Comprehensive Characterization of the Transcriptional Signaling of Human Parturition Through Integrative Analysis of Myometrial Tissues and Cell Lines

Total Page:16

File Type:pdf, Size:1020Kb

Comprehensive Characterization of the Transcriptional Signaling of Human Parturition Through Integrative Analysis of Myometrial Tissues and Cell Lines COMPREHENSIVE CHARACTERIZATION OF THE TRANSCRIPTIONAL SIGNALING OF HUMAN PARTURITION THROUGH INTEGRATIVE ANALYSIS OF MYOMETRIAL TISSUES AND CELL LINES by ZACHARY STANFIELD Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Systems Biology and Bioinformatics CASE WESTERN RESERVE UNIVERSITY August, 2019 Case Western Reserve University School of Graduate Studies We hereby approve the thesis of ZACHARY STANFIELD candidate for the degree of Doctor of Philosophy1. Committee Chair Dr. Gurkan Bebek Department of Nutrition Committee Member, Adviser Dr. Mehmet Koyutürk Department of Computer Science and Electrical Engineering Committee Member Dr. Sam Mesiano Department of Obstetrics and Gynecology Committee Member Dr. Mark Cameron Department of Population and Quantitative Health Sciences Date of Defense May 10, 2019 1We certify that written approval has been obtained for any proprietary material contained therein. Acknowledgements I would first like to acknowledge my mentor, Dr. Mehmet Koyutürk. I knew from our first meeting that Dr. Koyutürk’s lab would be a great fit for me. He is a highly en- thusiastic and ambitious researcher as well as a relaxed, supportive, and understanding mentor. Dr. Koyutürk gave me a lot of freedom in my research but was always present to provide useful feedback and ideas on how to move forward. This allowed me the opportunity to progress in research directions I personally found both interesting and rewarding. I would also like to mention Dr. Sam Mesiano, who essentially served as my co-mentor throughout the latter part of my PhD. His extensive knowledge and experi- ence in the topic of my thesis research helped me progress quickly and better plan my project. Dr. Mesiano was always willing to offer advice and introduce me to potential collaborators at various research retreats and conferences. The amount of support and belief shown in me by both Dr. Koyutürk and Dr. Mesiano gave me the confidence and drive I needed throughout my PhD career. Graduate school is just as much a lifestyle as a step in one’s career path. Therefore it is important to build relationships with those around you and experience life outside of research. Thankfully I have been able to meet a lot of great people through school events like intramural sports and grad student functions, as well as while exploring Cleveland. Some of these relationships have lasted since the very beginning and will continue long after graduation. I thank each and every one of these individuals for their friendship and the memories we were able to create. Lastly, I would like to thank my family. My parents are extremely supportive of me in every aspect of my life and I am truly grateful for it. My brother also deserves much credit, having participated in countless conversations about every possible aspect of my iii personal and professional life throughout the years. Without my family’s continuous encouragement and guidance I would not be where I am today. iv Table of Contents Acknowledgements iii List of Tables ix List of Figuresx Comprehensive Characterization of the Transcriptional Signaling of Human Parturition through Integrative Analysis of Myometrial Tissues and Cell Lines xx Chapter 1. Introduction1 Overview of Human Parturition1 Preterm Labor2 Processes Controlling Human Parturition2 The Role of Transcriptomic Studies in Parturition Research4 The Role of Experimental Cell Lines in Parturition Research5 Hypotheses and Objectives6 1.6.1. Characterizing Tissue Gene Expression7 1.6.2. Characterizing Cell Line Gene Expression8 1.6.3. Determining the Agreement between Tissue and Cell Lines9 Chapter 2. Materials and Methods 11 Data 11 2.1.1. Tissue Data 11 