Widely Distributed Red Algae Often Represent Hidden Introductions, Complexes of Cryptic Species Or Species with Strong Phylogeographic Structure1

WIDELY DISTRIBUTED RED ALGAE OFTEN REPRESENT HIDDEN INTRODUCTIONS, COMPLEXES OF CRYPTIC SPECIES OR SPECIES WITH STRONG PHYLOGEOGRAPHIC STRUCTURE1

Pilar Dıaz-Tapia 2 Coastal Biology Research Group, Faculty of Sciences and Centre for Advanced Scientiﬁc Research (CICA), University of A Coruna~ 15071, A Coruna,~ Spain School of BioSciences, University of Melbourne, Melbourne, Victoria 3010, Australia Christine A. Maggs Portaferry Marine Laboratory, Queen’s University Belfast, Belfast BT22 1PF, UK Erasmo C. Macaya Laboratorio de Estudios Algales (ALGALAB), Departamento de Oceanografıa, Facultad de Ciencias Naturales y Oceanograﬁcas, Universidad de Concepcion, Concepcion, Chile Millennium Nucleus Ecology and Sustainable Management of Oceanic Island (ESMOI), Larrondo, 1281, Coquimbo, Chile Centro FONDAP de Investigaciones en Dinamica de Ecosistemas Marinos de Altas Latitudes (IDEAL), Valdivia, Chile and Heroen Verbruggen School of BioSciences, University of Melbourne, Melbourne, Victoria 3010, Australia

Despite studies suggesting that most seaweeds are spinifera). This study shows that widely distributed poor dispersers, many red algal species are reported species are the exception in marine red algae, unless to have circumglobal distributions. Such distributions they have been spread by humans. have mostly been based on morphological iden- Key index words: Herposiphonieae; introductions; new tifications, but molecular data have revealed a range record; phylogeography; Polysiphonieae; Pterosipho- of issues with morphologically defined species nieae; rbcL; Rhodomelaceae; species boundaries; spe- boundaries. Consequently, the real distribution of cies complexes such reportedly circumglobal species must be questioned. In this study, we analyzed molecular data sets (rbcL gene) of nine species in the Rhodo- melaceae for which samples were available from Phylogeography of marine organisms is influ- widely spaced geographical locations. Three overall enced by barriers to dispersal and geographical dis- patterns were identified: (i) species showing strong tance, as well as by aspects of their life-history, phylogeographic structure (i.e., phylogenetic simi- physiology and ecology (Jackson 1974, Palumbi larity correlates with geographical provenance), often 1994, Riginos et al. 2011). The dispersal ability of to the point that populations from different loca- seaweeds is generally very limited, of the order of tions could be considered as different species tens of meters or less (Santelices 1990, Kinlan and (Lophosiphonia obscura, Ophidocladus simpliciusculus, Gaines 2003, Destombe et al. 2009). However, Polysiphonia villum, and Xiphosiphonia pinnulata); (ii) long-distance dispersal is known in brown seaweeds species with a broad distribution that is explained, with buoyant structures (Fraser et al. 2009, Macaya in part, by putative human-mediated transport and Zuccarello 2010), which can act as rafts pro- (Symphyocladia dendroidea and Polysiphonia moting in turn the dispersal of the epiphytic spe- devoniensis); and (iii) non-monophyletic complexes of cies that they host (Fraser et al. 2013, Macaya et al. cryptic species, most with a more restricted 2016, Lopez et al. 2017, 2018). Still, a large propor- distribution than previously thought (Herposiphonia tion of macroalgae are epilithic, so their expected tenella, Symphyocladia dendroidea, and the dispersal ability is very limited and consequently Xiphosiphonia pennata complex that includes the their distribution range is expected to be relatively species Xiphosiphonia pinnulata and Symphyocladia small. Paradoxically, many macroalgal species are reported to be very widely or even globally distributed. 1 Received 7 April 2018. Accepted 8 August 2018. First Published Records are usually based only on morphological Online 23 August 2018. 2Author for correspondence: e-mail [email protected]. identification, which can be inaccurate due to mor- Editorial Responsibility: K. Muller€ (Associate Editor) phological plasticity within species as well as

