Huu Tien Nguyen

DIVERSITY, CHARACTERISATION, AND DESCRIPTION OF KNOWN AND NEW PLANT-PARASITIC NEMATODES FROM SOME EXOTIC PLANTS IN BELGIUM

Huu Tien Nguyen

Student number: 01608112

Promoter(s): Prof. Dr. Bert Wim, Prof. Dr. Wilfrida Decraemer

A dissertation submitted to Ghent University in partial fulfilment of the requirements for the degree of International Master of Science in Agro- and Environmental Nematology

Academic year: 2016 - 2018

Contents Chapter 1: Molecular and morphological characterisations of a new root-lesion nematode, Pratylenchus n. sp. (Tylenchomorpha: Pratylenchidae) from Belgium ...... 1 Materials and methods ...... 3 SAMPLING AND NEMATODE EXTRACTION ...... 3 MORPHOLOGICAL CHARACTERISATION ...... 3 MOLECULAR CHARACTERISATION ...... 4 CLUSTER ANALYSIS ...... 6 Results ...... 6 MEASUREMENTS ...... 6 DESCRIPTION ...... 8 MOLECULAR CHARACTERISATION ...... 11 DIAGNOSIS AND RELATIONSHIPS ...... 15 TYPE HOST AND LOCALITY ...... 20 TYPE MATERIAL ...... 20 Discussion ...... 20 Acknowledgment ...... 23 References ...... 23 Chapter 2: Survival of the tropical root-knot nematodes Meloidogyne incognita (Kofoid & White, 1919) (Chitwood, 1949) Whitehead, 1968 (Nematoda: Meloidogynidae) in Belgium ...... 27 Materials and methods ...... 30 SAMPLING AND NEMATODE EXTRACTION ...... 30 MORPHOLOGICAL CHARACTERISATION ...... 30 MOLECULAR CHARACTERISATION ...... 30 Results ...... 31 SYMPTOMS OF HOST PLANT ...... 31 MORPHOLOGICAL CHARACTERISATION OF M. INCOGNITA IN BELGIUM ...... 32 MOLECULAR CHARACTERISATION ...... 34 HOST AND LOCALITY ...... 39 SPECIMEN VOUCHER ...... 39 Discussion ...... 39 Acknowledgement ...... 42 References ...... 42 Chapter 3: Description of a new species of Rotylenchus and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae) ...... 45 Materials and methods ...... 47 SAMPLING AND NEMATODE EXTRACTION ...... 47 MORPHOLOGICAL CHARACTERISATION ...... 47 MOLECULAR CHARACTERISATION ...... 47 CLUSTER ANALYSIS ...... 49

Results ...... 50 Rotylenchus n. sp...... 50 MEASUREMENTS ...... 50 DESCRIPTION ...... 51 MOLECULAR CHARACTERISATION ...... 52 DIAGNOSIS AND RELATIONSHIPS ...... 57 TYPE HOST AND LOCALITY ...... 63 TYPE MATERIAL ...... 63 Rotylenchus buxophilus Golden, 1956 ...... 64 MEASUREMENTS ...... 64 MORPHOLOGICAL CHARACTERISATIONS OF ROTYLENCHUS BUXOPHILUS IN BELGIUM ...... 65 MOLECULAR CHARACTERISATION ...... 67 REMARKS ...... 68 HOST AND LOCALITY ...... 69 VOUCHER SPECIMENS ...... 69 Discussion ...... 69 Acknowledgment ...... 72 References ...... 72

Acknowledgements

I would firstly like to express my sincere and profound gratitude to my promoters, Prof. Wim Bert and Prof. Decraemer Wilfrida for their valuable comments, suggestions, and support throughout my study. Their guidance was really important and useful to improve my thesis. And, it was my luck to work under the guidance of leading nematological professors of the world. Their extensive experiences have made me really admire them.

I am also very grateful to Marjolein, Dieter, Rolish and everyone in the

Nematology Research Unit for giving time, laboratory facilities, and technical support during the working time in the lab to fulfill my thesis.

My very heartfelt thanks go to all of my colleges in my department, especially to

Dr. Phap, for their material and mental support during my course in Belgium.

Many thanks to the course International Master of Science in Agro- and

Environmental Nematology, and all professors in this course for providing me the valuable knowledge as well as VLIR-OUS scholarship for offering me the opportunity to study in Belgium. Finally, I am very thankful to Inge Dehennin and all of my classmates for their support throughout this course.

Huu Tien Nguyen | 2018

Chapter 1: Molecular and morphological characterisations of a

new root-lesion nematode, Pratylenchus n. sp. (Tylenchomorpha:

Pratylenchidae) from Belgium

Huu Tien Nguyen

Summary – Root-lesion nematodes, Pratylenchus spp., are one of the economically most important nematode groups. Currently, 102 valid species have been described over the world.

The combination of morphological analyses and molecular analyses based on D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA regions supported the establishment of a new

Pratylenchus species. The females of the new species are characterised by the following traits: low labial region with two annuli continuous to the body; en face belongs to group II sensu Corbett and Clark (1983) with submedian segments in triangular shapes fused with oral disc and separated from lateral segments; lateral field with four incisures at vulva level without areolation; robust stylet 15-17 µm long with rounded knobs; subcylindrical tail with smooth tail tip. The males are largely similar to the females, but they differ from the females by possessing the following features: partially areolated lateral field; slightly ventrally arcuate spicules (15-19 µm) with weakly cephalate; conical, elongate, and ventrally curved tail with a poorly protruding, crenate bursa.

Keywords – 28S, barcode, barcoding, cluster analysis, COI, D2D3, exotic plant, Hedychium greenii, ITS, maker, mtDNA, plant-parasitic, rDNA, systematic, taxonomy.

Root-lesion nematodes, Pratylenchus spp., are one of the economically most important nematode groups. They are migratory endoparasites and their infection can cause reduction of root growth, formation of lesions, necrotic areas, browning, and cell death; these damages

Huu Tien Nguyen | 2018

create favorable conditions for secondary attack of other pathogens such as soil fungi or bacteria (Jones et al., 2013).

Pratylenchus species are distributed worldwide, from Europe, Africa, Asian, North

America, South and Central America to Oceania and even Antarctica. Moreover, they are polyphagous plant-parasitic nematodes with a very wide host range from monocotyledon to dicotyledon plants (Castillo & Vovlas, 2007). At present, 102 valid species of Pratylenchus genus have been described over the world (Geraert, 2013; Hodda et al., 2014; Palomares-

Rius et al., 2014; Wang et al., 2015; Nguyen et al., 2017; Singh et al., 2018). The diversity of root-lesion nematodes in Belgium is relatively well investigated with 14 reported species namely Pratylenchus brzeskii Karssen, Waeyenberge & Moens, 2000, Pratylenchus convallariae Seinhorst, 1959, Pratylenchus crenatus Loof, 1960, Pratylenchus dellatrei Luc,

1958, Pratylenchus dunensis de la Peña, van Aelst, Moens & Karssen, 2006, Pratylenchus fallax Seinhorst, 1968, Pratylenchus flakkensis Seinhorst, 1968, Pratylenchus goodeyi Sher and Allen, 1953, Pratylenchus neglectus (Rensch, 1924) Filipjev & Schuurmans Stekhoven,

1941, Pratylenchus penetrans (Cobb, 1917) Filipjev & Schuurmans Stekhoven, 1941,

Pratylenchus pratensis (de Man, 1880) Filipjev, 1936, Pratylenchus pseudopratensis

Seinhorst, 1968, Pratylenchus thornei Sher & Allen, 1953, Pratylenchus vulnus Allen &

Jensen, 1951 (Steel et al., 2014; Janssen et al., 2017b).

The identification of Pratylenchus spp. is a difficult task due to the great number of valid species and their intraspecific variation. Castillo and Vovlas (2007) developed a very useful tabular identification key for Pratylenchus species based on 11 main morphological characteristics. Recently, 18S rDNA, ITS rDNA, D2-D3 of 28S rDNA, and COI mtDNA regions are being used extensively as molecular markers to identify species level and allow the detection of the cryptic species throughout plant-parasitic nematode groups (Blaxter et al.,

1998; Subbotin et al., 1999; Subbotin et al., 2003; Subbotin & Moens, 2006; Subbotin et al.,

Huu Tien Nguyen | 2018

2007; Holterman et al., 2009; Janssen et al., 2017a). According to Subbotin et al. (2008),

D2–D3 of 28S rDNA seems to be a better target than partial 18S rDNA for identification of species level in the genus Pratylenchus. Therefore, the makers of D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA regions are good makers for studying Pratylenchus species.

However, Janssen et al. (2017a) discussed the pitfalls of molecular-only approach in identifying Pratylenchus, including the presence of misassembled, mislabelled, unlabelled or misidentified sequences on GenBank. Therefore, it is necessary to involve both morphological and molecular approaches in characterising and identifying Pratylenchus species.

This study aims at describing a new Pratylenchus species from Belgium associated with an exotic plant, based on the combination of morphological and molecular analyses.

Materials and methods

SAMPLING AND NEMATODE EXTRACTION

After the removal of dead material layer, the soil and root samples were collected from the upper 30cm soil layer around the rhizosphere of Hedychium greenii at the Botanical garden of Ghent University. The nematodes were extracted from soil and roots by the modified Baermann tray method (Whitehead & Hemming, 1965).

MORPHOLOGICAL CHARACTERISATION

Nematodes were fixed in Trump’s fixative (2% paraformaldehyde + 2.5% glutaraldehyde in a 0.1 M Sorenson buffer (Sodium phosphate buffer at pH 7.3)) and transferred to anhydrous glycerin to make permanent slides following the method described by Singh et al.

(2018). Microphotographs and drawings were made from permanent slides using an Olympus

BX51 DIC Microscope equipped with a digital camera and a drawing tube. The measurements were calculated based on the obtained pictures using ImageJ 1.51.

Huu Tien Nguyen | 2018

Illustrator ® CS 3 was used to make the illustrations based on pencil drawings and SEM pictures. For scanning electron microscopy (SEM), nematodes in Trump’s fixative were subsequently washed 3 times in 0.1 M Sorenson buffer and 2 times in double-distilled water

(10 min each). In the next step, they were dehydrated by passing through a graded ethanol concentration series of 30, 50, 75, 95%, and 3 times of 100% (20 min each). In the last step, the specimens were critical point-dried with liquid CO2, mounted on stubs with carbon tabs and coated with gold (25 nm, Jeol 1200jfc) before observation with a JSM-840 EM (JEOL,

Tokyo, Japan) at 12 kV.

MOLECULAR CHARACTERISATION

The living nematodes were used to make temporary slides (one specimen per slide) for taking digital light microscope pictures as morphological vouchers. In the next step, the single nematodes was taken out of the temporary slide, washed with distil-water for 10 min, cut into 2-3 pieces and put in the Eppendorf tubes with 20µ of WLB (50mM KCl;10mM Tris pH 8.3; 2.5mM MgCl2; 0.45% NP 40 (Tergitol Sigma); 0.45% Tween 20). Subsequently, the samples were incubated at −20°C for at least 10 min, followed by adding 1μl proteinase K

(1.2 mg ml−1) before the incubation in a PCR machine for 1 h at 65°C and 10 min at 95°C and centrifugation for 1 min at 14000 rpm. Finally, the samples were stored at −20°C before running PCR (Singh et al., 2018).

The PCR reaction was done by using 23 µl of Mastermix (17µl Water; 2.5µl 10x buffer;

2µl MgCL2; 2.5µl Coralload; 0.5µl dNTP (10mM); 0.5µl Primer 1; 0.5µl Primer 2; 0.06µl

Toptaq) and 2µl DNA template for each sample. The primers DP391/501

(AGCGGAGGAAAAGAAACTAA/TCGGAAGGAACCAGCTACTA) were used to amplify the 5’-end of the D2-D3 of 28S rDNA region (Nadler et al., 2006) with the PCR reaction started at 94°C for 4 min, followed by 5 cycles of 94°C for 30 s, 45°C for 30 s, and

72°C for 2 min. This step was followed by 35 cycles of 94°C for 30 s, 54°C for 30 s and

Huu Tien Nguyen | 2018

72°C for 1 min and finished at 12°C for 10 min. For amplifying ITS rDNA region, the primers Vrain2F/Vrain2R

(CTTTGTACACACCGCCCGTCGCT/TTTCACTCGCCGTTACTAAGGGAATC) (Vrain et al., 1992) were used with the PCR reaction started at 94°C for 4 min, followed by 50 cycles of 94°C for 30 s, 54°C for 30 s and 72°C for 2 min. The cytochrome c oxidase subunit

1 (COI) gene fragment was amplified using the primers JB3/JB4

(TTTTTTGGGCATCCTGAGGTTTAT/ TAAAGAAAGAACATAATGAAAATG) following the protocol of Derycke et al. (2010). The PCR reactions were checked by gel electrophoresis. After that, the successful PCR reactions were purified and sequenced commercially by Macrogen Inc. (Europe).

The consensus sequences were obtained by assembling forward and backward sequences using GENEIOUS R11. The BLAST search was used to check for the closely related sequences from other species on GenBank (Altschul et al., 1997). Meloidogyne enterolobii

(KX823403) and Meloidogyne ichinohei (EF029862) were chosen as out-groups for D2-D3 of 28S rDNA sequences, Meloidogyne mali (KR535971) and Meloidogyne africana

(KY433429) were chosen as out-groups for ITS rDNA sequences, and Meloidogyne haplanaria (KU174206) and Meloidogyne enterolobii (KT936633) were chosen as out- groups for COI mtDNA sequences. Multiple alignments were made from selected sequences by using MUSCLE in MEGA 7 (Barry, 2011). The poorly aligned regions of the alignments were eliminated using Gblocks (http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks)

(Castresana, 2000; Dereeper et al., 2008). The best fit models were selected by using MEGA

7 based on BIC criterion (Barry, 2011). HKY+G model was chosen for all the datasets. The phylogenetic trees were created by using MrBayes 3.2.6 Add-in in GENEIOUS R11. The

Markov chains were set with 1 × 106 generations, 4 runs, 20% burn-in, and subsampling frequency was 500 generations (Huelsenbeck & Ronquist, 2001).

Huu Tien Nguyen | 2018

CLUSTER ANALYSIS

The Hierarchical Cluster analysis in Primer 6 was used to cluster 102 valid species and

Pratylenchus n. sp. into small groups. The species within one group are more similar to each other compared to other groups. This analysis based on Bray-Curtis similarity measure, the percent similarity between species defined by the average of multiple characters. 11 main characters were ranked according to Castillo and Vovlas (2007): A) Lip annuli: 1: two, 2: three, 3: four; B) Male: 1: absent, 2: present; C) Stylet length: 1: stylet<13μm, 2: stylet 13-

15.9μm, 3: stylet 16-17.9μm, 4: stylet 18-20μm, 5: stylet>20μm; D) Shape of spermatheca: 1: absent or reduced, 2: rounded to spherical, 3: oval, 4: rectangular; E) Vulva position, ratio V:

1: V<75%, 2: V=75-79.9%, 3: V=80-85%, 4: V>85%; F) Post-vulval uterine sac (PUS):

1:<16μm, 2: 16-19.9μm, 3: 20-24.9μm, 4: 25-29.9μm, 5: 30-35μm, 6:>35μm; G) Female tail shape: 1: cylindrical, 2: subcylindrical, 3: conoid; H) Female tail tip: 1: smooth, 2: striated, 3: pointed, 4: with ventral projection; I) Pharyngeal overlapping length: 1:<30μm, 2: 30-

39.9μm, 3: 40-50μm, 4:>50μm; J) Lateral field lines at vulval region: 1: four, 2: five, 3: six to eight; K) Lateral field structure at vulval region: 1: smooth bands, 2: partially or completely areolated bands.

Results

Pratylenchus n. sp.

MEASUREMENTS

See table 1.

Table 1. Morphometric data of Pratylenchus n. sp. from glycerin-fixed specimens. All measurements are in μm (except for ratio) and in the form: mean±s.d. (range).

