European Journal of Phycology
For Peer Review Only
The genera Melanothamnus Bornet & Falkenberg and Vertebrata S.F. Gray constitute well-defined clades of the red algal tribe Polysiphonieae (Rhodomelaceae, Ceramiales)
Journal: European Journal of Phycology
Manuscript ID TEJP-2016-0091.R1
Manuscript Type: Original Article
Date Submitted by the Author: n/a
Complete List of Authors: Díaz-Tapia, Pilar; University of A Coruña, Departamento de Bioloxía Animal, Vexetal e Ecoloxía; University of Melbourne, School of BioSciences; Bournemouth University, Faculty of Science and Technology McIvor, Lynne; Queen’s University Belfast, School of Biological Sciences Freshwater, David; University of North Carolina at Wilmington, Center for Marine Science Verbruggen, Heroen; University of Melbourne, School of BioSciences Wynne, Michael; University of Michigan Ann Arbor, Department of Ecology and Evolutionary Biology and Herbarium Maggs, Christine; Queen´s University Belfast, School of Biological Sciences; Bournemouth University, Faculty of Science and Technology
Biogeography, Evolution, Molecular systematics, morphology, phylogeny, Keywords: Polysiphonia, Red algae, Time calibration
URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 1 of 109 European Journal of Phycology
1 2 3 4 5 1 6 7 1 The genera Melanothamnus Bornet & Falkenberg and Vertebrata S.F. Gray constitute well- 8 9 2 defined clades of the red algal tribe Polysiphonieae (Rhodomelaceae, Ceramiales) 10 11 3 12 4 PILAR DÍAZ TAPIA 1,2,3 , LYNNE MCIVOR 4, D. WILSON FRESHWATER 5, HEROEN 13 14 3 6 2,4 5 VERBRUGGEN , MICHAELFor J. WYNNE Peer AND CHRISTINE Review A. MAGGS Only 15 16 6 17 18 7 1BioCost Research Group, Universidad de A Coruña, 15071, A Coruña, Spain 19 20 8 2Faculty of Science and Technology, Bournemouth University, Talbot Campus, Poole, Dorset 21 22 9 BH12 5BB, UK 23 3 24 10 School of BioSciences, University of Melbourne, Victoria 3010, Australia
25 4 26 11 School of Biological Sciences, Queen’s University Belfast, Medical Biology Centre, BT9 7BL, 27 12 Northern Ireland 28 29 13 5Center for Marine Science, University of North Carolina at Wilmington, 5600 Marvin Moss Lane, 30 31 14 Wilmington, NC 28409, USA 32 33 15 6Department of Ecology and Evolutionary Biology and Herbarium, University of Michigan Ann 34 35 16 Arbor, MI 48109, USA 36 37 17 38 39 18 Running title: The genera Melanothamnus and Vertebrata (Rhodophyta) 40 19 41 42 20 43 44 21 *Correspondence to: Pilar Díaz Tapia (e mail: [email protected]) 45 46 22 47 23 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 2 of 109
1 2 3 4 5 2 6 7 24 ABSTRACT 8 9 25 10 11 26 Polysiphonia is the largest genus of red algae, and several schemes subdividing it into smaller taxa 12 27 have been proposed since its original description. Most of these proposals were not generally 13 14 28 accepted, and currentlyFor the tribe Polysiphonieae Peer consists Review of the large genus Polysiphonia Only (190 15 16 29 species), the segregate genus Neosiphonia (43 species), and 13 smaller genera (< 10 species each). 17 18 30 In this paper, phylogenetic relationships of the tribe Polysiphonieae are analysed, with particular 19 20 31 emphasis on the genera Carradoriella , Fernandosiphonia , Melanothamnus , Neosiphonia , 21 22 32 Polysiphonia sensu stricto, Streblocladia and Vertebrata . We evaluated the consistency of 14 23 24 33 selected morphological characters in the identified clades. Based on molecular phylogenetic (rbc L 25 26 34 and 18S genes) and morphological evidence, two speciose genera are recognized: Vertebrata 27 35 (including the type species of the genera Ctenosiphonia , Enelittosiphonia , Boergeseniella and 28 29 36 Brongniartella ) and Melanothamnus (including the type species of the genera Fernandosiphonia 30 31 37 and Neosiphonia ). Both genera are distinguished from other members of the Polysiphonieae by 32 33 38 synapomorphic characters, the emergence of which could have provided evolutionarily selective 34 35 39 advantages for these two lineages. In Vertebrata trichoblast cells are multinucleate, possibly 36 37 40 associated with the development of extraordinarily long, photoprotective, trichoblasts. 38 39 41 Melanothamnus has 3 celled carpogonial branches and plastids lying exclusively on radial walls of 40 42 the pericentral cells, which similarly may improve resistance to damage caused by excessive light. 41 42 43 Other relevant characters that are constant in each genus are also shared with other clades. The 43 44 44 evolutionary origin of the genera Melanothamnus and Vertebrata is estimated as 75.7 95.78 and 45 46 45 90.7 138.66 Ma, respectively. Despite arising in the Cretaceous, before the closure of the Tethys 47 48 46 Seaway, Melanothamnus is a predominantly Indo Pacific genus and its near absence from the 49 50 47 northeastern Atlantic is enigmatic. The nomenclatural implications of this work are that 46 species 51 52 48 are here transferred to Melanothamnus , six species are transferred to Vertebrata and 13 names are 53 54 49 resurrected for Vertebrata . 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 3 of 109 European Journal of Phycology
1 2 3 4 5 3 6 7 50 8 9 51 10 11 52 Key words: biogeography, evolution, molecular systematics, morphology, phylogeny, 12 53 Polysiphonia , red algae, time calibration 13 14 54 For Peer Review Only 15 16 55 17 18 56 19 20 57 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 4 of 109
1 2 3 4 5 4 6 7 58 INTRODUCTION 8 9 59 The Rhodomelaceae Areschoug is the largest family of red algae, currently including more than 10 11 60 1,000 species (Guiry & Guiry, 2016). It consists of the tribes Amansieae Schmitz (1889) , 12 61 Bostrychieae Falkenberg (1901) , Chondrieae Schmitz & Falkenberg (1897) , Herposiphonieae 13 14 62 Schmitz & FalkenbergFor (1897) , Heterocladieae Peer Falkenberg Review (1901) , Laurencieae Schmitz Only (1889) , 15 16 63 Lophothalieae Schmitz & Falkenberg (1897) , Neotenophyceae Kraft & I.A.Abbott (2002) , 17 18 64 Pleurostichidieae (Hommersand, 1963) , Polysiphonieae Schmitz (1889) , Polyzonieae Schmitz & 19 20 65 Falkenberg (1897) , Pterosiphonieae Falkenberg (1901) , Rhodomeleae Schmitz & Falkenberg 21 22 66 (1897) , Sonderelleae L.E.Phillips (2001) and Streblocladieae nom. nud. (Hommersand, 1963; 23 24 67 Kraft & Abbott, 2002; Womersley, 2003), of which the most speciose is the Polysiphonieae with 25 26 68 over 300 species in 15 currently recognized genera (Guiry & Guiry, 2016). 27 69 Within the Polysiphonieae the genus Polysiphonia Greville (1824), nom. cons., has 28 29 70 representatives throughout the world, in the majority of photic marine benthic habitats including 30 31 71 brackish ones (e.g. Womersley, 1979; Hollenberg, 1942, 1944, 1968 a, 1968 b; Maggs & 32 33 72 Hommersand, 1993; Lam et al., 2013). Polysiphonia is poorly circumscribed, and has remained in 34 35 73 a state of taxonomic flux since its original description. Numerous schemes for subdividing this 36 37 74 large and morphologically diverse genus into smaller and more manageable groups have been 38 39 75 proposed (e.g. Segi, 1951; Hollenberg, 1968 a, 1968 b), based mostly on the number of periaxial 40 76 cells, either four (subgenus Oligosiphonia ) or more than four (subgenus Polysiphonia ). These 41 42 77 schemes have generally been rejected and several generic names [e.g. Orcasia Kylin (1941), based 43 44 78 on Polysiphonia senticulosa Harvey] are currently regarded as synonyms of Polysiphonia. 45 46 79 However, despite having been subsumed within Polysiphonia in most classification schemes, 47 48 80 Vertebrata S.F.Gray (1821) is currently recognized as a monospecific genus containing only the 49 50 81 type species, V. lanosa (Linnaeus) T.A.Christensen . 51 52 82 The segregate genus Neosiphonia M. S.Kim & I.K.Lee (Kim & Lee, 1999) has been widely 53 54 83 accepted and is now the second largest in the Polysiphonieae (Guiry & Guiry, 2016). Neosiphonia 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 5 of 109 European Journal of Phycology
1 2 3 4 5 5 6 7 84 (type species: N. flavimarina M. S.Kim & I.K.Lee from Korea) is characterized by the following 8 9 85 features: (1) thalli erect with a main axis bearing branches; (2) branches or trichoblasts formed on 10 11 86 every segment; (3) rhizoids cut off from pericentral cells; (4) carpogonial branches 3 celled; (5) 12 87 spermatangial branches formed on a branch of modified trichoblasts; (6) tetrasporangia in a spiral 13 14 88 arrangement (Kim & Lee,For 1999). These Peer features contrast Review markedly with the key characters Only of 15 16 89 Polysiphonia sensu stricto , exemplified by the type species P. stricta (Dillwyn) Greville : prostrate 17 18 90 axes with rhizoids in open connection with pericentral cells; carpogonial branches 4 celled; 19 20 91 spermatangial branches borne directly on axes; tetrasporangia in straight rows (Kim et al ., 2000). 21 22 92 In addition to describing the new species N. flavimarina , Kim & Lee (1999) also transferred eleven 23 24 93 species of Polysiphonia to Neosiphonia , all based on material from Korea, and there are 43 25 26 94 currently recognized species (Guiry & Guiry, 2016), not all of which exhibit the six key characters 27 95 of Neosiphonia listed above. 28 29 96 Kim & Lee (1999) considered Neosiphonia (also referred to as the " Polysiphonia japonica 30 31 97 complex" sensu Yoon (1986)) to be related to Fernandosiphonia Levring , which was erected for 32 33 98 F. unilateralis Levring from the Juan Fernández Islands off Chile on the basis of its unilateral 34 35 99 development of ultimate branches (Levring, 1941) and which currently consists of three species. 36 37 100 They reported that Neosiphonia differed from Fernandosiphonia principally in its branching 38 39 101 pattern, the origin of spermatangial branches, and the 3 celled carpogonial branches. Kim & Lee 40 102 (1999) did not comment, however, on the possible relationship between Fernandosiphonia and 41 42 103 Streblocladia F. Schmitz (in Schmitz & Falkenberg, 1897). Hommersand (1963) and Norris (1994) 43 44 104 compared Fernandosiphonia (trichoblasts formed spirally) with Streblocladia (trichoblasts borne 45 46 105 only adaxially). Choi et al. (2001) drew attention to the relationship in their 18S tree between N. 47 48 106 japonica (Harvey) M. S.Kim & I.K.Lee and Polysiphonia virgata (C.Agardh) Sprengel , the type 49 50 107 species of Carradoriella P.C.Silva (Kylin, 1956, as Carradoria ; Silva et al ., 1996), and suggested 51 52 108 that Neosiphonia might either be subsumed into Carradoriella or be resolved as a sister to it. 53 54 109 Recent searches of DNA sequence databases unexpectedly showed a possible relationship between 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 6 of 109
1 2 3 4 5 6 6 7 110 Neosiphonia species and Melanothamnus somalensis Bornet & Falkenberg , the type species of the 8 9 111 genus Melanothamnus Bornet & Falkenberg (in Falkenberg, 1901) , which was regarded as 10 11 112 incertae sedis by Bornet & Falkenberg in (Falkenberg , (1901). 12 113 Given the taxonomic and nomenclatural complexity within the Polysiphonieae, our aims 13 14 114 were to re evaluate theFor morphological Peer features of Neosiphonia Review and Vertebrata in relation Only to those 15 16 115 of Fernandosiphonia , Streblocladia , Carradoriella , Melanothamnus and Polysiphonia sensu 17 18 116 stricto within a phylogenetic analysis of the Polysiphonieae using sequences of the plastid encoded 19 20 117 rbc L gene and the ribosomal DNA 18S gene (SSU). We surveyed within the Polysiphonieae the 21 22 118 distribution of a striking characteristic of the " Polysiphonia japonica complex", the position of 23 24 119 plastids on radial walls of the periaxial cells and their absence from the outer walls such that nuclei 25 26 120 are clearly visible after staining (Maggs & Hommersand, 1993; McIvor et al ., 2001). Likewise, we 27 121 analysed the multinucleate vs. uninucleate character of trichoblast cells, which seems to be 28 29 122 taxonomically significant (Maggs & Hommersand, 1993). 30 31 123 32 33 124 34 35 125 MATERIALS AND METHODS 36 37 126 38 39 127 Field collections, morphological studies and literature review 40 128 41 42 129 Samples of Polysiphonieae (Table S1) were collected from European Atlantic coasts, New 43 44 130 Zealand, Australia, Taiwan, Japan, Chile, USA, South Africa and Oman and processed fresh, 45 46 131 desiccated in silica gel or preserved in ethanol. 47 48 132 Type material of Fernandosiphonia unilateralis Levring was obtained from the Herbarium, 49 50 133 Botanical Museum, Göteborg, Sweden (GB) by correspondence with the curator. It consisted in of 51 52 134 four permanent slides, a herbarium sheet and formalinliquid preserved material. Furthermore, we 53 54 135 studied recent collections from Juan Fernández Islands, the type locality. We also studied the type 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 7 of 109 European Journal of Phycology
1 2 3 4 5 7 6 7 136 material in US and TCD of several species currently assigned to Neosiphonia (Table S2; 8 9 137 herbarium abbreviations as in Thiers, 2016) for which the key morphological characteristics (Table 10 11 138 1) could not be clearly ascertained from published literature, in order to determine their correct 12 139 generic assignment. For this purpose, we exclusively considered the descriptions provided for 13 14 140 material from type localitiesFor or near them.Peer To ensure theReview accuracy of our interpretation Only of the 15 16 141 genera, our concept of them is based on material of their type species obtained from their type 17 18 142 localities. For Streblocladia, we used material of, and sequences from, the type species S. 19 20 143 glomerulata (Montagne) Papenfuss from New Zealand. Carradoriella (i.e. Polysiphonia virgata ) 21 22 144 was obtained from the type locality in South Africa, and the type species of Vertebrata and 23 24 145 Melanothamnus came from Ireland and Oman respectively. 25 26 146 Fresh material and herbarium samples were prepared as squashes, either unstained or stained 27 147 with aqueous aniline blue, post fixed in 1% HCl, and mounted in 80% Karo corn syrup (Bestfoods 28 29 148 Inc, NJ, USA). Permanent slide mounts were prepared as vouchers and deposited in: BM, MICH, 30 31 149 SANT, WNC and MEL. 32 33 150 A systematic review was carried out to identify relevant phycological literature from 34 35 151 around the world from which to assess for each species of Polysiphonieae the 14 vegetative and 36 37 152 reproductive features relevant to Neosiphonia and Vertebrata . 38 39 153 Nomenclatural authorities for the species mentioned in the manuscript are provided in 40 154 Tables 2 5 and S1 S2. 41 42 155 43 44 156 DNA extraction, PCR amplification and sequencing 45 46 157 47 48 158 This was carried out in four different laboratories using different protocols as described below. 49 50 159 At Queen's University Belfast, DNA was extracted from fresh, silica gel dried or ethanol 51 52 160 preserved material using the Qiagen DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany), 53 54 161 according to the manufacturer's instructions, or by a CTAB method, modified after Doyle & Doyle 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 8 of 109
1 2 3 4 5 8 6 7 162 (1987). For PCR amplification, a PTC 200 DNA Engine (MJ Research Inc.) was used. Except for 8 9 163 material of Fernandosiphonia unilateralis , all PCR amplifications were carried out using rbcLFC 10 11 164 as the forward primer, and rbcLRD as the reverse primer (Nam et al ., 2000; McIvor et al ., 2001). 12 165 All reactions contained 200 µM each of dATP, dCTP, dGTP and dTTP, 0.3 µM of each primer, 13 14 TM 166 2.5 mM MgCl , and 1.6For units of Biotaq Peer DNA Taq polymerase Review (Bioline, UK ). The PCROnly 15 2 16 167 amplification followed Nam et al. (2000) and McIvor et al. (2001) . About 1250 base pairs (bp) of 17 18 168 the rbc L gene were amplified using rbcLFC and rbcLRDand t. T he PCR fragments for sequencing 19 20 169 were purified using the High Pure PCR Product Purification Kit (Roche Diagnostics Ltd., Lewes, 21 22 170 UK), according to the manufacturer's instructions. The PCR products were directly sequenced 23 24 171 commercially by MWG Biotech, Ebersberg, Germany. 25 26 172 Type material of Fernandosiphonia unilateralis had been preserved in Fformalin by 27 173 Levring (1941) prior to long term storage in ethanol (A. Athanasiados, personal communication). 28 29 174 At the Leiden herbarium, various protocols for retrieving DNA from formalin preserved 30 31 175 specimens were attempted (Kirby & Reid, 2001); the most successful was to soak and wash the 32 33 176 material repeatedly in clean sterile water, prior to DNA extraction using using a Chelex 100 34 35 177 (Biorad, Hercules, California) protocol (Goff & Moon, 1993; Zuccarello et al ., 1999). Applying a 36 37 178 strategy for amplifying degraded "ancient" DNA (Provan et al. , 2008), primers were designed 38 39 179 from an alignment of Neosiphonia harveyi (Bailey) M. S.Kim, H. G.Choi, Guiry & G.W.Saunders 40 180 and related species in order to amplify 100 bp fragments. We used the primers F183 (5’ 41 42 181 TGCAGGTGAATCTTCTACAGCT 3’) and R383 (5’ ACGTTACCAATAATTGAAGCTGTT 43 44 182 3’). 45 46 183 At the University of Melbourne, DNA was extracted from silica gel dried material 47 48 184 following Saunders & McDevit (2012). PCR amplification was carried out for rbc L using the 49 50 185 primers F7/RrbcStart or F57/rbcLrevNEW (Freshwater & Rueness, 1994; Saunders & Moore, 51 52 186 2013) and for 18S using the primers F47 (5’ AGCCATGCAAGTGCCTGTAT 3’) and R1867 53 54 187 (5’CGCAGGTTCACCTACGGAAA 3’). Reactions were performed in a total volume of 25 µl, 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 9 of 109 European Journal of Phycology
1 2 3 4 5 9 6 7 188 consisting of 5 µl 5× MyTaq TM reaction buffer, 0.7 µl 10 µM of forward and reverse primers, 8 1 TM 9 189 0.125 µl 1U /µl My Taq DNA Polymerase (Bioline), 17.475 µl MilliQ® water and 1 µl Formatted: Superscript 10 11 190 template DNA. The PCR profile consisted of initial denaturation (93ºC for 3 min); 35 cycles of 12 191 denaturation (94ºC for 30 s), primer annealing (45ºC for 30 s), and extension (74ºC for 90 s) ; and 13 14 192 final extension (74ºC forFor 5 min). The Peer PCR products were Review purified and sequenced commercially Only by 15 16 193 Macrogen. 17 18 194 At A Coruña, Melanothamnus from Oman was extracted using the CTAB protocol (Doyle 19 20 195 & Doyle, 1987) and rbc L was amplified using the primers F7 R753 and F57 rbcLrevNEW 21 22 196 (Freshwater & Rueness, 1994; Saunders & Moore, 2013). The PCR products were purified and 23 24 197 sequenced commercially by the sequencing service of the University of A Coruña. 25 26 198 DNA extraction, amplification and sequencing at UNCW were as described by Stuercke & 27 199 Freshwater (2008). 28 29 200 30 31 201 Sequence alignment and phylogenetic analysis 32 33 202 34 35 203 A total of 65 rbc L and 48 18S sequences were downloaded from GenBank and 25 new rbc L and 36 37 204 ten new 18S sequences were generated in this study. The sequences and their corresponding 38 39 205 GenBank accession numbers are listed in Table S1. 40 206 Sequences were aligned using Muscle in Geneious 6.1.8 (Kearse et al., 2012). Identical 41 42 207 sequences and those that diverged by less than 1.1% were removed from the rbc L analysis, except 43 44 208 for Neosiphonia flavimarina and N. harveyi (0.4% divergence), the two selected representatives of 45 46 209 the “ N. japonica complex” (Kim & Lee, 1999), which also includes N. decumbens , N. harlandii 47 48 210 and P. akkeshiensis Segi (McIvor et al. , 2001; Kim & Yang, 2006; Savoie & Saunders, 2015; 49 50 211 Bárbara et al. , 2013). Identical sequences were also removed from the 18S analysis. The sequences 51 52 212 included in the final alignment were selected after considering their quality in terms of both length 53 54 213 and the presence of ambiguous bases. Phylogenetic trees for rbc L and 18S were estimated with 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 10 of 109
1 2 3 4 5 10 6 7 214 Maximum Likelihood (ML) using RAxML 8.1.6 (Stamatakis, 2014). GTR Gamma was selected as 8 9 215 the best nucleotide model; branch support was estimated with 100 bootstrap replicates. Three 10 11 216 species of Symphyocladia Falkenberg (in Schmitz & Falkenberg, 1897) were selected as the 12 217 outgroup in the rbc L phylogeny and one species each of Symphyocladia , Xiphosiphonia Savoie & 13 14 218 Saunders (2016) PterosiphoniaFor Falkenberg Peer (in Schmitz &Review Falkenberg, 1897) and Herposiphonia Only 15 16 219 Nägeli (1846) were selected as outgroups for the 18S analysis. This outgroup selection was based 17 18 220 on our phylogenomic analyses of the major lineages of the Rhodomelaceae which resolve a clade 19 20 221 formed by the Herposiphonieae and Pterosiphonieae as sister to the Polysiphonieae (Díaz Tapia et 21 22 222 al ., 2015). 23 24 223 We used MrBayes v.3.2.2 for Bayesian phylogenetic inference (Ronquist et al. , 2011). The 25 26 224 rbc L alignment was analysed using a single (unpartitioned) GTR+Γ+I as well as completely 27 225 unlinked GTR+Γ+I for each codon position. We used a single GTR+Γ+I model for 18S. All 28 29 226 analyses were run for 5 M million s of generations, sampling every 1,000th generation and using 30 31 227 two independent runs each consisting of four incrementally heated Metropolis coupled (MCMC) 32 33 228 chains. Convergence and stationarity of runs were evaluated with Tracer v.1.6.0 (Rambaut et al. , 34 35 229 2013), resulting in the use of a burnin of 500k generations for all analyses. Post burnin trees were 36 37 230 summarized with the sum pt command in MrBayes, using the all compatible groups consensus 38 39 231 type. 40 232 Trees were calibrated in geological time using relaxed molecular clock analyses. The 41 42 233 calibration was derived from node ages inferred by Yang et al. (2016), which estimated the earliest 43 44 234 split in Ceramiales (between Spyridia Harvey (1833) and the remaining Ceramiales) to be 292 Ma 45 46 235 old (stdev ≈ 24.6 Ma). After adding the rbc L sequences of Ceramiales from the Yang et al. (2016) 47 48 236 study to our alignment and setting Spyridia as the outgroup, node ages were inferred with two 49 50 237 Bayesian methods. The first analysis used an autocorrelated model of molecular evolutionary rate 51 52 238 change (Thorne & Kishino, 2002) as implemented in PhyloBayes v.3.3f (Lartillot et al. , 2009). 53 54 239 The MCMC chain was run for 50k cycles, stationarity was assessed with Tracer, and the node ages 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 11 of 109 European Journal of Phycology
1 2 3 4 5 11 6 7 240 summarized with the readdiv command, discarding the first 25k cycles as burnin. The second 8 9 241 analysis used uncorrelated rates of evolution sampled from a lognormal distribution (Drummond et 10 11 242 al ., 2006) as implemented in BEAST v.1.8.2. The MCMC chain was run for 10 M million 12 243 generations, used a Yule tree prior, and an unpartitioned GTR+Γ+I model of sequence evolution. 13 14 244 Stationarity was assessedFor with Tracer. Peer A maximum clade Review credibility tree and median nodeOnly heights 15 16 245 were inferred with TreeAnnotator, discarding the first 1M 1 million generations as burnin and 17 18 246 using a posterior probability limit of zero. 19 20 247 21 22 248 23 24 249 RESULTS 25 26 250 27 251 DNA sequences and alignments 28 29 252 DNA extraction and PCR amplification of type material of Fernandosiphonia unilateralis that had 30 31 253 been initially formalinFormalin /seawater fixed and then stored in ethanol for several decades 32 33 254 yielded a 95 bp partial rbc L sequence with seven ambiguous nucleotides. The sequence was 34 35 255 unique by comparison with other taxa sequenced either at QUB or in Leiden, confirming that there 36 37 256 had been no contamination. 38 39 257 25 new rbc L sequences and ten 18S sequences were obtained from members of the 40 258 Polysiphoniae (Table S1), including an rbc L sequence from Melanothamus somalensis , and four 41 42 259 rbc L and two 18S sequences from new collections of F. unilateralis from the type locality. 43 44 260 Alignments for the rbc L were unambiguous, with no insertions or deletions. 45 46 261 47 48 262 Phylogenetic analyses 49 50 263 The ML rbc L tree (Fig. 1) has three strongly supported major clades within the Polysiphonieae: 51 52 264 Polysiphonia sensu stricto 1 (including P. stricta , the type of the genus), Polysiphonia sensu 53 54 265 stricto 2 (with morphological features corresponding to those defining Polysiphonia sensu stricto : 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 12 of 109
