Disease and Related Disorders Assoc., Inc. Jessie Kennicott Gordon Trust American Cancer Society E. S. Gosney Fund American Foundation for AIDS Research Lawrence A. Hanson Foundation Hughes Aircraft Fellowship American Heart Ass_ociation American Society for Engineering Education Italian Government Postdoctoral Fellowship Earle C. Anthony Fellowship James Irvine Foundation Applied Biosystems Mrs. Evelyn Ward Johnson Arthritis Foundation Johnson & Johnson Mr. Victor Atkins Joint Tactical Fusion Program Australian Medical Foundation Fellowship Mr. William M. Keck II Myron A. Bantrell Fellowship Mrs. William M. Keck Jr. The Donald E. and Delia B. Baxter Foundation The Esther A. and Joseph Klingenstein Fund, Inc. Beckman Fund Leukemia Society of America Dr. Giuseppe Bertani Life Sciences R'esearch Foundation Anne P. and Benjamin F. Biaggini Lockheed Corporation MacArthur Foundation Bing Endowment Fund, Inc. Biomedical Research Support Grant (NIH) March of Dimes Lucille P. Markey Charitable Trust Bionational Agricultural Research and Development The James G. Boswell Foundation Ms. Grace M. Mayer Ethel Wilson Bowles and Robert Bowles Memorial Fund The Helen G. and Arthur McCallum Fund California Foundation for Biochemical Research The McKnight Foundation Caltech President's Fund The McKnight Endowment Fund for Neuroscience Cancer Research Institute, Inc. Merck & Co., Inc. Carnegie Institution of Washington Merck Sharp & Dohme Research Laboratories Centre National de la Recherche Scientifique, France Li Ming Scholarship Charles B. Corser Fund Monsanto Company Albert and Kate Page Crutcher Fellowship Fund Francis L. Moseley Fund Mrs. Max Delbruck Muscular Dystrophy Associations of America, Inc. Deutsche Forschungsgemeinschaft National Cancer Institute Directors Developmental Fund, JPL National Foundation for Cancer Research The Camille and Henry Dreyfus Foundation, Inc. National Institutes of Health, USPHS Joseph Drown Foundation National Multiple Sclerosis Society Sherman Fairchild Foundation National Science Foundation Mrs. George A. Feigen NATO Lawrence L. and Audrey W. Ferguson Natural Sciences and Engineering Research Council of Canada John Douglas French Foundation Department of the Navy, Office of Naval Research Frank and Laura Frlan Ne.therlands Organization for the Advancement of Fulbright Grant Pure Research (N. W.0.) The Anna Fuller Fund Mr. C. Ed Nix General Electric Foundation 279 Pandex Laboratories, Inc. Harry and Grace Steele Foundation Ralph M. Parsons Foundation DOr'is Jones Stein Foundation Ann Peppers Foundation Mrs. Jean Stein Gustavus and Louise Pfeiffer Research Dr. and Mrs. Michael Strieby Foundation Swedish National Science Research Council Max Planck Society System Development Foundation Charles Lee Powell Foundation Uehara Memorial Foundation The