Modulation of P53 Family Proteins in the Treatment of Neuroblastoma

Modulation of p53 Family Proteins in the Treatment of Neuroblastoma

Jennifer Wolter

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Medical Biophysics University of Toronto

Modulation of p53 family proteins in the treatment in neuroblastoma

Jennifer Wolter

Doctor of Philosophy

Department of Medical Biophysics University of Toronto 2013

Abstract

Neuroblastoma is the most common type of extra-cranial solid tumour in children. Additional investigation is required to fully understand the genetics and tumour biology of neuroblastoma for improvements in patient care. We explored the importance of p53 family proteins in neuroblastoma tumorigenesis and response to therapy. Despite aggressive multi-modality treatments, more than half of patients with high-risk neuroblastoma relapse, and cure after recurrence is rare. Repurposing medications already in use for other indications is a safe and expedient way to discover novel therapies for neuroblastoma. Using a high-throughput screen of

FDA-approved drugs we identified the beta-adrenergic receptor antagonist propranolol and cardiac glycosides as candidate compounds to investigate for the treatment of neuroblastoma.

Studies have demonstrated that propranolol and cardiac glycosides have anti-cancer effects in range of malignancies in both in vitro and epidiomologic studies. Propranolol has a well- documented safety profile in children and more recently is used to treat infants with large hemangiomas. Cardiac glycosides have a narrower therapeutic window therefore analogues were designed in an attempt to develop a more effective anti-proliferative cardiac glycoside without cardiotoxic side effects. While these drugs have disparate anti-cancer mechanisms in neuroblastoma, both classes of compounds are able to induce neuroblastoma cell death and may reveal new targets to further improve patient care.

Acknowledgments

I would like to start by thanking my supervisors Dr. Meredith Irwin and Dr. David

Malkin. Their support and mentorship in and out of the laboratory have meant so much to me over the last six years. If it were not for Dr. Irwin, I would not have had the courage to pursue a

Masters degree or a PhD. I will use the critical thinking and problem solving skills I developed during my studies throughout my career. I would also like to thank my advisory committee; Dr.

David Kaplan and Dr. Linda Penn, who have provided exceptional guidance and insight throughout my graduate studies. I owe a debt of gratitude to Dr Joseph Lam at The University of

Guelph who helped put me on the path of research.

Over the course of my studies I have had the opportunity to work with a number of remarkable trainees and researchers. I would like to thank Dr. Loretta Lau who mentored me in the early stages of my research endeavors, Lynn Cheng for her constant emotional and research support, as well as the past and present Irwin lab members for their friendship and research advice that has meant so much to me.

Personally, I would like to thank my parents for their endless support throughout my education and research studies. I would like to thank my husband and collaborator, Dr. Nikolaus

Wolter, for his patience, encouragement and understanding. Our work together that comprised the bulk of the Chapter 3 appendix was one of the greatest challenges our marriage has faced since we put up the wallpaper. Finally, I would like to thank my friends and family. Although my long hours in the lab often prevented me from sharing many occasions with you, knowing you would be waiting with open arms and full glass of wine was a continuous source of support.

iii

Table of Contents

Table of Contents Abstract...... ii

Acknowledgments...... iii

Table of Contents...... iv

List of Figures...... ix

List of Abbreviations...... x

Chapter 1 Introduction ...... 1

1.1 Overview of Neuroblastoma ...... 1

1.1.1 Clinical presentation of neuroblastoma...... 1

1.1.2 Treatment of neuroblastoma...... 1

1.1.3 Tumour biology and genetic characteristics of neuroblastoma ...... 5

1.2 p53 family ...... 10

1.2.1 Characteristics of p53 ...... 10

1.2.2 p53 family members: p73 and p63 ...... 16

1.2.3 Role of p53 family proteins in Cancer...... 19

1.3 β-Adrenergic signalling ...... 25

1.3.1 β-Adrenergic Receptors ...... 25

1.3.2 Pharmacological agents targeting β-adrenergic receptors...... 26

1.3.3 Beta-Adrenergic signalling in cancer...... 29

1.4 Cardiac Glycosides...... 31

1.4.1 Structure and Function of Cardiac Glycosides...... 31

1.4.2 Cardiac Glycosides and Na+/K+-ATPase ...... 32

1.4.3 Cardiac glycosides and cancer therapy ...... 35

1.5 Conclusions...... 39

Chapter 2 – The role of LFS associated p53 mutations in neuroblastoma...... 40

2.1 Abstract...... 40

2.2 Introduction ...... 41

2.3 Results...... 43

2.3.1 Identification of LFS- associated neuroblastoma cases...... 43

2.3.2 Neuroblastoma LFS p53 mutants are defective in target gene induction and response to

chemotherapy...... 44

2.3.4 LFS-neuroblastoma p53 mutants form complexes with TAp73...... 47

2.3.4 Mutant p53 increases tumorigenicity of primary neuroblastoma cells...... 49

2.4 Discussion ...... 51

2.5 Materials and methods ...... 55

2.5.1 Cell culture, transfections and chemotherapy...... 55

2.5.2 Plasmids...... 55

2.5.3 Western immunoblots and immunoprecipitation...... 56

2.5.4 Luciferase Assay ...... 56

2.5.5 Sphere and Foci formation assay ...... 57

Chapter 3 – Anti-tumour activity of the beta-adrenergic receptor antagonist propranolol in neuroblastoma...... 58

3.1 Abstract...... 58

3.2 Introduction ...... 59

3.3 Results...... 62

3.3.1 Propranolol inhibits neuroblastoma growth, viability, and proliferation ...... 62

3.3.2 β2-adrenergic receptors are expressed in neuroblastoma and are required for

neuroblastoma cell death ...... 65

3.3.3 Propranolol induces apoptosis in neuroblastoma...... 66

3.3.4 Propranolol increases p53 and TAp73 and pro-apoptotic target genes...... 69

3.3.5 Propranolol inhibits growth in vivo ...... 70

3.4 Discussion ...... 73

3.5 Materials and methods ...... 80

3.5.1 Cell culture and Drugs...... 80

3.5.2 Apoptosis assays ...... 81

3.5.3 Cell Viability, Proliferation and Focus formation Assays...... 81

3.5.4 Western immunoblot analysis ...... 82

3.5.5 Semi-quantitative PCR...... 83

3.5.7 Combination Index and Statistical analyses...... 83

3.5.8 Xenograft studies ...... 83

Chapter 3 Appendix – Propranolol as a Novel Adjunctive Treatment for Head and

Neck Squamous Cell Carcinoma...... 85

Appendix 3.1 Abstract...... 85

Appendix 3.2 Introduction ...... 86

Appendix 3.3 Results...... 88

Appendix 3.3.1 β2-adrenergic receptors are expressed on HNSCC and β2-adrenergic receptors

antagonists inhibit HNSCC growth and viability ...... 88

Appendix 3.3.2 Propranolol induces apoptosis in HNSCC...... 90

Appendix 3.3.3 Propranolol modulates p53 family proteins and VEGF...... 91

Appendix 3.3.4 Propranolol is synergistic with cisplatin and enhances radiation sensitivity... 91

Appendix 3.4. Discussion ...... 94

Appendix 3.5 Methods...... 96

Appendix 3.5.1 Cell culture, drugs, and western immunoblot ...... 96

Appendix 3.5.2 Cell viability and apoptosis assays ...... 96

Appendix 3.5.3 Drug and radiation treatment ...... 96

Chapter 4 – Chemically modified Cardiac glycoside analogue, RIDK34, has anti neuroblastoma activity...... 97

4.1 Abstract...... 97

4.2 Introduction ...... 98

4.3 Results...... 102

4.3.1 Small molecule screens identify cardiac glycosides as therapeutic candidates for

neuroblastoma...... 102

4.3.3 Induction of apoptosis and decrease of foci formation in neuroblastoma cells by RIDK34

...... 106

4.3.4 Knockdown of the alpha subunit Na+/K+ -ATPase increases the sensitivity to digoxin and

RIDK34...... 106

4.3.5 RIDK34 induced signalling in neuroblastoma cells...... 109

4.4 Discussion ...... 111

4.5 Materials and methods ...... 116

4.5.1 Cell culture and compounds...... 116

4.5.2 Western immunoblot analysis ...... 116

4.5.3 Apoptosis assays ...... 117

4.5.4 Cell Viability and Proliferation Assays...... 117

4.5.5 Foci formation assay...... 118

4.5.6 Na+/K+-ATPase activity screen...... 118

4.5.7 SiRNA transfection ...... 118

vii

4.5.8 RT-PCR...... 119

4.5.9 γH2AX immunostaining ...... 119

Chapter 5 - General discussion and future directions...... 121

5.1 Understanding the role of p53 and p53 family in neuroblastoma development and

response to therapy...... 121

5.1.1 Summary of LFS-mutant p53 in neuroblastoma ...... 121

5.1.2 Future Directions exploring mutant p53 in neuroblastoma...... 124

5.2 Repurposing existing approved compounds for the treatment of neuroblastoma ..... 126

5.2.1 Summary of anti-tumour activity of β-adrenergic receptor antagonist propranolol...... 127

5.2.2 Future directions for the anti-cancer effects of propranolol ...... 129

5.2.3 Summary of novel cardiac glycosides for treatment of neuroblastoma ...... 132

5.2.4 Future directions of cardiac glycosides analogues for treatment of neuroblastoma...... 133

5.3 Neuroblastoma models...... 135

5.4 Conclusions...... 135

References...... 137

viii

List of Figures

Chapter 1 Figure 1.1 Neuroblastoma risk stratification, based on age and MYCN status Figure 1.2 p53/MDM2/p14ARF signalling pathway in neuroblastoma Figure 1.3 Schematic representation of the gene structure of the p53 family Figure 1.4 Protein structure of p53 family isoforms Figure 1.5 Model for drug-induced apoptosis via modulation of p53 family proteins. Figure 1.6 Sporadic TP53 mutational spectrum in human cancers Figure 1.7 Signalling pathways of the adrenergic receptors subtypes Figure 1.8 General chemical structural characteristics of cardiac glycoside ouabain. Figure 1.9 Tissue distribution of Na+/K+ATPase in humans Figure 1.10 Na+/K+-ATPase medicated signal transduction Figure 1.11 Summary of the most studied cardiac glycosides and their anticancer activity

Chapter 2 Figure 2.1 LFS-associated mutant p53 Figure 2.2 LFS-associated p53 mutants are inactive Figure 2.3 LFS-associated p53 mutants bind to TAp73 and prevent activation of activation of target genes Figure 2.4 Mutant p53 increases proliferation and self-renewal of primary cells

Chapter 3 Figure 3.1 Propranolol inhibits neuroblastoma growth. Figure 3.2 Propranolol inhibits neuroblastoma growth and is synergistic with SN-38 Figure 3.3 β2-adrenergic receptors are required for propranolol induced cell death and is expressed in neuroblastoma Figure 3.4 Propranolol induces apoptosis Figure 3.5 Induction of p53 and TAp73β by propranolol

Chapter 3 Appendix Figure 3.7 Mechanism of interaction of p53 family members in HNSCC Figure 3.8 Propranolol inhibits cells growth and decreases cell viability in HNSCC Figure 3.9 Propranolol induces apoptosis in HNSCC Figure 3.10 Propranolol regulates ΔNp63α, TAp73β and target genes Figure 3.11 Propranolol is synergistic with cisplatin and enhances radiation induced cell growth inhibition

Chapter 4 Figure 4.1 Identification and confirmation of cardiac glycosides for the treatment of neuroblastoma Figure 4.2 RIDK34 decreases cell survival Figure 4.3 RIDK34 induced apoptosis and decreases foci formation in neuroblastoma Figure 4.4 Knockdown of alpha1 subunit not required for digoxin or RIDK34 cell death Figure 4.5 RIDK34 affect on signalling in neuroblastoma cells

List of Abbreviations

ALK Anaplastyc lymphoma kinase AP Alternate promoter ARF-BP1 Alternate reading frame binding protein 1 AS Alternative Splicing ATM Ataxia telangiectasia mutated ATP Adenosine-5’-triphosphate BARD 1 BRCA1 Associated RING Domain 1 Bax BCL2-associated X protein Bcl-xL B-cell leukemia/lymphoma xL BCL2 B-cell CLL/lymphoma 2 bFG Basic fibroblast growth factor BH3 Bcl-2 homology domain 3 bHLH Basic helix-loop-helix Bim Bcl-2-like protein 11 BrdU Bromodeoxyuridine cAMP Cyclic Adenosine Monophosphate CDK Cyclin dependent kinases Chk Checkpoint kinases CI Combination index Cl-PARP Cleaved poly ADP-ribose polymerase CNS Central nervous system CNV Copy number variation COPD Chronic obstructive pulmonary disease COX-2 Cyclooxygenase–2 DBD DNA-binding domain DDR DNA-damage response DFO Desferrioxamine DMs Double minutes DMSO Dimethyl sulfoxide DR4/5 Death receptor 4/5 DRAM-1 Damage-regulated autophagy modulator EBV Epstein Barr virus EC50 Effective concentration for 50% maximal effect EFS Event free survival EGF Epidermal growth factor EGFR Epidermal growth factor receptor ELISA Enzyme-linked immunosorbent assay EPI Epinephrine ER Endoplasmic reticulum ERK Extracellular-signal-regulated kinase FADD FAS-associated death domain x

FDA Food and Drug Administration G-protein Guanine–nucleotide-binding protein GFP Green fluorescent protein GRB2 Growth factor receptor-bound protein 2 GWAS Genome wide association studies HA Haemagglutinin HDM2 E3 ubiquitin-protein ligase Mdm2 HES1 Hairy and enhancer of split1 Hey2 Hairy/enhancer-of-split related with YRPW motif protein 2 HIF-1α Hypoxia inducible factor 1α HNSCC Head and neck squamous cell carcinomas HPV Human papillomavirus HSR Homogenously staining regions IC50 Inhibitory concentration for 50% maximal inhibitory effect IGFBP3 Insulin-like growth factor-binding protein 3 IL Interleukin INRG International Neuroblastoma Risk Group INSS International Neuroblastoma Staging System IP3 Inositol trisphosphate IP3R IP3 receptor iPSC-CM Induced pluripotent stem cell– derived cardiomyocytes JNK c-Jun N-terminal kinases LFS Li Fraumeni Syndrome LOH Loss of heterozygosity MAPK Mitogen-activated protein kinases MEK Mitogen-activated protein kinase kinase MMP Matrix metalloproteinase MRD Minimal residual disease MRP1 Multi-drug resistance protein-1 mTOR Mammalian target of rapamycin MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived NE Norepinephrine NES Nuclear export signal NF-ΚB Nuclear factor kappa-light-chain-enhancer of activated B cells NK Natural killer cells NLS Nuclear localization signal NOXA Phorbol-12-myristate-13-acetate-induced protein 1 OD Oligomerization domain OSCC Oral squamous cell carcinoma p53RE p53-responsive elements p57/kip1 Cyclin-dependent kinase inhibitor 1C PAI-1 Plasminogen activator inhibitor-1 PBS Phosphate buffered saline PEI Polyethylenimine xi

PERP p53 apoptosis effector related to PMP-22 PHOX2B Paired-like homeobox 2b PI Propidium iodide PIDD p53-induced protein with a death domain PIG3 p53-inducible gene 3 Pin1 Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 PINK1 PTEN induced putative kinase 1 pirh2 RING finger and CHY zinc finger domain-containing protein 1 PKA Protein kinase A PKC Protein kinase C PLC Phospholipase C PTPN11 Tyrosine-protein phosphatase non-receptor type 11 PUMA p53 upregulated modulator of apoptosis Ras Rat sarcoma Rb Retinoblastoma ROS Reactive oxygen species RPMI Roswell Park Memorial Institute medium RT-PCR Reverse-transcriptase polymerase chain reaction SAM Sterile a-motif SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis SH3 SRC Homology 3 Domain shRNA Small hairpin RNA siRNA Small interfering RNA SKP Skin keratinocyte precursors SNP Single nucleotide polymorphisms SNS Sympathetic nervous system SV40 Simian virus 40 TA Transactivation TBS Tris-buffered saline TNF Tumor necrosis factor TRADD TNFR1-associated death domain TRAIL TNF-related apoptosis-inducing ligand TrkA/B Neurotrophic tyrosine kinase receptor type A/B VEGF Vascular endothelial growth factor Wnt Wingless-type MMTV integration site family

xii

Chapter 1 Introduction

1.1 Overview of Neuroblastoma

1.1.1 Clinical presentation of neuroblastoma

Neuroblastoma is a cancer of the sympathetic nervous system and is the second most common paediatric solid malignancy (1). Although tumours can arise at any site along the sympathetic nervous system ganglion chain, primary tumours are most commonly located in the adrenal gland. Neuroblastoma is characterized by extreme heterogeneity with diverse clinical behaviours and tumour biology, which can present numerous clinical challenges. The clinical spectrum can range from a very aggressive, rapidly progressive disease to a form that undergo spontaneous regression, as in infants with metastatic disease limited to specific sites (stage 4S or

Special) (2). The clinical factors most strongly associated with prognosis are age at diagnosis and stage of disease (3). The effect of age at diagnosis on 5-year event free survival is profound; patients younger than 1 year at diagnosis have a 90% survival, which drops to 68% between 1-4 years, 52% between 5-9 years, and 66% between 10-14 years of age (4).

1.1.2 Treatment of neuroblastoma

Currently, most treatment protocols group patients according to a three tier risk stratification system (low, intermediate and high), that takes into account clinical and biological prognostic factors including age, stage, histopathologic subtype, MYCN amplification, ploidy, and loss of heterozygosity (LOH) at chromosomes 1p and 11q. Neuroblastoma was previously classified according to a classical format staging system (International Neuroblastoma Staging

System, INSS) with stages 1–4 (5). Recently, the International Neuroblastoma Risk Group

(INRG) has validated these prognostic factors in 8800 patients and published guidelines using

these criteria in an effort to provide universal clinical and biological criteria for risk group assessment for all newly diagnosed patients (6) (Figure 1.1).

Approximately 40% of neuroblastoma patients present with localized tumours, which fall mostly within the low or intermediate risk categories. These patients can achieve excellent cure rates (70-90%) with surgery alone or in combination with chemotherapy (7, 8). In contrast, children 18 months of age or older who present with metastases (stage 4) and patients with localized disease (stage 2,3) whose tumours harbour MYCN amplification have a dismal (<40% overall survival) prognosis and are thus considered high-risk patients. High-risk neuroblastoma is an aggressive disease with poor outcome despite intensive multi-modality treatment including surgery, radiotherapy, high dose chemotherapy with autologous stem cell rescue, and retinoids.

The current therapy for high-risk patients is divided into three phases: induction, consolidation and a maintenance phase to eradicate minimal residual disease (MRD). Although high-risk

Figure 1.1 Neuroblastoma risk stratification, based on age and MYCN status A, International Neuroblastoma Staging System (INSS) (Reproduced from Owens et al., 2012) B, International Neuroblastoma Risk Group (INRG) Consensus Pretreatment Classification schema. Hyperdiploid (DNA index >1.0 and includes near-triploid and near-tetraploid tumours. Very low risk (5-year Event free survival (EFS) > 85%); low risk (5-year EFS >75% to <85%); intermediate risk (5-year EFS ≥50% to ≤75%); high risk (5-year EFS <50%). GN, ganglioneuroma; GNB, ganglioneuroblastoma; Amp, amplified; NA, not amplified (Reproduced from Cohn et al., 2009).

neuroblastoma tumours and metastases initially respond well to therapy, ultimately tumour cells become resistant to traditional chemotherapies and more than half of patients with high-risk neuroblastoma eventually relapse (9). Persistent MRD has been implicated in the high rate of relapse; thus treatments have been focused on eradicating the remaining neuroblastoma cells following cytotoxic therapy (10). Patients who receive 13-cis-retinoic acid after completion of consolidation therapy have a higher event free survival than patients who do not receive the retinoid treatment, most likely due to differentiation effects (10-13). Neuroblastoma cell lines terminally differentiate following exposure to retinoid compounds (14, 15). The retinoid, isotretinoin (13-cis-retinoic acid) is standard therapy in the maintenance phase of high-risk neuroblastoma. A synthetic retinoid, fenretinide, is currently under investigation. Fenretinide also induces its anti-tumour activity through differentiation and induction of apoptosis (16, 17).

Recent studies also support an important role and improved survival with addition of immunotherapy with anti-GD2 antibodies and cytokines (IL-2 and GMCSF) in high-risk patients

(18, 19). Neuroblastoma cells express the disialoganglioside GD2 that can be used as a target for immunotherapy for the eradication of MRD (19, 20). Novel therapies that target cellular signalling pathways aberrantly upregulated in neuroblastoma cells are currently in phase 1 and 2 clinical trials. These include inhibitors of the mammalian target of rapamycin (mTOR) pathways

(e.g. rapamycin, temsirolomus), aurora kinase inhibitors, anti-angiogenic therapies and anaplastic lymphoma kinase (ALK) inhibitors (21-25). Long-term survival from high-risk neuroblastoma remains <40% and relapsed metastatic neuroblastoma is almost universally fatal (<5% survival).

Thus, novel therapies are needed.

Despite the major advances in our understanding of the genetic and molecular determinants of neuroblastoma prognosis over the past decade only a few drugs targeting these

pathways are in clinical trials. Elucidating pathways involved in chemoresistance in neuroblastoma may lead to the discovery of additional therapeutic targets to kill neuroblastoma cells and prevent the development of chemoresistance.

1.1.3 Tumour biology and genetic characteristics of neuroblastoma

The factors that contribute to the initiation of neuroblastoma tumours are still largely unknown. There are a number of genetic abnormalities found in neuroblastoma; however, these changes are heterogeneous and recent whole genome sequencing approaches suggest that recurrent mutations in only 5-8% of tumours (26-28). Common genetic features of tumours that have been linked to aggressive clinical behaviour and poor outcome include MYCN oncogene amplification, diploid DNA index and LOH at 1p36 and 11q23 loci (24). In 1983, a novel MYC homolog was discovered to be amplified in several neuroblastoma cell lines and a primary tumour (29). The

MYCN gene is located on chromosome 2 (2p24), and genetic material from this region can be transposed to double minutes (DM; small fragments of extrachromsomal DNA) or randomly integrated in homogeneously staining regions (HSRs) during amplification (30, 31). The MYC proteins are nuclear helix-loop-helix transcription factors involved in cell growth, proliferation, differentiation and apoptosis (32). MYCN regulates neural progenitor cell proliferation and differentiation and studies have shown the importance of MYCN in the development and regulation of the cell cycle in neural crest cells and sympathetic neurons (31, 33). One of the most common genetic abnormalities detected is amplification of the oncogene MYCN that has been shown to enhance malignant transformation and cell cycle progression of neuroblastoma in vitro, as well as impact chemotherapy sensitivity (34, 35). MYCN amplification (defined as >10 copies) is detected in approximately 20% of neuroblastoma tumours and has been shown to correlate with poor outcome (36, 37). The TH-MYCN transgenic mouse model suggests that MYCN

amplification may be an initial event in neuroblastoma tumorigenesis. These mice develop neuroblastoma tumours that recapitulate many of the histological and pathological aspects of the neuroblastoma, including tumour localization, positive staining for neuronal markers, and gains and losses of chromosomes in regions observed in human neuroblastoma (38). Although these mice rarely develop metastases, more recent MYCN transgenic models have been developed in which mice have increased metastases (39). Since MYCN amplification is only identified in 20% of tumours at presentation, other factors must contribute to neuroblastoma pathogenesis.

The balance between the pro- and anti-apoptotic p53 family members plays an important role in many cancers including neuroblastoma and inactivation in the p53 pathway can contribute to chemoresistance (40, 41). Both mutant p53 and ΔNp73 can form hetero-tetramers with full- length p53 family proteins that result in the ability to activate target genes (p53 family is discussed in detail in section 1.2.1). p53 mutations are rarely detected at diagnosis; however, neuroblastoma tumours often acquire p53 mutations during therapy and mutation is associated with a loss of p53 function and multidrug resistance (42). A high proportion of neuroblastoma tumours at time of relapse have an abnormality in the p53/HDM2/p14ARF pathway (>50% of relapsed neuroblastoma cell lines tested) as well as overexpression of the anti-apoptotic ΔNp73 (43-45)

(Figure 1.2). Figure 1.2 demonstrates reported proteins in p53 signalling pathways that are aberrantly expressed or mutated in neuroblastoma.

LOH at chromosome 1p36 is deleted in 25% of neuroblastoma primary tumours and strongly correlated with MYCN amplification (46-48). 11q23, another common location of chromosomal deletion, is found in 34% of neuroblastomas, and is commonly present in tumours

Figure 1.2 p53/MDM2/p14ARF signalling pathway in neuroblastoma. Upstream signals, including c-abl and E2F-1, mediate TAp73 activation in response to certain chemotherapies. HDM2 negatively regulates both p53 and p73. ΔNp73 and mutant p53 inhibit the pro-apoptotic full-length forms of p53 and p73. In primary neuroblastoma, mutant p53, ΔNp73, HDM2 and p14 ARF abnormalities have been reported. In addition, high levels of MYCN are deleted in more than 20% of neuroblastoma and may affect both HDM2 and p73 directly. (Adapted from Wolter et al., 2010))

without MYCN amplification (46). Both 1p and 11q LOH correlate with high risk disease features and are independent markers of poor survival in patients with and without MYCN amplification

(46, 48). Gain of chromosome 17q is another prognostic genetic abnormality that confers poor survival (49, 50). Morowitz et al. reported that 17q gain was strongly associated with advanced stage disease, age >1 year, 1p LOH, and MYCN amplification, but also had independent prognostic significance (51).

In 2008, ALK mutations were identified in 8-10% of neuroblastoma tumours (52-55).

ALK is a receptor tyrosine kinase that is involved in development of the central and peripheral nervous system (56-58). The most common “hot spot” mutations identified are in the kinase domain and result in constitutive activation of ALK (26). Knockdown of ALK or use of small molecule ALK inhibitors led to reduction of cell proliferation and induction of apoptosis (53, 59).

Interestingly ALK is mutated in up to 10% of sporadic neuroblastoma tumours and also a subset of patients with germline predisposition to neuroblastoma. Recent data in mice and humans support a role for ALK targeting in neuroblastoma with the inhibitor crizotinib (60, 61). Whole genome screening of neuroblastoma has determined somatic mutations of ALK are among the most common recurrent oncogenes (8%) (26-28). PTPN11 activating mutations have also been reported in neuroblastoma (~2%) and more recently loss-of-function mutations or deletions of

RNA-helicase ATRX and mutations/deletions of chromatin remodelling protein ARID1A/B have been described (26-28, 62, 63). Other genes and pathways have been implicated in neuroblastoma pathogenesis and prognosis, including Ras, aurora kinase A, wnt/β-catenin, twist, caspase 8 and

BARD1 (64-68). Retrospective and prospective studies are underway to determine if the status of these genes and their protein products are independent prognostic factors.

Although the majority of neuroblastomas are sporadic, approximately 1-2% of neuroblastoma patients have an inherited predisposition and often these patients present at a very early age with multiple primary tumours (69). While linkage studies have revealed several candidate genetic loci with autosomal dominant patterns of transmission, only two neuroblastoma predisposition genes have been identified: PHOX2B and ALK. Mutations in PHOX2B, a homeobox gene that regulates normal autonomic nervous system development, are usually found in patients with other defects in neural crest development, including Hirschsprung’s disease and congenital hypoventilation syndrome (70, 71). In contrast to PHOX2B, in which mutations are only detected in the germline of inherited neuroblastoma, ALK mutations, have been detected in both sporadic and hereditary neuroblastoma (52-55). Although neuroblastoma are not typically considered one of the common tumours in patients with Li Fraumeni syndrome (LFS) cancer predisposition syndrome, rare germline p53 mutations have been identified in neuroblastoma patients from LFS kindreds (26, 72-74). In addition, genome wide association studies (GWAS) have identified germline copy number variation (CNV) at 1pq21.1 and single nucleotide polymorphisms (SNPs) at 6p22 to be associated with a susceptibility to neuroblastoma (75, 76).

The functions of the proteins encoded by these loci are currently being investigated. More recently, in addition to the above-mentioned genes, candidate germline pathogenic variants

CHEK2, PINK1, BARD1 and PALB2 have also been suggested (26).

The expression of the neurotrophin receptors TrkA and TrkB have also been implicated in the pathogenesis of neuroblastoma and in certain cases predict outcome. TrkA is expressed in biologically favourable neuroblastoma with low MYCN expression that are prone to regress or differentiate (77-79). Neuroblastoma tumours expressing TrkB frequently have unfavourable features including MYCN amplification (79, 80). At the cellular level TrkB has been associated

with enhanced tumour survival and resistance to chemotherapy in neuroblastoma (81).

Telomerase activity has been found to have prognostic significance in several cancers. Normal cells enter replicative senescence, a non-dividing state following a finite number of cell divisions

(82). Cancer cells can avoid cellular senescence by producing telomerase, an enzyme that maintains telomere length. Poor clinical outcome for neuroblastoma patients has been shown to be associated with tumours with high telomerase activity, increased expression of telomerase subunits and long telomeres (83-86).

1.2 p53 family

The p53 family consists of three paralogues: p53, p63 and p73 that share a highly conserved genetic structure. Although p63 and p73 share some similarities with p53 these three genes and their protein products have unique roles in diverse processes ranging from development to tumorigenesis.

1.2.1 Characteristics of p53

Structural characteristics of the p53

p53 was first discovered as a protein that interacts with a DNA tumour virus, simian virus

40 (SV40) (87-90) and was one of the first genes identified to be a tumour suppressor. The structure of p53 protein includes three functional domains. In the NH2-terminus there are two transactivation (TA) subdomains, TAD-1 and TAD-2, which bind to transcriptional machinery to facilitate activation of target genes. This region also has a proline-rich motif that has been shown to play a role in signal transduction via its SH3 domain binding activity (91). Within the proline- rich domain of p53 is a common sequence polymorphism at codon 72, which encodes for either a proline or an arginine residue (92-94). Although both proteins are structurally wild type, they are functionally distinct with the arginine variant more susceptible to degradation by the human

papillomavirus (HPV) 18 E6 protein and with a greater ability to induce apoptosis than the proline variant (95-97). Also, p53 mutant proteins that have an arginine at codon 72 has been to shown to bind the p53 homolog p73 more strongly than p53 mutants with a proline at codon 72 (98). The central DNA-binding domain (DBD) interacts with consensus p53 sites in promoters of p53 target genes. The COOH-terminus has nuclear localization and export signals, a regulatory domain and tetramerization domain (99). The tetramerization domain mediates oligomerization of four p53 monomers to form a transcriptionally active p53 tetramer. The p53 gene can encode at least 12 different functionally distinct isoforms due to alternative promoters and splicing (100, 101)

(Figure 1.3). There are six N-terminal truncated protein isoforms that lack the TA domain,

Δ40p53 (α,β,γ) and Δ133p53 (α,β,γ) (100, 102) (Figure 1.4A). The Δ133p53α is dominant- negative toward full-length p53, inhibiting p53-mediated apoptosis while the β/γ isoforms alters p53 transcriptional activity and is aberrantly expressed in tumours (103). There are also four alternatively spliced C-terminal p53 isoforms, the full-length p53α, p53β (p53i9), p53γ and Δp53

(104, 105). The p53β and p53γ lack the OD while the Δp53 lacks the extreme C-terminus of the

DBD.

Regulation of p53

p53 levels and activity are tightly controlled and under basal conditions protein levels are low. In response to cell stress or DNA damage, such as chemotherapy and radiation, p53 is stabilized as a result of post-translational modifications, such as phosphorylation by ataxia- telangiectasia mutated (ATM) and checkpoint kinases Chk1 and Chk2 (106-108). Ubiquitination and modification with ubiquitin-like proteins tightly regulates the stability and activity of p53.

Numerous E3 ligase enzymes, such as HDM2, pirh2, cop9 and arf-BP1, target p53 for proteasomal degradation (109-112). HDM2 (the human homologue of MDM2) is the most well

Figure1.3 Schematic representation of the gene structure of p53, p63 and p73. The approximate demarcation of exons encoding the unique amino acids for the transactivation domain (green), DNA-binding (purple), oligomerization (blue) and sterile alpha motif (red) domains are indicated by colour. The untranslated regions are shaded black. Arrows indicate transcriptional start sites. TA isoforms result from transcription initiation at the P1 promoter, while ΔN isoforms utilize a second promoter (P2) located in the third intron. Alternative splicing at the COOH- terminal and alternative promoters (P1 and P2) give rise to multiple transcripts. p53: α, β, γ; p63: α, β, γ; p73: α, β, γ, δ, ε, ζ, η, η1, φ.

Figure 1.4 Protein structure of p53 family isoforms. (A) p53 protein isoforms: p53, p53β and p53γ proteins encoded from P1 or P2 promoters contain an N-terminal domain of transactivation (TA). Δ133p53 isoforms encoded from promoter P2 are amino-truncated proteins that lack the TA domain and part of the DNA binding domain (DBD). Δ40p53 protein isoforms encoded from P1 or P1’ promoters and lack part of the TA domain due to alternative splicing of intron-2 and/or alternative initiation of translation (B) TAp63 proteins encoded from promoter P1 contain TA domain. ΔNp63 proteins encoded from the P2 promoter are amino-truncated proteins lacking the TA domain. (C) p73 protein isoforms. TAp73 proteins resulting from the P1 promoter contain the conserved N-terminal TA domain. ΔEx2p73 and ΔEx2/3p73 proteins result from splicing of exon 2 or exons 2 and 3, respectively, and these proteins lack the majority of the TA domain. ΔNp73AS is due to alternative splicing of exon 3’ contained in intron-3. ΔNp73AP proteins encoded from isoforms utilizing the P2 and also lack the TA domain. ΔNp73AP also contains unique amino acids not found in the other variants (shown in white). ΔN: Truncated isoform; DBD: DNA-binding domain (purple); OD: Oligomerization domain (blue); SAM: Sterile a-motif (red); TA: Transactivation domain (green); NLS: Nuclear localization signal (yellow).

studied negative regulator of p53, binds the N-terminal transactivation domain of p53 inhibiting its ability to induce downstream target genes (112). HDM2 can mediate both p53 mono- ubiquitylation promoting nuclear export and polyubiquitylation resulting in p53 degradation (113,

114). Furthermore, HDM2 is a p53 target gene and this results in a p53-HDM2 negative feedback loop (115). High levels of HDM2 due to amplification, increased transcription or enhanced translation are detected in many tumours including paediatric sarcomas, neuroblastoma and leukaemia (44, 116-118). Multiple approaches have been taken to enhance the levels and activities of p53 in these tumours including the use of some chemotherapies and other compound such as cyclooxygenase–2 (COX-2) inhibitors to downregulate HDM2 as well as using small molecule antagonists like Nutlin to inhibit the HDM2-p53 interaction leading to (119-121). A naturally occurring single nucleotide polymorphism in the HDM2 promoter results in a T>G change at nucleotide 309 in the first intron of HDM2 [wild type (T/T), heterozygous (T/G), homozygous (G/G)]. SNP309 increases the affinity of the transcriptional activator Sp1 binding to its putative consensus site in the HDM2 promoter resulting in higher levels of HDM2 RNA and protein and subsequent attenuation of the p53 pathway (116). SNP309 is associated with predisposition to soft tissue sarcoma and specifically has been linked to poor outcomes in neuroblastoma (116, 122-124).

Function of p53

Stabilization of wildtype p53 occurs in response to stimuli including DNA damage, aberrant growth signals from oncogenes such as Myc or Ras or from chemotherapeutic drugs, ultraviolet light or protein-kinase inhibitors (reviewed in (125)). Many of the cellular effects of p53 are due to its role as a homo-tetrameric transcription factor that activates target genes involved in suppressing cellular transformation and tumorigenesis by inducing apoptosis, cell cycle arrest

and DNA repair (126). Upon activation, p53 undergoes post-translational modifications leading to its stabilization and translocation to the nucleus. The activated form of p53 is a tetramer that oligomerizes via the OD domain in the C-terminus of the protein (127, 128). p53 binds as a tetramer to p53-responsive elements (p53RE) found within the promoter of transcriptional target genes (DNA consensus sequence: 10-base pair repeat of 5'-PuPuPu-C(A/T)(T/A)GPyPyPy-

3';where Pu is a purine and Py is a pyrimidine) (128-131). Transcriptional activation of downstream target genes can lead to cell cycle arrest and/or apoptosis (125). One of the most well characterized target genes is p21WAF1/CIP1, an inhibitor of cyclin dependent kinases (CDKs).

Induction of p21 results in cell cycle arrest, inhibiting the proliferation of stressed cells (132, 133).

Damaged cells can either undergo DNA repair or irreversible apoptotic cell death, senescence or autophagy (134, 135). The ability of p53 to induce apoptosis is due, in part, to its ability to bind to and activate the promoters of pro-apoptotic BCL2 proteins via BH3-only proteins, such as Bax,

PUMA, and NOXA (136, 137). Once activated these proteins localize to the mitochondria leading to the permeabilization of the mitochondrial membrane and release of cyctochrome C (136). This induces the formation of the apoptosome and the activation of the executioner caspases (138). p53 can also directly translocate to the mitochondria resulting in the loss of mitochondrial membrane potential and directly inducing apoptosis (139). p53 can also induce apoptosis through the activation of the death receptor pathway which includes the TNF receptors CD95/Fas/APO-1 and

Killer/DR5 as well as the cytoplasmic proteins, PERP and Pidd leading to activation of caspases

(140-144). This pathway is activated when TNF binds to its death receptor, TNFR1, causing the recruitment of adaptor molecules, TRADD (TNFR1-associated death domain) and FADD (FAS- associated death domain) resulting in the binding and activation of procaspases and subsequent activation of executioner caspases. In addition to apoptosis, in certain cellular contexts in

response to specific stresses, p53 has also be show to induce senescence. In response to certain stressors, cells cease to divide and undergo morphological and metabolic changes (145).