1 2 3 4 5 12 6 7 266 Kim et al ., 2000) and a third clade grouping all the other taxa. The third clade comprised a large 8 9 267 number of lineages, many with low or intermediate support. The two most speciose lineages, here 10 11 268 named Vertebrata and Melanothamnus , however, are both robustly supported (Fig. 1). The 12 269 Vertebrata clade includes V. lanosa , the current name for the type species of Vertebrata , V. 13 14 270 fastigiata S.F.Gray (1821),For as well asPeer the type species ofReview several other genera: Brongniartella Only Bory 15 16 271 (1822), Boergeseniella Kylin (1956), Enelittosiphonia Segi (1949) and Ctenosiphonia Falkenberg 17 18 272 (in Schmitz & Falkenberg, 1897). The Melanothamnus clade includes Fernandosiphonia 19 20 273 unilateralis , Neosiphonia flavimarina , and M. somalensis , the type species of their corresponding 21 22 274 genera. In addition to these two large clades, six other lineages containing 3 4 species are highly 23 24 275 supported (BP/PP > 94/0.95); among these are the Carradoriella clade including Polysiphonia 25 26 276 virgata , the type species of Caradoriella , and the Streblocladia clade, which includes the type 27 277 species S. glomerulata . Our phylogenetic tree also resolved five individual species as sisters to the 28 29 278 other clades with low support. 30 31 279 The Melanothamnus clade receives support of 100/1.00 (Fig. 1). In addition to F. 32 33 280 unilateralis , N. flavimarina and M. somalensis , this clade includes 27 other species currently 34 35 281 assigned to Neosiphonia and Polysiphonia. The 95 bp sequence obtained from the type material of 36 37 282 F. unilateralis analysed separately showed that this sequence was positioned unequivocally within 38 39 283 the Melanothamnus clade, but sequence ambiguities due to the quality of the DNA made it 40 284 impossible to determine its precise position. 41 42 285 The phylogenetic relationships among species within the Melanothamnus clade are 43 44 286 generally poorly resolved, with a few exceptions. Although the lineage formed by “Polysiphonia ” 45 46 287 schneideri , “P. ” amplacapilli , “P. ” pentamera and “P. ” morroides is very weakly positioned as 47 48 288 sister to the Melanothamnus clade in the rbc L tree, in 18S analyses this position is robustly 49 50 289 supported (see below). 51 52 290 The RAxML 18S tree (Fig. 2) has a similar topology to the rbc L phylogeny, with three 53 54 291 strongly supported major clades: Polysiphonia sensu stricto 1 and 2 and a third clade with all the 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 13 of 109 European Journal of Phycology
1 2 3 4 5 13 6 7 292 other taxa. Polysiphonia sensu stricto clades 1 and 2 are placed robustly together (99/1.00). Within 8 9 293 the third clade, the Vertebrata clade receives full support, while support is lower for 10 11 294 Melanothamnus (82/1.00). The sister relationship between the Melanothamnus and “P. ” 12 295 schneideri clades is strongly supported in the 18S phylogeny. In addition, the Carradoriella and 13 14 296 Streblocladia clades areFor highly supported. Peer Review Only 15 16 297 The time calibrated phylogenies (Figs S1, S2) estimated the divergence in Vertebrata to be 17 18 298 more ancient than in Melanothamnus (90.7 138.66 vs 75.7 95.78 Ma). Furthermore, the radiation 19 20 299 of major lineages in Vertebrata and Melanothamnus was gradual and took place over periods of 21 22 300 ca. 20 and 12 Ma, respectively. 23 24 301 25 26 302 Morphological observations 27 303 28 29 304 An overview of the distribution of selected morphological characters within clades of the 30 31 305 Polysiphonieae is shown in Table 1. 32 33 306 34 35 307 Habit : There is considerable variation within and among clades (Table 1), with the exception of 36 37 308 the Carradoriella clade, in which both species are erect. True prostrate axes giving rise to erect 38 39 309 axes, as opposed to decumbent axes that themselves become erect, are confined to Polysiphonia 40 310 sensu stricto and Vertebrata . Most species of the Melanothamnus clade are completely erect or 41 42 311 have a very short prostrate system. However, some taxa are decumbent (e.g. Polysiphonia blandii, 43 44 312 P. simplex ), forming extensive prostrate systems with rhizoids in the basal parts of the erect axes. 45 46 313 Members of the Polysiphonieae are typically smaller than 10 cm. As an exception, M. afaqhusainii 47 48 314 can exceed 1 m in length. 49 50 315 51 52 316 Rhizoids : The connection between the rhizoids and the pericentral cells from which they originate 53 54 317 is a uniform character within each clade, so far as it can be observed (Table 1). Rhizoids are in 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 14 of 109
1 2 3 4 5 14 6 7 318 open connection with pericentral cells in Polysiphonia sensu stricto (Fig. 19), while they are cut 8 9 319 off from pericentral cells in the other clades (Figs 20 24). Observations on rhizoids cannot be 10 11 320 made in mature specimens of some species, such as Vertebrata lanosa which is an obligate hemi 12 321 parasite that lacks rhizoids, and Fernandosiphonia unilateralis, Streblocladia glomerulata and 13 14 322 Melanothamnus somalensisFor, which allPeer have compact basal Review discs without individual rhizoids.Only 15 16 323 17 18 324 Pericentral cells and cortication : The number of pericentral cells and the presence of cortication 19 20 325 are variable in most of the clades (Table 1). All species in the Vertebrata clade have six or more 21 22 326 pericentral cells, while members of the Polysiphonia sensu stricto clades have four pericentral 23 24 327 cells, with the exception of Bryocladia cuspidata (6 8 pericentrals). Cortication is uniformly 25 26 328 absent in the Polysiphonia sensu stricto and “P. ” schneideri clades. Cortication is variable within 27 329 the other clades, absent or slight in small species of Fernandosiphonia but very heavy in 28 29 330 Melanothamnus , and absent or slight in most species of Vertebrata with the exception of 30 31 331 Boergeseniella , in which cortication is elaborate. 32 33 332 34 35 333 Plastid arrangement : The arrangement of plastids in the cells is a synapomorphy for the 36 37 334 Melanothamnus clade. The species in this clade have the plastids lying exclusively on radial walls 38 39 335 of pericentral cells so the outer walls appear transparent (Table 1, Figs 8, 13, 34 39). This 40 336 particular arrangement of the plastids can be easily observed under the microscope as the cells 41 42 337 show a dark flank when observed in detail (Figs 14, 35, 37), as well as a transparent halo when the 43 44 338 pericentral cells are observed in a suitable position (Fig. 38). All the other taxa of the 45 46 339 Polysiphonieae have plastids against all the cell walls including the outer wall (Table 1, Figs 25 47 48 340 33). The revision of the type materials listed in Table S2, currently assigned to Neosiphonia , 49 50 341 allowed us to verify the plastid character in the species Polysiphonia concinna , P. eastwoodiae , P. 51 52 342 gorgoniae , P. harlandii and P. johnstonii . Conversely, the species Lophosiphonia mexicana , P. 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 15 of 109 European Journal of Phycology
1 2 3 4 5 15 6 7 343 beaudettei, P. confusa , P. poko , P. profunda and P. rubrorhiza have the plastids scattered within 8 9 344 the cells, including against the outer wall cells. 10 11 345 12 346 Branch/trichoblast arrangement : Whether trichoblasts and/or branches are formed on every 13 14 347 segment or are separatedFor by naked segmentsPeer is variable inReview three clades, Melanothamnus, Only 15 16 348 Carradoriella and Vertebrata. Most species of the Melanothamnus clade have branches or 17 18 349 trichoblasts on every segment, which is a key feature of Neosiphonia . However, there are 19 20 350 exceptions in this clade such as Neosiphonia collabens , Polysiphonia nuda and P. pseudovillum 21 22 351 from Panama, in which there are interspersed naked segments. Conversely, the formation of 23 24 352 trichoblasts/branches with naked segments between them is a uniform character in the 25 26 353 Streblocladia , “Polysiphonia ” schneideri and Polysiphonia sensu stricto clades (Table 1). Within 27 354 all clades except Melanothamnus , branches may form in a position axillary to trichoblasts, but 28 29 355 although constant at the species level, this character is variable within clades. In the 30 31 356 Melanothamnus clade this character is absent, and branches are never axillary. 32 33 357 34 35 358 Trichoblast nuclei : The proximal cells of trichoblasts are multinucleate in the Vertebrata clade 36 37 359 (Table 1, Figs 41 43), with up to 8 or more nuclei in the basal cell and decreasing in number 38 39 360 towards the apices, which can be uninucleate. The nuclei are uniformly distributed inside the cells, 40 361 each appearing to have a domain within the cell. Conversely, all the cells of trichoblasts are 41 42 362 uninucleate in other clades of the Polysiphonieae (Figs 40, 44 46). The only known exception is 43 44 363 Leptosiphonia schousboei , which sometimes has two nuclei in the trichoblast cells. 45 46 364 47 48 365 Branching pattern : Despite the great significance previously placed on dorsiventral vs. radial 49 50 366 branching in the Rhodomelaceae, this character varies within all our clades. A primary dorsiventral 51 52 367 branching pattern characterizes some species of the clades Melanothamnus (F. unilateralis and N. 53 54 368 collabens ; Figs 10, 11), Streblocladia (S. glomerulata ) and Vertebrata (Ctenosiphonia hypnoides ) 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 16 of 109
1 2 3 4 5 16 6 7 369 (Table 1). However, this characteristic is not significant in delineating these three genera, as our 8 9 370 phylogenetic tree reveals that each of these four species is closely related to others that have 10 11 371 spirally or pseudodichotomously arranged branches. For example, the branching pattern of 12 372 members of the Streblocladia clade varies from dorsiventral in S. glomerulata , the type species, to 13 14 373 spiral or pseudodichotomousFor in Polysiphonia Peer muelleriana Review and Polysiphonia sp. Likewise, Only the Formatted: Font: Not Italic 15 16 374 dorsiventral Neosiphonia collabens is related to species with spiral or pseudodichotomous 17 18 375 branching patterns. 19 20 376 21 22 377 Spermatangial branches : Whether spermatangial branches replace trichoblasts completely or 23 24 378 replace only one branch of a dichotomously branched trichoblast is a constant character in all 25 26 379 clades (Table 1). In the two Polysiphonia sensu stricto and Streblocladia clades, spermatangial 27 380 branches almost uniformly replace trichoblasts (Fig. 47). In the other clades, they are formed on 28 29 381 the first dichotomy of modified trichoblasts (Figs 15, 49 52), with the exception of Vertebrata 30 31 382 (Fig. 48) as V. lanosa has no trichoblasts in male thalli they can only be observed occasionally in 32 33 383 females. The presence or absence of apical sterile cells on spermatangial branches is variable 34 35 384 within clades, except for Carradoriella in which they are present (Figs 47 52, Table 1). 36 37 385 38 39 386 Carpogonial branches: The Melanothamnus clade is characterized by having 3–celled carpogonial 40 387 branches (Table 1). In our study, we observed this character in N. harveyi , N. collabens , P. blandi 41 42 388 and P. forfex (Figs 57, 58). By contrast, the other Polysiphonieae uniformly have 4 celled 43 44 389 carpogonial branches like the majority of the Rhodomelaceae (Table 1, Figs 53 56). 45 46 390 47 48 391 Cystocarps : The outline morphology of cystocarps varies from globose to ovoid in all the clades 49 50 392 analysed here (Table 1, Figs 60 64). Urceolate cystocarps are exclusive to the Polysiphonia sensu 51 52 393 stricto clades (Table 1, Fig. 59). Cells around the ostiole are conspicuously larger than (more than 53 54 394 twice the size of) the cells of the pericarp immediately below in most species of the 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 17 of 109 European Journal of Phycology
1 2 3 4 5 17 6 7 395 Melanothamnus clade (Fig 70). However, Neosiphonia harveyi is an exception, and the cells of 8 9 396 the ostiole in this species are only slightly larger than the other cells of the pericarp. This character 10 11 397 is also seen in Streblocladia glomerulata (Fig. 68). Conversely, the cells of the ostiole in the other 12 398 four clades are uniformily similar to the cells below (Figs 65 67, 69). 13 14 399 For Peer Review Only 15 16 400 Tetrasporangia : The formation of tetrasporangia in straight or spiral rows is variable in all clades 17 18 401 (Table 1, Figs 71 76). It must be noted that very long straight series of tetrasporangia are typically 19 20 402 observed only in members of the Polysiphonia sensu stricto clade (Fig. 71). However, straight 21 22 403 series can also form in other clades, for example in Neosiphonia collabens and Polysiphonia nuda 23 24 404 within the Melanothamnus clade whereas tetrasporangia in Fernandosiphonia unilateralis form 25 26 405 short and markedly spiral series (Fig. 18). The third tetrasporangial cover cell is exclusive to the 27 406 Polysiphonia sensu stricto clade, but this character has not been examined in all the species. 28 29 407 30 31 408 32 33 409 DISCUSSION 34 35 410 36 37 411 Phylogenetic analysis 38 39 412 Amongst the Polysiphonieae studied here, the early branching clade/clades Polysiphonia sensu 40 413 stricto 1 and 2 were resolved as separate lineages in rbc L analyses (Fig. 1) but together formed a 41 42 414 robust clade in 18S analyses (Fig. 2). The marked discordance between rbc L and 18S trees 43 44 415 regarding the monophyly/paraphyly of the Polysiphonia sensu stricto lineages requires additional 45 46 416 research for a more accurate assessment of relationships and character evolution. Because the 47 48 417 Polysiphonia sensu stricto lineages occur near the base of the tree, it is possible that the outgroups 49 50 418 (which are relatively distant taxa compared to the ingroup) could have attached to the ingroup in 51 52 419 the wrong position in one of the analyses (Shavit et al. , 2007). Future work should focus on 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 18 of 109
1 2 3 4 5 18 6 7 420 including a wider range of taxa from across the Rhodomelaceae as well as using larger, multi gene 8 9 421 datasets to infer the correct branching order of the two Polysiphonia sensu stricto lineages. 10 11 422 The Vertebrata and Melanothamnus clades were resolved as large, speciose clades with 12 423 strong support using rbc L. The 18S phylogeny also resolves the Vertebrata clade with robust 13 14 424 support, while MelanothamnusFor is moderately Peer well supported. Review Both clades are clearly Onlydistinguished 15 16 425 from Polysiphonia sensu stricto by the rhizoid anatomy (cut off from pericentral cells). Both 17 18 426 clades are identified by distinct morphological synapomorphies. The Vertebrata clade is 19 20 427 characterized by the multinucleate cells of trichoblasts; the other key feature of Vertebrata , that all 21 22 428 species have six or more pericentral cells, is shared with members of some other clades. The 23 24 429 Melanothamnus clade is unequivocally distinguished from other Polysiphonieae by two 25 26 430 synapomorphic characteristics: the plastid arrangement and the 3 celled carpogonial branches. 27 431 Furthermore, branch origin is independent from trichoblasts in all the species of this clade, and the 28 29 432 majority of species have enlarged ostiolar cells. 30 31 433 In addition to the above mentioned clades, the rbc L phylogeny resolved six small (3 4 32 33 434 species) but highly supported clades, as well as indicating five species that are uncertainly 34 35 435 positioned. The generic assignment of these lineages requires further taxon and gene sampling in 36 37 436 order to better understand their phylogenetic relationships and establish a natural classification – it 38 39 437 would be premature to speculate on the outcomes of these investigations at present . One of the 40 438 major shortcomings in Polysiphonieae sequence databases is the uneven geographical sampling, as 41 42 439 the majority of sequenced taxa come from Atlantic Europe and northwestern America. The 43 44 440 generation of molecular data from additional regions could contribute to acquiring a more realistic 45 46 441 perspective of the magnitude of unplaced lineages and to delineating their corresponding genera. 47 48 442 Also, the resolution of the commonly employed molecular markers in the Polysiphonieae is not 49 50 443 sufficient to resolve the phylogenetic relationships among numerous lineages, which could be 51 52 444 improved using larger gene datasets (Díaz Tapia et al. , 2015). 53 54 445 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 19 of 109 European Journal of Phycology
1 2 3 4 5 19 6 7 446 Taxonomic position of Vertebrata 8 9 447 Vertebrata lanosa is placed in a strongly supported clade that also includes Brongniartella 10 11 448 byssoides , Boergeseniella fruticulosa, Ctenosiphonia hypnoides and Enelittosiphonia stimpsonii , 12 449 the type species of their corresponding genera, and Lophosiphonia reptabunda (which is not the 13 14 450 type species). All membersFor of this cladePeer have a synapomorphic Review characteristic that was Only previously 15 16 451 overlooked in relation to systematics (but see Maggs & Hommersand, 1993): multinucleate 17 18 452 trichoblast cells. We conclude from molecular and morphological evidence that members of this 19 20 453 clade represent a single genus. Vertebrata is the oldest name among those available for this clade, 21 22 454 as noted before (Choi et al ., 2001), and the new combinations proposed in Table 2 are required. 23 24 455 Furthermore, the Vertebrata binomials previously established by Kuntze (1891) should be 25 26 456 reinstated for the other 13 species included in this clade (Table 3). 27 457 Interestingly, Brongniartella is not monophyletic despite its distinctive persistent and 28 29 458 pigmented trichoblasts that led to its classification in the tribes Lophothalieae (Falkenberg, 1901; 30 31 459 Womersley, 2003) or Brongniartelleae Parsons (Parsons, 1975; Maggs & Hommersand, 1993). 32 33 460 Although trichoblasts are typically considered unpigmented in the Polysiphonieae, they are 34 35 461 commonly pigmented when young before they enlarge and become colourless (Delivopoulos, 36 37 462 2002). The two currently recognized species of Brongniartella , B. byssoides and B. australis , 38 39 463 were separated within the Vertebrata clade, respectively placed with V. lanosa and Polysiphonia 40 464 nigra . 41 42 465 Ctenosiphonia is a monotypic genus segregated from Polysiphonia due to its very peculiar 43 44 466 morphological characteristics, including a dorsiventral thallus and two tetrasporangia per segment 45 46 467 (Falkenberg, 1901; Díaz Tapia & Bárbara, 2013). This genus, together with Lophosiphonia 47 48 468 Falkenberg (1987) , is currently positioned within the “Lophosiphonia group” (Falkenberg, 1901). 49 50 469 Boergeseniella and Enelittosiphonia were distinguished from other Polysiphonieae by their 51 52 470 particular branching patterns (Kylin, 1956; Segi, 1949), but our molecular evidence (Fig. 1) does 53 54 471 not support their recognition as independent genera. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 20 of 109
1 2 3 4 5 20 6 7 472 The diversity of currently recognized genera included in this clade reflects the high 8 9 473 variability among Vertebrata species in trichoblast characteristics (pigmented/unpigmented; 10 11 474 persistent/deciduous; spirally/dorsiventrally arranged) and branching patterns (spiral/dorsiventral; 12 475 presence or absence of alternating branches of determinate and indeterminate growth), which 13 14 476 classical authors consideredFor important Peer at levels of genus Review and tribe (Falkenberg, 1901; OnlyKylin, 1956; 15 16 477 Hommersand, 1963). 17 18 478 The main morphological character delineating the Vertebrata group is that trichoblast cells 19 20 479 are multinucleate. In the Polysiphonieae and some other Ceramiales, the apical cell is uninucleate, 21 22 480 whereas the cells cut off from it undergo nuclear divisions during elongation, becoming 23 24 481 multinucleate, with the number of nuclei being proportional to the volume of the cell (Goff & 25 26 482 Coleman, 1986; McIvor et al. , 2002). The trichoblasts of the Rhodomelaceae are usually 27 483 uninucleate, whereas the polysiphonous parts of the thalli are multinucleate (Coomans & 28 29 484 Hommersand, 1990; Garbary & Clarke, 2001; Delivopoulos, 2002). A plausible advantage of 30 31 485 having multinucleate trichoblasts in Vertebrata is that their cells can reach larger sizes. In fact, 32 33 486 trichoblasts in this genus are sometimes extremely well developed, exceeding 10 mm in length in 34 35 487 species such as Vertebrata (Lophosiphonia ) reptabunda and V. (Ctenosiphonia ) hypnoides . In the 36 37 488 red algae, cell streaming is slow compared with other algae (Pueschel, 1990), and multinuclearity 38 39 489 of large cells may facilitate the regulation of cellular activities. Several potential functions have 40 490 been attributed to the vegetative hairs of the red algae or trichoblasts of the Rhodomelaceae 41 42 491 including dessication resistance, nutrient uptake, metabolite secretion, shading, trapping of 43 44 492 spermatia, mucilage stabilization and monitoring of phosphorus status (Delivopoulos, 2002, and 45 46 493 references therein). Physically, trichoblasts can form a dense network around the apices that could 47 48 494 potentially restrict access to the cells by small grazers, such as amphipods and copepods. 49 50 495 51 52 496 Taxonomic position of Neosiphonia , Fernandosiphonia and Melanothamnus 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 21 of 109 European Journal of Phycology
1 2 3 4 5 21 6 7 497 The presence of the type species of the genus Melanothamnus (M. somalensis ) in a strongly 8 9 498 supported clade with the type species of the genus Neosiphonia (N. flavimarina ) and 10 11 499 Fernandosiphonia (F. unilateralis ) indicates that Neosiphonia , Fernandosiphonia and 12 500 Melanothamnus are not distinct monophyletic genera. Neosiphonia is a later heterotypic synonym 13 14 501 of Fernandosiphonia. ForHowever, the namePeer Melanothamnus Review is older than both Fernandosiphonia Only 15 16 502 and Neosiphonia , and the new combinations proposed in Tables 4 and 5 are required. These new 17 18 503 combinations include 31 species that were previously assigned to Neosiphonia ; two species known 19 20 504 to be closely related to Neosiphonia but that had been retained in Polysiphonia because their 21 22 505 morphology conflicted with Kim & Lee (1999); six species for which molecular data are presented 23 24 506 here for the first time; and three species that are transferred to Melanothamnus on the basis of their 25 26 507 morphology. 27 508 On the other hand, ten species that are currently placed in Neosiphonia should be replaced in 28 29 509 Polysiphonia for formal purposes pending clarification of their phylogenetic affinities and generic 30 31 510 assingment . Polysiphonia beaudettei, P. confusa, P. echinata, P. elongella, P. poko , P. rubrorhiza 32 33 511 and P. profunda were assigned to Neosiphonia based on morphological characteristics (Kim & 34 35 512 Lee, 1999; Abbott et al. , 2002; Kim & Abbott, 2006; Mamoozadeh & Freshwater, 2011; Norris, 36 37 513 2014). However, they lack the plastid character, and furthermore molecular data for P. echinata 38 39 514 and P. elongella show that they do not belong to the Melanothamnus clade (Fig. 1). Likewise, 40 515 Polysiphonia sertularioides was transferred to Neosiphonia based on the morphology of Korean 41 42 516 material attributed to this species (Nam & Kang, 2012). However, its type locality is in the 43 44 517 Mediterranean, and Atlantic sequences for this species are not in the Fernandosiphonia clade (Fig. 45 46 518 1; Mamoozadeh & Freshwater, 2012). Polysiphonia paniculata was transferred to Neosiphonia 47 48 519 (Norris, 2014), but again it is not in the Melanothamnus clade (Figs 1, 2). Finally, our study of the 49 50 520 type material of Lophosiphonia mexicana, also transferred to Neosiphonia (Norris, 2014; Table 51 52 521 S2), leads us to conclude indicates that this species is probably not a member of the 53 54 522 Polysiphonieae. As noted by Norris (2014), further studies are needed to clarify the generic 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 22 of 109