1 2 PILAR DIAZ-TAPIA ET AL. similarity between cryptic species (e.g., Verbruggen (Airoldi 1998, Dıaz-Tapia et al. 2013a). This makes 2014, Schneider et al. 2017). Closer investigation of the family a good candidate to test hypotheses material from distant regions using DNA data com- about species distributions and phylogeographic monly leads to the discovery of cryptic species (e.g., patterns. Won et al. 2009, Bustamante et al. 2014, Schneider The objective of this paper is to reassess the wide et al. 2017). Even though studies combining mor- reported distributions of nine turf-forming species phological and molecular data are increasing, DNA of the family Rhodomelaceae using DNA sequences. databases are still very limited for most algal groups Using molecular data from distant locations within and molecular data are often available only for each species’ reported distribution range, we evalu- some regions. As a consequence, the true distribu- ate whether these are indeed widely distributed spe- tion of many seaweed species should be regarded as cies, analyze the observed phylogeographic patterns, uncertain. Few studies have reassessed the distribu- and consider whether these species may have been tion of widely reported red algal species using introduced into one or several regions by human molecular data from a broad sampling area. Com- activities. plexes of look-alike species, as well as widely distributed species, have been detected (Zuccarello et al. 1999, 2002a, Zuccarello and West 2003, Won MATERIALS AND METHODS et al. 2009). Among the widely distributed species, Material of Herposiphonia tenella, Lophosiphonia obscura, Ophi- some exhibit high genetic variability and strong phy- docladus simpliciusculus, Polysiphonia villum, P. devoniensis, Sym- logeographic structure that often distinguishes pop- phyocladia spinifera, S. dendroidea, Xiphosiphonia pennata, and X. ulations from different basins (Zuccarello et al. pinnulata was collected in Norway, United Kingdom, France, 2002a,b, Won et al. 2009). Other widely distributed Spain, Portugal, Italy, Brazil, Chile, Australia, and South species lack phylogeographic signal, suggesting Africa during general sampling surveys of the family Rhodo- melaceae (Table S1 in the Supporting Information). All these long-distance dispersal processes by unknown mech- species form epilithic turfs, most of them on intertidal sand- anisms (Zuccarello et al. 2002a, Fraser et al. 2013). covered rocks (Womersley 2003, Dıaz-Tapia and Barbara Therefore, red algal phylogeographic patterns are 2013). Lophosiphonia obscura was found in North Atlantic highly heterogeneous and depend on evolutionary brackish water coastal lagoons or estuaries, and S. dendroidea was collected in Australian and Chilean shallow subtidal turfs. histories and dispersal abilities. – In addition to natural dispersal mechanisms, Distribution maps of records for these species (Figs. 1 3, lines) were drawn up based on information available in human-mediated vectors can transport seaweeds AlgaeBase and references therein (Guiry and Guiry 2018). from native areas to other world regions and rapidly DNA was extracted from silica gel-dried material following alter distribution patterns (Straub et al. 2016). More Saunders and McDevit (2012), using the Qiagen DNeasy than 200 red algal species have been considered as Plant Mini Kit (Qiagen GmbH, Hilden, Germany) or the Pro- introduced or cryptogenic in one or several regions mega Wizard Magnetic 96 DNA Plant System kit (Promega (Thomsen et al. 2016). Cryptic introductions are Corporation, Madison, WI, USA), following the manufac- common in the red algae and non-native species turer’s instructions. PCR amplification was carried out for the rbcL gene using primers F7/RrbcStart, F7/R893 or F57/ often remain unnoticed until diversity surveys use rbcLrevNEW (Freshwater and Rueness 1994, Mamoozadeh molecular tools (McIvor et al. 2001, Zuccarello et al. and Freshwater 2011, Saunders and Moore 2013), as well as 2002b, Dıaz-Tapia et al. 2013b, 2017a). Considering the newly designed primers F2 (TGTCTAACTCTGTAGAA the low dispersal ability of non-buoyant epilithic red CAACGGA), F8 (ACTCTGTAGAASAACGGACAMG), R1008 algae, we hypothesize that the distribution of most (AACTACTACAGTACCAGCATG), R1464 (AACAT truly cosmopolitan species can be explained by TAGCTGTTGGAGTTTCYAC) and R1452 (TGGAGTTTCYA – CRAAGTCAGCTGT). Names of these primers indicate their human-mediated transport which is frequently position in the rbcL gene (e.g., first base of F2 primer corre- provided as a potential explanation for wide distri- sponds with the second base of the rbcL gene). PCR reactions butions of species (Zuccarello et al. 2002a,b, Fraser were performed in a total volume of 25 lL containing 19 et al. 2013). MyTaqTM reaction buffer, 0.28 lM forward and reverse pri- The Rhodomelaceae, with >1,000 recognized spe- mers, 0.125 units My TaqTM DNA Polymerase (Bioline, Lon- don, UK) and 1 lL template DNA. The PCR profile cies, is the most diverse red algal family (Guiry and ° Guiry 2018). It includes numerous examples of consisted of initial denaturation (93 C for 3 min), 35 cycles of denaturation (94°C for 30 s), primer annealing (45°C for widely reported species and, as in most red algal 30 s), and extension (74°C for 90 s) and final extension groups, cryptic diversity is common (e.g., Zuc- (74°C for 5 min). The PCR products were purified and carello et al. 2002a, 2018, Dıaz-Tapia and Barbara sequenced at Queen’s University of Belfast on an AB3730xl 2013, Bustamante et al. 2014, Savoie and Saunders DNA Analyzer (Applied Biosystems, Foster City, CA, USA) or commercially by Macrogen or the sequencing service of the 2016). Among the red algae the Rhodomelaceae ~ accounts for the largest number of introduced spe- University of A Coruna. cies (Williams and Smith 2007). Members of this A total of 128 new rbcL sequences were generated in this study and an additional 91 sequences were downloaded from family are often major components of algal turfs GenBank (Table S1). Length of sequences ranged from 585 where canopy-forming brown algae with buoyant to 1,467 (Table S1). Sequences were aligned using MUSCLE structures are rare as a consequence of the stressful in Geneious 6.1.8 (Kearse et al. 2012). As a first stage, we conditions imposed by the presence of sediment analyzed these sequences in taxon-rich data sets for the tribes RED ALGAE WITH WIDE GEOGRAPHICAL DISTRIBUTIONS 3

FIG. 1. Distribution and UPGMA unrooted distance phylogram based on rbcL sequences of (a, b) Ophidocladus simpliciusculus, (c, d) Lophosiphonia obscura (as Polysiphonia hemisphaerica and P. boldii in Norway and Texas, respectively, see Appendix S1), and (e, f) Polysiphonia villum. In panels a, c and e, circles indicate the regions from which sequences are available and their colors indicate the distribution of haplotypes. Areas outlined in red are regions where the species is recorded for the ﬁrst time. Coastline in black shows the reported distribution (Guiry and Guiry 2018). (c) Black coastlines represent the recorded distribution of L. obscura, red line P. hemisphaerica and yellow line P. boldii. Scale bars: 5 mm in (a), 8 mm in (c), 6 mm in (e).

Herposiphonieae, Pterosiphonieae, Polysiphonieae, and Stre- trees based on our phylogenomic analyses of the major lin- blocladieae to verify that the target species were mono- eages of the Rhodomelaceae (Dıaz-Tapia et al. 2017b). phyletic. Based on the resulting trees, we selected all sequences corresponding to the species (or group of closely related species) that are the focus of this paper. These data RESULTS sets were analyzed species by species using the unweighted pair group method with arithmetic mean (UPGMA). For two The taxonomy of several of the studied species is complexes of non-sister species in our initial taxon-rich trees complex and details are provided in Appendix S1 in (Symphyocladia dendroidea and Herposiphonia tenella), we the Supporting Information. included wider species sampling considering the available Ophidocladus simpliciusculus. data for the respective genera (Table S1). We performed Ophidocladus simpliciusculus was collected in four out maximum likelihood (ML) analyses separately for each of the of the six world regions where it has been reported two genera using RAxML 8.1.X (Stamatakis 2014). GTR- Gamma was used as the nucleotide model and branch sup- (Fig. 1a). The UPGMA analyses included 15 newly port was estimated with 1,000 bootstrap replicates. Three spe- determined rbcL sequences and two downloaded cies of Xiphosiphonia and Dipterosiphonia were selected as the from GenBank (Table S1). Sequences comprised respective outgroups for the Symphyocladia and Herposiphonia four haplotypes (Fig. 1b): haplotype 1, seven 4 PILAR DIAZ-TAPIA ET AL.