Activation of plasminogen activator inhibitor-1 (PAI-1) by p53 has been shown to mediate senescence (146). p53 also modulates autophagy through the activation of mTOR, damage- regulated autophagy modulator (DRAM-1) and Sestrin2 (147-149). Autophagy is a lysosome- dependent cellular process in which damaged or superfluous proteins and organelles are degraded.

This process can lead to cell death and is induced by a number of cellular stresses leading the activation of p53 that increases the level of autophagy in cells and subsequently an additional tumour suppression mechanism.

1.2.2 p53 family members: p73 and p63

Two p53 family paralogues were discovered in the late 1990s. p63 and p73 share three conserved domains with p53: the NH2-TA domain, the central DNA binding domain and the

COOH-terminal oligomerization domain (Figure 1.3). There is a certain degree of functional overlap between the family members; however p63 and p73 also have distinct roles in development. p63 has been shown to be essential for limb formation and epidermal morphogenesis while certain isoforms of p73 are required for neuronal survival (150-153).

Structure of p73 and p63

p63 and p73 share significant homology to p53 in three functional domains with approximately 25%, 60%, and 35% amino acid identity with p53 in TAD, DBD, and OD, respectively (154-160). p63 (Figure 1.4B) and p73 (Figure 1.4C), genes encode multiple isoforms resulting in proteins with varying functions. The p73 and p63 genes encode full-length (TA) isoforms when transcribed from the first promoter and truncated (ΔN) isoforms as a result of initiating transcription from a second promoter in the third intron. The ΔN isoforms lack the N-

terminal TA domain. The transcripts generated from the P1 promoter of p73 can also undergo exon splicing resulting in additional isoforms that lack the transactivation domain (∆N’p73,

∆Ex2p73, ∆Ex2/3p73) (161). Alternative splicing at the COOH terminal leads to nine functionally distinct p73 protein isoforms (α, β, γ, δ, ε, ζ, η, η1, φ) (162, 163). Only 6 isoforms of p63 have been shown to be expressed in cells (TAp63α,β,γ and ΔNp63 α,β,γ) (155). The alpha isoforms of p73 and p63 contain a conserved sterile alpha motif (SAM) that functions as a protein-protein interaction domain (164).

Regulation of p73 and p63 stability

In contrast to p53, less is known about the upstream pathways that modulate p73 and p63. p73 has been shown to be regulated by some of the same mechanisms as p53, however, p73 degradation is not mediated by HDM2 as seen with p53 (165). Although HDM2 binds to p73 inhibiting its ability to transactivate target genes, most reports suggest this binding leads to the stabilization but not the degradation of the p73 protein (166, 167). Additional proteins implicated in TAp73 regulation include E3 ligase Itch, c-abl and Pin-1 (168, 169). The E3 ligase Itch degrades p73 and p63, but not p53, and Itch itself is regulated in response to DNA damage (169,

170). p73 phosphorylation by c-abl in response to cisplatin and gamma irradiation results in enhanced p73 stability and induction of apoptosis (171, 172). p73 has also been linked to the

Rb/E2F1 pathway; E2F1 transcriptionally activates the full length TAp73 resulting in apoptosis

(173). Other pathways implicated in p73 regulation and inactivation and therefore play a role in p73 dependent DNA damage response are chk1, Akt, and YAP (174-176). The specific pathways regulating the levels and activity of p63 are less well understood; however, E3 ligases WWP1,

Stxbp4, and RACK1 have been reported to bind and degrade p63 (177, 178). The regulation and

relative levels of expression of different p53, p63, and p73 isoforms play critical roles in development, tumorigenesis, and chemotherapy sensitivity.

Functional activity of p73 and p63

p73 and p63 can functionally mimic p53 by transactivating many p53 target genes thereby inducing apoptosis. The full-length forms of p63 and p73 (TAp63 and TAp73) can bind p53

DNA-binding sites in the promoters of pro-apoptotic target genes and induce cell cycle arrest and apoptosis (155, 179, 180). Notably, in comparison to TAp73α, the TAp73β isoform is a more potent transcriptional activator (162, 181, 182). This may be due, in part, to differential binding to target gene promoters. While p63 and p73 can bind to canonical p53-REs (RRRCWWGYYY) there are also unique target genes for each of the p53 paralogues including PERP for p63 and p57kip2 for p73 (183-185). Specific sequences that mediate p63 binding in promoters have also been identified (186). In contrast, the transcriptionally inactive ∆Np73 and ΔNp63 isoforms lack the N-terminal transactivation domain and act as dominant-negative inhibitors of both p53 and

TAp73 (187). ∆Np73/p63 can inhibit the full length TA forms of p53, p63, or p73 preventing target gene induction and apoptosis by at least two mechanisms: 1) interfering with oligomerization by forming inactive heterotetramers or 2) by competing for binding to the same p53/p73/p63 responsive element in the promoter of target genes (188-191) (Figure 1.5). Recent papers also indicate that the Δp63 and Δp73 proteins also act as transcriptional activators for target genes and have been shown to regulate genes involved in DNA repair and growth suppression

(192, 193).

Figure 1.5 Model for drug-induced apoptosis via modulation of p53 family proteins. There is a balance between pro- and anti-apoptotic isoforms of p53, p63 and p73. The TA isoforms of p63 and p73 (denoted TA, purple) and p53 (green) form active homotetramers that bind to and activate promoters of apoptotic and cell cycle arrest genes, leading to cell death. The prosurvival protein ΔN isoforms of p63 and p73 (denoted ΔN, blue) and mutant p53 (red) inhibits apoptosis by two mechanisms: binding to and competing for target gene promoters; and forming inactive hetero- oligomers that cannot transactivate target genes. In cells with mutant p53 or high levels of ΔN isoforms, the balance is tipped to the left toward cell survival.

1.2.3 Role of p53 family proteins in Cancer p53 inactivation in cancer

Defects in p53 are one of the most commonly detected genetic alterations in sporadic human cancers (194). p53 mutations are identified in more than 50% of sporadic tumours and the p53 pathway is inactivated in a further 20%. The majority of cancer-derived p53 mutations are missense and are localized in the central DBD, resulting in the loss of ability to bind DNA and thus induce many target genes involved in apoptosis and cell cycle arrest (195) (Figure 1.6A).

The disruption of binding depends on the mutation and can result in destabilization of the tertiary structure of the DBD, structural changes in the DBD, or elimination of direct contact between

protein and DNA (196). Therefore, p53 mutants are classified as either contact mutations that directly disrupt the DNA-binding of p53 but have modest impact on p53 conformation or conformational mutations that result in a partially denatured protein (197-199). There are a small number of common “hotspot” mutated residues (Figure 1.6B). In comparison to wildtype p53, the levels of mutant p53 are often higher in part due to the failure to induce the p53-target HDM2, leading to impaired HDM2-mediated degradation of the mutant p53 (200). In contrast to most mutations of common tumour suppressor proteins, many p53 missense mutations result in enhanced protein stability and “gain of function” activities. Thus, mutant p53 proteins not only have lost wildtype p53 functions but in cell based assays are also associated with enhanced transformation, increased genomic instability and chemotherapy resistance (201-203). More recently additional, “gain of function” activities have been reported. Certain p53 mutant proteins can bind to and inactivate TAp63 and TAp73 (98, 204, 205). Similar to the ΔNp73/p63 forms these p53 point mutants form inactive hetero-oligomers with TAp73 and TAp63. In tumours that retain wildtype p53, the p53 protein can be inactivated by these hetero-oligomers or by alternative mechanisms via impaired nuclear retention of p53, loss of the upstream activator p14ARF (via methylation), amplification of HDM2 or inactivation by oncoproteins such as SV40T and human papilloma virus E6 (44, 206, 207).

p53-/- mice or mice expressing common tumour-derived p53 mutant proteins also develop cancers (208, 209). p53-/- mice primarily develop sarcomas and lymphomas, whereas, mice expressing a p53 point mutation show an increased incidence of sarcomas and endothelial tumours as well as develop carcinomas that are not seen with p53-/- mice. Mutant p53 mice tumours are also more invasive or showed metastasis to various organs at a higher frequency than p53-/- or p53+/- mice (208, 209).

Figure 1.6 Sporadic p53 mutational spectrum in human cancers. (A) p53 missense mutation data for human cancer patients (N = 27,595) were obtained from the p53 International Agency for Research on Cancer (IARC) database (http://p53.iarc.fr/) and plotted as a function of amino acid position. Schematic of the p53 protein with domain structures illustrated. Transactivation domain (1–42); proline-rich domain (40–92), which also contains a second transactivation domain; DNA- binding domain (101–306); oligomerization domain (307–355); C-terminal regulatory domain (356– 393), (data adapted from http://p53.free.fr). (B) Table for the most common missense mutations residues in p53 with corresponding frequency. TP53 mutation data for human cancer patients (N = 27,595) were obtained from the p53 database (http://p53.free.fr) (Modified from Freed-Pastor and Prives 2012).

Li-Fraumeni Syndrome

LFS is a rare autosomal dominant familial cancer disorder. It is a clinically and genetically heterogeneous syndrome with an estimated disease penetrance of 50% by 30 years and 90% by 60 years. Li and Fraumeni initially described LFS as a clinical syndrome in 1969 when they identified kindreds with high incidence of specific tumours including soft-tissue sarcomas, breast cancer, and other neoplasms (210). In 1990, Malkin and colleagues identified germ-line p53 mutations in LFS patients (211). Patients with germ-line p53 mutations develop the Li-Fraumeni cancer predisposition syndrome, characterized by early onset of a spectrum of tumours (211). The clinical definition of classic LFS is: three close relatives with documented cancer, including one individual, designated the proband, with a sarcoma before 45 years of age, a first degree relative with cancer in this age interval and a close relative with cancer at this age interval or a sarcoma at any age (212). Individuals affected with LFS show an early onset of soft tissue sarcomas, osteosaromas, breast cancer and brain tumours (212). Furthermore, multiple primary tumours can arise in both synchronous (single occurrence) or metachronous (multiple separate occurrences) patterns. The p53 mutations found most commonly in LFS patients are similar to those identified in sporadic tumours (Figure 1.6). Most are missense and frequently in the DNA binding domain.

These mutant alleles encode p53 protein with decreased ability to activate p53 target genes and induce apoptosis leading to early onset of cancer. Knock-in LFS mouse models were developed using mice expressing the murine equivalents to two of the hotspot p53 mutations to recapitulate the disease with one p53 allele mutated and were found to produce more metastatic tumours when compared to p53-/- mice (208, 209). Mutant p53 mice had an increased incidence of lymphomas and sarcomas that are also seen with p53-/- knockout mice but also developed carcinomas (208,

209).

Role of p73 and p63 in cancer

Unlike p53, point mutations of p63 and p73 are rare. However, there is increasing evidence to support roles for p63 and p73 in cancer. The TA isoforms have tumour suppressor-like activity, while the ΔN anti-apoptotic isoforms have oncogenic properties. Studies suggest that the balance between p53, p63 and p73 isoforms is an important determinant of tumour development. Aged p63-/- and p73-/- mice in which all isoforms are deleted, develop both pre-malignant tumours and spontaneous tumours in which there is loss of the second p63 or p73 allele (213). Furthermore, in p53-/- mice with either deletion of p73 or p63 have a different tumour and metastatic potential, suggesting that p53 family protein interactions play important non-overlapping roles in tumorigenesis in vivo. A specific role for TAp73 is supported by the finding that TAp73-/- mice in which only the full length forms of p73 are deleted develop leukaemia, lymphomas and sarcomas characterized by an enhanced sensitivity to chemical carcinogens and increased genomic instability (214). To date, TAp63 specific knockout mice do not develop tumours (215). Evidence in human tumours also suggests that the relative expression and stability of the different N- terminal isoforms of p73 and p63 may contribute to tumorigenesis. In certain tumours the anti- apoptotic “oncogenic” ΔNp73 isoforms are expressed at high levels and this expression is associated with a poor prognosis in neuroblastoma, rhabdomyosarcoma, medulloblastoma, breast, ovarian, hepatocellula and prostate cancers (216-219). Low levels of TAp73 has also been reported in human hematopoietic cancers, due in part to methylation, and together with the observation that TAp73-/- mice develop leukemia, suggests a role for TAp73 in hematopoietic cancers. Similar to ΔNp73 high levels of ΔNp63 protein are detected in several cancers including a high proportion of squamous cell carcinomas of the head and neck, lung, cervix, and esophagus

(220, 221).

Many chemotherapies and other drugs exert their anti-tumour activity by inducing cells to undergo apoptosis. The relative balance between the different p53 family proteins is an important determinant of chemotherapy sensitivity (40, 221, 222). Evidence for a role of p73 in chemosensitivity includes the finding that mouse embryo fibroblasts (MEFs) with combinations of p53, p63 and p73 deletions are more resistant to doxorubicin than MEFs lacking only p53 (223).

In addition, many studies have demonstrated that the chemotherapy drugs; doxorubicin, cisplatin, camptothecin, and etoposide, as well as gamma-irradiation, specifically induce the full length pro- apoptotic form of p73, TAp73 (41, 224). Interfering with the expression of the anti-apoptotic

ΔNp73 and ΔNp63 also results in enhanced sensitivity to chemotherapy. In head and neck squamous cell carcinomas (HNSCC) high levels of ΔNp63 binds to TAp73β inhibiting the activation of pro-apoptotic targets is inhibited, therefore strategies aimed at altering the balance between the different p73 and p63 isoforms may prove effective treatment target (221, 225).

Role of p63 and p73 in development

Although there is some functional overlap between the family proteins, p63 and p73 also have distinct roles in development. p63 has been shown to be essential for limb formation and epidermal morphogenesis (226). p63 −/− mice fail to develop skin and other epithelial tissues as well as have craniofacial and limb malformations (151, 226). Patients with ectodermal dysplasia syndromes with varying degrees of craniofacial (cleft lip and palate), limb, skin, and hair abnormalities have germline p63 mutations (227). While the physiological role of p63 has shown it primarily to be involved in epithelial cell development, p63 also plays an important role in determining life versus death of developing sympathetic neurons. In the nervous system, p63 is primarily expressed as TAp63 and is essential developmental neuronal death. In contrast, ΔNp63

antagonizes the pro-apoptotic activity of p53 allowing the survival of embryonic cortical precursors and newly born cortical neurons (228).

p73 is also known to be required for neuronal development. p73 −/− mice have hippocampal dysgenesis, hydrocephalus and olfactory neuron defects (150). ΔNp73 is critical for the survival of developing neurons as deletion led to sympathetic neuron loss and cortical thinning (152, 153). More recently, TAp73 was found to prevent premature differentiation of neural stem cells through transcriptional regulation of basic helix-loop-helix protein Hey2, which promoted long-term neural precursor maintenance (229). During aging, p73 has an essential role in preventing neurodegeneration. Having only one functional copy of p73 may be a susceptibility factor for Alzheimer’s disease and other neurodegenerative disorders(230). Also, p73 -/- mice displayed chronic infections and inflammation, as well as defects in pheromone sensory pathways

(150). TAp73 also modulates macrophage polarization, acting as a suppressor of innate immune response further supporting of the role of p73 in the immune system (231).

1.3 β-Adrenergic signalling

1.3.1 β-Adrenergic Receptors

The β-adrenergic signalling pathway mediates the sympathetic nervous system (SNS). The catecholamine neurotransmitters epinephrine (EPI) and norepinephrine (NE) are released from

SNS axon terminals following physiological stress. The biologic effects of EPI and NE are mediated by the adrenergic receptor. The adrenergic receptors belong to a family of guanine– nucleotide-binding protein (G-protein) coupled receptors. There are two major families of adrenergic receptors, the α- and β-adrenergic receptors, with distinct patterns of tissue distribution and signalling pathways (232). The α-adrenergic receptors are expressed on peripheral sympathetic nerves and activation leads to vasoconstriction of the smooth muscle in blood vessels.

The α1 receptors couple to the Gq protein receptor leading to the stimulation of phopholipase C, which results in increased intracellular Ca2+. The α2 receptors, on the other hand, couple to inhibitory G protein (Gi), leading to decreased inhibition of cyclic adenosine monophosphate

(cAMP) activity. Both the α1 and α2 receptor activation result in smooth muscle contraction.

Three different β-adrenergic receptors subtypes have been described (β1, β2, β3) (232). β1- adrenergic receptors are expressed primarily in the heart and in the kidneys; β2-adrenergic receptors are expressed in the lungs, gastrointestinal tract, liver, uterus, vascular smooth muscle, and skeletal muscle and β3-adrenergic receptors are mainly expressed in adipocytes. The β receptors couple to the stimulatory G proteins (Gs) and stimulate the production of cAMP activity from ATP. cAMP acts as a second messenger that activates protein kinase A (PKA) (Figure 1.7).

Stimulation results in a number of physiological effects including heart muscle contraction, smooth muscle relaxation and glycogenolysis. Understanding the diverse structures and functions of the adrenergic receptors has resulted in the successful development of specific pharmacological agonists and antagonists directed at various receptor subtypes.

1.3.2 Pharmacological agents targeting β-adrenergic receptors

β-adrenergic receptor agonists

β-adrenergic receptor agonists are a class of sympathomimetic agents that mimic the action of EPI and NE signalling in the heart, lungs and smooth muscle tissue. Stimulation of the β- adrenergic receptor results in the activation of the adenylate cyclase enzyme. This leads to an accumulation of cAMP, activation of PKA and subsequent induction of smooth muscle relaxation and contraction of cardiac tissue resulting in the opening of calcium channels and induction of positive inotropic and chronotropic output of the myocardium (233, 234). Clinically, β-adrenergic receptor agonists have been used to treat a number of cardiac conditions such as bradycardia,

hypotension, chronic obstructive pulmonary disease (COPD) and heart failure as well as hypoglycemia, asthma and allergic reactions (235-237).

β-adrenergic receptor antagonists

β-antagonists block the action of endogenous catecholamines on β-adrenergic receptor.

Clinically, β-adrenergic antagonists are used for treatment of hypertension, cardiac arrhythmias, angina pectoris, migraine headaches, and anxiety/”stage fright”. Non-selective β antagonists, such as propranolol and timolol can bind with equal affinity to both the β1- and β2-adrenergic receptor.

Selective β-antagonists have an affinity to either the β1- and β2-adrenergic receptor and include metropolol (β1 specific) and butaxamine, ICI-118 (β2 specific). The non-selective β-blocker propranolol was originally designed to treat cardiovascular disorders such as hypertension and arrhythmias and has more recently being used for the treatment of infants with large hemangiomas

(238, 239). Infantile hemangiomas are the most common benign vascular tumours in children and propranolol is now the first line of therapy in severe cases due to its anti-proliferative effect on haemangiomas (240, 241). The mechanism of action in hemangiomas is largely unknown; however, potential ones have been implicated including vasoconstriction, inhibition of angiogenesis and induction of apoptosis. β-blockers inhibit the vasodilatation mediated by adrenaline via β-receptors and thus lead to vasoconstriction reducing the blood supply to the hemangioma (242). Hemangiomas have increased levels of proangiogenic growth factors such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) during the proliferative phase with lower levels observed in the involution phase (243, 244). Propranolol leads to a reduced expression of VEGF with subsequent decrease in Akt and MAPK activity resulting in the inhibition of angiogenesis and reduction in hemangiomas size (245). Propranolol has been shown to induce apoptosis in haemangioma cells likely through the suppression of VEGF

Figure 1.7 Signalling pathways of the adrenergic receptors subtypes. Epinephrine or norepinephrine are receptor ligands for either α1, α2 or β-adrenergic receptors. The α1- adrenoceptor couples to Gq protein and activates phospholipase C and the downstream mediators inositol trisphosphate (IP3), diacylglycerol (DAG), and protein kinase C, which are involved in cardiac and in smooth muscle contraction. α2-adrenoceptor, couples to inhibitory G protein (Gi), which inhibits adenylate cyclase (cAMP) activity, resulting in smooth muscle contraction. β- adrenoceptor couple to stimulatory G protein Gs, increases intracellular cAMP activity and activation of protein kinase A (PKA), resulting in e.g. heart muscle contraction, smooth muscle relaxation and glycogenolysis. (Adapted from Christensen et al. 2010 (246))

expression, activation of caspases, and up-regulation of the pro-apoptotic genes p53 and Bax

(247). Propranolol has had widespread clinical use for over 50 years with no significant side effects reported for paediatric patients treated at therapeutic doses.

1.3.3 Beta-Adrenergic signalling in cancer

The first evidence that β-adrenergic receptors may have a regulatory role in cancer involved experiments in which treatment with the β-receptor agonist isoproterenol led to increased proliferation of human lung adenocarcinoma cells (248). Since these early reports several studies have demonstrated that β-adrenergic receptor antagonists have anti-proliferative and apoptotic effects in a number of cancer cells types such as pancreatic, leukaemia, gastic and head and neck squamous cell carcinoma (HNSCC) (225, 249-251). For example, Zhang et al. reported that treatment inhibited proliferation of pancreatic cancer cells and induced apoptosis through the β2- adrenergic receptor blockade based on finding that a β1-adrenergic receptor specific antagonist did not induce cell death (252). Propranolol in combination with radiation also resulted in decreased cell viability and clonogenic survival as well as induction of apoptosis in human gastric adenocarcinoma and HNSCC cell lines (225, 253).

Several different molecular mechanisms have been implicated in β-adrenergic regulation of cell death. β-adrenergic agonists have been shown to stimulate a number of pathways involved in increased proliferation of cells by two different mechanisms: first, stimulation of β2- adrenoceptors directly leads to an activation of ERK⁄MAPK (potentially via src) and secondly, propranolol induces increased release of VEGF, which itself can activate the ERK⁄MAPK cascade

(254, 255). Previous reports have also suggested that EPI exerts its proliferative and proangiogenic effects on cancer cells by regulation of the p38/MAPK and COX-2 pathways as well as through matrix metalloproteinases (MMPs) (255-257).

Although there have been some genes and pathways implicated in the proliferative effects of EPI, the anti-cancer mechanisms of β-adrenergic antagonists have not been elucidated. Liao et al. previously reported that treatment with the non-selective beta-antagonist propranolol decreased the level of NF-ΚB expression and down-regulated VEGF, COX-2, and EGFR levels in gastric cancer cells (251). This downregulation of VEGF expression by propranolol was also observed in propranolol treated pancreatic and head and neck cancer cells (225, 258). MMP-2 and -9, which are implicated in proliferation, migration and angiogenesis, have also been shown to be downregulated following treatment with propranolol (259). Furthermore, it has been demonstrated that the non-selective β-antagonist carvedilol, reduces the expression of hypoxia inducible factor

1α (HIF-1α) (260).

Epidemiologic data further supports a potential anti-cancer role for β-adrenergic receptor antagonist. A 10-year longitudinal study found that breast cancer patients receiving beta-blocker therapy for hypertension had diminished incidence of metastases, recurrence and mortality in comparison to women who did not receive β-blocker providing the first clinical evidence to support in vitro studies (261). A retrospective study of women with stage I-IV invasive breast cancer was performed from a series of population-based observational studies. The study determined that while there was no benefit to women receiving a β1-specific antagonist, women who received propranolol were significantly less likely to present with advanced stage tumours compared to women not taking propranolol (262). Similarly, perioperative treatment combining β

-blockers and COX-2 inhibitors reduced the risk of tumour metastasis in lung cancer patients.

Benish et al. 2008 tested COX inhibitors alone and in combination with propranolol, and while monotherapy decreased metastasis, combined treatment further attenuated these effects. The authors speculated that this was the result of improved immune competence resulting from the

inhibition of excessive prostaglandin and catecholamine release in the perioperative period; however, the molecular mechanism for these observed effects was not determined (263).

β-adrenergic receptors are expressed on multiple malignant cell types and treatment with propranolol has been reported to reduce viability cancer cell lines including as pancreatic, leukaemia, gastic and head and neck squamous cell carcinomas (HNSCC) (225, 249-251). OSCC patients with strong β2-adrenergic receptor immunohistochemical expression had a superior overall survival in comparison to patients with weak/negative β2-adrenergic receptor expression

(264). In addition, lower expression of β2-adrenergic receptor mRNA (ADRB2) was detected in leukaemia cells of patients who relapsed compared to patients who remained in continuous complete remission and low levels of ADRB2 were found to be associated with poor prognosis for patients with clinically localized prostate cancer and predicted an increased recurrence risk (265).

1.4 Cardiac Glycosides

1.4.1 Structure and Function of Cardiac Glycosides

Cardiac glycosides are a group of naturally derived compounds that share a common structural motif (Figure 1.8). Cardiac glycosides are comprised of a steroid nucleus, an unsaturated lactone ring at the C-17 position, and a sugar moiety. There are two groups of cardiac glycosides differentiated by the type of lactone moiety: cardenolides, characterized by the presence of a 5-membered unsaturated lactone ring, and bufadienolides, characterized by a 6- membered unsaturated lactone ring (reviewed in (266)). The majority of cardiac glycosides target the ubiquitous cell membrane associated Na+/K+-ATPase, which is described in detailed below.

1.4.2 Cardiac Glycosides and Na+/K+-ATPase

Characteristics of the Na+/K+-ATPase

Na+/K+-ATPase is a membrane-associated enzyme from the P-type family of cation pumps that consists of two polypeptides: the α and β subunits with four α subunit isoforms (α1,

α2, α3, α4) and three β subunit isoforms (β1, β2, β3) (267). Also, the Na+/K+-ATPase αβ- complex can often be associated with single-span transmembrane FXYD proteins, that seem to act as modulators of the kinetic properties of the pump (268). The α-subunit is responsible for the catalytic and transport properties of the Na+/K+-ATPase and the β-subunit is essential for activity of the Na+/K+-ATPase, acting as a chaperone protein that assists in membrane insertion, folding, and delivery to the plasma membrane (269-271). The Na+/K+-ATPase is expressed in tissues where electrochemical gradients are important for physiological function such as in the kidney, brain, skeletal muscle and cardiac muscle. The Na+/K+-ATPase subunit isoforms are also selectively expressed in a tissue specific manner (272, 273) (Figure 1.9). Na+/K+-ATPase uses energy from the hydrolysis of adenosine triphosphate (ATP) to transport 3 Na+ out of the cell in exchange for 2 K+ (274) (Figure 1.10A). The main physiological role for the Na+/K+-ATPase is establishing and maintaining the electrochemical gradient across the plasma membrane. These gradients are used as an energy source to maintain membrane potential of the cell, osmotic regulation of cell volume, secondary active transport (275).

Cardiac glycosides effect on Na+/K+-ATPase

Certain cardiac glycosides, such as digoxin are used clinically for the treatment of management of heart failure and arrhythmias. Cardiac glycosides can reversibly bind to the α subunit of the Na+/K+-ATPase resulting in an increase in intracellular levels of Na+ (271). This

Figure 1.8 General chemical structural characteristics of cardiac glycoside ouabain. Each cardiac glycoside has three structural motifs: a steroid nucleus, a sugar moiety and a lactone moiety. The core structure consists of a steroidal framework, which is considered the pharmacophoric moiety responsible for the activity of these compound carries the essential features responsible for a drug’s biological activity. A lactone moiety at C17 characterizes one of two subgroup of the glycosides, cardenolides have a five-membered unsaturated butyrolactone ring, whereas bufadienolides contain a six-membered unsaturated pyrone ring. A wide variety of sugars at are attached at C3 to the steriod moiety, which themselves have no activity but affects the pharmacodynamic and pharmacokinetic profile of each glycoside

Figure 1.9 Tissue distribution of Na+/K+ATPase in humans (Adapted from Bagrov et al. 2009)

Figure 1.10 Na+/K+-ATPase medicated signal transduction. (A) Active transport of Na+/K+- ATPase to exchange 2K+ into the cell and 3Na+ out of the cell. (B) Binding of cardiac glycosides to Na+/K+-ATPase activates multiple signal transduction cascades involved in cell death and proliferation. To summarize briefly, following cardiac glycoside binding to Na+/K+- ATPase, the tyrosine kinase SRC is activated and in turn activates the proximal epidermal growth- factor receptor (EGFR). Activated EGFR sequentially recruits the adaptors SHC, growth factor receptor-bound protein 2 (GRB2) and SOS, which ultimately leads to activation of the mitogen- activated protein kinase (MAPK) cascade. In parallel, phospholipase C (PLC) and inositol 1,4,5- triphosphate (IP3) also participate in the formation of a functional microdomain that brings Na+/K+-ATPase into direct contact with the IP3 receptor (IP3R) of the endoplasmic reticulum (ER). At this point, single or repeated transient increases in intracellular Ca2+ are produced. Ca2+ oscillations mediate a diverse range of cell functions including cell proliferation, differentiation and apoptosis. MEK, MAPK kinase; NF-κB, nuclear factor-κB; ROS, reactive oxygen species. (Adapted from Prasses et al. 2008).

decreases the activity of the Na+/Ca2+ exchanger resulting in increased levels of intracellular

Ca2+ accumulating in the sarcoplasmic reticulum that is released on subsequent depolarization resulting in enhanced contractility (276) (Figure 1.10B). Unfortunately, cardiac glycosides have a very narrow therapeutic window. While calcium is essential for normal cardiac function, excessive levels of calcium are toxic to the heart and can cause may cause cardiac arrhythmias and arrest and digoxin toxicity induced arrhythmias have been reported in children (277, 278).

1.4.3 Cardiac glycosides and cancer therapy

The targeting of Na+/K+-ATPase cardiac glycosides in cancer is supported by a growing body of preclinical and clinical data. Anti-cancer activity of digitalis was first observed in patients with breast cancer. An epidemiological study by Stenkvist et al. followed a group of women with breast cancer treated with digitalis for heart disease and determined that tumours were smaller and the rate of recurrence was lower in women taking digitalis (279). Concentrations of digitoxin commonly used to treat patients also inhibits the growth of cancer cells and induces apoptosis

(280). A number of in vitro studies have found that conventional cardiac glycosides have anti- tumour properties against a range of cancer cell lines including: prostate, lung, neuroblastoma and breast (281-284). Initially, the observed effects were attributed to direct inhibition of the

Na+/K+ATPase pump (Figure 1.11). Digitoxin inhibits the Na+/K+ATPase at 0.5-5µM resulting in an increase of intracellular Na+ (267). There is a subsequent increase in intracellular calcium; large influxes of calcium are associated with apoptosis (281). However, subsequent studies have found that digitoxin decreases the viability of cancer cells at a much lower dose than what is needed to inhibit the Na+/K+ATPase pump (10-100nM) (280, 283, 284). These findings suggest a different anti-cancer mechanism exists than that which was initially proposed, distinct from the ion pump activity. The observed anti-cancer signalling characteristics may be due to the

Na+/K+ATPase signalosome, a multiple protein signalling complex that has been observed to control apoptosis, cell proliferation and cell motility (285). Digoxin binds to the Na+/K+ATPase signalosome and activates a number of downstream signalling cascades such as phospholipase C

(PLC), mitogen-activated protein kinase (MAPK), phosphatidyl-inositol-3-kinase (PI3K), and Src kinase signalling (285) (Figure 1.10B). Cardiac glycosides also inhibit the activation of tumour necrosis factor (TNF)-induced NF-κB signalling pathway (286, 287). Furthermore, anti- proliferative activity following treatment with cardiac glycosides is also associated with inhibition of topoisomerase I and II as well as TRAIL activation and up-regulation of DR4/5 (288, 289).

Also, cardiac glycosides sensitize resistant cells to anoikis, a process by which normal epithelial cells undergo apoptosis upon detachment from the extracellular matrix (290). Malignant epithelial cells with metastatic potential are resistant to anoikis, surviving in an anchorage- independent fashion and the cardiac glycoside, ouabain, has been shown to decrease tumour metastasis (290). More recently Hiyoshi and colleagues found that treatment with ouabain induced quiescence in neuroblastoma cells through the up-regulation of the quiescence-specific transcription factor ‘hairy and enhancer of split1’ (HES1) as well as activated the DNA-damage response (DDR) pathway marker γH2AX and reduced tumour growth of neuroblastoma xenografts by >50% (291).

At present, there are no suitable murine models to investigate toxic effects of cardiac glycosides. In 1967, Shiratori examined the cytotoxicity using a rodent cancer cell line and found the dose required to inhibit the in vitro proliferation are toxic to humans (0.1-10µM) (292).

However, it was later determined there are species-specific differences in the Na+/K+ATPase that accounted for the high anti-proliferative dose requirements. Animals differ greatly in cardiac glycoside sensitivity; rabbit, cat and humans were highly sensitive whereas rat, mouse and toad

were less susceptible to these toxic effects (293). While the Na+/K+ATPase is highly conserved across species, amino acid differences in the cardiac glycoside binding site can lead to humans and sheep being 1000 fold more sensitive to cardiac glycosides than rodents (294). Differential expression and activity of the Na+/ K+-ATPase subunits in tumour tissues compared with their normal counterparts have been evident in various cancers (295-297). In tissue samples from patients with colorectal cancer there is an up-regulation of the Na+/K+ATPase α3-isoform and down-regulation of the α1-isoform (295).

Novel strategies to circumvent cardiac glycoside induced toxicity

To achieve a more potent drug with reduced cardiotoxicity, efforts have been devoted to synthesizing safe novel cardiac glycoside compounds with improved anti-cancer activity (285).

Previous studies have shown that synthesis of digitoxin analogues have high cytotoxic activity.

For example modification of the glycosidic linkage or oligosaccharide moiety of digitoxin can increase anti-cancer cell efficacy (285). Wang et al. showed that numerous cancer cell types were sensitive to several monosaccharide analogues of digitoxin with a small subset of these analogues demonstrating increased potency in inducing apoptosis and growth inhibition (298). In particular, one analogue D6-MA, modulated several pathways controlling cell cycle progression, cell proliferation and apoptosis and was more potent at inhibiting NA+/K+ATPase activity than digoxin (283). Interestingly, the cytotoxic dose of both digoxin and D6-MA was significantly less than that required to inhibit the NA+/K+ATPase pump, suggesting that the direct inhibition of the pump may not mediate the cytotoxic effects observed (283).

!"#$"%&'( )*+%,*%+-( )%.,-$/01-(,2&,-+(*3$-( 4!56(+2&7-( )(*+,-.$./(0$'0/+( )1/"2/3&$( !"#$%&'( 456)64(78(

(*+,-.$./(0$'0/+(

9&',:"#$;&'( 456)64(78(

)*+,-.$./(0$'0/+(( )!+/$-.(0$'0/+( )(>/'$%( $?/',0$+0&',3$(( <&;&.,=&'( )(8/%$',3$( 456)64(78( )(1/"2/3&$( )(1"';(( )(9,%,'( )(*+,-.$./( )(9/+@&0$%( <&;,=&'( )(1"';(( 456)64(78(

)(*+,-.$./(0$'0/+( )(1/"2/3&$(( )(!+/$-.( )(1B3CD,3$( A%/$'?+&'( 456)6(78( )(A@$+&$'( )(*$'0+/$E0( )(9,%,'( )(8/%$',3$( )(*+,-.$./( )(!+/$-.( )(1"';(( )(1/"2/3&$( A"$:$&'( 456)64(78( )(9,%,'( )(8B/%,3$( )(1B3CD,3$( )(>/'$%( )(!+/$-.(( )(8B/%,3$( *+,-0&%%$+&?&'( )(1B3CD,3$( F4)644('8( )(1/"2/3&$( )(9,%,'(

Figure 1.11 Summary of the most studied cardiac glycosides and their anticancer activity (Reproduced from Elbaz et al. 2012)

1.5 Conclusions

A better understanding of neuroblastoma through further characterization of genes and mechanisms involved in the tumorigenesis of neuroblastoma can be used to identify novel therapies for high-risk patients. The importance of p53 family proteins in regulation of apoptosis makes it a common focus of investigation in cancer research. For instance, elucidating the role of p53 in neuroblastoma can lead to potential strategies to overcome chemoresistance in neuroblastoma with p53 mutations. The development of novel ways to access this crucial step in cancer cell survival could be of benefit in cancer therapy. Repurposing existing medications can lead to insights into neuroblastoma tumorigenesis and potential new treatments. Using a high- throughput drug screen of FDA-approved drugs, we identified the β-adrenergic receptor antagonist propranolol and cardiac glycosides as potential anti-neuroblastoma agents. Propranolol has previously been shown to induce cell death in a number of cancer types and has been implicated in the modulation of the p63/p73 balance. Cardiac glycosides have a well-documented in vitro and epidemiological effect on the inhibition of cancer cell growth. However, due to a narrow therapeutic window novel cardiac glycoside analogues were designed in an attempt to develop a more effective anti-proliferative cardiac glycoside without cardiotoxic side effects.

The focus of my graduate studies was aimed at identifying novel gene and protein targets for the treatment of neuroblastoma, initially focusing on the pro-apoptotic p53/p73-signalling pathway. Later studies went beyond p53-family focused targets and involved characterization and mechanistic studies of candidate anti-neuroblastoma drugs identified by high throughput screens.