1 2 3 4 5 22 6 7 523 placement of this unusual species, and meanwhile we propose to leave it in Lophosiphonia until 8 9 524 more information is available. 10 11 525 Specimens of Melanothamnus collected in Oman and housed in MICH were initially 12 526 assigned to M. somalensis (Wynne & Banaimoon, 1990), before the description of M. afaqhusainii 13 14 527 M.Shameel from PakistanFor (1999). Revision Peer of the Omani Review materials leads us to conclude Only that both 15 16 528 M. somalensis and M. afaqhusainii are represented in Oman, and their morphology agrees with the 17 18 529 criteria proposed by Shameel (1999, 2000) for distinguishing them. Their rbc L sequences diverged 19 20 530 by 1.4% (18 bp). 21 22 531 The Melanothamnus clade is morphologically distinguished from other members of the tribe 23 24 532 Polysiphonieae by an unequivocal synapomorphic character: plastids lie exclusively on the radial 25 26 533 walls of the pericentral cells and are absent from outer walls. The plastid character was previously 27 534 noted by Hollenberg (1961, 1968 a), who described “hyaline cell walls” for several species (e.g. P. 28 29 535 pseudovillum , P. bajacali ), and by Maggs & Hommersand (1993). However, its significance at 30 31 536 higher taxonomic levels has not previously been highlighted. We observed this character in a total 32 33 537 of 35 species, and we conclude that it is uniform in the Melanothamnus clade. Conversely, other 34 35 538 Polysiphonieae and most of the Rhodomelaceae have plastids distributed within the cytoplasm, 36 37 539 some lying against outer cell walls. In the family, the only other exception is some species of 38 39 540 Herposiphonia in which the plastids form transverse bands (Hollenberg, 1968 c; Womersley, 2003; 40 541 Díaz Tapia & Bárbara, 2013). 41 42 542 Carpogonial branches are typically 4 celled throughout the family Rhodomelaceae. 3 celled 43 44 543 carpogonial branches were described for the first time in Polysiphonia platycarpa (Iyengar & 45 46 544 Balakrishnan, 1950), and later this was one of the features proposed to delineate the genus 47 48 545 Neosiphonia (Kim & Lee, 1999). 3 celled carpogonial branches have been reported in 17 species 49 50 546 (four of them in the “ japonica complex”), all of which are placed here in Melanothamnus . 51 52 547 Alternative interpretations of the carpogonial branch configuration were found in the literature for 53 54 548 F. unilateralis , as Leving (1941) described and illustrated a 4 celled structure, while Morrill (1976, 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 23 of 109 European Journal of Phycology
1 2 3 4 5 23 6 7 549 plate 37, figs E and H) illustrated 3 celled carpogonial branches in the same species, also from the 8 9 550 type locality. This character can be easily misinterpreted if the carpogonial branches are not 10 11 551 observed at the right developmental stage. In our study of the type material, a single procarp was 12 552 observed in a permanent slide (Fig. 16), most probably the same one illustrated by Levring. It is 13 14 553 unclear how this procarpFor should be interpretedPeer because itReview is too mature, and so it is difficultOnly to 15 16 554 determine with certainty which cell corresponds to the sterile basal cell and which to the basal cell 17 18 555 of the carpogonial branch. From the evidence of the presence of both the plastid character and 3 19 20 556 celled carpogonial branches, Kintarosiphonia fibrillosa Uwai & Masuda (1999), based on 21 22 557 Pterosiphonia fibrillosa , and Polysiphonia platycarpa are also here transferred to Melanothamnus 23 24 558 (Table 1). 25 26 559 The other morphological characters proposed by Kim & Lee (1999) to delineate the genus 27 560 Neosiphonia vary among closely related species, except for the rhizoid anatomy. Rhizoids are cut 28 29 561 off from the pericentral cells in all Polysiphonieae except for Polysiphonia sensu stricto in which 30 31 562 they are in open connection with the pericentral cells. After the establishment of Neosiphonia , 32 33 563 numerous species were transferred to the new genus based on morphology, but commonly 34 35 564 overlooking the number of cells in carpogonial branches. Excluding this trait, several species have 36 37 565 all five characteristics proposed by Kim & Lee (1999) to delineate Neosiphonia but nevertheless 38 39 566 are not in the Melanothamnus clade (e.g. P. brodiei , P. echinata , P. elongella ), while several 40 567 species are clearly in the clade (e.g. M. collabens, M. nuda , M. pseudovillum ) but lack this 41 42 568 combination of traits. 43 44 569 The key morphological feature of Melanothamnus is the restriction of plastids to the radial 45 46 570 walls of the pericentral cells and their absence from the outer walls. Algae demonstrate a notable 47 48 571 decline in photosynthesis at higher light levels possibly due to damage to the photosynthetic 49 50 572 apparatus caused by excessive light delivery to photosystem II (Lüning, 1990; Hurd et al ., 2014). 51 52 573 Many green and brown algal plastids have phototropic reactions to blue and UV light in order to 53 54 574 protect them from irradiation damage (Lüning, 1990). Plastid movement, however, has never been 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 24 of 109
1 2 3 4 5 24 6 7 575 demonstrated for the vast majority of red algae (Pueschel, 1990), and it appears that red algae have 8 9 576 evolved other types of protection against UV damage. Red algae including Polysiphonia species 10 11 577 have high concentrations of various mycosporine like amino acids that respond rapidly to 12 578 environmental change and act as defences against the photooxidative effects of sunlight (Karsten 13 14 579 et al. , 1998; Navarro etFor al ., 2014). ThePeer movement of theReview plastids onto the radial walls Only of the 15 16 580 periaxial cells, in combination with MAAs, may have given the Melanothamnus ancestor a 17 18 581 selective advantage over other Polysiphonieae, allowing it to exploit new ecological niches. The 19 20 582 prevalence of Melanothamnus species in habitats with exposure to high light levels, such as in 21 22 583 Hawaii or turfs on coral reefs (Price & Scott, 1992, ; Kim & Abbott, 2006), supports this 23 24 584 speculation. 25 26 585 27 586 Biogeography of Vertebrata and Melanothamnus 28 29 587 The genus Vertebrata is distributed worldwide and representatives have been described from all 30 31 588 regions where there has been a detailed study of the tribe Polysiphonieae. The majority of our 32 33 589 sequences are from Europe, but our systematic review and unpublished data suggest that this genus 34 35 590 is widespread. BEAST and PhyloBayes calibrations indicate radiation of the major lineages of the 36 37 591 Vertebrata clade over a 20 MA period starting about 140 or 90 Ma (estimates from different 38 39 592 methods; see Figs S1, S2). Further conclusions as to its origins and centres of diversity would be 40 593 premature, pending more comprehensive sampling. 41 42 594 In contrast, Melanothamnus is predominantly Indo Pacific (Fig. 77). Although few 43 44 595 molecular data are available from Indian coasts, some species occur in South Africa (M. 45 46 596 incompta ), Oman ( M. somalensis and M. afaqhusainii ), India ( M. platycarpa ) and Thailand (M. 47 48 597 thailandica ). Among the regions for which there is a comprehensive study of the Polysiphonieae, 49 50 598 the diversity of Melanothamnus is particularly high in Korea, Japan and Hawaii (14, 11 and 14 51 52 599 species, respectively). This genus is also well represented on North American Atlantic coasts (4 5 53 54 600 species), but it is almost completely absent from Atlantic and Mediterranean Europe, where only 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 25 of 109 European Journal of Phycology
1 2 3 4 5 25 6 7 601 two species have been reported, which are both most probably examples of old human mediated 8 9 602 introductions. Melanothamnus harveyi is native to southeastern Asia and has been introduced by 10 11 603 multiple events onto northern Atlantic coasts (McIvor et al. , 2001; Savoie & Saunders, 2016). 12 604 Similarly, M. collabens is likely to be an old introduction into the Atlantic, where it extends from 13 14 605 the Bay of Biscay to CapeFor Verde, including Peer the western ReviewMediterranean (Díaz Tapia &Only Bárbara, 15 16 606 2013). The finding of M. collabens in California (as P. johnstonii , see Table 4) supports this 17 18 607 hypothesis, but although Polysiphonia johnstonii was first collected from the Gulf of California in 19 20 608 1921 (Setchell & Gardner, 1924), California was probably not the original source of the 21 22 609 introduction. Polysiphonia johnstonii was first collected from the Gulf of California in 1921 23 24 610 (Setchell & Gardner, 1924). However an An investigation of Polysiphonia species from the 25 26 611 Northern Gulf of California (Hollenberg & Norris, 1977) suggested that since its initial collection 27 612 and description, P. johnstonii has extended its range along the Pacific coast of North America, 28 29 613 fulfilling one of the criteria for an invasive species (Chapman & Carlton, 1991; Ribera & 30 31 614 Boudouresque, 1995). How far this species has spread along the Pacific coast of America and 32 33 615 along North Atlantic coastlines remains to be determined, and further sampling is needed to 34 35 616 establish its origin. 36 37 617 The absence of naturally occurring Melanothamnus species in the Mediterranean and 38 39 618 northeastern Atlantic might suggest that Melanothamnus is of recent origin, having evolved in the 40 619 Pacific Ocean after the closure of the Tethys Seaway, between 60 and 20 million years ago, 41 42 620 particularly as the sister “P. ” schneideri clade is also primarily Pacific in distribution. In our rbc L 43 44 621 phylogeny (Fig. 1), the “P. ” schneideri clade includes two Korean species and two species 45 46 622 distributed in the Pacific and North America with one of them introduced in Europe (Díaz Tapia et 47 48 623 al. , 2013). Furthermore, our surveys in Australia revealed five other Indo Pacific species 49 50 624 belonging to this clade (unpublished data). However, BEAST and PhyloBayes calibrations indicate 51 52 625 radiation of the major lineages of the Melanothamnus clade over a 12 Ma period starting about 95 53 54 626 or 75 Ma (the two methods providing different estimates), with divergence from the “P. ” 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 26 of 109
1 2 3 4 5 26 6 7 627 schneideri clade 140 or 95 Ma (Figs S1, S2). The distribution resembles a Tethyan one that 8 9 628 originated during the Cretaceous 125 75 Ma (Lüning, 1990; Hommersand, 2007) when the Tethys 10 11 629 Ocean formed a tropical girdle around the earth. Unlike typical Tethyan distributions, in addition 12 630 to its wide occurrence throughout the tropics, Melanothamnus occupies more temperate regions in 13 14 631 the North Pacific (e.g.For Japan, Korea) Peerand the South Pacific/Oceania Review (e.g. South Australia, Only New 15 16 632 Zealand). The question of whether Melanothamnus failed to colonize the northeastern Atlantic as it 17 18 633 opened up during the Cretaceous, or whether northeastern Atlantic lineages evolved but became 19 20 634 extinct, perhaps during Pleistocene glaciations, cannot be answered at present. 21 22 635 23 24 636 25 26 637 ACKNOWLEDGEMENTS 27 638 28 29 639 We are pleased to recognize here that Dr Max H. Hommersand (UNC Chapel Hill) independently 30 31 640 discovered the key morphological character of the position of plastids in the Melanothamnus clade. 32 33 641 We thank Joana Costa for providing us samples of Polysiphonia spp. from South Africa, and 34 35 642 Erasmo Macaya for supplying material from his recent collections of Fernandosiphonia 36 37 643 unilateralis from the type locality. Prof. Gary Saunders is thanked warmly for generously sharing 38 39 644 sequences for Melanothamnus afaqhusainii from Oman. We acknowledge the curators of the 40 645 herbaria TFC, US and TCD; Dr Joe Zuccarello provided host support for Lynne McIvor during her 41 42 646 Marie Curie fellowship at Leiden Herbarium. PDT acknowledges support by the postdoctoral 43 44 647 programmes Axudas de apoio á etapa inicial de formación posdoutoral do Plan I2C (Xunta de 45 46 648 Galicia). Funding for the aspects of the work carried out in the Melbourne lab was provided by the 47 48 649 Australian Biological Resources Study (RFL213 08) and the Australian Research Council 49 50 650 (FT110100585). 51 52 651 53 54 652 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 27 of 109 European Journal of Phycology
1 2 3 4 5 27 6 7 653 REFERENCES 8 9 654 10 11 655 Abbott, I. A. (1999). Marine Red Algae of the Hawaiian Islands. Bishop Museum Press, Honolulu. 12 656 Abbott, I.A. & Hollenberg, G.J. (1976). Marine Algae of California . Stanford University Press, 13 14 657 Stanford, California.For Peer Review Only 15 16 658 Abbott, I. A., Fisher, J. & McDermid, K. J. (2002). New reported and revised marine algae from 17 18 659 the vicinity of Nha Trang, Vietnam. In Taxonomy of Economic Seaweeds with Reference to 19 20 660 some Pacific Species (Abbott, I. A. & McDermid, K. J., editors), 291 321 . California Sea 21 22 661 Grant College, La Jolla. 23 24 662 Adams, N.M. (1991). The New Zealand species of Polysiphonia Greville (Rhodophyta). New 25 26 663 Zealand Journal of Botany , 29 : 411 427. 27 664 Adams, N.M. (1994). Seaweeds of New Zealand. An Illustrated Guide . Canterbury University 28 29 665 Press, Christchurch. 30 31 666 Agardh, C. A. (1824). Systema algarum. Berlinginiana, Lundae. 32 33 667 Agardh, C.A. (1828). Species algarum rite cognitae, cum synonymis, differentiis specificis et 34 35 668 descriptionibus succinctis. Voluminis secundi. Sectio prior. Sumptibus Ernesti, Greifswald. 36 37 669 Agardh, J.G. (1842). Algae maris Mediterranei et Adriatici , observationes in diagnosin specierum 38 39 670 et dispositionem generum. Apud Fortin, Masson et Cie, Paris. 40 671 Agardh, J. G. (1863). Species Genera et Ordines Algarum, seu descriptiones succinctae specierum, 41 42 672 generum et ordinum, quibus algarum regnum constituitur. Volumen secundum: algas 43 44 673 florideas complectens. C.W.K. Gleerup, Lundae. 45 46 674 Bailey, J.W. (1848). Continuation of the list of localities of algae in the United. American Journal 47 48 675 of Science and Arts, series 2 , 6: 37 42. 49 50 676 Bárbara, I., Cremades, J., Calvo, S., López Rodríguez, M. C. & Dosil, J. (2005). Checklist of the 51 52 677 benthic marine and brackish Galician algae (NW Spain). Anales del Jardín Botánico de 53 54 678 Madrid , 62 : 69 100. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 28 of 109
1 2 3 4 5 28 6 7 679 Bárbara, L, Choi, H. G., Secilla, A., Díaz Tapia, P. Gorostiaga, J.M., Seo, T. K., Jung, M.Y. & 8 9 680 Berecibar, E. (2013). Lampisiphonia iberica gen. et sp. nov. (Ceramiales, Rhodophyta) based 10 11 681 on morphology and molecular evidence. Phycologia , 52 : 137 155. 12 682 Børgesen, F. (1918). The marine algae of the Danish West Indies. Part 3. Rhodophyceae (4). 13 14 683 Dansk BotaniskFor Arkiv , 3: 241 304. Peer Review Only 15 16 684 Børgesen, F. (1934). Some Indian Rhodophyceae especially from the shores of the Presidency of 17 18 685 Bombay IV. Bulletin of Miscellaneous Information, Royal Botanic Gardens, Kew , 1934 : 1 30. 19 20 686 Bornet, É. (1892). Les algues de P. K. A. Schousboe, récoltées au Maroc & dans la Méditerranée 21 22 687 de 1815 a 1829, et déterminées par M. Édouard Bornet. Mémoires de la Société Nationale 23 24 688 des Sciences naturelles et Mathématiques de Cherbourg , 28 : 165 376. 25 26 689 Bory de Saint Vincent, J.B.G.M. (1822). Brongniartelle. Brongniartella. Bot. crypt. (Céramiaires.). 27 690 In Dictionnaire Classique d'Histoire Naturelle (Audouin, I. et al. , editors), 516 517. Rey et 28 29 691 Gravier; Baudoin frères, Paris. 30 31 692 Bustamante, D.E., Won, B.Y., Ramirez, M.E. & Cho, T.O. (2012). Neosiphonia peruviensis sp. 32 33 693 nov. (Rhodomelacea, Rhodophyta) from the Pacific coast of South America. Botanica 34 35 694 Marina , 55 : 359 366. 36 37 695 Bustamante, D. E., Won, B. Y. & Cho, T. O. (2013a). Neosiphonia ramirezii sp. nov. 38 39 696 (Rhodomelaceae, Rhodophyta) from Peru. Algae , 28 : 73 82. 40 697 Bustamante, D. E., Won, B. Y. & Cho, T. O. (2013b). Neosiphonia baliana sp. nov. and N. silvae 41 42 698 sp. nov. (Rhodomelaceae, Rhodophyta) from Bali, Indonesia. Botanica Marina , 56 : 515 43 44 699 524. 45 46 700 Chapman, J.W. & Carlton, J.T. (1991). A test of criteria for introduced species: the global invasion 47 48 701 by the isopod Synidotea laevidorsalis (Miers, 1881). Journal of Crustacean Biology , 11 : 49 50 702 386 400. 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 29 of 109 European Journal of Phycology
1 2 3 4 5 29 6 7 703 Choi, H. G., Kim, M. S., Guiry, M. D. & Saunders, G. W. (2001). Phylogenetic relationships of 8 9 704 Polysiphonia (Rhodomelaceae, Rhodophyta) and its relatives based on anatomical and 10 11 705 nuclear small subunit rDNA sequence data. Canadian Journal of Botany , 79 : 1465 1476. 12 706 Coomans, R. J. & Hommersand, M. H. (1990). Vegetative growth and organization. In Biology of 13 14 707 the red algae (Cole,For K.M. & Sheath,Peer R.G., editors), Review 275–304. Cambridge University Only Press, 15 16 708 Cambridge. 17 18 709 Delivopoulos, S. (2002). Ultrastructure of trichoblasts in the red alga Osmundea spectabilis var. 19 20 710 spectabilis (Rhodomelaceae, Ceramiales). European Journal of Phycology , 37 : 329 338. 21 22 711 Dawes, C.J. & Mathieson, A.C. (2008). The Seaweeds of Florida . University Press of Florida, 23 24 712 Gainesville, Florida. 25 26 713 Dawson, E. Y. (1944). The marine algae of the gulf of California. The University of Southern 27 714 California Publications , 3: 189 359. 28 29 715 Díaz Tapia, P. & Bárbara, I. (2013). Seaweeds from sand covered rocks of the Atlantic Iberian 30 31 716 Peninsula. Part 1. The Rhodomelaceae (Ceramiales, Rhodophyta). Cryptogamie, Algologie , 32 33 717 34 : 325 422. 34 35 718 Díaz Tapia, P., Kim, M.S., Secilla, A., Bárbara, I. & Cremades, J. (2013a). Taxonomic 36 37 719 reassessment of Polysiphonia foetidissima (Rhodomelaceae, Rhodophyta) and similar 38 39 720 species, including P. schneideri , a newly introduced species in Europe. European Journal 40 721 of Phycology , 48 : 345 362. 41 42 722 Díaz Tapia, P., Bárbara, I., Berecibar, E. (2013b). Vegetative and reproductive morphology 43 44 723 of Polysiphonia tripinnata (Rhodmelaceae, Rhodophyta): a new record from the European 45 46 724 Atlantic coast. Botanica Marina, 56 : 151 160. 47 48 725 Díaz Tapia, P., Maggs, C.A., West, J.A. & Verbruggen, H. 2015. Tackling rapid radiations with 49 50 726 chloroplast phylogenomics in the Rhodomelaceae. European Journal of Phycology , 50 : 54 51 52 727 55. 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 30 of 109
1 2 3 4 5 30 6 7 728 Doyle, J. J. & Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh 8 9 729 leaf tissue. Phytochemical Bulletin , 1: 11–5. 10 11 730 Drummond, A.J., Ho, S.Y.W., Phillips, M.J. & Rambaut, A. (2006). Relaxed phylogenetics and 12 731 dating with confidence. PLoS Biology , 4: e88. 13 14 732 Falkenberg, P. (1901).For Die Rhodomelaceen Peer des Golfes vonReview Neapel und der angrenzenden Only Meeres- 15 16 733 Abschnitte. Fauna und Flora des Golfes von Neapel, Monographie 26. Berlin. 17 18 734 Freshwater, D. W. & Rueness, J. (1994). Phylogenetic relationships of some European Gelidium 19 20 735 (Gelidiales, Rhodophyta) species, based on rbc L nucleotide sequence analysis. Phycologia , 21 22 736 33 : 187 194. 23 24 737 Garbary, D.J. & Clarke, B. (2001). Apoptosis in trichoblast development in Polysiphonia harveyi 25 26 738 (Rhododpyta). Phycologia , 40 : 324 329. 27 739 Goff, L. J. & Coleman, A. W. (1986). A novel pattern of apical cell polyploidy, sequential 28 29 740 polyploidy reduction and intercellular nuclear transfer in the red alga Polysiphonia . 30 31 741 American Journal of Botany , 73 : 1109 1130. 32 33 742 Goff, L. J. & Moon, D. A. (1993). PCR amplification of nuclear and plastid genes from algal 34 35 743 herbarium specimens and algal spores. Journal of Phycology , 29 : 381–384. 36 37 744 Goodenough, S. & Woodward, T.J. (1797). Observations on the British Fuci, with particular 38 39 745 descriptions of each species. Transactions of the Linnean Society of London , 3: 84 235. 40 746 Gray, S. F. (1821). A Natural Arrangement of British Plants..... Baldwin, Cradock & Joy, 41 42 747 Paternoster Row, London. 43 44 748 Greville, R.K. (1824). Flora Edinensis... William Blackwood, Edinburgh, & T. Cadell, London. 45 46 749 Grunow, A. (1874). Algen der Fidschi , Tonga und Samoa Inseln, gesammelt von Dr. E. Graeffe. 47 48 750 Journal des Museum Godeffroy , 3: 23 50. 49 50 751 Guimarâes, S. M. P. D. B., Fujii, M. T., Pupo, D. & Yokoya, N. S. (2004). Reavaliaçao das 51 52 752 características morfológicas e suas implicaçoes taxonômicas no gênero Polysiphonia sensu 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 31 of 109 European Journal of Phycology
1 2 3 4 5 31 6 7 753 lato (Ceramiales, Rhodophyta) do litoral dos estados de Sao Paulo e Espírito Santo, Brasil. 8 9 754 Revista Brasileira de Botânica , 27 : 163 183. 10 11 755 Guiry, M.D. & Guiry, G.M. (2016). AlgaeBase. World wide electronic publication, National 12 756 University of Ireland, Galway. http://www.algaebase.org; searched on 07 February 2016. 13 14 757 Hariot, P. (1891). ListeFor des algues marinesPeer rapportés de ReviewYokoska (Japon) par M. le DrOnly Savatier. 15 16 758 Mémoires de la Société nationale des sciences naturelles de Cherbourg , 27 : 211 230. 17 18 759 Harvey, W.H. (1847). Nereis Australis, or Algae of The Southern Ocean ... [Part 1] . Reeve 19 20 760 Brothers, London. 21 22 761 Harvey, W.H. (1853). Nereis boreali americana; or, contributions towards a history of the marine 23 24 762 algae of the Atlantic and Pacific coasts of North America. Part II. Rhodospermeae. 25 26 763 Smithsonian Contributions to Knowledge , 5: [i ii], [1] 258, pls XIII XXXVI. 27 764 Harvey, W.H. (1855). Algae. In: The botany of the Antarctic voyage of H.M. discovery ships 28 29 765 Erebus and Terror, in the years 1839-1843, under the command of Captain Sir James 30 31 766 Clark Ross.... II. Flora Novae-Zelandiae. Part II. Flowerless plants (Hooker, J.D., editor), 32 33 767 pp. 211 266. Reeve, London. 34 35 768 Harvey, W.H. (1857 '1856'). Algae. In: Account of the Botanical specimens. (Gray, A., editor) 36 37 769 Narrative of the expedition of an American squadron to the China Seas and Japan, 38 39 770 performed in the years 1852, 1853 and 1854, under the command of Commodore M.C. 40 771 Perry, United States Navy. Volume II - with illustrations. (Anon, editors), pp. 331 332. 41 42 772 Senate of the Thirty third Congress, Second Session, Executive Document. House of 43 44 773 Representatives, Washington. 45 46 774 Harvey, W.H. (1859). Phycologia Australica... Vol. 2 . Lovell Reeve & Co, London. 47 48 775 Harvey, W.H. (1860). Characters of new algae, chiefly from Japan and adjacent regions, collected 49 50 776 by Charles Wright in the North Pacific Exploring Expedition under Captain James 51 52 777 Rodgers. Proceedings of the American Academy of Arts and Sciences , 4: 327 335. 53 54 778 Harvey, W.H. (1862). Phycologia australica...Vol. 4 . Lovell Reeve & Co, London. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 32 of 109