FIG. 2. Distribution and UPGMA unrooted distance phylogram based on rbcL sequences of (a, b) Polysiphonia devoniensis (as Polysiphonia kaprauni in North Carolina), (c, d) Symphyocladia dendroidea and (e, f, g) S. spinifera/Xiphosiphonia pennata/Xiphosiphonia pinnulata. Symbols are as in Figure 1, and pie divisions in panels a, c, and e indicate proportions of each haplotype when multiple haplotypes were present. In panel e, circles with white border correspond to S. spinifera and the ones with black border to X. pinnulata. Encircled areas marked with red color are regions where the species are here recorded for the ﬁrst time. (a) Black lines represent the recorded distribution of P. devoniensis and red line the distribution of P. kapraunii. In panel c, black lines represent the recorded distribution of S. dendroidea, blue lines the regions where it was recorded as S. tanakae, red line the region where molecular data demonstrated that S. dendroidea 2 is present, the asterisk indicates the area where both S. dendroidea 2 and S. tanakae were reported based on molecular data, and plus symbols the regions from which sequences of S. dendroidea 2 are available. (e) Black lines represent the recorded distribution of X. pennata; yellow lines the regions where molecular data showed the presence of S. spinifera instead X. pennata, red lines regions where only X. pinnulata has been recorded based on molecular data and blue line the region where both X. pinnulata and X. pennata have been recorded based on molecular data. Scale bars: 6 mm in (a), 7 mm in (c), 4 mm in (e). RED ALGAE WITH WIDE GEOGRAPHICAL DISTRIBUTIONS 5

FIG. 3. Distribution of Herposiphonia tenella. Asterisks indicate the regions from which sequences are available. Scale bar: 1 mm.

samples from Europe (Atlantic and Mediterranean); (Fig. 1e). Furthermore, it was also sampled in Spain, haplotype 2, six samples from Australia; haplotype the French Mediterranean, and Australia, where it is 3, one sample from South Africa; and haplotype 4, here newly recorded. The 13 sequences determined three samples from Brazil. The South African sam- for P. villum and the two downloaded from Gen- ple differed by only 0.1% (1 bp) from the Aus- Bank (Table S1) belong to three haplotypes tralian samples, while Brazilian samples were the (Fig. 1f): (i) four samples from Australia, (ii) three most divergent (up to 0.8% and 11 bp) from sam- samples from Brazil and 3) eight samples from the ples from other regions. Our results indicate that North Atlantic (North Carolina, Spain, and France). Ophidocladus simpliciusculus has a unique rbcL haplo- Australian samples were 0.5%–0.6% (4–7 bp) diver- type in each region, but it has a strong phylogeo- gent from the Atlantic samples and the Brazilian graphic structure. sequences differed by 0.2% (2 bp) from the North Lophosiphonia obscura. Atlantic samples. Thus, P. villum shows a clear phy- Lophosiphonia obscura has been reported in the Atlan- logeographic structure. tic and Indo-Pacific and sequences are available Polysiphonia devoniensis. from Europe and Australia (Fig. 1c). Furthermore, Our data set included samples from the previously our data set also included Polysiphonia hemisphaerica recorded distribution in Atlantic Europe, as well as from Norway and P. boldii from Texas, USA which from the northwestern Mediterranean (Italy and may be conspecific as suggested by the low rbcL France), the Adriatic Sea (Italy), and Victoria (Aus- divergence from L. obscura (see Appendix S1). We tralia), from where Polysiphonia devoniensis is here analyzed six newly determined rbcL sequences and recorded for the first time (Fig. 2a, Table S1). Fur- two downloaded from GenBank for L. obscura, thermore, sequences of Polysiphonia kapraunii from P. hemisphaerica, and P. boldii (Table S1). Four hap- North Carolina were also included in our data set lotypes were found (Fig. 1d): (i) four samples from (see Appendix S1). Analyses including an rbcL Spain (Atlantic and Mediterranean) and Norway; sequence of P. kapraunii from GenBank and 21 (ii) a sample from the United Kingdom; (iii) a sam- newly determined sequences of Polysiphonia devonien- ple from USA; and (iv) two samples from Australia. sis (Table S1) showed eight haplotypes (Fig. 2b). Atlantic samples differed by 0.1%–0.2% (1–2 bp), One haplotype was found in the northwestern while Australian samples were 0.7%–0.9% (8–11bp) Mediterranean, Atlantic Spain, and Australia; one divergent from the Atlantic samples. Our results occurred in the Adriatic Sea and the northwestern indicate that the lineage formed by these three taxa Mediterranean; and six haplotypes were each repre- is moderately variable in the North Atlantic, and is sented by a single sample (two from Wales, two clearly separated from the Australian populations. from the Adriatic Sea, one from the northwestern Polysiphonia villum. Mediterranean and one from North Carolina). The Molecular data were obtained from two regions North Carolina sample identified as P. kapraunii was where Polysiphonia villum (as P. scopulorum var. vil- 0.2%–0.3% (3–4 bp) divergent from two of the lum, see Appendix S1) had previously been reported European samples (PD301 and PD2430). These 6 PILAR DIAZ-TAPIA ET AL. three samples differ from the others by sequence four correspond to Korean samples, four to Peru- divergences of 1%–1.4% (12–18 bp), while diver- vian samples, one to Australian samples and one to gence between the other five haplotypes is 0.1%–1% a Washingtonian sample (Fig. 2f). Sequence diver- (1–9 bp). The lineage formed by samples assigned gence among haplotypes is up to 0.9% (7 bp). Aus- to Polysiphonia devoniensis and P. kapraunii has a tralian samples match the morphological concept of high genetic diversity and the distribution of haplo- Xiphosiphonia pennata, but our molecular data reveal types lacks geographic structure. that none of them grouped with the European Symphyocladia dendroidea complex. X. pennata but instead are mostly closely related to Sequences of Symphyocladia dendroidea are available S. spinifera. Therefore, X. pennata should be from most of the previously known distribution (Bri- excluded from the recorded Australian flora and tish Columbia, California, Chile, Peru, Japan, and replaced by S. spinifera. Interestingly, all the Aus- the Mediterranean). Some of these sequences were tralian samples belong to a single haplotype, which labeled as Pterosiphonia tanakae (see Appendix S1). contrasts with the four haplotypes found in both Furthermore, we collected this species in a Galician Peru and Korea. marina (northwestern Spain) and in Australia (Vic- Xiphosiphonia pinnulata sequences were resolved as toria), where it is here recorded for the first time three haplotypes of which two were found in Euro- (Fig. 2c). pean samples and one in Brazilian samples The rbcL data for Symphyocladia dendroidea reveal (Fig. 2g). Sequence divergence among them is up cryptic diversity in the Americas, as specimens from to 0.7% (9 bp) and between the two European Peru and Chile and specimens from British Colum- clades is up to 0.3% (3 bp). Xiphosiphonia pennata bia (here referred as S. dendroidea 2) do not consti- was only found in the Atlantic Iberian Peninsula. tute a clade (Fig. S1 in the Supporting Information, Therefore, the widely reported X. pennata (as Pterosi- Table S1). In addition to these regions, both were phonia pennata) is apparently restricted to European recorded in California. Symphyocladia dendroidea is shores. Xiphosiphonia pinnulata is restricted to the resolved as sister to S. parasitica with high support, Atlantic, where it has a strong phylogeographic while S. dendroidea 2 is placed in a moderately sup- structure with divergences that may even suggest ported clade together with S. brevicaulis and S. baileyi they are separate species. Symphyocladia spinifera is (Fig. S1). Molecular data show that S. dendroidea has restricted to the Pacific and it has a high genetic a wide distribution in the Pacific and occurs in variability between regions and within regions in some European locations, while S. dendroidea 2is Korea and South America. apparently restricted to Pacific North America. Herposiphonia tenella complex. In total, 28 rbcL sequences were analyzed for In total, 27 rbcL sequences were obtained for samples Symphyocladia dendroidea (some sequences labeled as morphologically identified as Herposiphonia tenella S. tanakae, see Appendix S1) including 13 newly from Europe, North America and Queensland (Aus- determined and 15 downloaded from GenBank tralia; Fig. 3). They were analyzed together with the (Table S1). The UPGMA dendrogram shows seven available rbcL data for the genus (15 species). The haplotypes (Fig. 2d) of which five comprise samples phylogeny resolved H. tenella in seven lineages, four from Pacific South America, one includes samples from the Atlantic and three from Queensland from Australia and Japan, and the other consists of (Fig. 4). Sequence divergence among the lineages samples from California and Europe. Maximum vari- was at least 1.9%, while divergence within them was ability between South American haplotypes is 0.6% up to 0.7%. Only two of these lineages were resolved (8 bp), and sequence divergence between them and as sisters (1.9%–2.1% sequence divergence), while the two other clades is 0.4%–1% (3–9 bp). These the others, despite morphological similarities, were levels of rbcL variation suggest that this entity may more closely related to other lineages. Thus, consist of multiple species or highly differentiated H. tenella is a large species complex that requires tax- populations. onomic revision to better understand its cryptic diver- Xiphosiphonia pennata complex, including X. pin- sity and the distribution of the resulting new species. nulata and Symphyocladia spinifera. Its type locality is in the Mediterranean, where three Xiphosiphonia pennata has been reported in the of the four European lineages were collected. Atlantic and Indo-Pacific (Fig. 2e) and this morphological species is a complex of at least three non-sister species. Their taxonomy has been resolved with DISCUSSION the clarification of the identity of X. pinnulata and Species complexes. In this work we detected several S. spinifera that have been misidentified as X. pen- complexes of non-sister species (Xiphosiphonia pennata (see Appendix S1). nata, Symphyocladia dendroidea, and Herposip- At present, 39 rbcL sequences (16 newly deter- honia tenella). Also, we found species-level taxa that mined and 23 downloaded from GenBank) are represent monophyletic lineages containing several available for Symphyocladia spinifera from California, haplotypes that in most cases are distributed in Pacific South America, Australia, and Korea accordance with geographic regions. They could (Fig. 2f). The UPGMA shows 10 haplotypes of which also be classified as species complexes, as sequence RED ALGAE WITH WIDE GEOGRAPHICAL DISTRIBUTIONS 7