Procter & Gamble Co. Unisys Corporation Mrs. Josephine C. Rinne University of California University-Wide Task The Rockefeller Foundation Force on AIDS Rockwell International Corporation The Upjohn Company Gordon Ross Medical Foundation Veterans Administration The Rotary Foundation of Rotary International The Del E. Webb Foundation The Rothschild Fellowship Martin Webster Royal Dutch Academy of Sciences (K.N.A.W.) Jean Weigle Memorial Fund Albert Billings Ruddock Fund The Weingart Foundation Damon Runyon-Walter Winchell Cancer Fund Chaim Weizmann Postdoctorate Fellowships Searle Scholars Program, Chicago Community Trust for Scientific Research The Whitaker Foundation The Seaver lnstitute Helen Hay Whitney Foundation Evelyn Sharp Fellowship Cornelius and Jeanne Wiersma Trust Shell Companies Foundation, Inc. Alfred P. Sloan Foundation World Health Organization Ralph L. Smith Foundation 280 AUTHOR INDEX (by page number) Callaway, E. M., 265-267 Fox, J. F., 264 Abelson, J. N., 117 Calzone, F. J., 19-21, 23 Fox, P. T., 242 Adams, P. R., 252 Cameron, R. A., 25, 26 Franks, R. R., 20 Adolphs, R., 224 Campbell, J. L., 135, 136, 140 Fraser, S. E., 26 Aebersold, R., 43, 53-57, 229 Carlyle, D. A., 75 Frey, A., 81 Ahmed, R., 15 5 Carnahan, J. F ., 229 Fromson, D. R., 27 Allman, J.M., 241, 242, 244-246 Catterall, W. A., 192 Fruh, K., 65 Altman, E., 176 Celniker, S. E., 78, 79 Fryxell, K. J., 87 Alziari, S., 131 Chait, B. T., 47, 48 Fujita, I., 225 Amatruda, T. T., 104 Chang, C., 84, 85 Anderson, C. H., 264 Chang, T .-H., 123 Anderson, D. J., 203, 205-207, Charmley, P., 32 Gage, F ., 230 209 Charnet, P., 194 Gaines, G., 131 Anderson, R., 20, 22 Chen, W. Q., 53, 63, 64 Garfinkel, M. D., 90 Arakelian, P ., 62-64 Cheng, S.-C., 122 Garner, J. A., 217 Arden, B., 33 Cheroutre, H., 42, 43 Garrity, P.A., 161 Aroian, R. V., l 11 Chien, C.-B., i 97 Gatti, R. A., 32 Assad, C., 223 Chomyn, A., 132,133 Gautam, M., 235 Atkinson, R. D., 217 Clark, M. W., 120 Gautam, N., 103 A ttardi, G., 128 Clark, S. M., 47, 53, 62-64, 106 Gese, E. F., 62 Auld, V. J., 192, 193 Clark-Lewis, !., 49 Girard, M., 52 Austin, B. J., 178-181 Clawson, L. E., 50 Glantz, D. S., 82, 83 Concannon, P. J., 32, 45 Glasgow, A. C., 107 Cox, J. V., 69 Goldin, A. L., L92, 193 Bach, A., 65 Crank, W. D., 197 Gomez, C., 31 Baker, R. H., 77, 78 Cusick, M. E., 125 Gordon, C., 137, 138 Baklayan, G., 53, 54, 56 Cutting, A. E., 19 Goverman, J. M., 35 Ballinger, D. G., 214, 215 Czyzyk, L. L., 194 Griffin, D. E., 148, 149 Banerjee, U., 213, 216 Banik, J. J., 221 Banroques, J ., l 23 Dalbadie-McFarland, G., 123 Hackett, R. W., 215 Banta, L. M., 172 Dalrymple, J. M., 154 Hahn, B. H., 51, 52 Barber, L. A., 113 Dausman, J. A., 163 Hahn, C. S., 148-150, 155 Barker, N. A., 142 Davidson, E. H., l 9 Hahn, Y. S., 146, 147, 149, 150, Baron, W. F ., 25, 