1 2 3 4 5 32 6 7 779 Hollenberg, G.J. (1942). An account of the species of Polysiphonia on the Pacific coast of North 8 9 780 America. I. Oligosiphonia. American Journal of Botany, 29 : 772 785. 10 11 781 Hollenberg, G.J. (1944). An account of the species of Polysiphonia on the Pacific coast of North 12 782 America. II. Polysiphonia . American Journal of Botany , 31 : 474 483. 13 14 783 Hollenberg, G. J. (1961).For Marine red Peeralgae of Pacific Mexico, Review Part 5: The genus Polysiphonia Only. 15 16 784 Pacific Naturalist , 2: 345 375. 17 18 785 Hollenberg, G.J. (1968a). An account of the species of Polysiphonia of the central and western 19 20 786 tropical Pacific ocean. II Oligosiphonia . Pacific Science , 22 : 56 98. 21 22 787 Hollenberg, G.J. (1968b). An account of the species of Polysiphonia of the central and western 23 24 788 tropical Pacific ocean. I. Polysiphonia . Pacific Science , 22 : 198 207. 25 26 789 Hollenberg, G. J. (1968c). An account of the species of the red alga Herposiphonia occurring in 27 790 the Central and Western tropical Pacific Ocean. Pacific Science , 22 : 536 559. 28 29 791 Hollenberg, G. J. & Norris, J. N. (1977). The red alga Polysiphonia (Rhodomelaceae) in the 30 31 792 Northern Gulf of California. Smithsonian Contributions to the Marine Sciences , 1: 1 21. 32 33 793 Hommersand, M. H. (1963). The morphology and classification of some Ceramiaceae and 34 35 794 Rhodomelaceae. University of California Publications in Botany , 35 : 165 366. 36 37 795 Hommersand M.H. (2007). Global biogeography and relationships of the Australian marine 38 39 796 macroalgae. In Algae of Australia (McCarthy, P.M. & Orchard, A.E., editors), 511 542. 40 797 Australian Biological Resources Study, Canberra. 41 42 798 Hommersand, M.H. & Fredericq, S. (1990). Sexual reproduction and cystocarp development. In: 43 44 799 Biology of the red algae . (Cole, K.M. & Sheath, R.G., editors), 305 346. Cambridge 45 46 800 University Press, Cambridge. 47 48 801 Hooker, W. & Harvey, W. H. (1845). Algae Novae Zelandiae... London Journal of Botany , 4: 521 49 50 802 551. 51 52 803 Hudson, W. (1762). Flora anglica; exhibens plantas per regnum angliae sponte crescentes, 53 54 804 distributas secundum systema sexuale: cum differentiis specierum, synonymis auctorum, 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 33 of 109 European Journal of Phycology
1 2 3 4 5 33 6 7 805 nominibus incolarum, solo locorum, tempore florendi, offìcinalibus pharmacopoeorum . J. 8 9 806 Nourse & C. Moran, London. 10 11 807 Hurd, C.L., Harrison, P.J., Bischof, K. & Lobban, C.S. (2014). Seaweed Ecology and Physiology . 12 808 Second Edition . Cambridge University Press, Cambridge. 13 14 809 Iyengar, M.O.P. & Balakrishnan,For M.S. Peer (1950). Morpho logyReview and cytology of Polysiphonia Only 15 16 810 platycarpa Boerges. Proceedings of the Indian Academy of Science B , 31 : 135 161. 17 18 811 Karsten, U., Sawall, T., Hanelt, D., Bischof, K., Figueroa, F. L., Flores Moya, A. & Wiencke, C. 19 20 812 (1998). An inventory of UV absorbing mycosporine like amino acids in macroalgae from 21 22 813 polar to warm temperate regions. Botanica Marina , 41 : 443 454. 23 24 814 Kearse, M., Moir, R., Wilson, A., Stones Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, 25 26 815 A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P. & Drummond, A. 27 816 (2012). Geneious Basic: an integrated and extendable desktop software platform for the 28 29 817 organization and analysis of sequence data. Bioinformatics , 28 :1647 1649. 30 31 818 Kim, M. S. (2003). Taxonomic reassessment of the genus Polysiphonia (Rhodomelaceae, 32 33 819 Rhodophyta): morphology and reproduction of Neosiphonia decumbens and N. harlandii . 34 35 820 Algae , 18 : 107 119. 36 37 821 Kim, M. S. (2005). Taxonomy of a poorly documented alga, Neosiphonia savatieri 38 39 822 Rhodomelaceae, Rhodophyta) from Korea. Nova Hedwigia , 81 : 163 176. 40 823 Kim, M.S. & Lee, I.K. (1999). Neosiphonia flavimarina gen. et sp. nov. with a taxonomic 41 42 824 reassessment of the genus Polysiphonia (Rhodomelaceae, Rhodophyta). Phycological 43 44 825 Research , 47 : 271 281. 45 46 826 Kim, M. S. & Abbott, I. A. (2006). Taxonomic notes on Hawaiian Polysiphonia , with transfer to 47 48 827 Neosiphonia (Rhodomelaceae, Rhodophyta). Phycological Research , 54 : 32 39. 49 50 828 Kim, M. S. & Yang, E. C. (2006). Taxonomy and phylogeny of Neosiphonia japonica 51 52 829 (Rhodomelaceae, Rhodophyta) based on rbc L and cpe A/B gene sequences. Algae , 21 : 287 53 54 830 294. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 34 of 109
1 2 3 4 5 34 6 7 831 Kim, B. & Kim, M.S. (2014). Three new species of Polysiphonia sensu lato (Rhodophyta) based 8 9 832 on the morphology and molecular evidence. Algae , 29 : 183 195. 10 11 833 Kim, B. & Kim, M.S. (2016). Neosiphonia yongpilii sp. nov. (Rhodomelaceae, Rhodophyta), 12 834 known as Neosiponia simplex from Korea, with an emphasis on cystocarp development. 13 14 835 Phycologia , 55 : 323 332.For Peer Review Only 15 16 836 Kim, M. S., Lee, I. K. & Boo, S. M. (1994). Morphological studies of the red alga Polysiphonia 17 18 837 morrowii Harvey on the Korean coast. The Korean Journal of Phycology , 9: 185 192. 19 20 838 Kim, M. S., Maggs, C.A., McIvor, L. & Guiry, M.D. (2000). Reappraisal of the type species of 21 22 839 Polysiphonia (Rhodomelaceae, Rhodophyta). European Journal of Phycology, 35 : 83 92. 23 24 840 Kirby, R.R. & Reid, P.C. (2001). PCR from the CPR offers a historical perspective on marine 25 26 841 population ecology. Journal of the Marine Biological Association of the United Kingdom , 81 : 27 842 539–540. 28 29 843 Kraft, G. T. & Abbott, I. A. (2002). The anatomy of Neotenophycus ichthyosteus gen. et sp. nov. 30 31 844 (Rhodomelaceae, Ceramiales), a bizarre red algal parasite from the central Pacific. 32 33 845 European Journal of Phycology , 37 : 269 278. 34 35 846 Kuntze, O. (1891). Revisio generum plantarum. Pars II . Arthur Felix, Dulau & Co., U. Hoepli, 36 37 847 Gust. A. Schechert, Charles Klincksieck, Leipzig, London, Milano, New York, Paris. 38 39 848 Kützing, F.T. (1863). Tabulae phycologicae; oder, Abbildungen der Tange. Vol. XIII . Gedruckt 40 849 auf kosten des Verfassers (in commission bei W. Köhne), Nordhausen. 41 42 850 Kützing, F.T. (1864). Tabulae phycologicae; oder, Abbildungen der Tange. Vol. XIV . Gedruckt auf 43 44 851 kosten des Verfassers (in commission bei W. Köhne), Nordhausen. 45 46 852 Kylin, H. (1941). Californische Rhodophyceen. Acta Universitatis Lundensis , 37 (2):1 71. 47 48 853 Kylin, H. (1956). Die Gattungen der Rhodophyceen. CWK Gleerups Förlag, Lund. 49 50 854 Lam, W. D., García Fernández, M. E., Aaboal, M., Vis, M. L. (2013). Polysiphonia subtilissima 51 52 855 (Ceramiales, Rhodophyta) from freshwater habitats in North America and Europe is confirmed 53 54 856 as conspecific with marine collections. Phycologia , 52 : 156 160. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 35 of 109 European Journal of Phycology
1 2 3 4 5 35 6 7 857 Lartillot, N., Lepage, T. & Blanquart, S. (2009). PhyloBayes 3: a Bayesian software package for 8 9 858 phylogenetic reconstruction and molecular dating. Bioinformatics , 25 : 2286 2288. 10 11 859 Lee, Y. (2008). Marine Algae of Jeju . Academy Publication, Seoul. 12 860 Levring, T. (1941). Die Meeresalgen der Juan Fernandez Inseln. Die Corallinaceen der Juan 13 14 861 Fernandez Inseln.For In The Natural Peer History of Juan FernandezReview and Easter Island (Skottsberg,Only 15 16 862 C., editor) Vol. 2, 601 670; 753 757. Almqvist & Wiksells Boktryckeri, Uppsala. 17 18 863 Lüning, K. (1990). Seaweeds: their Environment, Biogeography and Ecophysiology. Wiley 19 20 864 Interscience publications, New York. 21 22 865 Maggs, C.A. & Hommersand, M.H. (1993). Seaweeds of the British Isles. Volume 1 Rhodophyta, 23 24 866 Part 3A Ceramiales . Natural History Museum/HMSO, London. 25 26 867 Mamoozadeh, N.R. & Freshwater, D.W. (2011). Taxonomic notes on Caribbean Neosiphonia and 27 868 Polysiphonia (Ceramiales, Florideophyceae): five species from Florida, USA and Mexico. 28 29 869 Botanica Marina, 54 : 269 292. 30 31 870 Mamoozadeh, N.R. & Freshwater, D.W. (2012). Polysiphonia sensu lato (Ceramiales, 32 33 871 Florideophyceae) species of Caribbean Panama including Polysiphonia lobophoralis sp. nov. 34 35 872 and Polysiphonia nuda sp. nov. Botanica Marina , 55 : 317–347. 36 37 873 Masuda, M., Kudo, T., Kawaguchi, S. & Guiry, M. D. (1995). Lectotypification of some marine 38 39 874 red algae described by W. H. Harvey from Japan. Phycological Research , 43 : 191 202. 40 875 Masuda, M., Abe, T., Kawaguchi, S. & Phang, S. M. (2001). Taxonomic notes on marine algae 41 42 876 from Malaysia. VI. Five species of Ceramiales (Rhodophyceae). Botanica Marina , 44 : 43 44 877 467 478. 45 46 878 McIvor, L., Maggs, C.A., Provan, J. & Stanhope, M.J. (2001). rbc L sequences reveal multiple 47 48 879 cryptic introductions of the Japanese red alga Polysiphonia harveyi. Molecular Ecology, 10 : 49 50 880 911 919. 51 52 881 Millar, A. J. K. (1990). Marine red algae of the Coffs Harbour region, northern New South Wales. 53 54 882 Australian Systematic Botany , 3: 293 593. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 36 of 109
1 2 3 4 5 36 6 7 883 Morrill, J.F. (1976). Comparative morphology and taxonomy of some dorsiventral and some 8 9 884 parasitic Rhodomelaceae. Thesis, University of North Carolina, Chapel Hill. 10 11 885 Muangmai, N., Yamagishi, Y., Maneekat, S & Kaewsuralikhit, C. (2014). The new species 12 886 Neosiphonia thailandica sp. nov. (Rhodomelaceae, Rhodophyta) from the Gulf of Thailand. 13 14 887 Botanica Marina , 57For: 459 467. Peer Review Only 15 16 888 Nägeli, C. (1846). Über Polysiphonia und Herposiphonia . Zeitschrift für wissenschaftliche 17 18 889 Botanik 4: 207 256. 19 20 890 Nam, K.W. & Kang, P.J. (2012). Algal flora of Korea. Volume 4, Number 4. Rhodophyta: 21 22 891 Ceramiales: Rhodomelaceae: 18 genera including Herposiphonia . National Institute of 23 24 892 Biological Resources, Incheon. 25 26 893 Nam, K. W., Maggs, C. A., McIvor, L. & Stanhope, M. J. (2000). Taxonomy and phylogeny of 27 894 Osmundea (Rhodomelaceae, Rhodophyta) in Atlantic Europe. Journal of Phycology , 36 : 28 29 895 759 772. 30 31 896 Navarro, N.P., Mansilla, A., Figueroa, F., Korbee, N., Jofre, J. & Plastino, E. (2014). Short term 32 33 897 effects of solar UV radiation and NO 3 supply on the accumulation of mycosporine like 34 35 898 amino acids in Pyropia columbina (Bangiales, Rhodophyta) under spring ozone depletion 36 37 899 in the sub Antarctic region, Chile. Botanica Marina , 57 : 9 20. 38 39 900 Noda, M. & Kitami, T. (1971). Some species of marine algae from Echigo Province facing the 40 901 Japan Sea. Scientific Reports Niigata University, Ser. D. (Biology) , 8: 35 52. 41 42 902 Norris, R. E. (1994). Some cumophytic Rhodomelaceae (Rhodophyta) occuring in Hawaiian surf. 43 44 903 Phycologia , 33 : 434 443. 45 46 904 Norris, J.N. (2014). Marine algae of the northern Gulf of California, II: Rhodophyta . Smithsonian 47 48 905 Institution Scholarly Press, Washington D.C. 49 50 906 Okamura, K. (1912). Icones of Japanese Algae . Vol. II (10), pls. 96-100. Privately published, 51 52 907 Tokyo. 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 37 of 109 European Journal of Phycology
1 2 3 4 5 37 6 7 908 Parsons, M.J. (1975). Morphology and taxonomy of the Dasyaceae and the Lophothalieae 8 9 909 (Rhodomelaceae) of the Rhodophyta. Australian Journal of Botany , 23 : 549 713. 10 11 910 Parsons, M. J. (1980). The morphology and taxonomy of Brongniartella Bory sensu Kylin 12 911 (Rhodomelaceae, Rhodophyta). Phycologia , 19 : 273 295. 13 14 912 Phillips, L. E., Choi, H.For G., Saunders, Peer G. W. & Kraft, G.Review T. (2000). The morphology, Onlytaxonomy 15 16 913 and molecular phylogeny of Heterocladia and Trigenea (Rhodomelaceae, 17 18 914 Rhodophyta),with delineation of the little known tribe Heterocladieae. Journal of 19 20 915 Phycology , 36 : 199 219. 21 22 916 Price, I.R. & Scott, F.J. (1992). The turf algal flora of the Great Barrier Reef. Part I. Rhodophyta . 23 24 917 Townsville, Australia: Botany Department, James Cook University. 25 26 918 Provan, J., Booth, D., Todd, N.P., Beatty, G.E. & Maggs, C.A. (2008). Tracking biological 27 919 invasions in space and time: elucidating the invasive history of the green alga Codium 28 29 920 fragile using old DNA. Diversity and Distributions, 14 : 343 354. 30 31 921 Pueschel, C. M. (1990). Cell structure. In Biology of the red algae (Cole, K. M. & Sheath, R. G., 32 33 922 editors), 7 41 . Cambridge University Press, Cambridge. 34 35 923 Rambaut, A., Suchard, M.A., Xie, W., Drummond, A.J. (2013). Tracer MCMC Trace Analysis 36 37 924 Tool, Version v1.6.0. Available from: http://tree.bio.ed.ac.uk/software/tracer/ 38 39 925 Ribera, M. A. & Boudouresque, C. F. (1995). Introduced marine plants, with special reference to 40 926 macroalgae: mechanisms and impact. In Progress in Phycological Research (Round, F. E. 41 42 927 & Chapman, D. J., editors), 187 268 . Biopress Ltd. 43 44 928 Ronquist, F., Teslenko, M., Mark, P. van der, Ayres, D., Darling, A., Höhna, S., Larget, B., Liu, 45 46 929 L., Suchard, M.A. & Huelsenbeck, J.P. (2011). MrBayes 3.2: Efficient Bayesian 47 48 930 phylogenetic inference and model choice across a large model space. Systematic Biology , 49 50 931 61 : 539 542. 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 38 of 109
1 2 3 4 5 38 6 7 932 Savoie, A.M. & Saunders, G.W. (2015). Evidence for the introduction of the Asian red alga 8 9 933 Neosiphonia japonica and its introgression with Neosiphonia harveyi (Ceramiales, 10 11 934 Rhodophyta) in the Northwest Atlantic. Molecular Ecology , 24 : 5917 5937. 12 935 Savoie, A.M. & Saunders, G.W. (2016). A molecular phylogenetic and DNA barcode assessment 13 14 936 of the tribe PterosiphonieaeFor (Ceramiales,Peer Rhodophyt Reviewa) emphasizing the Northeast Only Pacific. 15 16 937 Botany , 94 : 917–939. 17 18 938 Saunders, G.W. & McDevit, D.C. (2012). Methods for DNA barcoding photosynthetic protists 19 20 939 emphasizing the macroalgae and diatoms. Methods in Molecular Biology , 858 : 207 222. 21 22 940 Saunders, G.W. & Moore, T.E. (2013). Refinements for the amplification and sequencing of red 23 24 941 algal DNA barcode and RedToL phylogenetic markers: a summary of current primers, 25 26 942 profiles and strategies. Algae , 28 : 31 43. 27 943 Schmitz, F. & Falkenberg, P. (1897). Rhodomelaceae. In Die natürlichen Pflanzenfamilien nebst 28 29 944 ihren Gattungen und wichtigeren Arten insbesondere den Nutzpflanzen unter Mitwirkung 30 31 945 zahlreicher hervorragender Fachgelehrten, Teil 1, Abteilung 2. (Engler, A. & Prantl, K. 32 33 946 editors), 421 480. Verlag von Wilhelm Engelmann, Leipzig. 34 35 947 Segi, T. (1949). On the systematic position of the so called Polysiphonia hakodatensis Yendo from 36 37 948 Japan. Siebutsu , 14 : 134 139. 38 39 949 Segi, T. (1951). Systematic study of the genus Polysiphonia from Japan and its vicinity. Journal 40 950 of the Faculty of Fisheries, Prefectual University of Mie , 1: 169 272. 41 42 951 Setchell, W.A. (1926). Tahitian algae collected by W.A. Setchell, C.B. Setchell and H.E. Parks. 43 44 952 University of California Publications in Botany , 12 : 61 142. 45 46 953 Setchell, W. A. & Gardner, N. L. (1924). XXIX Expedition of the California Academy of Sciences 47 48 954 to the Gulf of California in 1921. The Marine Algae. Proceeding of the California 49 50 955 Academy of Science , 4: 695 949. 51 52 956 Setchell, W. A. & Gardner, N. L. (1930). Marine algae of the Revillagigedo Islands expedition in 53 54 957 1925. Proceedings of the California Academy of Sciences , 4: 109 215. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 39 of 109 European Journal of Phycology
1 2 3 4 5 39 6 7 958 Shameel, M. (1999). Melanothamnus afaqhusainii , a new red alga from the coast of Karachi. 8 9 959 Pakistan Journal of Botany , 31 : 211 214. 10 11 960 Shameel, M. (2000). Further investigations on the red algae Melanothamnus afaqhusainii 12 961 (Ceramiales) from the coast of Pakistan. Pakistan Journal of Botany , 32 : 15 26. 13 14 962 Shavit, L., Penny, D., ForHendy, M.D. &Peer Holland, B.R. (2007). Review The problem of rooting rapidOnly 15 16 963 radiations. Molecular Biology and Evolution, 24 : 2400–2411. 17 18 964 Sherwood, A.R., Kurihara, A., Conklin, K.Y., Sauvage, T., & Presting, G.G. (2010). The Hawaiian 19 20 965 Rhodophyta biodiversity survey (2006 2010): a summary of principal findings. BMC Plant 21 22 966 Biology , 10 : 258. 23 24 967 Silva, P. C., Basson, P. W. & Moe, R. L. (1996). Catalogue of the benthic marine algae of the 25 26 968 Indian Ocean. University of California Publications in Botany , 79 : 1 1259. 27 969 Stamatakis, A. (2014). RAxML Version 8: A tool for phylogenetic analysis and post analysis of 28 29 970 large phylogenies. Bioinformatics , 30 : 1312–1313. 30 31 971 Stegenga, H., Bolton, J.J. & Anderson, R.J. (1997). Seaweeds of the South African west coast . 32 33 972 Bolus Herbarium, University of Cape Town, Cape Town. 34 35 973 Stuercke, B. & Freshwater, D.W. (2008). Consistency of morphological characters used to delimit 36 37 974 Polysiphonia sensu lato species (Ceramiales, Florideophyceae): analyses of North Carolina, 38 39 975 USA specimens. Phycologia, 47 : 541–559. 40 976 Stuerke, B. & Freshwater, D.W. (2010). Two new species of Polysiphonia (Ceramiales, 41 42 977 Florideophyceae) from the western Atlantic. Botanica Marina , 53 : 301 311. 43 44 978 Suhr, J.N. von (1831). Beschreibung einiger neuen Algen. Flora , 14 : 673 687, 709 716, 725 731. 45 46 979 Thiers, B. [continuously updated]. Index Herbariorum: A global directory of public herbaria and 47 48 980 associated staff . New York Botanical Garden's Virtual Herbarium. 49 50 981 http://sweetgum.nybg.org/science/ih/ . 51 52 982 Thorne, J.L. & Kishino, H. (2002). Divergence time and evolutionary rate estimation with 53 54 983 multilocus data. Systematic Biology , 51: 689 702. 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 40 of 109
1 2 3 4 5 40 6 7 984 Uwai, S. & Masuda, M. (1999). Kintarosiphonia (Rhodomelaceae, Ceramiales), a new red algal 8 9 985 genus based on Pterosiphonia fibrillosa Okamura from Japan. Phycologia , 38 : 225 233. 10 11 986 Womersley, H. B. S. (1979). Southern Australian species of Polysiphonia Greville (Rhodophyta). 12 987 Australian Journal of Botany , 27 : 459 528. 13 14 988 Womersley, H. B. S. (2003).For The Marine Peer Benthic Flora Reviewof Southern Australia. Rhodophyta. Only Part 15 16 989 IIID. Ceramiales- Delesseriaceae, Sarcomeniaceae, Rhodomelaceae . Australian Biological 17 18 990 Resources Study & State Herbarium of South Australia, Canberra & Adelaide. 19 20 991 Wulfen, F.X. (1789). Plantae rariores carinthiacae. In Collectanea ad botanicam, chemiam, et 21 22 992 historiam naturalem, spectantia cum figuris (Jacquin, J.N., editor). Ex Officina Wappleriana, 23 24 993 Vienna. 25 26 994 Wynne, M. J. & Banaimoon, S. A. (1990). The occurrence of Jolyna laminarioides (Phaeophyta) 27 995 in the Arabian Sea and the Indian Ocean and a new report of Melanothamnus somalensis 28 29 996 (Rhodophyta). Botanica Marina , 33 : 213 218. 30 31 997 Yang, E.U., Boo, S.M., Bhattacharya, D., Saunders, G.W., Knoll, A.H., Fredericq, S., Graf, L. & 32 33 998 Yoon, S.H. (2016). Divergence time estimates and the evolution of major lineages in the 34 35 999 florideophyte red algae. Scientific Reports , 6: 21361. 36 37 1000 Yoon, H.Y. (1986). A taxonomic study of genus Polysiphonia (Rhodophyta) from Korea. Korean 38 39 1001 Journal of Phycology , 1: 3 86. 40 1002 Yoshida, T. (1998). Marine algae of Japan . Uchida Rokakuho Publishing Co., Tokyo. 41 42 1003 Zuccarello, G.C., West, J.A., Kamiya, M. & King, R.J. (1999). A rapid method to score plastid 43 44 1004 haplotypes in red seaweeds and its use in determining parental inheritance of plastids in the 45 46 1005 red alga Bostrychia (Ceramiales). Hydrobiologia , 401 : 207–214. 47 48 1006 49 50 1007 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 41 of 109 European Journal of Phycology
1 2 3 4 5 41 6
7 8 Table 1. Comparison of selected morphological characteristics among the Polysiphonia sensu stricto 1 and 2, Vertebrata , Carradoriella , 9 10 Streblocladia, Polysiphonia schneideriFor and Melanothamnus Peer clades. Review Only 11 12 Feature Polysiphonia sensu Vertebrata Carradoriella Streblocladia clade “Polysiphonia ” Melanothamnus 13 14 stricto 1 and 2 clade schneideri clade 15 16 Thallus habit Erect; decumbent; Erect; decumbent; Erect Erect Erect; decumbent Erect; decumbent 17 prostrate prostrate 18 19 Rhizoid connection Open Cut off Cut off Cut off Cut off Cut off 20 21 Pericentral cells 4 (6 8 in 6 24 5 16 4 12 4 7 4 9 22 23 Bryocladia 24 25 cuspidata , clade 2) 26 27 Cortication Absent Absent / Present Present Present Absent Absent / Present 28 29 Plastid arrangement Scattered Scattered Scattered Scattered Scattered Radial walls 30 31 Branch/trichoblast With naked On every segment On every segment With naked With naked On every segment 32 33 arrangement segments or with naked or with naked segments segments or with naked 34 35 segments segments segments 36 Branches in No Yes / No Yes / No No Yes / No No 37 38 trichoblast axils 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 42 of 109
1 2 3 4 5 42 6
7 8 Trichoblast cell Uninucleate; Multinucleate; Uninucleate; Trichoblasts absent Uninucleate; Uninucleate; 9 10 nuclei and PigmentationFor Pigmentation Peer Pigmentation Review PigmentationOnly Pigmentation 11 12 pigmentation absent absent (Present) absent absent absent 13 14 Branching pattern Spiral, Spiral, Pseudodichotomous Dorsiventral, spiral, Spiral, Dorsiventral, spiral, 15 pseudodichotomous pseudodichotomous, pseudodichotomous pseudodichotomous pseudodichotomous 16 17 dorsiventral 18 19 Spermatangial Replacing On a branch of On a branch of Replacing On a branch of On a branch of 20 21 branches trichoblasts (or on a trichoblasts trichoblasts, with trichoblasts, trichoblasts, trichoblasts, 22 23 trichoblast branch (replacing them in sterile apical cells without sterile with/without sterile with/without sterile 24 25 in P. devoniensis V. lanosa ), apical cells apical cells apical cells 26 and P. kapraunii), with/without sterile 27 28 with or without apical cells 29 30 sterile apical cells 31 32 Carpogonial branch 4 celled 4 celled 4 celled Unknown 4 celled 3 celled 33 34 Cystocarp Globular; ovoid; Globular; ovoid Ovoid Ovoid Globular Globular; ovoid 35 36 morphology urceolate 37 38 Cells of the ostiole Similar to the cells Similar to the cells Similar to the cells Larger than cells Similar to the cells (Similar to) Larger 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 43 of 109 European Journal of Phycology
1 2 3 4 5 43 6
7 8 below below below below below than cells below 9 10 Tetrasporangial rows Straight (slightlyFor Straight Peer or spiral Straight Reviewor spiral Straight or spiral StraightOnly or spiral (Straight) Spiral 11 12 spiral) (two per segment in 13 14 Ctenosiphonia ) 15 16 References This work, 5, 6, 9, This work, 1, 2, 3, This work, 16, 21. This work, 2, 3. This work, 7, 13, This work, 2, 3, 4, 17 18 15, 16, 18, 22. 6, 7, 8; 16, 18, 20, 18, 22. 6, 9, 10, 11, 12, 14, 19 21, 24. 16, 17, 18, 19, 20, 20 21 21, 22, 23, 24, 25. 22 23 24 25 References: 1Abbott & Hollenberg (1976); 2Adams (1991); 3Adams (1994); 4Bustamante et al. (2013 b); 5Dawes & Mathieson (2008); 6Díaz 26 27 Tapia & Bárbara (2013); 7Díaz Tapia et al. (2013 a); 8Díaz Tapia et al. (2013 b); 9Hollenberg (1942); 10Hollenberg (1968 a); 11Hollenberg & 28 29 Norris (1977); 12 Kim & Lee (1999); 13 Kim & Kim (2014); 14Kim & Kim (2016); 15 Kim et al. (1994); 16 Maggs & Hommersand (1993); 30 17 18 19 20 21 31 Mamoozadeh & Freshwater (2011); Mamoozadeh & Freshwater (2012); Muangmai et al. (2014); Segi (1949); Stegenga et al. (1997);
32 22 23 24 25 33 Stuercke & Freshwater (2010); Uwai & Masuda (1999); Womersley (2003); Yoon (1986). 34
35 36 37 38 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 44 of 109
1 2 3 4 5 44 6
7 8 Table 2. Genus Vertebrata with new combinations resulting from the present study 9 10 For Peer Review Only 11 12 13 14 Binomial in Vertebrata Type material 15 16 Basionym Type locality 17 Synonyms 18 19 Vertebrata constricta (Womersley) Díaz Tapia & Maggs, comb. nov. Holotype: AD A32927 20 21 Polysiphonia constricta Womersley (1979, 497 498; Southern Australian species of Polysiphonia Greville Kangaroo I., South Australia; 22 23 (Rhodophyta). Australian Journal of Botany , 27 : 459 528) 21.xi.1968 24 25 Vertebrata foetidissima (Cocks ex Bornet) Díaz Tapia & Maggs, comb. nov. Lectotype (Maggs & Hommersand, 26 27 Polysiphonia foetidissima Cocks ex Bornet (1892, pp. 314 315; Les algues de P. K. A. Schousboe….. 1993): PC 0146017 28 29 Mémoires de la Société Nationale des Sciences naturelles et Mathématiques de Cherbourg , 28 : 165 Plymouth, England; undated 30 31 376.) 32 33 Vertebrata isogona (Harvey) Díaz Tapia & Maggs, comb. nov. Lectotype (Womersley, 1979): BM 34 Polysiphonia isogona Harvey (in Hooker 1855, p. 231; The botany of the Antarctic voyage…. Reeve, 1082304 35 36 London.) Blind Bay, Cook´s Straits, New 37 38 Zealand; viii.1849 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 45 of 109 European Journal of Phycology