94 Herposiphonia tenella IP2MG975656FR 100 Herposiphonia tenella IP2 MG975657 SP Herposiphonia tenella IP2 GU385834 NC 84 Herposiphonia tenella IP2 KT825867 NC Herposiphonia prorepens KU551924 IN 81 Herposiphonia sp. MF094076 WA Herposiphonia pectinella MF094068 VIC 87 Herposiphonia akidoglossa KU551923 IN 82 Herposiphonia sp. IP1 MF094070 PO Herposiphonia calothrix MF094067 VIC Herposiphonia tenella QL2 MG975665 QL Herposiphonia tenella IP1 MG975651 IT Herposiphonia tenella IP1 MG975649 CI Herposiphonia tenella IP1Mg975650FR 94 Herposiphonia tenella IP1MG975652IT 100 Herposiphonia tenella IP1 MG975653 SP Herposiphonia tenella IP1MG975654SP Herposiphonia tenella IP1 MG975655 SP 88 Herposiphonia tenella IP1MG975677SP 90 Herposiphonia sp. MF094071 QL Herposiphonia tenella QL3 MG975666 QL 100 Herposiphonia tenella QL3 MG975667 QL 100 Herposiphonia tenella QL3 MF094072 QL 93 Herposiphonia sp. WA2 MF094073 WA 100 Herposiphonia insidiosa KT825868 KO Herposiphonia parca JX828127 KO Herposiphonia tenella 100 IP3MG975662PO Herposiphonia tenella IP3MG975678FR Herposiphonia tenella IP3MG975661PO Herposiphonia tenella 97 IP3 MG975658 SP Herposiphonia tenella IP3MG975659FR 100 Herposiphonia tenella IP3MG975660SP Herposiphonia tenella CI4 MG975648 CI 100 Herposiphonia tenella CI4 MG975646 CI Herposiphonia tenella CI4 MG975647 CI 100 Herposiphonia sp. WA3 MF094074 WA Herposiphonia versicolor NC035279 VIC Herposiphonia plumula KU564517 CA Herposiphonia pecten veneris KU551922 BE 100 Herposiphonia tenella QL1 MG975663 QL 99 Herposiphonia tenella QL1 MG975664 QL Herposiphonia sp. WA2 MF094075 WA Dipterosiphonia australica NC035288 VIC 100 Dipterosiphonia dendritica 1 MF094058 WA Dipterosiphonia dendritica 2 MF094059 WA

