J. Phycol. *, ***–*** (2018) © 2018 Phycological Society of America DOI: 10.1111/jpy.12778 WIDELY DISTRIBUTED RED ALGAE OFTEN REPRESENT HIDDEN INTRODUCTIONS, COMPLEXES OF CRYPTIC SPECIES OR SPECIES WITH STRONG PHYLOGEOGRAPHIC STRUCTURE1 Pilar Dıaz-Tapia 2 Coastal Biology Research Group, Faculty of Sciences and Centre for Advanced Scientific Research (CICA), University of A Coruna~ 15071, A Coruna,~ Spain School of BioSciences, University of Melbourne, Melbourne, Victoria 3010, Australia Christine A. Maggs Portaferry Marine Laboratory, Queen’s University Belfast, Belfast BT22 1PF, UK Erasmo C. Macaya Laboratorio de Estudios Algales (ALGALAB), Departamento de Oceanografıa, Facultad de Ciencias Naturales y Oceanograficas, Universidad de Concepcion, Concepcion, Chile Millennium Nucleus Ecology and Sustainable Management of Oceanic Island (ESMOI), Larrondo, 1281, Coquimbo, Chile Centro FONDAP de Investigaciones en Dinamica de Ecosistemas Marinos de Altas Latitudes (IDEAL), Valdivia, Chile and Heroen Verbruggen School of BioSciences, University of Melbourne, Melbourne, Victoria 3010, Australia Despite studies suggesting that most seaweeds are spinifera). This study shows that widely distributed poor dispersers, many red algal species are reported species are the exception in marine red algae, unless to have circumglobal distributions. Such distributions they have been spread by humans. have mostly been based on morphological iden- Key index words: Herposiphonieae; introductions; new tifications, but molecular data have revealed a range record; phylogeography; Polysiphonieae; Pterosipho- of issues with morphologically defined species nieae; rbcL; Rhodomelaceae; species boundaries; spe- boundaries. Consequently, the real distribution of cies complexes such reportedly circumglobal species must be questioned. In this study, we analyzed molecular data sets (rbcL gene) of nine species in the Rhodo- melaceae for which samples were available from Phylogeography of marine organisms is influ- widely spaced geographical locations. Three overall enced by barriers to dispersal and geographical dis- patterns were identified: (i) species showing strong tance, as well as by aspects of their life-history, phylogeographic structure (i.e., phylogenetic simi- physiology and ecology (Jackson 1974, Palumbi larity correlates with geographical provenance), often 1994, Riginos et al. 2011). The dispersal ability of to the point that populations from different loca- seaweeds is generally very limited, of the order of tions could be considered as different species tens of meters or less (Santelices 1990, Kinlan and (Lophosiphonia obscura, Ophidocladus simpliciusculus, Gaines 2003, Destombe et al. 2009). However, Polysiphonia villum, and Xiphosiphonia pinnulata); (ii) long-distance dispersal is known in brown seaweeds species with a broad distribution that is explained, with buoyant structures (Fraser et al. 2009, Macaya in part, by putative human-mediated transport and Zuccarello 2010), which can act as rafts pro- (Symphyocladia dendroidea and Polysiphonia moting in turn the dispersal of the epiphytic spe- devoniensis); and (iii) non-monophyletic complexes of cies that they host (Fraser et al. 2013, Macaya et al. cryptic species, most with a more restricted 2016, Lopez et al. 2017, 2018). Still, a large propor- distribution than previously thought (Herposiphonia tion of macroalgae are epilithic, so their expected tenella, Symphyocladia dendroidea, and the dispersal ability is very limited and consequently Xiphosiphonia pennata complex that includes the their distribution range is expected to be relatively species Xiphosiphonia pinnulata and Symphyocladia small. Paradoxically, many macroalgal species are reported to be very widely or even globally distributed. 1 Received 7 April 2018. Accepted 8 August 2018. First Published Records are usually based only on morphological Online 23 August 2018. 2Author for correspondence: e-mail [email protected]. identification, which can be inaccurate due to mor- Editorial Responsibility: K. Muller€ (Associate Editor) phological plasticity within species as well as 1 2 PILAR DIAZ-TAPIA ET AL. similarity between cryptic species (e.g., Verbruggen (Airoldi 1998, Dıaz-Tapia et al. 2013a). This makes 2014, Schneider et al. 2017). Closer investigation of the family a good candidate to test hypotheses material from distant regions using DNA data com- about species distributions and phylogeographic monly leads to the discovery of cryptic species (e.g., patterns. Won et al. 2009, Bustamante et al. 2014, Schneider The objective of this paper is to reassess the wide et al. 2017). Even though studies combining mor- reported distributions of nine turf-forming species phological and molecular data are increasing, DNA of the family