1 2 3 4 5 45 6
7 8 Vertebrata lobophoralis (N.R.Mamoozadeh & D.W.Freshwater) D.W.Freshwater Holotype: US 217938 9 10 Polysiphonia lobophoralis N.R.MamoozadehFor & D.W.Freshwater Peer (2012, pp. Review331 333; Polysiphonia sensu Bocas Only del Toro, Panama; 11 12 lato (Ceramiales, Florideophyceae) species of Caribbean Panama including Polysiphonia lobophoralis 6.viii.2010 13 14 sp. nov. and Polysiphonia nuda sp. nov. Botanica Marina , 55 : 317–347.) 15 16 Vertebrata nigra (Hudson) Díaz Tapia & Maggs, comb. nov. Neotype (Maggs & Hommersand, 17 Conferva nigra Hudson (1762, p. 481; Flora anglica... . Prostant venales apud J. Nourse in the Strand & C. 1993): BM 1067621 18 19 Moran in Covent Garden, London.) Marsden, Durham, England; 20 21 Polysiphonia nigra (Hudson) Batters 12.vi.1971 22 23 Vertebrata reptabunda (Suhr) Díaz Tapia & Maggs, comb. nov. Holotype: L 955.62.97 24 25 Hutchinsia reptabunda Suhr (1831, p. 684; Beschreibung einiger neuen Algen. Flora 14: 673 687, 709 Biarritz, Pyrénées Atlantiques, 26 27 716, 725 731) France 28 29 Lophosiphonia reptabunda (Suhr) Kylin 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 46 of 109
1 2 3 4 5 46 6
7 8 Table 3. Genus Vertebrata with resurrected names resulting from the present study. 9 10 For Peer Review Only 11 12 Binomial in Vertebrata Type material 13 14 Basionym Type locality 15 16 Synonyms 17
18 19 Vertebrata aterrima (J.D.Hooker & Harvey) Kuntze Probable syntypes: TCD 12786 8, 20 21 Polysiphonia aterrima J.D.Hooker & Harvey BM 1067593 6 and BM 1067598 22 23 New Zealand 24 25 Vertebrata australis (C.Agardh) Kuntze Lectotype (Parsons, 1980): PC 26 27 Cladostephus australe C.Agardh Western Australia 28 29 Brongniartella australis (C.Agardh) F.Schmitz 30 31 Vertebrata byssoides (Goodenough & Woodward) Kuntze Lectotype (Maggs & Hommersand, 32 33 Fucus byssoides Goodenough & Woodward 1993): BM 34 Brongniartella byssoides (Goodenough & Woodward) F.Schmitz Christchurch, England; 1794 35 36 Vertebrata fruticulosa (Wulfen) Kuntze Lectotype (Maggs & Hommersand, 37 38 Fucus fruticulosus Wulfen 1993): Wulfen (1789), pl. 16, fig. 1 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 47 of 109 European Journal of Phycology
1 2 3 4 5 47 6
7 8 Boergeseniella fruticulosa (Wulfen) Kylin Trieste [Tergestum], Adriatic 9 10 Vertebrata fucoides (Hudson) KuntzeFor Peer ReviewNeotype Only (Maggs & Hommersand, 11 12 Conferva fucoides Hudson 1993): BM 807101 13 14 Polysiphonia fucoides (Hudson) Greville Unlocalized, undated 15 16 Vertebrata furcellata (C.Agardh) Kuntze Lectotype (Maggs & Hommersand, 17 18 Hutchinsia furcellata C.Agardh 1993): LD 40907 19 Polysiphonia furcellata (C.Agardh) Harvey Brittany, France; undated 20 21 Vertebrata hypnoides (Welwitsch) Kuntze Holotype: LD Agardh´s herbarium 22 23 Polysiphonia hypnoides Welwitsch ex J.Agardh no. 39346 24 25 Ctenosiphonia hypnoides (Welwitsch ex J.Agardh) Falkenberg Lisbon, Portugal 26 27 Vertebrata lanosa (Linnaeus) T.A.Christensen Holotype: LINN 1274.23 28 29 Fucus lanosus Linnaeus Iceland, undated 30 31 Polysiphonia lanosa (Linnaeus) Tandy 32 33 Vertebrata simulans (Harvey) Kuntze Lectotype (Maggs & Hommersand, 34 35 Polysiphonia simulans Harvey 1993): BM K 36 Devon, England; 20.v.1831 37 38 Vertebrata stimpsonii (Harvey) Kuntze Holotype: TCD 11956 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 48 of 109
1 2 3 4 5 48 6
7 8 Polysiphonia stimpsonii Harvey Hakodate Bay, Japan 9 10 Enelittosiphonia stimpsonii (Harvey)For Kudo & Masuda Peer Review Only 11 12 Vertebrata subulifera (C.Agardh) Kuntze Lectotype (Maggs & Hommersand, 13 14 Hutchinsia subulifera C.Agardh 1993): LD 41607 15 16 Polysiphonia subulifera (C.Agardh) Harvey Venice, Italy; undated 17 18 Vertebrata thuyoides (Harvey) Kuntze Lectotype (Maggs & Hommersand, 19 Polysiphonia thuyoides Harvey 1993): TCD 20 21 Boergeseniella thuyoides (Harvey) Kylin Milltown Malbay, Ireland; 1831 22 23 Vertebrata tripinnata (J.Agardh) O.Kuntze Lectotype (Díaz Tapia et al., 24 25 Polysiphonia tripinnata J.Agardh (1842, p. 142; Algae maris Mediterranei et Adriatici , observationes in 2013 b): LD J. Agardh´s Herbarium 26 27 diagnosin specierum et dispositionem generum. Apud Fortin, Masson et Cie, Paris.) 40938 28 29 [Kuntze transferred “Polysiphonia tripinnata Harvey” to Vertebrata , presumably a typographical error as Trieste, Italy 30 31 the basionym is P. tripinnata J.Agardh (1842)] 32 33 Vertebrata urbana (Harvey) Kuntze Probable Holotype: TCD 186 34 35 Polysiphonia urbana Harvey Table Bay, Cape Province, South 36 Africa 37 38 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 49 of 109 European Journal of Phycology
1 2 3 4 5 49 6
7 8 Note : The positions of Polysiphonia paniculata in the rbc L and 18S trees are not congruent. This suggests that these two sequences, generated 9 10 from samples from Chile and California,For respectively Peer (Table S1), were obtained Review from different species. The assignment Only of this species to the 11 12 genus Vertebrata therefore requires further study to clarify the identity of the two published sequences. The type locality is Peru. 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 50 of 109
1 2 3 4 5 50 6
7 8 Table 4. Genus Melanothamnus with new combinations resulting from the present study. 9 10 For Peer Review Only 11 12 13 14 New combination (if any) Type material Notes 15 16 Basionym Type locality, collection date 17 Synonyms 18 19 Melanothamnus somalensis Bornet & Falkenberg Probable syntypes: PC 584990 2 Figs 3 8 20 21 Somalia 22 23 Melanothamnus afaqhusainii M.Shameel Holotype: KUH SW SAH 127 24 25 Pakistan 26 27 Melanothamnus unilateralis (Levring) Díaz Tapia & Maggs, Holotype: GB Figs 9 18 28 29 comb. nov. Juan Fernández Islands, Chile 30 31 Fernandosiphonia unilateralis Levring (1941, pp. 660 662; Die 32 33 Meeresalgen der Juan Fernandez Inseln. Die Corallinaceen 34 der Juan Fernandez Inseln. In: The natural history of Juan 35 36 Fernandez and Easter Island (Skottsberg, C., editor) Vol. 2, 37 38 601 670; 753 757. Almqvist & Wiksells Boktryckeri, 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 51 of 109 European Journal of Phycology
1 2 3 4 5 51 6
7 8 Uppsala) 9 10 Melanothamnus apiculatus (Hollenberg)For Díaz Tapia Peer & Maggs, Holotype: Review US 48522 3 celled Only carpogonial branches (Kim & 11 12 comb. nov. O’ahu Island, Hawai’i; 30.vii.1959 Abbott, 2006); plastid character 13 14 Polysiphonia apiculata Hollenberg (1968a, p. 61; An account of (Hollenberg 1968 a; Fig. 9) 15 16 the species of Polysiphonia of the central and western tropical 17 Pacific ocean. II Oligosiphonia . Pacific Science , 22: 56 98) 18 19 Neosiphonia apiculata (Hollenberg) Masuda & Kogame 20 21 Melanothamnus bajacali (Hollenberg) Díaz Tapia & Maggs, Holotype: AHFH “Cell walls hyaline” (Hollenberg, 1961). Formatted: Font: 11 pt, Spanish (International 22 Sort) 23 comb. nov. Isla Guadalupe, Baja California, Molecular data available from Yucatan, 24 25 Polysiphonia bajacali Hollenberg (1961, pp. 347 348; Marine Mexico; 18.xii. 1949 Mexico (Mamoozadeh & Freshwater, 26 27 red algae of Pacific Mexico, Part 5: The genus Polysiphonia . 2011) 28 29 Pacific Naturalist , 2: 345 375) 30 31 Neosiphonia bajacali (Hollenberg) N.R.Mamoozadeh & D.W. 32 33 Freshwater 34 Melanothamnus balianus (D.E.Bustamante, B.Y.Won & Holotype: CUK 7937 Molecular data from the type locality 35 36 T.O.Cho) Díaz Tapia & Maggs, com. nov. Blue Lagoon beach, Padang Bai, (Bustamante et al ., 2013 b) 37 38 Neosiphonia baliana D.E.Bustamante, B.Y.Won & T.O.Cho Karangasem, Bali, Indonesia; 27.iv. 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 52 of 109
1 2 3 4 5 52 6
7 8 (2013 b, pp. 516 518; Neosiphonia baliana sp. nov. and N. 2012. 9 10 silvae sp. nov. (Rhodomelaceae,For Rhodophyta) fromPeer Review Only 11 12 Bali, Indonesia. Botanica Marina , 56 : 515 524) 13 14 Melanothamnus blandii (Harvey) Díaz Tapia & Maggs, comb. Lectotype (Womersley, 1979): TCD 3 celled carpogonial branches; plastid 15 16 nov. Brighton, Port Phillip, Victoria, character. Molecular data available from 17 Polysiphonia blandii Harvey (1862, pl. 184; Phycologia Australia the type locality (this work) 18 19 australica…. Vol. 4 . Lovell Reeve & Co, London) 20 21 Melanothamnus cheloniae (Hollenberg & J.N.Norris) Díaz Holotype: US 160602 Plastid character (Hollenberg & Norris, 22 23 Tapia & Maggs, comb. nov. Sonora, Gulf of California, Mexico; 1977; fig. 4B) 24 25 Polysiphonia sphaerocarpa var. cheloniae Hollenberg & 21.i.1974 26 27 J.N.Norris (1977, p. 16 17; The red alga Polysiphonia 28 29 (Rhodomelaceae) in the Northern Gulf of California. 30 31 Smithsonian Contributions to the Marine Sciences , 1: 1 21.) 32 33 Neosiphonia cheloniae (Hollenberg & J.N.Norris) J.N.Norris 34 Melanothamnus collabens (C.Agardh) Díaz Tapia & Maggs, Syntypes: LD Agardh herbarium 3 celled carpogonial branches; plastid 35 36 comb. nov. 40885 40887 and 40890 40898; character; molecular data available from 37 38 Hutchinsia collabens C.Agardh (1824, p. 153; Systema algarum. Cádiz, Spain the type locality (Díaz Tapia & Bárbara, 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 53 of 109 European Journal of Phycology
1 2 3 4 5 53 6
7 8 Berlinginiana, Lundae) 2013) 9 10 Polysiphonia collabens (C.Agardh)For Kützing Peer Review Only 11 12 Streblocladia collabens (C.Agardh) Falkenberg 13 14 Neosiphonia collabens (C.Agardh) Díaz Tapia & Bárbara 15 16 Melanothamnus concinnus (Hollenberg) Díaz Tapia & Maggs, Holotype: US 61210; Plastid character observed in our study of 17 comb. nov. La Jolla, California, USA; the type material 18 19 Polysiphonia concinna Hollenberg (1944, pp. 474 475; An 26.xii.1936. 20 21 account of the species of Polysiphonia on the Pacific coast of 22 23 North America. II. Polysiphonia . American Journal of Botany , 24 25 31: 474 483) 26 27 Polysiphonia johnstonii var. concinna (Hollenberg) Hollenberg 28 29 Neosiphonia concinna (Hollenberg) J.N.Norris 30 31 Melanothamnus decumbens (T.Segi) Díaz Tapia & Maggs, Holotype: SAP 25880; 3 celled carpogonial branches; plastid 32 33 comb. nov. Mihonoseki, Shimane Prefecture, character (Kim, 2003, fig. 5F). Molecular 34 Polysiphonia decumbens T.Segi (1951, p. 218; Systematic study Japan; vi.1948. data available from Korea (Kim & Yang, 35 36 of the genus Polysiphonia from Japan and its vicinity. Journal 2006) 37 38 of the Faculty of Fisheries, Prefectual University of Mie , 1: 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 54 of 109
1 2 3 4 5 54 6
7 8 169 272) 9 10 Neosiphonia decumbens (T.Segi)For M. S.Kim & I.K.Lee Peer Review Only 11 12 Melanothamnus ecorticatus (R.E.Norris) Díaz Tapia & Maggs, Holotype: BISH 630042 Plastid character; ostiolar cells larger than 13 14 comb. nov. Keokea Bay, Hawai´i; v.1990 other pericarpial cells (Abbott, 1999) 15 16 Fernandosiphonia ecorticata R.E.Norris (1994, p. 434; Some 17 cumophytic Rhodomelaceae (Rhodophyta) occuring in 18 19 Hawaiian surf. Phycologia 33: 434 443) 20 21 22 23 Melanothamnus eastwoodiae (Setchell & N.L.Gardner) Díaz Holotype: CAS 173674 Plastid character observed in type 24 25 Tapia & Maggs, comb. nov. Islas Revillagigedo material 26 27 Polysiphonia eastwoodiae Setchell & N.L.Gardner (1930, p. 28 29 161, as P. eastwoodae ; Marine algae of the Revillagigedo 30 31 Islands expedition in 1925. Proceedings of the California 32 33 Academy of Sciences , 4: 109 215) 34 Neosiphonia eastwoodae (Setchell & N.L.Gardner) Xiang Si 35 36 duan 37 38 Melanothamnus ferulaceus (Suhr ex J.Agardh) Díaz Tapia & Type materials are in LD, J.Agardh´s Plastid character in Panama and Brazil. 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 55 of 109 European Journal of Phycology
1 2 3 4 5 55 6
7 8 Maggs, comb. nov. Herbarium (not seen) Molecular data from Panama 9 10 Polysiphonia ferulacea Suhr ex J.AgardhFor (1863, p. 980;Peer Species Atlantic Mexico;Review North America; (Mamoozadeh Only & Freshwater, 2012; 11 12 Genera et Ordines Algarum..... C.W.K. Gleerup, Lundae) Guadeloupe; Hawaiian Islands; Guimarâes et al. , 2004) 13 14 Neosiphonia ferulacea (Suhr ex J.Agardh) S.M.Guimarães & Marquesas Islands; Australia 15 16 M.T.Fujii 17 Melanothamnus fibrillosus (Okamura) Díaz Tapia & Maggs, Lectotype (Uwai & Masuda, 1999): 3 celled carpogonial branches, plastid 18 19 comb. nov. SAP character, cells surrounding the ostiole 20 21 Pterosiphonia fibrillosa Okamura (1912, p. 172; Icones of Shirahama, Chiba Prefecture, Japan; much larger than the cells below (Uwai & 22 23 Japanese Algae . Vol. II (10) . Privately published, Tokyo) undated Masuda, 1999, figs. 18, 19). 24 25 Kintarosiphonia fibrillosa (Okamura) S. Uwai & Masuda 26 27 Melanothamnus flavimarinus (M. S.Kim & I.K.Lee) Díaz Tapia Holotype: SNU IBA001 3 celled carpogonial branches; plastid 28 29 & Maggs, comb. nov. Bangpo, Anmyondo, Korea; character (Kim & Lee, 1999, fig. 5). 30 31 Neosiphonia flavimarina M. S.Kim & I.K.Lee (1999, p. 272; 17.vii.1988. Molecular data available from the type 32 33 Neosiphonia flavimarina gen. et sp. nov. with a taxonomic locality (Kim & Yang, 2006) 34 reassessment of the genus Polysiphonia (Rhodomelaceae, 35 36 Rhodophyta). Phycological Research , 47: 271 281) 37 38 Melanothamnus forfex (Harvey) Díaz Tapia & Maggs, comb. Lectotype (Womersley, 1979): TCD 3 celled carpogonial branches; plastid 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 56 of 109
1 2 3 4 5 56 6
7 8 nov. 15353 4 character, molecular data available from 9 10 Polysiphonia forfex Harvey (1859,For pl. XCVI; Phycologia Peer Rottnest Island,Review Western Australia the type Only locality (this work) 11 12 Australica…. Vol. 2 . Lovell Reeve & Co, London) 13 14 Melanothamnus gorgoniae (Harvey) Díaz Tapia & Maggs, Syntypes: TCD 12801 4, NY 3 celled carpogonial branches observed 15 16 comb. nov. 900637 8 in Brazil (Guimaraes, et al ., 2004); 17 Polysiphonia gorgoniae Harvey (1853, p. 39; Nereis boreali Key West, Florida, U.S.A plastid character observed in type 18 19 americana…. Smithsonian Contributions to Knowledge , 5: [i material (this work) 20 21 ii], [1] 258, pls XIII XXXVI) 22 23 Neosiphonia gorgoniae (Harvey) S.M.Guimarães & M.T.Fujii 24 25 Melanothamnus harlandii (Harvey) Díaz Tapia & Maggs, comb. Probable syntypes: TCD 11955, US 3 celled carpogonial branches. Molecular 26 27 nov. 56848 data available from Korea (Kim, 2003; 28 29 Polysiphonia harlandii Harvey (1860, p. 330; Characters of new Hong Kong Kim & Yang, 2006) 30 31 algae…. Proceedings of the American Academy of Arts and 32 33 Sciences , 4: 327 335) 34 Neosiphonia harlandii (Harvey) M.S.Kim & I.K.Lee 35 36 Melanothamnus harveyi (Bailey) Díaz Tapia & Maggs, comb. Lectotype (Maggs & Hommersand, 3 celled carpogonial branches (this 37 38 nov. 1993): TCD 12810 work); plastid character. Molecular data 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 57 of 109 European Journal of Phycology
1 2 3 4 5 57 6
7 8 Polysiphonia harveyi Bailey (1848, p. 38; Continuation of the Bailey; Stonington, Connecticut, available from the type locality (McIvor 9 10 list of localities of algae in the UnitedFor States. Proceedings Peer of USA; vii.1847Review et al. , 2001)Only 11 12 the American Academy of Arts and Sciences , 4: 327 335) 13 14 Neosiphonia harveyi (Bailey) M. S.Kim, H. G.Choi, Guiry & 15 16 G.W.Saunders 17 Melanothamnus hawaiiensis (Hollenberg) Díaz Tapia & Maggs, Holotype: US 48524 3 celled carpogonial branches (Kim & 18 19 comb. nov. Waikiki beach, O´ahu Island, Abbott, 2006). Plastid character (Abbott, 20 21 Polysiphonia hawaiiensis Hollenberg (1968 a, pp. 66 67; An Hawai´i; 21.i.1963 1999, fig. 122C) 22 23 account of the species of Polysiphonia of the central and 24 25 western tropical Pacific ocean. II Oligosiphonia . Pacific 26 27 Science , 22: 56 98.) 28 29 Neosiphonia hawaiiensis (Hollenberg) M. S.Kim & I.A.Abbott 30 31 Melanothamnus incomptus (Harvey) Díaz Tapia & Maggs, Probable holotype: TCD 192 Plastid character. Molecular data 32 33 comb. nov. False Bay, Cape Province, South available from the type locality (this 34 Polysiphonia incompta Harvey (1847, p. 44; Nereis australis …. Africa work) 35 36 Reeve Brothers, London) 37 38 Melanothamnus japonicus (Harvey) Díaz Tapia & Maggs, Lectotype (Masuda et al. , 1995): Plastid character (this work); 3 celled 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 58 of 109
1 2 3 4 5 58 6
7 8 comb. nov. TCD 11905 carpogonial branches. Molecular data 9 10 Polysiphonia japonica Harvey (inFor M.C. Perry 1857, Peer p. 331; Hakodate, Review Japan; v.1854 available Only from the type locality (Kim & 11 12 Account of the Botanical specimens. (Gray, A., editor) Yang, 2006) 13 14 Narrative of the expedition of an American squadron to the 15 16 China Seas and Japan…. Senate of the Thirty third Congress, 17 Second Session, Executive Document. House of 18 19 Representatives, Washington) 20 21 Neosiphonia japonica (Harvey) M.S.Kim & I.K.Lee 22 23 Melanothamnus johnstonii (Setchell & Gardner) Díaz Tapia & Holotype: CAS1361 Plastid character. Molecular data 24 25 Maggs, comb. nov. San Esteban Island, Gulf of available from the type locality (this 26 27 Polysiphonia johnstonii Setchell & Gardner (1924, p. 767; California; iv.1921 work). 28 29 XXIX Expedition of the California Academy of Sciences to the The sequence from California 30 31 Gulf of California in 1921. The Marine Algae. Proceeding of (KX756670) is only 0.1 0.2 % divergent 32 33 the California Academy of Science, Series 4 12: 695 949) in its rbc L sequence from M. collabens 34 Neosiphonia johnstonii (Setchell & N.L.Gardner) J.N.Norris from Spain. Further studies are needed to 35 36 clarify the possible synonymy between 37 38 these two species that share the unusual 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 59 of 109 European Journal of Phycology
1 2 3 4 5 59 6
7 8 character of having (5 ) 6 pericentral 9 10 For Peer Reviewcells. Only 11 12 Melanothamnus nudus (N.R.Mamoozadeh & D.W.Freshwater) Holotype: US 211334 Molecular data available from the type 13 14 D.W.Freshwater Parque de Juventud, Calle Primero, locality (Mamoozadeh & Freshwater, 15 16 Polysiphonia nuda N.R.Mamoozadeh & D.W.Freshwater (2012, Colon, Caribbean coast of Panama; 2012) 17 p. 335; Polysiphonia sensu lato (Ceramiales, Florideophyceae) 20.v.2009 18 19 species of Caribbean Panama including Polysiphonia 20 21 lobophoralis sp. nov. and Polysiphonia nuda sp. nov. Botanica 22 23 Marina , 55: 317–347) 24 25 Melanothamnus peruviensis (D.E.Bustamante, B.Y.Won, Holotype: CUK 7976 Plastid character. Molecular data 26 27 M.E.Ramirez & T.O.Cho) Díaz Tapia & Maggs, comb. nov. Lagunillas, Pisco, Ica, southern coast available from the type locality 28 29 Neosiphonia peruviensis D.E.Bustamante, B.Y.Won, of Lima, Peru; 21.viii.2008 (Bustamante et al ., 2012, fig. 10) 30 31 M.E.Ramirez & T.O.Cho (2012, p. 360; Neosiphonia 32 33 peruviensis sp. nov. (Rhodomelacea, Rhodophyta) from the 34 Pacific coast of South America. Botanica Marina , 55: 359 366) 35 36 Melanothamnus platycarpus (Børgesen) Díaz Tapia & Maggs, Probable syntypes: BM 1067681 and 3 celled carpogonial branches; plastid 37 38 comb. nov. 106760 character (Iyengar & Balakrishnan, 1949, 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 60 of 109
1 2 3 4 5 60 6
7 8 Polysiphonia platycarpa Børgesen (1934, p. 23; Some Indian Bombay, India; 19.xii.1927 fig. 1) 9 10 Rhodophyceae especially from Forthe shores of the PresidePeerncy of Review Only 11 12 Bombay IV. Bulletin of Miscellaneous Information, Royal 13 14 Botanic Gardens, Kew , 1934: 1 30) 15 16 Melanothamnus pseudovillum (Hollenberg) Díaz Tapia & Holotype: US 61232; Cell walls “hyaline” (Hollenberg, 1968 17 Maggs, comb. nov. North Island, Johnston Islands; a). Molecular data available from 18 19 Polysiphonia pseudovillum Hollenberg (1968 a, p. 73; An 22.vi.1965 Panama (Mamoozadeh & Freshwater, 20 21 account of the species of Polysiphonia of the central and 2011) 22 23 western tropical Pacific ocean. II Oligosiphonia . Pacific 24 25 Science , 22: 56 98) 26 27 Melanothamnus ramireziae (D.E.Bustamante, B.Y.Won & Holotype: CUK 6511 Plastid character, 3 celled carpogonial 28 29 T.O.Cho) Díaz Tapia & Maggs, comb. nov. Lagunillas, Pisco, Ica, Peru; branches. Molecular data available from 30 31 Neosiphonia ramirezii D.E.Bustamante, B.Y.Won & T.O.Cho 21.viii.2008. the type locality (Bustamante et al ., 32 33 (2013 a, Neosiphonia ramirezii sp. nov. (Rhodomelaceae, 2013 a, fig. 1f) 34 Rhodophyta) from Peru. Algae , 28: 73 82.) 35 36 Melanothamnus silvae (D.E.Bustamante, B.Y.Won & T.O.Cho) Holotype: CUK 7976 Plastid character. Molecular data 37 38 Díaz Tapia & Maggs, comb. nov. Geger, Nusadua, Bali, Indonesia; available from the type locality 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 61 of 109 European Journal of Phycology
1 2 3 4 5 61 6
7 8 Neosiphonia silvae D.E.Bustamante, B.Y.Won & T.O.Cho 26.iv.2012 (Bustamante et al ., 2013 b, figs 22 23) 9 10 (2013 b, pp. 518 520; NeosiphoniaFor baliana sp. nov. Peer and N. Review Only 11 12 silvae sp. nov. (Rhodomelaceae, Rhodophyta) from 13 14 Bali, Indonesia. Botanica Marina , 56: 515 524) 15 16 Melanothamnus simplex (Hollenberg) Díaz Tapia & Maggs, Holotype: US 61238 Plastid character. Molecular data 17 comb. nov. Laguna Beach, Orange County, available from the type locality (this 18 19 Polysiphonia simplex Hollenberg, (1942, p. 782; An account of California, U.S.A; 14.v.1937 work). 20 21 the species of Polysiphonia on the Pacific coast of North Rbc L sequence not incuded in our 22 23 America. I. Oligosiphonia. American Journal of Botany, 29: phylogeny because it is only 1% 24 25 772 785) divergent from N. ramirezii . 26 27 Neosiphonia simplex (Hollenberg) Y. P.Lee 28 29 Melanothamnus sphaerocarpus (Børgesen) Díaz Tapia & Isotypes: US , C Plastid character. Molecular data 30 31 Maggs, comb. nov. Store Nordsidebugt, St. Thomas, available from Florida (Mamoozadeh & 32 33 Polysiphonia sphaerocarpa Børgesen (1918, p. 271; The marine Virgin Islands Freshwater, 2011, fig. 18) 34 algae of the Danish West Indies. Part 3. Rhodophyceae (4). 35 36 Dansk Botanisk Arkiv , 3: 241 304.) 37 38 Neosiphonia sphaerocarpa (Børgesen) M. S.Kim & I.K.Lee 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 62 of 109
1 2 3 4 5 62 6
7 8 Melanothamnus strictissimus (J.D.Hooker & Harvey) Díaz Probable syntype: BM 561312 Plastid character (this work). Molecular 9 10 Tapia & Maggs, comb. nov. For PeerNew Zealand Review data availableOnly from the type locality 11 12 Polysiphonia strictissima J.D.Hooker & Harvey (1845, p. 538; (Stuercke & Freshwater, 2010) 13 14 Algae Novae Zelandiae…. London Journal of Botany , 4: 521 15 16 551.) 17 Melanothamnus thailandicus (N.Muangmai & Holotype: KUMF SRC 03 011 1 3 celled carpogonial branches. Molecular 18 19 C.Kaewsuralikhit) Díaz Tapia & Maggs, comb. nov. Sri Racha Harbor, Chon Buri, data available from the type locality 20 21 Neosiphonia thailandica N.Muangmai & C.Kaewsuralikhit Thailand; 11.iii.2011 (Muangmai et al. , 2014) 22 23 (2014, pp. 460 461; The new species Neosiphonia thailandica 24 25 sp. nov. (Rhodomelaceae, Rhodophyta) from the Gulf of 26 27 Thailand. Botanica Marina , 57: 459 467) 28 29 Melanothamnus yongpilii (B.Kim & M. S.Kim) Díaz Tapia & Holotype: JNUB 140704 101 3 celled carpogonial branches; plastid 30 31 Maggs, comb. nov. Jongdal, Jeju Island, Korea; character. Molecular data available from 32 33 Neosiphonia yongpilii B.Kim & M. S.Kim (2016, pp. 324 325; 04.iv.2014 the type locality (Kim & Kim, 2016, fig. 34 Neosiphonia yongpilii sp. nov. (Rhodomelaceae, Rhodophyta), 14) 35 36 known as Neosiphonia simplex from Korea, with an emphasis 37 38 on cystocarp development. Phycologia , 55: 323 332) 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 63 of 109 European Journal of Phycology
1 2 3 4 5 63 6
7 8 Note: Here we include only species that we can confidently assign to this genus (i.e., we have examined type material or suitable pictures of the 9 10 type material showing the plastidFor character and/or seqPeeruences are available fromReview the type locality or nearby). Only 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 64 of 109
1 2 3 4 5 64 6