0.02

FIG. 4. RAxML tree based on rbcL sequences of the genus Herposiphonia. Samples that morphologically correspond with H. tenella are in bold. Bootstrap values are indicated on the nodes when >80. BE (Belize), CA (Canada), CI (Canary Islands), FR (France), IN (India), IT (Italy), KO (Korea), NC (North Carolina), PO (Portugal), QL (Queensland), SP (Spain), WA (Western Australia), VIC (Victoria). divergences between haplotypes are often large (up has been hotly debated, but there is a general con- to 1.4%), possible evidence for multiple species. sensus that speciation is a process that takes place Interpretations of genetic divergences when delin- when gene flow is interrupted as a consequence of eating species boundaries vary among authors. For isolation of populations (Coyne et al. 1988, Leliaert example, Melanothamnus harveyi/japonicus and other et al. 2014). In the present work, assessing species closely related species have been interpreted as a boundaries was not always straightforward, and we single species with an intraspecific variability in the used information based on genetic divergences, spe- rbcL gene ≤2.1% (McIvor et al. 2001, as Polysiphonia) cies distribution and, in one lineage, interbreeding or as a species complex in which interspecific vari- experiments described by Rueness (1973). The first ability in the rbcL gene is 0.3%–0.7% (Savoie and scenario we encountered consists of species with a Saunders 2015, as Neosiphonia). The species concept variety of haplotypes found in distant locations. 8 PILAR DIAZ-TAPIA ET AL.

Genetic isolation by distance seems obvious consid- phylogeographic structure or were spread by ering our data and, in some cases, where the diver- humans. Our results confirmed these hypotheses gences between distant populations are relatively and exposed a third scenario, where the morpholog- large (≤0.9%), one might consider them different ically defined species was in fact a complex of non- species (Ophidocladus simpliciusculus from Europe vs. sister cryptic species. Brazil vs. Australia/South Africa, Lophosiphonia ob- Three of the species exhibit genetic variability scura from the North Atlantic vs. Australia, P. villum with clear phylogeographic structure in Australia, from the Atlantic vs. Australia, and X. pinnulata and the North and South Atlantic (Ophidocladus sim- from Brazil vs. Europe). However, the low number pliciusculus, Lophosiphonia obscura and Polysiphonia vil- of samples in some regions or species, as well as the lum). This result is not unexpected considering that lack of sampling in other regions where these spe- genetic divergence is promoted by the isolation cies were recorded or may be still unknown pre- among populations separated by large geographic cludes a definitive conclusion. Perhaps the observed distances (Palumbi 1994). However, the observed large sequence divergences between the lineages genetic divergence is relatively low (≤0.9%) consid- within these species would be less evident with lar- ering that Australia and the North and South Atlan- ger data sets. A second scenario is similar to the for- tic have been separated since about 80 My (Jordan mer, as it consists of species with a variety of et al. 2016). Therefore, rather than this genetic haplotypes, but in this case several haplotypes share divergence resulting from an 80 My old vicariant the same distribution (P. devoniensis, evolution, long-distance dispersal processes acting Symphyocladia dendroidea, S. spinifera). Thus, despite on a common ancestor and subsequent divergence rbcL divergences among some haplotypes (≤1.4%) into differentiated populations are invoked to being even larger than in the previous group explain the observed patterns. Mechanisms responsi- (≤0.9%), whether they are at present reproductively ble for this long-distance dispersal are obscure con- isolated and should be considered as distinct species sidering that these species either occur in coastal is uncertain. Interbreeding experiments may help to lagoons/estuaries or on sand-covered rocks where clarify if these species should be considered as dis- buoyant macroalgae that can act as rafts are rare tinct or not. While successful reproduction may (Airoldi 1998, Dıaz-Tapia et al. 2013a). Molecular have multiple interpretations (Leliaert et al. 2014), data have provided evidence for long-distance dis- unsuccessful reproduction indicates reproductive persal in other red algal species but mechanisms incompatibility. The third scenario we found in this remain unknown (Zuccarello et al. 2002a, Fraser work is represented by L. obscura whose eastern and et al. 2013). The genetic separation among geo- western Atlantic populations have low genetic dis- graphically distant lineages may indicate that long- tances (0.1%–0.2%) in the rbcL gene, and also in distance dispersal occurs at a low rate. Alternatively, the more variable cox1 marker (0.6%–1.2%, density-dependent processes are involved and once HQ412544-5 as P. hemisphaerica and P. boldii, a population colonizes a new region it prevents the MF094025). Despite this, crossing experiments establishment of latecomers (Waters et al. 2013). demonstrate that isolates from Texas and from Nor- Furthermore, available data for the three species way fail to produce fully fertile progeny (Rueness mentioned above indicate different evolutionary his- 1973, as P. hemisphaerica and P. boldii). This suggests tories and/or dispersal paths. For instance, in L. ob- that these two populations are reproductively iso- scura and P. villum the largest sequence divergences lated, and that divergent selection may be acting on are between Australian and Atlantic populations, these populations but rbcL and cox1 gene sequences whereas in O. simpliciusculus the Australian haplo- do not reflect this isolation (Nosil et al. 2009). type is relatively close to South African and Euro- These three scenarios show different evolutionary pean haplotypes but the divergence across the patterns even among closely related species (e.g., Atlantic (Brazil vs. Europe) is much larger. P. villum vs. P. devoniensis). Therefore, application of Several species showed a diversity of haplotypes genetic distances in delineating species boundaries sharing the same region: the Pacific should be evaluated on a case by case basis. While Symphyocladia spinifera and S. dendroidea, as well as these are very interesting issues from a taxonomic the Atlantic Polysiphonia devoniensis. The origin of perspective, they are not the focus of this paper. this diversity must be related to processes of isola- From a phylogeographic point of view, whether tion that led to genetic differentiation, followed by these closely related monophyletic lineages are dif- local dispersal events. As for Ophidocladus simplicius- ferent species or not is of minor importance, culus, Lophosiphonia obscura and P. villum, dispersal because either way they share a common ancestor mechanisms for S. spinifera and P. devoniensis are from which several genetic entities evolved. unknown. In contrast, S. dendroidea has been Phylogeographic patterns. The paradox between reported growing on stranded holdfasts of the float- expected dispersal limitation (Santelices 1990, Kin- ing alga Durvillaea antarctica (Macaya et al. 2016, lan and Gaines 2003) and wide reported species dis- Lopez et al. 2017, 2018), which could contribute to tributions led us to hypothesize that such widely dispersal after genetic differentiation influenced its distributed species would either have strong genetic structure. RED ALGAE WITH WIDE GEOGRAPHICAL DISTRIBUTIONS 9