Note: Chapters 2, 3, and 4, each represent the latest draft of a manuscript in which the results and discussion have been expanded upon.

Chapter 2 – The role of LFS associated p53 mutations in neuroblastoma

Authors: Jennifer K Wolter, David Malkin, Meredith S. Irwin

All experiments shown in this chapter were performed by the author.

2.1 Abstract

Despite intensive therapy less than 40% of older children with metastatic neuroblastoma survive.

Although rare at diagnosis p53 mutations and other aberrations of the p53/HDM2/ARF pathway are more commonly detected in relapsed neuroblastoma. p53 plays a critical role in the response to chemotherapy. We identified germline p53 mutations (R158H and R248W) in two infants with Li-

Fraumeni Syndrome (LFS)-neuroblastoma. Our objective was to determine the role of these mutant p53 proteins as well as wildtype p53 and p73 in chemotherapy response in neuroblastoma cell lines and primary cells isolated from the bone marrow of neuroblastoma patients. Adherent and primary neuroblastoma lines were transfected with plasmids encoding wildtype p53, TAp73 or mutant p53 (R158H and R248W). Immunoblots to detect target gene expression and apoptosis

(by Cl-PARP), luciferase assays, and foci formation assays were performed. In contrast to wildtype p53, expression of the mutant p53 proteins identified in the patients resulted in decreased chemotherapy-induced apoptosis and activation of p53-target genes (p21, BAX). Both mutant p53 proteins formed complexes with the pro-apoptotic p73 protein TAp73, and inhibited p53 and

TAp73-dependent p53 target gene activation. In primary neuroblastoma patient cells, transfection of mutant p53 proteins resulted generation of in more spheres that were larger in size, in comparison to similar experiments with wildtype p53. LFS–derived mutant p53 enhance chemoresistance in neuroblastoma and interference with wild type p53 or p73 contributes to

enhanced self-renewal and proliferation of neuroblastoma cells. Taken together our data supports a role for p53 and p73 in neuroblastoma chemotherapy response and suggest that interference with wildtype p53 expression or function in neuroblastoma results in a survival advantage.

2.2 Introduction

Neuroblastoma is a malignancy of the sympathetic nervous system and is responsible for

15% of all cancer related childhood deaths. Despite intensive therapies, less than a 40% of children with high-risk neuroblastoma are cured (1). About half of neuroblastoma patients present with localized tumours with favourable genetic and biological characteristics and thus are categorized as low or intermediate risk according to the International Neuroblastoma Risk Group

(INRG) classification system (6). Their survival rates range from 70-90% with surgery alone or surgery in combination with low doses of chemotherapy. In certain cases, most commonly young infants with localized small adrenal masses or 4S disease, spontaneous regression can be observed without any treatment (7, 8). In contrast, children diagnosed at 18 months or older often present with metastases and although they initially respond well to traditional therapy more than 50% relapse and these tumours are often chemoresistant resulting in an overall poor outcome (9). Age

(<18 months) remains one of the most powerful predictors of favourable outcome in patients with neuroblastoma. Genomic features that predict improved survival include lack of amplification of the MYCN oncogene and absence of segmental chromosomal aberrations such as loss of heterozygosity of 1p or 11q.

The tumour suppressor protein p53 is a transcription factor that activates target genes that regulate DNA repair, cell cycle arrest and apoptosis in response to cellular stresses. p53 mutations and/or p53 pathway aberrations are detected in more than half of human tumours. Li-Fraumeni

Syndrome (LFS) is a rare autosomal dominant familial cancer disorder in which patients with LFS

have germ-line p53 mutations that are associated with early onset of tumours, most commonly sarcomas, breast cancer, CNS malignancies, and adrenocortical carcinomas (211). Similarly, both p53-/+ and p53-/- mice develop a spectrum of tumours. Furthermore, mice engineered to overexpress tumour derived mutant p53 proteins commonly detected in human tumours develop more aggressive metastatic tumours (208, 209). In contrast to many tumours, neuroblastomas rarely express mutant p53 at the time of diagnosis (299). In neuroblastoma, p53 missense mutations and p53 pathway abnormalities are more common at relapse, and inactivation of p53 at relapse has been suggested as a potential mechanism that contributes to the more aggressive chemoresistant nature of these recurrent tumours (43, 44, 299, 300). Although rare, germ-line p53 mutations (R248W, R273G, R282W, P219S) have been detected in patients with neuroblastoma

(301). Some of those specific mutations are commonly detected in patients with LFS, and occur as hot spots in sporadic tumours (26, 72-74, 302). Tumours associated with p53 germline mutations, including neuroblastoma, are usually diagnosed at an earlier age than their sporadic counterparts and/or go on to develop multiple primary tumours.

Recently, we screened our LFS database at The Hospital for Sick Children for families in which neuroblastoma was reported. We identified two infants from families with known p53 germline mutations. Both patients were diagnosed in very early childhood and their disease was very aggressive and unresponsive to typical therapies. Both families revealed germ-line missense p53 mutations identified by sequencing, one at codon 158 (R158H) and the other at codon 248

(R248W). Although the p53-R248W mutation is a hotspot that has been described previously, the p53-R158H mutation has not been previously reported in neuroblastoma and the functional effect of this mutation has not been well characterized. In this study we characterize the function of these two mutations in neuroblastoma cells in comparison to wildtype p53. We demonstrate that both

LFS associated mutant p53 proteins are defective in activation of canonical p53 target genes and induction of apoptosis in response to chemotherapy in neuroblastoma and non- neuroblastoma cells. Both mutant p53 proteins bind to and inactivate the full length TAp73 isoform. Furthermore, in primary cells derived from neuroblastoma patients both LFS-associated p53 mutant proteins enhance colony formation and tumour growth in vivo. We hypothesize that these LFS-associated p53 mutations may have contributed to the chemoresistant progressive disease in these two LFS patients with neuroblastoma.

2.3 Results

2.3.1 Identification of LFS- associated neuroblastoma cases

To date, two confirmed LFS families with neuroblastoma and germ-line p53 mutations have been identified in the Hospital for Sick Children Cancer Genetics Database. Patient 1 was diagnosed as a newborn with stage 4S neuroblastoma (Figure 2.1A Left panel; family 1). This patient has a germline p53 mutation at codon 158 (arginine to histidine) and the tumour demonstrated MYCN amplification. His brother had been previously diagnosed with choroid plexus carcinoma. Patient 2 was diagnosed at age 2 years, based on a subsequent history of osteosarcoma and medulloblastoma in two siblings; p53 testing was performed and revealed a mutation in codon 248 of exon 7 (arginine to tryptophan) (Figure 2.1A Right panel; family 2).

We generated plasmids to encode each of the mutations identified in the LFS families with associated neuroblastoma (Figure 2.1B). Site-directed mutagenesis was used to introduce an arg→trp mutation at codon 158 (R158H) and arg→his mutation at codon 248 (R248W) in a plasmid encoding Haemagglutinin (HA)-tagged wildtype p53 (Figure 2.1C). Plasmids were verified by sequencing the entire p53 open reading frame and all intron/exon boundaries in the targeting vectors (data not shown).

2.3.2 Neuroblastoma LFS p53 mutants are defective in target gene induction and response to chemotherapy

To determine if the p53 LFS neuroblastoma mutant proteins were able to induce known p53 target genes, plasmids encoding wildtype or mutant p53 were co-transfected in HCT p53-/- cells with luciferase reporter plasmids in which the promoters of p53 target genes were cloned upstream of firefly luciferase. Wildtype p53, but neither of the LFS neuroblastoma p53 mutant proteins activated the promoters of BAX, IGFBP3, cyclin G and p21 (Figure 2.2A). Since induction of target genes is critical to 53-dependent apoptosis we next asked whether these p53

LFS mutant proteins were able to induce neuroblastoma cell death in response to chemotherapy.

In contrast to wildtype p53, overproduction of the LFS-neuroblastoma p53 mutant proteins in SK-

N-AS neuroblastoma cells did not induce apoptosis as determined by protein expression of cleaved PARP following exposure to doxorubicin, a chemotherapy commonly used in neuroblastoma treatment (Figure 2.2B). p53-/- H1299 transfected with mutant p53 plasmids had a significantly greater number of colonies than cells expressing wildtype p53 (Figure 2.2C).

Experiments are underway to confirm these results in neuroblastoma cells.

$" Family 1 Family 2

NB CPC NB OS MB age <1 age 4 age 2 age 15 age 2

!" R158H R248W * *

p53 TA DBD OD

#" wtp53 CACCCGCGTCC G CGCCATGGCCA R158H CACCCGCGTCC A CGCCATGGCCA

R158H

wtp53 GGGCGGCATGAAC C GGAGGCCCATCC R248W GGGCGGCATGAAC T GGAGGCCCATCC

R248W

Figure 2.1 LFS-associated mutant p53. A, Pedigree of two families with Li-Fraumeni Syndrome. Open circles and squares, normal females and males. Black circles and squares, affected females or males. A dot inside represents p53 mutation carrier status of a nonaffected individual. Oblique line, death. NB=neuroblastoma, CPC=choroid plexus carcinoma, MB=medulloblastoma, OS=osteosarcoma. B, Schematic of p53 protein structure indicating position of p53 mutations. TA, transactivation domain; DBD, DNA binding domain; and OD, oligomerization domain. C, Location of mutated nucleotide in p53 sequence.

Figure 2.2 LFS-neuroblastoma associated p53 mutants are inactive. A, HCT-/- cells were transfected with empty vector (cDNA) or plasmids encoding wildtype p53 or mutant p53 plasmids, the indicated p53-responsive luciferase reporter plasmids and Renilla luciferase. At 24 hours post-transfection luciferase activity was measured. Results are normalized to Renilla luciferase activity and are means of triplicates ± s.d. Data shown are representative of three independent experiments. B, SK-N-AS neuroblastoma cells were transfected with indicated plasmids for 24 hours and then treated with 1 µg/µl doxorubicin for 3 hours. Lysates were immunoblotted with cleaved-PARP, HA.11 and Vinculin antibodies. C, Effects of mutant p53 on foci formation. H1299 cells were transfected with indicated plasmids for 24 hours; foci attained with crystal violet were counted after 14 days. Bars represent the mean number of colonies of triplicate wells from three independent experiments ± s.d; ** p <0.001 students t-test.

2.3.4 LFS-neuroblastoma p53 mutants form complexes with TAp73

Many p53 mutant proteins are unable to bind to p53-consensus DNA binding sites in promoters of target genes. p53 mutations are most commonly due to missense mutations in the p53 DNA binding domain that attenuate or abrogate the ability of the mutant protein to bind.

However, many p53 mutant proteins are also classified as gain of function due to the ability to also bind to wildtype p53 forming inactive p53 heterotetramers. Thus, these proteins not only exhibit loss of function in that they lose ability to bind DNA, but they also gain the ability to bind and inactive wildtype p53. Furthermore, certain p53 mutant proteins also gain the ability to bind to the p53 paralogues TAp73 and TAp63. To determine whether LFS-associated mutant p53 proteins bind to wildtype p73, we transfected cells lacking endogenous p53 with plasmids encoding HA-tagged wildtype p53 or mutant p53, together with TAp73α and performed co- immunoprecipitations. We found that both p53 R158H and R248W proteins bound to TAp73α

(Figure 2.3A and 2.3B). In order to determine whether mutant p53 interaction with TAp73 affects

TAp73-dependent activation of p53/p73 target genes we performed luciferase assays. Over- expression of either p53 R158H or R248W led to decreased TAp73 induction of the promoters of

BAX (Figure 2.3B). Furthermore, co-expression of mutant p53 R158H and R248W led to decreased induction of cleaved PARP in cells overexpressing TAp73 (Figure 2.3C)

!" %" INPUT IP:12CA5 INPUT IP:ER-15

HA-WTp53 - + - - - + - - HA-WTp53 - + - - - + - - HA-158p53 - - + - - - + - HA-158p53 - - + - - - + - HA-248p53 - - - + - - - + HA-248p53 - - - + - - - + TAp73! - + + + - + + + TAp73! - + + + - + + + TAp73! TAp73! (2301) (BL906)

HA-p53 (HA.11) HA-p53 (HA.11)

Vinculin Vinculin

#" $" TAp73 Mock WT TAp73 WT R158H R248W

Bax luciferase - + - + - + - + - + - + CL-PARP

HA-p53 (HA.11)

TAp73! (BL906)

Vinculin

Figure 2.3 LFS-neuroblastoma associated p53 mutants bind to TAp73 and prevent activation p53 family of target genes. A-B, H1299 cells (p53-/-) were transfected with p73α, haemagglutinin (HA)-tagged wildtype p53 or the indicated p53 mutants. Bound proteins were detected by anti-HA and anti-p73 immunoblot analysis. C, H1299 cells were transfected with indicated plasmids, Bax or IGFBP3 p53-responsive luciferase reporter plasmids and Renilla luciferase. At 24 hours post-transfection luciferase activity was measured. Results are normalized to Renilla luciferase activity and are means of triplicates ± s.d. Data shown are representative of three independent experiments. D, IMR-5 neuroblastoma cells were transfected with indicated plasmids. Cells were treated with doxorubicin for 24 hours and whole cell extracts subjected to western immunoblot.

2.3.4 Mutant p53 increases tumorigenicity of primary neuroblastoma cells

We next examined the effect of overexpression of LFS neuroblastoma p53 mutant proteins on self-renewal and sphere formation using primary bone marrow cultures from neuroblastoma patients. Epstein Barr virus (EBV) transformed cells were isolated from bone marrow aspirates of neuroblastoma patients and established as cultures in serum-free conditions. These cells, confirmed to have endogenous wildtype p53 (by sequencing), were transfected with the plasmids encoding p53 R158H and R248W and sphere formation was assessed. Overexpression of both mutant p53 proteins resulted in a higher number of spheres, indicating that cells expressing the neuroblastoma associated mutant p53 proteins have an increased ability to self-renew (Figure

2.4A). The mutant p53 expressing individual spheres were also larger in size than those transfected with vector or wildtype p53 suggesting enhanced proliferation (Figure 2.4B). Since we hypothesized that the larger spheres were the result of increased proliferation, we assessed the level of the p53 target p21. We found that cells with mutant p53 expressed a lower level of p21

(Figure 2.4C). Following treatment with doxorubicin we also detected lower levels of cleaved

PARP in cells transfected with mutant p53 (Figure 2.4D). In order to determine whether these mutant p53 proteins led to enhanced tumour formation in vivo we generated xenografts in

NOD/SCID mice. Preliminary results with xenografts from cells transfected with plasmids encoding p53 R158H and R248W demonstrated higher tumour rate take and increased tumour volume. Furthermore, mice injected with xenografts expressing either p53 mutant had decreased survival compared to those with wildtype p53 or control.

Figure 2.4 Mutant p53 increases proliferation and self-renewal of primary cells. Primary EBV+ cells isolated from the bone marrow of neuroblastoma patients were transfected with indicated plasmids A-B, Sphere formation potential, (number, NB12, A; and size, NB88, B) was assessed at day 7. Representative of 3 independent experiments. Bars, SD. Inset, western blot showing expression of HA-p53 (wildtype and mutant) 7 days post transfection. C-D, NB12 (C) and NB88 (D) cells transfected with the indicated plasmids were lysed and immunoblotted for cl- PARP and p21. In D, cells were treated with 0.1 µM doxorubicin for indicated time (hours).

2.4 Discussion

We identified two children with aggressive neuroblastoma in families with classic LFS.

Each patient had documented germ-line mutations in the DNA binding domain of p53 (R158H,

R248W). Both children had high-risk neuroblastoma and chemoresistant tumours. The role of these p53 mutants in neuroblastoma development, response to treatment and prognosis is unknown. Our data suggests that the LFS-associated p53 mutations may contribute to the development and/or progression of the neuroblastoma tumours found in our patients.

Prognosis of neuroblastoma depends on age at diagnosis and the stage of disease. Infants typically present with limited disease and are often cured with surgery and/or chemotherapy (7, 8).

In contrast, older children (>18 months) often have very aggressive and rapidly progressive disease. Although p53 mutations are detected in over 50% of cancers, mutations in p53 are rarely detected in neuroblastoma at time of diagnosis (303, 304). While the majority of neuroblastoma tumours respond well to chemotherapy initially, over 50% of advanced stage tumours are chemoresistant and tend to relapse (305). At time of relapse p53 is more commonly mutated or inactivated by other mutations or alterations in the p53 pathway (43, 44). Furthermore, although rare, germ-line p53 mutations have been described in several patients with neuroblastoma and these tumours are usually diagnosed at an earlier age and patients may go ont to develop multiple primary other tumours (26, 72-74, 302). These patients were from families’ known to have LFS, a rare cancer predisposition syndrome not commonly associated with neuroblastoma. The neuroblastoma tumours found in our LFS patients were chemoresistant and associated with poor outcome. The purpose of this study was to elucidate the possible role for these specific p53 mutations in the molecular pathogenesis of neuroblastoma. Mutations are most frequently seen in the DNA binding domain (DBD) resulting in disrupted binding to targets. The disruption depends

on the mutation and can result in destabilization of the tertiary structure of the DBD, structural changes in the DBD, or eliminating direct contact between protein and DNA. Both missense mutations identified in our patients were in the DBD of p53. p53 mutants can be classified as contact mutations that directly disrupt the DNA-binding of p53 but have modest impact on p53 conformation or conformational mutations that result in a partially denatured protein (197-199).

R248W is known to be a contact mutation, which retains the wild type p53 conformation but disrupts binding to DNA whereas R158H has been predicted to be a conformational mutant based on the location of the mutated residue; however, there are no published experiments confirming this prediction (131, 199, 306).

Most missense mutations in the p53 DBD result in a mutant protein that cannot bind promoter DNA thus abolishing the function of p53 (307). We confirmed that both p53 mutants were unable to active downstream the target genes: BAX, p21, IGFBP3 and cyclin G. We also found that overexpressing mutant p53 in established neuroblastoma cell line, SK-N-AS, decreased the sensitivity of the cells to chemotherapy. Of the two mutations discussed in this study, the

R248W is one of the most commonly identified p53 mutations in sporadic tumours (2.67%) and in the germline of LFS patients (4.42%) (301). R248W has been characterized in non-neuroblastoma cancers. R248W mutant p53 exhibits loss of wild type p53 function and is not able to activate downstream target genes p21, MDM2, Bax and PIG3 and exhibits a gain of function by having a dominant negative effect on wildtype p53 by inhibiting its transactivation ability (307, 308).

Similarly, our studies demonstrate the inability to activate the promoters of p21, Bax, IGFBP3 and cyclin G. p53-R248W also inhibited chemotherapy induced apoptosis in neuroblastoma cells and promoted proliferation and self-renewal of primary cells in vitro and in vivo.

The p53-R158H mutation is not as frequently reported and accounts for only 0.41% of somatic mutations and 0.72% of germline mutations; however, it is considered a hot spot mutation tobacco exposure associated lung tumours (301, 309). R158H was first reported in three unrelated children with adrenocortical carcinoma with no family history of cancer and germ-line mutations at codon 158 have been reported in a 60-year-old woman with malignant mesotheliamoa as well as in a 3 year old Caucasian male adrenocortical carcinoma (ACC) (310-312). p53-R158H mutations have been predicted to be possibly environmentally induced since this mutation is localized in a highly conserved proline-rich portion of the p53 protein at amino acids 147-158 (306).

Campomenosi et al. reported that R158H partially retained its ability to transactivate the p53 target genes p21, Bax and PIG3 (308). However, in our study, p21 and Bax were not significantly induced.

In addition to loss of function, certain tumour-derived p53 mutants can also lead to enhanced protein stability as well as “gain of function” properties such as enhanced transformation, increased genomic instability and chemotherapy resistance (201-203, 313). These

“gain of functions” are at least in part due to the ability of certain p53 mutant proteins to bind to and inactivate wildtype p53, TAp63 and TAp73 to form inactive hetero-oligomers (98, 204, 205).

We have demonstrated that both R158H and R248W mutants bind to TAp73α and as a result inhibit TAp73-dependent activation of downstream target gene promoters and induction of apoptosis. Certain mutant p53 proteins have been previously shown to bind to TAp73; however,

R248W was not previously reported to bind to TAp73 and p53-R158H binding to TAp73 had not been investigated (98). Our results demonstrate that these LFS associated p53 mutants are not only functionally inactive but also inhibit the TAp73-dependent apoptosis.

One of the greatest challenges in neuroblastoma is relapse and resistance to therapy. We used cells isolated from relapsed patients with high-risk neuroblastoma that metastasized to the bone marrow (314, 315). Initially these cells were a mixture of neuroblastoma cells and EBV- transformed lymphocytes that evidently occurred in the patients (316). Only the lymphocytes persisted in culture providing us with primary EBV-transformed lymphocytes recently derived from patients. These cells were a highly tumorigenic population of cells that proliferated as suspension spheres in vitro and in vivo (314). Using these cells, we found that overexpression of

LFS associated mutant p53 resulted in a greater number of larger spheres. To determine if the larger spheres were due to increased proliferation we looked at a regulator of cell cycle progression, p21, and found that there was diminished protein levels in cells expressing mutant p53. We also looked at the effects of these mutations following chemotherapy treatment. Cells expressing mutant p53 had decreased levels of apoptotic induction with lower proteins levels of cleaved PARP. Preliminary in vivo results show increased tumour volume and a greater tumour take in xenografts with mutant p53.

Classically neuroblastoma is not a typical tumour type found in individuals with LFS; however, previous studies have identified individuals with germline p53 mutations and neuroblastoma (26, 72-74, 302). Our data corroborates the aforementioned reports and provide additional evidence to support an association between LFS and neuroblastoma. This study is the first to document significant characterization of the R158H p53 mutation as well as characterize both these p53 mutations in neuroblastoma. Improved knowledge of the role of neuroblastoma in

LFS as well as the development and chemoresistance of neuroblastoma may also provide further insight into the role of mutant p53 in neuroblastoma survival and lead to potential strategies to overcome chemoresistance in neuroblastoma with p53 mutations.

2.5 Materials and methods

2.5.1 Cell culture, transfections and chemotherapy

Established adherent neuroblastoma cell lines (SK-N-AS, SK-N-SH, SH-EP) were cultured in

RPMI containing 10% fetal bovine serum (Invitrogen, Burlington, ON, Canada) at 37°C, in 5%

CO2. Adherent neuroblastoma cell lines were transfected with plasmids encoding wildtype or mutant p53 using Polyethylenimine (PEI) with a ratio of 1 µg DNA to 6 µl PEI. The primary lymphoma-like cell lines BM12, BM88, were established from bone marrow aspirates obtained from neuroblastoma patients at The Hospital for Sick Children according to Protocol 1000006069 and cultured as previously described (314). Cells were passaged by mechanical dissociations and split 1:30 in DMEM:F12, 3:1 (Invitrogen) with 2% B27 supplement, basic fibroblast growth factor

2 (bFGF) and 50ug/ml epidermal growth factor (EGF) in 75 cm2 flasks in a 37°C in 5% CO2.

Primary cells (1.5x106) were subjected to electroporation using Neon® Transfection System

Microporation (Life Technologies Burlington, ON, Canada) as per the manufacture’s instructions

(conditions: pulse 1350V, speed 20mls, number 2). These lines were initially a mixture of neuroblastoma cells and cells with B-cell/Epstein Barr Virus (EBV) markers, but following eight passages only the EBV-transformed lymphocytes remained in culture.

2.5.2 Plasmids pcDNA3 plasmids encoding wildtype p53 were previously described {Marin:1998te} and were engineered to generate mutations at codon 158 (R158H) and codon 248 (R248W) using the

Quickchange site-directed mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, USA) according to the manufacturer’s instructions with oligonuclotides

R158H: CACCCGCGTCCACGCCATGGCCA

R248W: GGGCGGCATGAACTGGAGGCCCATCC

Plasmids were sequenced to confirm successful mutagenesis and absence of additional mutations introduced by the technique.

2.5.3 Western immunoblots and immunoprecipitation

Whole cell extracts were prepared with EBC lysis buffer (50mM Tris (pH 8.0), 120 mM NaCl,

0.5% NP-40) with protease inhibitors (Roche Diagnostics, Laval, QC, Canada). Equal amounts as determined by Bradford protein assay (Bio-Rad laboratories, Hercules, CA, USA) were resolved by SDS-PAGE and transferred to nitrocellulose membrane. Membranes were blocked in 5% milk/tris-buffered saline with 0.1%tween (TBST), probed with indicated primary antibodies, and horseradish peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific, Rockford, IL,

USA). Proteins were detected by an enhanced chemiluminescene system (Super Signal West

Pico, Thermo Fisher Scientific, Rockford, IL, USA). Primary antibodies include: Cleaved-PARP

(Cell Signaling Technology, Beverly, MA, USA); TAp73/GC-15 (Oncogene, La Jolla, CA, USA);

Vinculin (Upstate, Lake Placid, NY, USA); BL906/TAp73 (Bethyl Laboratories, Montgomery,

TX); HA.11/16B12 (Covance, Princeton, NJ, USA). For immunoprecipitation, equal amounts of protein were incubated for four hours with the indicated antibody and protein A sepharose beads.

The immunoprecipitates were washed 5 times with NETN buffer (2M Tris pH 8, 5M NaCl, 0.5M

EDTA pH 8.0, and 0.5% NP-40), eluted by boiling in SDS-containing sample buffer, and resolved by SDS-PAGE.

2.5.4 Luciferase Assay

HCT-/- cells were cultured in 6-well plates were transfected with 0.1µg plasmids encoding wild type or mutant p53, 0.5µg reporter plasmid and 0.001µg Renilla luciferase with PEI. All cells were transfected with equal total amount of DNA (1µg) using vector plasmid. After 24h cells were rinsed with PBS, harvested and the luciferase assay was performed using the Dual-Luciferase

Reporter assay system (Promega Corporation, Madison, WI, USA). Luciferase activity was quantified using a Lumat LB 9507 luminometer (Berthold Technologies, Bad Wildbad, Germany) and normalized to Renilla activity. Reporter plasmids: pGL3-Bax, pGL3-IGFBP3, pGL3- p21WAF/Cip1 and pGL3-CyclinG.

2.5.5 Sphere and Foci formation assay

Primary neuroblastoma cells were seeded post transfection at 2000-3000 cells/well in a 96 well plate in 100ul 2x growth factor media (DMEM without pheonol red) and an additional 50ul complete media added at day 4. Cells were fixed at 7 days with 4% paraformaldehyde and pictures and images generated using Gelcounter were analyzed manually using ImageJ to quantitate spheres. For the foci formation assay, (Cell line) cells were transfected with plasmids, incubated overnight at 37°C and seeded (102/well in six-well plates) the following day. Cells were grown at 37°C for 14 days with fresh growth medium was replaced at seven days. Two weeks after seeding, foci were fixed in 70% ethanol and stained with 10% methylene blue. Foci of 50 cells were counted manually using ImageJ.

Chapter 3 – Anti-tumour activity of the beta-adrenergic receptor antagonist propranolol in neuroblastoma

Manuscript of Chapter 3 findings submitted to Oncotarget (June 9, 2013)

Authors: Jennifer K Wolter, Nikolaus E Wolter, Alvaro Blanch, Teresa Partridge, Monika Podkowa, Daniel A. Morgenstern, David R. Kaplan, Meredith S. Irwin All experiments shown in this chapter were performed by the author except Annexin5 (A. Blanch); other authors provided intellectual input and/or assistance with tumour database analysis.

3.1 Abstract

Neuroblastoma is a paediatric tumour of the sympathetic nervous system, which is often associated with elevated catecholamines. More than half of patients with metastatic neuroblastoma relapse and survival is extremely poor with current therapies. In a high-throughput screen of FDA- approved drugs we identified anti-neuroblastoma activity for the non-selective β-adrenergic receptor antagonist propranolol hydrochloride. The activity of propranolol and other β-antagonists alone and in combination with the topoisomerase I inhibitor SN-38 was evaluated in vitro in fifteen neuroblastoma cell lines from differing genetic backgrounds using viability and apoptosis assays. Growth inhibition in vivo was determined following treatment of SK-N-AS xenografts with 1mg/kg of propranolol administered twice daily. Downstream signalling in response to propranolol was assessed by western immunoblots of candidate proteins. Propranolol induced apoptosis in a panel of neuroblastoma cell lines irrespective of MYCN status. Activity was dependent on inhibition of the β2, and not β1, adrenergic receptor, and treatment resulted in activation of p53 and p73 signalling. Neuroblastoma cell lines and primary tumours express β2 adrenergic receptor and higher mRNA levels correlate with improved patient survival, but did not correlate with in vitro sensitivity to propranolol. Furthermore, propranolol is synergistic with the topoisomerase inhibitor SN-38 and inhibits growth of neuroblastoma xenografts in vivo at doses commonly used to treat infants with hemangiomas. Taken together, our results suggest that

propranolol may have potential activity in patients with neuroblastoma at similar doses to those used to treat paediatric patients with hypertension and hemangiomas.

3.2 Introduction

The sympathetic nervous system cancer neuroblastoma is the second most common extra- cranial solid tumour in childhood. A broad range of clinical behaviours and biological heterogeneity characterizes neuroblastoma. Despite intensive treatments that include chemotherapy, radiation, surgery, stem cell transplant and immunotherapy, and an increased understanding of molecular characteristics of neuroblastoma, more than 50% of children with metastatic neuroblastoma relapse, and survival from recurrent neuroblastoma is less than 10%. (9).

Continued research must be devoted to identifying treatment options for these high-risk patients.

Moreover, there are significant long-term effects of these therapies including cardiac toxicities and second cancers (317). Thus, novel therapies are needed for patients with newly diagnosed and relapsed neuroblastoma. Pairing currently employed chemotherapeutics with novel compounds is also an important strategy to enhance efficacy and potentially reduce individual side effects by utilizing decreased doses in combination. However, developing new drugs is time-consuming and costly. An analysis of 68 approved drugs estimated that it takes an average of 15 years and

US$800 million to bring a single drug to market (318). The US FDA only approves 20-30 new compounds a year and may not include chemotherapeutic drugs (318). Repurposing existing medications prescribed for non-malignant diseases has been successfully used to identify active agents for pre-clinical testing for cancers including neuroblastoma. As of 2012, 63 drugs in clinical/animal testing or being remarketed by the pharmaceutical industry for pediatric diseases,

24 of them specifically are being tested for pediatric cancer (319). This is a potentially more

efficient method of drug discovery, by capitalizing on the known pharmacokinetics and safety profiles of the drugs.

There are a number of ways to identify new uses for old drugs. One approach is having a target or hypothesis-driven approach having a biological rational for a target. For example, Nutlin was designed to inhibit HDM2 binding to p53; thereby increasing p53 protein levels and thereby promoting apoptosis (320). HDM2 also prevents transcriptional activation of TAp73, and our lab demonstrated that Nutlin induces the death of cells with mutated p53 through activation of TAp73, suggesting its potential efficacy in tumors with both wild-type and mutant p53 (166). (321). Drug repurposing can also be suggested by an unexpected clinical situation. For example, a patient may experience improvement in two different conditions unexpectedly by treatment with a single drug prescribed for one of their symptoms. In 2008, the treatment for large symptomatic infantile hemangiomas, a congenital vascular malformation, was corticosteroids. A side effect of long-term corticosteroid treatment is hypertension. Leaute-Lebreze treated two infants with steroid induced hypertension with propranolol and noticed significantly decreased growth in the hemangiomas. By

6 months, the hemangiomas had completely resolved and propranolol has now been adopted as first-line therapy for hemangiomas (239). An alternative way to identify novel drugs and targets is to perform high throughput screens of compounds such as chemical libraries of FDA-approved drugs. FDA-approved drugs for non-cancer indications have been identified to have anti-cancer properties by unbiased high-throughput cell based screening assays using drug libraries or studies of candidate drugs with proposed mechanisms of actions that may target tumour promoting signalling pathways (322, 323). In order to identify novel therapies for relapsed neuroblastoma, we previously conducted high-throughput screens with the Prestwick library (Prestwick Chemical,

Inc) of 1,120 FDA approved drugs using a panel of neuroblastoma cell lines (Monika

Podkowa/Meredith Irwin, unpublished data). The screen was intended to identify compounds that would be effective against multiple genetic backgrounds, using multiple adherent neuroblastoma cell lines were MYCN amplified and non-amplified as well as cells with differing p53 status. In addition to chemotherapies with known efficacy in neuroblastoma, such as doxorubicin and etoposide, we identified additional compounds with anti-neuroblastoma activity including propranolol hydrochloride, a non-selective β-blocker that competitively inhibits the action of epinephrine (EPI) and norepinephrine (NE) on β1- and β2-adrenergic receptor. Although originally used for the treatment of hypertension and other cardiovascular disorders, recently propranolol has been shown to be effective and safe for the treatment of large hemangiomas in infants (239).

Additional rationale supports potential anti-cancer, and specifically anti-neuroblastoma effects for β-blockers. Catecholamines and their metabolites increase proliferation of several different cancer cell types in vitro and patients with neuroblastoma often have elevated serum and urinary catecholamines (324, 325). Anti-tumour activity of propranolol in vitro has also been demonstrated for many cancer cell lines including pancreatic, breast, gastric, HNSCC and leukaemia (225, 250-252). Furthermore, retrospective clinical studies suggest that cancer patients treated with beta-blockers have improved outcomes (261, 262). Based on these clinical findings, the pro-proliferative effects of catecholamines, and the safety profile for propranolol in children we hypothesized that the β-blocker propranolol may have potential efficacy in neuroblastoma.

In this chapter we demonstrate that propranolol reduces the viability of human neuroblastoma cell lines through the inhibition of proliferation and induction of apoptosis. The

β2-adrenergic receptor is expressed on neuroblastoma cell lines and primary tissue, and higher levels of expression correlate with improved survival. The mechanism of action involves specific

inhibition of the β2-adrenergic receptor. Propranolol treatment is associated with induction of apoptosis and the pro-apoptotic p53 family proteins p53 and p73. Propranolol treatment at doses similar to those used to treat infants with hemangiomas also resulted in growth inhibition of neuroblastoma xenografts in vivo. Our findings suggest that propranolol, alone or in combination with chemotherapy, may be an effective agent in neuroblastoma.

3.3 Results

3.3.1 Propranolol inhibits neuroblastoma growth, viability, and proliferation

Propranolol is a non-selective β-blocker that competitively inhibits the action of EPI and

NE on β1- and β2-adrenergic receptor. To determine the effect of propranolol on neuroblastoma, a panel of fifteen established human neuroblastoma cell lines representing a range of genetic profiles (eg. status of MYCN amplification, p53 mutation, 1p and 11q LOH) were treated with increasing doses of propranolol to determine the half-maximal inhibitory concentration (IC50) using alamarBlue, an indicator of metabolic activity and cellular health (Figure 3.1A). The IC50s ranged from 114 µM to 218 µM (average 155 µM) (Figure 3.1B), doses similar to those reported for propranolol in non-neuroblastoma cancer cell lines, which range from 100-300 µM. We treated human umbilical vein endothelial cells (HUVEC cells) with various concentrations of propranolol for 24 hours and cell proliferation capacity was analyzed using the alamar blue assay.

Cell growth was inhibited by propranolol in a concentration-dependent manner; the IC50 of propranolol was 190 µM (Figure 3.1C). To determine if catecholamines increased proliferation of neuroblastoma cells we treated with increasing doses of EPI for 24 hours and used alamar blue to determine if there was changes in cells growth. There was a statistically significant increase in cell growth in a dose dependent manner (Figure 3.1D)

Figure 3.1 Propranolol inhibits neuroblastoma growth. A, Growth curves of neuroblastoma cell lines were treated with indicated doses of propranolol for 72h. B, IC50 values for fifteen neuroblastoma cell lines. IC50 measurement was performed with alamar blue (triplicate). Results represent the average of three experiments expressed as a mean percentage of untreated control cells. C, HUVEC cells were treated with indicated concentrations of propranolol and IC50 was determined with alamar blue (triplicate). Results represent the average of three experiments expressed as a mean percentage of untreated control cells. D, SK-N-SH and SK-N-AS cells were stimulated with indicated doses of epinephrine for 24h. Cell growth was measured using alamar blue (triplicate) and normalized to untreated controls. Data shown are representative of three independent experiments and are expressed as means of triplicates ± s.e. *p=0.04, **p=0.011

Figure 3.2 Propranolol inhibits neuroblastoma growth and is synergistic with SN-38. A, SK- N-AS cells were incubated with indicated doses of propranolol for 24h and cell viability was determined using trypan blue exclusion method. Results are expressed as a mean percentage of trypan blue negative cells (live cells); data shown are representative of three independent experiments and are expressed as means of triplicates ± s.d. B, SK-N-SH cells were treated with indicated doses of propranolol for 24h. Cell proliferation was assessed by BrdU incorporation. Results are a mean percentage of control cells. C, Alamar blue assays were performed on SK-N- AS cells treated with increasing doses of propranolol and SN-38 at a ratio of 10,000:1 (100µM propranolol: 0.01µM SN-38) for 48hr. Results are expressed as percentage compared to controls. The combination index [CI] was determined based on the Chou-Talalay method is shown on the top of the bar representing combination treatment * p= 0.008, ‡ p= 0.0009. D, Concentration- dependent effects of propranolol on foci formation. SK-N-AS cells were treated for 14 days with propranolol at indicated doses or media alone (control); foci were detected by staining with crystal violet. Bars represent the mean number of foci of triplicate wells from three independent experiments ± s.d; ** p <0.001 students t-test

Decreased viability and proliferation were detected by trypan blue (Figure 3.2A) and BrdU incorporation assays (Figure 3.2B), respectively. We next asked whether combination treatment with topoisomerase I inhibitors such as irinotecan, which is commonly used to treat neuroblastoma relapse, demonstrate enhanced efficacy. Treatment of cells with the combination of propranolol and the irinotecan active metabolite SN-38 resulted in a greater decrease in cell viability than either drug alone (Figure 3.2C). This effect was synergistic based on the combination index (CI) of 0.719 determined by the Chou-Talalay method (326, 327). Propranolol is rapidly metabolized with a plasma half-life of about 4 hours and thus, usually delivered in at least two divided doses per day(328). For our in vitro assays a single dose was delivered prior to performing specific growth or proliferation assays. In order to determine long-term effects of lower doses of treatment in vitro we used a focus formation assay that assesses self-renewal capacity, in which cells were treated for 14 days with propranolol replaced daily. There was a significant decrease in the number of foci in a dose dependent manner following 14 days of treatment (Figure 3.2D).