28 Deerinck, T., 214 154 Baylor, D., 199 Delbruck, T ., 264 Halsell, S. R., 80, 81 Beall, S. S., 32 de! Mazo, J., 104, 105 Hamilton, B. A., 92 Bedwell, D. M., 174 DeModena, J. A., 170 Hamilton, C. R., 258, 259 Benzer, S., 210-216 Dervan, P. B., 107 Hanna, M. M., l l 9 Bernander, 0. J., 265 DeYoe, E. A., 261-263 Harcus, D., 32 Bertani, G., l 40 Diamond, R. A., 97 Hardy, W.R., 147, 148 Bertani, L. E., l 40 Ding, D., 82 Harrington, M., 56 Bhalla, U. S., 200 Dohadwala, M., 95 Harshey, R., 64 Biddison, W. E., 32 Dong, D., 177 Hauschka, S., 159 Birren, B. W., 62, 106 Donnellan, S. M., 87 Hecht, S., 127 Blackburn, K. N., 37, 39, 40 Doupe, A. J., 227 Herman, P. K., 172 Bleecker, A. B., 87 Dreyer, W. J., 141, 142 Herrup, K., 222 Bloom, S. E., 75 Dunn, J. M., 192 Hess, J. W., IOI Blumer, K. V., 196 Dunn, R. J., l 92, 193 Hill, R. J., 95, i l 2 Boggs, W. M., 149 Hill, R. L., 19, 20 Bond, V. C., 162 Hinton, D.R., 216, 218 Bourret, R. B., I 02 Eakle, K., 173 Ho, C. K., ll8 Bower, J.M., 219-223 Edens, J. E., 180 Hofmann, A., 90, 91 Bowers, J. E., 24 Ellisman, M. H., 214 Hoger, J. H., 193 Bowman, J. L., 84 Emr, S. D., 169 Hoh, J. H., 180, 181 Boyer, P. D., 97, 98 Holboke, A. E., 111, l 12 Britten, R. J., 25, 27, 28 Ho! thuizen, E., 39 Brokaw, C. J., 167, 168 Fabrizio, P., 121 Hood, L. E., JO Brorson, K. A., 42, 43 Fain, S. R., 23 Hoag, c. s. L., 22, 25 Brothers, L., 246 Feary, M.A., 96 Hoopes, L. M., 38 Brown, T. K., 190 Felleman, D. J., 261-263 Hopfield, J. J., 177 Bruning, D. J., 263 Fischer-Lindahl, K., 42 Horvath, S. J., 31, 34, 45, 107, Budd, M., 136, 137 Fisher, W.W., 80, 81 271 Bulleit, R. F., 185, 186 Fong, H.K. W., 103 Hough-Evans, B. R., 20, 22, 26 Burbeck, C. A., 250 Fong, T. M., 196 Hughes, K. T ., I 08 Burns, N. R., 72 Forman, J., 37 Hughes, P. J., 59 Fors, L., 43 Hunt, S. W., 42, 43 281 Hunter, T ., 56 Lenches, E. M., 150, 154 Nakayama, C., 64 Hyde, D.R., 212 Leonard, D. A. S., 190 Narasimhan, N., 129 Leonard, R. J., 194, 195 Nawa, H., 230 Lester, H. A., 191 Nelson, M. E., 220, 221, 223 Imrich, J., 213 Leung, P. C., 64 Neurath, A. R., 52 Isacke, C. M., 56 Levedakou, E., 32 Ngai, J. J., 73, 74 Iverson, L. E., 195, 233 Levinson, R. S., 152 Nickells, R. W., 21 Lewis, E. B., 77, 78 Nickerson, D. A., 40, 43 Lewis, K. D., 38 Niesters, H. G. M., 145, 146, 152 Jackson, A. C., 148 Li, G., 148 Nika, H., 53-55 Jameson, B. A., 51, 52 Li, Z., 177 Nishimura, M. I., 38 Jennings, V. L., 190 Liotta, A. S., 46 Normanly, J., 126, 127 Jentoft-Nilsen, B. R., 168 Lipscher, R. B., 60 Novak, T. J., 96, 97 John, S. A., 179 Lipshitz, H. D., 79-83 Johnson, J. E., 159, 160, 163 Livant, D. L., 19, 26 Jongeward, G. D., 111, 113 Live, D. H., 48 O'Brien, C. J ., 223 Journet, E.-P., 139 Lo, L.