Female Female Male

Holotype Paratypes Paratypes

Huu Tien Nguyen | 2018

n 1 15 10

510 ± 14.1 (497 - 504 ± 22.1 (475 - Body length (L) 527 527) 534) 19.9 ± 3.8 (13.3 - 23.7 ± 2.6 (21.1 - a= L/MBD 21.9 22.6) 28.1) b’= L/ Anterior end to the end of pharyngeal gland 4.5 4.1 ± 0.4 (3.8 - 4.6) 4.1 ± 0.2 (3.8 - 4.3)

19.0 ± 2.0 (16.6 - 19.8 ± 1.8 (17.6 - c= L/Tail length 18.8 22.0) 21.8) c’= Tail length/ABD 2 1.8 ± 0.3 (1.4 - 2.1) 1.9 ± 0.2 (1.6 - 2.3)

277 ± 32.4 (248 - V=Anterior end to vulva/L 77.4 78 ± 1.3 (76 - 79) 327)

Lip height 2.2 3 ± 0.4 (2 - 3) 3 ± 0.8 (2 - 4)

Lip width 8.7 8 ± 0.5 (8 - 9) 8 ± 0.5 (7 - 8)

Stylet length 17 16 ± 0.7 (15 - 17) 16 ± 0.5 (15 - 16)

Conus length 8.9 8 ± 0.5 (7 - 8) 8 ± 0.4 (7 - 8)

Shaft length 6 6 ± 0.5 (5 - 6) 6 ± 0.5 (5 - 6)

Knob height 2.1 3 ± 0.4 (2 - 3) 2 ± 0.4 (2 - 3)

Dorsal gland opening from stylet base 2.3 3 ± 0.5 (2 - 3) 3 ± 0.8 (2 - 4)

Anterior end to secretory-excretory pore 80 84 ± 8.1 (70 - 90) 85 ± 7.3 (72 - 92)

Anterior end to nerve ring 74 66 ± 7.8 (55 - 75) 59 ± 25.1 (8 - 74)

Anterior end to the end of pharyngeal gland 117 124 ± 8.2 (115 - 131) 123 ± 4.8 (115 - 129)

Pharyngeal gland overlapping 34 45 ± 12.3 (34 - 65) 36 ± 5.9 (28 - 43)

PUS (posterior uterine sac) 25 30 ± 6.5 (22 - 36) -

Max body diameter (MBD) 24 27 ± 6.5 (22 - 38) 21 ± 1.5 (19 - 23)

Body diam. at vulva 21 25 ± 5.4 (21 - 34) -

Anal body diameter (ABD) 14 16 ± 2.7 (13 - 20) 13 ± 1.0 (12 - 15)

Tail length 28 27 ± 2.2 (24 - 30) 26 ± 1.6 (23 - 27)

Hyaline length 4 4 ± 0.8 (3 - 5) -

Tail annuli number 22 20 ± 2.2 (17 - 22) -

Spicule length (along arc) - - 17 ± 1.4 (15 - 19)

Spicule width (mid - way) - - 3 ± 0.6 (2 - 4)

Gubernaculum length - - 6 ± 0.8 (5 - 7)

Huu Tien Nguyen | 2018

DESCRIPTION

Female

Body habitus slightly curved ventrally. Body annulation prominent. Lateral field with four incisures at vulva level without areolation but sometimes with oblique strokes. Outline of outer bands becoming indented towards tail end, between phasmid and tail tip. Low labial region with two annuli, continuous to body. En face view with submedian segments triangular-shaped fused to oral disc and separated from lateral segments; amphid apertures slit-like laterally bordering oral disc. Stylet rather long, robust, conus ca 0.5 stylet length; stylet shaft slender, basal knobs prominent, rounded. Pharyngeal procorpus narrowing just anterior to small, oval metacorpus with conspicuous valve; isthmus elongate, slender, encircled by nerve ring; gland lobe overlapping intestine ventrally for ca 45 μm. Secretory- excretory pore located just posterior to hemizonid, at pharyngo-intestinal junction level.

Genital system monodelphic, oocytes arranged in a single row or two rows; spermatheca small ca 14x20 μm, round to oval, full of sperm; post-uterine sac ca 1-1.5 vulval body diameter long; vulva slightly protruded from body. Tail subcylindrical, tapering towards tail tip; tail terminus variable in shape, from truncate (rarer) to smooth rounded margin; phasmids located at mid-tail.

Huu Tien Nguyen | 2018

Figure 1. Pratylenchus n. sp. Females: A. Entire body; C: En face view; D: Pharyngeal region; E: Vulva region; F: Lateral field at vulva region; G-J: Tail variations. Males: B: Entire body; K: Head region; L: Lateral field at mid-body; M: Tail region. (D, H: holotype).

Male

Largely similar to female except for sexual features. However, anterior part of body more slender than in female and outer bands of lateral field areolated partially. Testis outstretched, short. Spicules paired, weakly cephalate, slightly ventrally arcuate; gubernaculum slightly curved. Tail conical, elongate, bent on ventral side, enveloped by a poorly protruding, crenate bursa.

Huu Tien Nguyen | 2018

Figure 2. The LM and SEM pictures of Pratylenchus n. sp. A-N: females: A, B: Pharyngeal region; C: En face view; D: Head region; E: Vulva region ventral view; F: Entire body; G: Vulva region (see arrow); H: Lateral field at vulva region; I-N: Tail region. O-U: males. O: Pharyngeal region; P: En face view; Q: Head region; R: Lateral field; S,T: Tail region lateral view; U: Tail region ventral view. (A, F, L: female holotype).

Huu Tien Nguyen | 2018

MOLECULAR CHARACTERISATION

D2-D3 of 28S rDNA

Five sequences of the 5’-end region of 28S rDNA were obtained with the lengths between

1004 and 1066 bp. The alignment of D2-D3 of 28S region involved 153 nucleotide sequences. The length of MUSCLE alignment was 1146 positions and 691 positions were retained in the final dataset by Gblocks. The D2-D3 of 28S rDNA sequences of Pratylenchus n. sp. were 99-100% similar to each other with the variation from 0-2 positions. These sequences were 81-96% similar to other species with the variation from 27-127 positions.

They were most similar (95-96%) to the sequences of Pratylenchus speijeri De Luca,

Troccoli, Duncan, Subbotin, Waeyenberge, Coyne, Brentu, Inserra, 2012 with 27-30 different positions. The Bayesian interference phylogenetic tree based on the D2-D3 of 28S rDNA sequences showed that the sequences of Pratylenchus n. sp. were placed in a maximally supported clade with a sister relation to a clade (0.75 PP) including Pratylenchus pseudocoffeae Mizukubo, 1992, Pratylenchus scribneri Steiner in Sherbakoff & Stanley,

1943, Pratylenchus hexincisus Taylor & Jenkins, 1957, Pratylenchus agilis Thorne & Malek,

1968, Pratylenchus alleni Ferris, 1961, Pratylenchus gutierrezi Golden, López & Vílchez,

1992, Pratylenchus panamaensis Siddiqi, Dabur & Bajaj, 1991, Pratylenchus hippeastri

Inserra, Troccoli, Gozel, Bernard, Dunn & Duncan, 2007, Pratylenchus parafloridensis De

Luca, Troccoli, Duncan, Subbotin, Waeyenberge, Moens & Inserra, 2010, Pratylenchus floridensis De Luca, Troccoli, Duncan, Subbotin, Waeyenberge, Moens & Inserra, 2010,

Pratylenchus araucensis Múnera, Bert & Decraemer, 2009, Pratylenchus loosi Loof, 1960,

Pratylenchus coffeae (Zimmermann, 1898) Filipjev & Schuurmans Stekhoven, 1941, and

Pratylenchus speijeri (Fig. 3).

Huu Tien Nguyen | 2018

Figure 3. BI phylogenetic tree generated from the D2-D3 of 28S rDNA sequences dataset with the HKY+G model. Bayesian posterior probabilities are given next to each node. Sequences of Pratylenchus n. sp. are in red.

Huu Tien Nguyen | 2018

ITS rDNA Three ITS rDNA sequences were obtained with the length from 961 to 1049 bp, with a variation of 1-3 positions (99-99.7% similar). 94 nucleotide sequences were involved in ITS rDNA analysis. The length of MUSCLE alignment was 1296 positions and 280 positions were retained by Gblocks. The ITS rDNA sequences of Pratylenchus n. sp. differed 14-46 positions compared to other species (84-96% similar) and were most similar to the sequence of P. pseudocoffeae with 14-16 different positions (95-96% similar). The ITS rDNA tree topology showed several changes compared to D2-D3 of 28S rDNA tree topology such as the switch between the position of P. japonicus and Pratylenchus n. sp. making P. japonicus sister to a moderately supported clade (0.81 PP) including Pratylenchus n. sp. together with a clade (0.5 PP) of Pratylenchus Jaehni Inserra, Duncan, Troccoli, Dunn, dos Santos, Kaplan

& Vovlas, 2001, P. araucensis, P. scribneri, P. agilis, P. floridensis, P. parafloridensis, P. hippeastri, P. gutierrezi, P. loosi, P. alleni, P. pseudocoffeae. (Fig. 4).

COI mtDNA

The lengths of eight obtained COI gene fragments were 436-443 bp. The analysis of COI gene fragments involved 69 nucleotide sequences. The length of MUSCLE alignment was

825 positions and 389 positions were retained by Gblocks. The COI mtDNA sequences of

Pratylenchus n. sp. were identical without intraspecific variation. These sequences were 64-

79% similar to other Pratylenchus species in this analysis with 85-167 different positions and were most similar to P. speijeri with 78% similarity (85 different positions). The phylogenetic tree based on the COI mtDNA sequences showed that the sequences of

Pratylenchus n. sp. were placed in a maximal supported clade (1 PP) together with P. coffeae,

P. hippeastri, P. speijeri, P. scribneri, P. hexincisus, P. loosi, P. vulnus and P. pratensis.

However, the relationship between the sequences of Pratylenchus n. sp. and its sister group,

Huu Tien Nguyen | 2018

including P. coffeae, P. hippeastri, and P. speijeri, P. scribneri, P. hexincisus and P. loosi, was poorly supported (0.66 PP). (Fig. 5).

Figure 4. BI phylogenetic tree generated from ITS rDNA sequences with HKY+G model. Bayesian posterior probabilities are given next to each node. Sequences of Pratylenchus n. sp. are in red.

Huu Tien Nguyen | 2018

Figure 5. BI phylogenetic tree generated from COI sequences with the HKY+G model. Bayesian posterior probabilities are given next to each node. Sequences of Pratylenchus n. sp. are in red.

DIAGNOSIS AND RELATIONSHIPS

The females of Pratylenchus n. sp. are characterised by the following traits: the labial region bearing two annuli is continuous to the body; the en face in SEM belongs to group II according to Castillo and Vovlas (2007), characterised by the fusion of triangular-shaped submedian segments and oral disc with slit-like amphidial apertures located in the inner edges of lateral segments; the lateral field with four incisures at vulva level without

Huu Tien Nguyen | 2018

areolation; the middle band is smooth (but with oblique strokes sometimes); the spermatheca is small, round to oval when it is filled by sperm; the tail is subcylindrical with truncate to smooth margin (frequently with smooth margin). The males have partially areolated lateral field, outstretched testis, weakly cephalated, and ventrally arcuate spicules, poorly protruding, crenate bursa. The matrix code (Castillo & Vovlas, 2007) for this species is: A1,

B2, C3, D3, E2, F5, G2, H1, I3, J1, K1.

Table 2. Comparison of the matrix code of Rotylenchus n. sp. (in bold) with other closely related species Species A B C D E F G H I J K L Pratylenchus n. sp. 1 2 3 3 2 5 2 1 3 1 1 2 P. mulchandi 2 2 3 3 2 5 3 1 2 1 1 1 P. hippeastri 1 1 2 4 2 5 3 1 3 1 1 1 P. parafloridensis 1 2 2 2 2 5 3 1 3 1 1 1 P. pseudocoffeae 1 2 2 3 3 4 2 1 4 1 1 2 P. speijeri 1 2 3 3 3 3 2 2 3 1 1 1 *Note: feature L: en face group sensu Corbett and Clark (1983) (1 = group I, 2 = group II, 3 = group 3)

Pratylenchus n. sp. is different from all other species according to the dichotomous key of

Castillo and Vovlas (2007) and Geraert (2013) as well as the comparison with the species of

Hodda et al. (2014), Palomares-Rius et al. (2014), Wang et al. (2015), Nguyen et al. (2017), and Singh et al. (2018). A comparison of Pratylenchus n. sp. with 102 other species using matrix codes sensu Castillo and Vovlas (2007), facilitated by a Cluster analysis, showed that

Pratylenchus n. sp. is most similar to P. mulchandi Nandakumar & Khera, 1970, P. hippeastri, and P. parafloridensis. They are more than 90% similar to each other and are less than 90% similar compared to all other species (see Fig. 6). The species in this group share the following common traits: V ratio between 75-79% (E2); post-uterine sac between 30-35

μm (F5); smooth female tail tip (H1); four lateral lines at vulva level (J1) with smooth bands

(K1). However, Pratylenchus n. sp. can be differentiated from these former species by the features that are compared below.

Huu Tien Nguyen | 2018

Figure 6. The Cluster analysis of 103 species (included Pratylenchus n. sp.) based on Bray- Curtis similarity measure of 11 ranked features. Pratylenchus n. sp. is in bold and red. The red line indicates 90% similarity.

Huu Tien Nguyen | 2018

Although the molecular data for P. mulchandi is unavailable, Pratylenchus n. sp. is clearly different from P. mulchandi by morphological features. Pratylenchus n. sp. differs from P. mulchandi by three out of eleven features in matrix codes according to Castillo and

Vovlas (2007) including: A: lip annuli (two vs three); G: female tail shape (subcylindrical vs conoid); I: Pharyngeal overlapping (40-50 μm vs 30-39.9 μm). Furthermore, the females of

Pratylenchus n. sp. have a different structure of en face (group II vs group I), shorter body length (510 (497-527) μm vs 540 (470-600) μm), smaller a value (19.9 (13.3-22.6) vs 30 (26-

32)), larger c value (19 (16.6-22.0) vs 2.9 (2.1-3.2)), larger V ratio (78 (76-79) vs 75 (72-77)).

The males of Pratylenchus n. sp. have a smaller a value (23.7 (21.1-28.1) vs 33), smaller c’ value (1.9 (1.6-2.3) vs 2.4), shorter tail (26 (23-27) μm vs 34 μm), longer spicules (17 (15-19)

μm vs 14 μm).

Pratylenchus n. sp. can be distinguished from P. hippeastri by four out of eleven features in the matrix codes including: B: males (present vs absent); C: stylet length (between 16-17.9

μm vs between 13-15.9 μm); D: spermatheca shape (oval vs rectangular); G: female tail shape

(subcylindrical vs conoid). Moreover, the females of Pratylenchus n. sp. have a different structure of en face (group II vs group I), shorter body length (510 (497-527) μm vs 590 (550-

630) μm), smaller a value (19.9 (13.3-22.6) vs 25.5 (23.2-27.9)), larger c value (19.0 (16.6-

22.0) vs 16.1 (14.6-18.7)), and smaller c’ value (1.8 (1.4-2.1) vs 2.6 (2.2-2.9)).

Pratylenchus n. sp. is different from P. parafloridensis by three out of eleven features in the matrix codes including: C: stylet length (between 16-17.9 μm vs between 13-15.9 μm); D: spermatheca shape (oval vs rounded to spherical); G: female tail shape (subcylindrical vs conoid). The females of Pratylenchus n. sp. are also different from P. parafloridensis by having a different structure of en face (group II vs group I), smaller a value (19.9 (13.3-22.6) vs 29 (25.2-37)), larger c value (19.0 (16.6-22.0) vs 16.8 (14.9-18.5)), larger c’ value (1.8

(1.4-2.1) vs 2.9 (2.4-3.3)), larger anal body diam. (16 (13-20) μm vs 11 (10.5-13) μm), shorter

Huu Tien Nguyen | 2018

tail (27 (24-30) μm vs 32 (28-35) μm). The males of Pratylenchus n. sp. are different from P. parafloridensis by having a different shape of en face (group II vs group I), larger body length (504 (475-534) μm vs 448 (414-494) μm), smaller a value (23.7 (21.1-28.1) vs 29.7

(25-35.3)), larger b’ value (4.1 (3.8-4.3) vs 3.7 (3.4-4.0)), larger c value (19.8 (17.6-21.8) vs

17.9 (15-19.1)), smaller c’ value (1.9 (1.6-2.3) vs 2.8 (2.4-3.3)), shorter spicules (17 (15-19)

μm vs 18.5 (17.8-19) μm).

The molecular analyses based on D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA regions indicated Pratylenchus n. sp. as an unique lineage that is clearly different from all other species. The sequences of Pratylenchus n. sp. are most similar to the sequences of P. speijeri and P. pseudocoffeae. Pratylenchus n. sp. can also be differentiated from two former species by morphological features.

Pratylenchus n. sp. is distinguished from P. speijeri by three out of eleven features in the matrix codes including: E: V ratio (78 (76-79) vs 80 (78-82)); F: Post-uterine sac length

(between 30-35 μm vs 20-24.9 μm); H: tail tip (smooth vs striated). Furthermore, the females of Pratylenchus n. sp. differ from P. speijeri by having a different structure of en face (group

II vs group I), smaller a value (19.9 (13.3-22.6) vs 27.7 (23.4-32.7)), larger anal body diameter (16 (13-20) μm vs 12.5 (11.0-14.5) μm). The males of Pratylenchus n. sp. can be differentiated from P. speijeri by having smaller a value (23.7 (21.1-28.1) vs 29.7 (27.1-

33.0)), larger c value (19.8 (17.6-21.8) vs 16.2 (14.2-17.6)), larger c’ value (1.9 (1.6-2.3) vs

3.2 (2.9-3.5)), and shorter tail (26 (23-27) μm vs 30 (27-34) μm).

Pratylenchus n. sp. can be differentiated from P. pseudocoffeae by four out of eleven features in the matrix codes including: C: stylet length (between 16-17.9 μm vs between 13-

15.9 μm); E: V ratio (between 75-79.9% vs 80-85%); F: Post-uterine sac length (between 30-

35 μm vs 25-29.9 μm); I: Pharyngeal overlapping (between 40-50 μm vs larger than 50 μm).

Additionally, the females of Pratylenchus n. sp. differ from P. pseudocoffeae by having a

Huu Tien Nguyen | 2018

smaller a value (19.9 (13.3-22.6) vs 27.5 (22.6-32.1)), larger b’ value (4.1 (3.8-4.6) vs 3.1

(2.6-3.4)). The males of Pratylenchus n. sp. differ from P. pseudocoffeae by having smaller a value (23.7 (21.1-28.1) vs 30.6 (25.6-37.0)), larger b’ value (4.1 (3.8-4.3) vs 3.3 (2.9-3.8)), shorter tail (26 (23-27) μm vs 43 (38-48) μm), and longer stylet length (16 (15-16) μm vs 15

(14.0-15.5) μm).

TYPE HOST AND LOCALITY

Pratylenchus n. sp. was recovered from soil and root samples from the rhizosphere of

Hedychium greenii in the botanical garden of Gent University, Belgium (GPS coordinates N:

51o2’6.7”, E: 3o43’22.4”).