The disjunct distribution of a second group of have also been documented in the red algae (Zuc- species (Polysiphonia devoniensis and Symphyo- carello et al. 2018). Morphological similarity among cladia dendroidea) can be explained by human- non-monophyletic groups of cryptic species can be mediated introduction events. The human transport explained by evolutionary convergence, morphologi- of species from native (donor) to introduction (re- cal stasis or developmental constraints (Leliaert cipient) regions causes the rapid expansion of spe- et al. 2014, Zuccarello et al. 2018). Xiphosiphonia cies’ distribution and alters natural phylogeographic pennata, S. spinifera, and S. dendroidea are placed in a patterns (Straub et al. 2016). The discovery of tribe (Pterosiphonieae) with high morphological Polysiphonia devoniensis in Victoria (Australia), variation ranging from filiform to foliose species exhibiting a single haplotype that is also present in (Dıaz-Tapia et al. 2017b). The body plan of both Europe, suggests that this species has been intro- species is filiform, among the simplest observed in duced into this country from Europe, possibly Atlan- the tribe, and morphological stasis is a plausible tic Spain or the NW Mediterranean. Symphyocladia explanation for their similarity. In the tribe Herposi- dendroidea was recorded as an introduced species in phonieae all species are very similar in morphology, the French Mediterranean in 2005 (Boudouresque with limited differences in their body plans (Dıaz- and Verlaque 2008, as Pterosiphonia tanakae) and our Tapia et al. 2017b) and the cryptic diversity in recent discovery of the same haplotype in a marina H. tenella might result from morphological stasis or in Atlantic Spain probably represents a secondary developmental constraints. introduction and suggests that the species is spread- Understanding the processes underlying phylo- ing in Europe via hull fouling. The presence of sev- geographic patterns requires the study of numerous eral genetically separated lineages of S. dendroidea in specimens from across the entire distribution of the Pacific South America contrasts with the occurrence species. In this regard, we recognize important limi- of a single haplotype in Japan, Australia, and Cali- tations in our work that prevent us from fully eluci- fornia. Japan and Australia have the same haplo- dating causes of the observed phylogeographic type, suggesting that one or both populations could patterns, leading to some tentative conclusions be introduced. Genetic diversity of seaweeds in the about the potentially introduced status of some of introduced regions is usually either similar or the analyzed populations. However, most of the spe- reduced relative to the native area (McIvor et al. cies treated here are rare in all or part of their 2001, Voisin et al. 2005, Provan et al. 2008, Geoffroy known distribution range so improving the data sets et al. 2016). The finding of diverse haplotypes in would be very difficult. For example, the introduced region is indicative of an introduc- Lophosiphonia obscura, despite being widely reported, tion involving several haplotypes or multiple intro- is very rare in the regions here studied: the sample ductions, depending on the phylogeographic from the United Kingdom used in this study is the structure in the native area (McIvor et al. 2001, Voi- first one collected since 1970 (Maggs and Hommer- sin et al. 2005, Geoffroy et al. 2016). A single haplo- sand 1993). In Spain, we found it only once in the type of both S. dendroidea and P. devoniensis has Atlantic and once in the Mediterranean, and the been detected in the areas where the introduction species is here recorded for only the third time in of these species is certain, suggesting that their Australia. Our work should thus be interpreted as introduction is the result of a single event in which one of the first attempts to understand phylogeo- a single haplotype was involved. However, much graphic patterns of widely distributed red algal spe- more complex scenarios could explain the observed cies. Even though their evolutionary history is not patterns and a better understanding of the phylo- well known, our analyses provide clear examples of geographic patterns in native and introduced areas (i) species with wide distributions and strong phylo- would be needed to elucidate the introduction geographic structure that reflects the geographical dynamics. distance; (ii) species with a broad distribution that The third group of species analyzed here involved can be only explained by human-mediated trans- species complexes of non-sister cryptic species port; and (iii) species complexes in which non- (Xiphosiphonia pennata including X. pinnulata and monophyletic cryptic diversity has been found. This Symphyocladia spinifera; S. dendroidea; and study indicates that widely distributed species are Herposiphonia tenella). In both cases species found in the exception in red algae, except when they have the Atlantic and Pacific basins differ, but in addition been spread by humans. several species were found with overlapping distributions in some regions of each basin. Therefore, the We thank Francis Bunker, Fabio Rindi, Iara Chapuis, Jan Rue- distribution of these widely reported species is much ness, and Max Hommersand for providing samples and Joana narrower than previously thought. Cryptic algal spe- Costa, as well as other researchers included in Table S1, for assistance in the field. We thank Marisa Pasella for carrying cies often involve a group of morphologically similar out part of the molecular work. PDT acknowledges support species that are genetically differentiated, but by the postdoctoral program “Axudas de apoio a etapa de for- resolve as a monophyletic group (Zuccarello et al. macion posdoutoral,” as well as the funding program “Axudas 2002a, Won et al. 2009, Payo et al. 2013). However, para a consolidacion e estruturacion de unidades de investi- examples of non-monophyletic cryptic “species” gacion competitivas do SUG,” grant GPC2015/025 (Xunta de 10 PILAR DIAZ-TAPIA ET AL.