Rhodomelaceae using DNA sequences. databases are still very limited for most algal groups Using molecular data from distant locations within and molecular data are often available only for each species’ reported distribution range, we evalu- some regions. As a consequence, the true distribu- ate whether these are indeed widely distributed spe- tion of many seaweed species should be regarded as cies, analyze the observed phylogeographic patterns, uncertain. Few studies have reassessed the distribu- and consider whether these species may have been tion of widely reported red algal species using introduced into one or several regions by human molecular data from a broad sampling area. Com- activities. plexes of look-alike species, as well as widely dis- tributed species, have been detected (Zuccarello et al. 1999, 2002a, Zuccarello and West 2003, Won MATERIALS AND METHODS et al. 2009). Among the widely distributed species, Material of Herposiphonia tenella, Lophosiphonia obscura, Ophi- some exhibit high genetic variability and strong phy- docladus simpliciusculus, Polysiphonia villum, P. devoniensis, Sym- logeographic structure that often distinguishes pop- phyocladia spinifera, S. dendroidea, Xiphosiphonia pennata, and X. ulations from different basins (Zuccarello et al. pinnulata was collected in Norway, United Kingdom, France, 2002a,b, Won et al. 2009). Other widely distributed Spain, Portugal, Italy, Brazil, Chile, Australia, and South species lack phylogeographic signal, suggesting Africa during general sampling surveys of the family Rhodo- melaceae (Table S1 in the Supporting Information). All these long-distance dispersal processes by unknown mech- species form epilithic turfs, most of them on intertidal sand- anisms (Zuccarello et al. 2002a, Fraser et al. 2013). covered rocks (Womersley 2003, Dıaz-Tapia and Barbara Therefore, red algal phylogeographic patterns are 2013). Lophosiphonia obscura was found in North Atlantic highly heterogeneous and depend on evolutionary brackish water coastal lagoons or estuaries, and S. dendroidea was collected in Australian and Chilean shallow subtidal turfs. histories and dispersal abilities. – In addition to natural dispersal mechanisms, Distribution maps of records for these species (Figs. 1 3, lines) were drawn up based on information available in human-mediated vectors can transport seaweeds AlgaeBase and references therein (Guiry and Guiry 2018). from native areas to other world regions and rapidly DNA was extracted from silica gel-dried material following alter distribution patterns (Straub et al. 2016). More Saunders and McDevit (2012), using the Qiagen DNeasy than 200 red algal species have been considered as Plant Mini Kit (Qiagen GmbH, Hilden, Germany) or the Pro- introduced or cryptogenic in one or several regions mega Wizard Magnetic 96 DNA Plant System kit (Promega (Thomsen et al. 2016). Cryptic introductions are Corporation, Madison, WI, USA), following the manufac- common in the red algae and non-native species turer’s instructions. PCR amplification was carried out for the rbcL gene using primers F7/RrbcStart, F7/R893 or F57/ often remain unnoticed until diversity surveys use rbcLrevNEW (Freshwater and Rueness 1994, Mamoozadeh molecular tools (McIvor et al. 2001, Zuccarello et al. and Freshwater 2011, Saunders and Moore 2013), as well as 2002b, Dıaz-Tapia et al. 2013b, 2017a). Considering the newly designed primers F2 (TGTCTAACTCTGTAGAA the low dispersal ability of non-buoyant epilithic red CAACGGA), F8 (ACTCTGTAGAASAACGGACAMG), R1008 algae, we hypothesize that the distribution of most (AACTACTACAGTACCAGCATG), R1464 (AACAT truly cosmopolitan species can be explained by TAGCTGTTGGAGTTTCYAC) and R1452 (TGGAGTTTCYA – CRAAGTCAGCTGT). Names of these primers indicate their human-mediated transport which is frequently position in the rbcL gene (e.g., first base of F2 primer corre- provided as a potential explanation for wide distri- sponds with the second base of the rbcL gene). PCR reactions butions of species (Zuccarello et al. 2002a,b, Fraser were performed in a total volume of 25 lL containing 19 et al. 2013). MyTaqTM reaction buffer, 0.28 lM forward and reverse pri- The Rhodomelaceae, with >1,000 recognized spe- mers, 0.125 units My TaqTM DNA Polymerase (Bioline, Lon- don, UK) and 1 lL template DNA. The PCR profile cies, is the most diverse red algal family (Guiry and ° Guiry 2018). It includes numerous examples of consisted of initial denaturation (93 C for 3 min), 35 cycles of denaturation (94°C for 30 s), primer annealing (45°C for widely reported species and, as in most red algal 30 s), and extension (74°C for 90 s) and final extension groups, cryptic diversity is common (e.g., Zuc- (74°C for 5 min). The PCR products were purified and carello et al. 2002a, 2018, Dıaz-Tapia