TYPE MATERIAL

Slide number UGMD 1043 XX (comprises the holotype female, and two paratype females) and slide number UGMD XXX (comprise 4 paratype males) are deposited at the

Ghent University Museum, Zoology Collections. Additional paratypes (2 females in one slide) are available in the UGent Nematode Collection (slide number UGnem-179) of the

Nematology Research Unit, Department of Biology, Ghent University, Ghent, Belgium.

Discussion

The Cluster analysis based on the matrix tabular key of Castillo & Vovlas 2007 in this study was able to cluster Pratylenchus spp. into small groups with high similarities. The cryptic species or species complexes without significant morphological differences, such as

Pratylenchus teres teres and P. teres vandenbergae or P. parafloriensis and P. hippeastri, were grouped together supporting the reliability of this analysis. In a manual comparison by dichotomous or polytomous key, two very similar species (even with only one different feature) will be separated if one starts to compare from any different feature between them.

For example, Pratylenchus n. sp. will never be considered as the most similar species of P.

Huu Tien Nguyen | 2018

mulchandi, if we start to compare by the number of labial annuli (two vs three).

Consequently, different starting points to compare will give the different results of the most similar species compared to the use of tabular key. The Cluster analysis not only can avoid a biased selection of species to compare with, but it also facilitates the use of tabular key to minimize mistakes of naked eye comparison and speed up the identification process, especially for a huge dataset.

The en face structure of Pratylenchus n. sp. clearly belongs to group II sensu Corbett and

Clark (1983). By linking molecular data and en face structures, Subbotin et al. (2008) evaluated lip patterns as one of the most informative features to group Pratylenchus species.

In this study, the en face structure was also used to support the species delimitation. Thus, the en face feature should be added to the tabular key of Castillo and Vovlas (2007), if available.

The molecular analyses of D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA sequences in this study agreed with the morphological data to delineate our Pratylenchus population as a new species. Aside from the phylogenetic trees based on D2-D3 of 28S rDNA, ITS rDNA, the phylogenetic trees based on COI mtDNA sequences in this study gave a good resolution in separating different groups of Pratylenchus species. However, the number of COI mtDNA sequences on GenBank for Pratylenchus species are still quite limited. Additionally, although the high mutational rates in mtDNA make them very useful for low-level phylogenetic applications, underestimating the intraspecific variation can potentially lead to phylogenetic error (Subbotin et al., 2013). Hence, more research is needed for the COI mtDNA gene to exploit all of its benefits.

Strikingly, some sequences of the same species did not gather together in one clade. For example, the sequences of P. gutierrezi on D2-D3 of 28S rDNA tree were placed in two different clades: clade 1 includes the sequences of P. gutierrezi (AF170441, AF170440) and

P. panamaensis (KT971358, KT971359) with maximal support (1 PP); clade 2 includes the

Huu Tien Nguyen | 2018

sequences of P. gutierrezi (KT971355, KT971356, KT971357) with 1 PP. The ITS rDNA tree also comprises two different maximal supported clades of P. gutierrezi (clade 1:

FJ712929, FR692277; clade 2: KT971363, KT971364). The D2-D3 of 28S rDNA sequences of P. pratensis are also separated into two clades with 100% support on phylogenetic tree

(clade 1: AM231933, AM231934, AM231931, AM231930; clade 2: KY828296, KY828299,

KY828298). These arrangements implied that these sequences are generated from cryptic species or they are mislabeled or misidentified sequences. The latter agrees with the conclusion of Janssen et al. (2017a) that there are many misassembled, mislabelled, unlabelled or misidentified sequences on GenBank. Therefore, the identification of

Pratylenchus spp. should always consider both morphological and molecular aspects to provide the most precise identification and sequencing of topotype material is often the only way to confidently connect DNA sequences to formerly described morphospecies (Inserra et al., 2007; De Luca et al., 2010; Troccoli et al., 2016). In this study, the combination of morphological and molecular data of Pratylenchus n. sp. will provide a good reference for the comparison of morphological features as well as for DNA barcoding.

Pratylenchus n. sp. has been found on Hedychium greenii, an imported exotic plant from the Himalaya Mountains, in the botanical garden of Gent University, Belgium. Although this plant’s origin is probably from a cold region (Himalaya Mountains), the exact weather condition has been remained unknown. This plant has been planted outside under the Belgian weather conditions several years ago. Interestingly, the aerial parts of this plant were cut down and used together with chopped woods to cover its growing area during winter time; this might create a slightly different condition compared to the natural condition of Belgian weather conditions. To our knowledge, this is the first report of a nematode on Hedychium greenii by far. It remains to be investigated if Pratylenchus n. sp was introduced together with Hedychium greenii or it is a native species occurring also on other hosts in Belgium.

Huu Tien Nguyen | 2018

Acknowledgment

This work was supported by the special research fund UGent 01N02312.

References Allen, M. W. & Jensen, H. J. 1951. Pratylenchus vulnus, new species (Nematoda Pratylenchinae), a parasite of trees and vines in California. Proceedings of the Helminthological Society of Washington 18, 47-50. Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic acids research 25, 3389-3402. Barry, G. H. 2011. Phylogenetic Trees Made Easy: A How-To Manual, Sunderland, MA., Sinauer Associates, 282 pp. Blaxter, M., De Ley, P., Garey, J., Liu, L., Scheldeman, P., Vierstraete, A., Vanfleteren, J., Mackey, L., Dorris, M., Frisse, L., Vida, J. & Thomas, W. 1998. A molecular evolutionary framework for the phylum Nematoda. Nature 392, 71–75. DOI:10.1038/32160 Castillo, P. & Vovlas, N. 2007. Pratylenchus (Nematoda: Pratylenchidae): diagnosis, biology, pathogenicity and management, Brill, 529 pp. Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17, 540-552. DOI:10.1093/oxfordjournals.molbev.a026334 Cobb, N. A. 1917. A new parasitic nema found infesting cotton and potatoes. Journal of Agricultural Research 11, 27-33. Corbett, D. C. M. & Clark, S. A. 1983. Surface features in the taxonomy of Pratylenchus species. Revue de Nématologie 6, 85-98. De La Peña, E., Moens, M., Van Aelst, A. & Karssen, G. 2006. Description of Pratylenchus dunensis sp. n. (Nematoda: Pratylenchidae), a root-lesion nematode associated with the dune grass Ammophila arenaria (L.) Link. Nematology 8, 79-88. DOI:10.1163/156854106776179917 De Luca, F., Inserra, R. N., Duncan, L. W., Coyne, D. L., Brentu, F. C., Troccoli, A., Waeyenberge, L. & Subbotin, S. A. 2012. Pratylenchus speijeri n. sp. (Nematoda: Pratylenchidae), a new root-lesion nematode pest of plantain in West Africa. Nematology 14, 987-1004. DOI:10.1163/156854112X638424 De Luca, F., Troccoli, A., Duncan, L., Waeyenberge, L., Subbotin, S., Inserra, R. & Moens, M. 2010. Characterisation of a population of Pratylenchus hippeastri from bromeliads and description of two related new species, P. floridensis n. sp. and P. parafloridensis n. sp., from grasses in Florida. Nematology 12, 847-868. DOI:10.1163/138855410X495809 De Man, J. G. 1880. Die Einheimischen, frei in der reinen Erde und im sussen Wasser lebenden Nematoden Vorlaufiger Bericht und descriptiv-systematischer Theil. Tijdschrift der Nederlandsche Dierkundige Vereeniging 5, 1-104. Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Dufayard, J. F., Guindon, S., Lefort, V., Lescot, M., Claverie, J. M. & Gascuel, O. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36, 465-469. DOI:10.1093/nar/gkn180

Huu Tien Nguyen | 2018

Derycke, S., Vanaverbeke, J., Rigaux, A., Backeljau, T. & Moens, T. 2010. Exploring the use of cytochrome oxidase c subunit 1 (COI) for DNA barcoding of free-living marine nematodes. PLoS One 5, e13716. DOI:10.1371/journal.pone.0013716 Ferris, V. R. 1961 A new species of Pratylenchus (Nemata-Tylenchida) from roots of soybeans. Proceedings of the Helminthological Society of Washington 28, 109-111. Filipjev, I. & Stekhoven Jr, J. S. 1941. A manual of agricultural helminthology, Brill, 878 pp. Filipjev, I. N. 1936. On the classification of the Tylenchinae. Proceedings of the helminthological Society of Washington. 80-82 pp. Geraert, E. 2013. The Pratylenchidae of the world: identification of the family Pratylenchidae (Nematoda: Tylenchida), 430 pp. Golden, A. M., R., L. C. & Vílchez, R. H. 1992. Description of Pratylenchus gutierrezi n. sp. (Nematoda: Pratylenchidae) from coffee in Costa Rica. Journal of Nematology 24, 298-304. Hodda, M., Collins, S. J., Vanstone, V. A., Hartley, D., Wanjura, W. & Kehoe, M. 2014. Pratylenchus quasitereoides n. sp. from cereals in Western Australia. Zootaxa 3866, 277-288. DOI:10.11646/zootaxa.3866.2.6 Holterman, M., Karssen, G., Van Den Elsen, S., Van Megen, H., Bakker, J. & Helder, J. 2009. Small subunit rDNA-based phylogeny of the Tylenchida sheds light on relationships among some high-impact plant-parasitic nematodes and the evolution of plant feeding. Phytopathology 99, 227-235. DOI:10.1094/PHYTO-99-3-0227 Huelsenbeck, J. P. & Ronquist, F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754-755. DOI:10.1093/bioinformatics/17.8.754 Inserra, R., Bernard, E., Dunn, D., Duncan, L., Troccoli, A. & Gozel, U. 2007. Pratylenchus hippeastri n. sp. (Nematoda: Pratylenchidae) from amaryllis in Florida with notes on P. scribneri and P. hexincisus. Nematology 9, 25-42. DOI:10.1163/156854107779969754 Inserra, R., Kaplan, D., Maia Dos Santos, J., Duncan, L., Vovlas, N., Dunn, D. & Troccoli, A. 2001. Pratylenchus jaehni sp. n. from citrus in Brazil and its relationship with P. coffeae and P. loosi (Nematoda: Pratylenchidae). Nematology 3, 653-665. DOI:10.1163/156854101753536028 Janssen, T., Karssen, G., Couvreur, M., Waeyenberge, L. & Bert, W. 2017a. The pitfalls of molecular species identification: a case study within the genus Pratylenchus (Nematoda: Pratylenchidae). Nematology 19, 1-17. DOI:10.1163/15685411- 00003117 Janssen, T., Karssen, G., Orlando, V., Subbotin, S. A. & Bert, W. 2017b. Molecular characterisation and species delimiting of plant-parasitic nematodes of the genus Pratylenchus from the penetrans group (Nematoda: Pratylenchidae). Molecular phylogenetics and evolution 117, 30-48. DOI:10.1016/j.ympev.2017.07.027 Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T., Manzanilla‐López, R., Palomares‐Rius, J. E., Wesemael, W. M. & Perry, R. N. 2013. Top 10 plant‐parasitic nematodes in molecular plant pathology. Molecular Plant Pathology 14, 946-961. DOI:10.1111/mpp.12057 Karssen, G., Waeyenberge, L. & Moens, M. 2000. Pratylenchus brzeskii sp. nov. (Nematoda: Pratylenchidae), a root-lesion nematode from European coastal dunes. Annales Zoologici 50, 255–261. Loof, P. A. 1960. Taxonomic studies on the genus Pratylenchus (Nematoda). Tijdschrift over Plantenziekten 66, 29-90.

Huu Tien Nguyen | 2018

Luc, M. 1958. Les nématodes et le flétrissement des cotonniers dans le Sud-Ouest de Madagascar. Coton et Fibres Tropicales 13, 1-18. Mizukubo, T. 1992. Morphological and statistical differentiation of Pratylenchus coffeae complex in Japan (Nematoda: Pratylenchidae). Applied Entomology and Zoology 27, 213-224. DOI:10.1303/aez.27.213 Múnera, G., Bert, W. & Decraemer, W. 2009. Morphological and molecular characterisation of Pratylenchus araucensis n. sp. (Pratylenchidae), a root-lesion nematode associated with Musa plants in Colombia. Nematology 11, 799-813. DOI:10.1163/156854109x415524 Nadler, S. A., De Ley, P., Mundo-Ocampo, M., Smythe, A. B., Patricia Stock, S., Bumbarger, D., Adams, B. J., De Ley, I. T., Holovachov, O. & Baldwin, J. G. 2006. Phylogeny of Cephalobina (Nematoda): molecular evidence for recurrent evolution of probolae and incongruence with traditional classifications. Molecular phylogenetics and evolution 40, 696-711. DOI:10.1016/j.ympev.2006.04.005 Nandakumar, C. & Khera, S. 1970. A new nematode species, Pratylenchus mulchandi, from millets of Rajasthan. Indian Phytopathology 22, 359-363. Nguyen, T. D., Le, T. M. L., Nguyen, H. T., Nguyen, T. a. D., Liébanas, G. & Trinh, Q. P. 2017. Morphological and molecular characteristics of Pratylenchus haiduongensis sp. n., a new species of root-lesion nematode associated with carrot in Vietnam. Journal of Nematology 49, 276-285. Palomares-Rius, J. E., Guesmi, I., Horrigue-Raouani, N., Cantalapiedra-Navarrete, C., Liébanas, G. & Castillo, P. 2014. Morphological and molecular characterisation of Pratylenchus oleae n. sp. (Nematoda: Pratylenchidae) parasitizing wild and cultivated olives in Spain and Tunisia. European Journal of Plant Pathology 140, 53-67. DOI:10.1007/s10658-014-0443-4 Rensch, D. 1924. Aphelenchus neglectus sp. n. eine neue parasitäre Nematodenart. Sonderabdruck aus dem Zoologischen Anzeiger 59, 277-280. Seinhorst, J. W. 1959. Two new species of Pratylenchus. Nematologica 4, 83-86. DOI:10.1163/187529259X00417 Seinhorst, J. W. 1968. Three new Pratylenchus species with a discussion of the structure of the cephalic framework and of the spermatheca in this genus. Nematologica 14, 497- 510. DOI:10.1163/187529268X00183 Sher, S. A. & Allen, M. W. 1953. Revision of the genus Pratylenchus (Nematoda: Tylenchidae), University of California Press, 470 pp. Sherbakoff, C. D. & Stanley, W. W. 1943. The more important Diseases and Insect Pests of Crops in Tennessee, Bulletin of the Tennessee Agricultural Experiment Station, 142 pp. Siddiqi, M. R., Dabur, K. R. & Bajaj, H. K. 1991. Descriptions of three new species of Pratylenchus Filipjev, 1936 (Nematoda: Pratylenchidae). Nematologia Mediterranea 19, 1-7. Singh, P. R., Nyiragatare, A., Janssen, T., Couvreur, M., Decraemer, W. & Bert, W. 2018. Morphological and molecular characterisation of Pratylenchus rwandae n. sp. (Tylenchida: Pratylenchidae) associated with maize in Rwanda. Nematology, 1-14. DOI:10.1163/15685411-00003175 Steel, H., Coomans, A., Decraemer, W., Moens, T. & Bert, W. 2014. Nematodes from Terrestrial, Freshwater and Brackish Water Habitats in Belgium: An Updated List with Special Emphasis on Compost Nematodes. Zootaxa 3756, 2208-2218.

Huu Tien Nguyen | 2018

Subbotin, S. A., Halford, P. & Perry, R. 1999. Identification of populations of potato cyst nematodes from Russia using protein electrophoresis, rDNA-RFLP and RAPDS. Russ. J. Nematol 7, 57-63. Subbotin, S. A. & Moens, M. 2006. Molecular Taxonomy and Phylogeny. In: PERRY, R. N. & MOENS, M. (Eds.) Plant Nematology. Subbotin, S. A., Ragsdale, E. J., Mullens, T., Roberts, P. A., Mundo-Ocampo, M. & Baldwin, J. G. 2008. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters. Molecular phylogenetics and evolution 48, 491-505. DOI:10.1016/j.ympev.2008.04.028 Subbotin, S. A., Sturhan, D., Rumpenhorst, H. J. & Moens, M. 2003. Molecular and morphological characterisation of the Heterodera avenae species complex (Tylenchida: Heteroderidae). Nematology 5, 515-538. DOI:10.1163/156854103322683247 Subbotin, S. A., Sturhan, D., Vovlas, N., Castillo, P., Tanyi, T., Moens, M., Baldwin, J. & Debenham, N. 2007. Application of the secondary structure model of rRNA for phylogeny: D2-D3 expansion segments of the LSU gene of plantparasitic nematodes from the family Hoplolaimidae Filipjev, 1934. Mol. Phylogenet. Evol 43, 881-890. DOI:10.1016/j.ympev.2006.09.019 Subbotin, S. A., Waeyenberge, L. & Moens, M. 2013. Molecular Systematics. In: PERRY, R. N. & MOENS, M. (Eds.) Plant Nematology. Oxfordshire, UK: CABI publishing, 3-32. Taylor , D. P. & Jenkins, W. R. 1957. Variation within the nematode genus Pratylenchus, with the descriptions of P. hexincisus n. sp. and P. subpenetrans n. sp. Nematologica 2, 159-174. DOI:10.1163/187529257X00545 Thorne, G. & Malek, R. B. 1968. Part 1: Tylenchida (Nematoda: Secernentra). Nematodes of the Northern Great Plains. Brookings, South Dakota: Agricultural Experimental Station South Dakota University, 111. Troccoli, A., Subbotin, S. A., Chitambar, J. J., Janssen, T., Waeyenberge, L., Stanley, J. D., Duncan, L. W., Agudelo, P., Uribe, G. E. M., Franco, J. & Inserra, R. N. 2016. Characterisation of amphimictic and parthenogenetic populations of Pratylenchus bolivianus Corbett, 1983 (Nematoda: Pratylenchidae) and their phylogenetic relationships with closely related species. Nematology 18, 651-678. DOI:Doi 10.1163/15685411-00002981 Vrain, T. C., Wakarchuk, D. A., Levesque, A. C. & Hamilton, R. I. 1992. Intraspecific rDNA restriction fragment length polymorphism in the Xiphinema americanum group. Fundamental and Applied Nematology 15, 563-573. Wang, H., Zhuo, K., Ye, W. & Liao, J. 2015. Morphological and molecular charaterisation of Pratylenchus parazeae n. sp. (Nematoda: Pratylenchidae) parasitizing sugarcane in China. European journal of plant pathology 143, 173-191. DOI:10.1007/s10658-015- 0674-z Whitehead, A. G. & Hemming, J. R. 1965. A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Annales of Applied Biology 55, 25– 38. DOI:10.1111/j.1744-7348.1965.tb07864.x Zimmermann, A. W. P. 1898. De nematoden der koffiewortels. Deel I. Mededelingen uit’s Lands Plantentuin 27, 1-64.