Galicia). Field work in the Mediterranean Sea was funded by Jackson, J. B. C. 1974. Biogeographic consequences of eurytopy a grant awarded to PDT by the British Phycological Society. and stenotopy among marine bivalves and their evolutionary Part of the research presented here was funded through the significance. Amer. Nat. 108:541–60. Australian Biological Resources Study (ABRS), including par- Jordan, S. M. R., Barraclough, T. G. & Rosindell, J. 2016. Quanti- ticipation in a Bush Blitz expedition, a Bush Blitz Strategic fying the effects of the break up of Pangaea on global terres- Taxonomy Grant (TTC216-03) and a National Taxonomy trial diversification with neutral theory. Phil. Trans. R. Soc. B Research Grant (RFL213-08). Sampling in Western Australia, 371:20150221. Queensland and Tasmania was made possible through fund- Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., ing from the Holsworth Wildlife Research Endowment. ECM Sturrock, S., Buxton, S. et al. 2012. Geneious Basic: an inte- grated and extendable desktop software platform for the acknowledges support by the Chilean Millennium Initiative organization and analysis of sequence data. Bioinformatics (NC120030) grant, ESMOI (Millenium Nucleous “Ecology – ” 28:1647 9. and Sustainable Management of Oceanic Islands ). Kinlan, B. P. & Gaines, S. D. 2003. Propagule dispersal in marine and terrestrial environments: a community perspective. Ecol- Airoldi, L. 1998. Roles of disturbance, sediment stress, and sub- ogy 84:2007–20. stratum retention on spatial dominance in algal turf. Ecology Leliaert, F., Verbruggen, H., Vanormelingen, P., Steen, F., 79:2759–70. Lopez-Bautista, J. M., Zuccarello, G. C. & De Clerck, O. Boudouresque, C. F. & Verlaque, M. 2008. Biological pollution in 2014. DNA based species delimitation in algae. Eur. J. Phycol. the Mediterranean Sea: invasive versus introduced macro- 49:179–96. phytes. Mar. Pollut. Bull. 44:32–8. Lopez, B. A., Macaya, E. C., Rivadeneira, M., Tala, F., Tellier, F. & Bustamante, D. E., Won, B. Y. & Cho, T. O. 2014. Polysiphonia dok- Thiel, M. 2018. Epibiont communities on stranded kelp rafts doensis sp. nov. (Rhodomelaceae, Ceramiales) based on a of Durvillaea antarctica (Fucales, Phaeophyceae) – do positive population previously known as Polysiphonia atlantica sensu interactions facilitate range extensions? J. Biogeogr. 45:1833– Kim and Lee from Korea. Bot. Mar. 57:281–9. 45. Coyne, J. A., Orr, H. A. & Futuyma, D. J. 1988. Do we need a new Lopez, B. A., Tellier, F., Retamal-Alarcon, J. C., Perez-Araneda, species concept? Syst. Biol. 37:190–200. K., Fierro, A. O., Macaya, E. C., Tala, F. & Thiel, M. 2017. Destombe, C., Godin, J., Lefebvre, C., Dehorter, O. & Vernet, P. Phylogeography of two intertidal seaweeds, Gelidium lingula- 2009. Differences in dispersal abilities of haploid and diploid tum and G. rex (Rhodophyta: Gelidiales), along the South spores of Gracilaria verrucosa (Gracilariales, Rhodophyta). Bot. East Pacific: patterns explained by rafting dispersal? Mar. Mar. 35:93–8. Biol. 164:188. Dıaz-Tapia, P. & Barbara, I. 2013. Seaweeds from sand-covered Macaya, E. C., Lopez, B., Tala, F., Tellier, F. & Thiel, M. 2016. rocks of the Atlantic Iberian Peninsula. Part. 1. The Rhodo- Float and raft: role of buoyant seaweeds in the phylogeogra- melaceae (Ceramiales, Rhodophyta). Cryptog. Algol. 34:325– phy and genetic structure of non-buoyant associated flora. In 422. Hu, Z. M. & Fraser, C. I. [Eds.] Seaweed Phylogeography. Dıaz-Tapia, P., Barbara, I., Cremades, J., Verbruggen, H. & Maggs, Springer, Dordrecht, pp. 97–130. C. A. 2017a. Three new cryptogenic species in the tribes Macaya, E. C. & Zuccarello, G. C. 2010. Genetic structure of the Polysiphonieae and Streblocladieae (Rhodomelaceae, Rhodo- giant kelp Macrocystis pyrifera along the southeastern Pacific. phyta). Phycologia 56:605–23. Mar. Ecol. Prog. Ser. 420:103–12. Dıaz-Tapia, P., Barbara, I. & Dıez, I. 2013a. Multi-scale spatial vari- Maggs, C. A. & Hommersand, M. H. 1993. Seaweeds of the British ability in intertidal benthic assemblages: differences between Isles. Volume 1. Rhodophyta. Part 3A. Ceramiales. HMSO, Lon- sand-free and sand-covered rocky habitats. Estuar. Coast. Shelf don, 444 pp. Sci. 133:97–108. Mamoozadeh, N. R. & Freshwater, D. W. 2011. Taxonomic notes Dıaz-Tapia, P., Kim, M. S., Secilla, A., Barbara, I. & Cremades, J. on Caribbean Neosiphonia and Polysiphonia (Ceramiales, 2013b. Taxonomic reassessment of Polysiphonia foetidissima Florideophyceae): five species from Florida, USA and Mex- (Rhodomelaceae, Rhodophyta) and similar species, includ- ico. Bot. Mar. 54:269–92. ing P. schneideri, a newly introduced species in Europe. Eur. McIvor, L., Maggs, C. A., Provan, J. & Stanhope, M. J. 2001. rbcL J. Phycol. 48:345–62. sequences reveal multiple cryptic introductions of the Japa- Dıaz-Tapia, P., Maggs, C. A., West, J. A. & Verbruggen, H. 2017b. nese red alga Polysiphonia harveyi. Mol. Ecol. 10:911–9. Analysis of chloroplast genomes and a supermatrix inform Nosil, P., Funk, D. J. & Ortiz-Barrientos, D. 2009. Divergent selec- reclassification of the Rhodomelaceae (Rhodophyta). J. Phy- tion and heterogeneous genomic divergence. Molec. Ecol. col. 53:920–37. 18:375–402. Fraser, C. I., Nikula, R., Spencer, H. G. & Waters, J. M. 2009. Kelp Palumbi, S. R. 1994. Genetic divergence, reproductive isolation, genes reveal effects of subantarctic sea ice during the Last and marine speciation. Annu. Rev. Ecol. Syst. 25:547–72. Glacial Maximum. Proc. Natl. Acad. Sci. USA 106:3249–53. Payo, D. A., Leliaert, F., Verbruggen, H., D’hondt, S., Calum- Fraser, C. I., Zuccarello, G. C., Spencer, H. G., Salvatore, L. C., pong, H. P. & De Clerck, O. 2013. Extensive cryptic species Garcia, G. R. & Waters, J. M. 2013. Genetic affinities between diversity and fine-scale endemism in the marine red alga Por- trans-oceanic populations of non-buoyant macroalgae in the tieria in the Philippines. Proc. R. Soc. Lond. B Biol. Sci. high latitudes of the southern hemisphere. PLoS ONE 8: 280:20122660. e69138. Provan, J., Booth, D., Todd, N. P., Beatty, G. E. & Maggs, C. A. Freshwater, D. W. & Rueness, J. 1994. Phylogenetic relationships 2008. Tracking biological invasions in space and time: eluci- of some European Gelidium (Gelidiales, Rhodophyta) species dating the invasive history of the green alga Codium fragile based upon rbcL nucleotide sequence analysis. Phycologia using old DNA. Divers. Distributions 14:343–54. 33:187–94. Riginos, C., Douglas, K. E., Jin, Y., Shanahan, D. F. & Treml, E. Geoffroy, A., Destombe, C., Kim, B., Mauger, S., Raffo, M. P., A. 2011. Effects of geography and life history traits on Kim, M. S. & Le Gall, L. 2016. Patterns of genetic diversity of genetic differentiation in benthic marine fishes. Ecography the cryptogenic red alga Polysiphonia morrowii (Ceramiales, 34:566–75. Rhodophyta) suggest multiple origins of the Atlantic popula- Rueness, J. 1973. Speciation in Polysiphonia (Rhodophyceae, Cer- tions. Ecol. Evol. 6:5635–47. amiales) in view of hybridization experiments: P. hemi- Guiry, M. D. & Guiry, G. M. 2018. AlgaeBase. World-Wide Elec- sphaerica and P. boldii. Phycologia 12:107–9. tronic Publication, National University of Ireland, Galway, Santelices, B. 1990. Patterns of reproduction, dispersal and UK. Available at: http://www.algaebase.org (accessed 6 Jan- recruitment in seaweeds. Oceanogr. Mar. Biol. Ann. Rev. uary 2018). 28:177–276. RED ALGAE WITH WIDE GEOGRAPHICAL DISTRIBUTIONS 11