Compared to control cells, foci were reduced by 50% following treatment with 25µM propranolol and 84% with 50µM propranolol.

3.3.2 β2-adrenergic receptors are expressed in neuroblastoma and are required for neuroblastoma cell death

To determine whether the growth inhibitory effects of propranolol were a result of its inhibitory effects on β1- or β2-adernergic receptors, SK-N-BE(2)c cells were treated with (±)- propranolol HCl, the β1-specific antagonist metoprolol tartrate or the β2-specific antagonist ICI

118,551 hydrochloride. While the β1-specific antagonist had no effect on viability, the β2-specific antagonist ICI-118,551 was slightly more potent than propranolol, suggesting that propranolol induces cell death in neuroblastoma via β2-adrenergic receptor specific antagonism (Figure 3.3A).

We also tested three different enantiomers of propranolol HCl [(S)-(−)-propranolol HCl, (R)-(+)- propranolol HCl, (±)-propranolol HCl] and detected no significant difference in potency between the racemic mixture and the two enantiomers (Figure 3.3A).

We next asked whether neuroblastoma cells express β2-adrenergic receptor mRNA

(ADRB2) and whether the levels observed vary in cell lines with differing sensitivity to propranolol. All neuroblastoma cell lines tested expressed ADRB2, but there was no correlation between the IC50 and the level of ADRB2 mRNA detected (Figure 3.1 and Figure 3.3B). Most cultured neuroblastoma cell lines are isolated from patients with metastatic neuroblastoma. To determine whether the levels of ADRB2 in primary neuroblastoma tumours correlate with prognosis or known biological risk factors we examined expression data in two publically available databases. Interestingly, using data from the R2: microarray analysis and visualization platform (http://r2.amc.nl), we found higher levels of ADRB2 mRNA correlated with improved survival and findings were confirmed in a second cohort, Neuroblastoma Oncogenomics Database

(http://pob.abcc.ncifcrf.gov/cgi-bin/JK) (Figure 3.2C and data not shown). In contrast, mRNA levels of the β1-adrenergic receptor, ADRB1, did not predict differences in prognosis (Figure

3.2D). Furthermore, in comparison to the expression of ADRB2 in normal adrenal the relative expression of ADRB2 is higher in neuroblastoma tumours (Figure 3.3E). ADRB2 is detected in tumours from patients with all stages of disease, but relatively higher levels were observed in patients without MYCN amplification and those <1 year of age (Figure 3.3F).

3.3.3 Propranolol induces apoptosis in neuroblastoma

To determine if the decreases in neuroblastoma cell growth and viability following propranolol treatment was due to induction of apoptosis, we performed three assays to detect

Figure 3.3 β2-adrenergic receptors are required for propranolol induced cell death and is expressed in neuroblastoma. A, SK-N-SH was treated with increasing doses of either (±)- propranolol HCl and a β1 specific antagonist, metoprolol tartrate, or a β2-adrenergic receptor specific antagonist, ICI 118,551 HCl for 72 hours. Results are expressed as percentages of growth compared with untreated controls. Data shown are representative of three independent experiments and are expressed as means of triplicates ± s.d. For each β- antagonist, the IC50 of each cell line is shown with the corresponding legend. B, β2-adrenergic receptor (ADRB2) expression in neuroblastoma cell lines as demonstrated by semi-quantitative PCR. C-D, Cumulative overall survival probability curves of patients with neuroblastoma based on

expression of ADRB2 mRNA [C] or ADRB1 mRNA [D]. The cut-off for these analyses is the median expression level. E, Relative ADRB2 mRNA expression in normal adrenal tissue and neuroblastoma samples. F, Relative ADRB2 mRNA expression in MYCN non-amplified and amplified neuroblastoma samples. Kaplan-Meier curves and Box blots were generated from the R2: microarray analysis and visualization platform (http://r2.amc.nl), which includes data submitted by different investigators (Databases: 1, Versteeg; 2, Delattre; 3, Hiyama; 4, Lastowska).

Figure 3.4 Propranolol induces apoptosis. A, SK-N-SH and SK-N-BE(2)c were treated with indicated doses of propranolol for 5h and cellular caspase 3/7 activities were analyzed using Apo- ONE caspase 3/7 reagent. Results are representative of three independent experiments, performed in triplicate and are expressed as mean fold-induction over the control cells ± s.d. B, LAN5 and SK-N-BE(2)c cells were treated with indicated doses (24 hours) and live cells were analyzed for induction of annexinV positivity by flow cytometry. Results are expressed as mean fold-induction over the untreated control ± s.d. C, SK-N-BE(2)c cells were treated with indicated doses for 48h and CHLA-20 cells were treated with 150 µM of propranolol for indicated durations and then analyzed for PARP cleavage by immunoblot analysis.

apoptosis. First, we detected an 8- to 15-fold increase in caspase 3 and 7 activity (Figure 3.4A).

Also, in response to propranolol treatment there was a 2.5 fold increase in the number of live neuroblastoma cells undergoing apoptosis as detected by AnnexinV positivity (Figure 3.4B).

Finally, the levels of poly-ADP-ribose polymerase (PARP) cleavage increased in both a dose- and time-dependent manner (Figure 3.4C).

3.3.4 Propranolol increases p53 and TAp73 and pro-apoptotic target genes

We next addressed potential downstream signalling mechanisms involved in propranolol induced neuroblastoma cell death. A number of signalling pathways have been implicated in EPI- mediated activation of β2-adrenergic receptor, including activation of mitogen-activated protein kinase/extracellular signal-related kinase (MAPK/ERK) and changes in p53. Hara and colleagues recently demonstrated that in response to catecholamines including EPI and NE, β2-adrenergic receptor signalling led to DNA-damage and activation of β-arrestin-1 as well as AKT, which phosphorylates HDM2 (pHDM2), resulting in p53 degradation. Therefore, we predicted that inhibition of the β2-adrenergic receptor with propranolol may result in increased levels of p53, which is required for apoptosis in response to common chemotherapies as well as other drugs studied in preclinical neuroblastoma models. Following treatment with propranolol, we detected an increase in p53 as well as a decrease in the levels of the p53 negative regulator pHDM2 in a time dependent manner (Figure 3.5A).

We and others have shown that the p53 paralogue p73 can activate p53 target genes that mediate apoptosis in response to number of chemotherapeutic agents. Some of the neuroblastoma cell lines that are sensitive to propranolol express mutant and/or inactive p53 proteins (eg SK-N-

BE(2), SK-N-AS, SK-N-FI). Thus, we asked whether the protein levels of the pro-apoptotic p73 isoform TAp73β changed in response to propranolol. Following propranolol treatment TAp73β

isoform levels increased (Figure 3.5B). In addition, the levels of the p53 and TAp73 downstream pro-apoptotic target gene proteins p57kip2 and NOXA also increased (Figure 3.5C and 3.5D). We examined other downstream pathways previously implicated in the proliferative response to EPI in other cell types. We observed decreases in COX-2 in response to propranolol (Figure 3.5E).

3.3.5 Propranolol inhibits growth in vivo

The doses of propranolol required to inhibit neuroblastoma growth in short term assays in vitro were higher than those predicted to be achievable in vivo. However, since focus formation assays demonstrated efficacy with lower doses of propranolol, we next investigated the effects of propranolol on growth of SK-N-AS neuroblastoma xenografts. When tumours reached 50mm3, propranolol treatment was initiated at doses equivalent to those used to treat infants with hemangiomas. Mice were injected subcutaneously with 2mg/kg/day (given in 2 divided doses daily) for fourteen days. The tumours of mice treated with propranolol demonstrated slower growth as compared to PBS vehicle-treated control mice (Figure 3.6.A). The mean tumour volume of propranolol-treated group was lower than the control group on day 14: 197.6 ± 44.3 mm3 versus

414.5 ±76.6 mm3, unpaired t-test p = 0.0246) (Figure 3.6B). Notably, the mean body weight of propranolol-treated mice was not statistically significantly lower that that of the vehicle treated

(control) mice, suggesting that propranolol had no evident toxicity (Figure 3.6A inset). Mice treated with propranolol also had a prolonged survival in comparison to control mice (Wilcoxon: p= 0.0135, Log-Rank: p=0.0062) (Figure 3.6C).

Figure 3.5 Regulation of p53 family signalling by propranolol. A, p53 and pHDM2 western immunoblots of lysastes from SK-N-SH cells treated with 100 µM of propranolol for the indicated durations. B-F, TAp73β, NOXA and p57kip2, COX-2, western immunoblots of lysates from SK- N-AS cells treated with 150 µM of propranolol for the indicated durations.

Figure 3.6. Propranolol inhibits neuroblastoma tumour growth in vivo. NOD/SCID mice with SK-N-AS xenografts were treated with propranolol (1mg/kg bid) by subcutaneous injection for 14 days. A, Tumour volumes measured at indicated days post-injection of cells. Inset, absolute mean body weight, in grams, after the beginning of the treatment. Columns depict mean values; bars, SE. B, Box plot depicting mean tumour volumes of control (vehicle) treated and propranolol treated tumours at day 14. Each treatment group was composed of 10 mice (p<0.05). Bars depict mean values and error bars represent 95% confidence intervals. p values (2-tailed) were calculated using students t-test and are compared to control groups at indicated time points. C, Kaplan–Meier survival curve of NOD/SCID mice from control-treated (black, circle; N=15) or propranolol-treated (grey, square; N=15) tumours. Wilcoxon: p= 0.0135, Log-Rank: p=0.0062.

3.4 Discussion

In our study, we found that the non-selective β-antagonist propranolol inhibits neuroblastoma growth and that β2, but not β1, antagonists were active against a panel of human neuroblastoma cell lines at doses comparable to those previously reported for other cancer cell types. Propranolol induced apoptosis that correlated with induction of p53 and the p53 paralogue

TAp73 as well as activation of downstream p53/p73 target genes. In addition, propranolol was synergistic with the topoisomerase inhibitor SN-38 and had efficacy in vivo against neuroblastoma xenografts.

Although initially used in the treatment of hypertension and arrhythmias in adults and children, recently propranolol has become standard therapy in infants with large hemangiomas, proliferative lesions of vascular endothelial cells (239). β-adrenergic receptors and their antagonists have also been shown to have efficacy in several pre-clinical cancer models.

Catecholamines including EPI and NE as well as the β-adrenergic receptor agonist isoproterenol have pro-proliferative effects on cancer cell lines (324, 329). β-adrenergic receptors are expressed on multiple malignant cell types and treatment with propranolol has been reported to reduce viability, and in some cases induce apoptosis, of cancer cell lines including pancreatic, gastric, leukaemia, melanoma, and oral squamous cell carcinoma (225, 250-252, 330, 331). Recent epidemiology studies provide further evidence for the potential anti-cancer effects of β-blockers.

A ten-year longitudinal study found that women with breast cancer receiving β-adrenergic receptor antagonist therapy for hypertension had fewer metastases, recurrences and decreased mortality (261). In a second retrospective study of breast cancer patients, women receiving the nonselective β-blocker propranolol, but not those receiving β1-specific antagonists, were significantly less likely to present with advanced stage tumours (262). In addition, several other

studies have provided further support for possible clinical benefits for cancer patients receiving propranolol (332, 333).

Rationale for the use of the β-adrenergic receptor antagonist propranolol specifically in neuroblastoma include the observation that the majority of neuroblastoma tumours produce elevated levels of catecholamines including EPI and NE, both of which have been shown to have pro-proliferative effects when added to cells in culture. We also detected a modest increase in growth and proliferation of neuroblastoma cell lines in response to EPI. Propranolol decreased cell growth in 15 neuroblastoma cell lines at concentrations similar to those reported in cell lines derived from other cancers. Although MYCN status has been linked to the sensitivity of neuroblastoma cell lines to several drugs including aurora kinase inhibitors, we did not detect a difference in the IC50 values based on MYCN amplification. The majority of the experiments in this study used a single time point to assess cell death, 72 hours after drug treatment. While dead or senescent cells can be readily identified and measured, it is difficult to estimate the total number of cells killed by a treatment by examining a only a single time point. Therefore, to support our findings, we also used a clonogenic cell survival assay to determine the ability of propranolol to inhibit long-term neuroblastoma cell proliferation and reflect its ability to form colonies. This assay was carried out for 14 days and demonstrated that propranolol prevented the ability of neuroblastoma cells to replicate and form new colonies.

The cellular signalling events that mediate apoptosis in response to propranolol are poorly understood. Changes in the cyclo-oxygenase-2 protein (COX-2), mitogen activated protein kinase

(MAPK), and vascular endothelial growth factor (VEGF) pathways have been observed in response to EPI treatment and/or propranolol (225, 251, 255, 257, 324, 334). We did not detect effects on VEGF signalling; however, we did observe decreases of COX-2 in response to

propranolol. COX-2 has been shown to promote tumorigenesis and overexpression of COX-2 has been reported in numerous adult cancers including neuroblastoma cell lines and primary tumours

(335). Previous studies have found that p53 inhibits the expression of COX-2 and inhibition of

COX-2 with COX-2 inhibitors (e.g. celecoxib) modulates the levels of p53 (40, 336). Clinical trials are currently underway to investigate the role of perioperative propranolol and a COX- inhibitor to reduce breast and colon cancer recurrence (337). Recent data demonstrated that in primary and transformed cells, β2-adrendergic signalling activated by catecholamines leads to β- arrestin-1 activation, which results in enhanced AKT-mediated phosphorylation and inactivation of HDM2. Thus, we predicted that β2-adrenergic blockade with propranolol would result in decreased levels of the phosphorylated form of HDM2 (pHDM2) and therefore increased p53 levels. Indeed, in response to propranolol we detected decreased pHDM2 as well as increased p53 protein. We further found that treatment with propranolol resulted in induction of TAp73. The full-length form of the p53 paralogue p73, TAp73, can also mediate apoptotic responses to chemotherapies as well as other anti-cancer agents with efficacy in neuroblastoma cells, including chemotherapies, aurora kinase inhibitors, and COX-2 inhibitors, particularly when p53 is inactivated (40, 41). Accordingly, we found induction of TAp73 and activation of p53/p73 pro- apoptotic genes NOXA and PUMA as well as p57KIP2, a cyclin-dependent kinase inhibitor, the promoter for which has previously been identified to contain p53 and p73 response elements (184,

220). The mechanism for induction of TAp73 in response to propranolol is not clear but may be in part related to decreased levels of COX-2 since COX inhibitors have been shown to induce

TAp73β (40).

β2-specific antagonists, but not β1-adrenergic receptor antagonists, inhibited the growth of neuroblastoma cell lines in vitro, suggesting that expression of the β2-adrenergic receptor is

required for propranolol-induced cell death as detected by apoptosis. It should be noted that, in addition to apoptosis, there are other mechanisms by which cells can be eliminated (eg. necrosis, mitotic catastrophe, autophagy, premature senescence) that were not tested (338). Interestingly, the specific RNA levels of the β2-adrenergic receptor did not correlate with propranolol sensitivity in vitro, but were fairly similar in the 15 cell lines that we tested, most of which are derived from patients with metastatic disease. It is possible that β2-adrenergic receptor protein levels may be predictive of the propranolol sensitivity; however, we had difficulty determining protein levels in neuroblastoma cells using several commercial antibodies. Interestingly, expression of β2- adrenergic receptor mRNA (ADRB2) was relatively higher in tumours from patients with favourable features, such as younger age and low stage disease, even though ADBR2 mRNA were expressed in the majority of neuroblastoma tumours, as well as cell lines derived from high-risk patients including those with metastatic disease. The observation that high levels of ADBR2 are associated with more favourable prognosis is similar to findings for patients with other types of cancers. Oral squamous cell carcinoma (OSCC) patients with strong β2-adrenergic receptor immunohistochemical expression had a superior overall survival in comparison to patients with weak/negative β2-adrenergic receptor expression (264). In addition, the median ADRB2 mRNA expression was 9-fold lower in leukaemia cells of patients who relapsed compared to patients who remained in continuous complete remission and low levels of ADRB2 were found to be associated with poor prognosis for patients with clinically localized prostate cancer and predicted an increased recurrence risk (265). Our findings demonstrate that the majority of patients have tumours that express the propranolol target β2-adrenergic receptor and would thus be predicted to be sensitive to propranolol since we did not observe a correlation between the ADRB2 mRNA levels and sensitivity to propranolol. Experiments demonstrating preferential neuroblastoma

sensitivity to β2, not β1, blockers suggests apoptosis in response to propranolol is likely mediated via the β-adrenergic receptor. However, siRNA experiments will be required to prove that the β2- adrengerngic receptor is required for the observed drug effects. Thaker and colleagues reported using an in vivo chronic stress model of ovarian cancer that ADRB2 siRNA blocked stressed induced tumours (339).

In this study, the dose required to induce apoptosis in vitro was high (100µM range), but importantly, is similar to reports of doses used in other cell lines and may also be due to high serum protein bindin,g leaving it unavailable to bind to the target (340). Our hypothesis that the decrease in cell growth observed following propranolol treatment is not merely a product of dose- related toxicity comes from the differential effect of β1 and β2 inhibition. The decrease in cell growth seen with propranolol was not seen with a β1-specific antagonist, metropolol, even at significantly higher doses (1M). Also, tumour inhibition in SK-N-AS xenografts was observed using the doses used to treat infants with hemangiomas (1mg/kg/day divided in 2 daily doses). The

IC50 for haemangioma-derived cells in vitro (100µM) is similar to those for neuroblastoma cells in vitro (100-150µM) (247). Pharmacokinetic data suggests that in patients treated with propranolol the peak serum concentrations range from 200-400 ng/ml, which is equivalent to 0.77-

1.5µM (341).

Propranolol may also be affecting the tumour microenvironment as a possible explanation for the discrepancy between our in vitro and in vivo effects. Propranolol has been reported to inhibit pro-angiogenic factors, such as VEGF, and thus, in vivo tumour inhibition may be due to effects on endothelial cells in the blood vessels that surround the tumour. However, we did not detect significant difference in the IC50 for HUVEC endothelial cells in comparison to neuroblastoma cells in vitro. The IC50 for HUVEC was 190µM, which is similar to previous

reports (342). Furthermore, a manuscript published online (May 23, 2012) demonstrated in vivo anti-angiogenic effects of propranolol on neuroblastoma xenografts (343). In addition, NE from chronic stress or isoproterenol (non-selective β-adrenergic receptor agonist) increased VEGF and blood vessel density in ovarian tumor metastases in a β-adrenergic receptor-dependent manner

(339). Further studies have demonstrated that experimentally imposed chronic stress or pharmacologic activation of SNS signaling pathways accelerated breast cancer metastasis, and in mice treated with propranolol, the stress-enhanced metastasis was completely suppressed (344).

Tumor-associated macrophages have also been shown to promote cancer progression through multiple pathways including accelerated angiogenesis, extracellular matrix remodeling, chemoattraction of immune and tumor cells, generation of a pro-inflammatory environment and evasion of anti-tumor immune responses (345, 346). Myeloid progenitor cells and monocytes have also been found to express β-adrenergic receptors and may respond to β-adrenergic signaling while in the bone marrow or in circulation before being recruited to the primary tumor and transitioning to a macrophage phenotype (347, 348). Mice in continual isolation showed changes in gene expression in antigen presenting cells, including upregulation of genes involved in inflammation and suppression of genes involved in type I interferon responses (349).

Experimental models from other tumour types such as UV-induced squamous cell carcinoma-like skin lesions, metastatic breast cancer, and leukemia have shown SNS regulation of tumor- associated immune cells (350-352). Despite the discrepancy between in vitro and in vivo concentrations the doses effective against neuroblastoma xenografts are equivalent to the regimens for children with hemangiomas, which use doses of 2-3 mg/kg/day for up to 9 months (239).

Furthermore, higher doses have been administrated to paediatric patients up to 6-14 mg/kg/day for the treatment of tachycardia and hypertension following renal transplantation (353, 354).

Propranolol has been shown to be safe at high doses in patients. Less common side effects include hypotension, bradycardia and hypoglycemia (355). In addition to the effect on normal epithelial cells (HUVECS) already demonstrated, neural crest-like pediatric skin-derived precursor cells

(SKPs) can be used that more closely represent the normal neural crest cells (323) (Smith et al

EMBO Molec Med). Toxicities in vivo can be assessed by measuring liver enzymes and/or autopsies with histology of organs of mice treated with these compounds.

The in vitro synergy with the irinotecan metabolite SN-38 also supports potential combination therapy with topoisomerase inhibitors such as irinotecan or topotecan in the relapse setting. It will be important to examine synergy with other chemotherapies to determine whether synergistic effects are confirmed in vivo. In addition, pharmacokinetic data supports the ability of propranolol, which is highly lipophilic, to cross the blood brain barrier and concentrate in the central nervous system (CNS) (356), which may permit the incorporation of propranolol as a therapy in patients with CNS metastases, a subset of children for whom there are few available experimental therapies.

Taken together our results suggest that targeting the β2-adrenergic receptor with propranolol, which has been used in children for almost 50 years and more recently in infants with large hemangiomas, may be effective in children with neuroblastoma. Epidemiological and biological data further support a role for the use of propranolol in the treatment in a number of cancers. For example a phase II clinical trial is currently underway examining propranolol for the treatment of breast cancer (357). Our results suggest that the β2-adrenergic signalling pathway may be a useful target to treat neuroblastoma; however, ADRB2 siRNA knockdown experiments will need to be performed to determine whether the β2-adrenergic receptor is required for propranolol induced cell death. The majority of neuroblastoma tumours and cell lines derived

from metastases express β2-adrenergic receptor and although our in vitro data does not support a correlation between higher β2-adrenergic receptor mRNA levels and propranolol sensitivity more studies are required to determine whether β2-adrenergic receptor protein levels or other biomarkers may predict which tumours are most sensitive to β-blockade. Interestingly, ADRB2 may be a prognostic marker, since higher expression of these receptors was detected in patients with improved survival rates, and those with biologically favourable tumours including MYCN non-amplified and patients less than one year of age. However, using publically available databases we were not able to perform multi-variable analyses to confirm that ADRB2 expression is independently predictive for outcome. Treatments that could potentially reduce toxicity and eliminate need for chemotherapies in these young infants would be of potential clinical significance. Thus, two populations for consideration of propranolol clinical trials may include relapsed patients, including those with CNS metastases, and potentially younger patients with less aggressive favourable biology tumours. Although most infants with neuroblastoma have an excellent prognosis with surgery alone or minimal chemotherapy, there are young infants who present with large tumours that are not surgically resectable and often cause hypertension. Thus,

β-blockers might be the treatment of choice for these patients.

3.5 Materials and methods

3.5.1 Cell culture and Drugs

Established human neuroblastoma cell lines, KELLY, CHLA-20, LAN-5, IMR-32, SK-N-BE1,

SK-N-BE(2), SK-N-BE(2)c, SK-N-SH, SK-N-AS, LAN-6, SH-EP, CHLA-15, CHLA-90, SK-N-

FI were cultured in RPMI containing 10% fetal bovine serum (Invitrogen, Burlington, ON,

Canada) and obtained from American Type Culture Collection and Dr. Patrick Reynolds

(Children’s Oncology Group Cell Bank). Cells were incubated at 37°C and 5% CO2 tissue culture

incubator. Drugs: (±)-Propranolol hydrochloride, (S)(−)-propranolol HCl, (R)(+)-propranolol HCl,

Metoprolol tartrate, ICI 118,551 hydrochloride and Epinephrine-HCL (Sigma, St. Louis, MO,

USA) were dissolved in water; SN-38 (Tocris Bioscience, Bristol, UK) was dissolved in DMSO.

3.5.2 Apoptosis assays

Cells were seeded into a 96-well plate at 1.5x104 cells per well and treated 24 hours later with propranolol for five hours. The combined caspase-3 and caspase-7 activity was measured using the Apo-ONE caspase 3/7 Assay Kit, according to manufacturer’s instruction (Promega, Madison,

WI, USA). Fluorescence was read using a luminometer (Spectra MAX Gemini EM, Molecular

Devices) at 499/521 nM wavelengths. For annexin assays cells treated with propranolol for 24 h were harvested and stained with propidium iodide (PI) and APC-AnnexinV (Dead Cell Apoptosis kit, Invitrogen) according to the manufacturer’s instructions. The PI negative population was selected and analyzed for AnnexinV staining using a FACS Canto II flow cytometry (Beckton

Dickinson).

3.5.3 Cell Viability, Proliferation and Focus formation Assays

IC50 values were determined with alamar blue assay (Invitrogen, Burlington, ON, Canada). 3-6 x103 cells were plated in 96-well plates and treated with indicated doses of propranolol for 72 hours. At 48 hours, alamar blue was added (10% of total volume) and then incubated overnight.

The fluorescence was measured using a spectrophotometer at excitation 530 nm and emission

590 nm (Spectra MAX Gemini EM, Molecular Devices). Cell proliferation was assessed using

Bromodeoxyuridine (BrdU) (Cell Signaling, Danvers, MA, USA). 4000 cells were treated with indicated drug and then incubated with BrdU (10µM) for 4h and detected using anti-BrdU antibody. The absorbance was measured at 450nM using a spectrophotometer plate reader

(VersaMax tunable microplate reader, Molecular Devices). Trypan blue exclusion assay (Gibco,

St. Louis, MO, USA) was used to measure viability following 24 hours of propranolol treatment.

Live and dead cells (trypan blue positive) were counted in triplicate using a hemocytometer. For the colony or foci formation assay cells were seeded (102/well in six-well plates) in 2 ml of growth medium and incubated overnight at 37°C. Propranolol or media was added at the specified concentrations. Every 24h fresh propranolol and growth medium was added, and the plates were incubated at 37°C. Fourteen days after seeding, colonies were fixed in 70% ethanol and stained with 10% methylene blue. Colonies of 50 cells were counted.

3.5.4 Western immunoblot analysis

Whole cell extracts were prepared using EBC buffer (50mM Tris (pH 8.0), 120 mM NaCl, 0.5%

NP-40) with protease inhibitors (Roche Diagnostics, Laval, QC, Canada) and total protein concentration was determined using Bradford reagent (Bio-Rad laboratories, Hercules, CA, USA).

Equal amounts were resolved by SDS-PAGE and transferred to nitrocellulose membrane. The membranes were blocked in 5% milk/tris-buffered saline with tween (TBST), probed with indicated primary antibodies, horseradish peroxidase-conjugated secondary antibodies (Thermo

Fisher Scientific, Rockford, IL, USA). Proteins were detected by an enhanced chemiluminescene system (Super Signal West Pico, Thermo Fisher Scientific, Rockford, IL, USA). Primary antibodies include: cleaved-PARP, pHDM2ser116 (Cell Signaling Technology, Beverly, MA,

USA); TAp73/GC-15, p53/DO-1/AB-6 (Oncogene, La Jolla, CA, USA); Vinculin (Upstate, Lake

Placid, NY, USA); NOXA/114C307 (Novus Biological LLC, Littleton, CO, USA), p57kip2 /c-20

(Santa Cruz Biotechnology, Santa Cruz, CA, USA); COX-2/160107 (Cayman Chemical, Ann

Arbor, MI, USA); β-actin (Sigma-Aldrich, Oakville, ON, CA).

3.5.5 Semi-quantitative PCR

Total RNA was extracted using TRIzol (Invitrogen). cDNA was generated using the Omniscript

RT Kit (Qiagen, Mississauga, ON, Canada) and amplified by semi- using the Taq DNA polymerase Kit (Qiagen). RT-PCR conditions: initial denaturation (95°C/3min), 40 cycles of denaturation (94°C/1min), annealing (55°C/1min) and extension (72°C/1min), final extension

(72°C/ 10min). Primer sequences for ADRB2 are: 5’-GAGCAAAGCCCTCAAGAC-3’ and 5’-

TGGAAGGCAATCCTGAATC-3’, β-actin 5’-CTGGAACGGTGAAGGTGACA-3’ and 5’-

AAGGGACTTCCTGTAACAATGCA-3’. The RT-PCR products were resolved using a 1.5% agarose gel.

3.5.7 Combination Index and Statistical analyses

For combination treatment, cells treated in a ratio of 10,000:1 (Propranolol:SN-38) for 48 hours were subjected to alamarBlue assay. Using CalcuSyn Software (Biosoft, Cambridge, UK) the combination index (CI) was calculated. CI<1 and CI>1 indicated synergism and antagonism, respectively, and CI=1 indicates an additive effect. Comparisons between 2 groups were done using unpaired Student t-test with the Graphpad Prism software (GraphPad Software, Inc., version

3.0). The Kaplan–Meier method was used to determine survival of mice. All p values < 0.05 were considered statistically significant.

3.5.8 Xenograft studies

NOD/SCID (non-obese diabetic/severe combined immunodeficiency) mice were injected with

1.5x106 SK-N-AS cells in PBS and Matrigel Basement Membrane Matrix (100µM) (BD biosciences, Franklin Lakes, NJ USA) subcutaneously in the left flank. When xenografts reached

50mm3 mice were treated with propranolol (Sigma, Israel) dissolved in phosphate buffered saline

(PBS) or PBS alone (control) administrated subcutaneously at a dose of 1 mg/kg twice daily for up

to 35 days. Tumour growth was monitored three times a week and tumour volume (mm3) was calculated. Mice were sacrificed when tumours were greater 500mm3. Tumour volumes were compared on Day 14 in two independent experiments (N=5 and N=10 per group). Survival curves were generated by combining two experiments (N=15 per group).

Chapter 3 Appendix – Propranolol as a Novel Adjunctive Treatment for Head and Neck Squamous Cell Carcinoma

A similar report was published here as follows: Propranolol as a novel adjunctive treatment for head and neck squamous cell carcinoma. Wolter NE, Wolter JK, Enepekides DJ, Irwin MS. J Otolaryngol Head Neck Surg. 2012 Oct;41(5):334- 44.

Jennifer Wolter and Nikolaus Wolter contributed equally to this work.

Appendix 3.1 Abstract

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer in humans.

Despite intensive multimodality treatments that carry significant morbidity, less than 50% of patients survive. Better-tolerated and more efficacious strategies are required. The p53 family of proteins, p63 and p73 offer novel treatment targets in HNSCC. Repurposing existing drugs with well-tolerated toxicity profiles has opened new avenues in patient care. Propranolol has been shown to have anticancer effects in multiple cancer types by blocking the proliferative effects of epinephrine. HNSCC cell lines were cultured and treated with propranolol alone and in combination with cisplatin or γ-irradiation. Alamar blue assays were performed to assess cell viability and apoptosis was confirmed via western immunoblot for cleaved-PARP and caspase-3/7 assays. Propranolol reduced cell viability and induced apoptosis. In response to propranolol

ΔNp63α decreased, whereas TAp73β and downstream pro-apoptotic p53-family target genes increased. Expression of the pro-angiogenic protein VEGF also decreased. Combination treatment with propranolol and cisplatin resulted in synergistic effects. Propranolol treatment also enhanced the effects of γ-irradiation on cell viability. Our results demonstrate that propranolol reduced

HNSCC viability, induced apoptosis, and inhibited production of the pro-angiogenic protein

VEGF. These changes may be due to modulation of p53 family proteins, which are critical

regulators of chemotherapy-induced apoptosis in HNSCC. Moreover, propranolol is synergistic in combination with cisplatin and reduces HNSCC viability post-radiation in vitro, which may have important implications for novel treatments of HNSCC patients.

Appendix 3.2 Introduction

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer with more than 60% of patients presenting with an advanced stage disease (358, 359). Despite intensive treatments that may include surgery, radiation, and chemotherapy less than 50% of patients survive, and the benefits of chemoradiotherapy are sharply contrasted by treatment toxicities. Furthermore, HNSCC are commonly radiation and chemotherapy resistant; thus, novel therapies are needed (360). The tumour suppressor protein p53 and the p53 family proteins, p63 and p73, play important roles in radiation and chemosensitivity in HNSCC (361). Full-length (TA) isoforms induce apoptosis or programmed cell death whereas truncated (ΔN) isoforms that lack the N-terminal transactivation domain, inhibit apoptosis (223, 362). Anti-apoptotic ΔNp63α and pro-apoptotic TAp73β are found in HNSCC and the balance between apoptosis and cell survival, and in particular, response to chemotherapy depends on the relative levels and complex interplay between these proteins (221) (Figure 3.7). Thus, targeting p53 family proteins represents a potentially important therapeutic strategy in HNSCC.

The identification of pleiotropic effects of existing therapeutic agents with well-established safety and side-effect profiles has led to the discovery of new classes of drugs with anti-cancer efficacy. Accumulating data suggests that β-adrenergic receptors may be a potential target for anti-cancer therapies. β-adrenergic receptors are highly expressed on the surface of numerous cancer cell types including the oral cavity and esophagus and stimulation of HNSCC with epinephrine induces cell proliferation and migration (257, 324, 363). Since previous reports have

demonstrated that β2-adrenergic receptors antagonists can inhibit the stimulatory effect of epinephrine and recent evidence suggests that breast cancer patients receiving propranolol had improved survival we hypothesized that these β-adrenergic receptor antagonists might have anti- cancer properties in HNSCC (257, 262). In this study we demonstrate that propranolol induces apoptosis in HNSCC by altering the balance of pro- and anti-apoptotic p53 family members.

Moreover, propranolol is synergistic with chemotherapy and enhances sensitivity to radiation.

These results suggest that propranolol may be an effective adjuvant therapy in HNSCC.

Figure 3.7 Mechanism of interaction of p53 family members in HNSCC. ΔNp63α-inhibition of p53 and TAp73β in HNSCC prevents transcription of pro-apoptotic downstream markers. In the absence of high levels of ΔNp63α, in response to DNA damage p53 and TAp73β are free to form homo-tetramers that can bind to the p53-family consensus binding sites in promoters for pro- apoptotic genes e.g. PUMA, NOXA, and p57kip2 resulting in cell death. When ΔNp63α is expressed at high levels (as in majority of HNSCC), ΔNp63α will inhibit p53 and TAp73-induced cell death by at least two mechanisms: (1) ΔNp63α forms homo-tetramers that binds to p53-family consensus binding sites in promoters for pro-apoptotic genes, however, since they lack the N- terminal transactivation (TA) domain they cannot activate transcription of these genes. (2) ΔNp63α also binds to p53 and TAp73β forming inactive hetero-oligomers in a dominant negative manner, resulting in sequestration of the full-length pro-apoptotic p53 and TAp73β proteins. *Target genes: e.g. PUMA, NOXA, p57kip2 (adapted from Wolter et al. 2012).

Appendix 3.3 Results

Appendix 3.3.1 β2-adrenergic receptors are expressed on HNSCC and β2-adrenergic receptors antagonists inhibit HNSCC growth and viability

Western immunoblots of HNSCC cell lysates demonstrated β2-adrenergic receptor expression on 3/3 tested HNSCC cell lines (Figure 3.8A). We next asked whether the non-specific

β-adrenergic receptor antagonist propranolol could inhibit HNSCC cell growth using p53 wildtype cells (SCC17a) and mutant p53 cells (SCC25, FaDu and SCC9 cells). Growth inhibition and decreased cell viability was detected by alamar blue assay and trypan blue assays (Figure 3.8B and

3.8C) with an IC50 of approximately 140 µM.

Epinephrine exerts proliferative effects on cancer cells primarily through specific stimulation of the β2-adrenergic receptors and these epinephrine-dependent effects can be abrogated by β2-adrenergic receptor antagonists in cancer cells. To determine whether the observed growth inhibition with propranolol was due to antagonism of the β2-adrenergic receptors, SCC9 cells were treated with (±)-propranolol-HCL and a β1-specific antagonist, metoprolol tartrate, and a β2-adrenergic receptors specific antagonist, ICI-118,551-HCL. The β1- specific antagonist had no effect on viability while the β2-adrenergic receptors specific antagonist was more potent than propranolol (Figure 3.8D), suggesting that propranolol inhibits growth of

HNSCC via antagonism of the β2-adrenergic receptors.