Huu Tien Nguyen | 2018

Chapter 2: Survival of the tropical root-knot nematodes Meloidogyne incognita (Kofoid & White, 1919) (Chitwood, 1949) Whitehead, 1968 (Nematoda: Meloidogynidae) in Belgium Huu Tien Nguyen

Summary – M. incognita is considered as the world’s most damaging plant-pathogenic nematode with worldwide distribution. In Europe, this species is reported to occur in warmer parts of southern Europe and in glasshouses in northern Europe. However, the CLIMEX model of Robinet et al. (2018) indicated that whole Europe can be theoretically the growth potential area for M. incognita. Although Government Agricultural Research Centre (1974) and Moens and Hendrickx (1990) reported the presence of M. incognita in Belgium, these reports provided insufficient taxonomical information of M. incognita, including morphological and molecular characterisations. In this study, a repeated sampling process and the identification based on morphological features and sequencing of Nad5 gene proved the ability to survive through the cold season in Belgium of M. incognita (this is unsure whether they can survive without the cover of chopped woods or not).

Keywords – Barcode, barcoding, exotic plant, haplotype network, Hedychium greenii, maker, molecular, morphological, morphology, mtDNA, Nad5, plant-parasitic, systematic, taxonomy.

Meloidogyne species are commonly known as root-knot nematodes (RKN). These species parasitize nearly every species of higher plant and are the economically most important plant- parasitic nematodes that caused billions of dollars losses each year over the world (Agrios,

2005; Jones et al., 2013; Perry & Moens, 2013). At present, more than 104 species of this genus have been described (Ahmed et al., 2013; Perry & Moens, 2013; Humphreys-Pereira et al., 2014; Tao et al., 2017; Trinh et al., 2018). The most important and commonly known species are the tropical Meloidogyne arenaria (Neal, 1889) Chitwood, 1949, Meloidogyne

Huu Tien Nguyen | 2018 incognita (Kofoid & White, 1919) (Chitwood, 1949) Whitehead, 1968 and Meloidogyne javanica (Treub, 1885) Chitwood, 1949, and the temperate Meloidogyne hapla Chitwood,

1949 (Jones et al., 2013).

M. incognita is considered as the world’s most damaging plant-pathogenic nematode

(Trudgill & Blok, 2001) and a lot of evidence has proven that the three most important tropical RKN species are very closely related (Perry et al., 2009; Janssen et al., 2016). In

Europe, M. incognita has been reported as the most common species in warmer parts of southern Europe and in glasshouses in northern Europe (Wesemael et al., 2011). Although

Government Agricultural Research Centre (1974) reported the presence of M. incognita in

Belgium and Moens and Hendrickx (1990) also reported the presence of second-stage juveniles of M. incognita in the nutrient solution of hydroponic-like systems that were used for growing ornamental pot plants in Belgium, none of these reports are supported with sufficient taxonomical information, including morphological and molecular characterisations.

M. incognita was described by Kofoid & White in 1919 for the first time as an unknown helminth infecting soldiers in the U.S.A under the name Oxyuris incognita. They found eggs in the human stools and provided egg measurements, but no illustration was given. Chitwood

(1949) presented a revision for the genus Meloidogyne with the re-description of M. incognita, but Whitehead (1968) stated that the descriptions of Chitwood (1949) are insufficient for identification of Meloidogyne species. With the revision of the type materials from Chitwood (1949), Whitehead (1968) provided the most useful description of M. incognita that can be considered as close to the original description of this species.

In the past, the identification of Meloidogyne species was mostly based on morphological characteristics of the females, males, and juveniles (Jepson, 1987; Karssen, 2002; Perry &

Moens, 2013). Other methods, such as biochemical-based diagnostic technique, were introduced as additional tools in identifying Meloidogyne spp. to avoid the phenotypic

Huu Tien Nguyen | 2018 plasticity and interspecific similarities (Esbenshade & Triantaphyllou, 1985). Due to the most commonly used rDNA and mtDNA sequences such as 18S, 28S, and ITS rDNA or COI mtDNA regions have been proven to be insufficient to distinguish the closely-related lineages of RKN, isozyme electrophoresis is still a prevalent choice in RKN identification, especially for the tropical group (Esbenshade & Triantaphyllou, 1985; Janssen et al., 2016). However, the biochemical-based diagnostic technique, that is reliant on isozyme profiles, is only applicable to young adult females, and various results from different laboratories implied that polymorphic enzyme profiles exist (Esbenshade & Triantaphyllou, 1985; Perry et al., 2009;

Janssen et al., 2016). It seems likely that PCR-based methods will soon replace biochemical- based techniques for many applications because of the rapidly reducing cost, improvement of molecular techniques, and the finer resolution of this approach (Perry et al., 2009). By studying the barcoding region of nine genes from mitochondrial genome on numerous populations from geographically widespread origins and variable host plants, Janssen et al.

(2016) revealed that certain mtDNA haplotypes, especially Nad5 gene mitochondrial haplotypes, are strongly linked and are consistent with traditional esterase isozyme patterns.

Nad5 gene possesses some polymorphic nucleotide positions that are very informative positions for the identification of closely-related lineages such as the tropical group.

Therefore, Nad5 gene is a simple, efficient, and reproducible barcode maker for reliable identification of tropical root-knot nematodes that can be used as an alternative method for the aforementioned methods (Janssen et al., 2016).

In this study, the presence of the tropical nematode, M. incognita, in Belgium was confirmed by the combination of morphological features and the characterisation of Nad5 gene. The repetition of the sampling process (before and after winter) also proved the ability of M. incognita to survive through the cold season in Belgium, at least when it is covered by chopped woods during winter time.

Huu Tien Nguyen | 2018

Materials and methods

SAMPLING AND NEMATODE EXTRACTION

After removing the dead materials from the surface, soil and root samples were collected from the upper 30cm soil layer around the rhizosphere of Hedychium greenii at the Botanical garden of Ghent University. Twelve times of sampling from September 2017 to April 2018 were executed to check for the survival of the target nematodes through the winter season.

The second stage juveniles and males were extracted by the modified Baermann tray method

(Whitehead & Hemming, 1965). Mature females were extracted directly from the galls under a stereomicroscope, using a scalpel and forceps (Perry et al., 2009).

MORPHOLOGICAL CHARACTERISATION

Nematodes were fixed and transferred to anhydrous glycerine to make permanent slides following Singh et al. (2018). Perineal patterns were cut and cleaned following Hartman &

Sasser (1985) and mounted in glycerine.

Microphotographs were made from permanent slides using an Olympus BX51 DIC

Microscope equipped with a digital camera and a drawing tube. The measurements were calculated based on the obtained pictures using ImageJ 1.51.

MOLECULAR CHARACTERISATION

The temporary slides of fresh nematodes were made to get digital light microscope pictures as morphological vouchers. Then, the single juvenile or male were taken out of the temporary slide, washed with distil-water for 10 min, cut into 2-3 pieces, and put in the

Eppendorf tubes with 20µ of WLB (50mM KCl;10mM Tris pH 8.3; 2.5mM MgCl2; 0.45%

NP 40 (Tergitol Sigma); 0.45% Tween 20). This was followed by incubation of the samples at −20°C for at least 10 min, and followed by adding 1μl proteinase K (1.2 mg ml−1). The incubation of the samples was executed in a PCR machine for 1 h at 65°C and 10 min at 95°C

Huu Tien Nguyen | 2018 and centrifugation for 1 min at 14000 rpm. For the preservation, the samples were stored at

−20°C before running PCR (Singh et al., 2018).

For each PCR reaction, 23 µl of Mastermix (17µl Water; 2.5µl 10x buffer; 2µl MgCL2;

2.5µl Coralload; 0.5µl dNTP (10mM); 0.5µl Primer 1; 0.5µl Primer 2; 0.06µl Toptaq) and

2µl DNA template were used. The primers NAD5F2/NAD5R1 were used to amplify the

Nad5 mtDNA gene following the protocol of Janssen et al. (2016). The PCR reactions were visualized by gel electrophoresis. The successful PCR reactions were purified and sequenced commercially by Macrogen Inc. (Europe).

The consensus sequences were obtained by assembling forward and backward sequences using GENEIOUS R11. The BLAST search was used to check for the similarities with other related sequences on GenBank (Altschul et al., 1997). Due to the maximum similarity

(100%) of our sequences compared to the sequences from Meloidogyne incognita on

GenBank, our Nad5 mtDNA sequences were aligned with 73 reference sequences of tropical

RKN species from Janssen et al. (2016) using Muscle on GENEIOUS to check for polymorphic nucleotide positions (see table 3). Median-joining network in POPART 1.7

(Bandelt et al., 1999; Leigh & Bryant, 2015) was used to create the haplotype network from the alignment.

Results

SYMPTOMS OF HOST PLANT

Hedychium greenii that was infected by M. incognita showed no typical symptom on the aerial parts, but the roots formed series of single galls. The galls on the roots of Hedychium greenii were small, some distance from root tip, and each gall usually contains only one single female (Fig. 7).

Huu Tien Nguyen | 2018

A B C

Figure 7. the pictures of host plant Hedychium greenii. A: growing area during winter; B: growing area after winter; C: the symptom on root samples.

MORPHOLOGICAL CHARACTERISATION OF M. INCOGNITA IN BELGIUM

Mature females

Body pearly white, pear-shaped with relatively long neck. Labial region slightly set off from rest of body. Stylet slender with dorsally curved stylet tip; stylet knobs three, oval and sloping posteriorly. Distance from base of stylet to dorsal pharyngeal gland orifice 3–4 μm.

Secretory-excretory pore located at level of stylet knobs. Metacorpus rounded with large refractive thickenings. Perineal pattern rounded to oval with wavy striae; dorsal arch high and squared; lateral field absent or indistinct, weakly demarcated by forked striae (Fig. 8).

Males

Body vermiform, anterior end tapering and posterior region bluntly rounded. Body annuli distinct. Head caps high with a large labial annulus and post-labial various from one annulus to three indistinct annuli under light microscope. Stylet robust with length from 24–26 μm, cone pointed, smaller than shaft, knobs rounded. Distance from base of stylet to dorsal pharyngeal gland orifice from 3.2–4.4 μm. Lateral fields with 4 incisures at mid-body forming 3 bands, outer bands areolated. Spicules slightly curved ventrally with bluntly rounded terminus; gubernaculum short and crescentic shaped. Tail short with distinct phasmids at cloacal aperture level.

Huu Tien Nguyen | 2018

Figure 8. LM pictures of M. incognita in Belgium. Mature females: A-D. A: Entire body; B: Head region; C, D: Perineal patterns. Second-stage juveniles: E-H. E: Entire body; F: Head region; G: Lateral field; H: Tail region. Males: I-K. I: Head region; J: Lateral field; K: Tail region. Second-stage juveniles (J2)

Body slender, tapering at both ends. Labial region narrower than body, weakly sclerotized, continuous to body. Lateral field with 4 incisures forming 3 bands. Stylet slender; cone weakly expanding at junction with shaft; knobs small, oval shaped and backwardly sloping. Procorpus faintly outlined; metacorpus broadly oval, valve large and heavily sclerotized; pharyngo-intestinal junction just posterior to level of secretory-excretory pore;

Huu Tien Nguyen | 2018 gland lobe variable in length overlapping intestine ventrally. Secretory-excretory pore slightly posterior to nerve ring, opening just posterior to hemizonid. Tail conoid with rounded unstriated terminus; hyaline tail terminus clearly defined (13-20 μm); phasmids small, distinct.

MOLECULAR CHARACTERISATION

Six Nad5 sequences were obtained with the length from 544-599 nucleotides. The length of sequence alignment was 471 nucleotides. The sequences of M. incognita in Belgium were identical to each other and 5 other refrence sequences of M. incognita (specimen ID: T384,

T532, M8, M20, M21) from Morocco, Egypt, and Tanzania in the study of Janssen et al.

(2016). The numbers of polymorphic nucleotide positions of the sequences of M. incognita from Belgium were 0-2 compared other sequencess of M. incognita from GenBank.

Compared to other reference sequences from other species, 2-4 nucleotide differences were found. In the network haplotype analysis, the sequences of M. incognita in Belgium were closely linked with all other sequences of M. incognita (specimen ID: T384, T161, T515,

T526, T532, T540, T552, Y29, Y57, C33, C41, C49, C53, C69, C81, C87, C95, M4, M8,

M15, M20, M21, M28, M44, M46, M49, A1, A3) and clearly separated from all other reference sequences of M. javanica, M. arenaria, Meloidogyne floridensis Handoo, Nyczepir,

Esmenjaud, Van der Beek, Castagnone-Sereno, Carta, Skantar, and Higgins, 2004,

Meloidogyne luci Carneiro, Correa, Almeida, Gomes, Deimi, Castagnone-Sereno, and

Karssen, 2014, Meloidogyne ethiopica Whitehead, 1968, Meloidogyne inornata Lordello,

1956, Meloidogyne. sp. 1, and Meloidogyne sp. 2 from Janssen et al. (2016) (see Fig. 9).

Table 3. The Nad5 sequences from Janssen et al. (2016) were used in this study with their unique ID number together with esterase isozyme phenotype (Est), malate dehydrogenase isozyme phenotype (Mdh) and their respective host plant

Species Specimen Est Mdh Host plant Location Meloidogyne incognitaID T384 I1 N1 Daucus carota Morocco T161 I1 N1 Ficus China

Huu Tien Nguyen | 2018

T515 I1 N1 Solanum tuberosum Italy T526 I1 N1 Syngonium Togo T532 I1 N1 Vitis Egypt, Monufia Governorate, El Sadat city T540 I1 N1 Philodendron selloum United States of America T552 I1 N1 Ficus China Y29 I1 N1 Dioscorea (Yam) Nigeria, Kogi, Idah Y57 I1 N1 Celosia Nigeria, Oyo, Akobo C33 I1 N1 Solanum aethiopicum Tanzania, Morogoro, Kipera C41 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Kipera C49 I1 N1 Solanum aethiopicum Tanzania, Morogoro, Mlali C53 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Mlali C69 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Hembeti C81 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Msongozi C87 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Msongozi C95 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Msongozi M4 I1 N1 Capsicum annuum Tanzania, Morogoro, Mlali M8 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Mlali M15 I1 N1 Capsicum annuum Tanzania, Morogoro, Mlumbilo-Mtibwa M20 I1 N1 Fabaceae (Bean) Tanzania, Morogoro, Muomero M21 I1 N1 Solanum aethiopicum Tanzania, Morogoro, Muomero M28 I1 N1 Solanum lycopersicum Tanzania, Pwani, Bagamoyo-mtoni M44 I1 N1 Coffea Tanzania, Morogoro, Luale M46 I1 N1 Pisum sativum Tanzania, Morogoro, Luale M49 I1 N1 Solanum lycopersicum Tanzania, Morogoro, Bunduki A1 I1 N1 Abelmoschus esculentus Pakistan, Faisalabad, Chak # 61 JB A3 I1 N1 Abelmoschus esculentus Pakistan, Faisalabad,Dharoran Chak # 146/RB II Meloidogyne javanica Khewa T347 J3 N1 Solanum lycopersicum Rwanda, Kayonza T417 J3 N1 Carmona China T429 J3 N1 Solanum lycopersicum Spain T485 J3 N1 Ficus China T497 J3 N1 Fabaceae (Bean) Morocco T509 J3 N1 Solanum tuberosum Congo T520 J3 N1 Pistache Iran Y60 J3 N1 Dioscorea (Yam) Nigeria, Benue, Tsiabi C35 J3 N1 Solanum lycopersicum Tanzania, Morogoro, Kipera C47 J3 N1 Solanum lycopersicum Tanzania, Morogoro, Mlali C63 J3 N1 Solanum lycopersicum Tanzania, Morogoro, Dakawa C89 J3 N1 Solanum lycopersicum Tanzania, Morogoro, Msongozi M14 J3 N1 Brassica Tanzania, Morogoro, Mlumbilo-Mtibwa M30 J3 N1 Abelmoschus esculentus Tanzania, Pwani, Bagamoyo-mtoni M39 J3 N1 Solanum lycopersicum Tanzania, Dar-es-Salaam, Kisse M40 J3 N1 Brassica oleracea Tanzania, Morogoro, Msufini M50 J3 N1 Coffea Tanzania, Morogoro, Bunduki A8 J3 N1 Solanum melongena Plant Pathology Research Area (Culture), A21 J3 N1 Abelmoschus esculentus Pakistan,University Mandibahauddin, of Agriculture, Phalia, Faisalabad Kadhar A23 J3 N1 Abelmoschus esculentus Pakistan, Mandibahauddin, Phalia, A24 J3 N1 Abelmoschus esculentus Pakistan, Faisalabad,Chhohranwala Chak # 225 RB A25 J3 N1 Cucurbita pepo Pakistan, Mandibahauddin,Malkhanwala Phalia, A29 J3 N1 Solanum melongena Pakistan, Mandibahauddin,Chhohranwala Phalia, Seeray A30 J3 N1 Cucurbita pepo Pakistan, Mandibahauddin, Phalia, Seeray A31 J3 N1 Abelmoschus esculentus Pakistan, Mandibahauddin, Phalia, Seeray A32 J3 N1 Cucurbita pepo Pakistan, Mandibahauddin, Phalia, Meloidogyne arenaria Chhohranwala T311 A3 N1 unknown (extracted from Italie, Monsampolo del Tronto, Marché T332 A2 N1 Solanaceaesoil) France T393 A2 N1 Echiocactus grusonii Netherlands, greenhouse T411 A2 N1 Calathea Costa Rica M41 A2 N1 Allium cepa Tanzania, Morogoro, Msufini T453 A2 N3 Livistonia Sri Lanka

Huu Tien Nguyen | 2018

T461 A2 N3 Hosta USA Y19 A2 N3 Dioscorea (Yam) Nigeria, Benue, Otukpo Y34 A2 N3 Dioscorea (Yam) Nigeria, Niger, Tufakampani Meloidogyne sp. 1 T473 A2-S1-M1 N1 Heliconia Tanzania T585 A2-S1-M1 N1 Ficus China Meloidogyne sp. 2 T316 A1a-S1 N1 Beta vulgaris Spain T576 A1a-S1 N1 Solanum lycopersicum Guatemala Meloidogyne luci T326 L3 N1 Solanum lycopersicum Dornberg, Slovenia T459 L3 N1 Solanum lycopersicum Guatemala T693 L3 N1 Daucus carota Iran Meloidogyne inornata T638 I3 N1 Solanum lycopersicum Chili T695 I3 N1 Solanum lycopersicum Chili Meloidogyne ethiopica T612 E3 N1 Solanum lycopersicum Brazil, Charchar, received from R. Carneiro

REMARKS

In general, the morphology of M. incognita in Belgium is highly in agreement with the description of Whitehead (1968). Only few variations were observed such as the longer body length of juveniles (406 (374-420) µm vs 371 (337-403) µm) and the larger DGO value of the males (3.8 (3.2-4.4) vs 2.1 (1.4-2.5)). However, these variations are small and the measurements of other population also showed some variations (see table 4).