2.1.2. Cell Line Data 13 Methods 15 v 2.2.1. Raw Data Processing, Calculating Differential Expression, and Study Concatenation 15 2.2.2. Classification 17 2.2.3. Singular Value Decomposition 18 2.2.4. Enrichment Analysis 19 2.2.5. Annotation of Vascular Smooth Muscle Contraction Pathway Diagram 22 2.2.6. Signaling Network Construction 23 2.2.7. Regulatory Network Analysis 25 2.2.8. Comparison of Myometrial Cell Line and Tissue 26 Chapter 3. Characterizing Transcriptional Alterations at the Onset of Labor in Myometrial Tissue 28 Differential Gene Expression in Quiescent and Laboring Myometrium 28 Within-study Classification 31 Cross-study Classification 36 Identification of Latent Transcriptional Regulation Patterns via Singular Value Decomposition 37 Global Identification of Pathways Altered During Parturition 41 Hypothesis-Driven Signature Identification 43 Building a Parturition Signaling Network 49 Summary 52 Chapter 4. Investigating Pathways Controlling Human Parturition in a Myometrial Cell Line 54 Progesterone Signaling 55 vi cAMP Signaling 56 IL-1¯ Signaling 59 Additional Insights from Single Stimulus Comparisons 60 Anti-inflammatory Actions of P4 and cAMP 62 Synergy Between P4 and cAMP 64 Summary 67 Chapter 5. Identifying Transcriptional Similarities of Human Myometrial Tissues and Cell Lines 68 Agreement of Transcriptional Alterations at the Gene, Pathway, and Network Levels 68 Assessing Similarity Using Tissue Similarity Index 71 Summary 74 Chapter 6. Discussion and Conclusions 76 Tissue Analysis 76 Cell Line Analysis 83 Tissue and Cell Line Comparison 86 Conclusions 87 Chapter 7. Suggested Future Research 89 Utilizing Clinical Data 89 Confirmational Studies for Validation of Findings 90 Myometrial Cell-Specific Signaling 91 Linking the Uterine Tissues 91 Appendix A. Supplementary Tables 93 vii Appendix. Complete References 130 viii List of Tables 2.1 Myometrial tissue gene expression studies analyzed in this chapter. Three gene expression datasets collected from publicly available sources or collaborators are shown. Sample groups and names are consistent with the acronyms listed in column three throughout the chapter. Clinical definitions of labor represent how each sample was called phenotypically, based on the patient’s clinical presentation at the time of cesarean section, as chosen by the researchers collecting the samples. 12 ix List of Figures 2.1 Study design and conceptual illustration of the framework for data analysis. A. The human myometrial hTERT-HMA/B cell line, expressing the progesterone receptors (PRs), was treated with progesterone (P4), forskolin (FSK, induces cAMP), and IL-1¯ individually and in all combinations of these three stimuli. Treatment was performed for 24 hours to establish steady-state cellular transcription. RNA sequencing was performed in triplicate on each condition, resulting in expression measurements for at total of 24 samples. B. Stimulation of the targeted pathways was confirmed by examining the effect of different treatment combinations on mRNA expression of IL-8, a commonly used downstream target of IL-1¯ and indicator of inflammatory signaling. IL-8 induced expression is achieved with IL-1¯ treatment. This induced expression is inhibited by P4 in the presence of PR. cAMP inhibits IL-1¯ induced expression of IL-8, and, finally, the strongest inhibition of IL-8 up-regulation is achieved by treating cells with both FSK and P4. These experiments were carried out by a collaborator, Dr. Peyvand Amini, and are shown here to improve clarity. C. Comparisons performed to characterize the signaling carried out by P4, cAMP,and IL-1¯ individually. The results of these comparisons are shown in Figures 4.1-4.4. D. Comparisons performed to examine the interplay between P4 and cAMP in the context of their anti-inflammatory effects. Samples treated by IL-1¯ and different combinations of P4 and FSK were first compared to x vehicle. Subsequently, the genes, transcription factors, and processes identified in these comparisons were compared to each other to understand how P4 and cAMP work together or individually to suppress inflammatory processes. The results of these analyses are shown in Figures 4.5 and 4.6. 