7 8 9 10 For Peer Review Only 11 12 Table 5. New combinations in Melanothamnus made for formal reasons (because the current genus is here placed in synonymy with 13 14 Melanothamnus ) although type material has not been examined 15 16 17 Binomial in Melanothamnus (if any) Type material Notes 18 19 Basionym Type locality 20 21 Synonyms 22 23 24 25 Melanothamnus hancockii (Dawson) Díaz Tapia & Maggs, comb. Holotype: LAM EYD629c Plastid character. Molecular data from 26 27 nov. Baja California, Mexico; 16.ii.1940 Japan (this work) 28 29 Polysiphonia hancockii E.Y.Dawson (1944, pp. 331 332; The 30 31 marine algae of the Gulf of California. Allan Hancock Pacific 32 33 Expeditions 3: 189 432) 34 Fernandosiphonia hancockii (Dawson) R.E.Norris 35 36 Melanothamnus masonii (Setchell & N.L.Gardner) Díaz Tapia & Holotype: CAS 173618 37 38 Maggs, comb. nov. Isla Guadalupe, México; iv.1925 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 65 of 109 European Journal of Phycology
1 2 3 4 5 65 6
7 8 Polysiphonia masonii Setchell & Gardner (1930, p. 160; Marine 9 10 algae of the Revillagigedo IslandsFor expedition in 192Peer5. Review Only 11 12 Proceedings of the California Academy of Sciences , 4: 109 13 14 215) 15 16 Neosiphonia masonii (Setchell & N.L.Gardner) J.N.Norris 17 Melanothamnus minutissimus (Hollenberg) Díaz Tapia & Maggs, Holotype: US 66797 Plastid character. Molecular data from 18 19 comb. nov. Punta Banda, Baja California, Japan (this work) 20 21 Polysiphonia minutissima Hollenberg (1942, p. 781, An account Mexico; 17.xii.1938 22 23 of the species of Polysiphonia on the Pacific coast of North 24 25 America. I. Oligosiphonia. American Journal of Botany, 29: 26 27 772 785) 28 29 Melanothamnus nanus (A.J.K.Millar) Díaz Tapia & Maggs, Holotype: MELU AM752 30 31 comb. nov Coffs Harbour, New South Wales; 32 33 Fernandosiphonia nana A.J.K.Millar (1990, p. 439; Marine red 27.viii.1980 34 algae of the Coffs Harbour region, northern New South Wales. 35 36 Australian Systematic Botany , 3: 293 593) 37 38 Melanothamnus notoensis (Segi) Díaz Tapia & Maggs, comb. Holotype: SAP 025894 Plastid character in Korea (Nam & Kang, 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 66 of 109
1 2 3 4 5 66 6
7 8 nov. Shibagaki, Ishikawa Prefecture, 2012; fig. 47E) 9 10 Polysiphonia notoensis Segi (1951,For p. 266; Systematic Peer study of Japan; 9.vii.1947Review Only 11 12 the genus Polysiphonia from Japan and its vicinity. Journal of 13 14 the Faculty of Fisheries, Prefectual University of Mie , 1: 169 15 16 272) 17 Neosiphonia notoensis (Segi) M.S.Kim & I.K.Lee 18 19 Melanothamnus polyphysus (Kützing) Díaz Tapia & Maggs, Holotype: L 4082747 20 21 comb. nov. Vieillard; New Caledonia; undated 22 23 Polysiphonia polyphysa Kützing (1863, p. 20; Tabulae 24 25 phycologicae; oder, Abbildungen der Tange. Vol. XIII. 26 27 Gedruckt auf kosten des Verfassers (in commission bei W. 28 29 Köhne), Nordhausen) 30 31 Neosiphonia polyphysa (Kützing) Skelton & G.R.South 32 33 Melanothamnus porrectus (T.Segi) Díaz Tapia & Maggs, comb. Holotype: SAP 025867 Plastid character in Korea (Lee, 2008; p. 34 nov. Henashi, Nishitsugaru gun, Aomori 314, fig. C) 35 36 Polysiphonia porrecta Segi (1951, p. 260; Systematic study of the Prefecture, Japan; 19.vi.1948. 37 38 genus Polysiphonia from Japan and its vicinity. Journal of the 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 67 of 109 European Journal of Phycology
1 2 3 4 5 67 6
7 8 Faculty of Fisheries, Prefectual University of Mie , 1: 169 272) 9 10 Neosiphonia porrecta (Segi) Y. P.For Lee Peer Review Only 11 12 Melanothamnus savatieri (Hariot) Díaz Tapia & Maggs, comb. Lectotype (Kim, 2005): PC 3 celled carpogonial branches in 13 14 nov. 0011879 Malaysia (Masuda et al. , 2001). 15 16 Polysiphonia savatieri Hariot (1891, p. 226; Liste des algues Yokosuka, Kanagawa Prefecture, Molecular data available from Korea 17 marines rapportés de Yokoska (Japon) par M. le Dr Savatier. Japan (Phillips et al. , 2000) 18 19 Mémoires de la Société nationale des sciences naturelles de 20 21 Cherbourg , 27: 211 230) 22 23 Neosiphonia savatieri (Hariot) M.S.Kim & I.K.Lee 24 25 Melanothamnus sparsus (Setchell) Díaz Tapia & Maggs, comb. Holotype: UC 261144; Plastid character in Vietnam (Abbott et 26 27 nov. Arue Reef, Tahiti; 27.vi.1922 al. , 2002; fig. 27) 28 29 Lophosiphonia sparsa Setchell (1926, p. 103; Tahitian algae 30 31 collected by W.A. Setchell, C.B. Setchell and H.E. Parks. 32 33 University of California Publications in Botany , 12: 61 142) 34 Polysiphonia sparsa (Setchell) Hollenberg 35 36 Neosiphonia sparsa (Setchell) I.A.Abbott 37 38 Melanothamnus teradomariensis (M.Noda) Díaz Tapia & Maggs, Holotype: Herbarium Niigata Molecular data available from Korea 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 68 of 109
1 2 3 4 5 68 6
7 8 comb. nov. University (Bárbara et al. , 2013) 9 10 Polysiphonia teradomariensis M.NodaFor (in Noda, M.Peer & Kitami, T. Echigo ReviewProvince, Japan; 28.xi.1968 Only 11 12 1971, 47; Some species of marine algae from Echigo Province 13 14 facing the Japan Sea. Scientific Reports Niigata University, Ser. 15 16 D. (Biology) , 8: 35 52) 17 Polysiphonia japonica var. teradomariensis (M.Noda) H.Y.Yoon 18 19 Neosiphonia teradomariensis (M.Noda) M. S.Kim & I.K.Lee 20 21 Melanothamnus tongatensis (Harvey ex Kützing) Díaz Tapia & Holotype: L 4083619 Molecular data available from Panama 22 23 Maggs, comb. nov. Tonga, Friendly Islands; undated (Mamoozadeh & Freshwater, 2011) 24 25 Polysiphonia tongatensis Harvey ex Kützing, (1864, p. 14; 26 27 Tabulae phycologicae; oder, Abbildungen der Tange. Vol. XIV . 28 29 Gedruckt auf kosten des Verfassers (in commission bei W. 30 31 Köhne), Nordhausen) 32 33 Neosiphonia tongatensis (Harvey ex Kützing) M. S.Kim & 34 I.K.Lee 35 36 Melanothamnus upolensis (Grunow) Díaz Tapia & Maggs, comb. Syntypes: W Molecular data available from Hawaii 37 38 nov. Upolu, Western Samoa (Sherwood et al. , 2010) 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 69 of 109 European Journal of Phycology
1 2 3 4 5 69 6
7 8 Polysiphonia upolensis Grunow (1874, p. 49; Algen der Fidschi , 9 10 Tonga und Samoa Inseln, gesammeltFor von Dr. E.Peer Graeffe. Review Only 11 12 Journal des Museum Godeffroy , 3: 23 50) 13 14 Neosiphonia upolensis (Grunow) M.S.Kim & Boo 15 16 Melanothamnus yendoi (T.Segi) Díaz Tapia & Maggs, comb. nov. Holotype: SAP 0258883 Molecular data available from Korea 17 Polysiphonia yendoi Segi (1951, p. 211; Systematic study of the Muroran, Hokkaido, Japan; (Bárbara et al. , 2013) 18 19 genus Polysiphonia from Japan and its vicinity. Journal of the 30.iv.1935 20 21 Faculty of Fisheries, Prefectual University of Mie , 1: 169 272) 22 23 Neosiphonia yendoi (Segi) M. S.Kim & I.K.Lee 24 25 Neosiphonia saccorhiza (F.S.Collins & Hervey) J.M.C.Nunes & Isotypes: NY, Collins Herbarium Transfer to Melanothamnus is not made 26 27 S.M.Guimarães, nom. inval. Gibbet Island, Bermuda here as N. saccorhiza is an invalid 28 29 Lophosiphonia saccorhiza F.S.Collins & Hervey combination (the basionym was not 30 31 Polysiphonia saccorhiza (F.S.Collins & Hervey) Hollenberg cited), and the phylogenetic affinities of 32 33 Lophosiphonia saccorhiza are unknown. 34
35 36 37 38 39 40 41 42 43 44 45 46 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 70 of 109
1 2 3 4 70 5 6 Figure legends 7 8 9 10 Fig. 1 . Phylogenetic tree estimated with ML analysis of rbc L sequences. Values at 11 12 nodes indicate bootstrap support (BP)/posterior probability (PP) (only shown if > 13 14 60/0.6). BranchesFor marked with anPeer asterisk received Review 100% (BP)/1.00 (PP) support. Only 15 16 Species names printed in bold correspond to type species of genera. 17 18 19 20 Fig. 2 . Phylogenetic tree estimated with ML analysis of 18S sequences. Values at nodes 21 22 indicate bootstrap support/posterior probability (only shown if > 60%/0.6 PP). Branches 23 24 marked with an asterisk received 100%/1.00 PP support. Species names printed in bold 25 26 correspond to type species of genera. 27 28 29 30 Figs 3-8. Melanothamnus somalensis , the type species of Melanothamnus. Fig. 3 . 31 32 Herbarium specimen MICH 662774. Fig. 4. Apical part of a specimen with alternately 33 34 arranged branches. Figs 5-6. Apices of branches with (Fig. 5) or without (Fig. 6) 35 36 abundant trichoblasts. Fig. 7 . Apex of a lateral branch with trichoblasts. Fig. 8 . Surface 37 view of cells with the plastids lying exclusively on radial walls while the outer walls 38 39 appear transparent (arrows). Scale bars: Fig. 3, 6 cm; Fig. 4, 1 mm; Figs 5 and 6, 350 40 41 µm; Fig. 7, 200 µm; Fig. 8, 100 µm. 42 43
44 45 Figs 9-18. Fernandosiphonia unilateralis type material, the type species of 46 47 Fernandosiphonia. Fig. 9 . Herbarium specimen. Figs 10-11 . Branches unilaterally 48 49 arranged. Fig. 12 . Axis with scar cells of trichoblasts (arrows). Figs 13-14 . Surface 50 51 view of pericentral cells with plastids lying only on the radial walls, so that the outer 52 53 walls appear transparent (Fig. 13, arrows) and cells have a dark flank (Fig. 14). Fig. 15 . 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 71 of 109 European Journal of Phycology
1 2 3 4 71 5 6 Young spermatangial branch formed on the first dichotomy of a trichoblast, remaining 7 8 the other vegetative branch (arrow). Fig. 16. Procarp (su = supporting cell; cp = 9 10 carpogonium). Fig. 17 . Cystocarp. Fig. 18 . Tetrasporangia arranged in short spiral 11 12 series. Scale bars: Fig. 9, 3 cm; Fig. 10, 2 mm; Fig. 11, 450 µm; Figs 12, 14, 17 and 18, 13 14 100 µm; Figs 13 andFor 15, 40 µm; Peer Fig. 16, 20 µm. Review Only 15 16 17 18 Figs 19-24 . Rhizoid anatomy in the Polysiphonieae. In open connection with pericentral 19 20 cells in Polysiphonia stricta (Fig. 19 , Polysiphonia sensu stricto clade 1). Cut off from 21 22 pericentral cells in P. foetidissima (Fig. 20 , Vertebrata clade), P. denudata (Fig. 21 , 23 24 Carradoriella clade), Polysiphonia sp. (Fig. 22 , Streblocladia clade), P. schneideri 25 26 (Fig. 23 , P. schneideri clade) and P. incompta (Fig. 24 , Melanothamnus clade). Scale 27 28 bars: Figs 19 23, 100 µm; Fig. 24, 500 µm. 29 30 31 32 Figs 25-39 . Plastid arrangement in the Polysiphonieae. Scattered against all cell walls of 33 34 the pericentral cells in Polysiphonia stricta (Figs 25-26 , Polysiphonia sensu stricto 35 36 clade 1), Vertebrata lanosa (Figs 27-28 , Vertebrata clade), P. virgata (Figs 29-30 , 37 Carradoriella clade), Polysiphonia sp. (Fig. 31 , Streblocladia clade) and P. schneideri 38 39 (Figs 32-33 , P. schneideri clade). Lying exclusively on the radial walls of the 40 41 pericentral cells in species of the Melanothamnus clade: Neosiphonia collabens (Figs 42 43 34-35 ), N. harveyi (Figs 36-38) and P. forfex (Fig. 39 ). Scale bars: Figs 25, 27, 29, 38 44 45 and 39, 500 µm; Figs 26, 28 and 30, 800 µm; Figs 31, 32, 34, 35 and 37, 100 µm; Fig. 46 47 33, 300 µm; Fig, 36, 50 µm. 48 49 50 51 Figs 40-46 . Trichoblast nuclei (arrows) in the Polysiphonieae. Uninucleate trichoblast 52 53 cells in Polysiphonia scopulorum (Fig. 40, Polysiphonia sensu stricto clade 1), P. 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 72 of 109
1 2 3 4 72 5 6 denudata (Fig. 44 , Carradoriella clade), P. schneideri (Fig. 45 , P. schneideri clade) and 7 8 P. blandii (Fig. 46 , Melanothamnus clade). Multinucleate trichoblast cells in species of 9 10 the Vertebrata clade: P. nigra (Fig. 41 ), Boergeseniella fruticulosa (Fig. 42 ) and P. 11 12 foetidissima (Fig. 43 ). Scale bars: Figs 40 43, 60 µm, Fig. 44, 30 µm; Fig. 45, 20 µm; 13 14 Fig. 46, 100 µm. For Peer Review Only 15 16 17 18 Figs 47-52 . Spermatangial branches in the Polysiphonieae. Replacing trichoblasts and 19 20 with sterile apical filaments in Polysiphonia stricta (Fig. 47 , Polysiphonia sensu stricto 21 22 clade 1). Replacing trichoblasts and lacking sterile apical cells in Vertebrata lanosa 23 24 (Fig. 48 , Vertebrata clade). On a branch of a trichoblast and with sterile apical cells in 25 26 P. fucoides (Fig. 49 , Vertebrata clade), P. denudata (Fig. 50 , Carradoriella clade), P. 27 28 schneideri (Fig. 51 , P. schneideri clade) and Neosiphonia harveyi (Fig. 52 , 29 30 Melanothamnus clade). Scale bars: 100 µm. Arrows show the apical sterile cells and 31 32 arrowheads the sterile branch of fertile trichoblasts. 33 34 35 36 Figs 53-58 . Carpogonial branches in the Polysiphonieae. Four celled in Polysiphonia 37 stricta (Fig. 53 , Polysiphonia sensu stricto clade 1), P. nigra (Fig. 54 , Vertebrata 38 39 clade), P. denudata (Fig. 55 , Carradoriella clade) and P. schneideri (Fig. 56 , P. 40 41 schneideri clade). Three celled in species of the Melanothamnus clade: Neosiphonia 42 43 harveyi (Fig. 57 ) and P. blandii (Fig. 58 ). Su = supporting cell; st = sterile basal cell; 1 44 45 4 cells of carpogonial branches. Scale bars: Fig. 53, 30 µm; Figs 54 58, 20 µm. 46 47 48 49 Figs 59-64 . Cystocarps in the Polysiphonieae. Urceolate in Polysiphonia stricta (Fig. 50 51 59 , Polysiphonia sensu stricto clade 1). Ovoid in Vertebrata lanosa (Fig. 60 , Vertebrata 52 53 clade), P. denudata (Fig. 61 , Carradoriella clade), Streblocladia glomerulata (Fig. 62 , 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 73 of 109 European Journal of Phycology
1 2 3 4 73 5 6 Streblocladia clade). Globose in Polysiphonia schneideri (Fig. 63 , P. schneideri clade) 7 8 and Neosiphonia collabens (Fig. 64 , Melanothamnus clade). Scale bars: Figs 59 62 and 9 10 64, 200 µm; Fig. 63, 100 µm. 11 12 13 14 Figs 65-70 . Cells Forsurrounding thePeer ostiole in the Polysiphonie Reviewae. Similar or slightly Only 15 16 larger than the cells of the pericarp inmediately below in Polysiphonia stricta (Fig. 65 , 17 18 Polysiphonia sensu stricto clade 1), Vertebrata lanosa (Fig. 66 , Vertebrata clade), P. 19 20 denudata (Fig. 67 , Carradoriella clade), and P. schneideri (Fig. 69 , P. schneideri 21 22 clade). They are much larger in Streblocladia glomerulata (Fig. 68 , Streblocladia clade) 23 24 and Neosiphonia collabens (Fig. 70 , Melanothamnus clade). Scale bars: Figs 65 68 and 25 26 70, 100 µm; Fig. 69, 60 µm. 27 28 29 30 Figs 71-76 . Tetrasporangia in the Polysiphonieae. Forming long straight series in 31 32 Polysiphonia stricta (Fig. 71 , Polysiphonia sensu stricto clade 1). Forming spiral series 33 34 in Vetebrata lanosa (Fig. 72 , Vertebrata clade), Polysiphonia sp. (Fig. 74 , Streblocladia 35 36 clade) and Neosiphonia harveyi (Fig. 76 , Melanothamnus clade). Forming short straight 37 series in P. denudata (Fig. 73 , Carradoriella clade), and P. schneideri (Fig. 75 , P. 38 39 schneideri clade). Scale bars: Figs 71, 74 and 76, 200 µm; Figs 72, 73 and 75, 400 µm. 40 41
42 43 Fig. 77 . World map representing the proportion of Fernandosiphonia (black) and other 44 45 Polysiphonieae (grey) species in selected regions where the Polysiphonieae were 46 47 studied in detail. Data were obtained from the following references after updating the 48 49 species names: Alaska: Lindstrom (http://www.seaweedsofalaska.com); Brazil (Espírito 50 51 Santo São Paulo): Guimâraes et al. (2004); Hawaii: Abbott (1999); Japan: Yoshida 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 74 of 109
1 2 3 4 74 5 6 (1998); Korea: Nam & Kang (2012); Panama: Mamoozadeh & Freshwater (2012); 7 8 Spain (Galicia): Bárbara et al. (2005); British Isles: Maggs & Hommersand (1993). 9 10 11 12 Fig. S1 . Chronogram resulting from the Bayesian relaxed molecular clock analysis 13 14 performed with BEAST.For Peer Review Only 15 16 Fig. S2 . Chronogram resulting from the autocorrelated molecular clock analysis 17 18 performed with PhyloBayes. 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 75 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Fig. 1. Phylogenetic tree estimated with ML analysis of rbcL sequences. Values at nodes indicate bootstrap support (BP)/posterior probability (PP) (only shown if > 60/0.6). Branches marked with an asterisk received 48 100% (BP)/1.00 (PP) support. Species names printed in bold correspond to type species of genera. 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 76 of 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Fig. 2. Phylogenetic tree estimated with ML analysis of 18S sequences. Values at nodes indicate bootstrap support/posterior probability (only shown if > 60%/0.6 PP). Branches marked with an asterisk received 48 100%/1.00 PP support. Species names printed in bold correspond to type species of genera. 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 77 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Figs 3 8. Melanothamnus somalensis, the type species of Melanothamnus. Fig. 3. Herbarium specimen MICH 34 662774. Fig. 4. Apical part of a specimen with alternately arranged branches. Figs 5 6. Apices of branches with (Fig. 5) or without (Fig. 6) abundant trichoblasts. Fig. 7. Apex of a lateral branch with trichoblasts. Fig. 35 8. Surface view of cells with the plastids lying exclusively on radial walls while the outer walls appear 36 transparent (arrows). Scale bars: Fig. 3, 6 cm; Fig. 4, 1 mm; Figs 5 and 6, 350 µm; Fig. 7, 200 µm; Fig. 8, 37 100 µm. 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 78 of 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 Figs 9 18. Fernandosiphonia unilateralis type material, the type species of Fernandosiphonia. Fig. 9. 43 Herbarium specimen. Figs 10 11. Branches unilaterally arranged. Fig. 12. Axis with scar cells of trichoblasts 44 (arrows). Figs 13 14. Surfa ce view of pericentral cells with plastids lying only on the radial walls, so that the 45 outer walls appear transparent (Fig. 13, arrows) and cells have a dark flank (Fig. 14). Fig. 15. Young spermatangial branch formed on the first dichotomy of a trichoblast, remaining the other vegetative branch 46 (arrow). Fig. 16. Procarp (su = supporting cell; cp = carpogonium). Fig. 17. Cystocarp. Fig. 18. 47 Tetrasporangia arranged in short spiral series. Scale bars: Fig. 9, 3 cm; Fig. 10, 2 mm; Fig. 11, 450 µm; 48 Figs 12, 14, 17 and 18, 100 µm; Figs 13 and 15, 40 µm; Fig. 16, 20 µm. 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 79 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figs 19 24. Rhizoid anatomy in the Polysiphonieae. In open connection with pericentral cells in Polysiphonia stricta (Fig. 19, Polysiphonia sensu stricto clade 1). Cut off from pericentral cells in P. foetidissima (Fig. 20, 48 Vertebrata clade ), P. denudata (Fig. 21, Carradoriella clade), Polysiphonia sp. (Fig. 22, Streblocladia clade), 49 P. schneideri (Fig. 23, P. schneideri clade) and P. incompta (Fig. 24, Melanothamnus clade). Scale bars: Figs 50 19 23, 100 µm; Fig. 24, 500 µm. 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 80 of 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 Figs 25 39. Plastid arrangement in the Polysiphonieae. Scattered against all cell walls of the pericentral cells 42 in Polysiphonia stricta (Figs 25 26, Polysiphonia sensu stricto clade 1), Vertebrata lanosa (Figs 27 28, Vertebrata clade), P. virgata (Figs 29 30, Carradoriella clade), Polysiphonia sp. (Fig. 31, Streblocladia clade) 43 and P. schneideri (Figs 32 33, P. schneideri clade). Lying exclusively on the radial walls of the pericentral 44 cells in species of the Melanothamnus clade: Neosiphonia collabens (Figs 34 35), N. harveyi (Figs 36 38) 45 and P. forfex (Fig. 39). Scale bars: Figs 25, 27, 29, 38 and 39, 500 µm; Figs 26, 28 and 30, 800 µm; Figs 46 31, 32, 34, 35 and 37, 100 µm; Fig. 33, 300 µm; Fig, 36, 50 µm. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 81 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Figs 40 46. Trichoblast nuclei (arrows) in the Polysiphonieae. Uninucleate trichoblast cells in Polysiphonia 46 scopulorum (Fig. 40, Polysiphonia sensu stricto clade 1), P. denudata (Fig. 44, Carradoriella clade), P. schneideri (Fig. 45, P. schneideri clade) and P. blandii (Fig. 46, Melanothamnus clade). Multinucleate 47 trichoblast cells in species of the Vertebrata clade: P. nigra (Fig. 41), Boergeseniella fruticulosa (Fig. 42) and 48 P. foetidissima (Fig. 43). Scale bars: Figs 40 43, 60 µm, Fig. 44, 30 µm; Fig. 45, 20 µm; Fig. 46, 100 µm. 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 82 of 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figs 47 52. Spermatangial branches in the Polysiphonieae. Replacing trichoblasts and with sterile apical filaments in Polysiphonia stricta (Fig. 47, Polysiphonia sensu stricto clade 1). Replacing trichoblasts and 48 lacking sterile apical cells in Vertebrata lanosa (Fig. 48, Vertebrata clade). On a branch of a trichoblast and 49 with sterile apical cells in P. fucoides (Fig. 49, Vertebrata clade), P. denudata (Fig. 50, Carradoriella clade), 50 P. schneideri (Fig. 51, P. schneideri clade) and Neosiphonia harveyi (Fig. 52, Melanothamnus clade). Scale 51 bars: 100 µm. Arrows show the apical sterile cells and arrowheads the sterile branch of fertile trichoblasts. 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 83 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 Figs 53 58. Carpogonial branches in the Polysiphonieae. Four celled in Polysiphonia stricta (Fig. 53, 44 Polysiphonia sensu stricto clade 1), P. nigra (Fig. 54, Vertebrata clade), P. denudata (Fig. 55, Carradoriella 45 clade) and P. schneideri (Fig. 56, P. schneideri clade). Three celled in species of the Melanothamnus clade: 46 Neosiphonia harveyi (Fig. 57) and P. blandii (Fig. 58). Su = supporting cell; st = sterile basal cell; 1 4 cells of carpogonial branches. Scale bars: Fig. 53, 30 µm; Figs 54 58, 20 µm. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 84 of 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figs 59 64. Cystocarps in the Polysiphonieae. Urceolate in Polysiphonia stricta (Fig. 59, Polysiphonia sensu stricto clade 1). Ovoid in Vertebrata lanosa (Fig. 60, Vertebrata clade), P. denudata (Fig. 61, Carradoriella 48 clade), Streblocladia glomerulata (Fig. 62, Streblocladia clade). Globose in Polysiphonia schneideri (Fig. 63, 49 P. schneideri clade) and Neosiphonia collabens (Fig. 64, Melanothamnus clade). Scale bars: Figs 59 62 and 50 64, 200 µm; Fig. 63, 100 µm. 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 85 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Figs 65 70. Cells surrounding the ostiole in the Polysiphonieae. Similar or slightly larger than the cells of the 41 pericarp inmediately below in Polysiphonia stricta (Fig. 65, Polysiphonia sensu stricto clade 1), Vertebrata 42 lanosa (Fig. 66, Vertebrata clade), P. denudata (Fig. 67, Carradoriella clade), and P. schneideri (Fig. 69, P. 43 schneideri clade). They are much larger in Streblocladia glomerulata (Fig. 68, Streblocladia clade) and Neosiphonia collabens (Fig. 70, Melanothamnus clade). Scale bars: Figs 65 68 and 70, 100 µm; Fig. 69, 60 44 µm. 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 86 of 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figs 71 76. Tetrasporangia in the Polysiphonieae. Forming long straight series in Polysiphonia stricta (Fig. 71, Polysiphonia sensu stricto clade 1). Forming spiral series in Vetebrata lanosa (Fig. 72, Vertebrata clade), 48 Polysiphonia sp. (Fig. 74, Streblocladia clade) and Neosiphonia harveyi (Fig. 76, Melanothamnus clade). 49 Forming short straight series in P. denudata (Fig. 73, Carradoriella clade), and P. schneideri (Fig. 75, P. 50 schneideri clade). Scale bars: Figs 71, 74 and 76, 200 µm; Figs 72, 73 and 75, 400 µm. 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] Page 87 of 109 European Journal of Phycology
1 2 3 4 5 6 7 8 9 10 11 12 13 14 For Peer Review Only 15 16 17 18 19 20 21 22 23 24 25 Fig. 77. World map representing the proportion of Fernandosiphonia (black) and other Polysiphonieae (grey) 26 species in selected regions where the Polysiphonieae were studied in detail. Data were obtained from the 27 following references after updating the species names: Alaska: Lindstrom 28 (http://www.seaweedsofalaska.com); Brazil (Espírito Santo-São Paulo): Guimâraes et al. (2004); Hawaii: 29 Abbott (1999); Japan: Yoshida (1998); Korea: Nam & Kang (2012); Panama: Mamoozadeh & Freshwater 30 (2012); Spain (Galicia): Bárbara et al. (2005); British Isles: Maggs & Hommersand (1993). 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 88 of 109