Figure 9. The haplotype network shows the relationships between different haplotypes, circle size is equivalent to the number of sequences and small black circles indicate the mutations.

Huu Tien Nguyen | 2018

Table 4. The measurements of M. incognita from different populations

M. incognita (Kofoid & white, 1919) M. incognita (Širca et al., M. incognita (Belgium) (Chitwood, 1949) Whitehead, 1968 2004) Character Juveniles Males Females Juveniles Males Females Juveniles Females n 20 10 10 25 14 20 10 5 406 ± 17.1 1884.0 ± 135 584 ± 66.8 371 ± 16 1583 ± 227 609 ± 55 404.5 Body length (L) - (374-420) (1728-2048) (506-751) (337-403) (1108-1953) (500-723) (378.7-416.8) 27.4 ± 2.4 48.5 ± 4.0 1.8 ± 0.1 28.3 ± 1.65 46.3 ± 6.33 29.0 a - - (23.5-32.6) (44.9-54.2) (1.5-2.0) (24.9-31.5) (31.4-55.4) (26.7-32.1) 2.4 ± 0.3 3.0 ± 0.3 7.9 ± 0.6 b’ - - - - - (2.4-3.5) (7.3-8.6) (2.0-3.1) 8.4 ± 0.4 204.4 ± 107.6 8.1 ± 0.67 146 ± 40.6 7.9 c - - - (7.7-9.0) (137.1-365.1) (6.9-10.6) (97-255) (7.2-8.9) 5.0 ± 0.4 0.4 ± 0.3 5.0 c' - - - - - (4.5-5.6) (0.1-0.6) (4.2-6.8) 230 ± 9 length anterior end to middle of genital 254 ± 18.2 ------primordium (228-279) (212-247) 7.2 ± 1.1 Head cap height ------(6.3-8.8) 13.4 ± 0.3 Head cap width ------(13.2-13.9) 10.9 ± 0.8 24.7 ± 0.9 15.6 ± 0.7 10.5 ± 0.6 25 ± 2.51 14 11.3 16.5 Stylet length (9.5-12.0) (23.9-25.8) (14-17) (9.6-11.7) (23-0-32-7 (13-16) (10.3-11.9) (16.0-16.7) 6 ± 0.5 13.9 ± 0.5 9 ± 0.9 Conus length - - - - - (5-6) (13.2-14.5) (8-10) 4 ± 0.6 8.0 ± 0.6 4.8 ± 0.7 Shaft length - - - - - (3-5) (7.6-8.8) (4-6) 1 ± 0.0 2.8 ± 0.4 2.3 ± 0.3 Knob height - - - - - (1-1) (2.5-3.2) (2-3) Dorsal gland opening from stylet base 4 ± 0.5 3.8 ± 0.7 3.8 ± 0.6 2.1 ± 0.45 3 2.6 3.6 - (DGO) (3-4) (3.2-4.4) (3-4) (1.4-2.5) (2-4) (2.3-2.9) (3.1-4.4) 84 ± 3.4 176.4 ± 14.2 23 ± 7.8 Anterior end to secretory-excretory pore - - - - - (79-89) (156.2-189.6) (16-38)

Huu Tien Nguyen | 2018

71 ± 3.4 126.9 ± 12.0 Anterior end to nerve ring ------(66-77) (110.3-138.6) Anterior end to the end of pharyngeal 139 ± 15.5 239.7 ± 2.2 ------gland (117-173) (237.5-241.9) 15 ± 1.5 38.9 ± 2.5 327 ± 55.0 415 ± 48 13.9 Max body diameter (MBD) - - - (13-18) (35.9-41.0) (259-430) (331-520) (12.7-15.0) 10 ± 0.6 71.7 ± 101.3 10.5 Anal body diameter (ABD) - - - - - (9-11) (18.9-223.7) (8.4-12.0) 50 ± 2.5 10.7 ± 3.8 46 ± 3 Tail length - - - - - (46-53) (5.0-13.2) (38-55) 15 ± 2.1 Hyaline length ------(13-20) 35.2 ± 2.93 33.5 ± 5.1 Spicule length (along arc) ------(28.4-40.3) (28-8-40.3) 4.1 ± 0.6 Spicule width ------(3.8-5.0) 11.0 ± 1.2 11.2 ± 1.50 Gubernaculum length ------(10.1-12.6) (9.4-13.7) 243 ± 37.9 neck length ------(184-311) 81 ± 10.5 Anterior end to end of Median bulb ------(67-101) 36 ± 6.4 39 39.3 Metacorpus diameter - - - - - (28-47) (31-49) (32-51) 18.7 ± 2.9 Vulva slit length ------(15-23) 23 ± 3.2 Vulva width ------(19-28) 16.2 ± 2.2 Vulva-anus distance ------(12-18)

Note: the population of M. incognita (Kofoid & white, 1919) (Chitwood, 1949) Whitehead, 1968 is considered as type population

Huu Tien Nguyen | 2018

According to Whitehead (1968) the perinial patterns of M. incognita vary from the incognita type (with pattern striae closely spaced and wavy, dorsal arch high and squared) to the acrita type (with pattern striae smoother and wider apart, dorsal arch flattened dorsally).

The perineal pattern of Belgian population of M. incognita belongs to M. incognita incognita type with rounded to oval perineal pattern, wavy striae, high and squared dorsal arch, absent or indistinct lateral field.

HOST AND LOCALITY

The Belgian population of M. incognita was recovered from soil and root samples from the rhizosphere of Hedychium greenii in the botanical garden of Gent University, Belgium

(GPS coordinates N: 51o2’6.7”, E: 3o43’22.4”).

SPECIMEN VOUCHER

All the permanent slides (7 perineal patterns (in 7 slides), 6 mature females (3 females each slide), 14 males (in 3 slides) and 6 juveniles (in 1 slide)) are available in the UGent

Nematode Collection (slide number UGnem 180-191) of the Nematology Research Unit,

Department of Biology, Ghent University, Ghent, Belgium.

Discussion

This study provides the morphological characterisations of the juveniles, males, and females of M. incognita in Belgium. Perineal pattern of mature females, additional morphological and morphometric characteristics of mature females, males, and juveniles are useful information in identifying Meloidogyne spp. (Jepson, 1987; Eisenback &

Triantaphyllou, 1991; Karssen, 2002; Perry et al., 2009; Perry & Moens, 2013). However, even the some useful identification features, such as the form of perineal pattern or the number of lip annuli, showed the intraspecific variations (Whitehead, 1968; Perry et al.,

2009). The variation in the number of post-labial annuli of M. incognita in Belgium (ranging

Huu Tien Nguyen | 2018

from 1 to 3 annuli) confirmed the plasticity of morphological features in the genus

Meloidogyne. Therefore, the additional methods such as biochemical-based or molecular- based methods are needed in identifying the species in the genus Meloidogyne.

This study applied a haplotype network analysis that based on the Nad5 sequences of M. incognita in Belgium and reliable reference sequences from Janssen et al. (2016) to determine the relationship between target species and the species in tropical RKN group.

Haplotype network analysis is a recently introduced analysis that can be applied on population genetic data to visualize genealogical relationships at the intraspecific level and to make the inference about biogeography and history of populations (Leigh & Bryant, 2015).

Due to the presence of the phenomena like hybridisation, horizontal gene transfer, and symbiosis, biologists should believe that true evolutionary relationships are reticulate rather than strictly tree-like (Morrison, 2005). The identicalness between Nad5 sequences from

Belgian population of M. incognita and 5 other reference sequences of M. incognita has led to the similar haplotype network compared to Janssen et al. (2016). The reliability of Janssen et al. (2016) was also confirmed by the consensus between morphological and molecular data from this study.

Figure 10: Suitable area (area of potential establishment, on the left; orange dots: EI>0, white dots: EI=0, grey: no data) and growth potential (GI; on the right) for M. incognita in Europe based on a CLIMEX model by Zhenya Ilieva (Robinet et al., 2018)

Huu Tien Nguyen | 2018

Robinet et al. (2018) constructed the suitable and growth potential maps for M. incognita using the model that was based on wide range of information from the hosts, distribution, potential spread, and climatic suitability. The suitable area map shows Ecoclimatic Index (EI) that indicates how favourable the climate is for the long term survival of the species, and the growth potential map shows Growth Index (GI) that indicates the overall potential for the population growth. With the assumption of the input data such as Ecoclimatic index, the spread rate, and growing time, the model will return the output data that shows the growth potential area for the pest. In figure 10, the model shows that the suitable areas for M. incognita are restricted at southern Europe, but the growth potential areas occur all over

Europe at the end time point of the test. The study was done with the help of Zhenya Ilieva, an expert on Meloidogyne, who also provided input data and reviewed the results. These results implied the potential spread of M. incognita to Belgium and other countries in Europe in future.

The Belgian population of M. incognita has been found on Hedychium greenii in the botanical garden of Gent University, Belgium. This plant is an imported exotic plant from the

Himalaya Mountains (probably a cold region) and was planted outside under the Belgian weather conditions (with cold winter season) several years ago. However, M. incognita is known as a tropical nematode and strictly distributed in warm weather conditions (Wesemael et al., 2011). Thus, this nematode probably has the origin from one of the tropical plants that were also imported and planted in the botanical garden of Gent University. In addition, during winter time, the aerial parts of the host plant were cut down and the growing area was covered by chopped woods (see Fig. 7). This maybe created a more suitable condition for M. incognita, a tropical nematode. It is remaining unknown whether this nematode can survive without the support of the chopped wood cover during winter time or not.

Huu Tien Nguyen | 2018

Although M. incognita was reported in Belgium by Moens and Hendrickx (1990) and

Government Agricultural Research Centre (1974), the identification in the report of Moens and Hendrickx (1990) cannot be guaranteed since it is insufficient to identify Meloidogyne species based on the second-stage juveniles only. Government Agricultural Research Centre

(1974) reported the presence of M. incognita in two-thirds of the nurseries growing multiflora tuberous begonias, but no related taxonomical information was found. By the combination of morphological features and the characterisation of Nad5 gene as well as the repeated sampling, this study confirms the presence of M. incognita in Belgium and its survival during winter time, at least when the soil is covered with chopped woods during winter time.

Acknowledgement

This work was supported by the special research fund UGent 01N02312.

References

Agrios, G. N. 2005. Plant pathology, San Diego, California, Elsevier Academic Press, 391 pp. Ahmed, M., Van De Vossenberg, B. T., Cornelisse, C. & Karssen, G. 2013. On the species status of the root-knot nematode Meloidogyne ulmi Palmisano & Ambrogioni, 2000 (Nematoda, Meloidogynidae). ZooKeys, 1-27. DOI:10.3897/zookeys.362.6352 Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic acids research 25, 3389-3402. Bandelt, H. J., Forster, P. & Röhl, A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16, 37-48. DOI:10.1093/oxfordjournals.molbev.a026036 Carneiro, R. M. D. G., Correa, V. R., Almeida, M. R. A., Gomes, A. C. M. M., Mohammad Deimi, A., Castagnone-Sereno, P. & Karssen, G. 2014. Meloidogyne luci n. sp. (Nematoda: Meloidogynidae), a root-knot nematode parasitising different crops in Brazil, Chile and Iran. Nematology 16, 289-301. DOI:10.1163/15685411-00002765 Chitwood, B. G. 1949. Root-knot nematodes, part I. A revision of the genus Meloidogyne Goeldi, 1887. Proceedings of the Helminthological Society of Washington 16, 90-104. Eisenback, J. D. & Triantaphyllou, H. H. 1991. Root-knot nematodes: Meloidogyne species and races. In: R., N. W. (Ed.) Manual of Agricultural Nematology. New York: Marcell Dekker, 191-274. Esbenshade, P. R. & Triantaphyllou, A. C. 1985. Use of enzyme phenotypes for identification of Meloidogyne species. Journal of nematology 17, 6-20. Government Agricultural Research Centre, B. 1974. Activity report 1973. 203 pp.

Huu Tien Nguyen | 2018

Handoo, Z. A., Nyczepir, A. P., Esmenjaud, D., Van Der Beek, J. G., Castagnone-Sereno, P., Carta, L. K., Skantar, A. M. & Higgins, J. A. 2004. Morphological, molecular, and differential-host characterization of Meloidogyne floridensis n. sp.(Nematoda: Meloidogynidae), a root-knot nematode parasitizing peach in Florida. Journal of nematology 36, 20-35. Humphreys-Pereira, D. A., Elling, A. A., Gómez, M., Flores-Chaves, L., Gómez-Alpízar, L. & Salazar, L. 2014. Meloidogyne lopezi n. sp.(Nematoda: Meloidogynidae), a new root- knot nematode associated with coffee (Coffea arabica L.) in Costa Rica, its diagnosis and phylogenetic relationship with other coffee-parasitising Meloidogyne species. Nematology 16, 643-661. DOI:10.1163/15685411-00002794 Janssen, T., Karssen, G., Verhaeven, M., Coyne, D. & Bert, W. 2016. Mitochondrial coding genome analysis of tropical root-knot nematodes (Meloidogyne) supports haplotype based diagnostics and reveals evidence of recent reticulate evolution. Scientific Reports 6, 1-13. DOI:10.1038/srep22591 Jepson, S. B. 1987. Identification of Root-Knot Nematodes C A B Intl, 265 pp. Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T., Manzanilla‐López, R., Palomares‐Rius, J. E., Wesemael, W. M. & Perry, R. N. 2013. Top 10 plant‐parasitic nematodes in molecular plant pathology. Molecular Plant Pathology 14, 946-961. DOI:10.1111/mpp.12057 Karssen, G. 2002. The plant parasitic nematode genus Meloidogyne Göldi, 1892 (Tylenchida) in Europe, Brill, 160 pp. Kofoid, C. A. & White, A. W. 1919. A new nematode infection of man. Journal of the American medical Association 72, 567-569. DOI:10.1001/jama.1919.02610080033010 Leigh, J. W. & Bryant, D. 2015. Popart: full‐feature software for haplotype network construction. Methods in Ecology and Evolution 6, 1110-1116. Lordello, L. G. E. 1956. Meloidagyne inornata sp. n., a serious pest of soybean in the State of Sao Paulo, Brazil (Nematoda, Heterodendae). Revista Brasileira de Biologia 16, 65- 70. Moens, M. & Hendrickx, G. 1990. Nematode infection by recirculating nutrient solutions in gullies. Mededelingen van de Faculteit Landbouwwetenschappen, Rijksuniversiteit Gent 55, 739-743. Morrison, D. A. 2005. Networks in phylogenetic analysis: new tools for population biology. International journal for parasitology 35, 567-582. DOI:10.1016/j.ijpara.2005.02.007 Neal, J. C. 1889. The root-knot disease of the peach, orange and other plants in Florida due to the work of Anguillula, Bulletin US Bureau of Entomology, 74 pp. Perry, R. & Moens, M. 2013. Plant nematology, CABI, 542 pp. Perry, R. N., Moens, M. & Starr, J. L. 2009. Root-knot nematodes, CABI, 488 pp. Robinet, C., Kehlenbeck, H. & Van Der Werf, W. 2018. A report comparing the advantages and disadvantages of different approaches for creating a generic integrated model for pest spread and impacts. EU Framework 7 Research Project, 229 pp. Singh, P. R., Nyiragatare, A., Janssen, T., Couvreur, M., Decraemer, W. & Bert, W. 2018. Morphological and molecular characterisation of Pratylenchus rwandae n. sp. (Tylenchida: Pratylenchidae) associated with maize in Rwanda. Nematology, 1-14. DOI:10.1163/15685411-00003175 Širca, S., Urek, G. & Karssen, G. 2004. The incidence of the root-knot nematode Meloidogyne incognita and Meloidogyne hapla in Slovenia. Acta agriculturae slovenica 83, 15-22.