14 2.2 Data and methods used in bioinformatics pipeline. Raw gene expression was processed in multiple steps and combined with curated information from public databases to carry out supervised and unsupervised approaches to identify transcriptional signatures, assess their reproducibility, and identify key signaling pathways and interactions involved in parturition. 16 3.1 Venn diagram of differential expression in Warwick, Detroit, and London. Differentially expressed genes between non-labor and in-labor sample groups for each dataset are compared to calculate similarity across studies. 30 3.2 AUCs, ROC Curves, and sample classification frequencies for K-fold cross-validation and cross-study classification tasks on tissue gene expression studies using LASSO and EN. A-C. K-fold cross validation (CV) for each dataset (k = 3 for Warwick, 5 for London and Detroit). D-I. Classification of one dataset with training performed on another dataset. LASSO and EN were implemented using the glmnet package in R. J-R. Corresponding sample class frequencies for the classification tasks shown in panels A-I, specifically using the results xi from the top performing algorithm, based on AUC. For all prediction tasks, the early labor (L-ILEa) and established labor (L-ILEs) samples were grouped together as a single laboring sample group except for sample classification frequency for 5-fold CV on London, where the three sample groups were kept separate in order to assess how the new initial labor group was classified. All results shown were obtained using 100 runs of training and testing. Sample names in panels J-R follow the naming convention in Table 2.1. 33 3.3 Distribution of singular values and examination of genes and samples in the space spanned by the first singular vector from SVD analysis on aggregated gene expression matrix. A. Singular values calculated by performing SVD on the normalized, study-combined expression matrix (12,622 genes by 71 samples). B. Mapping of the top 25 positively and negatively valued genes in the space represented by the first right singular vector (eigen-gene). Bars representing genes are colored based on its differential expression in each of the four differential expression analyses (shown in Fig. 3.1; i.e.
Recommended publications
  • Influencers on Thyroid Cancer Onset: Molecular Genetic Basis
    G C A T T A C G G C A T genes Review Influencers on Thyroid Cancer Onset: Molecular Genetic Basis Berta Luzón-Toro 1,2, Raquel María Fernández 1,2, Leticia Villalba-Benito 1,2, Ana Torroglosa 1,2, Guillermo Antiñolo 1,2 and Salud Borrego 1,2,* 1 Department of Maternofetal Medicine, Genetics and Reproduction, Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville, 41013 Seville, Spain; [email protected] (B.L.-T.); [email protected] (R.M.F.); [email protected] (L.V.-B.); [email protected] (A.T.); [email protected] (G.A.) 2 Centre for Biomedical Network Research on Rare Diseases (CIBERER), 41013 Seville, Spain * Correspondence: [email protected]; Tel.: +34-955-012641 Received: 3 September 2019; Accepted: 6 November 2019; Published: 8 November 2019 Abstract: Thyroid cancer, a cancerous tumor or growth located within the thyroid gland, is the most common endocrine cancer. It is one of the few cancers whereby incidence rates have increased in recent years. It occurs in all age groups, from children through to seniors. Most studies are focused on dissecting its genetic basis, since our current knowledge of the genetic background of the different forms of thyroid cancer is far from complete, which poses a challenge for diagnosis and prognosis of the disease. In this review, we describe prevailing advances and update our understanding of the molecular genetics of thyroid cancer, focusing on the main genes related with the pathology, including the different noncoding RNAs associated with the disease.