-C., 205, 206 Olavarria, J. F., 261-263 Julesz, B., 249 Lochrie, M.A., 102 Olds, M. E., 254-257 Loguercio Polosa, P., 131 Ollick, T., 127 Lopez, A. F., 4 9 Oosawa, K., 101 Kaiser, R. J., 57-61, 64 Loveland, B., 42 Orbach, H. S., 262 Kamb, A., 233 Lowry, R., 32 Ostrand-Rosenberg, S., 38 Kappes, J. C., 52 Luo, J., 254 Otto, B. J., 57 Kayyem, J. F., 142 Lustig, S., 148, 150 Keelan, D. J., 78, 79 Kempin, S. A., 84, 86 Palazzolo, M. J., 83 Kennedy, M. B., 185, 190 Ma, D., 138, 140 Pang, P. P.-Y., 86 Kent, S. B. H., 46-55, 63, 64 Ma, H., 84 Parker, K. F., 46, 47, 52, 63 Kim, C. S., 52 Mac Kellar, S. L., 57, 58 Patel, S. D., 132 Kim, J. K., 142 Mahanthappa, N. K., 207, 230 Patterson, P.H., 228-231, 272 King, M. P., 132 Mann, D. W., 37 Patton, B. L., 187, 188 Klionsky, D. J., 170 Margioris, A. N., 46 Pauletti, G., 134 Knierim, J. J., 261-263 Marshall, J., 192 Paulin, M. G., 222, 223 Koch, C., 250-254 Mascagni, P ., 51 Pechstedt, P. H., 259 Koen, P. F., 180 Mathers, P.H., 87, 92 Pepper, K. A., 98 Komatsoulis, G. A., 120, 127 Mathew, M. K., 236 Perry, G., 216, 218 Konishi, M., 224, 225, 227 Mathur, B., 251 Petersen, N. S., 14 3, 144 Kono, D. H., 31 Mayeda, C. A., 88, 89, 93 Pike, L., 29 Korber, B., 39 McCormack, K. J., 237 Pine, J., 197-199, 223 Korsching, S., 229 McDonald, C. T., 242, 244, 245 Pipes, G. D., 53-55 Koski, R., 162 Mcfarland, H.F., 32 Pollock, J. A., 211, 212 Kozlowski, M., 216, 218 Mcfarlin, D. E., 32 Pollock, J. D., 237, 238 Krafte, D. S., 192, 193 McGuinness, E., 246 Popko, B. J., 44 Kramer, T. J., 198 McGuire, K. L., 94 Preugschat, F., 154, 155 Krempin, M., 237 McMahon, R. J., 237 Prusiner, S. B., 65 Krieger, D. T., 46 McPheeters, D.S., 121 Puckett, C., 44, 45 Kronenberg, M., 33 Mead, C., 254 Puranam, R. S., 130, 180 Krose, B. J. A., 249, 250 Mecklenburg, K., 212, 216 Kruse, B., 130 Meister, M., 199 Kuhn, R. J., 145, 152 Mendel, J. E., 111 Raichle, M. E., 242 Kumar, V., 31, 34, 35 Mermod, N., 39 Ralph, H. E., 52 Kuo, C.-L., 36 Meyerowitz, E. M., 83, 84 Ramaswami, M., 235 Michelsohn, A. M., 208 Ramirez, C., 252 Miezin, F. M., 242 Ramlose, R. R., 259 Labarca, C. G., 194 Millaruelo, A. I., 231 Rao, M., 230 Lai, E. H. C., 33, 62, 64, 106 Miller, C. A., 216-218 Rao, P. E., 51 134 Miller, S. G., 187, 188 Rasnow, B., 221, 223 Lal, R., 179 Miner, J. H., 158, 163 Rauhut, R., 118 Landegren, U., 32, 61 Minor, J., 23, 25, 27 Readhead, C., 273 Landis, S., 230 Mitchell, H.K., 143, 144 Regehr, W., 198 Larson, L., 57 Molloy, S.S., 189 Renfranz, P. J., 213 Lashgari, A. R., 235 Mooney, R. D., 227 Revel, J.-P., 178-181 Laug, W. E., 35, 45 Moos, M., 65 Rhode, P. R., 136 Lawton, T. B., 252 Mora, B. N., 241 Rice, C. M., 146, 148, 150 Lazar ides, E., 68, 70, 7 5 Mori, N., 204, 205 Rich, R., 42 Leavitt, J., 55 Morrow, C. D., 52 Richards, S., 42 Lee, C. C., l 08 Moss, D. J., 34 Roach, J. L., 222 Lee, M., 221 Mueller, P.R., 160 Roark, M., 88-90 Lee, S.