Figure 3.8. Propranolol inhibits cells growth and decreases cell viability in HNSCC. A, β2ARs are expressed in HNSCC cell lines SCC9, SCC17a, and FaDu at the protein level as demonstrated by western immunoblot. B, SCC9, SCC17a, SCC25, and FaDu were treated with the indicated doses of propranolol for 72 hr. Cell growth was determined using the alamar blue assay. Results are expressed as percentages of growth compared with untreated controls. C, SCC9 cells were treated with increasing doses of propranolol for 24 hr. Cell viability was determined by adding trypan blue and results are expressed as percentage of non-viable cells. D, SCC9 cells were treated with increasing doses of (±)-propranolol HCl and a β1 specific antagonist, metoprolol tartrate, and a β2-specific antagonist, ICI 118,551 HCl for 72 hr and the effect on cell growth was determined using the alamar blue assay. Results are expressed as percentages of growth compared with untreated controls. Data shown are representative of three independent experiments and are expressed as means of triplicates ± s.d. For each β-receptor antagonist, the IC50 of each cell line is shown with the corresponding legend.

Appendix 3.3.2 Propranolol induces apoptosis in HNSCC

To determine if the observed effect was due to apoptosis, caspase-3 and -7 activation was assessed. Propranolol treatment for 5 hours induced a 7-fold increase in caspase-3 and -7 activity in SCC9 and SCC17a (Figure 3.9A). Apoptosis was confirmed by measuring cleaved-PARP by western immunoblot. Following 24 hours of propranolol treatment the levels of cleaved-PARP increased in a time and dose-dependent manner (Figure 3.9B and 3.9C).

Figure 3.9 Propranolol induces apoptosis in HNSCC. A, Cells were incubated with propranolol (300 µM) for 5 hr and the cellular caspase-3/7 activities were analyzed using Apo- ONE caspase-3/7 reagents. Results were compared to untreated controls. B, HNSCC cells were treated with 100 µM of propranolol for increasing intervals for 24 hr (SCC9) and 48 hr (SCC17a) and immunoblotted with cleaved-PARP and vinculin antibodies. C, Cleaved-PARP and vinculin western immunoblots were performed on whole cell lysates of HNSCC cells (SCC9) treated with the indicated doses of propranolol of 24 hr. Data shown are representative of three independent experiments and are expressed as means of triplicates ± s.d.

Appendix 3.3.3 Propranolol modulates p53 family proteins and VEGF

Previous studies demonstrated that epinephrine-induced proliferation is associated with

MEK/ERK and COX-2 pathway activation; however, the mechanisms by which propranolol induces apoptosis have not been elucidated. Since propranolol induced apoptosis in both wildtype and mutant p53 HNSCC we hypothesized that p53 was not required for apoptosis. The balance between TAp73β and ΔNp63α is important in HNSCC cell survival and response to chemotherapies. Following propranolol treatment, the anti-apoptotic ΔNp63α was downregulated and the pro-apoptotic TAp73β was induced in HNSCC (Figure 3.10A and 3.10B). The TAp73β specific target gene, p57kip2, is required for TAp73β induced apoptosis. p57kip2 levels increased following treatment with propranolol (Figure 3.10C). Epinephrine treatment in other cancers is associated with increased VEGF levels and VEGF is also regulated by p53 family proteins.

Propranolol treatment resulted in decreased VEGF expression in a dose-dependent manner concordantly with TAp73β induction (Figure 3.10D).

Appendix 3.3.4 Propranolol is synergistic with cisplatin and enhances radiation sensitivity

Treatment of SCC17a cells with cisplatin or propranolol alone inhibited growth and like cisplatin, propranolol affects the relative expression of ΔNp63α and TAp73β. Interestingly, treatment of SCC17a cells with propranolol and cisplatin in combination resulted in a larger decrease in cell viability than either treatment alone (p<0.01) and these effects were synergistic

(CI= 0.578) (Figure 3.11A). Cleaved-PARP levels increased following treatment with both cisplatin and propranolol indicating that apoptosis was induced (Figure 3.11B). We investigated the effects of propranolol treatment in HNSCC following γ-irradiation. Cell viability was reduced in SCC9 cells treated with increasing doses of γ-irradiation as compared to control SCC9 cells.

Importantly, viability was further reduced in cells pre-treated with 150 µM of propranolol for 48

hours (p<0.01) (Figure 3.11C) suggesting that combining propranolol with radiation or cisplatin may be an effective regimen for advanced HNSCC.

Figure 3.10 Propranolol regulates ΔNp63α, TAp73β and target genes. A, Lysates of SCC9 and SCC17a cells treated with propranolol (100 µM) for 24 hr were immublotted with antibodies to detect ΔNp63α, TAp73β, cleaved-PARP, and vinculin. B, HNSCC lysates were treated with propranolol (100 µM) for the indicated durations and SCC17a cells were immunoblotted with ΔNp63α and SCC9 cells were immunoblotted with TAp73β. C, Lysates of SCC9 cells were treated with propranolol (100 µM) for the indicated durations were immunoblotted with antibodies to Protein levels of p57kip2. D, VEGF western immunoblot of SCC9 cells were treated with the indicated doses of propranolol for 24 hr. Data shown are representative of three independent experiments.

Figure 3.11. Propranolol is synergistic with cisplatin and enhances radiation induced cell growth inhibition. A, Alamar blue assays were performed on SCC17a cells treated with increasing doses of propranolol and cisplatin at a ratio of 6:1 (propranolol:cisplatin) for 48hr. Results are expressed as percentage compared to untreated controls. The combination index (CI) was determined based on the Chou and Talalay is shown on the top of the bar representing combination treatment. (*p = 0.002). B, SCC17a cells were treated with 100µM propranolol and 5µM cisplatin alone or in combination for 48 hr and lysates were immunoblotted with cleaved- PARP and vinculin antibodies. C, SCC9 cells were treated with the indicated doses of ϒ-radiation with and without 150 µM for 24 hr in triplicate. Alamar blue was used to assess viability and results are expressed as a percentage of the untreated control (* p = 0.009, ‡ p = 0.006, † p = 0.004). Data shown are representative of three independent experiments and are expressed as means of triplicates ± s.d.

Appendix 3.4. Discussion

Less than 50% of patients with advanced HNSCC are cured, therefore the development of better-tolerated and more efficacious drugs is critical for improved patient care (360).

Repurposing medications with well-known toxicity profiles and newly discovered anti-cancer activity has the advantage of more rapid translation to clinical trials, potential healthcare savings, and improved patient outcome.

Propranolol is a non-selective β-adrenergic receptor antagonist in use for over 50 years and have an important role in mitigating the cardiotoxic effects of chemotherapy (337, 364). The finding that β-adrenergic receptor is expressed on a variety of malignant cell types and pre-clinical data demonstrating that the β-adrenergic receptor ligand epinephrine induces proliferation provide a potential rationale to target the β-adrenergic receptor in cancer. Here, we have confirmed that

HNSCC express β2-adrenergic receptor. Propranolol increased apoptosis via inhibition of β2- adrenergic receptor. p53 is inactivated in over 50% of human HNSCC tumours, either by mutation or inactivation by HPV, which is associated with chemotherapy and radiation resistance

(365). In these tumours, treatment must target alternative intact apoptotic pathways. Rocco et al. demonstrated that ΔNp63α antagonizes TAp73β to inhibit pro-apoptotic target gene induction

(221). We have demonstrated that antagonizing the β2-adrenergic receptor with propranolol upregulates TAp73β and downregulates ΔNp63α in a dose- and time-dependent fashion thereby shifting the intracellular balance of p53 family proteins towards apoptosis. Importantly, in response to propranolol, down-stream targets of TAp73β, namely p57kip2, are similarly upregulated indicating activation of this pro-apoptotic pathway. Previous reports have also suggested that epinephrine exerts its proliferative and proangiogenic effects on cancer cells by regulation of the COX-2 pathway (331). Interestingly, inhibition of COX-2 with COX-2 inhibitors (e.g.

celecoxib) modulates the levels of TAp73β, which in part may explain the ability of propranolol to upregulate TAp73β (40).

The high levels of ΔNp63α in cancer cells may mediate chemoresistance. Sen et al. demonstrated that knockdown of ΔNp63α sensitized resistant HNSCC to cisplatin (366).

Propranolol treatment leads to induction of TAp73β and down-regulation of ΔNp63α. We hypothesized that propranolol might enhance the efficacy of common chemotherapies used in treatment of HNSCC. Our results have demonstrated a synergistic relationship between cisplatin and propranolol in HNSCC cells. ΔNp63α and TAp73 also have important roles in radiation response. Elevated levels of ΔNp63α contribute to HNSCC survival following irradiation; whereas

TAp73 is stabilized at the protein level following γ-irradiation and loss of TAp73 contributes to radiation resistance (172, 367, 368). Propranolol sensitizes gastric cancer cells to radiation and this effect correlated with changes in members of the VEGF, EGFR and COX-2 pathways and

EGFR and COX-2 pathways are stimulated by β-adrenergic receptor activation and inhibited by propranolol (253). Our results demonstrate that combination treatment with propranolol and radiation results in more significant reductions in viability than either alone.

Current strategies are aimed at more effective, molecularly targeted therapies for HNSCC that will hopefully have decreased short- and long-term toxicities. Propranolol is an antagonist of the β-adrenergic receptor and has anti-neoplastic effects in a number of cancer cell types. Clinical trials are currently underway to investigate the role of perioperative propranolol and a COX- inhibitor to reduce breast and colon cancer recurrence (337). In the present study propranolol targeted the differential expression of the p53 family proteins and induce apoptosis in HNSCC.

Propranolol treatment also enhanced radiation and chemotherapy effects. Thus, propranolol may be a useful adjuvant therapy in HNSCC by reversing chemotherapy and radiation resistance.

Appendix 3.5 Methods

Appendix 3.5.1 Cell culture, drugs, and western immunoblot

The HNSCC-derived cell lines SCC9 (tongue), SCC25 (tongue), SCC17a (laryngeal) and FaDu

(hypopharyngeal) were cultured. Drugs tested include: (±)-propranolol, Metoprolol tartrate and

ICI-118,551, and Cisplatin. HNSCC cell protein resolved via Western blot.

Appendix 3.5.2 Cell viability and apoptosis assays

Growth inhibition was determined by alamar blue assay. HNSCC cells were treated with increasing doses of propranolol for 72 hours. At 60 hours alamar blue was added for 12 hours and then fluorescence was measured using a spectrophotometer. Viability was measured using a trypan blue exclusion assay. Cells were treated for 24 hours with increasing doses of propranolol.

Following addition of trypan blue, a hemocytometer was used to count viable and dead cells.

Following 24 hours of propranolol treatment at the indicated doses and durations protein levels of cleaved-PARP were detected by western immunoblot. Caspase activation was measured using the

Apo-ONE caspase-3/7 reagents, following 5 hours of propranolol treatment and fluorescence was detected using a luminometer.

Appendix 3.5.3 Drug and radiation treatment

Cells were treated with a drug ratio of 6:1 (propranolol:cisplatin). The drug combination effect was measured by calculating the combination index (CI) using the Chou-Talalay method.

CI<1 and CI>1 indicate synergism and antagonism, respectively, and CI=1 indicates an additive effect. For radiation experiments cells grown for 24 hours and irradiated with a 137Cesium unit at a dose rate of 0.79 Gy/min. 24 hours later cells were treated with increasing doses propranolol for

48 hours. Growth inhibition was detected using alamar blue.

Chapter 4 – Chemically modified Cardiac glycoside analogue, RIDK34, has anti neuroblastoma activity

Authors: Jennifer K Wolter, Paulo De Gouveia, Teresa Partridge, Monika Podkowa, Clifford Lingwood, David R. Kaplan, Meredith S. Irwin

Initial high-throughput screen performed by M. Podkowa and a former MSc student P. DeGouveia performed the experiments on the cardiac glycoside analogue candidates that identified RIDK 34 as a lead compound. T. Partridge performed γH2Ax experiment. I performed all remaining experiments shown in the results section of this chapter.

4.1 Abstract

In an attempt to identify agents that specifically target neuroblastoma, drug screens were performed using libraries of bioactive compounds. Cardiac glycosides were the largest class of drugs identified with anti-tumour activity. Cardiac glycosides have a well-established inhibitory effect on cell proliferation and several epidemiological studies have demonstrated that patients receiving cardiac glycosides for cardiac conditions had better cancer related outcomes including decreased recurrence and mortality rates. However, due to a narrow therapeutic window there have been significant concerns about potential toxicities of these agents, especially in paediatric patients. In collaboration with Dr. Clifford Lingwood’s laboratory at Sick Kids novel cardiac glycoside analogues were designed in an attempt to develop a more effective anti-proliferative cardiac glycoside without cardiotoxic side effects. In this study we determined the sensitivity of neuroblastoma cells to novel synthetic cardiac glycoside analogues in comparison to conventional cardiac glycosides, with a focus on the lead analogue, RIDK34, which contains a unique oxime group. Our studies demonstrate that the concentrations of RIDK34 that decreased cell survival and induced apoptosis were lower than those for the commercially available cardiac glycosides, digoxin, ouabain and convallatoxin and that these effects do not appear to result from direct inhibition of the Na+/K+ ATPase activity.

4.2 Introduction

Neuroblastoma is a cancer of the sympathetic nervous system and has a wide range of clinical and biological behaviours. Neuroblastoma is the third most common paediatric cancer, however, it is responsible for 15% of childhood cancer-related deaths. Overall survival rates have significantly improved over the past two decades. Prognosis and treatment is based on a risk stratification system that takes into account clinical and biological prognostic factors. Infants with limited disease are often cured with surgery and/or chemotherapy. In contrast, despite intensive multi-modality therapy only approximately 40% of patients in the high-risk group survive (1).

Novel treatments for high-risk neuroblastoma, and in particular, relapsed disease, are needed with a focus on developing therapies with fewer short and long-term side effects. However, developing novel therapeutics is costly and requires many years of clinical trial testing for safety and efficacy, a process that is even longer in paediatrics. Thus, repurposing Food and Drug Administration

(FDA) and Health Canada approved compounds for the treatment of cancer is becoming a more common strategy (369). Using a high-throughput cell-based screening assay to help identify compounds that are active against neuroblastoma we tested four commercially available chemical libraries including: LOPAC, Prestwick, Spectrum and Biomol totalling 4687 licensed compounds

(323). Primary bone marrow cultures from neuroblastoma patients, normal paediatric skin precursor cells (SKPs) and established neuroblastoma cell lines grown in serum-free sphere- forming conditions were tested in parallel against the chemical libraries (323). Primary hits were defined as the compounds with B-scores shifted by at least three standard deviations from the mean of the general sample population (323). The class of cardiac glycosides was the largest group identified with 13 compounds showing efficacy against neuroblastoma cells. There are also

multiple reports in the literature supporting the anti-cancer effects of cardiac glycosides in many cancer types, including neuroblastoma (282, 291).

Cardiac glycosides are a large family of naturally occurring botanical compounds. They bind to and inhibit the Na+/K+ATPase, a ubiquitous membrane protein that drives the active transport of sodium and potassium ions across the cell membrane. Active Na+/K+ATPase consists of two subunits. The α-subunit is responsible for the catalytic and transport properties and the β-subunit, which is essential for activity of the Na+/K+-ATPase and acts as a chaperone protein (267). Cardiac glycosides can reversibly bind to the α subunit of the Na+/K+-ATPase resulting in an increase in intracellular levels of sodium and in cardiac myocytes, the influx of sodium ions results in an increase in intracellular calcium driving increased cardiac contractile force (271, 276). Certain cardiac glycosides, such as digoxin, are used clinically for the treatment of heart failure and arrhythmias in adults and infants. Previous studies have reported that conventional cardiac glycosides have anti-tumour properties in vitro against a number of cancer types such as prostate, lung, neuroblastoma and breast (281-284). Differential expression and activity of the Na+/ K+-ATPase subunits in tumour tissues compared with their normal counterparts have been identified in various cancers (295-297). Also, in tissue samples from patients with colorectal cancer there is an upregulation of Na+/K+ATPase α3-isoform and downregulation of the α1 isoform (295). Neuroblastoma cells co-express the α1 and α3 subunit isoforms and both isoforms are essential for survival following treatment with ouabain (370).

In vitro, cardiac glycosides have been shown to induce apoptosis and inhibit the growth of fibroblasts and cancer cells at doses ranging from 0.1-10mM depending on the specific cardiac glycoside and cell line. The mechanism(s) by which cardiac glycosides and analogues induce cell death have not been completely elucidated. There is some evidence that the ion pumping activity

of the Na+/K+ ATPase is separate from the signalling activity of the Na+/K+ ATPase (285). This latter activity has been referred to as the Na+/K+ATPase signalosome, and previous reports suggest that for the most well studied cardiac glycoside, digitoxin, effects on signalling in cancer cell lines are observed at doses that are significantly lower than those required to inhibit the ion pumping activity (nanomolar vs. 0.5-5uM) (285). Downstream pathways previously implicated in mediating cell growth inhibition in response to cardiac glycoside treatment include phospholipase

C (PLC), mitogen activated protein kinases (MAPKs), phopshatidyl-inositol-3 kinase (PIK3) and

SRC signalling (285). These findings suggest that the anti-cancer effects may not require pump inhibition, which is most commonly associated with side effects in patients.

All cardiac glycosides share a common structural motif (Figure 1.8): the steroid moiety, which is the pharmacologically active site as well as the binding site for Na+/K+ATPase, a sugar moiety and a lactone moiety (266). Both epidemiological and biological studies have demonstrated that cardiac glycosides are an effective treatment for many cancer types in vitro, affecting a wide variety of signaling pathways. However they have not been investigated further, in part, because there is no suitable animal model to investigate the toxic effects. Cardiac glycosides are non-toxic to rodents due to subunit isoform differences in the Na+/K+ATPase between species (294). While other animal models do show toxicity to cardiac glycosides, there are no animals that share the exact Na+/K+ATPase isoforms as humans (371). Current cardiac glycosides have a very narrow therapeutic window for toxicity and concerns over significant cardiotoxicity secondary to inhibition of Na+/K+- ATPase and subsequent elevation of intracellular calcium levels, have prevented more widespread consideration of these compounds for cancer indications. In the paediatric population, the toxicity of digoxin is most pronounced in neonates and infants or older children with renal dysfunction and manifestations of digoxin

100

toxicity commonly include bradyarrhythmias and heart block (278). Thus, in recent years, considerable effort has been devoted to manipulating the structure of cardiac glycosides to synthesize safe novel cardiac glycosides compounds with improved anti-cancer activity (285). The structural characteristics of cardiac glycosides are shown in Figure 4.1. Synthetic analogues have included structural modifications of the glycosidic bond that links the saccharide moiety to the core steroid nucleus. Analogues in which the sugar moiety is a monosacchride instead of a di- or tri-saccharide show increased in vitro anti-cancer efficacy (283).

We hypothesized that modified cardiac glycosides compounds may have efficacy in the treatment of neuroblastoma. Several analogues were synthesized with varying structural modifications from conventional cardiac glycosides focusing on modifying the three structural motifs. RIDK34 was identified as an ideal candidate based on preliminary cell viability testing in a panel of neuroblastoma cell lines (by a former MSc student in the laboratory, Paolo DeGouveia).

Structure-activity relationship and in vitro testing of the analogue compounds determined that the lactone ring was required for the anti-neuroblastoma activity and that none of the modifications made at this site further increased the efficacy. Also, it has been previously been shown that the number and type of sugar moieties affects the binding of the cardiac glycoside to the

Na+/K+ATPase (285). All of the analogues without the sugar moiety lacked anti-neuroblastoma activity. Modification of the steroid ring at carbon 19 affected the potency of the analogues.

Complete removal of the steroid ring resulted in loss of anti-neuroblastoma activity, while adding an amine group decreased potency. Addition of a hydroxal group did not affect activity; however the addition of an oxime group increased the potency. A previous study also found that modification at carbon 19 to a non-hindered polar group was important to maintain anti-tumour effects and is hypothesized to increase the in vivo tolerance of a cardiac glycoside analogue (372).

101

RIDK34 is an analogue of convallatoxin, glycoside extracted from Convallaria majalis, in which an oxime group was added at carbon 19. Following treatment with RIDK34 we found a decrease in cell viability and proliferation as well as induction of apoptosis at nanomolar concentrations.

Studies are planned to determine if RIDK34 and other cardiac glycosides analogues may have decreased cardiac toxicity by examining ion flux and conduction patterns in cardiac stem cells treated with conventional cardiac glycosides and RIDK34.

4.3 Results

4.3.1 Small molecule screens identify cardiac glycosides as therapeutic candidates for neuroblastoma

Neuroblastoma cells were treated using compounds identified from the LOPAC1280TM compound library, the Prestwick Chemical Library and the Spectrum Collection for 30 hours prior to a further 24-hour incubation in the presence of alamar blue. Primary hits were defined as the compounds with B-scores shifted by at least three standard deviations. Figure 4.1A shows the chemical structure of cardiac glycosides: digoxin, ouabain and convallatoxin (Chembank). To validate results of the screen the cardiac glycosides, digoxin and ouabain, were tested in serial dilution against a panel of neuroblastoma cell lines with varying genetic profiles (eg. status of

MYCN amplification, p53 mutation, 1p and 11q LOH). Figure 4.1B shows the growth inhibitory curve of SK-N-AS and SK-N-SH and the inhibitory concentration (IC50) was determined by MTT assay (Figure 4.1C). In addition, treatment with digoxin and ouabain induced an increase in cleaved-PARP protein expression in a dose dependent manner suggesting that these drugs induce apoptosis in neuroblastoma (Figure 4.1D)

102

!" Ouabain Digoxin

Convallatoxin #"

Digoxin Ouabain Convallatoxin

$" %"

IC50 IC50 IC50

8.6

Figure 4.1 Identification and confirmation of cardiac glycosides for the treatment of neuroblastoma. A, Chemical structure of know cardiac glycosides; digoxin, ouabain and convallatoxin (Chembank; http://chembank.broadinstitute.org/) B, Growth curves of neuroblastoma cells, SK-N-AS and SK-N-SH, treated with increasing doses with the indicated cardiac glycoside for 72h. C, IC50 measurement was performed with MTT (triplicate). Results represent the average of three experiments expressed as a mean percentage of untreated control cells. D, SK-N-AS cells were treated for 24 hours with indicated drugs and doses. Whole cell extracts were analyzed for PARP cleavage by immunoblot analysis.

103

4.3.2 Cardiac glycoside analogue, RIDK34, effects on cell growth and survival

RIDK34 was identified as a promising candidate based on structure-activity relationship analysis and a screen of twelve candidate analogues carried out by previous members of the Irwin and Kaplan labs. Figure 4.2A shows the structural modifications made to the cardiac glycoside convallatoxin to generate RIDK34, specifically the addition of an oxime group bonded to the C19 carbon. Seven neuroblastoma cell lines were treated with increasing doses of RIDK34 and the

IC50 was determined by MTT. The IC50 ranged from 14.1 to 26.9 nM with an average of 21.5 nM (Figure 4.2B). There were no significant differences in sensitivity of cells based on MYCN status. We next examined the effect of RIDK34 on the cell viability of cultured neuroblastoma cells by trypan blue staining. The results showed a dose-dependent cytotoxic effect with nearly

100% SK-N-AS trypan blue-positive (dead) cells at a dose of 50 nM RIDK34 (Figure 4.2C).

There was also a significant decrease in the proliferation of the cells as determined by BrdU incorporation (Figure 4.2D).

104

!" +,-.*/0*

!"#$%&&%'"()#* #"

100 SK-N-FI 80 SK-N-SH SH-EP 60 SK-N-BE(2)c 40

Growth (PercentControl) of Growth 0 0 10 20 30 40 50 60 70 80 Dose (!M) $" %"

BE(2)c

Figure 4.2 RIDK34 decreases cell survival. A, Structure of RIDK34 showing modification of convallatoxin at C19 with an addition of an unique oxime. B, Growth curves of neuroblastoma cells treated with indicated dose of RIDK34 for 72h. IC50 are a mean average of 3 separate experiments by MTT measured as a percentage of control cells. C, SK-N-AS cells were treated with indicated doses of propranolol for 24h and cell viability was determined using trypan blue exclusion method. Results are expressed as a mean percentage of trypan blue negative cells (live cells); data shown are representative of three independent experiments and are expressed as means of triplicates ± s.d. D, SK-N-SH and SK-N BE(2)c were treated with indicated doses of propranolol for 24h. Cell proliferation was assessed by BrdU incorporation. Results are a mean percentage of control cells.

105

4.3.3 Induction of apoptosis and decrease of foci formation in neuroblastoma cells by

RIDK34

To determine if the decreased neuroblastoma cell growth and viability following RIDK34 treatment was due to induction of apoptosis cleaved caspase 3/7 ELISA assays were performed.

Following treatment with RIDK34 there was a 5-fold increase in caspase 3 and 7 activity (Figure

4.3A). We also detected an increase in the levels of poly-ADP-ribose polymerase (PARP) cleavage in both a dose- and time-dependent manner (Figure 4.3B). In order to determine long- term effects of lower doses of treatment in vitro we used a focus formation assay in which cells were treated for two weeks. Following 14 days of treatment there was a significant decrease in the number of foci in a dose-dependent manner (Figure 4.3C). At 5nM there was a 50% decrease in the number of foci and at 15nm less than 5% of the foci remained.

4.3.4 Knockdown of the alpha subunit Na+/K+ -ATPase increases the sensitivity to digoxin and RIDK34.

To determine whether the growth inhibition observed was due to direct effects of cardiac glycosides and analogues on the Na+/K+-ATPase pump we performed siRNA knockdown of the

α1 subunit of the Na+/K+-ATPase in neuroblastoma cells. Importantly, the IC50 detected in SK-

N-AS cells in the presence of control siRNA was similar to that of untransfected cells. Short- interfering RNA of ATP1A1 (alpha one isoform of the human Na+/K+-ATPase) increased the sensitivity the cells to digoxin and RIDK34 as determined by MTT (Figure 4.4A). Cleaved PARP levels were highest in cardiac glycoside treated cells transfected with ATP1A1 as compared to control siRNA (Figure 4.4B). Similar results were obtained with two independent siRNA oligonucleotides targeting different regions of ATP1A1 as well as a pooled siRNA containing five different independent siRNAs.

106

Figure 4.3 RIDK34 induced apoptosis and decreases foci formation in neuroblastoma. A, SK- N-AS cells were treated for 5 hours with indicated doses of RIDK34. Levels of cleaved caspase 3 and 7 activity were determined using Apo-ONE caspase 3/7 reagent. Results are representative of three independent experiments, performed in triplicate and are expressed as mean fold-induction over the control cells ± s.d. B, SK-N-AS (left panel) were treated with the indicated doses of RIDK34 for 24h and SK-N-BE(2)c (right panel) cells were treated with 50 nM of RIDK34 for indicated durations. Whole cell extracts were immunoblotted for PARP and casapase 3 cleavage. C, Concentration-dependent effects of RIDK34 on foci formation. SK-N-AS cells were treated for 14 days with RIDK34 at indicated doses or media alone (control); foci were detected by staining with crystal violet. Bars represent the mean number of foci of triplicate wells from three independent experiments ± s.d.

107

100 Sicontrol 80 ATP1A1 #1 ATP1A1 #2 ATP1A1 pool 60 40 20 0 Growth (Percentcontrol) of Growth 0.5 1.0 1.5 2.0 2.5 Log [dose] nM #" 100 Sicontrol 80 ATP1A1 #1 ATP1A1 #2 60 ATP1A1 pool 40 20

Growth (Percentcontrol) of Growth 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 Log [dose] nM

Figure 4.4 Alpha1 subunit is not required for digoxin or RIDK34 induced cell death. A-B, Shown is a MTT assay for SK-N-AS cells transfected with siRNA targeting ATP1A1 (α1 subunit) or control siRNA and treated for 24 hours with the indicated drugs. The MTT assay was performed 48 hours after transfection. C, siATP1A1 SK-N-AS cells were treated for 24 hours with indicated doses of RIDK34 and immunoblotted for cleaved PARP.

108

4.3.5 RIDK34 induced signalling in neuroblastoma cells

The Wnt/β-catenin pathway mediates neural crest cell fate and neural stem-cell expansion and Wnt/β-catenin is deregulated in high-risk neuroblastoma (373). Following treatment with

RIDK34, decreased levels of β-catenin was detected in a dose and time dependent manner (Figure

4.5A). We also detected a decrease in LDL-related protein 6 (LRP6), a co-receptor of WNTs and a key mediator of the Wnt/β-catenin pathway (Figure 4.5B). In addition to their ability to inhibit the Na+/K+ ATPase pump, cardiac glycosides have been shown to induce affect several different pro-apoptotic signalling pathways. A recent publication from Hiyoshi and colleagues demonstrated that ouabain treatment of neuroblastoma cells results in activation of the DNA damage response (DDR) (291). Similar to ouabain we detected an increase in γ-H2AX staining in response to RIDK34 treatment suggesting that the modifications introduced to generate RIDK34 did not result in a loss of DDR signalling effects. Cardiac glycosides have also been found to activate the TRAIL apoptotic pathway by upregulation of the TRAIL receptor DR5 (or TRAIL

RII). Similar to this report we found that treatment with RIDK34 resulted in increased DR5 mRNA levels (Figure 4.5G).

109

Figure 4.5 RIDK34 affect on signalling in neuroblastoma cells. A, CHLA-15 (left panel) were treated with indicated doses for 24 hours and SK-N-BE(2) (right panel) cells were treated with 50 nM of RIDK34 for indicated durations and then analyzed for β-catenin protein levels by immunoblot analysis. B, SK-N-SH cells were treated with increasing doses of RIDK34 for 24 hours and then immunoblotted for LRP6. C-D, Immunostaining of γH2AX following of treated cells (C) or 24h treatment with 50nM ouabain (D) or 50nM RIDK34 (E). F, Quantification of γH2AX-phosphorylated positive cells treated with indicated drug. Pooled results from 50 randomly selected fields-of-views are shown. G, SK-N-AS ells were treated with 50nM RIDK34 for indicated time points and then harvested for extraction of total cellular RNA. DR5 mRNA expression was detected by RT-PCR.

110

4.4 Discussion

Cardiac glycosides are compounds derived from plants that are commonly used to treat cardiovascular diseases. We identified cardiac glycosides in a screen of FDA approved drugs with anti-neuroblastoma activity [(323) and Podkowa and Irwin, unpublished data]. Conventional cardiac glycosides have a very narrow therapeutic range before inducing cardiotoxicity. RIDK34 is a novel analogue of the cardiac glycoside convallatoxin. At nanomolar concentrations, RIDK34 treatment results in decreased cell growth and induction of apoptosis.

There is a need for novel therapies for treatment of high-risk metastatic neuroblastoma since the rate of relapse and chemotherapy resistance is high. Using high throughput screens of compounds used for other clinical indications can lead to the discovery of new therapies for neuroblastoma and other cancers (323). The potential anti-cancer activity of cardiac glycosides in humans has been the subject of several epidemiology studies. An observational study by Stenkvist et al. followed a group of women with breast cancer treated with digitalis for heart disease and found that in comparison to patients who did not receive cardiac glycoside treatment the tumours were smaller with a more benign histological appearance (279). Cardiac glycosides have been shown by several groups to have anti-cancer effects against a number of cancer cells in vitro. Two cardenolides: digoxin and ouabain were previously identified as potential anticancer agents against neuroblastoma (282, 291, 374). Kulikov et al. reported that ouabain induced apoptosis in SH-

SY5Y cells and these effects correlated with increased cytochrome C release and caspase 3 activation as well as decreasing anti-apoptotic Bcl-2 and Bcl-XL proteins (374). SH-SY5Y xenografts in mice were inhibited by 44% following treatment with digoxin (282, 291). Treatment of SH-SY5Y neuroblastoma cells with ouabain led to an accumulation in the late S-G2/M cell cycle phase and increase in γH2AX levels indicating an increase in DNA damage (291). In

111

agreement with these studies, following the identification of cardiac glycosides in our neuroblastoma drug screens, we treated SK-N-AS and SK-N-SH (subclone of SH-SY5Y) cells with digoxin, ouabain, and convallatoxin and detected decreased cell viability. We also found a dose dependent increase in apoptosis in SK-N-AS cells.

Cardiac glycosides are known to have a very narrow therapeutic window with subsequent cardiotoxicity being a primary concern. One major obstacle to the translation of cardiac glycosides and their synthetic analogues into the clinic is the ability to study the potential cardiac toxicities in pre-clinical models. For in vivo studies there is no suitable murine model to investigate the toxic effects due to species differences in the subunits of Na+/K+ATPase as rodents are intolerant to the toxic effect of cardiac glycosides (294). Synthetic analogues can be designed to make more effective and less toxic compounds as anti-cancer agents. Previous studies have used digitoxin as the backbone for new analogues with some showing increased anticancer activity (285). In the present study, we used convallatoxin; a cardiac glycoside extracted from the plant Convallaria majalis, as the backbone for RIDK34. RIDK34 contains an oxime group bonded to the C19 carbon that can increase the polar character at this site and possibly the number of potential hydrogen bonds. The polar character of this group is further away from the tetracyclic steroid core than the alternative groups added to the C19 carbon, which may allow RIDK34 to have more favourable interactions with its cellular target. Structure-activity-relationship analysis of novel (2′′-oxovoruscharin) cardenolide glycoside compounds showed that the addition of a hydroxyl group to the C19 carbon, in part is associated with higher in vivo tolerance relative to its precursor compound (372). RIDK34 displayed a lower IC50 relative to digitoxin and ouabain but had similar potency to its starting compound convallatoxin. The analogue may be less toxic in vivo relative to its starting compound based on the structural modifications; however, this will need to

112

be studied in appropriate models to examine cardiotoxicity (see Chapter 5 for future directions).

In vitro, the IC50 of RIDK34 was approximately 20nM in a panel of seven neuroblastoma cell lines tested. Effects on viability, proliferation and apoptosis were all detected in response to

RIDK34 and foci formation assays also revealed growth inhibition over periods of at least 2 weeks of treatment. Furthermore, we detected increases in the number γH2AX-phosphorylated positive cells following treatment with RIDK34.

Multiple studies have focused on elucidating the mechanism that mediate the anti-cancer effect of cardiac glycosides with a wide variety of signalling pathways been implicated such as activation of Src, Akt, JNK and ERK/MAPK pathways (266). More recently tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) activation accompanied by the upregulation of

DR4 and DR5 was found to be mediated by cardiac glycosides (289). We found that treatment with RIDK34 can increase expression of DR5 and activation of ERK1/2, as well as evidence of activation of DNA damage response. Further studies will be performed to determine if pathways previously implicated in cardiac glycoside signalling are likewise regulated by RIDK34.

We also identified RIDK34 effects on the wnt/β-catenin pathway, which have not previously been described. The Wnt/β-catenin pathway is of particular relevance to neuroblastoma as it mediates neural crest cell fate and neural stem-cell expansion (375).

Furthermore, neuroblastoma cell lines aberrantly express high levels of β-catenin and high-risk neuroblastoma without MYCN amplification may deregulate MYC via altered β-catenin signalling

(373). Also, Frizzled-1 Wnt receptor (FZD1) has been shown to mediate chemoresistance and knockdown of endogenous Wnt1 resulted in cell death and inhibited growth of neuroblastoma cells (SH-SY5Y) (65). We found that treatment with RIDK34 was associated with decreased β- catenin. We also found a decrease in LDL-related protein 6 (LRP6), a co-receptor of WNTs and a

113

key mediator of the Wnt/β-catenin pathway. These findings were detected in MYCN amplified cell lines and further studies to determine if these effects are specific to cells with high levels of MYC will need to be performed to determine if these observed effects in Wnt/β-catenin signalling may be an alternative mechanism by which RIDK34 mediates growth inhibition.

Given the lack of appropriate rodent models to test Na+/K+-ATPase pump activity we compared RIDK34’s inhibitory effect of Na+/K+-ATPase pump function and subsequent deregulation of [Na+]i and [K+]i against its parent compound convallatoxin in an in vitro model.

We found that higher concentrations of RIDK34 relative to convallatoxin were required to inhibit the Na+/K+-ATPase suggesting that it might have fewer effects on ion flux and cardiac conduction in vivo. To confirm if RIDK34 has lower cardiotoxic effects, an in vitro model using human cardiomyocyte progenitor cells differentiated into functional beating and mature cardiomyocytes will be used to test for cardiotoxicity (376). Digitoxin has been shown to inhibit the Na+/K+-ATPase pump at concentrations between 0.5-5 µM, but significantly lower doses inhibit cancer cell growth in vitro (285). Similarly, our study showed that in contrast to the parent compound, convallatoxin, higher concentrations of RIDK34 were required to inhibit Na+/K+-

ATPase pump activity (0.749 vs. 1.042 µM). Importantly, we demonstrate neuroblastoma growth inhibition at nanomolar concentrations (1-100nM) that are significantly lower than those required to affect the pump activity (285). This suggests that mechanisms other than Na+/K+-ATPase pump inhibition may be involved in the anti-cancer effects of cardiac glycosides suggesting that conduction problems resulting in arrhythmias would be less common.