    [Show full text]
  • Genome-Wide Analysis of Host-Chromosome Binding Sites For
    Lu et al. Virology Journal 2010, 7:262 http://www.virologyj.com/content/7/1/262 RESEARCH Open Access Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1) Fang Lu1, Priyankara Wikramasinghe1, Julie Norseen1,2, Kevin Tsai1, Pu Wang1, Louise Showe1, Ramana V Davuluri1, Paul M Lieberman1* Abstract The Epstein-Barr Virus (EBV) Nuclear Antigen 1 (EBNA1) protein is required for the establishment of EBV latent infection in proliferating B-lymphocytes. EBNA1 is a multifunctional DNA-binding protein that stimulates DNA replication at the viral origin of plasmid replication (OriP), regulates transcription of viral and cellular genes, and tethers the viral episome to the cellular chromosome. EBNA1 also provides a survival function to B-lymphocytes, potentially through its ability to alter cellular gene expression. To better understand these various functions of EBNA1, we performed a genome-wide analysis of the viral and cellular DNA sites associated with EBNA1 protein in a latently infected Burkitt lymphoma B-cell line. Chromatin-immunoprecipitation (ChIP) combined with massively parallel deep-sequencing (ChIP-Seq) was used to identify cellular sites bound by EBNA1. Sites identified by ChIP- Seq were validated by conventional real-time PCR, and ChIP-Seq provided quantitative, high-resolution detection of the known EBNA1 binding sites on the EBV genome at OriP and Qp. We identified at least one cluster of unusually high-affinity EBNA1 binding sites on chromosome 11, between the divergent FAM55 D and FAM55B genes. A con- sensus for all cellular EBNA1 binding sites is distinct from those derived from the known viral binding sites, sug- gesting that some of these sites are indirectly bound by EBNA1.
    [Show full text]
  • Pancreatic Beta Cells Express a Diverse Set Ofhomeobox Genes
    Proc. Nati. Acad. Sci. USA Vol. 91, pp. 12203-12207, December 1994 Biochemistry Pancreatic beta cells express a diverse set of homeobox genes (Lim motif/Lmx gene/Nkx gene/Alx gene/Vdx homeobox) ABRAHAM RUDNICK*t, THAI YEN LING*, HIROKI ODAGIRI*, WILLIAM J. RUTTER*t, AND MICHAEL S. GERMAN*t§ *Hormone Research Institute and Departments of tMedicine and tBiochemistry and Biophysics, University of California, San Francisco, CA 94143-0534 Contributed by William J. Rutter, August 22, 1994 ABSTRACT Homeobox genes, which are found in all RIPE3B element (16) and the P1 element (8) [also called CT1 eukaryotic organisms, encode transcriptional regulators in- (9)] lie on either side of the IEB1 element. The A/T elements volved in cell-type differentiation and development. Several and the E boxes function synergistically: none of the ele- homeobox genes encoding homeodomain proteins that bind and ments can function in isolation, but combination of an E box activate the insulin gene promoter have been described. In an and an A/T element results in dramatic activation of tran- attempt to identify additional beta-cell homeodomain proteins, scription (11, 16, 19). A number of complexes from beta-cell we designed primers based on the sequences of beta-cell nuclei bind to the A/T elements (6, 8-11, 16, 19). Some homeobox genes cdx3 and lmxl and the Drosophia homeodo- proteins in these complexes have been cloned, and they all main protein Antennapedia and used these primers to amplffy contain homeodomains. The A/T-binding proteins that have inserts by PCR from an insulinoma cDNA library.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • WO 2014/135655 Al 12 September 2014 (12.09.2014) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/135655 Al 12 September 2014 (12.09.2014) P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (21) International Application Number: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, PCT/EP2014/054384 DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, 6 March 2014 (06.03.2014) KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (25) Filing Language: English OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (26) Publication Language: English SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, (30) Priority Data: ZW. 13305253.0 6 March 2013 (06.03.2013) EP (84) Designated States (unless otherwise indicated, for every (71) Applicants: INSTITUT CURIE [FR/FR]; 26 rue d'Ulm, kind of regional protection available): ARIPO (BW, GH, F-75248 Paris cedex 05 (FR). CENTRE NATIONAL DE GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, LA RECHERCHE SCIENTIFIQUE [FR/FR]; 3 rue UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, Michel Ange, F-75016 Paris (FR).