Huu Tien Nguyen | 2018

Tao, Y., Xu, C., Yuan, C., Wang, H., Lin, B., Zhuo, K. & Liao, J. 2017. Meloidogyne aberrans sp. nov.(Nematoda: Meloidogynidae), a new root-knot nematode parasitizing kiwifruit in China. PloS one 12, e0182627. DOI:10.1371/journal.pone.0182627 Treub, M. 1885. Onderzoekingen over sereh-ziek suikerriet gedaan in s'Lands Plantentuin te Buitenzorg. Meded. uit 's lands plantentuin Batavia 2, 1-39. Trinh, Q. P., Le, T. M. L., Nguyen, T. D., Nguyen, H. T., Liebanas, G. & Nguyen, T. a. D. 2018. Meloidogyne daklakensis n. sp. (Nematoda: Meloidogynidae), a new root-knot nematode associated with Robusta coffee (Coffea canephora Pierre ex A. Froehner) in the Western Highlands, Vietnam. Journal of helminthology, 1-13. DOI:10.1017/S0022149X18000202 Trudgill, D. L. & Blok, V. C. 2001. Apomictic, polyphagous root-knot nematodes: exceptionally successful and damaging biotrophic root pathogens. Annu Rev Phytopathol 39, 53-77. DOI:10.1146/annurev.phyto.39.1.53 Wesemael, W. M. L., Viaene, N. & Moens, M. 2011. Root-knot nematodes (Meloidogyne spp.) in Europe. Nematology 13, 3-16. DOI:10.1163/138855410x526831 Whitehead, A. G. 1968. Taxonomy of Meloidogyne (Nematodea: Heteroderidae) with descriptions of four new species. The Transactions of the Zoological Society of London 31, 263-401. Whitehead, A. G. & Hemming, J. R. 1965. A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Annales of Applied Biology 55, 25– 38. DOI:10.1111/j.1744-7348.1965.tb07864.x

Huu Tien Nguyen | 2018

Chapter 3: Description of a new species of Rotylenchus and a

Belgian population of Rotylenchus buxophilus (Tylenchomorpha:

Hoplolaimidae)

Huu Tien Nguyen

Summary – During a survey in the Botanical garden of Ghent University, a new species

Rotylenchus n. sp. and a population of Rotylenchus buxophilus were detected. Rotylenchus n. sp. is characterised by the presence of a rhomboid-like widening of the mid-ridge of the lateral field at the level of the vulva, a feature so far unique within the genus. The new species, only known by females, has a rounded labial region with 4-5 annuli, robust stylet 31-

37 μm long, short (9-19 μm) dorsal pharyngeal gland overlap of the intestine, vulva located slightly posterior to mid-body, and hemispherical or rounded tail shape with rather large phasmids located 3-5 annuli anterior to the level of the anus. The Hierarchical Cluster analysis based on morphological features indicated that the new species closely resembles R. corsicus, R. gracilidens, and R. rugatocuticulatus. The DNA analyses of the D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA sequences of Rotylenchus n. sp. show a close relationship with R. buxophilus, R. goodeyi, R. laurentinus, R. pumilus, and R. incultus which can also be differentiated from the new species by morphological features. The combination of morphological, morphometric and molecular characteristics support the new species and confirm the first report of R. buxophilus in Belgium.

Keywords – 28S, barcode, barcoding, banana, cluster, COI, D2D3, Dioscorea toroko, exotic plant, first report, ITS, maker, molecular, morphological, morphology, mtDNA, Musa basjoo, nematode, phylogeny, plant-parasitic, rDNA, systematic, taxonomy, Yam.

Huu Tien Nguyen | 2018

The type species Rotylenchus robustus was originally described by de Man as Tylenchus robustus in 1876. In a publication concerning free-living nematodes and their relation to the parasitic nematodes, Filipjev (1934) proposed the new genus Rotylenchus based on the type species T. robustus of de Man, 1876.

The genus Rotylenchus is widely distributed all over the world and has been recorded from all continents with 102 valid species till date (Castillo & Vovlas, 2005; Vovlas et al.,

2008; Atighi et al., 2011; Cantalapiedra-Navarrete et al., 2012; Cantalapiedra-Navarrete et al., 2013; Talezari et al., 2015; Golhasan et al., 2016). According to Castillo and Vovlas

(2005), Rotylenchus shows the second highest diversity in Europe after Asia (Castillo &

Vovlas, 2005).

Several species of Rotylenchus are of economic importance in agriculture, among them R. robustus, Rotylenchus buxophilus Golden (1956), R. uniformis (Thorne, 1949) Loof and

Oostenbrink (1958) and Rotylenchus goodeyi Loof and Oostenbrink (1958) have been reported on many host plants. They are the main cause for yield losses in many agricultural crops. R. robustus is considered as the most common species worldwide, and has been reported from 25 countries and islands on all continents except for Antarctica. R. buxophilus is also a widely distributed species, occurring in Europe, Asia, North America, and New

Zealand. R. uniformis is known to have a wide host range and decrease the yield of a range of horticultural and agricultural crops, including pea, carrot, young trees and grass (Castillo &

Vovlas, 2005). Currently, only R. goodeyi, R. robustus, and R. uniformis have been reported in Belgium (Steel et al., 2014).

Herein, the new species Rotylenchus n. sp. and a population of R. buxophilus, which was discovered for the first time in Belgium, were described based on a combination of morphological, morphometric, and molecular characteristics of the D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA sequences.

Huu Tien Nguyen | 2018

Materials and methods

SAMPLING AND NEMATODE EXTRACTION

The soil and root samples were collected around the rhizosphere of banana (Musa basjoo) and Yam (Dioscorea toroko) at the Botanical garden of Ghent University. The nematodes were extracted from soil and roots by the modified Baermann tray method (Whitehead &

Hemming, 1965).

MORPHOLOGICAL CHARACTERISATION

Nematodes were fixed in Trump’s fixative (2% paraformaldehyde + 2.5% glutaraldehyde in a 0.1 M Sorenson buffer (Sodium phosphate buffer at pH 7.3)), before a dehydration to make permanent slides following the method described by Singh et al. (2018).

Microphotographs and drawings were made from permanent slides by using an Olympus

BX51 DIC Microscope with the support of a drawing tube and digital camera. The software

ImageJ 1.51 was used to calculate the measurements from the obtained pictures. The illustrations were made by Illustrator ® CS 3 based on pencil drawings and SEM pictures.

For scanning electron microscopy, specimens were processed and viewed following the procedure of Steel et al. (2011).

MOLECULAR CHARACTERISATION

Temporary slides of nematodes were made and digital light microscope pictures were taken as morphological vouchers. Then, the nematodes were cut into pieces and put in the

Eppendorf tubes with 20µ of WLB (50mM KCl;10mM Tris pH 8.3; 2.5mM MgCl2; 0.45%

NP 40 (Tergitol Sigma); 0.45% Tween 20) and were frozen for at least 10 min at −20°C. 1μl proteinase K (1.2 mg ml−1) was added before the incubation in a PCR machine for 1 h at

65°C and 10 min at 95°C and centrifugation for 1 min at 14000 rpm. Finally, the samples were stored at −20°C before running PCR (Singh et al., 2018).

Huu Tien Nguyen | 2018

For each PCR reaction, 23 µl of Mastermix (17µl Water; 2.5µl 10x buffer; 2µl MgCL2;

2.5µl Coralload; 0.5µl dNTP (10mM); 0.5µl Primer 1; 0.5µl Primer 2; 0.06µl Toptaq) and

2µl DNA template were used. The 5’-end of the 28S rDNA region was amplified using the primers DP391/501 (AGCGGAGGAAAAGAAACTAA/TCGGAAGGAACCAGCTACTA)

(Nadler et al., 2006) with the PCR reaction started at 94°C for 4 min, followed by 5 cycles of

94°C for 30 s, 45°C for 30 s, and 72°C for 2 min. This step was followed by 35 cycles of

94°C for 30 s, 54°C for 30 s and 72°C for 1 min and finished at 12°C for 10 min. For ITS rDNA region, the primers Vrain2F/Vrain2R

1 (COI mtDNA) gene was amplified using the primers JB3/JB4

(TTTTTTGGGCATCCTGAGGTTTAT/ TAAAGAAAGAACATAATGAAAATG) according to the protocol of Derycke et al. (2010). The amplicons were visualized by gel electrophoresis to check the result of the PCR reaction. The successful PCR reactions were purified and sequenced commercially by Macrogen Inc. (Europe).

The forward and backward sequences were assembled in GENEIOUS R11 to get the consensus sequences. All the contigs were used for the BLAST search on GenBank to check for the closely related species (Altschul et al., 1997). Multiple alignments of the different sequences of each gene were made using MUSCLE in MEGA 7 (Barry, 2011). The poorly aligned regions were removed from the alignments using Gblocks

(http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks) (Castresana, 2000;

Dereeper et al., 2008). The phylogenetic trees were created by using MrBayes 3.2.6 Add-in in GENEIOUS R11 under the models that were selected by using MEGA 7 based on BIC criterion (Barry, 2011). The selected models were HKY+G for the D2-D3 of 28S rDNA and

Huu Tien Nguyen | 2018

ITS rDNA sequences, and GTR+G+I for COI mtDNA sequences. The Markov chains were set with 1 × 106 generations, 4 runs, 20% burn-in, and subsampling frequency was 500 generations (Huelsenbeck & Ronquist, 2001). For D2-D3 of 28S rDNA dataset,

Helicotylenchus dihystera (AB933471) and Helicotylenchus multicinctus (MF401446) were chosen as out-groups. The out-groups were Hoplolaimus columbus (FJ485623) and

Hoplolaimus seinhorsti (KX446971) for ITS rDNA dataset, and Scutellonema brachyurus

(JX472089) and Scutellonema truncatum (KX959308) for COI mtDNA dataset.

CLUSTER ANALYSIS

This cluster analysis was achieved by the Hierarchical Cluster analysis of the software

Primer 6 using Bray-Curtis similarity measure with the percent similarity between species defined by the average of the multiple characters. This analysis used 11 main characters of

102 described species and Rotylenchus n. sp. which were ranked according to Castillo and

Vovlas (2005): A) Lip annulation: 1: absent or smooth labial region, 2: labial region with 2-3 annuli, 3: labial region with four annuli, 4: labial region with five annuli, 5: labial region with six annuli, 6: labial region with 7-8 annuli, 7: labial region with 9-10 annuli; B) Labial region shape: 1: labial region hemispherical, 2: labial region rounded, 3: labial region conoid, 4: labial region truncate; C) Lateral field areolation: 1: areolated only in pharyngeal region, 2: areolated in pharyngeal region and irregularly areolated at mid-body, 3: areolated in pharyngeal region and incompletely areolated at mid-body, 4: areolated in pharyngeal region and near phasmids, 5: areolated along whole length of body except at tail region, 6: areolated along whole length of body including the tail region, 7: incompletely areolated along whole body; D) Body longitudinal striations: 1: punctated along body annuli, 2: longitudinally striated in pharyngeal region, 3: longitudinally striated over whole body, 4: without body striations; E) Stylet length: 1: stylet shorter than 30 µm, 2: stylet between 30 and 35.9 µm, 3: stylet between 36 and 40.9 µm, 4: stylet longer than 41 µm; F) Dorsal pharyngeal gland

Huu Tien Nguyen | 2018

outlet to stylet base: 1: DGO less than 2 µm, 2: DGO between 2 and 6.9 µm, 3: DGO between 7 and 12 µm, 4: DGO >12 µm; G) Dorsal pharyngeal gland overlapping: 1: pharyngeal gland overlapping less than 5 µm, 2: pharyngeal gland overlapping by 6-20.9 µm,

3: pharyngeal gland overlapping by 21-30.9 µm, 4: pharyngeal gland overlapping by 31-40.9

µm, 5: pharyngeal gland overlapping by > 41 µm; H) Tail shape: 1: hemispherical, 2: rounded, 3: conoid, 4: pointed, 5: with ventral projection; I) Ratio V: 1: ratio V < 50%, 2: ratio V of 50-70%, 3: ratio V > 70%; J) Presence of males: 1: males present,2: males absent;

K) Phasmid position: 1: well anterior to level of anus (> five annuli anterior to anus), 2: at level of anus (from five annuli anterior to five annuli posterior to anus), 3: well posterior to level of anus (> five annuli posterior to anus) (Castillo & Vovlas, 2005).

Results

Rotylenchus n. sp.

MEASUREMENTS

See table 5.

Table 5. Morphometric data of Rotylenchus. n. sp. from glycerin-fixed specimens. All measurements are in μm (except for ratio) and in the form: mean ± sd. (range). Character Holotype female Paratype females n 1 12

Body length (L) 827 861 ± 101 (634 - 1049) a= L/MBD 28.5 31.8 ± 2.8 (27.8 - 35.1) b’= L/ Anterior end to the end of pharyngeal gland 7.6 6.9 ± 0.5 (5.6 - 7.6) c= L/Tail length 55 63.3 ± 10.7 (50.3 - 85.5) c’= Tail length/ABD 68 0.7 ± 0.1 (0.5 - 0.8)

V=Anterior end to vulva/L 59 56 ± 2.6 (53 - 61) Lip height 6 6 ± 0.7 (5 - 7) Lip width 11 10 ± 0.8 (8 - 11)

Huu Tien Nguyen | 2018

Stylet length 35 33 ± 1.5 (31 - 37) Conus length 17 17 ± 0.8 (16 - 18) Shaft length 14 13 ± 0.9 (12 - 14) Knob height 3 3 ± 0.4 (3 - 4) Dorsal gland opening from stylet base 4 3 ± 0.9 (2 - 5)

Anterior end to secretory-excretory pore 100 107 ± 10.6 (77 - 123) Anterior end to nerve ring 78 86 ± 9.9 (60 - 96)

Anterior end to pharyngeal gland end 108 125 ± 10.5 (108 - 146)

Pharynx overlapping 12 14 ± 2.3 (9 - 19)

Max body diameter (MBD) 29 27 ± 2.3 (23 - 31) Anal body diameter (ABD) 22 20 ± 1.8 (16 - 23) Tail length 15 14 ± 2.0 (9 - 16) Tail annuli number 11 10 ± 1.0 (8 - 11)

DESCRIPTION

Females

Body relatively small, habitus spiral or C-shaped. Lateral fields with four lines at mid- body, beginning anteriorly at 7-8th annulus as two lines forming one band, third line appearing at level 10-11th annulus; mid-ridge at vulva level with a characteristic rhomboid widening. Regular areolation of lateral fields observed only in pharyngeal region. Cuticle clearly annulated with irregular longitudinal striations in anterior region; annuli 1.6–2 μm wide at mid-body. Labial region rounded, offset from rest of body, bearing 4-5 annuli, divided longitudinally; labial disc rounded to hexagonal, marked from rest of labial region, but not elevated. Stylet robust; basal knobs rounded, 3-4 μm height. Dorsal pharyngeal gland opening 2-5 μm posterior to stylet base. Procorpus cylindrical, with slight depression just anterior to median bulb; median bulb well developed, rounded or broadly oval; isthmus slender, encircled by nerve ring; pharyngeal glands sacciform, overlapping intestine dorsally.

Secretory-excretory pore usually located just posterior to the hemizonid. Hemizonid distinct

Huu Tien Nguyen | 2018

ca 1.5-2 body annuli long, located around pharyngo-intestinal junction level. Reproductive system with both genital branches equally developed; vulva slightly posterior to mid-body, without distinct epiptygma; ovaries with a single row of oocytes; spermatheca mostly oval, without sperm. Tail short varying in shape from hemispherical to rounded, with 8-11 annuli ventrally, terminus striated. Phasmid opening relatively large 1.6 (1.2-2) μm, pore-like, located 3-5 annuli anterior to level of anus. (Fig. 11, 12).

Male

Not found.

MOLECULAR CHARACTERISATION

LSU rDNA

Four sequences of 5’-end region of 28S rDNA were obtained with the length from 916 to

1057 bp. The analysis of D2-D3 of 28S rDNA involved 46 nucleotide sequences. In the Blast results, the similarities of the sequences of Rotylenchus n. sp. were 86-97% compared to other Rotylenchus species. The length of Muscle alignment was 1080 positions, and Gblocks retained 655 positions in the final dataset after the removal of poorly aligned regions. The intraspecific variations of the sequences of Rotylenchus n. sp. were 1-4 positions (0.1-0.5%).

They differed from other species by 14-60 positions. The Bayesian interference phylogenetic tree based on the D2-D3 of 28S rDNA sequences showed that the sequences of Rotylenchus n. sp. have a maximally supported sister relation (1 PP) with R. buxophilus, R. goodeyi, R. laurentinus (Scognamiglio & Talamé, 1972), R. pumilus (Perry, V. G., Darling, H. M. &

Thorne, G. 1959) Sher (1961), and R. incultus Sher (1965) and were placed at the basal position of this group (Fig. 13).

Huu Tien Nguyen | 2018

Figure 11. The LM pictures of Rotylenchus n. sp. females: A: Pharyngeal region; D: Vulva region; E: Lateral field at vulva region with a rhomboid widening (see arrow); G: Entire body. H: Tail region; I: lateral field with phasmid at tail region. The SEM pictures of R. G01: B: Anterior body region; C: Enface view (arrow indicate amphid aperture); F: Vulva region; J: Vulva region, ventral view; K: Tail region of female; L, M: tail region of juveniles. (D, E, G, H, I: Holotype).