1 2 3 4 5 Table S1. Sample information for the species included in the phylogenetic analysis. 6 7 8 9 Species (current name) Publication or collection data and GenBank accession number 10 For Peer Review Only 11 herbarium voucher for new sequences 12 rbcL SSU 13 14 15 Boergeseniella fruticulosa (Wulfen) Kylin Bárbara et al. (2013) / Choi et al. (2001) JX828161 AF427526 16 17 18 Boergeseniella thuyoides (Harvey) Kylin Bárbara et al. (2013) JX828125 JX828165 19 20 21 Brongniartella australis (C.Agardh) F.Schmitz Pope´s Eye, Port Phillip Bay, Victoria KX499546 KX499570 22 23 Australia, 1.xii.2014, P. Díaz-Tapia & V. 24 25 26 Marcelino; MEL 27 28 29 Brongniartella byssoides (Goodenough & Woodward) F.Schmitz Yang et al. (2016) / Fanan Head, Donegal, DQ787584 KX499571 30 31 Ireland, 15.vi.2015, P. Díaz-Tapia & C. 32 33 34 Maggs; SANT 31111 35 36 37 Bryocladia cuspidata (J.Agardh) De Toni Lin et al. (2001) AF259498 - 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 89 of 109 European Journal of Phycology
1 2 3 4 5 Ctenosiphonia hypnoides (Welwitsch ex J.Agardh) Falkenberg Ensenada Cegoñas, Lugo, Spain, KX499547 - 6 7 15.vii.2010, P. Díaz-Tapia & I. Bárbara; 8 9 SANT 24410 10 For Peer Review Only 11 12 13 Enelittosiphonia stimpsonii (Harvey) Kudo & Masuda Bárbara et al. (2013) / Choi et al. (2001) JX828126 AF427527 14 15 16 Fernandosiphonia unilateralis Levring Juan Fernández, Chile, E. Macayo; SANT KX499549-52 KX499572-3 17 18 31104-6 19 20 21 Fernandosiphonia unilateralis Levring Type material, GB KX499553 - 22 23 24 Herposiphonia parca Setchell Bárbara et al. (2013) - JX828166 25 26 27 Lampisiphonia iberica Bárbara, Secilla, Díaz & H.-G. Choi Bárbara et al. (2013) JX828129 JX828168 28 29 30 Leptosiphonia schousboei (Thuret) Kylin Bárbara et al. (2013) JX828133 JX828170 31 32 33 Lophosiphonia reptabunda (Suhr) Kylin Zumaia, Basque Country, Spain, KX499554 KX499574 34 35 36 18.iii.2011, P. Díaz-Tapia & I. Bárbara; 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 90 of 109
1 2 3 4 5 SANT 25139 6 7 8 Melanothamnus somalensis Bornet & Falkenberg Raaha Bay, Oman, 12.ix.2001, M. Wynne; KX499555 - 9 10 For Peer ReviewMICH 662274 Only 11 12 13 Melanothamnus afaqhusainii Bornet & Falkenberg Savoie & Saunders (2016, as M. KU564460 - 14 15 16 somalensis) 17 18 19 N. teradomariensis (M. Noda) M.S. Kim & I.K. Lee Bárbara et al. (2013) JX828136 JX828174 20 21 22 Neosiphonia bajacali (Hollenberg) N.R.Mamoozadeh & Mamoozadeh & Freshwater (2011) HM573572 HM560659 23 24 D.W.Freshwater 25 26 27 Neosiphonia baliana D.E.Bustamante, B.Y.Won & T.O.Cho Bustamante et al. (2013) KF146879 - 28 29 30 Neosiphonia collabens (C. Agardh) Díaz-Tapia & Bárbara Bárbara et al. (2013, as Streblocladia JX828157 JX828188 31 32 33 collabens) 34 35 36 Neosiphonia echinata (Harvey) N.Mamoozadeh & D.W.Freshwater Mamoozadeh & Freshwater (2011) HM573559 HM560658 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 91 of 109 European Journal of Phycology
1 2 3 4 5 Neosiphonia ferulacea (Suhr ex J.Agardh) S.M.Guimarães & Mamoozadeh & Freshwater (2011) HM573584 - 6 7 M.T.Fujii 8 9 10 Neosiphonia flavimarina M.For-S.Kim & I.K.Lee Peer ReviewKim & Yang (2006) Only DQ787481 - 11 12 13 Neosiphonia harveyi (J. Bailey) M.-S. Kim, H.-G. Choi, M.D. Bárbara et al. (2013) JX828134 JX828172 14 15 16 Guiry & G.W. Saunders 17 18 19 Neosiphonia peruviensis D.E.Bustamante, B.Y.Won, M.E.Ramirez Bustamante et al. (2012b) JN989969 - 20 21 & T.O.Cho 22 23 24 Neosiphonia cf. savatieri (Hariot) M.S.Kim & I.K.Lee Onno, Okinawa, Japan, 10.xi.2003, C. KX499558 25 26 27 Trowbridge; BM 28 29 30 Neosiphonia silvae D.E.Bustamante, B.Y.Won & T.O.Cho Bustamante et al. (2013) KF146878 - 31 32 33 Neosiphonia ramireziae D.E.Bustamante, B.Y.Won & T.O.Cho Bustamante et al. (2012a) KC493352 - 34 35 36 Neosiphonia sp. Mamoozadeh & Freshwater (2011) HM573573 HM560649 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 92 of 109
1 2 3 4 5 Neosiphonia sphaerocarpa (Børgesen) M.-S.Kim & I.K.Lee Mamoozadeh & Freshwater (2011) HM573569 - 6 7 8 Neosiphonia thailandica N.Muangmai & C.Kaewsuralikhit Muangmai et al. (2014) KM502785 - 9 10 For Peer Review Only 11 Neosiphonia tongatensis (Harvey ex Kützing) M.-S.Kim & I.K.Lee Mamoozadeh & Freshwater (2011) HM573570 HM560642 12 13 14 Neosiphonia yendoi (Segi) M.S. Kim & I.K. Lee Bárbara et al. (2013) JX828137 JX828175 15 16 17 Polysiphonia amplacapilli B.Kim & M.S.Kim Kim & Kim (2014) KF479253 - 18 19 20 Polysiphonia anomala Hollenberg Mamoozadeh & Freshwater (2011) HM573550 - 21 22 23 Polysiphonia aterrima J.D.Hooker & Harvey Stuercke & Freshwater (2010) / GU385831 HM560638 24 25 26 Mamoozadeh & Freshwater (2011) 27 28 29 Polysiphonia atlantica Kapraun & J.N. Norris Bárbara et al. (2013) JX828141 JX828179 30 31 32 Polysiphonia atlantica Kapraun & J.N. Norris Stuercke & Freshwater (2008) / - HM560631 33 34 Mamoozadeh & Freshwater (2011) 35 36 37 Polysiphonia binneyi Harvey Mamoozadeh & Freshwater (2011) HM573555 HM560636 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 93 of 109 European Journal of Phycology
1 2 3 4 5 Polysiphonia blandii Harvey Sandrigham, Port Phillip Bay, Victoria KX499556 - 6 7 Australia, 8.i.2015, P. Díaz-Tapia & 8 9 M.Brookes; SANT 31107 10 For Peer Review Only 11 12 13 Polysiphonia brodiei (Dillwyn) Sprengel McIvor et al. (2001) / Bárbara et al. (2013) AF342916 JX828192 14 15 16 Polysiphonia ceramiiformis P.Crouan & H.Crouan Wembury Point, Exeter, England, UK, KX499568 KX499575 17 18 23.iii.2016, P. Díaz-Tapia & C. Maggs; 19 20 SANT 31108 21 22 23 Polysiphonia constricta Womersley Stuercke & Freshwater (2010) / GU385832 HM560639 24 25 26 Mamoozadeh & Freshwater (2011) 27 28 29 Polysiphonia denudata (Dillwyn) Grevill ex Harvey Bárbara et al. (2013) JX828143 JX828182 30 31 32 Polysiphonia elongata (Hudson) Sprengel Bárbara et al. (2013) / Choi et al. (2001) JX828162 AF427529 33 34 35 Polysiphonia elongella Harvey McIvor et al. (2001) AF342913 - 36 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 94 of 109
1 2 3 4 5 Polysiphonia fibrata (Dillwyn) Harvey McIvor et al. (2001) / Kimmeridge, AF342915 KX499576 6 7 Dorset, England, UK, 6.vi.2015, P. Díaz- 8 9 Tapia & C. Maggs; SANT 31110 10 For Peer Review Only 11 12 13 Polysiphonia fibrillosa (Dillwyn) Sprengel McIvor et al. (2001) / Swangea, Dorset, AF342912 KX499577 14 15 England, UK, 7.vi.2015, P. Díaz-Tapia & 16 17 C. Maggs; SANT 31110 18 19 20 Polysiphonia foetidissima Cocks ex Bornet Díaz-Tapia et al. (2013) JQ653284 - 21 22 23 Polysiphonia forfex Harvey Rottnest Island, Western Australia, KX499565 - 24 25 26 15.iii.2015, P. Díaz-Tapia & J. Costa; 27 28 MEL 29 30 31 Polysiphonia freshwateri D.Bustamante, B.Y.Won & T.O.Cho Bustamante et al. (2015) KJ957812 - 32 33 34 Polysiphonia fucoides (Hudson) Sprengel Bárbara et al. (2013) / Mamoozadeh & JX828163 HM560627 35 36 37 Freshwater (2011) 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 95 of 109 European Journal of Phycology
1 2 3 4 5 Polysiphonia furcellata (C.Agardh) Harvey Pwllheli, Wales, UK, 20.viii.1998, C. KX499559 - 6 7 Maggs; BM 8 9 10 Polysiphonia cf. hancockii For(Dawson) R.E.Norris Peer ReviewMakung, Taiwan, v.2002, Only M. KX499548 - 11 12 13 Hommersand & S.-M. Lin; BM 14 15 16 Polysiphonia havanensis Montagne Mamoozadeh & Freshwater (2011) HM573554 HM560641 17 18 19 Polysiphonia homoia Setchell & N.L.Gardner Mamoozadeh & Freshwater (2011) HM573553 HM560653 20 21 22 Polysiphonia incompta Harvey Preekstoel, Western Cape, South Africa, KX499560 - 23 24 25.xi.2014, K. Dixon & J. Ferreira; MEL 25 26 27 Polysiphonia isogona Harvey Mamoozadeh & Freshwater (2011) / HM573578 KX499578 28 29 30 Frankston, Dave´s Bay, Port Phillip Bay, 31 32 Victoria, Australia, 19.xi.2014, H. 33 34 Verbruggen, MEL 35 36 37 Polysiphonia kapraunii B.Stuercke & D.W.Freshwater Stuercke & Freshwater (2008) / EU492920 HM560630 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 96 of 109
1 2 3 4 5 Mamoozadeh & Freshwater (2011) 6 7 8 Polysiphonia lobophoralis N.R.Mamoozadeh & D.W.Freshwater Mamoozadeh & Freshwater (2011) HM573551 HM560657 9 10 For Peer Review Only 11 Polysiphonia macrocarpa (C.Agardh) Sprengel Mamoozadeh & Freshwater (2011) - HM560632 12 13 14 Polysiphonia cf. minutissima Hollenberg Sunabe, Okinawa, Japan, 6.xi.2003, C. KX499557 - 15 16 Towbridge; BM 17 18 19 Polysiphonia morroides B.Kim & M.S.Kim Kim & Kim (2014) KF479257 - 20 21 22 23 Polysiphonia morrowii Harvey D’ Archino et al. (2013) / Choi et al. KC152488 AF427532 24 25 (2001) 26 27 28 Polysiphonia muelleriana J.Agardh Fujii et al. (2006) AY588412 - 29 30 31 Polysiphonia nigra (Hudson) Batters Bárbara et al. (2013) / Choi et al. (2001) JX828164 AF427534 32 33 34 Polysiphonia nuda N.R.Mamoozadeh & D.W.Freshwater Mamoozadeh & Freshwater (2011) HM573571 HM560648 35 36 37 Polysiphonia pacifica Hollenberg Kim et al. (2004) / Choi et al. (2001) AY958162 AF427533 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 97 of 109 European Journal of Phycology
1 2 3 4 5 Polysiphonia paniculata Montagne Kim et al. (2004) from Chile AY396040 - 6 7 8 Polysiphonia paniculata Montagne Zuccarello et al. (2004) from California - AY617144 9 10 For Peer Review Only 11 Polysiphonia pentamera Hollenberg Mamoozadeh & Freshwater (2011) HM573564 HM560643 12 13 14 Polysiphonia pseudovillum Hollenberg Mamoozadeh & Freshwater (2011) HM573568 HM560650 15 16 17 Polysiphonia sabulosia B.Kim & M.S.Kim Kim & Kim (2014) KF479250 - 18 19 20 Polysiphonia schneideri B.Stuercke & D.W.Freshwater Stuercke & Freshwater (2010) / GU385836 HM560629 21 22 23 Mamoozadeh & Freshwater (2011) 24 25 26 Polysiphonia scopulorum Harvey Bárbara et al. (2013) JX828149 JX828184 27 28 29 Polysiphonia scopulorum var. villum (J.Agardh) Hollenberg Mamoozadeh & Freshwater (2011) - HM560633 30 31 32 Polysiphonia sertularioides (Grateloup) J.Agardh FL1 Mamoozadeh & Freshwater (2011) HM573548 HM560646 33 34 35 Polysiphonia sertularioides (Grateloup) J.Agardh FL2 Mamoozadeh & Freshwater (2011) HM573547 HM560652 36 37 38 Polysiphonia sertularioides (Grateloup) J.Agardh FL3 Mamoozadeh & Freshwater (2011) HM573546 HM560647 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 98 of 109
1 2 3 4 5 Polysiphonia sp. Carlile (2009) GQ252567 - 6 7 8 Polysiphonia sp. Sunabe, Okinawa, Japan, 9.iii.2003, C. KX499561 - 9 10 For Peer ReviewTrowbridge; BM Only 11 12 13 Polysiphonia sp. Sail Rock, Taiwan, v.2002, M.H. KX499562 - 14 15 16 Hommersand; BM 17 18 19 Polysiphonia sp. Womersley Mamoozadeh & Freshwater (2011, as P. HM573576 HM560637 20 21 pernacola) 22 23 24 Polysiphonia sp. New Zealand, W. Freshwater, WNC 34062 KX499569 - 25 26 27 Polysiphonia stricta (Dillwyn) Greville Bárbara et al. (2013) / Choi et al. (2001) JX828151 AF427535 28 29 30 Polysiphonia strictissima J.D.Hooker & Harvey Stuercke & Freshwater (2010) / GU385833 31 32 33 Mamoozadeh & Freshwater (2011) - 34 35 36 Polysiphonia subtilissima Montagne Lam et al. (2013) / Mamoozadeh & JX294918 HM560634 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 99 of 109 European Journal of Phycology
1 2 3 4 5 Freshwater (2011) 6 7 8 Polysiphonia subulifera (C.Agardh) Harvey Kingstown Bay, Co. Galway, Ireland, KX499564 - 9 10 For Peer Review22.ix.1999, C. Maggs; BMOnly 11 12 13 Polysiphonia tripinnata J.Agardh Peinzás, Lugo, Spain, 18.ix.2008, P. Díaz- KX499566 - 14 15 16 Tapia & I. Bárbara; SANT 22246 17 18 19 Polysiphonia urbana Harvey Shelley Beach, Eastern Cape, South KX499567 - 20 21 Africa, 8.xii.2014, K. Dixon & J. Ferreira; 22 23 MEL 24 25 26 27 Polysiphonia virgata (C. Agardh) Sprengel Bárbara et al. (2013) JX828152 JX828185 28 29 Bárbara et al. (2013) - JX828187 30 Xiphosiphonia pennata (C. Agardh) Savoie & Saunders 31 32 33 Streblocladia glomerulata (Montagne) Papenfuss New Zealand, W. Freshwater; WNC KX499569 KX499579 34 35 34061 36 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 100 of 109
1 2 3 4 5 Symphyocladia latiuscula (Harvey) Yamada Kim et al. (2010) GQ867072 - 6 7 8 Symphyocladia linearis (Okamura) Falkenberg Bárbara et al. (2013) JX828158 JX828189 9 10 For Peer Review Only 11 Symphyocladia lithophila M.-S.Kim Kim et al. (2010) GQ867078 - 12 13 14 Vertebrata lanosa (Linneaeus) T. Christensen Stuercke & Freshwater (2008) / Phillips et EU492914 AF203886 15 16 al. (2000) 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 101 of 109 European Journal of Phycology
1 2 3 4 5 References Table S1. 6 7 8 Bárbara, I., Choi, H. G., Secilla, A., Díaz-Tapia, P., Gorostiaga, J. M., Seo, T. K., Jung, M. Y. & Berecibar, E. 2013. Lampisiphonia iberica gen. 9 10 et sp. nov. (Ceramiales, Rhodophyta)For based Peer on morphology and Review molecular evidence. Phycologia Only 52:137-55. 11 12 13 Bustamante, B.E., Won, B.Y. & Cho, T.O. (2012a). Neosiphonia ramirezii sp. nov. (Rhodomelaceae, Rhodophyta) from Peru. Algae. Algae 27: 14 15 79-82. 16 17 18 19 Bustamante, D.E., Won, B.Y., Ramírez, M.E. & Cho, T.O. (2012b). Neosiphonia peruviensis sp. nov. (Rhodomelacea, Rhodophyta) from the 20 21 Pacific coast of South America. Botanica Marina 55: 359-366. 22 23 24 Bustamante, D.E., Won, B.Y. & Cho, T.O. (2013). Neosiphonia baliana sp. nov. and N. silvae sp. nov. (Rhodomelaceae, Rhodophyta) from Bali, 25 26 Indonesia. Botanica Marina 56: 515-524. 27 28 29 Bustamante, D.E., Won, B.Y. & Cho, T.O. (2015). Polysiphonia freshwateri sp. nov. and Polysiphonia koreana sp. nov.: two new species of 30 31 32 Polysiphonia (Rhodomelaceae, Rhodophyta) from Korea. European Journal of Phycology 50: 330-342. 33 34 35 Carlile, A.L. (2009). Molecular systematics of North Pacific Ceramiaceae (Rhodophyta): Phylogeny, taxonomy, and phylogeography. PhD, 36 37 University of Washington. 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 102 of 109
1 2 3 4 5 Choi, H. G., Kim, M. S., Guiry, M. D. & Saunders, G. W. 2001. Phylogenetic relationships of Polysiphonia (Rhodomelaceae, Rhodophyta) and 6 7 its relatives based on anatomical and nuclear small-subunit rDNA sequence data. Canadian Journal of Botany 79:1465-76. 8 9 10 D'Archino, R., Neill, K. & ForNelson, W. A. 2013.Peer Recognition andReview distribution of Polysiphonia Onlymorrowii (Rhodomelaceae, Rhodophyta) in 11 12 New Zealand Botanica Marina 56:41-47. 13 14 15 Fujii, M. T., Guimarâes, S. M. P. D. B., Gurgel, C. F. D. & Fredericq, S. 2006. Characterization and phylogenetic affinities of the red alga 16 17 18 Chondrophycus flagelliferus (Rhodomelaceae, Ceramiales) from Brazil on the basis of morphological and molecular evidence. Phycologia 19 20 45:432-41. 21 22 23 Kim, B. & Kim, M.S. (2014). Three new species of Polysiphonia sensu lato (Rhodophyta) based on the morphology and molecular evidence. 24 25 26 Algae 29: 183-195. 27 28 29 Kim, M. S. & Yang, E. C. 2006. Taxonomy and phylogeny of Neosiphonia japonica (Rhodomelaceae, Rhodophyta) Based on rbcL and cpeA/B 30 31 Gene Sequences. Algae 21:287-94. 32 33 34 Kim, M.-S., Chan Yang, E., Mansilla, A. & Min Boo, S. (2004). Recent introduction of Polysiphonia morrowii (Ceramiales, Rhodophyta) to 35 36 Punta Arenas, Chile . Botanica Marina 47: 389-394. 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 103 of 109 European Journal of Phycology
1 2 3 4 5 Kim, M. S., Kim, S. Y. & Nelson, W. A. (2010). Symphyocladia lithophylla sp.nov. (Rhodomelaceae, Ceramiales), a new Korean red algal 6 7 species based on morphology and rbcL sequences. Botanica Marina 53:233-41. 8 9 10 Lam, W. D., García-Fernández,For M. E., Aboal, Peer M. & Vis, M. L. Review2013. Polysiphonia subtilissima Only (Ceramiales, Rhodophyta) from freshwater 11 12 habitats in North America and Europe is confirmed as conspecific with marine collections. Phycologia 52:156-60. 13 14 15 Mamoozadeh, N. R. & Freshwater, D. W. 2011. Taxonomic notes on Caribbean Neosiphonia and Polysiphonia (Ceramiales, Florideophyceae): 16 17 18 five species from Florida, USA and Mexico. Botanica Marina 54:269-92. 19 20 21 McIvor, L., Maggs, C. A., Provan, J. & Stanhope, M. J. 2001. rbcL sequences reveal multiple cryptic introductions of the Japanese red alga 22 23 Polysiphonia harveyi. Molecular Ecology 10:911-19. 24 25 26 Mamoozadeh, N. R. & Freshwater, D. W. 2012. Polysiphonia sensu lato (Ceramiales, Florideophyceae) species of Caribbean Panama including 27 28 29 Polysiphonia lobophoralis sp. nov. and Polysiphonia nuda sp. nov . Botanica Marina 55:317-347. 30 31 32 Muangmai, N., Yamagishi, Y., Maneekat, S & Kaewsuralikhit, C. (2014). The new species Neosiphonia thailandica sp. nov. (Rhodomelaceae, 33 34 Rhodophyta) from the Gulf of Thailand. Botanica Marina 57: 459-467 35 36 37 Phillips, L. E., Choi, H. G., Saunders, G. W. & Kraft, G. T. 2000. The morphology, taxonomy and molecular phylogeny of Heterocladia and 38 39 40 Trigenea (Rhodomelaceae, Rhodophyta), with delineation of the little known tribe Heterocladieae. Journal of Phycology 36:199-219. 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 European Journal of Phycology Page 104 of 109
1 2 3 4 5 Savoie, A.M. & Saunders, G.W. (2016). A molecular phylogenetic and DNA barcode assessment of the tribe Pterosiphonieae (Ceramiales, 6 7 Rhodophyta) emphasizing the Northeast Pacific. Botany 94: 917-939. 8 9 10 Stuercke, B. & Freshwater,For D. W. (2008). ConsistencyPeer of morphological Review characters used to deliOnlymit Polysiphonia sensu lato species (Ceramiales, 11 12 Florideophyceae): analyses of North Carolina, USA specimens. Phycologia 47:541-59. 13 14 15 Stuercke, B. & Freshwater, D. W. 2010. Two new species of Polysiphonia (Ceramiales, Florideophyceae) from the western Atlantic. Botanica 16 17 18 Marina 53:301-11. 19 20 21 Yang, E.C., Boo, S.B, Bhattacharya, D., Saunders, G.W., Knoll, A.H., Fredericq, S., Graf, L. & Yoon, H.S. (2016). Divergence time estimates 22 23 and the evolution of major lineages in the florideophyte red algae. Scientific Reports 6: 21361. 24 25 26 Zuccarello, G.C., Moon, D. & Goff, L.J. (2004). A phylogenetic study of parasitic genera placed in the family Choreocolacaceae (Rhodophyta). 27 28 29 Journal of Phycology 40: 937-945. 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 105 of 109 European Journal of Phycology
1 2 3 Table S2. List of herbarium specimens examined for comparison with Melanothamnus 4 5 species 6 7 Species Herbarium Code 8 Lophosiphonia mexicana E.Y.Dawson US EYD430 (66781) 9 Polysiphonia beaudettei Hollenberg US EYD21379 (5219) 10 11 Polysiphonia concinna Hollenberg US GJH2015 (61210) 12 Polysiphonia eastwoodae Setchell & US 55 (66788) 13 N.L.Gardner 14 Polysiphonia gorgoniae Harvey TCD TCD0012804 15 16 PolysiphoniaFor harlandii Peer Harvey ReviewTCD TCD0011955 Only 17 Polysiphonia inconspicua (P. confusa US GJH3285 (61222) 18 Hollenberg) 19 Polysiphonia johnstonii Setchell & US 110 (66795) 20 N.L.Gardner 21 22 Polysiphonia poko Hollenberg US GJH.65-82.6 (61243) 23 Hollenberg 24 Polysiphonia poko var longii US 2709.1 (61230) 25 Polysiphonia profunda Hollenberg US MSD19116AI1 (61231) 26 Polysiphonia rubrorhiza Hollenberg US 18740D (48527) 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] European Journal of Phycology Page 106 of 109 Table S3. Percentage of bases that differ (down) and are identical (above) for the species sequences of the Melanothamnus clade included in our rbcL alignment.
1 )
2
3
ramirezii
4
hancockii (as
5
cf.
iensis 6 minutissima
7 cf. sp. sp. 8 sp. 9 10 For Peer Review Only 11 12 Neosiphonia bajacali pseudovillum Polysiphonia Polysiphonia savatieri thailandica Neosiphonia Neosiphonia silvae Neosiphonia ferulacea Neosiphonia sp. Polysiphonia Polysiphonia blandii Polysiphonia flavimarina Neosiphonia harveyi Neosiphonia tongatensis Neosiphonia sphaerocarpa Neosiphonia collabens Neosiphonia Neosiphonia peruv simplex Neosiphonia simplex Neosiphonia forfex Polysiphonia Fernandosiphonia unilateralis afaqhusainii Melanothamnus somalensis Melanothamnus Fernandosiphonia strictissima Polysiphonia yendoi Neosiphonia Polysiphonia baliana Neosiphonia Polysiphonia nuda Polysiphonia incompta Polysiphonia teradomariensis Neosiphonia Neosiphonia bajacali 90.7 90.9 90.2 92.3 90.9 92.6 90.4 90.4 91.7 90.6 90.9 91.6 91.2 90.6 91.2 91.5 90.6 91 91.2 91.8 91.9 90.9 91.2 91.3 91.1 92 91.8 92.6 91.2 92.1 13 Polysiphonia pseudovillum 9.3 91.9 92.8 92 92.4 92.8 92.4 92.1 93.1 92.2 92.4 92.4 92.2 92.4 93 93 91.7 92.8 92.4 93.1 93.3 92.1 93.2 92.3 91.4 92.3 92.6 92.8 91.8 92.8 14 Polysiphonia savatieri 9.1 8.1 91.7 91.5 91.7 92.7 93.3 93.4 91.4 93 93.1 91.7 93.6 92.9 92.5 92 91.4 91.8 92.2 91.4 92.1 92.4 92.2 93.2 91.7 91.6 91.9 92.7 90.6 92.5 15 Neosiphonia thailandica 9.8 7.2 8.3 92.4 92.6 92.5 93.1 92.5 93 92.4 92.9 91.7 92.7 93.3 93.2 92.7 90.5 92.3 92 92.1 92 91.8 92.8 93.5 91.7 91.8 92.9 92.9 91 93.1 16 91.4 Neosiphoni17 a sp. 7.7 8 8.5 7.6 92.8 93.6 91.8 91.3 92.6 92 92.2 92.7 92.5 92.6 92.4 92.2 92.2 91.4 93.3 93.5 92 92.5 92.3 91.5 91.4 92.8 92.9 92.4 92.9 92.2 Neosiphoni18 a silvae 9.1 7.6 8.3 7.4 7.2 92.8 92.7 92 92.8 91.9 92.2 92.4 92.1 91.8 93.1 92.9 91.8 91.2 93.6 93.7 91.4 91.9 92.4 90.7 91.7 91.7 91.9 92.5 92.1 90.9 Neosiphonia19 ferulacea 7.4 7.2 7.3 7.5 6.4 7.2 92 91.8 93.8 92.9 92.9 93.3 92.6 92.3 93.3 93.2 93.2 93.1 94 94.1 92.6 92.8 93.1 92 92.6 93.3 93.5 93 93.7 91.5 Polysiphon20 ia sp. 9.6 7.6 6.7 6.9 8.2 7.3 8 96.5 92 92.7 93.5 92.2 94 94.3 94 93.5 92.6 92.3 91.6 92.5 92.7 92.6 93.3 92 93.1 92.9 92.5 91.8 93.8 Polysiphon21 ia cf. minutissima 9.6 7.9 6.6 7.5 8.7 8 8.2 3.5 91.7 91.9 92.3 92 93.5 93.2 92.7 91.9 91.4 91.5 91.8 91.4 91.7 91.9 91.3 92.6 91 91.1 91.4 92.2 90.2 92.1 Polysiphon22 ia blandii 8.3 6.9 8.6 7 7.4 7.2 6.2 8 8.3 91.8 92.3 95.8 92.1 91.9 93 92.6 90.9 94 92.1 92.8 92.6 92.2 92.8 93.3 92.3 91.7 93.4 93.3 93.3 93.4 Neosiphoni23 a flavimarina 9.4 7.8 7 7.6 8 8.1 7.1 7.3 8.1 8.2 99.6 93.7 92.8 93.4 93.7 93.7 92.5 92.9 93.4 92.4 92.9 95.7 96.1 95.8 91.6 92.4 92.7 93.2 91.6 93.7 Neosiphonia24 harveyi 9.1 7.6 6.9 7.1 7.8 7.8 7.1 6.5 7.7 7.7 0.4 93.9 93 94.3 94.2 94 92.8 93.3 93.3 92.5 93.3 95.8 96.7 96.7 91.9 93.5 92.9 93.1 92 94.3 Neosiphoni25 a tongatensis 8.4 7.6 8.3 8.3 7.3 7.6 6.7 7.8 8 4.2 6.3 6.1 92.1 92.4 93.5 93.3 91.9 93 92.7 93.2 93.3 93.1 93.6 93.4 92.9 93.7 94.2 94.1 91.9 94.3 Neosiphoni26 a sphaerocarpa 8.8 7.8 6.4 7.3 7.5 7.9 7.4 6 6.5 7.9 7.2 7 7.9 95.5 93.7 93.6 92.7 93.2 92.5 92.3 93 93.4 93 93.7 92.6 91.8 93.2 93 91.8 93.6 Neosiphoni27 a collabens 9.4 7.6 7.1 6.7 7.4 8.2 7.7 5.7 6.8 8.1 6.6 5.7 7.6 4.5 94.1 93.5 92.5 93.1 91.8 92 92.5 93.4 93.4 94.5 92 92.5 93 92.7 92.3 94.1 Neosiphoni28 a peruviensis 8.8 7 7.5 6.8 7.6 6.9 6.7 6 7.3 7 6.3 5.8 6.5 6.3 5.9 97.8 96.6 93.5 93.1 92.7 93.4 94.3 95 94.2 91.9 93.3 93.7 93.4 92.2 94.5 Neosiphoni29 a simplex (as ramirezii) 8.5 7 8 7.3 7.8 7.1 6.8 6.5 8.1 7.4 6.3 6 6.7 6.4 6.5 2.2 99 93.5 93.7 92.7 93.4 93.8 95 93.5 91.4 93 93.6 92.7 92.4 93.7 Neosiphoni30 a simplex 9.4 8.3 8.6 9.5 8.6 7.8 8.1 8.5 8.6 9.1 7.5 7.2 8.1 7.3 7.5 3.4 1 92.2 92.7 91.7 92.5 92.2 93.7 92.1 89.9 91.1 91.8 91.7 92.1 91.7 Polysiphonia31 forfex 9 7.2 8.2 7.7 7.8 8.2 6.8 7.4 8.5 6 7.1 6.7 7 6.8 6.9 6.5 6.5 7.8 95.3 92.6 93.1 92.8 93.4 93.8 92.3 93.5 94.2 93.3 91.8 94.8 Fernandosiphonia32 unilateralis 8.8 7.6 7.8 8 8.6 8.8 6.9 7.7 8.2 7.9 6.6 6.7 7.3 7.5 8.2 6.9 6.3 7.3 4.7 91.3 91.9 92.8 93.2 93.4 91.4 93.5 93 92.9 91.2 93.4 Melanotham33 nus afaqhusainii 8.2 6.9 8.6 7.9 6.7 6.4 6 8.4 8.6 7.2 7.6 7.5 6.8 7.7 8 7.3 7.3 8.3 7.4 8.7 98.6 91.9 92.7 92.4 91.6 92.9 93.7 93.2 93.1 93.3 Melanothamnus34 somalensis 8.1 6.7 7.9 8 6.5 6.3 5.9 7.5 8.3 7.4 7.1 6.7 6.7 7 7.5 6.6 6.6 7.5 6.9 8.1 1.4 92.7 93.5 93 92 93.2 94.1 93.5 93.5 94.1 Fernandosi35 phonia cf. hancockii 9.1 7.9 7.6 8.2 8 8.6 7.4 7.3 8.1 7.8 4.3 4.2 6.9 6.6 6.6 5.7 6.2 7.8 7.2 7.2 8.1 7.3 95.5 95.3 91.7 92.5 93 93 91.2 93.4 Polysiphon36 ia strictissima 8.8 6.8 7.8 7.2 7.5 8.1 7.2 7.4 8.7 7.2 3.9 3.3 6.4 7 6.6 5 5 6.3 6.6 6.8 7.3 6.5 4.5 96.1 91.3 93.8 93.3 93.2 92.2 93.9 Neosiphonia37 yendoi 8.7 7.7 6.8 6.5 7.7 7.6 6.9 6.7 7.4 6.7 4.2 3.3 6.6 6.3 5.5 5.8 6.5 7.9 6.2 6.6 7.6 7 4.7 3.9 91.5 93.3 92.7 93.2 92.5 94.1 Polysiphon38 ia sp. 8.9 8.6 8.3 8.3 8.5 9.3 8 8 9 7.7 8.4 8.1 7.1 7.4 8 8.1 8.6 10.1 7.7 8.6 8.4 8 8.3 8.7 8.5 93.8 95.8 94.5 90.3 95.3 Neosiphoni39 a baliana 8 7.7 8.4 8.2 8.6 8.3 7.4 6.9 8.9 8.3 7.6 6.5 6.3 8.2 7.5 6.7 7 8.9 6.5 6.5 7.1 6.8 7.5 6.2 6.7 6.2 95.6 97.4 91.4 96 Polysiphonia40 sp. 8.2 7.4 8.1 7.1 7.2 8.3 6.7 7.1 8.6 6.6 7.3 7.1 5.8 6.8 7 6.3 6.4 8.2 5.8 7 6.3 5.9 7 6.7 7.3 4.2 4.4 96 92 97.9 Polysiphon41 ia nuda 7.4 7.2 7.3 7.1 7.1 8.1 6.5 7.5 7.8 6.7 6.8 6.9 5.9 7 7.3 6.6 7.3 8.3 6.7 7.1 6.8 6.5 7 6.8 6.8 5.5 2.6 4 92.4 96 Polysiphon42 ia incompta 8.8 8.2 9.4 9 7.6 7.5 7 8.2 9.8 6.7 8.4 8 8.1 8.2 7.7 7.8 7.6 7.9 8.2 8.8 6.9 6.5 8.8 7.8 7.5 9.7 8.6 8 7.6 92.5 Neosiphonia43 teradomariensis 7.9 7.2 7.5 6.9 7.1 7.9 6.3 6.2 7.9 6.6 6.3 5.7 5.7 6.4 5.9 5.5 6.3 8.3 5.2 6.6 6.7 5.9 6.6 6.1 5.9 4.7 4 2.1 4 7.5 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 107 of 109 European Journal of Phycology Table S4. Percentage of bases that differ (down) and are identical (above) for the species sequences of the Vertebrata clade included in our rbcL alignment.