-W., 52 Robinson, J. S., 171 Leiserson, W. M., 216 Robinson, M. 0., l 05 282 Rodgers, J., 42 Tacke, R., 65 Xu, Q., 118 Rodriguez, M., 76 Takahashi, T. T., 224, 225 Roman, J.M., 142 Tanamachi, B. G., 197, 198 Yamada, W. M., 252 Rosenberg, S. A., 34 Tank, D. W., 177 Yamamori, T., 229 Rossi, C., 131 Tanner, N. K., 119 Yancey, S. B., 178-181 Rothenberg, E., 93-98, 272 Tanouye, M. A., 195, 232 Yang, J. A., 94, 98 Ruby, S. W., 122 Taplitz, S. J., 208 Yanofsky, M. F ., 84, 86 Rudnicka, M., 216-218 Tavtigian, S., 157, 163 Yoon, H., 139 Rudy, B. C., 193, 233, 237, 238 Taylor, K. D., 29 Yoshida, B. N., 206 Ryckebusch, S., 222 Tempst, P., 46 Yoshinaga, K., 46 Teplow, D. B., 64-66, 273 Yu, L., 195, 196 Theze, N. J., 19-21 Yuen, A. S., 62 Saavedra, R. A., 43, 58 Thiebaud, P.R., 19-21 Yun, S., 171, 174 Sabry, J. H., 229, 230 Thomas, K., 105 Yuweiler, A., 257 Sanders, J. z., 57-60 Thompson, J., 198 Sangiorgi, F. 0., 69, 74, 75 Thorner, J., 196 Sargent, J., 259 To, L.B., 49 Zaller, D., 33, 35 Sasaki, A., 46 Todo, T., 89, 90 Sato, S., 46 Trevarrow, W.W., 237 Schachner, M., 65 Tseng-Crank, J. C. L., 233, 234 Scherer, H., 65 Tsoulfas, P., 72 Schiller, D. L., 47, 48 Turk, E., 65 Schimmerling, E. K., 267 Schlesinger, M., 147 Schneider, J., 50 Ulker, N., 40, 41 Schrader, J. W., 49 Unnikrishnan, K., 177 Schwarz, E. M., 215 Urban, J, L., 31 Sculley, T. B., 34 Segesman, K., 43 Selk, L. M., 46, 47, 50 Vadas, M. A., 49 Sereno, M. I., 242, 244 Valinsky, J., 52 Seto, B., 52 Vandenbergh, D. J., 205 Shaw, G. M., 51, 52 Van Essen, D. C., 253, 260 Shine, H. D., 44 Vermeire, B. A., 258, 259 Shinkawa, 0., 46 Vernooy, B., 36, 61 Shirako, Y., 151 Vida, T. A., 173 Shizuya, H., l 06 Vijay Raghavan, K., 89, 93 Shojaeian-Zansani, M. H., 222 Vijayraghavan, U., 118, 124 Simon, M. !., 99, 101-108 Vinayak, R. S., 60 Sinsheimer, R. L., 25 Volman, S. F., 225, 226 Sitney, K., 137 Sluka, J. P ., I 07 Smith, L. C., 24 Wagner, F. H., 224 Smolik-Utlaut, S. M., 79 Wagner, R. A., 163 Smyth, D. R., 85 Wallace, C. J., 51 Soha, J. M., 266 Walter, A. E., 197 Soloski, M., 37 Wang, K., 33, 35, 45, 62 Song, C. T., 113 Wang, K.-s., 153, 154 Spence, C. F., 62-64 Wang, T., 251 Sperry, R. W., 258 Wehmeier, U. J., 253 Stack, J. H., 71, 72 Werman, S. D., 27 Stein, R., 205 Wernicke-Jameson, D., 53 Stemple, D. L., 207 Westaway, S. K., 119, 120 Sternberg, P. W., l 09-111 Wettenhall, R. E. H., 54 Stout, D. B., 28 White, P. M., 95 Strauss, E. G., 148-150, 152, 153 Whitney, M. A., 93 Strauss, J. H., 144, 150, 155 Whittaker, K. L., 23 Strecker, T. R., 80 Wilkes, J., 48 Strick, N., 52 Wilkie, T., I 04 Strobel, S., 174 Williams, C., 218 Stroynowski, I., 36-41 Wilson, M. A., 220 Strumwasser, F., 47, 48 Wilson, R. K., 31, 62 Sucov, H. M., 23 Wold, B., 156, 159 Suzue, T., 231 Wong, H., 66 Sweder, K. S., 136 Woo, D. D.