Huu Tien Nguyen | 2018

Figure 12. Rotylenchus n. sp., Females. A. Entire body; B: Enface; C: Head region; D: Pharyngeal region; E: Lateral field at vulva region; F: Vulva region; G: Tail region; H: Lateral field at tail region. (B, C based on SEM illustrations) (A, E, F, G, H: Holotype).

Huu Tien Nguyen | 2018

Figure 13. BI phylogenetic tree generated from the D2-D3 of 28S rDNA region dataset with the HKY+G model. Bayesian posterior probabilities are given next to each node. Sequences of Rotylenchus n. sp. and R. buxophilus (Belgium) are in red and blue, respectively. ITS rDNA

Six ITS rDNA sequences were obtained with the length from 1026 to 1339 bp. The analysis of ITS rDNA region involved 34 nucleotide sequences. The sequences of

Rotylenchus n. sp. were 70-86% similar to other Rotylenchus species on GenBank. The length of Muscle alignment was 1443 positions, and 366 positions were retained in the ITS final dataset. The sequences of Rotylenchus n. sp. were 99-100% similar to each other (0-4 different nucleotides). The variations compared to other species were 31-80 positions (7-

21%). The ITS tree topology showed small changes compared to D2-D3 tree topology. The sequences of Rotylenchus n. sp. have the closest relation with R. buxophilus, R. incultus, and

Huu Tien Nguyen | 2018

R. laurentinus (0.97 PP). There was a swap between the position of the sequences of

Rotylenchus n. sp. and R. incultus compared to D2-D3 tree (Fig. 14).

Figure 14. BI phylogenetic tree generated from ITS sequences with HKY+G model. Bayesian posterior probabilities are given next to each node. Sequences of Rotylenchus n. sp. and R. buxophilus (Belgium) are in red and blue, respectively. COI mtDNA

Three COI mtDNA sequences were obtained (442 bp in length). The analysis of COI mtDNA involved 35 nucleotide sequences. The Blast search using the sequences of

Rotylenchus n. sp. showed 73-86% similarities compared to other Rotylenchus species on

GenBank. The Muscle alignment’s length was 445 positions, and Gblocks retained 290 positions in the final dataset. The sequences of Rotylenchus n. sp. showed 5-8 varied positions (2-3% different) compared to each other and these were 37-88 different positions

(17-30% different) compared to other species. The phylogenetic tree based on the COI

Huu Tien Nguyen | 2018

mtDNA showed almost the same topology with the ITS tree. In that, the sequences of

Rotylenchus n. sp. also have a closest relation with R. buxophilus, R. incultus, and R. laurentinus (1 PP) (Fig. 15).

Figure 15. BI phylogenetic tree generated from COI sequences with the GTR+G+I model. Bayesian posterior probabilities are given next to each node. Sequences of Rotylenchus n. sp. and R. buxophilus (Belgium) are in red and blue, respectively.

DIAGNOSIS AND RELATIONSHIPS

Rotylenchus n. sp. is characterised by a combination of the following traits: a rounded labial region with 4 annuli; an annulated body cuticle with irregular longitudinal striations in the anterior region; lateral field with 4 lines forming 3 ridges at mid-body, areolated only at

Huu Tien Nguyen | 2018

pharyngeal region; a rhomboid widening at the mid-ridge at level of the vulva; a robust stylet of average length (31-37 μm); pharyngeal glands shortly overlapping the intestine dorsally; female reproductive system with oval spermatheca without sperm and a vulva located slightly posterior to mid-body; hemispherical or rounded tail tip with relatively large phasmids (1.2-2

µm) located 3-5 annuli anterior to the level of the anus; male was not found. According to

Castillo and Vovlas (2005), the matrix code for this new species is: A3-4, B2, C1, D2, E2,

F2, G2, H1-2, I2, J2, K2.

Table 6. Comparison of the matrix code of Rotylenchus n. sp. with other closely related species Species A B C D E F G H I J K

Rotylenchus n. sp. 3-4 2 1 2 2 2 2 1-2 2 2 2 R. buxophilus from Belgium 4 1 1 4 2 2 3 3 2 2 1 R. buxophilus 4 1 1 4 2 2 3 3 2 2 1 R. corsicus 4 1 1 2 2 2 2 3 2 2 1 R. goodeyi 3 1 1 4 2 2 4 2 2 1 2 R. gracilidens 3 1 1 2 2 2 3 1 2 1 1 R. incultus 4 1 1 4 1 2 3 1 2 1 1 R. laurentinus 4 1 1 3 2 2 3 1 2 1 2 R. pumilus 4 1 1 4 1 2 2 1 2 1 2 R. rugatocuticulatus 3 2 1 2 3 2 4 1 2 1 1

Rotylenchus n. sp. is different from all other species according to the dichotomous key of

Castillo and Vovlas (2005) as well as the comparison with other species from Vovlas et al.

(2008), Atighi et al. (2011), Cantalapiedra-Navarrete et al. (2012), Cantalapiedra-Navarrete et al. (2013), Talezari et al. (2015), and Golhasan et al. (2016). By using the Hierarchical

Cluster analysis of all the characters that were used in the tabular key of Castillo and Vovlas

(2005), all 102 valid species and Rotylenchus n. sp. were separated into close groups that have the highest similarities. The new species was grouped together with R. corsicus Massèse and Germani (2000), Rotylenchus gracilidens Sauer (1958), and Rotylenchus

Huu Tien Nguyen | 2018

rugatocuticulatus Sher (1965) (see Fig. 16). They shared more than 85% similarity to each other and less than 80% similarity to all other species. The shared characters of this group are the labial region having 4-5 annuli, body longitudinal striations being restricted to the pharyngeal region, DGO at 2-6.9 μm from the base of the stylet and ratio V between 50 and

70%.

However, Rotylenchus n. sp. can be distinguished from R. corsicus by three out of the eleven main characters used in the tabular key of Castillo and Vovlas (2005), including B: labial region shape (rounded vs hemispherical); H: tail shape (rounded to hemispherical without mucron vs conoid to rounded with mucron in some specimens); K: phasmid position

(located 3-5 annuli anterior to anus level vs 5-16 annuli anterior to anus level) (Table 6).

Morphometrically, Rotylenchus n. sp. differs from R. corsicus by having a smaller body length (0.6-1 mm vs 0.85-1.1 mm), larger stylet length (31-37 μm vs 31-32 μm), smaller max body diam. (23-31 μm vs 48-57 μm), smaller a value (27.8-35.1 vs 30.5-36.3), larger c value

(50.3-85.5 vs 40.3-58.3), and smaller c' value (0.5-0.8 vs 1.0-1.3).

Rotylenchus n. sp. differs from R. gracilidens by four out of eleven compared characters in tabular key, including B: Labial region shape (rounded labial region vs hemispherical labial region); G: Dorsal pharyngeal gland overlapping (between 6-20.9 μm vs between 21-30.9

μm); J: Presence of males (absent vs present); K: phasmid position (phasmids 3-5 annuli anterior to the anus level vs 15-20 annuli anterior to the anus level). Furthermore,

Rotylenchus n. sp. has a smaller body length (0.6-1 mm vs 0.97-1.23 mm), smaller a value

(27.8-35.1 vs 31-41), smaller b’ value (5.6-7.6 vs 7.1-8.9), and smaller c value (50.3-85.5 vs

42-95).

Huu Tien Nguyen | 2018

Figure 16. The Cluster analysis of 103 species based on Bray-Curtis similarity measure of 11 ranked features. Rotylenchus n. sp. is in bold and red. The red line indicates 85% similarity.

Rotylenchus n. sp. differs from R. rugatocuticulatus by four out of eleven compared characters in tabular key, including E: stylet length (between 30-35.9 µm vs between 36-40.9

Huu Tien Nguyen | 2018

µm); G: dorsal pharyngeal gland overlapping (between 6-20.9 μm vs between 31-40.9 μm); J:

Presence of males (absent vs present); K: phasmid position (phasmids 3-5 annuli anterior to the anus level vs 8-10 annuli anterior to the anus level). Moreover, Rotylenchus n. sp. has different vulva structure (without epiptygma vs double epiptygma), a smaller body length

(0.6-1 mm vs 1-1.3 mm), and smaller c value (50.3-85.5 vs 49-90).

Rotylenchus n. sp. is phylogenetically close to R. buxophilus, R. goodeyi, R. laurentinus,

R. pumilus, and R. incultus. For D2-D3 of 28S rDNA, the sequences of Rotylenchus n. sp. differ from R. buxophilus, R. goodeyi, R. laurentinus, R. pumilus, and R. incultus by 14-21,

25-26, 22-25, 21-23, and 23-24 nucleotides, respectively. For ITS rDNA, the differences of the sequences of Rotylenchus n. sp. were 37-41, 34-37, 36-38, and 31-37 nucleotides compared to R. buxophilus, R. laurentinus, R. pumilus, and R. incultus, respectively. For COI mtDNA, the sequences of Rotylenchus n. sp. have 37-39, 51-65, and 55-58 varied nucleotides compared to R. buxophilus, R. laurentinus, and R. incultus, respectively. Rotylenchus n. sp. can also be differentiated from the phylogenetically closely related species by the morphological features.

Table 7. The specimen ID of the sequences of Rotylenchus n. sp. and the Belgian population of R. buxophilus in this study Species Locality Host Specimen ID Source 28S ITS COI Rotylenchus n. sp. Belgium Musa basjoo G01-14, G01-18, G01-16, This study G01-17, G01-22, G01-17, G01-18, G01-23, G01-18 TNN001 G01-26, G01-27, G01-28 Rotylenchus buxophilus Belgium Dioscorea toroko G04-11, G04-10, G04-10, This study G04-12 G04-13 G04-14

Rotylenchus n. sp. differs from R. buxophilus by five out of eleven compared characters in the tabular key including B: Labial region shape (rounded labial region vs hemispherical

Huu Tien Nguyen | 2018

labial region), D: Body longitudinal striations (longitudinally striated in pharyngeal region vs without body striation), G: Dorsal pharyngeal gland overlapping (between 6-20.9 μm vs between 21-30.9 μm), H: tail shape (rounded to hemispherical vs dorsally convex-conoid), K: phasmid position (phasmids 3-5 annuli anterior to the anus level vs 6-13 annuli anterior to anus level). Rotylenchus n. sp. also has a smaller body length (0.86 mm vs 1.09 mm), and larger c value (63.3 vs 43).

Rotylenchus n. sp. differs from R. goodeyi by four out of eleven compared characters in tabular key of Castillo and Vovlas (2005), including B: Labial region shape (rounded labial region vs hemispherical labial region); D: Body longitudinal striations (longitudinally striated in pharyngeal region vs without body striation); G: Dorsal pharyngeal gland overlapping

(between 6-20.9 μm vs between 31-40.9 μm); J: Presence of males (absent vs present).

Rotylenchus n. sp. can also be differentiated from R. goodeyi by having different number of lip annuli (4-5 annuli vs 3-4 annuli), smaller body length (0.86 mm vs 0.97 mm), different phasmid position (phasmids 3-5 annuli anterior to the anus level vs 1-11 annuli anterior to anus level).

Rotylenchus n. sp. differs from R. laurentinus by four out of eleven compared characters in tabular key of Castillo and Vovlas (2005), including B: Labial region shape (rounded labial region vs hemispherical labial region); D: Body longitudinal striations (longitudinally striated in pharyngeal region vs longitudinally striated over whole body); G: Dorsal pharyngeal gland overlapping (between 6-20.9 μm vs between 21-30.9 μm); J: Presence of males (absent vs present). Rotylenchus n. sp. also differs from R. laurentinus by having a smaller body length

(0.6-1 mm vs 0.92-1.26 mm), bigger a value (27.8-35.1 vs 25.7-33.8), the vulva without a distinct epiptygma vs vulva with posterior epiptygma present overlap less conspicuous anterior one.

Huu Tien Nguyen | 2018

Rotylenchus n. sp. differs from R. pumilus by four out of the eleven main compared characters in tabular key including B: labial region shape (rounded vs hemispherical); D:

Body longitudinal striations (longitudinally striated in pharyngeal region vs without body striation), E: stylet length (31-37 μm vs 23-28 μm); J: Presence of males (absent vs present).

Rotylenchus n. sp. also has a larger body length (0.6-1 mm vs 0.6-0.7 mm), smaller V value

(53-61 vs 58-64), and larger c value (50.3-85.5 vs 32-62).

Rotylenchus n. sp. differs from R. incultus by six out of the eleven main compared characters in the tabular key including B: labial region shape (rounded vs hemispherical); D: Body longitudinal striations (longitudinally striated in pharyngeal region vs without body striation);

E: stylet length (31-37 μm vs 24-28 μm); J: Presence of males (absent vs present); K: phasmid position (located 3-5 annuli anterior to anus level vs 13-14 annuli anterior to anus level). Rotylenchus n. sp. also differs from R. incultus by having a larger body length (0.6-1 mm vs 0.71-0.84 mm), and larger c value (50.3-85.5 vs 47-67).

Furthermore, Rotylenchus n. sp. differs from all compared species by the presence of the rhomboid widening of the mid-ridge of the lateral field at vulva level.

TYPE HOST AND LOCALITY

Rotylenchus n. sp. was recovered from soil and root samples from the rhizosphere of banana (Musa basjoo) in the botanical garden of Gent University, Belgium (GPS coordinates

N: 51o2’6.8”, E: 3o43’22.7”).

TYPE MATERIAL

Holotype female and four paratype females, all in one slide, are deposited at the Ghent

University Museum, Zoology Collections, collection number UGMD 1043xx. 3 paratype females were deposited at National Plant Protection Organization, Wageningen Nematode

Collection (WaNeCo), collection number XXX. Additional paratypes (9 females and 8

Huu Tien Nguyen | 2018

juveniles in 3 slides) are available in the UGent Nematode Collection (slide UGnem-1xx) of the Nematology Research Unit, Department of Biology, Ghent University, Ghent, Belgium.

Rotylenchus buxophilus Golden, 1956

MEASUREMENTS

See table 4.

Table 4. Morphometric data of Rotylenchus buxophilus from Belgium (glycerin-fixed specimens). All measurements are in μm (except for ratio) and in the form: mean ± sd. (range). Character Females n 15 Body length (L) 972 ± 87 (818 - 1065) a= L/MBD 30.1 ± 1.9 (27.2 - 32.5) b’= L/ Anterior end to the end of pharyngeal gland 7.0 ± 0.8 (5.3 - 8.2) c= L/Tail length 40.1 ± 4.1 (34.6 - 49.8) c’= Tail length/ABD 1.2 ± 0.1 (1.0 - 1.4) V=Anterior end to vulva/L 53 ± 3 (48 - 58) Lip height 7 ± 0.3 (6 - 8) Lip width 11 ± 0.6 (10 - 12) Stylet length 36 ± 1.6 (32 - 38) Conus length 18 ± 1.1 (16 - 20) Shaft length 14 ± 0.7 (13 - 14) Knob height 4 ± 0.6 (3 - 5) Dorsal gland opening from stylet base 4 ± 1.2 (3 - 7) Anterior end to secretory-excretory pore 123 ± 10 (105 - 139) Anterior end to nerve ring 99 ± 7 (87 - 109) Anterior end to pharyngeal gland end 140 ± 11 (124 - 157) Pharynx overlapping 22 ± 5 (18 - 28) Max body diameter (MBD) 32 ± 2 (29 - 37) Anal body diameter (ABD) 21 ± 1.6 (19 - 24)

Huu Tien Nguyen | 2018

Tail length 24 ± 3.1 (18 - 28) Tail annuli number 14 ± 1.3 (12 - 16)

MORPHOLOGICAL CHARACTERISATIONS OF ROTYLENCHUS BUXOPHILUS IN BELGIUM

Females

Body relatively larger, habitus mostly spiral. Lateral field with four lines at mid-body, areolated at pharyngeal region. Cuticle clearly annulated. Labial region bearing 5 annuli, hemispherical. Stylet robust; basal knobs rounded. Median bulb rounded to oval; isthmus slender, encircled by nerve ring; pharyngeal glands sacciform, overlapping intestine dorsally

18-28 μm. Secretory-excretory pore at pharyngo-intestinal junction level, Hemizonid distinct ca 1.5-2 body annuli long, just anterior to secretory-excretory pore. Vulva at mid-body level, with double distinct epiptygma; spermatheca inconspicuous, without sperms; ovaries paired, symmetrical, opposed with one row of oocytes. Tail dorsally convex-conoid shape; pore-like phasmids located 9-16 annuli anterior to anus level.

Male

Not found.

Huu Tien Nguyen | 2018

Figure 17. The LM pictures of the Belgian population of Rotylenchus buxophilus females: A: Entire body; B: Pharyngeal region; C: Lateral field at vulva region; D: Vulva region; E: Lateral field with phasmid at tail region; F: Tail region.

Huu Tien Nguyen | 2018

MOLECULAR CHARACTERISATION

LSU rDNA

Two sequences of 5’-end region of 28S rDNA were obtained (844 and 1047 bp in length, respectively). In the Blast results, the similarities of the sequences of the Belgian population of R. buxophilus were from 99% to 100% compared to other sequences of R. buxophilus.

Gblocks retained 655 positions in the final dataset. The D2-D3 of rDNA sequences of the

Belgian population of R. buxophilus differ from other population of R. buxophilus by 1-4 nucleotides and differ from sequences of other Rotylenchus species by 8-51 nucleotides. The phylogenetic tree based on the D2-D3 of 28S rDNA sequences showed that all the sequences of R. buxophilus were grouped together with all other sequences of R. buxophilus and R. pumilus with 0.98 posterior probability (Fig. 13).