1
2
3
4
5 6 lobophoralis 7 8 9 10
For lanosa Vertebrata stimpsonii Enelittosiphonia constricta Polysiphonia Peer aterrima Polysiphonia Polysiphonia Boergeseniella fruticulosa thuyoides Boergeseniella tripinnata Polysiphonia Review furcellata Polysiphonia subulifera Polysiphonia australis Brongniartella hypnoides Ctenosiphonia reptabunda Lophosiphonia simulans Polysphonia Only urbana Polysiphonia foetidissima Polysiphonia isogona Polysiphonia paniculata Polysiphonia fucoides Polysiphonia Brongniartella byssoides nigra Polysiphonia 11 Vertebrata lanosa 89.8 90.3 91.4 91.7 90.8 91.2 91.5 90.5 90 91.9 90.2 89.8 90.9 91.6 91.9 91.6 91.4 91 91.3 91.2 12 Enelittosiphonia stimpsonii 10.2 91.1 90.9 91.3 91.5 91.3 92.3 91.4 90.7 93.1 91.5 90.7 90.1 92.2 91.6 91.7 92.2 90.7 92.3 91.2 13 Polysiphonia constricta 9.7 8.9 91 91.2 91.6 91.8 91.7 91 90.7 92.2 91.1 90.4 91.3 92.7 92.5 92 91.5 91.1 91.6 91.4 14 Polysiphonia aterrima 8.6 9.1 9 92.4 91.6 92.2 91.7 92.2 91.4 93.2 90.9 90.8 91.6 92.6 92.2 92.8 92.1 91.7 91.7 91.6 15 16 Polysiphonia lobophoralis 8.3 8.7 8.8 7.6 91.7 92.7 90.5 90.9 90.8 93.4 90.5 91 91.6 91.7 91.5 91.3 90.7 90.3 91 91.1 17 Boergeseniella fruticulosa 9.2 8.5 8.4 8.4 8.3 97.4 96.6 95.3 95.4 93.6 91.9 91.4 92 92.9 92.4 92.1 92.2 92 92.8 92.5 18 Boergeseniella thuyoides 8.8 8.7 8.2 7.8 7.3 2.6 96.4 96.1 95.5 94.6 92.2 91.5 92.9 94 93.5 93 92.8 92.4 93.1 93.3 19 Polysiphonia tripinnata 8.5 7.7 8.3 8.3 9.5 3.4 3.6 95.7 96.3 93.8 92.3 90.5 93.6 94.5 94.1 94.5 93.3 93.8 94.1 94.1 20 Polysiphonia furcellata 9.5 8.6 9 7.8 9.1 4.7 3.9 4.3 94.7 93.4 91.7 90.5 92 93.5 92.9 92.4 92 91.5 92.4 92.2 21 Polysiphonia subulifera 10 9.3 9.3 8.6 9.2 4.6 4.5 3.7 5.3 92.9 91.6 90 91.4 92.8 91.9 91.5 90.9 91.2 91.7 91.6 22 Brongniartella australis 8.1 6.9 7.8 6.8 6.6 6.4 5.4 6.2 6.6 7.1 92.6 92.1 92.4 94.6 94 94 93.3 92.5 93.5 93.5 23 Ctenosiphonia hypnoides 9.8 8.5 8.9 9.1 9.5 8.1 7.8 7.7 8.3 8.4 7.4 92.3 92.4 93.4 93.1 92.8 92.5 92.2 92.8 92.5 24 Lophosiphonia reptabunda 10.2 9.3 9.6 9.2 9 8.6 8.5 9.5 9.5 10 7.9 7.7 92 92.8 92.2 92.4 92.2 91.4 92.1 92.3 25 Polysphonia simulans 9.1 9.9 8.7 8.4 8.4 8 7.1 6.4 8 8.6 7.6 7.6 8 94.2 93.8 93.5 93.9 94.2 94.8 94.8 26 Polysiphonia urbana 8.4 7.8 7.3 7.4 8.3 7.1 6 5.5 6.5 7.2 5.4 6.6 7.2 5.8 97.9 97.4 94.7 94.5 95.3 95.2 27 Polysiphonia foetidissima 8.1 8.4 7.5 7.8 8.5 7.6 6.5 5.9 7.1 8.1 6 6.9 7.8 6.2 2.1 98.1 94.9 94.3 95.2 95.4 28 Polysiphonia isogona 8.4 8.3 8 7.2 8.7 7.9 7 5.5 7.6 8.5 6 7.2 7.6 6.5 2.6 1.9 95.1 94.2 94.8 95.2 29 Polysiphonia paniculata 8.6 7.8 8.5 7.9 9.3 7.8 7.2 6.7 8 9.1 6.7 7.5 7.8 6.1 5.3 5.1 4.9 94.3 95 95.5 30 Polysiphonia fucoides 9 9.3 8.9 8.3 9.7 8 7.6 6.2 8.5 8.8 7.5 7.8 8.6 5.8 5.5 5.7 5.8 5.7 95.7 96.4 31 Brongniartella byssoides 8.7 7.7 8.4 8.3 9 7.2 6.9 5.9 7.6 8.3 6.5 7.2 7.9 5.2 4.7 4.8 5.2 5 4.3 96.5 32 Polysiphonia nigra 8.8 8.8 8.6 8.4 8.9 7.5 6.7 5.9 7.8 8.4 6.5 7.5 7.7 5.2 4.8 4.6 4.8 4.5 3.6 3.5 33 34 35 36 37 38 39 40 41 42 43 44 45 URL: http:/mc.manuscriptcentral.com/tejp Email: [email protected] 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Spyridia_filamentosa_XX_DQ787579DQ787579 European Journal of Phycology Spyridia filamentosa Page 108 of 109 156.63 CallithamnionCallithamnion_consanguineum_XX_DQ787565 consanguineum DQ787565 187.69 SeirosporaSeirospora_interrupta_XX_DQ110903 interrupta DQ110903 127.8 CeramiumCeramium_seundatum_XX_DQ110904 secundatum DQ110904 227.25 CentrocerasCentroceras_clavulatum_XX_AY295175 clavulatum AY295175 1 GriffithsiaGriffithsia_corallinoides_XX_AY295164 corallinoides AY295164 194.96 PtilotaPtilota_gunneri_XX_DQ787575 gunneri DQ787575 2285.67 160.29 28.37 DasysiphoniaDasysiphonia_okiensis_XX_DQ787581 oldensis DQ787581 Dasya_collabens_XX_DQ787580DQ787580 3 133.16 Dasya collabens Delesseria_serrulata_XX_DQ787582DQ787582 4 68.19 Delesseria serrulata PhycodrysPhycodrys_rubens_XX_DQ787583 rubens DQ787583 5 ChondrophycusChondrophycus_intermedius_XX_DQ787585 intermedius DQ787585 SymphyocladiaSymphyocladia_lithophila_MaStrRow337_GQ867078_strain.S146_GB lithophila GQ867078 6 44.23 173.9 19.32 SymphyocladiaSymphyocladia_linearis_MaStrRow331_JX828158_strain.CH419_GB linearis JX828158 7 249.97 SymphyocladiaSymphyocladia_latiuscula_MaStrRow342_GQ867072_strain.S67_GB latiuscula GQ867072 8 155.39 PolysiphoniaPolysiphonia_kapraunii_MaStrRow844_EU492920_strain.NC.11_GB kapraunii EU492920 69.24 Polysiphonia_morrowii_MaStrRow873_KC152488_strain.SS0023_GBKC152488 9 30.08 Polysiphonia morrowii 18.3 PolysiphoniaPolysiphonia_stricta_MaStrRow997_JX828151_strain.CH1367_GB stricta JX828151 10 130.82 PolysiphoniaPolysiphonia_pacifica_MaStrRow912_AY958162_strain.P194_GB pacifica AY958162 11 54.33 BryocladiaBryocladia_cuspidata_MaStrRow415_AF259498_strain.XX_GB cuspidata AF259498 71.94 PolysiphoniaPolysiphonia_caespitosa_MaStrRow693_JX828149_strain.CH1290_GB scopulorum JX828149 12 58.44 PolysiphoniaPolysiphonia_freshwateri_CUK10427-H1_KJ957812_Kor freshwateri KJ957812 Polysiphonia sp. BYW-2015b ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast 13 47.69 PolysiphoniaPolysiphonia_subtilissima_MaStrRow1039_JX294918_strain.XX_GB subtilissima JX294918 199.75 PolysiphoniaPolysiphonia_atlantica_MaStrRow638_JX828141_strain.CH1268_GB atlantica JX828141 14 62.72 PolysiphoniaPolysiphonia_sertularioidesFL2_MaStrRow980_HM573547_strain.PHYKOS.3534_GB sertularioides HM573547 15 49.79 PolysiphoniaPolysiphonia_sertularioidesFL3_MaStrRow979_HM573546_strain.PHYKOS.3226_GB sertularioides HM573546 PolysiphoniaPolysiphonia_sertularioidesFL1_MaStrRow978_HM573548_strain.PHYKOS.2257_GB sertularioides HM573548 16 For Peer Review OnlyPolysiphoniaPolysiphonia_anomala_MaStrRow628_HM573550_strain.FL09.78_GB anomala HM573550 17 131.54 63.06 LampisiphoniaLampisiphonia_iberica_MaStrRow439_JX828131_strain.CH1533_GB iberica JX828129 PolysiphoniaPolysiphonia_sabulosia_12sp103_KF479250_Korea sabulosia KF479250 Polysiphonia sp. 1 MSK-2013 voucher 12sp1-03 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast 18 Enelittosiphonia_stimpsonii_MaStrRow432_JX828126_strain.CH073_GBJX828126 78.47 Enelittosiphonia stimpsonii 116.47 PolysiphoniaPolysiphonia_constricta_MaStrRow710_GU385832_strain.NZ04.256_GB constricta GU385832 19 GU385831 64.48 PolysiphoniaPolysiphonia_aterrima_MaStrRow635_GU385831_strain.NZ04.512_GB aterrima 20 90.07 BrongniartellaBrongniartella_australis_PD931_XX_VicChloropl australis KX499546 A new nucleotide sequence entered manually 164.77 73.54 21 PolysiphoniaPolysiphonia_lobophoralis_MaStrRow1083_HM573551_strain.PHYKOS.3537_GB lobophoralis HM573551 Vertebrata_lanosa_MaStrRow1183_EU492914_strain.G0420_GB Vertebrata lanosa EU492914 Vertebrata 22 PolysiphoniaPolysiphonia_furcellata_LMI.469_XX furcellata KX499559 83.08 41.37 23 22.2 BoergeseniellaBoergeseniella_thuyoides_MaStrRow409_JX828125_strain.CH824_GB thuyoides JX828125 24 35.25 BoergeseniellaBoergeseniella_martensiana_MaStrRow404_JX828161_strain.CH049_GB fruticulosa JX828161 26.29 PolysiphoniaPolysiphonia_subulifera_LMI1017.1_XX subulifera KX499564 25 79.06 PolysiphoniaPolysiphonia_tripinnata_SANT.Algae.222246_XX_AtlSpain tripinnata KX499566 PolysiphoniaPolysphonia_ceramiformis_2192_XX_EN ceramiiformis KX499568 26 140.79 62.32 44.75 LophosiphoniaLophosiphonia_reptabunda_SANT.Algae.25139_XX_AtlSpain reptabunda KX499554 27 CtenosiphoniaCtenosiphonia_hypnoides_SANT.Algae.24410_XX_AtlSpain hypnoides KX499547 28 59 32.21 BrongniartellaBrongniartella_byssoides_MaStrRow2159_DQ787584_strain.XX_GB byssoides DQ787584 25.99 PolysiphoniaPolysiphonia_nigra_MaStrRow899_JX828164_strain.CH048_GB nigra JX828164 29 49.59 PolysiphoniaPolysiphonia_fucoides_MaStrRow802_JX828163_strain.CH046_GB fucoides JX828163 PolysiphoniaPolysiphonia_paniculata_MaStrRow919_AY396041_strain.XX_GB paniculata AY396040 30 46.51 17.74 PolysiphoniaPolysiphonia_urbana1_JFC1486_XX_Southafrica urbana KX499567 31 PolysiphoniaPolysiphonia_isogona_MaStrRow838_HM573578_strain.NZ04.139_GB isogona HM573578 32 12.63 PolysiphoniaPolysiphonia_foetidissima_MaStrRow792_JQ653284_strain.LLAS3_GB foetidissima JQ653284 PolysiphoniaPolysiphonia_sp_NZ04-131_XXsp. KX499569 33 108.14 Polysiphonia_pernacola_MaStrRow927_HM573576_strain.NZ04.291_GBsp. HM573576 48.24 Polysiphonia 34 19.09 StreblocladiaStreblocladia_glomerulata_NZ04-185_XX glomerulata KX499569 PolysiphoniaPolysiphonia_muelleriana_MaStrRow891_AY588412_strain.LAF223.WELTASA356_GB muelleriana AY588412 35 Neosiphonia_echinata_MaStrRow482_HM573559_strain.FL09.44_GBHM573559 124.8 43.71 Neosiphonia echinata 36 22.6 PolysiphoniaPolysiphonia_binneyi_MaStrRow660_HM573555_strain.PHYKOS.2517_GB binneyi HM573555 37 PolysiphoniaPolysiphonia_havanensis_MaStrRow817_HM573554_strain.PHYKOS.2628_GB havanensis HM573554 21.77 PolysiphoniaPolysiphonia_virgata_MaStrRow1067_JX828152_strain.CH1671_GB virgata JX828152 38 72.76 PolysiphoniaPolysiphonia_denudata_MaStrRow728_JX828143_strain.CH1954_GB denudata JX828143 39 119.6 49.76 PolysiphoniaPolysiphonia_elongella_MaStrRow758_AF342913_strain.DNA.ID468_GB elongella AF342913 100.41 PolysiphoniaPolysiphonia_elongata_MaStrRow750_JX828162_strain.CH047_GB elongata JX828162 40 PolysiphoniaPolysiphonia_fibrata_MaStrRow763_AF342915_strain.DNA.ID257_GB fibrata AF342915 72.25 41 30.13 PolysiphoniaPolysiphonia_fibrillosa_MaStrRow766_AF342912_strain.DNA.ID255_GB fibrillosa AF342912 Polysiphonia_brodiei_MaStrRow671_AF342916_strain.DNA.ID438_GB 42 24.23 Polysiphonia brodiei AF342916 116.66 LeptosiphoniaLeptosiphonia_schousboei_MaStrRow447_JX828133_strain.CH826_GB schousboei JX828133 43 PolysiphoniaPolysiphonia_homoia_MaStrRow823_HM573553_strain.PHYKOS.3525_GB homoia HM573553 PolysiphoniaPolysiphonia_morroides_12sp505_KF479257_Korea morroides KF479257 Neosiphonia sp. 2 MSK-2013 voucher 12sp5-05 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplas 44 67.2 Polysiphonia_pentamera_MaStrRow924_HM573564_strain.PHYKOS.3529_GBHM573564 42.3 Polysiphonia pentamera 45 16.93 PolysiphoniaPolysiphonia_amplicapilli_12sp405_KF479253_Korea amplacapilli KF479253 Neosiphonia sp. 1 MSK-2013 voucher 12sp4-05 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloropla 46 103.86 PolysiphoniaPolysiphonia_schneideri_MaStrRow962_GU385836_strain.WNC2010.023.CWS#09.17.1_GB schneideri GU385836 42.16 PolysiphoniaPolysiphonia_blandi1_PD1161_XX blandii KX499556 47 Neosiphonia_tongatensis_MaStrRow569_HM573570_strain.PHYKOS.2704_GBHM573570 65.09 Neosiphonia tongatensis 48 96.97 32.28 PolysiphoniaPolysiphonia_succulenta_PD1571_XX_WA forfex KX499565 FernandosiphoniaFernandosiphonia_unilateralis_JF0192_XX unilateralis KX499549 49 57.59 18.38 NeosiphoniaNeosiphonia_baliana_MaStrRow463_KF146879_strain.XX_GB baliana KF146879 50 37.93 PolysiphoniaPolysiphonia_nuda_MaStrRow1071_HM573571_strain.PHYKOS.2613_GB nuda HM573571 Polysiphonia_sp1612_LMI1612_XXsp. KX499562 29.2 Polysiphonia 51 Polysiphonia_sp_LMI00_XX_Taiwansp. KX499561 19.52 Polysiphonia 52 75.7 NeosiphoniaNeosiphonia_teradomariensis_MaStrRow568_JX828136_strain.CH424_GB teradomariensis JX828136 Melanothamnus Neosiphonia_bajacali_MaStrRow462_HM573572_strain.MEX04.9_GBHM573572 53 62.19 Neosiphonia bajacali 48.92 PolysiphoniaPolysiphonia_incompta_JFC0734_XX_Southafrica incompta KX499560 54 54.26 NeosiphoniaNeosiphonia_silvae_MaStrRow563_KF146878_strain.XX_GB silvae KF146878 Melanothamnus_somalensis_XX AKX499555 new nucleotide sequence entered manually 48.91 Melanothamnus somalensis 55 Neosiphonia_ferulacea_MaStrRow486_HM573584_strain.PHYKOS.2287_GBHM573584 42.31 Neosiphonia ferulacea 56 72.83 NeosiphoniaNeosiphonia_sp3536_MaStrRow573_HM573573_strain.PHYKOS.3536_GBsp. HM573573 PolysiphoniaPolysiphonia_pseudovillum_MaStrRow944_HM573568_strain.PHYKOS.3533_GB pseudovillum HM573568 57 Neosiphonia_thailandica_N1_KM502785_ThailandiaKM502785 Neosiphonia thailandica isolate N1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast 58.74 Neosiphonia thailandica 58 NeosiphoniaPolysiphonia_savatieri_LMI.1579_XXcf. s avatieri KX499558 59 68.7 51.25 31.93 NeosiphoniaNeosiphonia_sphaerocarpa_MaStrRow566_HM573569_strain.FL05.6_GB sphaerocarpa HM573569 44.99 NeosiphoniaStreblocladia_collabens_MaStrRow467_JX828157_strain.CH2526_GB collabens JX828157 60 Polysiphonia_minutissima_LMI1585_XX 61.66 20.66 Polysiphoniacf. minutissima KX499557 PolysiphoniaPolysiphonia_spAC197_MaStrRow1082_GQ252567_strain.AC197_GBsp. GQ252567 16.24 NeosiphoniaNeosiphonia_peruviensis_MaStrRow549_JN989969_strain.TC6510_GB peruviensis Jn989969 50.28 NeosiphoniaNeosiphonia_simplex_MaStrRow555_KC493352_strain.TC6520_GB.OrigIDramireziae simplex KC493352 35.24 PolysiphoniaFernandosiphonia_hancockii_LMI.001_XX_Taiwancf. hancockii KX499548 29.62 PolysiphoniaPolysiphonia_strictissima_MaStrRow1028_GU385833_strain.NZ04.552_GB strictissima Gu385833 Neosiphonia_yendoi_MaStrRow572_JX828137_strain.CH420_GBJX828137 23.24 Neosiphonia yendoi NeosiphoniaNeosiphonia_harveyi_MaStrRow505_JX828134_strain.CH1381_GB harveyi JX828134 URL: http:/mc.manuscriptcentral.com/tejp Email:2.68 [email protected]_flavimarina_MaStrRow488_DQ787481_strain.6N.flav.Bangpo_GB flavimarina DQ787481
Ma 250200 150 100 50 0 250 200 150 100 50 0 SpyridiaSpyridia_filamentosa_XX_DQ787579 filamentosa DQ787579 Page 109 of 109 European Journal of Phycology SeirosporaSeirospora_interrupta_XX_DQ110903 interrupta DQ110903 291.88 CallithamnionCallithamnion_consanguineum_XX_DQ787565 consanguineum DQ787565 235.48 DQ110904 169.38 CeramiumCeramium_seundatum_XX_DQ110904 secundatum Centroceras_clavulatum_XX_AY295175AY295175 288.73 Centroceras clavulatum 1 GriffithsiaGriffithsia_corallinoides_XX_AY295164 corallinoides AY295164 248.27 PtilotaPtilota_gunneri_XX_DQ787575 gunneri DQ787575 2 Phycodrys_rubens_XX_DQ787583DQ787583 216.04 116.24 Phycodrys rubens 3 Delesseria_serrulata_XX_DQ787582DQ787582 285.74 187.69 Delesseria serrulata Dasysiphonia_okiensis_XX_DQ787581DQ787581 4 27.32 Dasysiphonia oldensis DasyaDasya_collabens_XX_DQ787580 collabens DQ787580 5 ChondrophycusChondrophycus_intermedius_XX_DQ787585 intermedius DQ787585 6 SymphyocladiaSymphyocladia_lithophila_MaStrRow337_GQ867078_strain.S146_GB lithophila GQ867078 73.51 Symphyocladia_linearis_MaStrRow331_JX828158_strain.CH419_GBJX828158 247.74 37.24 Symphyocladia linearis 7 280.3 SymphyocladiaSymphyocladia_latiuscula_MaStrRow342_GQ867072_strain.S67_GB latiuscula GQ867072 8 225.25 PolysiphoniaPolysiphonia_kapraunii_MaStrRow844_EU492920_strain.NC.11_GB kapraunii EU492920 137.08 Polysiphonia_morrowii_MaStrRow873_KC152488_strain.SS0023_GBKC152488 9 74.18 Polysiphonia morrowii 46.7 PolysiphoniaPolysiphonia_stricta_MaStrRow997_JX828151_strain.CH1367_GB stricta JX828151 10 210.18 PolysiphoniaPolysiphonia_pacifica_MaStrRow912_AY958162_strain.P194_GB pacifica AY958162 107.08 PolysiphoniaPolysiphonia_caespitosa_MaStrRow693_JX828149_strain.CH1290_GB scopulorum JX828149 11 BryocladiaBryocladia_cuspidata_MaStrRow415_AF259498_strain.XX_GB cuspidata AF259498 122.07 Polysiphonia_freshwateri_CUK10427-H1_KJ957812_KorKJ957812 12 257.41 93.77 Polysiphonia freshwateri 13 81.42 PolysiphoniaPolysiphonia_subtilissima_MaStrRow1039_JX294918_strain.XX_GB subtilissima JX294918 PolysiphoniaPolysiphonia_atlantica_MaStrRow638_JX828141_strain.CH1268_GB atlantica JX828141 14 108.65 PolysiphoniaPolysiphonia_sertularioidesFL2_MaStrRow980_HM573547_strain.PHYKOS.3534_GB sertularioides HM573547 15 90.71 PolysiphoniaPolysiphonia_sertularioidesFL3_MaStrRow979_HM573546_strain.PHYKOS.3226_GB sertularioides HM573546 PolysiphoniaPolysiphonia_sertularioidesFL1_MaStrRow978_HM573548_strain.PHYKOS.2257_GB sertularioides HM573548 16 For Peer Review OnlyPolysiphoniaPolysiphonia_anomala_MaStrRow628_HM573550_strain.FL09.78_GB anomala HM573550 Polysiphonia_sabulosia_12sp103_KF479250_KoreaKF479250 17 137.84 Polysiphonia sabulosia 223.38 LampisiphoniaLampisiphonia_iberica_MaStrRow439_JX828131_strain.CH1533_GB iberica JX828129 18 Polysiphonia_constricta_MaStrRow710_GU385832_strain.NZ04.256_GBGU385832 127.41 Polysiphonia constricta 19 179.14 EnelittosiphoniaEnelittosiphonia_stimpsonii_MaStrRow432_JX828126_strain.CH073_GB stimpsonii JX828126 101.67 VertebrataVertebrata_lanosa_MaStrRow1183_EU492914_strain.G0420_GB lanosa EU492914 20 138.66 Polysiphonia_lobophoralis_MaStrRow1083_HM573551_strain.PHYKOS.3537_GBHM573551 120.12 Polysiphonia lobophoralis Polysiphonia_aterrima_MaStrRow635_GU385831_strain.NZ04.512_GBGU385831 21 111.28 Polysiphonia aterrima Brongniartella_australis_PD931_XX_VicChloropl 22 Brongniartella australis KX499546 Vertebrata 204.71 PolysiphoniaPolysiphonia_furcellata_LMI.469_XX furcellata KX499559 132.03 70.87 Polysiphonia_tripinnata_SANT.Algae.222246_XX_AtlSpainKX499566 23 44.64 Polysiphonia tripinnata Polysiphonia_subulifera_LMI1017.1_XXKX499564 24 58.47 Polysiphonia subulifera 42.23 BoergeseniellaBoergeseniella_thuyoides_MaStrRow409_JX828125_strain.CH824_GB thuyoides JX828125 25 127.27 BoergeseniellaBoergeseniella_martensiana_MaStrRow404_JX828161_strain.CH049_GB fruticulosa JX828161 Polysiphonia_urbana1_JFC1486_XX_SouthafricaKX499567 26 56.35 Polysiphonia urbana 41.82 PolysiphoniaPolysiphonia_isogona_MaStrRow838_HM573578_strain.NZ04.139_GB isogona HM573578 27 PolysiphoniaPolysiphonia_foetidissima_MaStrRow792_JQ653284_strain.LLAS3_GB foetidissima JQ653284 197.64 101.3 KX499554 28 74.22 LophosiphoniaLophosiphonia_reptabunda_SANT.Algae.25139_XX_AtlSpain reptabunda Ctenosiphonia_hypnoides_SANT.Algae.24410_XX_AtlSpainKX499547 29 96.19 Ctenosiphonia hypnoides 87.92 PolysiphoniaPolysiphonia_paniculata_MaStrRow919_AY396041_strain.XX_GB paniculata AY396040 30 PolysiphoniaPolysphonia_ceramiformis_2192_XX_EN ceramiiformis KX499568 76.71 Brongniartella_byssoides_MaStrRow2159_DQ787584_strain.XX_GBDQ787584 60.38 Brongniartella byssoides 31 Polysiphonia_nigra_MaStrRow899_JX828164_strain.CH048_GBJX828164 48.77 Polysiphonia nigra 32 PolysiphoniaPolysiphonia_fucoides_MaStrRow802_JX828163_strain.CH046_GB fucoides JX828163 Polysiphonia_sp_NZ04-131_XXsp. KX499569 33 Polysiphonia 155.79 PolysiphoniaPolysiphonia_pernacola_MaStrRow927_HM573576_strain.NZ04.291_GBsp. HM573576 89.48 Streblocladia_glomerulata_NZ04-185_XXKX499569 34 35.26 Streblocladia glomerulata 35 PolysiphoniaPolysiphonia_muelleriana_MaStrRow891_AY588412_strain.LAF223.WELTASA356_GB muelleriana AY588412 NeosiphoniaNeosiphonia_echinata_MaStrRow482_HM573559_strain.FL09.44_GB echinata HM573559 176.82 123.31 36 84.49 PolysiphoniaPolysiphonia_havanensis_MaStrRow817_HM573554_strain.PHYKOS.2628_GB havanensis HM573554 37 PolysiphoniaPolysiphonia_binneyi_MaStrRow660_HM573555_strain.PHYKOS.2517_GB binneyi HM573555 Polysiphonia_elongella_MaStrRow758_AF342913_strain.DNA.ID468_GBAF342913 106.99 Polysiphonia elongella 38 127.19 PolysiphoniaPolysiphonia_elongata_MaStrRow750_JX828162_strain.CH047_GB elongata JX828162 Polysiphonia_virgata_MaStrRow1067_JX828152_strain.CH1671_GBJX828152 39 174.71 37.99 Polysiphonia virgata 150.53 PolysiphoniaPolysiphonia_denudata_MaStrRow728_JX828143_strain.CH1954_GB denudata JX828143 40 PolysiphoniaPolysiphonia_fibrata_MaStrRow763_AF342915_strain.DNA.ID257_GB fibrata AF342915 105.33 41 40.58 PolysiphoniaPolysiphonia_fibrillosa_MaStrRow766_AF342912_strain.DNA.ID255_GB fibrillosa AF342912 Polysiphonia_brodiei_MaStrRow671_AF342916_strain.DNA.ID438_GBAF342916 35.35 Polysiphonia brodiei 42 171.79 LeptosiphoniaLeptosiphonia_schousboei_MaStrRow447_JX828133_strain.CH826_GB schousboei JX828133 43 PolysiphoniaPolysiphonia_homoia_MaStrRow823_HM573553_strain.PHYKOS.3525_GB homoia HM573553 PolysiphoniaPolysiphonia_morroides_12sp505_KF479257_Korea morroides KF479257 44 110.28 Polysiphonia_pentamera_MaStrRow924_HM573564_strain.PHYKOS.3529_GBHM573564 73.57 Polysiphonia pentamera 45 PolysiphoniaPolysiphonia_schneideri_MaStrRow962_GU385836_strain.WNC2010.023.CWS#09.17.1_GB schneideri GU385836 156.25 32.21 46 PolysiphoniaPolysiphonia_amplicapilli_12sp405_KF479253_Korea amplacapilli KF479253 NeosiphoniaNeosiphonia_tongatensis_MaStrRow569_HM573570_strain.PHYKOS.2704_GB tongatensis HM573570 89.4 Polysiphonia_succulenta_PD1571_XX_WAKX499565 47 142.19 46.72 Polysiphonia forfex 48 FernandosiphoniaFernandosiphonia_unilateralis_JF0192_XX unilateralis KX499549 88.55 29.96 PolysiphoniaPolysiphonia_nuda_MaStrRow1071_HM573571_strain.PHYKOS.2613_GB nuda HM573571 49 NeosiphoniaNeosiphonia_baliana_MaStrRow463_KF146879_strain.XX_GB baliana KF146879 60.12 Neosiphonia_teradomariensis_MaStrRow568_JX828136_strain.CH424_GBJX828136 50 44.1 Neosiphonia teradomariensis 95.78 39.33 PolysiphoniaPolysiphonia_sp_LMI00_XX_Taiwansp. KX499562 51 PolysiphoniaPolysiphonia_sp1612_LMI1612_XXsp. KX499561 52 PolysiphoniaPolysiphonia_blandi1_PD1161_XX blandii KX499556 Melanothamnus Neosiphonia_bajacali_MaStrRow462_HM573572_strain.MEX04.9_GBHM573572 53 Neosiphonia bajacali 76.26 60.65 PolysiphoniaPolysiphonia_incompta_JFC0734_XX_Southafrica incompta KX499560 54 92.02 68.83 NeosiphoniaNeosiphonia_silvae_MaStrRow563_KF146878_strain.XX_GB silvae KF146878 Melanothamnus_somalensis_XX KX499555 55 66.63 Melanothamnus somalensis 57.27 NeosiphoniaNeosiphonia_sp3536_MaStrRow573_HM573573_strain.PHYKOS.3536_GBsp. HM573573 56 88.89 NeosiphoniaNeosiphonia_ferulacea_MaStrRow486_HM573584_strain.PHYKOS.2287_GB ferulacea HM573584 PolysiphoniaPolysiphonia_pseudovillum_MaStrRow944_HM573568_strain.PHYKOS.3533_GB pseudovillum HM573568 57 Neosiphonia_thailandica_N1_KM502785_ThailandiaKM502785 67.3 Neosiphonia thailandica 58 NeosiphoniaPolysiphonia_savatieri_LMI.1579_XXcf. s avatieri KX499558 59 84.07 59.88 22.01 PolysiphoniaPolysiphonia_spAC197_MaStrRow1082_GQ252567_strain.AC197_GBsp. GQ252567 53.65 PolysiphoniaPolysiphonia_minutissima_LMI1585_XXcf. minutissima KX499557 60 73.78 37.5 NeosiphoniaStreblocladia_collabens_MaStrRow467_JX828157_strain.CH2526_GB collabens JX828157 NeosiphoniaNeosiphonia_sphaerocarpa_MaStrRow566_HM573569_strain.FL05.6_GB sphaerocarpa HM573569 Neosiphonia_simplex_MaStrRow555_KC493352_strain.TC6520_GB.OrigIDramireziaeKC493352 23.67 Neosiphonia simplex NeosiphoniaNeosiphonia_peruviensis_MaStrRow549_JN989969_strain.TC6510_GB peruviensis Jn989969 66.07 Fernandosiphonia_hancockii_LMI.001_XX_Taiwancf. KX499548 44.58 Polysiphonia hancockii 39.53 PolysiphoniaPolysiphonia_strictissima_MaStrRow1028_GU385833_strain.NZ04.552_GB strictissima Gu385833 NeosiphoniaNeosiphonia_yendoi_MaStrRow572_JX828137_strain.CH420_GB yendoi JX828137 33.79 NeosiphoniaNeosiphonia_harveyi_MaStrRow505_JX828134_strain.CH1381_GB harveyi JX828134 URL: http:/mc.manuscriptcentral.com/tejp Email:4.83 [email protected]_flavimarina_MaStrRow488_DQ787481_strain.6N.flav.Bangpo_GB flavimarina DQ787481
Ma 250 200 150 100 50 0 250 200 150 100 50 0