In addition to the pump activity, the Na+/K+-ATPase also has signalling properties that are sometimes referred to as the Na+/K+-ATPase signalosome. To determine if Na+/K+-ATPase protein complex is required for RIDK34 induced cell death we used ATP1A1 siRNA to knock

114

down the alpha1 subunit, which is the known binding site of cardiac glycosides and for many cancers has been the predominant subunit expressed (377). siRNA targeting of ATP1A1 increased sensitivity of the cells to digoxin and RIDK34 treatment. Cells with ATP1A1 and cardiac glycoside treatment had a lower IC50 as well as increased levels of apoptosis than cells exposed to either treatment alone. A previous study has also found that knock-down of the NA/K-ATPase α1 subunit increased the sensitivity of HepG2 cells to treatment with Ouabain (378). One possible explanation for our findings is that cell death from cardiac glycosides does not require inactivation of the Na+/K+-ATPase. An alternative explanation is derived from works of Karpova et al. Who established that both the α1 and α3 subunit of the sodium pump are needed to mediate a response to ouabain and that the α3 was responsible to activation of ERK1/2 (370). Thus, single knockdown of α1 subunit may not be sufficient. Further studies are ongoing to determine if α3 knockdown alone or in combination with α1 results in decreased sensitivity to RIDK34. The finding that high levels of α3 (ATP1A3) are associated with poor prognosis tumours suggests that this may potentially be a relevant target for patients with high-risk recurrent tumours. However, more studies are required to confirm this prediction.

Conventional cardiac glycosides, digoxin and ouabain have previously been shown to have anti-cancer activity in neuroblastoma cells. In the present study, we have demonstrated that a novel synthetic analogue of convallatoxin has activity against neuroblastoma at doses lower than those required to inhibit the Na+/K+ ATPase pump function and are not mediated by the α1 subunit. Modification of the structure by adding an oxime may potentially decrease cardiotoxicty in vivo; however, cardiotoxicity studies of RIDK34 will need to be performed for this to be determined.

115

4.5 Materials and methods

4.5.1 Cell culture and compounds

Established neuroblastoma cell lines SK-N-AS, SK-N-BE(2), SK-N-BE(2)C, SK-N-SH, SH-EP,

SH-SY5Y, SK-N-FI, CHLA-15 were cultured in RPMI containing 10% fetal bovine serum

(Invitrogen, Burlington, ON, Canada), 37°C, 5% CO2 tissue culture incubator. The

LOPAC1280TM library (Sigma Aldrich, St Louis, MO, USA), Prestwick Chemical Library®

(Prestwick Chemical, Inc.) and the Spectrum Collection (MicroSource Discovery Systems, Inc.) which combined include 4383 biologically-active molecules, off-patent drugs and natural products, were provided by the SMART Facility (Samuel Lunenfeld Research Institute, Mt Sinai

Hospital, Toronto, Canada). Compound libraries were dissolved in DMSO at 10 mM using the

BioMek FX (Beckman Coulter, Inc.) and re-aliquoted as 0.1 mM aqueous solutions prior to dispensing into the assay plates. Digoxin, Ouabain and Convallatoxin were purchased from

Sigma-Aldrich Co. (St. Louis, MO, USA) and were dissolved in DMSO. Novel cardiac glycoside compound RIDK34 was synthesized by the Focus in Synthetic Chemistry (FISC) group at the

Hospital for Sick Children and were dissolved in water.

4.5.2 Western immunoblot analysis

Whole cell extracts were prepared using EBC buffer (50mM Tris (pH 8.0), 120 mM NaCl, 0.5%

NP-40) with PI (Roche Diagnostics, Laval, QC, Canada) and quantified using Bradford reagent

(Bio-Rad laboratories, Hercules, CA, USA). Equal amounts were resolved by SDS-PAGE and transferred to nitrocellulose membrane. The membranes were blocked in 5% milk and probed with primary antibodies overnight. Horseradish peroxidase-conjugated secondary antibodies

(Thermo Fisher Scientific, Rockford, IL, USA) was used and then detected by an enhanced chemilminescene system (Super Signal West Pico, Thermo Fisher Scientific, Rockford, IL, USA).

116

Primary antibodies: cleaved-PARP, LRP6, β-catinen, cleaved-caspase 3 (Cell signaling technology, Beverly, MA, USA); Vinculin (Upstate, Lake Placid, NY, USA); β-actin (Sigma-

Aldrich, Oakville, ON, CA).

4.5.3 Apoptosis assays

Cells were seeded into a 96-well plate at 1.5x104 cells per well and treated 24 hours later with

RIDK34 for five hours. The combined caspase-3 and caspase-7 activity was measured using the

Apo-ONE caspase 3/7 Assay Kit, according to manufacturer’s instruction (Promega, Madison,

WI, USA). Fluorescence was read using a luminometer (Spectra MAX Gemini EM, Molecular

Devices) at 499/521 nm wavelengths. Apoptosis was evaluated at the protein level by immunoblotting with anti-cleaved PARP and anti-cleaved caspase-3 antibodies.

4.5.4 Cell Viability and Proliferation Assays

IC50’s were determined with MTT cell proliferation assay (Roche, Hoffmann-La Roche Limited,

Mississauga, ON, CA). 3000-6000 NB cells were plated in 96-well plates and cells were treated with increasing doses of digoxin, ouabain, convallatoxin or RIDK34 for 72 hours. At 72 hours,

MTT reagent was added to equal 10% of total volume in the well and then incubated for 4 hours at

37°C. 100ul of Solubilization/Stop Solution was added to each well and incubated overnight. The absorbance was measured using a spectrophotometer at 570 nm (VersaMax tunable microplate reader, Molecular Devices). Trypan blue exclusion assay (Gibco, St. Louis, MO, USA) was used to measure viability following 24 hours of treatment with increasing doses of RIDK34. The number of live and dead cells (trypan blue positive) was counted in triplicate using a hemocytometer and the percentage of viable cells was calculated using the formula: (Viable –

Dead cells)/Total cell number X 100%. Cell proliferation was assessed using Bromodeoxyuridine

(BrdU) (Cell Signaling, Danvers, MA, USA). 4000 cells were treated with indicated drug and

117

then incubated with BrdU (10µM) for 4h and detected using anti-BrdU antibody. The absorbance was measured at 450nM using a spectrophotometer plate reader (VersaMax tunable microplate reader, Molecular Devices).

4.5.5 Foci formation assay

Cells were seeded (102/well in six-well plates) in 2 ml of growth medium and incubated overnight at 37°C. RIDK34 or media was added at the specified concentrations and plates were incubated at

37°C for 14 days. Fresh media and drug was replaced at 7 days. Fourteen days after seeding, foci were fixed and stained in 1% crystal violet with 20% methanol. Foci of 50 cells were counted.

4.5.6 Na+/K+-ATPase activity screen

Na+/K+-ATPase activity was assayed by Aurora Biomed (Vancouver, B.C., Canada). Briefly,

HEK-293 cells, which endogenously express Na+/K+-ATPase, were exposed to rubidium (Rb+) and subsequently washed with SPA-Wash Buffer and lysed. Cellular uptake of Rb+ in response to drug treatment was measured using flame atomic absorption spectroscopy (ICR8000, Aurora

Biomed). The Na+/K+-ATPase recognizes Rb+ ions as analogous to K+ ions and thus decreased

Rb+ uptake is considered a marker for inhibition of Na+/K+-ATPase mediated ion influx.

4.5.7 SiRNA transfection

Short-interfering RNA was performed using the following double-stranded RNA 21 base pair oligonucleotides:

SiRNA Target Sequence ATP1A1 -1 GUGAAGGAGAUGAGAGAAAUU ATP1A1-2 GUUCAAAGAUCAUGGAAUCUU UGAAUUUCCCUAUCGAUAA GUUCAAAGAUCAUGGAAUC ATP1A1-Pool GGUUGGACGUGAUAAGUAU GAAGGCACCGCACGUGGUA

118

Oligonucleotides were resuspended according to the manufacturer’s instructions (Dharmacon,

Lafayatte, CO, USA). SK-N-AS were seeded at 105 cells in P100 plates and transfected with siRNA at approximately 50-60% confluency using Oligofectamine (Invitrogen) according to the manufacturer’s instructions. siCONTROL (Dharmacon) transfection was used as control. The final concentration of siRNA was 100nM. Cells were allowed to recover for 24 h before re-plated for experiments. The gene silencing effect was evaluated by RT-PCR.

4.5.8 RT-PCR

Total RNA was extracted using TRIzol (Invitrogen). cDNA was generated using the Omniscript

RT Kit (Qiagen, Mississauga, ON, Canada) and amplified by semiquantitative RT–PCR using the

Taq DNA polymerase Kit (Qiagen).

RT-PCR conditions:

Annealing # of Gene Forward Reverse Temp Cycles β-actin 5’-CTGGAACGGTGAAGGTGACA-3’ 5’-AAGGGACTTCCTGTAACAATGCA-3’ 58°C 25 DR5 5’-ACTCCTGGAATGACTACCTG-3’ 5’-ATCCCAAGTGAACTTGAGCC-3’ 58°C 25 ATP1A1 5’-TGTGATTCTGGCTGAGAACG-3’ 5’-TCTTGCAGATGACCAAGTCG-3’ 55°C 32 The amplified products were then separated on 1.5 % agarose gels with ethidium bromide and visualized under UV illumination.

4.5.9 γH2AX immunostaining

SK-N-AS cells were seeded in uncoated Labtek chamber slides (Nunc) (80,000 cells/chamber), grown for 24 hrs and treated with 0.5mL media containing the appropriate drug treatment (50nM

Ouabain, 50nM RIDK34). After 24hrs cells were fixed with 4% PFA for 15 min, permeabilized with 0.2% Triton X-100 for 5 min and blocked with 6% Normal Goat Serum in 0.5% BSA for 1 hr. To stain γH2AX, slides were incubated with 1:400 dilution of Phospho-Histone H2A.X

(Ser139) (20E3) Rabbit mAB (Cell Signaling) overnight at 4ºC. Slides were then incubated with

1:5000 Alexa Fluor 488 Goat Anti-Rabbit IgG (H+L) (Life Technologies) for 1hr at room

119

temperature. 1:5000 DAPI stain was also applied to the slides. Slides were visualized using spinning disc confocal microscopy. 50 fields-of-view (FOV) were captured and cells were scored positive for the presence of γH2AX foci and compared to the number of foci in untreated cells.

120

Chapter 5 - General discussion and future directions

Advances in neuroblastoma treatment have resulted in an increase in five-year survival rates from 46% (1974-1989) to 71% for patients diagnosed between 1999-2005 (4). However, the improvement in treatment outcome is mostly due to the increased survival of patients with low and intermediate-risk disease. Neuroblastoma is an extremely heterogeneous cancer and patient prognosis is based on the age, stage and tumour biology and genetics. Infants, 18 months and under, and patients with favourable disease characteristics have a long-term disease free survival rates approaching 90%. Although older children with advanced stage neuroblastoma receive aggressive treatment that includes surgery, radiation, hematopoietic stem cell transplant, immunotherapy and chemotherapy, long-term survival rates remain low. Further characterization of the genes and mechanisms involved in the molecular pathogenesis of neuroblastoma are critical to the identification of novel therapies for high-risk patients.

5.1 Understanding the role of p53 and p53 family in neuroblastoma development and response to therapy

5.1.1 Summary of LFS-mutant p53 in neuroblastoma

p53 is rarely mutated in sporadic neuroblastoma at diagnosis. However, emerging evidence suggests that mutations may be more common at the time of relapse (44). Most p53 mutations map to the coding region of the central DNA binding domain. In rare cases, Li-Fraumeni syndrome patients with germ-line p53 mutations have developed neuroblastoma (26, 72, 73).

While neuroblastoma is not a characteristic tumour found in LFS patients, we have identified two infants diagnosed with neuroblastoma with germline mutations in p53 (R158H and R248W) in the

Hospital for Sick Children Cancer Genetics Program Database. These tumours were aggressive and did not respond to therapy. Similar to its role in other cancers, several studies have

121

demonstrated an important role for p53 in chemosensitivity in neuroblastoma. In vitro studies using cultured neuroblastoma cell lines have found that cells with mutated p53 and cells with inactivated p53 via overexpression of the E6 viral oncoprotein are less sensitive to some chemotherapies (42, 305). Chemotherapy induced p53- dependent apoptotic pathways in neuroblastoma often involve transcriptional activation of the pro-apoptotic BH3 containing proteins such as NOXA, PUMA and Bim (379, 380). We proposed that the mutant germline and somatic p53 mutations in LFS patients may have contributed towards the poor clinical outcome in these patients. Multiple studies lend further support for p53 as a determinant of chemosensitivity in neuroblastoma. Isogenic neuroblastoma cell lines with or without p53 expression as a result of siRNA inhibition/degradation was used to show that inactivation of p53 resulted in resistance to doxorubicin, cisplatin and vincristine in vitro and in vivo (381). More recently reversan, an inhibitor to the multi-drug resistance protein-1 (MRP1), induced apoptosis in response to chemotherapies in association with activation of p53 target genes as detected by a p53 responsive promoter reporter (382). Furthermore, Chesler et al. used a MYCN transgenic neuroblastoma murine model to study the role of p53 in drug-induced apoptosis (379). In comparison to MYCN transgenic mice, MYCN transgenic mice lacking one copy of p53 were more resistant to cyclophosphamide, and decreased levels of the pro-apoptotic genes PUMA, Bim and Bax as well as total apoptosis were detected in these MYCN transgenic p53-/- mice. Neuroblastoma tumours with acquired p53 mutations have been found to express high-levels of multidrug resistance proteins (42). A high proportion of neuroblastoma that relapse have detectable abnormalities in the p53/HDM2/p14ARF pathway (43, 44). Furthermore, SNPs in p53 codon 72 (arginine/proline) and HDM2 nucleotide 309 located in the promoter have both been associated with more aggressive poor prognosis tumours (116, 122-124). The majority of the defects are upstream of

122

p53 suggesting that therapies that reactivate wildtype p53 may be beneficial while those with defects downstream of p53 would require implementation of p53-independent therapies (43, 44).

After confirming that both of these mutations were non-functional in a p53 null cell line we examined the effects of these mutations on neuroblastoma cells. Overexpression of both LFS- p53 mutant proteins led to decreased activation of downstream target genes and induction of apoptosis following treatment with chemotherapy. We also found that both mutant p53 proteins bind to TAp73, and this binding to TAp73 as well as the wildtype p53 in these neuroblastoma cells likely led to inhibition of p53-family target gene activation. Although certain p53 mutant proteins have been previously shown to bind to TAp73; R248W was reported not to bind wildtype p53 and R158H had not been previously investigated (98).

As support for neuroblastoma as a possible LFS-associated tumour grows, this may prove to have clinical utility. Conceivably, select individuals from LFS families could be screened for neuroblastoma allowing identification at younger ages when prognosis is often the most favourable. To date there are two reported cases associated with mutations in codon 248

(including our case) and it may be interesting to determine if there are certain missense mutations that might be more commonly detected in LFS –associated neuroblastoma. A screening protocol developed by Malkin and colleagues has shown promise in the earlier diagnosis of LFS tumours with an impact on patient outcome (383). The incidence of neuroblastoma is still quite low compared to other LFS associated tumours so it is not clear if sufficient evidence warrants testing affected infants and young children in LFS families with urinary catecholamines and/or abdominal ultrasounds. Finally, our study may also provide further insight into the role of p53 in neuroblastoma tumorigenesis and lead to potential strategies to overcome chemoresistance in neuroblastoma with p53 mutations. Our group has already demonstrated that the HMD2 small

123

molecule antagonist can enhance chemosensitivity in mutant p53 neuroblastoma cells by interfering with HDM2-p73 interactions (321) and additional agents that reactivate p53 mutant are in various stages of pre-clinical testing.

5.1.2 Future Directions exploring mutant p53 in neuroblastoma

Unfortunately tumour material from the two LFS neuroblastoma patients is not available.

However, fibroblasts obtained from a skin biopsy of one of the LFS patients can be used further to characterize R158H p53 mutation. Attempts to “rescue” wildtype p53 function by shRNA knockdown of mutant p53 may be used to further determine whether this mutant p53 protein has gain of function properties. The chemotherapy responses of the fibroblasts with mutant p53 can be compared to fibroblasts with mutant p53 shRNA as well as to normal fibroblasts with wildtype p53. This can be done by looking at cell viability using an MTT assay or trypan blue staining as well as performing apoptosis assays (e.g. caspase activation or annexin assays). These cells can also be used to determine if p53 R158H forms an endogenous complex with TAp73 by performing co-immunoprecipitation experiments. Further studies to examine the role of these mutants, and especially R158H, which is less well studied, could include generation of a knock-in mouse in which the murine equivalent of the specific LFS mutant allele would be engineered into the endogenous p53 gene loci. These experiments would be similar to those performed by the Jacks and Lozano groups in which they generated mice with mutations at hotspot codons 172, 175, and

270. To further determine the specific role of these LFS-neuroblastoma associated mutations in neuroblastoma these mice could be crossed to the MYCN transgenic mouse to ask whether the tumour onset or burden in the compound mice differed from either the single knock-in mice of the

MYCN transgenic mouse.

124

There are other possible studies that might elucidate differences in the functions of the mutant LFS neuroblastoma associated p53 mutations at the cellular level. Upon activation in response to certain stimuli p53 quickly translocates to the mitochondria and forms complexes with pro-apoptotic BclXL and Bcl2 proteins, resulting in the permeabilization of the outer mitochondrial membrane and release of cytochrome C (384, 385). Recent reports demonstrate that some mutant p53 proteins fail to induce this transcription-independent cell death (386, 387).

Sansome et al. reported that short-term hypoxia results in p53 translocation to the mitochondria earlier than p53 protein accumulation in the nucleus (385). Immunoflorescence can be used to investigate if the LFS p53 mutant proteins are capable of translocation to the mitochondria. Cells can be transfected with plasmids encoding epitope tagged versions of wild type or mutant p53 and subsequently exposed to hypoxic conditions (eg. hypoxic conditions (1-2% oxygen) or hypoxia- mimetic agents cobalt chloride (CoCl(2)) and desferrioxamine (DFO) for short periods of time (as used in the Sansome et al. 2001). The cells can then be labelled with a Mito tracker, stained for p53 (or epitope tag), fixed and examined for mitochondrial p53 to determine whether they have decreased mitochondrial localization as compared to the wildtype p53.

To study the role of p53 in tumour initiation in neural crest cells and to provide insight into whether p53 plays a role in the transformation of neural crest precursors into neuroblastoma, skin keratinocyte precursors (SKP) can be used as a model system. The LFS mutant p53 plasmids can be overexpressed in SKPs and growth following overproduction of the LFS p53 mutants can be examined in vitro.

Preliminary experiments in which primary bone marrow cells isolated from neuroblastoma patients were engineered to over-express mutant p53 demonstrated that xenografts of the mutant p53 expressing cells had increased tumour volume when compared to xenografts with the parental

125

cells. Further experiments can be done to determine if these mutants can increase the tumorigenicity of neuroblastoma. Xenografts using stably transfected neuroblastoma cell lines can be used to evaluate the following endpoints: 1) the percentage of mice developing primary tumours after injection, 2) the time from tumour injection to detection in hind limb [rate of growth] 3) the time from injection to death or sacrifice. Tumour size will be measured to determine whether tumours expressing mutant p53 have increased growth in comparison to vector-transfected cells.

Finally, the combination of increasing evidence that the p53 family proteins are involved in metastases together with the observation that our patients with p53 mutations developed very aggressive and metastatic tumours suggests that further studies examining the roles of these mutants in a metastatic model may provide additional insight into roles for mutant p53 in invasion and metastasis in neuroblastoma (213, 388, 389). Current neuroblastoma metastatic models rely on tail vein injection, orthotopic injection or use of genetically engineered mouse models. An intracardiac injection model is under development in the Kaplan and Irwin labs and utilizes cells labelled with a GFP and a luciferin reporter construct. These mice develop significant bone, bone marrow, and brain metastases that are visualized by imaging including Xenogen (Fathers K, Irwin

M, Kaplan DR, personal communication, 2012). We could generate and inject cells expressing our mutant LFS p53 proteins and ask whether the metastatic spread, tumour burden, or survival of mice is significantly different than those with parent cells.

5.2 Repurposing existing approved compounds for the treatment of neuroblastoma

Despite aggressive multi-modality treatments, more than half of patients with high-risk neuroblastoma relapse, and cure after recurrence is rare. There is a need to find alternative

126

therapies to treat these patients. Repurposing medications already in use for other indications is a safe and expedient way to discover novel therapies for neuroblastoma. Using a high-throughput screen of FDA-approved drugs we identified candidate compounds to investigate for the treatment of neuroblastoma.

5.2.1 Summary of anti-tumour activity of β-adrenergic receptor antagonist propranolol

Propranolol is a β-adrenergic antagonist that when used for the treatment of hypertension was incidentally discovered to have efficacy in the treatment of paediatric patients with benign vascular proliferative haemangioma lesions (239). High-throughput screening in our lab identified propranolol to have anti-neuroblastoma activity. Notably, propranolol is also under investigation as a potential therapy for other malignancies (225, 250, 252). Although it is well tolerated and in routine clinical use in paediatric patients, it has not been tested for use with neuroblastoma. We found that treatment with propranolol led to decreased cell viability and proliferation as well as induction of apoptosis and synergy with the irinotecan metabolite, SN-38. The dose of propranolol used to treat cells in vitro was relatively high (100-200uM) but similar to the observed doses reported for other cancer types in vitro (200-400 µM). The requirement for the high dose is potentially due to the short half-life (4 hours) and/or protein binding. Therefore we used a long- term foci formation assay to show that daily treatment with propranolol demonstrated lower dose that was needed to reduce the number of foci. Propranolol is an extremely well tolerated drug and can be given at high doses for long periods of time. Using the dose given to infants treated long- term for hemangiomas (2mg/kg bid) we saw a significant decrease in tumour volume after fourteen days of treatment as well as an increase in survival of propranolol treated mice. We investigated potential mechanisms for these effects and found that both p53 and TAp73 and p53- family pro-apoptotic target genes were induced. TAp73 is activated in response to several

127

chemotherapies and is especially important in determining chemosensitivity in cells with mutant p53 (40, 41). Numerous studies have revealed only rare p73 mutations in neuroblastoma; however,

LOH of p73 (located within the region of 1p36) is frequent and associated with MYCN amplification and advanced stage neuroblastoma (47, 390). Levels of the anti-apoptotic ΔNp73 are elevated in high risk neuroblastoma and is an independent marker of poor prognosis (45). The role of p63 in neuroblastoma has not been reported; however, in contrast to p73 and p53, which are expressed in numerous adherent neuroblastoma cell lines derived from patients with metastatic disease, p63 mRNA or protein is not detected in neuroblastoma cell lines (40). Although we cannot exclude the possibility that p63 is expressed in a subset of neuroblastoma primary tumours, to date, data suggests that in cells isolated from patients with metastatic neuroblastoma, p73 and p53 are the predominant p53 family proteins expressed.

Differential regulation of TAp73 and ΔNp73 isoforms has been found in response to chemotherapy agents cisplatin, doxorubicin and etoposide. In vivo treatment of xenografts with the topoisomerase I inhibitor CPT-11, which is closely related to two effective anti-neuroblastoma therapies topotecan and irinotecan, also leads to apoptosis that correlates with induction of p73 expression (391). Thus, relative levels of p73 isoforms influence the chemosensitivity of various tumours with both mutant and wildtype p53.

Our findings in neuroblastoma were similar to those for HNSCC, where we detected upregulation of p53 and TAp73. Interestingly, the pro-survival ΔNp63 protein, which has been reported to modulate chemotherapy and radiosensitivity in HNSCC, was downregulated in response to propranolol. Thus, taken together our data in two different systems suggests that in response to the β-blocker propranolol the relative levels of the pro-and anti-apoptotic p73 and p63 isoforms are modulated to induce cell death.

128

5.2.2 Future directions for the anti-cancer effects of propranolol

The effects of propranolol on neuroblastoma may uncover new and important pathways involved in the development and survival of neuroblastoma. Propranolol has been implicated in numerous signalling pathways in other cancer types; however, it is still relatively unclear which pathways are required for propranolol induced cell death. To confirm the importance of p53 and

TAp73, siRNA knock down of one or both p53 family proteins would help determine the relative contribution of this pathway. Other pathways reported to be affected by other investigators that have also been implicated in the apoptotic response to other neuroblastoma therapies include

ERK/MAPK, Akt and HIF-1α. Furthermore, since propranolol has been previously shown to prevent the migration and invasion of pancreatic cancer cells and MMPs are known to play a role in migration and are downregulated following treatment with propranolol in other cancers, it would be interesting to look at the effect of propranolol on migration and invasion of neuroblastoma cells in vitro or efficacy in a murine metastatic model. In addition, investigating propranolol in combination with current therapies in vivo would provide better insight into whether this drug can be used clinically. While our manuscript was under review another publication revealed that propranolol is synergistic in vivo with the chemotherapies vincristine and vinblastine (343). We identified a novel target (β2AR) and therapy (propranolol) for neuroblastoma and demonstrates efficacy in 15 cell lines in which levels of β2AR do not correlate with sensitivity; however, β2AR levels and relationship to IC50 was not reported in the publication. Also, we identified a novel mechanism by which propranolol inhibits cell death, by activating p53 and p73 signalling and downstream pro-apoptotic targets, in part via down- regulation of phospho-HDM2. Finally we demonstrated that levels of β2-AR, but not β1-AR, are

129

predictive of prognosis in primary tumor samples. No primary tumor expression data is included in the publication.

Cardiovascular disease is one of the most serious complications of treatment observed in long-term paediatric cancer survivors (392). The direct toxic effect of radiotherapy or chemotherapy causes long-term cardiac effects including hypertension and congestive heart failure

(317, 392). Propranolol therapy has been used safely for over 40 years for paediatric arrhythmias, hypertension, congenital heart disease, and hypertrophic cardiomyopathy, including in the treatment of current and former cancer patients (354, 393). Propranolol is now given as a first line therapy in many centres for the treatment of hemangiomas in infants (239, 241). Although propranolol is a commonly used in paediatric patients, performing a retrospective study to examine associations between β-blocker use and paediatric tumour incidence, characteristics or cancer–specific mortality is unlikely to be informative in comparison to similar studies performed for patients with adult cancers. Experience from the breast cancer literature in humans demonstrated that inhibiting the β2-adrenergic signalling pathway may reduce breast cancer progression and mortality in a similar epidemiological study (262). Use of propranolol in breast cancer treatment is now being investigated in phase 2 clinical trials (NCT01847001) (357).

Although single agent trials in paediatric oncology are still used to examine novel agents, many phase I and II trials try to incorporate combinations. Unfortunately, only a minority of drugs that are successful in pre-clinical investigations proceed to the clinic. Thus, the current pre-clinical testing is not optimal for predicting efficacy in patients. This may be due to current models used to validate targets. Promising in vitro studies for many cancer types including neuroblastoma, may fail to show efficacy in murine models and/or clinical trials because while they effectively treat a subset of cancer lines or tumors the models may not accurately represent tumour heterogeneity or

130

address cancer stem cells (CSC) that may be the cells responsible for relapse. Using tumour initiating cell populations as a model may provide a better predictor for effective therapies that target CSC type populations. Identifying a neuroblastoma CSC marker to sort cells into subpopulations would be the ideal method to isolate potentially more tumorigenic cells against which to test candidate therapies. However, finding neuroblastoma CSC markers has proven difficult. Recently, the granulocyte colony-stimulating factor (G-CSF) was reported to be expressed on a highly tumorigenic subpopulation in neuroblastoma with stem cell characteristics

(394). G-CSF(+) cells were capable of both self-renewal and differentiation to progeny cells and had characteristics that resembled embryonic and induced pluripotent stem cells (394). G-CSF- sorted cells could be used for future drug screeing and validation studies, if this population is shown to be highly tumorigenic in primary cells from patients tumors or metastases. Another possible strategy would be to determine if the tumors from drug treated mice no longer form tumours in a second mouse. Finally, current in vivo models using subcutaneous and orthotopic xenografts may also be insufficiently heterogeneous. The current use of xenografts allows evaluation of tumour growth in response to treatments either in the skin or in the adrenal capsule

(site of majority of primary neuroblastoma); however, the microenvironment and use of matrigel does not replicate the microenvironment and metastatic niche for neuroblastoma tumors in patients. Many groups utilize engineered models; however, one caveat for these mice is that neuroblastoma mutations and alterations are heterogeneous and no single driver mutation is detected in more than 8% of tumors. Thus, genetically engineered mice allow for investigation of the role of a particular mutation or genetic aberration found in subsets of neuroblastoma,,but may not adequately reflect the heterogeneous nature of theses tumours. These are some of the potential reasons that many promising drugs fail to make the transition from bench to bedside leaving many

131

diseases under or poorly treated. Repurposing exist drugs capitalizes on the pleitropic effects of these drugs, such as propranolol that seems to target many different neuroblastoma cell lines may circumvent many of the aforementioned issues. However, it will be critical to develop models that represent the metastatic and heterogeneous nature of neuroblastoma primary tumors and metastases in order to identify future candidate. Nevertheless, given the well established safety profile for propranolol, and the fact that the receptor is expressed on most tumours, it might be worth considering a trial in which propranolol is combined with irinotecan or vinblastine, both drugs with demonstrated efficacy in the relapse setting.

5.2.3 Summary of novel cardiac glycosides for treatment of neuroblastoma

Cardiac glycosides were the largest class of drugs identified with anti-neuroblastoma activity in our high-throughput drug screen and have well-established inhibitory effects on cellular proliferation in a number of cancers in addition to neuroblastoma. However, due to a narrow therapeutic window, implementation of these drugs for the treatment of cancer is difficult, particularly in paediatric patients. Novel cardiac glycosides analogues were designed in an attempt to develop a drug with enhanced anti-proliferative effects while minimizing the cardiotoxicity thought to be due to the direct inhibition of Na+/K+ATPase pump activity. We characterized the effects of our lead analogue RIDK34 and determined that it was more effective at lower doses than other cardiac glycosides (digoxin and ouabain) but similar to its parent cardiac glycoside convallatoxin. Preliminary experiments demonstrated that knockdown of the α1 subunit of the sodium pump results in increased digoxin and RIDK34 sensitivity, which is similar to results reported for ouabain treated cells (378). These results indicate that the α1 subunit of the

Na+/K+ATPase may not be required for cardiac glycoside cell death. However, both the α1 and

α3 subunits have recently been proposed to be essential for neuroblastoma survival and both

132

subunits are expressed on primary neuroblastoma tumours, with higher a3 subunit expression detected on poor prognosis tumours (370). Therefore knockdown of the α3 subunit will need to done before making any conclusions about whether the Na+/K+ATPase is required for RIDK34 mediated cell death.

5.2.4 Future directions of cardiac glycosides analogues for treatment of neuroblastoma

Of the novel cardiac glycosides analogues developed, RIDK34 was our lead candidate based on the low IC50 in vitro. Assessing cardiac safety testing of drug candidates is an important part of drug development, especially for cardiac glycosides. Therefore in order to determine if

RIDK34 (or potentially any novel drug with unstudied cardiac side effects) is acceptable for use in patients we would need to determine whether the same doses that inhibit neuroblastoma growth result in cardiotoxicity. No suitable animal model exists to test toxicity since rodents are highly insensitive to cardiac glycosides based on murine expression of cardiac glycoside insensitive

ATPase subunits. Through collaboration at Sick Kids with Dr. Jason Maynes we will be testing the toxicity of RIDK34. The xCELLigence System RTCA Cardio Instrument can be used to accurately predict the preclinical cardiac safety of potential drugs (376). This system uses electrophysiological analysis of extracellular field action potentials established by Na+, Ca2+, and

K+ voltage-gated ion channels found on human induced pluripotent stem cell– derived cardiomyocytes (iPSC-CMs) to determine the effects of the cardiac glycoside analogues. Human iPSC-CMs exhibit molecular and functional properties comparable to intact human heart that provides an effective means to test of the cardiotoxicity of the cardiac glycoside analogues (395,

396).

We will use a high-throughput functional assay employing a monolayer of beating human iPSC-CMs to compare the novel analogues against the parent compound. To assess impedance,

133

the rhythmic, synchronous contractions of the iPSC- CMs will be tested in 96-well plates with interdigitated electrode arrays. Treatment of the iPSC-CMs with digoxin, ouabain and convallatoxin will result in specific changes in the beat rate and/or the amplitude of the impedance measurement. We can then use these measurements and compare them to those induced by

RIDK34. This technique has been validated previously by testing compounds with known cardiotoxic effects. The experiments found that changes in impedance were comparable with the results from a related technology, electric field potential assessment obtained from microelectrode arrays and one of the compounds tested was Ouabain, which showed an increase in beat amplitude suggesting that treatment of 30 nM caused tachycardia- or fibrillation-like arrhythmia (376).

Once safety of the RIDK34 in cardiomyocytes has been established, we wish to determine if there are synergistic effects with current therapies that are used to treat neuroblastoma. Previous studies have shown synergistic effects of digoxin with irinotecan in colon cancer (397). Also, an in vivo xenograft mouse model, using both single drug and in combination with the irinotecan metabolite SN-38, can be used to determine if RIDK34 is capable of reducing tumour burden.

The cardiac glycoside, digoxin has previously been shown to reduce tumour size in neuroblastoma xenografts (282).

Further investigation into which pathways are involved in RIDK34 induced cell death will be important for future studies. In the present study we only examined a small fraction of the pathways already implicated in the anti-cancer activity of cardiac glycosides. It would also be interesting to see if there are any differences in the signalling pathways affected compared to the parent compound convallatoxin.

134

5.3 Neuroblastoma models

Our studies have relied heavily on a panel of commonly used adherent neuroblastoma cell lines with varying genetic backgrounds. Ongoing studies to identify neuroblastoma tumour initiating cells or cells with cancer stem cell like properties may provide additional systems for future drug discovery and validation studies. In particular efforts by our neuroblastoma groups at

Sick Kids and collaborators are geared towards isolating cells from the metastases of patients with recurrent disease, including samples obtained at different times pre- and post therapy. Currently, we are also testing some of our lead drugs on early passage cells recently isolated from patients.

As these new cell resources are developed it will be critical to determine whether they are more predictive of patient responses in vivo. In addition to in vitro models, there has been considerable effort towards generating genetically engineered neuroblastoma models in mice and more recently, zebrafish. Thus far the MYCN and ALK transgenic animals have been used most commonly. However, since neuroblastoma is very heterogeneous and many gene mutations are only detected in 1-2% of tumours, modelling the disease in vivo still will require the use of human cells in murine hosts. We have mainly used subcutaneous xenografts, which allow the use of multiple genetically divergent cell lines, but do not permit assessment of metastatic burden or response to treatment. Other models including orthotopic neuroblastoma have a low incidence of metastases and plans to develop other metastatic models that more faithfully recapitulate the human disease are ongoing.

5.4 Conclusions

The evolving understanding of neuroblastoma tumour biology has provided a number of valuable insights that have improved risk stratification and more targeted treatments.

Nevertheless, there are still significant subsets of this population with aggressive tumours and

135

poor outcome reflecting the heterogeneous nature of this complex disease. Clearly further investigation is required to fully understand the genetics and molecular pathogenesis of neuroblastoma to lead to improvements in treatments. Studies of aberrantly activated pathways in neuroblastoma have already led to several promising clinical trials including mTOR and ALK inhibitors. Significant efforts in other cancers have led to agents that target the p53 pathway and our studies may provide further insight into which of these agents might benefit patients with defects in p53/p53 family signalling. Studying the off-target anti-cancer effects of pharamacological agents already in use allows investigators to make use of established safety and side-effect profiles. In so doing these compounds may be more likely to come into clinical use in a shorter time frame and for a reduced cost.

Investigation of the mechanism of action of novel drugs and molecular mechanisms may yield new insights into the tumour biology of neuroblastoma and other malignancies. Thus, it is our hope that the insights provided by our experiments in neuroblastoma with the p53 family and following the treatment with RIDK34 and propranolol may ultimately lead to the development of novel therapies for the treatment of relapsed neuroblastoma.

136

References 1. Maris JM. Recent advances in neuroblastoma. N Engl J Med 2010;362(23):2202-11. 2. D'Angio GJ, Evans AE, Koop CE. Special pattern of widespread neuroblastoma with a favourable prognosis. Lancet 1971;1(7708):1046-9. 3. London WB, London WB, Castleberry RP, et al. Evidence for an age cutoff greater than 365 days for neuroblastoma risk group stratification in the children's oncology group. Journal of Clinical Oncology 2005;23(27):6459-65. 4. Horner MJ, Ries L, Krapcho M, et al. SEER cancer statistics review, 1975-2006, National Cancer Institute.Bethesda, MD 2009. 5. Brodeur GM, Seeger RC, Barrett A, et al. International criteria for diagnosis, staging, and response to treatment in patients with neuroblastoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 1988;6(12):1874-81. 6. Cohn SL, Pearson ADJ, London WB, et al. The international neuroblastoma risk group (INRG) classification system: An INRG task force report. Journal of Clinical Oncology 2009;27(2):289- 97. 7. Strother DR, London WB, Schmidt ML, et al. Outcome after surgery alone or with restricted use of chemotherapy for patients with low-risk neuroblastoma: Results of children's oncology group study P9641. Journal of Clinical Oncology 2012;30(15):1842-8. 8. Baker DL, Schmidt ML, Cohn SL, et al. Outcome after reduced chemotherapy for intermediate- risk neuroblastoma. N Engl J Med 2010;363(14):1313-2. 9. Garaventa A, Parodi S, de Bernardi B, et al. Outcome of children with neuroblastoma after progression or relapse. A retrospective study of the italian neuroblastoma registry. Eur J Cancer 2009;45(16):2835-42. 10. Matthay KK, Reynolds CP, Seeger RC, et al. Long-term results for children with high-risk neuroblastoma treated on a randomized trial of myeloablative therapy followed by 13-cis-retinoic acid: A children's oncology group study. Journal of Clinical Oncology 2009;27(7):1007-13. 11. Matthay KK, Villablanca JG, Seeger RC, et al. Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis- retinoic acid. children's cancer group. N Engl J Med 1999;341(16):1165-73. 12. Seeger RC, Reynolds CP, Gallego R, Stram DO, Gerbing RB, Matthay KK. Quantitative tumor cell content of bone marrow and blood as a predictor of outcome in stage IV neuroblastoma: A children's cancer group study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2000;18(24):4067-76. 13. Kohler JA, Imeson J, Ellershaw C, Lie SO. A randomised trial of 13 cis retinoic acid in children with advanced neuroblastoma after high dose therapy. Br J Cancer 2000;83(9):1124-7. 14. Sidell N. Retinoic acid-induced growth inhibition and morphologic differentiation of human neuroblastoma cells in vitro. J Natl Cancer Inst 1982;68(4):589-96. 15. Thiele CJ, Reynolds CP, Israel MA. Decreased expression of N-myc precedes retinoic acid- induced morphological differentiation of human neuroblastoma. Nature 1985;313(6001):404-6. 16. Maurer BJ, Metelitsa LS, Seeger RC, Cabot MC, Reynolds CP. Increase of ceramide and induction of mixed apoptosis/necrosis by N-(4-hydroxyphenyl)- retinamide in neuroblastoma cell lines. J Natl Cancer Inst 1999;91(13):1138-46. 17. Garaventa A, Luksch R, Lo Piccolo MS, et al. Phase I trial and pharmacokinetics of fenretinide in children with neuroblastoma. Clinical cancer research : an official journal of the American Association for Cancer Research 2003;9(6):2032-9.