ITS rDNA

Two sequences of ITS rDNA sequences were obtained with 1175 and 1249 bp long, respectively. The Blast results showed that the similarities of the sequences of the Belgian population of R. buxophilus were 98-99% compared to other sequences of R. buxophilus. 366 positions in the ITS final dataset were analysed. The ITS sequences of the Belgian population of R. buxophilus differ from other population of R. buxophilus by 3-10 nucleotides and differ from sequences of other Rotylenchus species by 34-75 nucleotides. The position of the sequences of R. buxophilus on the phylogenetic tree based on the ITS sequences showed the same topology with the tree based on D2-D3 region sequences except for the slight change of posterior probabilities (Fig. 14).

COI mtDNA

Two sequences of COI mtDNA sequences were obtained with the length from 444 to 445 bp. 290 positions in the ITS final dataset were analysed. The COI mtDNA sequences of the

Huu Tien Nguyen | 2018

Belgian population of R. buxophilus are identical to the sequence of R. buxophilus on

GenBank and these sequences differ from other Rotylenchus species by 39-84 nucleotides.

The position of the sequences of R. buxophilus on the phylogenetic tree based on the COI mtDNA sequences showed the same topology with the tree based on D2-D3 region and ITS sequences except for the slight change of posterior probabilities (Fig. 15).

REMARKS

The morphological characteristics of the Belgian population of R. buxophilus resemble the original description of R. buxophilus. The few minor differences were observed, including the number of lip annuli (5 annuli vs 4-5 annuli), a slightly lower average V value (53 (48-58) vs 55), a slightly larger stylet (36 (32-38) μm vs 33.5 μm), a smaller a ratio (30.1 (27.2-32.5) vs 31), and a smaller c value (40.1 (34.6-49.8) vs 43). However, these differences are insignificant and the measurements of other population also show some variations (Table 8).

According to Castillo and Vovlas (2005), the matrix code for this population is: A4, B1,

C1, D4, E2, F2, G3, H3, I2, J2, K1. This matrix code is identical to that of the type population of R. buxophilus.

Table 8. The measurements of known and new populations of R. buxophilus

Female R. buxophilus, R. buxophilus R. buxophilus R. buxophilus R. buxophilus R. buxophilus (Belgian Golden, 1956 Sher (1965) = R. sheri Geraert and Wouts and population) Jairajpuri Barooti (1996) Sturhan (1999) (1963) Host, location Yam (Dioscorea English camellia Cedrus libani Magnolia sp. L., Cabbage tree toroko), Belgium boxwood (Buxus (Camellia var. deodara, Iran (Cordyline sp. sempervirens japonica L.), India Comm, ex var. suffruticosa France R.Br.), New L.), USA Zealand n 15 20 20 10 4 6 L 972 (818-1065) 1090 920-1310 900-1200 850-1070 1020-1250 V 53 (48-58) 55 52-58 52-56 54-58 55-58 STL 36 (32-38) 33.5 34-38 35-39 34 38-40 a 30.1 (27.2-32.5) 31 28-38 27-35 25-32 32-43 b 7.0 (5.3-8.2) 7 6.4-8.9 5.5-7.0 6-8 7.3-8.7 c 40.1 (34.6-49.8) 43 36-48 38-47 33-45 41-58 c' 1.2 (1.0-1.4) - - - 1.1-1.4 0.8-1.2 *Note: R. buxophilus Golden, 1956 = type population.

Huu Tien Nguyen | 2018

The BI phylogenetic trees on figures 13, 14, and 15 showed the very close relationship of the sequences from our population compared to the sequences of R. buxophilus and R. pumilus from GenBank. However, our population can be differentiated from R. pumilus by three out of eleven compared characters in tabular key of Castillo and Vovlas (2005), including E: stylet length (32-38 μm vs 23-28 μm); H: tail shape (conoid vs hemispherical); J:

Presence of males (absent vs present); K: phasmid position (located 9-16 annuli anterior to anus level vs located immediately posterior to latitude of anal opening). Furthermore, the females of our population have a larger body length (818-1065 µm vs 600-700 µm), smaller

V value (48-58 vs 58-64), and larger a value (27.2-32.5 vs 20.0-23.7).

HOST AND LOCALITY

The Belgian population of Rotylenchus buxophilus was recovered from soil and root samples from the rhizosphere of Yam (Dioscorea toroko) in the botanical garden of Ghent

University, Belgium (GPS coordinates: N: 51o2’6.9”, E: 3o43’22.6”).

VOUCHER SPECIMENS

All the permanent slides (19 females in 3 slides) are available in the UGent Nematode

Collection (slide UGnem-1xx) of the Nematology Research Unit, Department of Biology,

Ghent University, Ghent, Belgium.

Discussion

The identification keys for Rotylenchus spp. used to be based on dichotomous principle

(Sher, 1965; Geraert & Barooti, 1996). However, according to Geraert and Barooti (1996), the overlapping of various character states makes species differentiation difficult and it will be a big challenge for the great number of nominal species (102 valid species at present).

Based on the principle of polytomous keys, Castillo and Vovlas (2005) developed a tabular or matrix key for the genus Rotylenchus, which is now generally used. By including both major

Huu Tien Nguyen | 2018

and supplementary characters for the identification of Rotylenchus species, the tabular key facilitates the identification process. In this study, the utilization of Hierarchical Cluster analysis of the software Primer 6 with the dataset based on the tabular key principle was successful in separating the 103 species including Rotylenchus n. sp. into small groups that shared the highest similarities. This application can speed up the identification process, avoid mistakes by naked eye comparison (especially for large dataset), and avoid biases in the selection of closely related species to compare with.

The use of tabular keys in this study was straightforward and the morphological data agreed with the molecular data. However, the molecular data is not available for every species on GenBank and there were many examples of cryptic species in plant-parasitic nematode group (including Rotylenchus species) that have no significant morphological differences (Palomares-Rius et al., 2014). For example, in the genus Rotylenchus, Vovlas et al. (2008) proposed to elevate the subspecies Rotylenchus magnus jaeni into a cryptic species level with the new name Rotylenchus jaeni. Cantalapiedra-Navarrete et al. (2013) also described Rotylenchus paravitis as a clear example for cryptic species. Therefore, the combination morphological and molecular approach is warranted to handle the limitations of each approach in identification of Rotylenchus or plant-parasitic nematodes in general.

According to the molecular analyses of this study, the number of changed nucleotides and the genetic distances between Rotylenchus species were smallest for D2-D3 region sequences and largest for COI sequences. These results agreed with the fact that D3-D3 of 28S rDNA has a relatively slow evolution rate compared to the ITS rDNA, and the evolution rate of COI mtDNA is higher than the former two. The analyses based on D2-D3 of 28S rDNA, ITS rDNA, and COI mtDNA gene were successful in differentiating Rotylenchus n. sp. from the other Rotylenchus species as well as in confirming the presence of Rotylenchus buxophilus in

Huu Tien Nguyen | 2018

Belgium. Therefore, these gene regions are potentially useful for the identification of

Rotylenchus species.

As can be seen from figure 1, the new species Rotylenchus n. sp. has relatively large phasmid opening (1.2-2 µm). The only feature to separate Scutellonema spp. from

Rotylenchus spp. is the large phasmid (scutellum). According to Germani et al. (1985),

Rotylenchus species possess the pore-like phasmids and Scutellonema species deal with scutella (external opening ca 3-9 µm). Phillips (1971) described four Scutellonema species with small scutellum in Australia, but later on, Germani et al. (1985) transferred these species to the genus Rotylenchus after the consideration of all morphological and morphometric characteristics. Although there is no available molecular information for these species, the molecular analysis strongly supports for Rotylenchus n. sp. to be a Rotylenchus species as the sequences of Rotylenchus n. sp. always show the far higher similarities with Rotylenchus spp. compared to Scutellonema spp. in the Blast results. Furthermore, they were grouped with all other Rotylenchus species with maximal support in all tree topologies.

Although Rotylenchus n. sp. and R. buxophilus were found on banana (Musa basjoo) and

Yam (Dioscorea toroko) that were imported from Asian countries (Japan and China), these plants were planted outside under the Belgian weather conditions more than a decade ago.

Interestingly, R. buxophilus has been reported in many countries on many different hosts such as from English boxwood (Buxus sempervirens var. suffruticosa L.), lima beans (P. lunatus), rye (S. cereale), strawberry (Fragaria x ananassa), tomato and yew (T. canadensis) in USA; Cupressus sempervirens L. and pea in Spain; Hydrangea hortensia in

Italy; camellia (Camellia japonica L.) in France; unknown grass soils in Austria and Poland; vineyards in Switzerland; bilberries (Vaccinium myrtillus L.) in Slovakia; grassland in

Romania; bilberry plants in Russia; sugarcane in Taiwan; elder, lilac and Taraxacum F. H.

Wigg. in Hungary; beech forest humus in Bulgaria; in Pakistan; olive in Turkey; Magnolia

Huu Tien Nguyen | 2018

sp. L. in Iran; cabbage tree (Cordyline sp. Comm, ex R.Br.), Erica arborea L., fig (Ficus car- ica L.), and soil from a flower garden in New Zealand. However, they have never been reported on Yam (Dioscorea toroko) as well as in China or Japan (Castillo & Vovlas, 2005).

The distribution of R. buxophilus showed that this species is more prevalent in European countries than Asian country (only in Taiwan).

Acknowledgment

This work was supported by the special research fund UGent 01N02312.

References

Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic acids research 25, 3389-3402. Atighi, M. R., Cantalapiedra-Navarrete, C., Pedram, M., Castillo, P., Palomares-Rius, J. E. & Pourjam, E. 2011. Molecular and morphological characterisations of two new species of Rotylenchus (Nematoda: Hoplolaimidae) from Iran. Nematology 13, 951-964. DOI:10.1163/138855411x571795 Barry, G. H. 2011. Phylogenetic Trees Made Easy: A How-To Manual, Sunderland, MA., Sinauer Associates, 282 pp. Cantalapiedra-Navarrete, C., Liébanas, G., Archidona-Yuste, A., Palomares-Rius, J. E. & Castillo, P. 2012. Molecular and morphological characterisation of Rotylenchus vitis n. sp. (Nematoda: Hoplolaimidae) infecting grapevine in southern Spain. Nematology 14, 235-247. DOI:10.1163/138855411x588175 Cantalapiedra-Navarrete, C., Navas-Cortés, J. A., Liébanas, G., Vovlas, N., Subbotin, S. A., Palomares-Rius, J. E. & Castillo, P. 2013. Comparative molecular and morphological characterisations in the nematode genus Rotylenchus: Rotylenchus paravitis n. sp., an example of cryptic speciation. Zoologischer Anzeiger-A Journal of Comparative Zoology 252, 246-268. DOI:10.1016/j.jcz.2012.08.002 Castillo, P. & Vovlas, N. 2005. Bionomics and identification of the genus Rotylenchus (Nematoda: Hoplolaimidae), Brill Academic Publishers, 378 pp. Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17, 540-552. DOI:10.1093/oxfordjournals.molbev.a026334 De Man, J. G. 1876. Onderzoekingen over vrij in de aarde levende Nematoden. Tijdschr. Ned. Dierk. Ver. 2, 78-196. Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Dufayard, J. F., Guindon, S., Lefort, V., Lescot, M., Claverie, J. M. & Gascuel, O. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36, 465-469. DOI:10.1093/nar/gkn180

Huu Tien Nguyen | 2018

Derycke, S., Vanaverbeke, J., Rigaux, A., Backeljau, T. & Moens, T. 2010. Exploring the use of cytochrome oxidase c subunit 1 (COI) for DNA barcoding of free-living marine nematodes. PLoS One 5, e13716. DOI:10.1371/journal.pone.0013716 Filipjev, I. N. 1934. The classification of the free-living nematodes and their relation to the parasitic nematodes. Smithson. misc. Coll. 89. (6), 1-63. Geraert, E. & Barooti, S. 1996. Four Rotylenchus from Iran, with a key to the species. Nematologica 42, 503-520. DOI:10.1163/004625996x00018 Germani, G., Baldwin, J. G., Bell, A. H. & Wu, X. Y. 1985. Revision of the genus Scutellonema Andrassy, 1958 (Nematoda: Tylenchida). Revue de nématologie 8, 289-320. Golden, A. M. 1956. Taxonomy of the spiral nematodes (Rotylenchus and Helicotylenchus), and the developmental stages and host-parasite relationships of R. buxophilus n. sp., attacking boxwood, Bulletin of the Maryland Agricultural Experiment Station, 28 pp. Golhasan, B., Heydari, R., Álvarez-Ortega, S., Meckes, O., Pedram, M. & Atighi, M. R. 2016. Rotylenchus sardashtensis n. sp., a monosexual species from Iran, with molecular identification and detailed morphological observations on an Iranian population of Rotylenchus cypriensis Antoniou, 1980 (Nematoda: Rhabditida: Hoplolaimidae). Systematic parasitology 93, 395-411. DOI:10.1007/s11230-015-9619-3 Huelsenbeck, J. P. & Ronquist, F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754-755. DOI:10.1093/bioinformatics/17.8.754 Jairajpuri, M. S. 1963. Rotylenchus sheri n. sp. (Nematoda: Tylenchida) from North India. Nematologica 9, 378-380. DOI:10.1163/187529263X00917 Loof, P. a. A. & Oostenbrink, M. 1958. Die Identität Von Tylenchus robustus De Man. Nematologica 3, 34 – 43. Massèse, C. S. L. & Germani, G. 2000. Description de quatre nouvelles espèces et de quatre populations de Rotylenchus (Nematoda: Hoplolaimidae). Proposition d’une clé tabulaire. Nematology 2, 699-718. DOI:10.1163/156854100509565 Nadler, S. A., De Ley, P., Mundo-Ocampo, M., Smythe, A. B., Patricia Stock, S., Bumbarger, D., Adams, B. J., De Ley, I. T., Holovachov, O. & Baldwin, J. G. 2006. Phylogeny of Cephalobina (Nematoda): molecular evidence for recurrent evolution of probolae and incongruence with traditional classifications. Molecular phylogenetics and evolution 40, 696-711. DOI:10.1016/j.ympev.2006.04.005 Phillips, S. P. 1971. Studies of plant and soil nematodes. 16. Eight new species of spiral nematodes (nematoda: Tylenchoidea) from Queensland. Qd. J. Agric. Anim. Sci 28, 227–242. Sauer, M. R. 1958. Hoplolaimus gracilidens, Radopholus inaequalis, and Radopholus neosimilis, three new tylenchs to Victoria, Australia. Nemato-logica 3, 97-107. Scognamiglio, A. & Talamé, M. 1972. Rotylenchus laurentinus n. sp. (Nematoda: Hoplolaimidae). Bolletino del Laboratorio di Entomologia Agraria ‘Filippo Silvestri 30, 1-7. Sher, S. A. 1961. Revision of the Hoplolaiminae (Nematoda). 1. Classification of nominal genera and nominal species. Nematologica 6, 155-159. DOI:10.1163/187529261X00414 Sher, S. A. 1965. Revision of the Hoplolaiminae (Nematoda) V. Rotylenchus Filipjev, 1936. Nematologica 11, 173-198. DOI:10.1163/187529265X00041 Singh, P. R., Nyiragatare, A., Janssen, T., Couvreur, M., Decraemer, W. & Bert, W. 2018. Morphological and molecular characterisation of Pratylenchus rwandae n. sp.

Huu Tien Nguyen | 2018

(Tylenchida: Pratylenchidae) associated with maize in Rwanda. Nematology, 1-14. DOI:10.1163/15685411-00003175 Steel, H., Coomans, A., Decraemer, W., Moens, T. & Bert, W. 2014. Nematodes from terrestrial, freshwater and brackish water habitats in Belgium: an updated list with special emphasis on compost nematodes. Zootaxa 3765, 143-60. DOI:10.11646/zootaxa.3765.2.3 Steel, H., Moens, T., Scholaert, A., Boshoff, M., Houthoofd, W. & Bert, W. 2011. Mononchoides composticola n. sp. (Nematoda: Diplogastridae) associated with composting processes: morphological, molecular and autecological characterisation. Nematology 13, 347-363. DOI:10.1163/138855410x523023 Talezari, A., Pourjam, E., Kheiri, A., Liebanas, G., Aliramaji, F., Pedram, M., Rezaee, S. & Atighi, M. R. 2015. Rotylenchus castilloi n. sp. (Nematoda: Hoplolaimidae), a new species with long stylet from northern Iran. Zootaxa 3931, 88-100. DOI:10.11646/zootaxa.3931.1.6 Thorne, G. 1949. On the classification of the Tylenchida, new order (Nematoda, Phasmidia). Proceedings of the Helminthological Society of Washington Vol.16, 37-73. Vovlas, N., Subbotin, S. A., Troccoli, A., Liébanas, G. & Castillo, P. 2008. Molecular phylogeny of the genus Rotylenchus (Nematoda, Tylenchida) and description of a new species. Zoologica Scripta 37, 521-537. DOI:10.1111/j.1463-6409.2008.00337.x Vrain, T. C., Wakarchuk, D. A., Levesque, A. C. & Hamilton, R. I. 1992. Intraspecific rDNA restriction fragment length polymorphism in the Xiphinema americanum group. Fundamental and Applied Nematology 15, 563-573. Whitehead, A. G. & Hemming, J. R. 1965. A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Annales of Applied Biology 55, 25– 38. DOI:10.1111/j.1744-7348.1965.tb07864.x Wouts, W. M. & Sturhan, D. 1999. Descriptions of Rotylenchus species from New Zealand, including R. labiodiscus sp. n. (Nematoda: Hoplolaimidae). New Zealand Journal of Zoology 26, 395-404. DOI:10.1080/03014223.1999.9518202