-L., 48 Woods, C. M., 70, 71, 75 Woolf, T. M., 33 Wright, P. C., 247 Wuenschell, C. W., 204, 209 283 FINANCIAL SUPPORT INDEX (by page number) Rita Allen Foundation, 156 James Irvine Foundation, 191 Alzheimer's Disease and Related Istituto Veneto di Scienze, Lettere ed Disorders Assoc., Inc., 228 Arti-Fondazione Protti, 128 American Cancer Society, 30, 77, 79, 99, 117, 135, Italian Government Postdoctoral Fellowship, 128 169, 19l American Foundation for AIDS Research, 30 American Heart Association, 68, 191, 228 Johnson & Johnson, 30 Earle C. Anthony Fellowship, 219 Joint Tactical Fusion Program, 219, 25l Apple Computer, lnc., 219 Arthritis Foundation, 30 Australian Medical Foundation Fellowship, 68 The Esther A. and Joseph Klingenstein Fund, Inc., 191 Myron A. Bantrell Fellowship, 210 Leukemia Society of America, 30 The Donald E. and Delia B. Baxter Foundation, 30 Life Sciences Research Foundation, 83, 210 Beckman Fund, 19 Lockheed Corporation, 219 AT&T Bell Laboratories, 249 Anne P. and Benjamin F. Biaggini Professorship in Biological Sciences, 99 MacArthur Foundation, 249 Bing Professorship in Behavioral Biology, 224 March of Dimes, 77, 135 Biomedical Research Support Grant (NlH), 19, 30, 83, Lucille P. Markey Charitable Trust, 19, 30, 68, 77, 79, 93, 128, 156, l78, 185, 191, 203, 219, 228, 83, 93, 99, 109, 128, 141, 156, 169, 178, 185, 191, 241, 250, 258 203, 210, 219, 224, 228, 232, 241, 260 Bionational Agricultural Research and Helen G. and Arthur Mccallum Fund, 228, 260 Development, 210 The McKnight Endowment Fund for Neuroscience, 224 The James G. Boswell Professorship in The McKnight Foundation, 185, 228, 232 Neuroscience, 210 Medical Research Council of Canada, 228 Ethel Wilson Bowles and Robert Bowles Merck Sharp & Dohme Research Laboratories, l 17 Professorship in Biology, 30 Li Ming Scholarship, 79 Monsanto Co., 30 Francis L. Moseley Fund for Cancer Research, 30 California Foundation for Biochemical Research, 79 Muscular Dystrophy Associations of America, Inc., 68, Caltech President's Fund, l 9 l 191, 228 Cancer Research Institute, Inc., 30, 93 Carnegie Institution of Washington, 19 Centre National de la Recherche Scienti!ique, l35 National Cancer Institute, 30 Norman Chandler Professorship in Cell Biology, l 9 National Institute of Mental Health, 258 Charles B. Corser Fund for Biological Research, l 9 National Institutes of Health, USPHS, l 9, 30, 68, 77, Albert and Kate Page Crutcher Fellowship Fund, 228 79, 83, 93, 99, 109, 117, 128, l35, l41, 143, 144, 156, 167, 169, 178, 185, 191, 203, 210, 219, 224, 228, 232, 241, 260 Deutsche Forschungsgemeinschaft, 79 National Science Foundation, 19, 30, 68, 77, 83, 99, Directors Developmental Fund, JPL, 219, 250 109, ll7, 135, 144, 156, 191, 203, 210, 219, 228, The Camille and Henry Dreyfus Foundation, Inc., 68 251, 260 Joseph Drown Foundation, l85, 191, 219, 228 National Science