137

18. Gilman AL, Ozkaynak MF, Matthay KK, et al. Phase I study of ch14.18 with granulocyte- macrophage colony-stimulating factor and interleukin-2 in children with neuroblastoma after autologous bone marrow transplantation or stem-cell rescue: A report from the children's oncology group. Journal of Clinical Oncology 2008;27(1):85-91. 19. Yu AL, Gilman AL, Ozkaynak MF, et al. Anti-GD2 antibody with GM-CSF, interleukin-2, and isotretinoin for neuroblastoma. N Engl J Med 2010;363(14):1324-3. 20. Barker E, Mueller BM, Handgretinger R, Herter M, Yu AL, Reisfeld RA. Effect of a chimeric anti-ganglioside GD2 antibody on cell-mediated lysis of human neuroblastoma cells. Cancer Res 1991;51(1):144-9. 21. Johnsen JI, Segerstr\om L, Orrego A, et al. Inhibitors of mammalian target of rapamycin downregulate MYCN protein expression and inhibit neuroblastoma growth in vitro and in vivo. Oncogene 2008;27(20):2910-22. 22. Azarova AM, Gautam G, George RE. Emerging importance of ALK in neuroblastoma. Semin Cancer Biol 2011;21(4):267-75. 23. Sridhar S, Al-Moallem B, Kamal H, Terrile M, Stallings RL. New insights into the genetics of neuroblastoma : Implications for diagnosis and therapy. Molecular diagnosis & therapy 2013. 24. Owens C, Irwin M. Neuroblastoma: The impact of biology and cooperation leading to personalized treatments. Crit Rev Clin Lab Sci 2012;49(3):85-115. 25. Carpinelli P, Moll J. Aurora kinase inhibitors: Identification and preclinical validation of their biomarkers. Expert Opinion on Therapeutic Targets 2008;12(1):69-80. 26. Pugh TJ, Morozova O, Attiyeh EF, et al. The genetic landscape of high-risk neuroblastoma. Nat Genet 2013;45(3):279-84. 27. Molenaar JJ, Koster J, Zwijnenburg DA, et al. Sequencing of neuroblastoma identifies chromothripsis and defects in neuritogenesis genes. Nature 2012;483(7391):589-93. 28. Sausen M, Leary RJ, Jones S, et al. Integrated genomic analyses identify ARID1A and ARID1B alterations in the childhood cancer neuroblastoma. Nat Genet 2013;45(1):12-7. 29. Schwab M, Alitalo K, Klempnauer KH, et al. Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature 1983;305(5931):245-8. 30. Emanuel JR, Schulz J, Zhou XM, et al. Expression of an ouabain-resistant na,K-ATPase in CV-1 cells after transfection with a cDNA encoding the rat na,K-ATPase alpha 1 subunit. The Journal of biological chemistry 1988;263(16):7726-33. 31. Schwab M, Ellison J, Busch M, Rosenau W, Varmus HE, Bishop JM. Enhanced expression of the human gene N-myc consequent to amplification of DNA may contribute to malignant progression of neuroblastoma. Proc Natl Acad Sci U S A 1984;81(15):4940-4. 32. Pelengaris S, Khan M, Evan G. C-MYC: More than just a matter of life and death. Nature reviews.Cancer 2002;2(10):764-76. 33. Kohl NE, Kanda N, Schreck RR, et al. Transposition and amplification of oncogene-related sequences in human neuroblastomas. Cell 1983;35(2 Pt 1):359-67. 34. Seeger RC, Wada R, Brodeur GM, et al. Expression of N-myc by neuroblastomas with one or multiple copies of the oncogene. Prog Clin Biol Res 1988;271:41-9. 35. Kavallaris M, Gardaneh M, Cheung B, et al. In vitro effects of MYCN sense and antisense expression in MYCN-amplified human neuroblastoma cells. Anticancer Res 1998;18(3A):1793-7. 36. Seeger RC, Brodeur GM, Sather H, et al. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 1985;313(18):1111-6.

138

37. Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 1984;224(4653):1121-4. 38. Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J 1997;16(11):2985-9. 39. Teitz T, Inoue M, Valentine MB, et al. Th-MYCN mice with caspase-8 deficiency develop advanced neuroblastoma with bone marrow metastasis. Cancer Res 2013. 40. Lau LMS, Wolter JK, Lau JTML, et al. Cyclooxygenase inhibitors differentially modulate p73 isoforms in neuroblastoma. Oncogene 2009;28(19):2024-33. 41. Irwin MS, Kondo K, Marin MC, Cheng LS, Hahn WC, Kaelin WG. Chemosensitivity linked to p73 function. Cancer cell 2003;3(4):403-10. 42. Keshelava N, Zuo JJ, Chen P, et al. Loss of p53 function confers high-level multidrug resistance in neuroblastoma cell lines. Cancer Res 2001;61(16):6185-93. 43. Carr-Wilkinson J, O'Toole K, Wood KM, et al. High frequency of p53/MDM2/p14ARF pathway abnormalities in relapsed neuroblastoma. Clinical cancer research : an official journal of the American Association for Cancer Research 2010;16(4):1108-1. 44. Carr J, Bell E, Pearson ADJ, et al. Increased frequency of aberrations in the p53/MDM2/p14(ARF) pathway in neuroblastoma cell lines established at relapse. Cancer Res 2006;66(4):2138-45. 45. Casciano I, Mazzocco K, Boni L, et al. Expression of DeltaNp73 is a molecular marker for adverse outcome in neuroblastoma patients. Cell Death Differ 2002;9(3):246-51. 46. Attiyeh EF, London WB, Mosse YP, et al. Chromosome 1p and 11q deletions and outcome in neuroblastoma. N Engl J Med 2005;353(21):2243-5. 47. Ichimiya S, Nimura Y, Kageyama H, et al. Genetic analysis of p73 localized at chromosome 1p36.3 in primary neuroblastomas. Med Pediatr Oncol 2001;36(1):42-4. 48. White PS, Thompson PM, Gotoh T, et al. Definition and characterization of a region of 1p36.3 consistently deleted in neuroblastoma. Oncogene 2005;24(16):2684-9. 49. Lastowska M, Cotterill S, Pearson AD, et al. Gain of chromosome arm 17q predicts unfavourable outcome in neuroblastoma patients. U.K. children's cancer study group and the U.K. cancer cytogenetics group. Eur J Cancer 1997;33(10):1627-33. 50. Bown N, Cotterill S, Lastowska M, et al. Gain of chromosome arm 17q and adverse outcome in patients with neuroblastoma. N Engl J Med 1999;340(25):1954-61. 51. Morowitz M, Shusterman S, Mosse Y, et al. Detection of single-copy chromosome 17q gain in human neuroblastomas using real-time quantitative polymerase chain reaction. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 2003;16(12):1248-56. 52. Chen Y, Takita J, Choi YL, et al. Oncogenic mutations of ALK kinase in neuroblastoma. Nature 2008;455(7215):971-4. 53. George RE, Sanda T, Hanna M, et al. Activating mutations in ALK provide a therapeutic target in neuroblastoma. Nature 2008;455(7215):975-8. 54. Janoueix-Lerosey I, Lequin D, Brugi\`eres L, et al. Somatic and germline activating mutations of the ALK kinase receptor in neuroblastoma. Nature 2008;455(7215):967-70. 55. Mosse YP, Laudenslager M, Longo L, et al. Identification of ALK as a major familial neuroblastoma predisposition gene. Nature 2008;455(7215):930-5.

139

56. Degoutin J, Brunet-de Carvalho N, Cifuentes-Diaz C, Vigny M. ALK (anaplastic lymphoma kinase) expression in DRG neurons and its involvement in neuron-schwann cells interaction. Eur J Neurosci 2009;29(2):275-86. 57. Hurley SP, Clary DO, Copie V, Lefcort F. Anaplastic lymphoma kinase is dynamically expressed on subsets of motor neurons and in the peripheral nervous system. J Comp Neurol 2006;495(2):202-1. 58. Iwahara T, Fujimoto J, Wen D, et al. Molecular characterization of ALK, a receptor tyrosine kinase expressed specifically in the nervous system. Oncogene 1997;14(4):439-4. 59. Janoueix-Lerosey I, Penther D, Thioux M, et al. Molecular analysis of chromosome arm 17q gain in neuroblastoma. Genes, chromosomes {\&} cancer 2000;28(3):276-84. 60. Mosse YP, Lim MS, Voss SD, et al. Safety and activity of crizotinib for paediatric patients with refractory solid tumours or anaplastic large-cell lymphoma: A children's oncology group phase 1 consortium study. The lancet oncology 2013;14(6):472-80. 61. Bresler SC, Wood AC, Haglund EA, et al. Differential inhibitor sensitivity of anaplastic lymphoma kinase variants found in neuroblastoma. Science Translational Medicine 2011;3(108):108ra114. 62. Bentires-Alj M, Paez JG, David FS, et al. Activating mutations of the noonan syndrome- associated SHP2/PTPN11 gene in human solid tumors and adult acute myelogenous leukemia. Cancer Res 2004;64(24):8816-20. 63. Cheung NV, Zhang J, Lu C, et al. Association of age at diagnosis and genetic mutations in patients with neuroblastoma. JAMA : the journal of the American Medical Association 2012;307(10):1062-71. 64. Shang X, Burlingame SM, Okcu MF, et al. Aurora A is a negative prognostic factor and a new therapeutic target in human neuroblastoma. Molecular Cancer Therapeutics 2009;8(8):2461-9. 65. Flahaut M, Meier R, Coulon A, et al. The wnt receptor FZD1 mediates chemoresistance in neuroblastoma through activation of the wnt/b-catenin pathway. Oncogene 2009;28(23):2245-56. 66. Valsesia-Wittmann S, Magdeleine M, Dupasquier S, et al. Oncogenic cooperation between H- twist and N-myc overrides failsafe programs in cancer cells. Cancer cell 2004;6(6):625-30. 67. Stupack DG, Teitz T, Potter MD, et al. Potentiation of neuroblastoma metastasis by loss of caspase-8. Nature 2006;439(7072):95-9. 68. Capasso M, Devoto M, Hou C, et al. Common variations in BARD1 influence susceptibility to high-risk neuroblastoma. Nat Genet 2009;41(6):718-23. 69. Knudson AG, Strong LC. Mutation and cancer: Neuroblastoma and pheochromocytoma. Am J Hum Genet 1972;24(5):514-32. 70. Tonini GP, Longo L, Coco S, Perri P. Familial neuroblastoma: A complex heritable disease. Cancer Lett 2003;197(1-2):41-5. 71. Trochet D, Bourdeaut F, Janoueix-Lerosey I, et al. Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma. Am J Hum Genet 2004;74(4):761-4. 72. Birch JM, Alston RD, McNally RJ, et al. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001;20(34):4621-8. 73. Rossbach H, Baschinsky D, Wynn T, Obzut D, Sutcliffe M, Tebbi C. Composite adrenal anaplastic neuroblastoma and virilizing adrenocortical tumor with germline TP53 R248W mutation. Pediatric blood {\&} cancer 2008;50(3):681-3. 74. Porter DE, Holden ST, Steel CM, Cohen BB, Wallace MR, Reid R. A significant proportion of patients with osteosarcoma may belong to li-fraumeni cancer families. The Journal of bone and joint surgery.British volume 1992;74(6):883-6.

140

75. Maris JM, Mosse YP, Bradfield JP, et al. Chromosome 6p22 locus associated with clinically aggressive neuroblastoma. N Engl J Med 2008;358(24):2585-93. 76. Diskin SJ, Hou C, Glessner JT, et al. Copy number variation at 1q21.1 associated with neuroblastoma. Nature 2009;459(7249):987-91. 77. Nakagawara A, Arima-Nakagawara M, Scavarda NJ, Azar CG, Cantor AB, Brodeur GM. Association between high levels of expression of the TRK gene and favorable outcome in human neuroblastoma. N Engl J Med 1993;328(12):847-54. 78. Nakagawara A, Arima M, Azar CG, Scavarda NJ, Brodeur GM. Inverse relationship between trk expression and N-myc amplification in human neuroblastomas. Cancer Res 1992;52(5):1364- 8. 79. Light JE, Koyama H, Minturn JE, et al. Clinical significance of NTRK family gene expression in neuroblastomas. Pediatric blood {\&} cancer 2012;59(2):226-32. 80. Nakagawara A, Azar CG, Scavarda NJ, Brodeur GM. Expression and function of TRK-B and BDNF in human neuroblastomas. Mol Cell Biol 1994;14(1):759-67. 81. Ho R, Minturn JE, Hishiki T, et al. Proliferation of human neuroblastomas mediated by the epidermal growth factor receptor. Cancer Res 2005;65(21):9868-75. 82. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998;279(5349):349-52. 83. Hiyama E, Hiyama K, Yokoyama T, Matsuura Y, Piatyszek MA, Shay JW. Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med 1995;1(3):249-55. 84. Hiyama E, Hiyama K, Ohtsu K, et al. Telomerase activity in neuroblastoma: Is it a prognostic indicator of clinical behaviour? Eur J Cancer 1997;33(12):1932-6. 85. Poremba C, Scheel C, Hero B, et al. Telomerase activity and telomerase subunits gene expression patterns in neuroblastoma: A molecular and immunohistochemical study establishing prognostic tools for fresh-frozen and paraffin-embedded tissues. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2000;18(13):2582-9. 86. Ohali A, Avigad S, Ash S, et al. Telomere length is a prognostic factor in neuroblastoma. Cancer 2006;107(6):1391-9. 87. Kress M, May E, Cassingena R, May P. Simian virus 40-transformed cells express new species of proteins precipitable by anti-simian virus 40 tumor serum. J Virol 1979;31(2):472-83. 88. Melero JA, Stitt DT, Mangel WF, Carroll RB. Identification of new polypeptide species (48- 55K) immunoprecipitable by antiserum to purified large T antigen and present in SV40-infected and -transformed cells. Virology 1979;93(2):466-80. 89. Linzer DI, Levine AJ. Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 1979;17(1):43-52. 90. Lane DP, Crawford LV. T antigen is bound to a host protein in SV40-transformed cells. Nature 1979;278(5701):261-3. 91. Walker KK, Levine AJ. Identification of a novel p53 functional domain that is necessary for efficient growth suppression. Proc Natl Acad Sci U S A 1996;93(26):15335-40. 92. Harris N, Brill E, Shohat O, et al. Molecular basis for heterogeneity of the human p53 protein. Mol Cell Biol 1986;6(12):4650-6. 93. Buchman VL, Chumakov PM, Ninkina NN, Samarina OP, Georgiev GP. A variation in the structure of the protein-coding region of the human p53 gene. Gene 1988;70(2):245-52. 94. Matlashewski GJ, Tuck S, Pim D, Lamb P, Schneider J, Crawford LV. Primary structure polymorphism at amino acid residue 72 of human p53. Mol Cell Biol 1987;7(2):961-3.

141

95. Dumont P, Leu JI, Della Pietra AC, George DL, Murphy M. The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 2003;33(3):357-65. 96. Thomas M, Kalita A, Labrecque S, Pim D, Banks L, Matlashewski G. Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol 1999;19(2):1092- 100. 97. Storey A, Thomas M, Kalita A, et al. Role of a p53 polymorphism in the development of human papillomavirus-associated cancer. Nature 1998;393(6682):229-34. 98. Marin MC, Jost CA, Brooks LA, et al. A common polymorphism acts as an intragenic modifier of mutant p53 behaviour. Nat Genet 2000;25(1):47-54. 99. Beckerman R, Prives C. Transcriptional regulation by p53. Cold Spring Harbor perspectives in biology 2010;2(8):a000935. 100. Bourdon J, Fernandes K, Murray-Zmijewski F, et al. p53 isoforms can regulate p53 transcriptional activity. Genes {\&} development 2005;19(18):2122-37. 101. Khoury MP, Bourdon J. p53 isoforms: An intracellular microprocessor? Genes & cancer 2011;2(4):453-65. 102. Ghosh A, Stewart D, Matlashewski G. Regulation of human p53 activity and cell localization by alternative splicing. Mol Cell Biol 2004;24(18):7987-9. 103. Song W, Huo S, L\u Jia-ju, et al. Expression of p53 isoforms in renal cell carcinoma. Chin Med J 2009;122(8):921-6. 104. Flaman JM, Waridel F, Estreicher A, et al. The human tumour suppressor gene p53 is alternatively spliced in normal cells. Oncogene 1996;12(4):813-8. 105. Rohaly G, Chemnitz J, Dehde S, et al. A novel human p53 isoform is an essential element of the ATR-intra-S phase checkpoint. Cell 2005;122(1):21-32. 106. Banin S, Moyal L, Shieh S, et al. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science 1998;281(5383):1674-7. 107. Shieh SY, Ahn J, Tamai K, Taya Y, Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes {\&} development 2000;14(3):289-300. 108. Hirao A, Kong YY, Matsuoka S, et al. DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science 2000;287(5459):1824-7. 109. Leng RP, Lin Y, Ma W, et al. Pirh2, a p53-induced ubiquitin-protein ligase, promotes p53 degradation. Cell 2003;112(6):779-91. 110. Dornan D, Wertz I, Shimizu H, et al. The ubiquitin ligase COP1 is a critical negative regulator of p53. Nature 2004;429(6987):86-92. 111. Chen D, Kon N, Li M, Zhang W, Qin J, Gu W. ARF-BP1/mule is a critical mediator of the ARF tumor suppressor. Cell 2005;121(7):1071-83. 112. Momand J, Zambetti GP, Olson DC, George D, Levine AJ. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 1992;69(7):1237-45. 113. Geyer RK, Yu ZK, Maki CG. The MDM2 RING-finger domain is required to promote p53 nuclear export. Nat Cell Biol 2000;2(9):569-73. 114. Li M, Brooks CL, Wu-Baer F, Chen D, Baer R, Gu W. Mono- versus polyubiquitination: Differential control of p53 fate by Mdm2. Science 2003;302(5652):1972-5. 115. Barak Y, Juven T, Haffner R, Oren M. Mdm2 expression is induced by wild type p53 activity. EMBO J 1993;12(2):461-8.

142

116. Bond GL, Hu W, Bond EE, et al. A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell 2004;119(5):591-602. 117. Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein B. Amplification of a gene encoding a p53-associated protein in human sarcomas. Nature 1992;358(6381):80-3. 118. Watanabe T, Hotta T, Ichikawa A, et al. The MDM2 oncogene overexpression in chronic lymphocytic leukemia and low-grade lymphoma of B-cell origin. Blood 1994;84(9):3158-65. 119. Lau L, Hansford LM, Cheng LS, et al. Cyclooxygenase inhibitors modulate the p53/HDM2 pathway and enhance chemotherapy-induced apoptosis in neuroblastoma. Oncogene 2007;26(13):1920-31. 120. Tovar C, Rosinski J, Filipovic Z, et al. Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy. Proc Natl Acad Sci U S A 2006;103(6):1888-93. 121. Watson IR, Li BK, Roche O, Blanch A, Ohh M, Irwin MS. Chemotherapy induces NEDP1- mediated destabilization of MDM2. Oncogene 2010;29(2):297-304. 122. Perfumo C, Parodi S, Mazzocco K, et al. Impact of MDM2 SNP309 genotype on progression and survival of stage 4 neuroblastoma. Eur J Cancer 2008;44(17):2634-9. 123. Perfumo C, Parodi S, Mazzocco K, et al. MDM2 SNP309 genotype influences survival of metastatic but not of localized neuroblastoma. Pediatric blood {\&} cancer 2009;53(4):576-83. 124. Cattelani S, Defferrari R, Marsilio S, et al. Impact of a single nucleotide polymorphism in the MDM2 gene on neuroblastoma development and aggressiveness: Results of a pilot study on 239 patients. Clinical cancer research : an official journal of the American Association for Cancer Research 2008;14(11):3248-53. 125. Prives C, Hall PA. The p53 pathway. J Pathol 1999;187(1):112-26. 126. Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature 2000;408(6810):307-10. 127. Pavletich NP, Chambers KA, Pabo CO. The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots. Genes {\&} development 1993;7(12B):2556- 64. 128. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B. Definition of a consensus binding site for p53. Nat Genet 1992;1(1):45-9. 129. McLure KG, Lee PW. How p53 binds DNA as a tetramer. EMBO J 1998;17(12):3342-50. 130. Kitayner M, Rozenberg H, Kessler N, et al. Structural basis of DNA recognition by p53 tetramers. Mol Cell 2006;22(6):741-53. 131. Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor- DNA complex: Understanding tumorigenic mutations. Science 1994;265(5170):346-55. 132. Flores-Rozas H, Kelman Z, Dean FB, et al. Cdk-interacting protein 1 directly binds with proliferating cell nuclear antigen and inhibits DNA replication catalyzed by the DNA polymerase delta holoenzyme. Proc Natl Acad Sci U S A 1994;91(18):8655-9. 133. Riley T, Sontag E, Chen P, Levine A. Transcriptional control of human p53-regulated genes. Nature reviews.Molecular cell biology 2008;9(5):402-1. 134. Zhou BB, Elledge SJ. The DNA damage response: Putting checkpoints in perspective. Nature 2000;408(6811):433-9. 135. Rich T, Allen RL, Wyllie AH. Defying death after DNA damage. Nature 2000;407(6805):777-83. 136. Wei MC, Zong WX, Cheng EH, et al. Proapoptotic BAX and BAK: A requisite gateway to mitochondrial dysfunction and death. Science 2001;292(5517):727-30.

143

137. Shibue T, Takeda K, Oda E, et al. Integral role of noxa in p53-mediated apoptotic response. Genes {\&} development 2003;17(18):2233-8. 138. Li P, Nijhawan D, Budihardjo I, et al. Cytochrome c and dATP-dependent formation of apaf- 1/caspase-9 complex initiates an apoptotic protease cascade. Cell 1997;91(4):479-8. 139. Marchenko ND, Zaika A, Moll UM. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. The Journal of biological chemistry 2000;275(21):16202-1. 140. Wu GS, Burns TF, McDonald ER, et al. KILLER/DR5 is a DNA damage-inducible p53- regulated death receptor gene. Nat Genet 1997;17(2):141-3. 141. Owen-Schaub LB, Angelo LS, Radinsky R, Ware CF, Gesner TG, Bartos DP. Soluble fas/APO-1 in tumor cells: A potential regulator of apoptosis? Cancer Lett 1995;94(1):1-8. 142. M\uller M, Wilder S, Bannasch D, et al. p53 activates the CD95 (APO-1/fas) gene in response to DNA damage by anticancer drugs. J Exp Med 1998;188(11):2033-45. 143. Lin Y, Ma W, Benchimol S. Pidd, a new death-domain-containing protein, is induced by p53 and promotes apoptosis. Nat Genet 2000;26(1):122-7. 144. Attardi LD, Reczek EE, Cosmas C, et al. PERP, an apoptosis-associated target of p53, is a novel member of the PMP-22/gas3 family. Genes & development 2000;14(6):704-18. 145. Ben-Porath I, Weinberg RA. The signals and pathways activating cellular senescence. The international journal of biochemistry & cell biology 2005;37(5):961-76. 146. Kortlever RM, Higgins PJ, Bernards R. Plasminogen activator inhibitor-1 is a critical downstream target of p53 in the induction of replicative senescence. Nat Cell Biol 2006;8(8):877- 84. 147. Maiuri MC, Malik SA, Morselli E, et al. Stimulation of autophagy by the p53 target gene Sestrin2. Cell cycle (Georgetown, Tex.) 2009;8(10):1571-6. 148. Crighton D, Wilkinson S, O'Prey J, et al. DRAM, a p53-induced modulator of autophagy, is critical for apoptosis. Cell 2006;126(1):121-34. 149. Feng Z, Zhang H, Levine AJ, Jin S. The coordinate regulation of the p53 and mTOR pathways in cells. Proc Natl Acad Sci U S A 2005;102(23):8204-9. 150. Yang A, Walker N, Bronson R, et al. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature 2000;404(6773):99-103. 151. Yang A, Schweitzer R, Sun D, et al. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 1999;398(6729):714-8. 152. Pozniak CD, Radinovic S, Yang A, McKeon F, Kaplan DR, Miller FD. An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 2000;289(5477):304-6. 153. Pozniak CD, Barnab\'e-Heider F, Rymar VV, Lee AF, Sadikot AF, Miller FD. p73 is required for survival and maintenance of CNS neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 2002;22(22):9800-9. 154. Kaghad M, Bonnet H, Yang A, et al. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 1997;90(4):809-1. 155. Yang A, Kaghad M, Wang Y, et al. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 1998;2(3):305-16. 156. Schmale H, Bamberger C. A novel protein with strong homology to the tumor suppressor p53. Oncogene 1997;15(11):1363-7.

144

157. Trink B, Okami K, Wu L, Sriuranpong V, Jen J, Sidransky D. A new human p53 homologue. Nat Med 1998;4(7):747-8. 158. Tan M, Bian J, Guan K, Sun Y. p53CP is p51/p63, the third member of the p53 gene family: Partial purification and characterization. Carcinogenesis 2001;22(2):295-300. 159. Zeng X, Zhu Y, Lu H. NBP is the p53 homolog p63. Carcinogenesis 2001;22(2):215-9. 160. Osada M, Ohba M, Kawahara C, et al. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat Med 1998;4(7):839-43. 161. Stiewe T, Tuve S, Peter M, Tannapfel A, Elmaagacli AH, P\utzer BM. Quantitative TP73 transcript analysis in hepatocellular carcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research 2004;10(2):626-33. 162. De Laurenzi V, Costanzo A, Barcaroli D, et al. Two new p73 splice variants, gamma and delta, with different transcriptional activity. J Exp Med 1998;188(9):1763-8. 163. Grespi F, Amelio I, Tucci P, Annicchiarico-Petruzzelli M, Melino G. Tissue-specific expression of p73 C-terminal isoforms in mice. Cell cycle (Georgetown, Tex.) 2012;11(23):4474- 83. 164. Chi SW, Ayed A, Arrowsmith CH. Solution structure of a conserved C-terminal domain of p73 with structural homology to the SAM domain. EMBO J 1999;18(16):4438-45. 165. Oberst A, Rossi M, Salomoni P, et al. Regulation of the p73 protein stability and degradation. Biochem Biophys Res Commun 2005;331(3):707-12. 166. Zeng X, Chen L, Jost CA, et al. MDM2 suppresses p73 function without promoting p73 degradation. Mol Cell Biol 1999;19(5):3257-66. 167. Ongkeko WM, Wang XQ, Siu WY, et al. MDM2 and MDMX bind and stabilize the p53- related protein p73. Current biology : CB 1999;9(15):829-32. 168. Mantovani F, Piazza S, Gostissa M, et al. Pin1 links the activities of c-abl and p300 in regulating p73 function. Mol Cell 2004;14(5):625-36. 169. Rossi M, De Laurenzi V, Munarriz E, et al. The ubiquitin-protein ligase itch regulates p73 stability. EMBO J 2005;24(4):836-48. 170. Rossi M, Aqeilan RI, Neale M, et al. The E3 ubiquitin ligase itch controls the protein stability of p63. Proc Natl Acad Sci U S A 2006;103(34):12753-8. 171. Agami R, Blandino G, Shaul MOY. Interaction of c-abl and p73a and their collaboration to induce apoptosis. Nature 1999;399(24):809-13. 172. Yuan ZM, Shioya H, Ishiko T, et al. p73 is regulated by tyrosine kinase c-abl in the apoptotic response to DNA damage. Nature 1999;399(6738):814-7. 173. Irwin M, Marin MC, Phillips AC, et al. Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature 2000;407(6804):645-8. 174. Gonzalez S, Prives C, Cordon-Cardo C. p73alpha regulation by Chk1 in response to DNA damage. Mol Cell Biol 2003;23(22):8161-7. 175. Urist M, Tanaka T, Poyurovsky MV, Prives C. p73 induction after DNA damage is regulated by checkpoint kinases Chk1 and Chk2. Genes & development 2004;18(24):3041-54. 176. Basu S, Totty NF, Irwin MS, Sudol M, Downward J. Akt phosphorylates the yes-associated protein, YAP, to induce interaction with 14-3-3 and attenuation of p73-mediated apoptosis. Mol Cell 2003;11(1):11-23. 177. Li Y, Zhou Z, Chen C. WW domain-containing E3 ubiquitin protein ligase 1 targets p63 transcription factor for ubiquitin-mediated proteasomal degradation and regulates apoptosis. Cell Death Differ 2008;15(12):1941-5.

145

178. Li Y, Peart MJ, Prives C. Stxbp4 regulates DeltaNp63 stability by suppression of RACK1- dependent degradation. Mol Cell Biol 2009;29(14):3953-6. 179. Marin MC, Jost CA, Irwin MS, DeCaprio JA, Caput D, Kaelin WG. Viral oncoproteins discriminate between p53 and the p53 homolog p73. Mol Cell Biol 1998;18(11):6316-24. 180. Jost CA, Marin MC, Kaelin WG. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature 1997;389(6647):191-4. 181. Lee CW, La Thangue NB. Promoter specificity and stability control of the p53-related protein p73. Oncogene 1999;18(29):4171-8. 182. Zhu J, Jiang J, Zhou W, Chen X. The potential tumor suppressor p73 differentially regulates cellular p53 target genes. Cancer Res 1998;58(22):5061-5. 183. Ihrie RA, Marques MR, Nguyen BT, et al. Perp is a p63-regulated gene essential for epithelial integrity. Cell 2005;120(6):843-56. 184. Blint E, Phillips AC, Kozlov S, Stewart CL, Vousden KH. Induction of p57(KIP2) expression by p73beta. Proc Natl Acad Sci U S A 2002;99(6):3529-34. 185. Osada M, Park HL, Nagakawa Y, et al. Differential recognition of response elements determines target gene specificity for p53 and p63. Mol Cell Biol 2005;25(14):6077-89. 186. Yang A, Zhu Z, Kapranov P, et al. Relationships between p63 binding, DNA sequence, transcription activity, and biological function in human cells. Mol Cell 2006;24(4):593-602. 187. Moll UM, Slade N. p63 and p73: Roles in development and tumor formation. Molecular cancer research : MCR 2004;2(7):371-86. 188. Melino G, De Laurenzi V, Vousden KH. p73: Friend or foe in tumorigenesis. Nature reviews.Cancer 2002;2(8):605-1. 189. Nakagawa T, Takahashi M, Ozaki T, et al. Autoinhibitory regulation of p73 by delta Np73 to modulate cell survival and death through a p73-specific target element within the delta Np73 promoter. Mol Cell Biol 2002;22(8):2575-8. 190. Slade N, Zaika AI, Erster S, Moll UM. DeltaNp73 stabilises TAp73 proteins but compromises their function due to inhibitory hetero-oligomer formation. Cell Death Differ 2004;11(3):357-60. 191. Stiewe T, Theseling CC, P\utzer BM. Transactivation-deficient delta TA-p73 inhibits p53 by direct competition for DNA binding: Implications for tumorigenesis. The Journal of biological chemistry 2002;277(16):14177-85. 192. Liu G, Nozell S, Xiao H, Chen X. DeltaNp73beta is active in transactivation and growth suppression. Mol Cell Biol 2004;24(2):487-501. 193. Helton ES, Zhu J, Chen X. The unique NH2-terminally deleted (DeltaN) residues, the PXXP motif, and the PPXY motif are required for the transcriptional activity of the DeltaN variant of p63. The Journal of biological chemistry 2006;281(5):2533-42. 194. Levine AJ. p53, the cellular gatekeeper for growth and division. Cell 1997;88(3):323-31. 195. Olivier M, Eeles R, Hollstein M, Khan MA, Harris CC, Hainaut P. The IARC TP53 database: New online mutation analysis and recommendations to users. Hum Mutat 2002;19(6):607-14. 196. Laptenko O, Prives C. Transcriptional regulation by p53: One protein, many possibilities. Cell Death Differ 2006;13(6):951-6. 197. Wong KB, DeDecker BS, Freund SM, Proctor MR, Bycroft M, Fersht AR. Hot-spot mutants of p53 core domain evince characteristic local structural changes. Proc Natl Acad Sci U S A 1999;96(15):8438-42.

146

198. Milner J. A conformation hypothesis for the suppressor and promoter functions of p53 in cell growth control and in cancer. Proceedings.Biological sciences / The Royal Society 1991;245(1313):139-45. 199. Bartek J, Iggo R, Gannon J, Lane DP. Genetic and immunochemical analysis of mutant p53 in human breast cancer cell lines. Oncogene 1990;5(6):893-9. 200. Peng Y, Chen L, Li C, Lu W, Agrawal S, Chen J. Stabilization of the MDM2 oncoprotein by mutant p53. The Journal of biological chemistry 2001;276(9):6874-8. 201. Blandino G, Levine AJ, Oren M. Mutant p53 gain of function: Differential effects of different p53 mutants on resistance of cultured cells to chemotherapy. Oncogene 1999;18(2):477- 85. 202. Liu DP, Song H, Xu Y. A common gain of function of p53 cancer mutants in inducing genetic instability. Oncogene 2010;29(7):949-56. 203. Aas T, Børresen A, Geisler S, et al. Specific P53 mutations are associated with de novo resistance to doxorubicin in breast cancer patients. Nat Med 1996;2(7):811-4. 204. Di Como CJ, Gaiddon C, Prives C. p73 function is inhibited by tumor-derived p53 mutants in mammalian cells. Mol Cell Biol 1999;19(2):1438-49. 205. Strano S, Fontemaggi G, Costanzo A, et al. Physical interaction with human tumor-derived p53 mutants inhibits p63 activities. The Journal of biological chemistry 2002;277(21):18817-26. 206. Mietz JA, Unger T, Huibregtse JM, Howley PM. The transcriptional transactivation function of wild-type p53 is inhibited by SV40 large T-antigen and by HPV-16 E6 oncoprotein. EMBO J 1992;11(13):5013-20. 207. Leach FS, Tokino T, Meltzer P, et al. p53 mutation and MDM2 amplification in human soft tissue sarcomas. Cancer Res 1993;53(10 Suppl):2231-4. 208. Olive KP, Tuveson DA, Ruhe ZC, et al. Mutant p53 gain of function in two mouse models of li-fraumeni syndrome. Cell 2004;119(6):847-60. 209. Lang GA, Iwakuma T, Suh Y, et al. Gain of function of a p53 hot spot mutation in a mouse model of li-fraumeni syndrome. Cell 2004;119(6):861-72. 210. Li FP, Fraumeni JF. Soft-tissue sarcomas, breast cancer, and other neoplasms. A familial syndrome? Ann Intern Med 1969;71(4):747-52. 211. Malkin D, Li FP, Strong LC, et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250(4985):1233-8. 212. Li FP, Fraumeni JF, Mulvihill JJ, et al. A cancer family syndrome in twenty-four kindreds. Cancer Res 1988;48(18):5358-62. 213. Flores ER, Sengupta S, Miller JB, et al. Tumor predisposition in mice mutant for p63 and p73: Evidence for broader tumor suppressor functions for the p53 family. Cancer cell 2005;7(4):363-7. 214. Tomasini R, Tsuchihara K, Wilhelm M, et al. TAp73 knockout shows genomic instability with infertility and tumor suppressor functions. Genes {\&} development 2008;22(19):2677-91. 215. Suh E, Yang A, Kettenbach A, et al. p63 protects the female germ line during meiotic arrest. Nature 2006;444(7119):624-8. 216. Nakagawa T, Takahashi M, Ozaki T, et al. Negative autoregulation of p73 and p53 by \DeltaNp73 in regulating differentiation and survival of human neuroblastoma cells. Cancer Lett 2003;197(1-2):105-9. 217. Zitterbart K, Zavrelova I, Kadlecova J, et al. p73 expression in medulloblastoma: TAp73/DeltaNp73 transcript detection and possible association of p73alpha/DeltaNp73 immunoreactivity with survival. Acta Neuropathol 2007;114(6):641-50.