Saunders, G. W. & McDevit, D. C. 2012. Methods for DNA bar- (Ceramiaceae, Ceramiales), including two new species. J. Phy- coding photosynthetic protists emphasizing the macroalgae col. 45:227–50. and diatoms. In Kress, W. & Erickson, D. [Eds.] DNA Bar- Zuccarello, G. C., Sandercock, B. & West, J. A. 2002a. Diversity codes. Methods in Molecular Biology (Methods and Protocols). within red algal species: variation in world-wide samples of Humana Press, Totowa, New Jersey, pp. 207–22. Spyridia filamentosa (Ceramiaceae) and Murrayella periclados Saunders, G. W. & Moore, T. E. 2013. Refinements for the ampli- (Rhodomelaceae) using DNA markers and breeding studies. fication and sequencing of red algal DNA barcode and Red- Eur. J. Phycol. 37:403–18. ToL phylogenetic markers: a summary of current primers, Zuccarello, G. C. & West, J. 2003. Multiple cryptic species: molec- profiles and strategies. Algae 28:31–43. ular diversity and reproductive isolation in the Bostrychia radi- Savoie, A. M. & Saunders, G. W. 2015. Evidence for the introduc- cans/B. moritziana complex (Rhodomelaceae, Rhodophyta) tion of the Asian red alga Neosiphonia japonica and its intro- with focus on North American isolates. J. Phycol. 39:948–59. gression with Neosiphonia harveyi (Ceramiales, Rhodophyta) Zuccarello, G. C., West, J. A. & Kamiya, M. 2018. Non-monophyly in the Northwest Atlantic. Mol. Ecol. 24:5927–37. of Bostrychia simpliciuscula (Ceramiales, Rhodophyta): multi- Savoie, A. M. & Saunders, G. W. 2016. A molecular phylogenetic ple species with very similar morphologies, a revised taxon- and DNA barcode assessment of the tribe Pterosiphonieae omy of cryptic species. Phycological Res. 66:100–7. (Ceramiales, Rhodophyta) emphasizing the Northeast Paci- Zuccarello, G., West, J. & King, R. 1999. Evolutionary divergence fic. Botany 94:917–39. in the Bostrychia moritziana/B. radicans complex (Rhodomela- Schneider, C. W., Quach, P. K. & Lane, C. E. 2017. A case for ceae, Rhodophyta): molecular and hybridization data. Phy- true morphological crypsis: Pacific Dasya anastomosans and cologia 38:234–44. Atlantic D. cryptica sp. nov. (Dasyaceae, Rhodophyta). Phycolo- Zuccarello, G. C., West, J. & Rueness, J. 2002b. Phylogeography gia 56:359–68. of the cosmopolitan red alga Caulacanthus ustulatus (Caula- Stamatakis, A. 2014. RAxML version 8: a tool for phylogenetic canthaceae, Gigartinales). Phycol. Res. 50:163–72. analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–3. Straub, S. C., Thomsen, M. S. & Wernberg, T. 2016. The dynamic biogeography of the anthropocene: the speed of recent Supporting Information range shifts in seaweeds. In Hu, Z.-M. & Fraser, C. [Eds.] Sea- weed Phylogeography. Springer, Amsterdam, pp. 63–93. Additional Supporting Information may be Thomsen, M. S., Wernberg, T., South, P. M. & Schiel, D. R. 2016. Non-native seaweeds drive changes in marine coastal commu- found in the online version of this article at the nities around the world. In Hu, Z. M. & Fraser, C. I. [Eds.] publisher’s web site: Seaweed Phylogeography. Springer, Dordrecht, pp. 147–85. Verbruggen, H. 2014. Morphological complexity, plasticity, and Figure S1. RAxML tree based on rbcL species diagnosability in the application of old species names sequences of the genus Symphyocladia. S. den- in DNA-based taxonomies. J. Phycol. 50:26–31. droidea, and S. dendroidea 2 are marked in bold. Voisin, M., Engel, C. R. & Viard, F. 2005. Differential shuffling of Bootstrap values are indicated on the nodes when native genetic diversity across introduced regions in a brown >80. AU (Australia), BC (British Columbia), CL alga: aquaculture vs. maritime traffic effects. Proc. Natl. Acad. Sci. USA 102:5432–7. (California), CH (Chile), EU (Europe), JA Waters, J. M., Fraser, C. I. & Hewitt, G. M. 2013. Founder takes (Japan), PE (Peru). all: density-dependent processes structure biodiversity. Trends Ecol. Evol. 28:78–85. Table S1. GenBank accession numbers of the Williams, S. L. & Smith, J. E. 2007. A global review of the distribu- rbcL sequences included in the UPGMA and phy- tion, taxonomy, and impacts of introduced seaweeds. Annu. logenetic analysis. Rev. Ecol. Evol. Syst. 38:327–59. Womersley, H. B. S. 2003. The Marine Benthic Flora of Southern Aus- Appendix S1. Taxonomic notes. tralia - Part IIID Ceramiales - Delesseriaceae, Sarcomeniaceae, Rho- domelaceae. Australian Biological Resources Study and State Herbarium of South Australia, Canberra and Adelaide, 533 pp. Won, B. Y., Cho, T. O. & Fredericq, S. 2009. Morphological and molecular characterization of species of the genus Centroceras