Foundation, "Presidential Young Investigator Award," 169 Natural Sciences and Engineering Research Council Educational Foundation of America, 219 of Canada, 144, 169, 258 Department of the Navy, Office of Naval Research, 30, 99, 117, 141, 177, 219, 249, 251, 260 Fairchild Scholars Program, 249 Office of Naval Research and Defense Advanced John Douglas French Foundation, 68 Research Projects Agency, 135 Fulbright Grant, 99 Netherlands Organization for the Advancement Anna Fuller Fund, 68 of Pure Research (N. W.0.), 30 C. Ed Nix Fund, 258 The General Electric Foundation, 83, 169 Gordon Trust, 241 Pandex Laboratories, Inc., 30 E. S. Gosney Fund, 68, 144 Ralph M. Parsons Foundation, 251, 260 Pew Memorial Trust, 185 Gustavus and Louise Pfeiffer Research Lawrence A. Hanson Foundation, 210, 241 Foundation, 185, 228, 232, 260 Hughes Aircraft Fellowship, 250 Max Planck Society, 224 Charles Lee Powell Foundation, 251 The Procter & Gamble Co., 30, 68, 83, 93, ll 7, 128, 169, 178, 191 284 TRW Corporation, 219 The Rockefeller Foundation, 203 Rockwell International, 251 Gordon Ross Medical Foundation, 144, 210, 224, 228 Uehara Memorial Foundation, 224 The Rotary Foundation of Rotary International, 128 Unisys Corporation, 191 Royal Dutch Academy of Sciences (K.N.A.W.), 30 University of California University-Wide Task Albert Billings Ruddock Professorship, 178 Force on AIDS, 93 Damon Runyon-Walter Winchell Cancer Fund, 99, 117, The Upjohn Company, 30 203, 210 Veterans Administration, 19 Searle Scholars Program, The Chicago Community Trust, 169, 203 The Seaver Institute, 30 The Del E. Webb Foundation, 191, 210, 219, 232 Evelyn Sharp Fellowship, 224, 232 The Weingart Foundation, 30 Alfred P. Sloan Foundation, 19, 232, 241, 251 Weizmann Fellowship, 210 Ralph L. Smith Foundation, 258 The Whitaker Foundation, 219 Grace C. Steele Professorship in Helen Hay Whitney Foundation, 83, 169 Molecular Biology, 128 World Health Organization, 144 Doris Jones Stein Foundation, 258 Sundry Donors for Cancer Research, 30 Swedish National Science Research Council, 30 System Development Foundation, 191 A gallery of electron microscopic images of the yeast spliceosome particle purified by the double glycerol gradient purification procedure. Immediately upon fractionation of the final 100 mM KCl-containing gradient, glutaraldehyde was added to each fraction to make a concentration of 0.3%. The radioactivity profile was determined and the 405 peak fractions were stained for electron microscopy by the single-layer carbon method. The average size of the ovoid particle on the left side of the gallery was 20 x 23.5 ± 1.5 nm. The average size of the more circular particle on the right side of the gallery was 20 x 20 ± 1.5 nm. Bar= 25 nm. Reprinted from Clark, M. W. and Abelson, J., 1988, EMBO J. 7(12), in press.