147

218. Cam H, Griesmann H, Beitzinger M, et al. p53 family members in myogenic differentiation and rhabdomyosarcoma development. Cancer cell 2006;10(4):281-93. 219. Concin N, Becker K, Slade N, et al. Transdominant DeltaTAp73 isoforms are frequently upregulated in ovarian cancer. evidence for their role as epigenetic p53 inhibitors in vivo. Cancer Res 2004;64(7):2449-60. 220. Deyoung MP, Ellisen LW. p63 and p73 in human cancer: Defining the network. Oncogene 2007;26(36):5169-83. 221. Rocco JW, Leong C, Kuperwasser N, DeYoung MP, Ellisen LW. p63 mediates survival in squamous cell carcinoma by suppression of p73-dependent apoptosis. Cancer cell 2006;9(1):45- 56. 222. Chung J, Lau J, Cheng LS, et al. SATB2 augments delta-Np63-alpha in head and neck squamous cell carcinoma. EMBO Rep 2010;11(10):777-83. 223. Flores ER, Tsai KY, Crowley D, et al. p63 and p73 are required for p53-dependent apoptosis in response to DNA damage. Nature 2002;416(6880):560-4. 224. Costanzo A, Merlo P, Pediconi N, et al. DNA damage-dependent acetylation of p73 dictates the selective activation of apoptotic target genes. Mol Cell 2002;9(1):175-86. 225. Wolter NE, Wolter JK, Enepekides DJ, Irwin MS. Propranolol as a novel adjunctive treatment for head and neck squamous cell carcinoma. Journal of otolaryngology - head & neck surgery 2012;41(5):334-4. 226. Mills AA, Zheng B, Wang XJ, Vogel H, Roop DR, Bradley A. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 1999;398(6729):708-13. 227. van Bokhoven H, McKeon F. Mutations in the p53 homolog p63: Allele-specific developmental syndromes in humans. Trends Mol Med 2002;8(3):133-9. 228. Dugani CB, Paquin A, Fujitani M, Kaplan DR, Miller FD. p63 antagonizes p53 to promote the survival of embryonic neural precursor cells. The Journal of neuroscience : the official journal of the Society for Neuroscience 2009;29(20):6710-21. 229. Fujitani M, Cancino GI, Dugani CB, et al. TAp73 acts via the bHLH Hey2 to promote long- term maintenance of neural precursors. Current biology : CB 2010;20(22):2058-65. 230. Wetzel MK, Naska S, Lalibert\'e Christine L, et al. p73 regulates neurodegeneration and phospho-tau accumulation during aging and alzheimer's disease. Neuron 2008;59(5):708-21. 231. Tomasini R, Secq V, Pouyet L, et al. TAp73 is required for macrophage-mediated innate immunity and the resolution of inflammatory responses. Cell Death Differ 2013;20(2):293-301. 232. Bylund DB, Eikenberg DC, Hieble JP, et al. International union of pharmacology nomenclature of adrenoceptors. Pharmacol Rev 1994;46(2):121-36. 233. McDevitt DG. In vivo studies on the function of cardiac beta-adrenoceptors in man. Eur Heart J 1989;10 Suppl B:22-8. 234. Brodde OE, Michel MC. Adrenergic and muscarinic receptors in the human heart. Pharmacol Rev 1999;51(4):651-90. 235. Osthoff M, Jenkins C, Leuppi JD. Chronic obstructive pulmonary disease - a treatable disease. Swiss medical weekly 2013;143:0. 236. Ortiz-Alvarez O, Mikrogianakis A, Canadian Paediatric Society,Acute Care Committee. Managing the paediatric patient with an acute asthma exacerbation. Paediatrics {\&} child health 2012;17(5):251-62. 237. Cheng A. Emergency treatment of anaphylaxis in infants and children. Paediatrics {\&} child health 2011;16(1):35-40. 238. Degoute C. Controlled hypotension: A guide to drug choice. Drugs 2007;67(7):1053-76.

148

239. L'eaute-Labreze C, Dumas de la Roque E, Hubiche T, Boralevi F, Thambo J, Ta\\ieb A. Propranolol for severe hemangiomas of infancy. N Engl J Med 2008;358(24):2649-51. 240. Drolet BA, Esterly NB, Frieden IJ. Hemangiomas in children. N Engl J Med 1999;341(3):173-81. 241. Cushing SL, Boucek RJ, Manning SC, Sidbury R, Perkins JA. Initial experience with a multidisciplinary strategy for initiation of propranolol therapy for infantile hemangiomas. Otolaryngology -- Head and Neck Surgery 2010;144(1):78-84. 242. Heintzen MP, Strauer BE. Peripheral vascular effects of beta-blockers. Eur Heart J 1994;15 Suppl C:2-7. 243. Berard M, Sordello S, Ortega N, et al. Vascular endothelial growth factor confers a growth advantage in vitro and in vivo to stromal cells cultured from neonatal hemangiomas. The American Journal of Pathology 1997;150(4):1315-26. 244. Przewratil P, Sitkiewicz A, Wyka K, Andrzejewska E. Serum levels of vascular endothelial growth factor and basic fibroblastic growth factor in children with hemangiomas and vascular malformations--preliminary report. Pediatr Dermatol 2009;26(4):399-404. 245. Chim H, Armijo BS, Miller E, Gliniak C, Serret MA, Gosain AK. Propranolol induces regression of hemangioma cells through HIF-1\alpha-mediated inhibition of VEGF-A. Ann Surg 2012;256(1):146-5. 246. Christensen GL, Aplin M, Hansen JL. Therapeutic potential of functional selectivity in the treatment of heart failure. Trends Cardiovasc Med 2010;20(7):221-7. 247. Ji Y, Li K, Xiao X, Zheng S, Xu T, Chen S. Effects of propranolol on the proliferation and apoptosis of hemangioma-derived endothelial cells. J Pediatr Surg 2012;47(12):2216-23. 248. Schuller HM, Cole B. Regulation of cell proliferation by beta-adrenergic receptors in a human lung adenocarcinoma cell line. Carcinogenesis 1989;10(9):1753-5. 249. Zhang L, Li K, Lv Z, Xiao X, Zheng J. The effect on cell growth by Wnt1 RNAi in human neuroblastoma SH-SY5Y cell line. Pediatr Surg Int 2009;25(12):1065-71. 250. Hajighasemi F, Mirshafiey A. In vitro sensitivity of leukemia cells to propranolol. Journal of clinical medicine research 2009;1(3):144-9. 251. Liao X, Che X, Zhao W, Zhang D, Bi T, Wang G. The β-adrenoceptor antagonist, propranolol, induces human gastric cancer cell apoptosis and cell cycle arrest via inhibiting nuclear factor κB signaling. Oncol Rep 2010;24(6):1669-76. 252. Zhang D, Ma Q, Shen S, Hu H. Inhibition of pancreatic cancer cell proliferation by propranolol occurs through apoptosis induction: The study of beta-adrenoceptor antagonist's anticancer effect in pancreatic cancer cell. Pancreas 2009;38(1):94-100. 253. Liao X, Che X, Zhao W, et al. Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro. Radiation oncology (London, England) 2010;5:98. 254. Fredriksson JM, Lindquist JM, Bronnikov GE, Nedergaard J. Norepinephrine induces vascular endothelial growth factor gene expression in brown adipocytes through a beta - adrenoreceptor/cAMP/protein kinase A pathway involving src but independently of Erk1/2. The Journal of biological chemistry 2000;275(18):13802-11. 255. Huang X, Wang H, Yuan Z, Huang J, Zheng Q. Norepinephrine stimulates pancreatic cancer cell proliferation, migration and invasion via Î²-adrenergic receptor-dependent activation of P38/MAPK pathway. Hepatogastroenterology 2012;59(115):889-93.

149

256. Yang EV, Sood AK, Chen M, et al. Norepinephrine up-regulates the expression of vascular endothelial growth factor, matrix metalloproteinase (MMP)-2, and MMP-9 in nasopharyngeal carcinoma tumor cells. Cancer Res 2006;66(21):10357-64. 257. Liu X, Wu WKK, Yu L, et al. Epinephrine stimulates esophageal squamous-cell carcinoma cell proliferation via beta-adrenoceptor-dependent transactivation of extracellular signal-regulated kinase/cyclooxygenase-2 pathway. J Cell Biochem 2008;105(1):53-60. 258. Zhang D, Ma Q, Hu H, Zhang M. Β-2-adrenergic antagonists suppress pancreatic cancer cell invasion by inhibiting CREB, NFκB and AP-1. Cancer biology {\&} therapy 2010;10(1):19-2. 259. Annabi B, Lachambre M, Plouffe K, Moumdjian R, B\'eliveau R. Propranolol adrenergic blockade inhibits human brain endothelial cells tubulogenesis and matrix metalloproteinase-9 secretion. Pharmacological research : the official journal of the Italian Pharmacological Society 2009;60(5):438-45. 260. Shyu K, Lu M, Chang H, Sun H, Wang B, Kuan P. Carvedilol modulates the expression of hypoxia-inducible factor-1alpha and vascular endothelial growth factor in a rat model of volume- overload heart failure. J Card Fail 2005;11(2):152-9. 261. Powe DG, Voss MJ, Habashy HO, et al. Alpha- and beta-adrenergic receptor (AR) protein expression is associated with poor clinical outcome in breast cancer: An immunohistochemical study. Breast Cancer Res Treat 2011;130(2):457-63. 262. Barron TI, Connolly RM, Sharp L, Bennett K, Visvanathan K. Beta blockers and breast cancer mortality: A population- based study. Journal of Clinical Oncology 2011;29(19):2635-44. 263. Benish M, Bartal I, Goldfarb Y, et al. Perioperative use of beta-blockers and COX-2 inhibitors may improve immune competence and reduce the risk of tumor metastasis. Annals of surgical oncology 2008;15(7):2042-5. 264. Bravo-Calderon DM, Oliveira DT, Marana AN, Nonogaki S, Carvalho AL, Kowalski LP. Prognostic significance of beta-2 adrenergic receptor in oral squamous cell carcinoma. Cancer biomarkers : section A of Disease markers 2011;10(1):51-9. 265. Pottier N, Paugh SW, Ding C, et al. Promoter polymorphisms in the β-2 adrenergic receptor are associated with drug-induced gene expression changes and response in acute lymphoblastic leukemia. Clin Pharmacol Ther 2010;88(6):854-61. 266. Prassas I, Diamandis EP. Novel therapeutic applications of cardiac glycosides. Nature Reviews Drug Discovery 2008;7(11):926-35. 267. Kaplan JH. Biochemistry of na,K-ATPase. Annu Rev Biochem 2002;71:511-35. 268. Geering K. Function of FXYD proteins, regulators of na, K-ATPase. J Bioenerg Biomembr 2005;37(6):387-92. 269. McDonough AA, Geering K, Farley RA. The sodium pump needs its beta subunit. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 1990;4(6):1598-605. 270. Chow DC, Forte JG. Functional significance of the beta-subunit for heterodimeric P-type ATPases. J Exp Biol 1995;198(Pt 1):1-17. 271. Blanco G, DeTomaso AW, Koster J, Xie ZJ, Mercer RW. The alpha-subunit of the na,K- ATPase has catalytic activity independent of the beta-subunit. The Journal of biological chemistry 1994;269(38):23420-5. 272. Bagrov AY, Shapiro JI, Fedorova OV. Endogenous cardiotonic steroids: Physiology, pharmacology, and novel therapeutic targets. Pharmacol Rev 2009;61(1):9-38.

150

273. Sverdlov ED, Akopyanz NS, Petrukhin KE, Broude NE, Monastyrskaya GS, Modyanov NN. Na+,K+-ATPase: Tissue-specific expression of genes coding for alpha-subunit in diverse human tissues. FEBS Lett 1988;239(1):65-8. 274. Sen AK, Post RL. Stoichiometry and localization ofAdenosine triphosphate-dependent sodium and potassium transport in the erythrocyte. The Journal of biological chemistry 1964;239:345-52. 275. Blanco G, Mercer RW. Isozymes of the na-K-ATPase: Heterogeneity in structure, diversity in function. Am J Physiol 1998;275(5 Pt 2):F633-50. 276. Barry WH, Hasin Y, Smith TW. Sodium pump inhibition, enhanced calcium influx via sodium-calcium exchange, and positive inotropic response in cultured heart cells. Circ Res 1985;56(2):231-4. 277. Zaloga GP, Malcolm D, Holaday J, Chernow B. Verapamil reverses calcium cardiotoxicity. Ann Emerg Med 1987;16(6):637-9. 278. Thacker D, Sharma J. Digoxin toxicity. Clin Pediatr 2007;46(3):276-9. 279. Stenkvist B, Bengtsson E, Eriksson O, Holmquist J, Nordin B, Westman-Naeser S. Cardiac glycosides and breast cancer. Lancet 1979;1(8115):563. 280. Lopez-Lazaro M, Pastor N, Azrak SS, Ayuso MJ, Austin CA, Cortes F. Digitoxin inhibits the growth of cancer cell lines at concentrations commonly found in cardiac patients. J Nat Prod 2005;68(11):1642-5. 281. McConkey DJ, Lin Y, Nutt LK, Ozel HZ, Newman RA. Cardiac glycosides stimulate Ca2+ increases and apoptosis in androgen-independent, metastatic human prostate adenocarcinoma cells. Cancer Res 2000;60(14):3807-12. 282. Svensson A, Azarbayjani F, Backman U, Matsumoto T, Christofferson R. Digoxin inhibits neuroblastoma tumor growth in mice. Anticancer Res 2005;25(1A):207-12. 283. Elbaz HA, Stueckle TA, Wang HL, et al. Digitoxin and a synthetic monosaccharide analog inhibit cell viability in lung cancer cells. Toxicol Appl Pharmacol 2012;258(1):51-60. 284. Kometiani P, Liu L, Askari A. Digitalis-induced signaling by na+/K+-ATPase in human breast cancer cells. Mol Pharmacol 2004;67(3):929-36. 285. Elbaz HA, Stueckle TA, Tse W, Rojanasakul Y, Dinu CZ. Digitoxin and its analogs as novel cancer therapeutics. Experimental hematology {\&} oncology 2012;1(1):4. 286. Manna SK, Sah NK, Newman RA, Cisneros A, Aggarwal BB. Oleandrin suppresses activation of nuclear transcription factor-kappaB, activator protein-1, and c-jun NH2-terminal kinase. Cancer Res 2000;60(14):3838-47. 287. Yang Q, Huang W, Jozwik C, et al. Cardiac glycosides inhibit TNF-alpha/NF-kappaB signaling by blocking recruitment of TNF receptor-associated death domain to the TNF receptor. Proc Natl Acad Sci U S A 2005;102(27):9631-6. 288. Bielawski K, Winnicka K, Bielawska A. Inhibition of DNA topoisomerases I and II, and growth inhibition of breast cancer MCF-7 cells by ouabain, digoxin and proscillaridin A. Biological & pharmaceutical bulletin 2006;29(7):1493-7. 289. Frese S. Cardiac glycosides initiate Apo2L/TRAIL-induced apoptosis in non-small cell lung cancer cells by up-regulation of death receptors 4 and 5. Cancer Res 2006;66(11):5867-74. 290. Simpson CD, Mawji IA, Anyiwe K, et al. Inhibition of the sodium potassium adenosine triphosphatase pump sensitizes cancer cells to anoikis and prevents distant tumor formation. Cancer Res 2009;69(7):2739-47. 291. Hiyoshi H, Abdelhady S, Segerström L, et al. Quiescence and gammaH2AX in neuroblastoma are regulated by ouabain/na,K-ATPase. Br J Cancer 2012;106(11):1807-15.

151

292. Shiratori O. Growth inhibitory effect of cardiac glycosides and aglycones on neoplastic cells: In vitro and in vivo studies. Gann 1967;58(6):521-8. 293. Shimizu K, Nakajyo S, Urakawa N. Species differences in the inhibitory effect of ouabain on high K-induced contraction in the ileal longitudinal muscle. Jpn J Pharmacol 1985;39(1):67-75. 294. Abeywardena MY, McMurchie EJ, Russell GR, Charnock JS. Species variation in the ouabain sensitivity of cardiac na+/K+-ATPase. A possible role for membrane lipids. Biochem Pharmacol 1984;33(22):3649-54. 295. Sakai H, Suzuki T, Maeda M, et al. Up-regulation of na(+),K(+)-ATPase alpha 3-isoform and down-regulation of the alpha1-isoform in human colorectal cancer. FEBS Lett 2004;563(1-3):151- 4. 296. Mijatovic T, Roland I, Van Quaquebeke E, et al. The alpha1 subunit of the sodium pump could represent a novel target to combat non-small cell lung cancers. J Pathol 2007;212(2):170-9. 297. Lee S, Baek M, Yang H, et al. Identification of genes differentially expressed between gastric cancers and normal gastric mucosa with cDNA microarrays. Cancer Lett 2002;184(2):197-206. 298. Wang HL, Xin W, Zhou M, Stueckle TA, Rojanasakul Y, O'Doherty GA. Stereochemical survey of digitoxin monosaccharides: New anticancer analogues with enhanced apoptotic activity and growth inhibitory effect on human non-small cell lung cancer cell. ACS medicinal chemistry letters 2011;2(1):73-8. 299. Tweddle DA, Malcolm AJ, Bown N, Pearson AD, Lunec J. Evidence for the development of p53 mutations after cytotoxic therapy in a neuroblastoma cell line. Cancer Res 2001;61(1):8-13. 300. Keshelava N, Zuo JJ, Waidyaratne NS, Triche TJ, Reynolds CP. p53 mutations and loss of p53 function confer multidrug resistance in neuroblastoma. Med Pediatr Oncol 2000;35(6):563-8. 301. Petitjean A, Mathe E, Kato S, et al. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: Lessons from recent developments in the IARC TP53 database. Hum Mutat 2007;28(6):622-9. 302. Malkin D, Jolly KW, Barbier N, et al. Germline mutations of the p53 tumor-suppressor gene in children and young adults with second malignant neoplasms. N Engl J Med 1992;326(20):1309- 15. 303. Hosoi G, Hara J, Okamura T, et al. Low frequency of the p53 gene mutations in neuroblastoma. Cancer 1994;73(12):3087-93. 304. Vogan K, Bernstein M, Leclerc JM, et al. Absence of p53 gene mutations in primary neuroblastomas. Cancer Res 1993;53(21):5269-73. 305. Keshelava N, Seeger RC, Groshen S, Reynolds CP. Drug resistance patterns of human neuroblastoma cell lines derived from patients at different phases of therapy. Cancer Res 1998;58(23):5396-405. 306. Brandt-Rauf PW, Monaco R, Pincus MR. Conformational effects of environmentally induced, cancer-related mutations in the p53 protein. Proc Natl Acad Sci U S A 1994;91(20):9262-6. 307. Willis A, Jung EJ, Wakefield T, Chen X. Mutant p53 exerts a dominant negative effect by preventing wild-type p53 from binding to the promoter of its target genes. Oncogene 2004;23(13):2330-8. 308. Campomenosi P, Monti P, Aprile A, et al. p53 mutants can often transactivate promoters containing a p21 but not bax or PIG3 responsive elements. Oncogene 2001;20(27):3573-9. 309. Pfeifer GP, Denissenko MF, Olivier M, Tretyakova N, Hecht SS, Hainaut P. Tobacco smoke carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene 2002;21(48):7435-51.

152

310. Varley JM, McGown G, Thorncroft M, et al. Are there low-penetrance TP53 alleles? evidence from childhood adrenocortical tumors. Am J Hum Genet 1999;65(4):995-1006. 311. Ceelen WP, Van Dalen T, Van Bockstal M, Libbrecht L, Sijmons RH. Malignant peritoneal mesothelioma in a patient with li-fraumeni syndrome. Journal of Clinical Oncology 2011;29(17):e503-5. 312. Raymond VM, Else T, Everett JN, Long JM, Gruber SB, Hammer GD. Prevalence of germline TP53 mutations in a prospective series of unselected patients with adrenocortical carcinoma. Journal of Clinical Endocrinology & Metabolism 2013;98(1):E119-25. 313. Lu X, Liu DP, Xu Y. The gain of function of p53 cancer mutant in promoting mammary tumorigenesis. Oncogene 2012. 314. Hansford LM, McKee AE, Zhang L, et al. Neuroblastoma cells isolated from bone marrow metastases contain a naturally enriched tumor-initiating cell. Cancer Res 2007;67(23):11234-43. 315. Hansford LM, Kaplan DR. Tumor-initiating cells in childhood neuroblastoma--response. Cancer Res 2012;72(3):823-4. 316. Powell JL, Bunin NJ, Callahan C, Aplenc R, Griffin G, Grupp SA. An unexpectedly high incidence of epstein-barr virus lymphoproliferative disease after CD34+ selected autologous peripheral blood stem cell transplant in neuroblastoma. Bone Marrow Transplant 2004;33(6):651- 7. 317. Laverdière C, Liu Q, Yasui Y, et al. Long-term outcomes in survivors of neuroblastoma: A report from the childhood cancer survivor study. JNCI Journal of the National Cancer Institute 2009;101(16):1131-40. 318. Chong CR, Sullivan DJ. New uses for old drugs. Nature 2007;448(7154):645-6. 319. Blatt J, Corey SJ. Drug repurposing in pediatrics and pediatric hematology oncology. Drug Discov Today 2013;18(1-2):4-10. 320. Vassilev LT, Vu BT, Graves B, et al. In vivo activation of the p53 pathway by small- molecule antagonists of MDM2. Science 2004;303(5659):844-8. 321. Lau LMS, Nugent JK, Zhao X, Irwin MS. HDM2 antagonist nutlin-3 disrupts p73-HDM2 binding and enhances p73 function. Oncogene 2008;27(7):997-1003. 322. Macarron R, Banks MN, Bojanic D, et al. Impact of high-throughput screening in biomedical research. Nature Reviews Drug Discovery 2011;10(3):188-95. 323. Smith KM, Datti A, Fujitani M, et al. Selective targeting of neuroblastoma tumour-initiating cells by compounds identified in stem cell-based small molecule screens. EMBO Molecular Medicine 2010;2(9):371-84. 324. Bernabé D, Tamae A, Biasoli É, Oliveira S. Stress hormones increase cell proliferation and regulates interleukin-6 secretion in human oral squamous cell carcinoma cells. Brain Behavior and Immunity 2011;25(3):574-83. 325. Eldeeb BB, Hammond EM, Worthington DJ, Mann JR. Urinary catecholamines and their metabolites in management of neuroblastoma. Pediatr Hematol Oncol 1988;5(3):229-37. 326. Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: The combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul 1984;22:27-55. 327. Chou TC, Talalay P. Generalized equations for the analysis of inhibitions of michaelis- menten and higher-order kinetic systems with two or more mutually exclusive and nonexclusive inhibitors. European journal of biochemistry / FEBS 1981;115(1):207-16. 328. Thadani U, Parker JO. Propranolol in the treatment of angina pectoris. comparison of duration of action in acute and sustained oral therapy. Circulation 1979;59(3):571-9.

153

329. Pérez Piñero C, Bruzzone A, Sarappa M, Castillo L, Lüthy I. Involvement of α2- and β2- adrenoceptors on breast cancer cell proliferation and tumour growth regulation. Br J Pharmacol 2011;166(2):721-36. 330. De Giorgi V, Grazzini M, Gandini S, et al. Treatment with β-blockers and reduced disease progression in patients with thick melanoma. Arch Intern Med 2011;171(8):779-81. 331. Weddle DL, Tithoff P, Williams M, Schuller HM. Beta-adrenergic growth regulation of human cancer cell lines derived from pancreatic ductal carcinomas. Carcinogenesis 2001;22(3):473-9. 332. Melhem-Bertrandt A, Chavez-Macgregor M, Lei X, et al. Beta-blocker use is associated with improved relapse-free survival in patients with triple-negative breast cancer. Journal of Clinical Oncology 2011;29(19):2645-52. 333. Bangalore S, Kumar S, Kjeldsen SE, et al. Antihypertensive drugs and risk of cancer: Network meta-analyses and trial sequential analyses of 324,168 participants from randomised trials. The lancet oncology 2011;12(1):65-82. 334. Guo K, Ma Q, Wang L, et al. Norepinephrine-induced invasion by pancreatic cancer cells is inhibited by propranolol. Oncol Rep 2009;22(4):825-30. 335. Johnsen JI, Lindskog M, Ponthan F, et al. Cyclooxygenase-2 is expressed in neuroblastoma, and nonsteroidal anti-inflammatory drugs induce apoptosis and inhibit tumor growth in vivo. Cancer Res 2004;64(20):7210-5. 336. Subbaramaiah K. Inhibition of cyclooxygenase-2 gene expression by p53. J Biol Chem 1999;274(16):10911-5. 337. Vaklavas C, Chatzizisis YS, Tsimberidou AM. Common cardiovascular medications in cancer therapeutics. Pharmacology and Therapeutics 2011;130(2):177-90. 338. Brown JM, Attardi LD. The role of apoptosis in cancer development and treatment response. Nat Rev Cancer 2005;5(3):231-7. 339. Thaker PH, Han LY, Kamat AA, et al. Chronic stress promotes tumor growth and angiogenesis in a mouse model of ovarian carcinoma. Nat Med 2006;12(8):939-44. 340. Barber HE, Hawksworth GM, Kitteringham NR, Petersen J, Petrie JC, Swann JM. Protein binding of atenolol and propranolol to human serum albumin and in human plasma [proceedings. Br J Clin Pharmacol 1978;6(5):446P-7. 341. Dey M, Brisson J, Davis G, et al. Relationship between plasma propranolol concentration and dose in young, healthy volunteers. Biopharmaceutics {\&} drug disposition 1986;7(2):103-11. 342. Xie W, Xie H, Liu F, et al. Propranolol induces apoptosis of human umbilical vein endothelial cells through down-regulation of CD147. Br J Dermatol 2012. 343. Pasquier E, Street J, Pouchy C, et al. Β-blockers increase response to chemotherapy via direct antitumour and anti-angiogenic mechanisms in neuroblastoma. Br J Cancer 2013. 344. Sloan EK, Priceman SJ, Cox BF, et al. The sympathetic nervous system induces a metastatic switch in primary breast cancer. Cancer Res 2010;70(18):7042-5. 345. Pollard JW. Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 2004;4(1):71-8. 346. DeNardo DG, Coussens LM. Inflammation and breast cancer. balancing immune response: Crosstalk between adaptive and innate immune cells during breast cancer progression. Breast Cancer Res 2007;9(4):212. 347. Valledor AF, Borras FE, Cullell-Young M, Celada A. Transcription factors that regulate monocyte/macrophage differentiation. J Leukoc Biol 1998;63(4):405-17.

154

348. Muthu K, Iyer S, He LK, et al. Murine hematopoietic stem cells and progenitors express adrenergic receptors. J Neuroimmunol 2007;186(1-2):27-36. 349. Cole SW, Hawkley LC, Arevalo JM, Cacioppo JT. Transcript origin analysis identifies antigen-presenting cells as primary targets of socially regulated gene expression in leukocytes. Proc Natl Acad Sci U S A 2011;108(7):3080-5. 350. Saul AN, Oberyszyn TM, Daugherty C, et al. Chronic stress and susceptibility to skin cancer. J Natl Cancer Inst 2005;97(23):1760-7. 351. Ben-Eliyahu S, Page GG, Yirmiya R, Shakhar G. Evidence that stress and surgical interventions promote tumor development by suppressing natural killer cell activity. Int J Cancer 1999;80(6):880-8. 352. Inbar S, Neeman E, Avraham R, Benish M, Rosenne E, Ben-Eliyahu S. Do stress responses promote leukemia progression? an animal study suggesting a role for epinephrine and prostaglandin-E2 through reduced NK activity. PLoS One 2011;6(4):e19246. 353. Pickoff AS, Zies L, Ferrer PL, et al. High-dose propranolol therapy in the management of supraventricular tachycardia. J Pediatr 1979;94(1):144-6. 354. Potter DE, Schambelan M, Salvatierra O, Orloff S, Holliday MA. Treatment of high-renin hypertension with propranolol in children after renal transplantation. J Pediatr 1977;90(2):307-11. 355. Herndon DN, Rodriguez NA, Diaz EC, et al. Long-term propranolol use in severely burned pediatric patients: A randomized controlled study. Ann Surg 2012;256(3):402-11. 356. Neil-Dwyer G, Bartlett J, McAinsh J, Cruickshank JM. Beta-adrenoceptor blockers and the blood-brian barrier. Br J Clin Pharmacol 1981;11(6):549-53. 357. University Columbia. A phase II study of the beta-blocker propranolol alone and with chemotherapy in patients receiving neoadjuvant treatment for newly diagnosed breast cancer. In: ClinicalTrialsgov [cited 2013 Mar 12] Available from: http://clinicaltrialsgov/show/ NCT01847001 NLM Identifier: NCT01847001 2012. 358. Price KAR, Cohen EE. Current treatment options for metastatic head and neck cancer. Head and Neck Cancer 2012:1-12. 359. Brockstein BE, Vokes EE. Head and neck cancer in 2010: Maximizing survival and minimizing toxicity. Nature Publishing Group 2011;8(2):72-4. 360. Bonner JA, Harari PM, Giralt J, et al. Radiotherapy plus cetuximab for squamous-cell carcinoma of the head and neck. N Engl J Med 2006;354(6):567-78. 361. Cuddihy AR, Bristow RG. The p53 protein family and radiation sensitivity: Yes or no? Cancer Metastasis Rev 2004;23:237-5. 362. Irwin MS. Family feud in chemosensitvity: p73 and mutant p53. Cell cycle (Georgetown, Tex.) 2004;3(3):319-23. 363. Shang ZJ, Liu K, Liang DF. Expression of beta2-adrenergic receptor in oral squamous cell carcinoma. Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology 2009;38(4):371-6. 364. Baker JG, Hill SJ, Summers RJ. Evolution of beta-blockers: From antianginal drugs to ligand-directed signalling. Trends Pharmacol Sci 2011;32((4-2)):227-34. 365. Nemunaitis J, Nemunaitis J. Head and neck cancer: Response to p53 based therapeutics. Head {\&} Neck 2011;33(1):131-4. 366. Sen T, Sen N, Brait M, et al. DeltaNp63alpha confers tumor cell resistance to cisplatin through the AKT1 transcriptional regulation. Cancer Res 2011;71(3):1167-76.

155

367. Moergel M, Abt E, Stockinger M, Kunkel M. Overexpression of p63 is associated with radiation resistance and prognosis in oral squamous cell carcinoma. Oral Oncol 2010;46(9):667- 71. 368. Johnson J, Lagowski J, Lawson S, Liu Y, Kulesz-Martin M. p73 expression modulates p63 and Mdm2 protein presence in complex with p53 family-specific DNA target sequence in squamous cell carcinogenesis. Oncogene 2008;27:2780-7. 369. Paul SM, Lewis-Hall F. Drugs in search of diseases. Science Translational Medicine 2013;5(186):186fs18. 370. Karpova L, Eva A, Kirch U, Boldyrev A, Scheiner-Bobis G. Sodium pump alpha1 and alpha3 subunit isoforms mediate distinct responses to ouabain and are both essential for survival of human neuroblastoma. The FEBS journal 2010;277(8):1853-60. 371. Sweadner KJ, Herrera VL, Amato S, Moellmann A, Gibbons DK, Repke KR. Immunologic identification of na+,K(+)-ATPase isoforms in myocardium. isoform change in deoxycorticosterone acetate-salt hypertension. Circ Res 1994;74(4):669-78. 372. Van Quaquebeke E, Simon G, André A, et al. Identification of a novel cardenolide (2''- oxovoruscharin) from calotropis procera and the hemisynthesis of novel derivatives displaying potent in vitro antitumor activities and high in vivo tolerance: Structure-activity relationship analyses. J Med Chem 2005;48(3):849-56. 373. Liu X, Mazanek P, Dam V, et al. Deregulated wnt/beta-catenin program in high-risk neuroblastomas without MYCN amplification. Oncogene 2008;27(10):1478-8. 374. Kulikov A, Eva A, Kirch U, Boldyrev A, Scheiner-Bobis G. Ouabain activates signaling pathways associated with cell death in human neuroblastoma. Biochimica et Biophysica Acta (BBA) - Biomembranes 2007;1768(7):1691-702. 375. Zechner D, Fujita Y, H\ulsken J, et al. Beta-catenin signals regulate cell growth and the balance between progenitor cell expansion and differentiation in the nervous system. Dev Biol 2003;258(2):406-18. 376. Guo L, Abrams RMC, Babiarz JE, et al. Estimating the risk of drug-induced proarrhythmia using human induced pluripotent stem cell-derived cardiomyocytes. Toxicological sciences : an official journal of the Society of Toxicology 2011;123(1):281-9. 377. Dostanic-Larson I, Lorenz JN, Van Huysse JW, Neumann JC, Moseley AE, LINGREL JB. Physiological role of the alpha1- and alpha2-isoforms of the na+-K+-ATPase and biological significance of their cardiac glycoside binding site. American journal of physiology.Regulatory, integrative and comparative physiology 2006;290(3):R524-8. 378. Xu Z, Wang F, Gao M, Chen X, Hu W, Xu R. Targeting the na(+)/K(+)-ATPase alpha1 subunit of hepatoma HepG2 cell line to induce apoptosis and cell cycle arresting. Biological & pharmaceutical bulletin 2010;33(5):743-51. 379. Chesler L, Goldenberg DD, Collins R, et al. Chemotherapy-induced apoptosis in a transgenic model of neuroblastoma proceeds through p53 induction. Neoplasia 2008;10(11):1268-74. 380. Kurata K, Yanagisawa R, Ohira M, Kitagawa M, Nakagawara A, Kamijo T. Stress via p53 pathway causes apoptosis by mitochondrial noxa upregulation in doxorubicin-treated neuroblastoma cells. Oncogene 2008;27(6):741-54. 381. Xue C, Haber M, Flemming C, et al. p53 determines multidrug sensitivity of childhood neuroblastoma. Cancer Res 2007;67(21):10351-60. 382. Burkhart CA, Watt F, Murray J, et al. Small-molecule multidrug resistance-associated protein 1 inhibitor reversan increases the therapeutic index of chemotherapy in mouse models of neuroblastoma. Cancer Res 2009;69(16):6573-80.

156

383. Villani A, Tabori U, Schiffman J, et al. Biochemical and imaging surveillance in germline TP53 mutation carriers with li-fraumeni syndrome: A prospective observational study. The lancet oncology 2011;12(6):559-67. 384. Mihara M, Erster S, Zaika A, et al. p53 has a direct apoptogenic role at the mitochondria. Mol Cell 2003;11(3):577-90. 385. Sansome C, Zaika A, Marchenko ND, Moll UM. Hypoxia death stimulus induces translocation of p53 protein to mitochondria. detection by immunofluorescence on whole cells. FEBS Lett 2001;488(3):110-5. 386. Pietsch EC, Sykes SM, McMahon SB, Murphy ME. The p53 family and programmed cell death. Oncogene 2008;27(50):6507-21. 387. Tomita Y, Marchenko N, Erster S, et al. WT p53, but not tumor-derived mutants, bind to Bcl2 via the DNA binding domain and induce mitochondrial permeabilization. The Journal of biological chemistry 2006;281(13):8600-6. 388. Lin Y, Sengupta S, Gurdziel K, Bell GW, Jacks T, Flores ER. p63 and p73 transcriptionally regulate genes involved in DNA repair. PLoS genetics 2009;5(10):e1000680. 389. Tomasini R, Mak TW, Melino G. The impact of p53 and p73 on aneuploidy and cancer. Trends Cell Biol 2008;18(5):244-52. 390. Ichimiya S, Nimura Y, Kageyama H, et al. p73 at chromosome 1p36.3 is lost in advanced stage neuroblastoma but its mutation is infrequent. Oncogene 1999;18(4):1061-6. 391. Santos A, Calvet L, Terrier-Lacombe M, et al. In vivo treatment with CPT-11 leads to differentiation of neuroblastoma xenografts and topoisomerase I alterations. Cancer Res 2004;64(9):3223-9. 392. Geenen MM, Bakker PJM, Kremer LCM, Kastelein JJP, van Leeuwen FE. Increased prevalence of risk factors for cardiovascular disease in long-term survivors of acute lymphoblastic leukemia and wilms tumor treated with radiotherapy. Pediatric blood & cancer 2010;55(4):690-7. 393. Flynn JT, Daniels SR. Pharmacologic treatment of hypertension in children and adolescents. J Pediatr 2006;149(6):746-54. 394. Hsu DM, Agarwal S, Benham A, et al. G-CSF receptor positive neuroblastoma subpopulations are enriched in chemotherapy-resistant or relapsed tumors and are highly tumorigenic. Cancer Res 2013;73(13):4134-46. 395. Braam SR, Tertoolen L, van de Stolpe A, Meyer T, Passier R, Mummery CL. Prediction of drug-induced cardiotoxicity using human embryonic stem cell-derived cardiomyocytes. Stem cell research 2010;4(2):107-16. 396. Kattman SJ, Witty AD, Gagliardi M, et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell 2011;8(2):228-40. 397. Felth J, Rickardson L, Ros\'en J, et al. Cytotoxic effects of cardiac glycosides in colon cancer cells, alone and in combination with standard chemotherapeutic drugs. J Nat Prod 2009;72(11):1969-74.

157