    [Show full text]
  • The Plasma Peptides of Alzheimer's Disease
    Florentinus‑Mefailoski et al. Clin Proteom (2021) 18:17 https://doi.org/10.1186/s12014‑021‑09320‑2 Clinical Proteomics RESEARCH Open Access The plasma peptides of Alzheimer’s disease Angelique Florentinus‑Mefailoski1, Peter Bowden1, Philip Scheltens2, Joep Killestein3, Charlotte Teunissen4 and John G. Marshall1,5* Abstract Background: A practical strategy to discover proteins specifc to Alzheimer’s dementia (AD) may be to compare the plasma peptides and proteins from patients with dementia to normal controls and patients with neurological condi‑ tions like multiple sclerosis or other diseases. The aim was a proof of principle for a method to discover proteins and/ or peptides of plasma that show greater observation frequency and/or precursor intensity in AD. The endogenous tryptic peptides of Alzheimer’s were compared to normals, multiple sclerosis, ovarian cancer, breast cancer, female normal, sepsis, ICU Control, heart attack, along with their institution‑matched controls, and normal samples collected directly onto ice. Methods: Endogenous tryptic peptides were extracted from blinded, individual AD and control EDTA plasma sam‑ ples in a step gradient of acetonitrile for random and independent sampling by LC–ESI–MS/MS with a set of robust and sensitive linear quadrupole ion traps. The MS/MS spectra were ft to fully tryptic peptides within proteins identi‑ fed using the X!TANDEM algorithm. Observation frequency of the identifed proteins was counted using SEQUEST algorithm. The proteins with apparently increased observation frequency in AD versus AD Control were revealed graphically and subsequently tested by Chi Square analysis. The proteins specifc to AD plasma by Chi Square with FDR correction were analyzed by the STRING algorithm.
    [Show full text]
  • SNM1A (DCLRE1A) (NM 001271816) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC235137 SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DCLRE1A Synonyms: PSO2; SNM1; SNM1A Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC235137 representing NM_001271816 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTAGAAGACATTTCCGAAGAAGACATTTGGGAATACAAATCTAAAAGAAAACCAAAACGAGTTGATC CAAATAATGGCTCTAAAAATATTCTAAAATCTGTTGAAAAAGCAACAGATGGAAAATACCAGTCAAAACG GAGTAGAAACAGAAAAAGAGCCGCAGAAGCTAAAGAGGTGAAGGACCATGAAGTGCCCCTTGGAAATGCA GGTTGTCAGACTTCTGTTGCTTCTAGTCAGAATTCAAGTTGTGGAGATGGTATTCAGCAGACCCAAGACA AGGAAACTACTCCAGGAAAACTCTGTAGAACTCAAAAAAGCCAACACGTGTCCCCAAAGATACGTCCAGT TTATGATGGATACTGTCCAAATTGCCAGATGCCTTTTTCCTCATTGATAGGGCAGACACCTCGATGGCAT GTTTTTGAATGTTTGGATTCTCCACCACGCTCTGAAACAGAGTGTCCTGATGGTCTTCTGTGTACCTCAA CCATTCCTTTTCATTACAAGAGATACACTCACTTCCTGCTAGCTCAAAGCAGGGCTGGTGATCATCCTTT TAGCAGCCCATCACCTGCGTCAGGTGGCAGTTTCAGTGAGACTAAGTCAGGCGTCCTTTGTAGCCTTGAG GAAAGATGGTCTTCGTATCAGAACCAAACTGATAACTCGGTTTCAAATGATCCCTTATTGATGACACAGT ATTTTAAAAAGTCTCCGTCTCTGACTGAAGCCAGTGAAAAGATTTCTACTCATATCCAAACATCCCAACA AGCTCTACAATTTACAGATTTTGTTGAGAATGACAAACTAGTGGGAGTTGCTTTGCGTCTTGCAAACAAC
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]