DOCSLIB.ORG

ABSTRACT CHAROENPANICH, ADISRI. Analyses of Human

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ABSTRACT CHAROENPANICH, ADISRI. Analyses of Human ABSTRACT CHAROENPANICH, ADISRI. Analyses of Human Adipose Derived Stem Cells and Human Mesenchymal Stem Cells for Functional Tissue Engineering using Biomimetic Physical Stimuli. (Under the direction of Elizabeth G. Loboa.) Autologous stem-cell-based tissue engineering holds great potential for treating trauma and pathologies in a patient specific manner. Adult stem cells can be derived from various source tissues such as bone marrow, epidermal tissue, and adipose tissue. Initially, bone-marrow-derived mesenchymal stem cells (MSC) received the most attention for musculoskeletal tissue engineering applications given their direct lineage capability. More recently however, adipose-derived stem cells (ASC) have received increasing interest for tissue engineering applications due to their relative ease of harvest, abundance, and multi- lineage differentiation potential. To better implement the use of stem and progenitor cells for cell-based therapy and tissue repair, understanding of how these cells are committed to, or differentiate into, a specific cell lineage is needed. Previous studies have shown the ability of hMSC and hASC to differentiate into bone, fibrous tissue, cartilage, and smooth muscle cells in response to appropriate chemical and/or mechanical stimuli. In this dissertation, the effect of allograft extracellular matrix, soluble inductive factors, and a specific mechanical stimulus (10% uniaxial cyclic tensile strain) on hASC/hMSC osteo- and chondrogenic differentiation and gene expression were examined. In the first study, hASC were seeded into a decellularized human meniscal allograft to determine the effects of inherent soluble cues provided by the extracellular matrix (ECM) on hASC viability, proliferation, differentiation and histology of the hASC-seeded meniscus. In the second study, hASC osteogenic differentiation and response to combined chemical and mechanical stimuli were investigated. Gene expression profiles of proliferating or osteogenically induced hASC in 3D collagen I culture in the presence and absence of 10% uniaxial cyclic tensile strain were examined using microarray analysis. In the final study, hMSC isolated from aged, postmenopausal osteoporotic donors were cultured in three-dimensional (3D) collagen constructs and analyzed for changes in mRNA expression in response to 10% uniaxial cyclic tensile strain in an attempt to identify potential mechanisms underlying the use of appropriate mechanical loading for prevention and treatment of osteoporosis. The results of the first study show promising initial results of the use of hASC combined with a decellularized meniscal allograft for improved approaches for meniscal allograft transplants. The following studies of hASC and hMSC in response to tensile strain expanded findings from the first study to determine the effects of combined chemical and mechanical stimuli for regeneration of other musculoskeletal tissues in addition to fibrocartilage, with particular emphasis on bone formation. Application of cyclic tensile strain at different magnitudes is a stimulus for fibrous tissue, fibrocartilage and bone formation during normal secondary fracture healing or distraction osteogenesis. Specifically, our lab has previously shown that 10% cyclic tensile enhances osteogenesis of both hASC and hMSC in vitro. However, the molecular mechanisms underlying this potential are not yet known. The research performed in this thesis identified angiogenesis as a potential mechanism in response of hMSC and hASC to 10% cyclic tensile strain. Potential key genes identified to play important roles in hASC and hMSC in response to 10% tensile strain included PDLIM4, an actin binding protein. PDLIM4 knockdown was also shown to increase hMSC osteogenesis via enhanced expression of bone marker genes and alkaline phosphatase activity. © Copyright 2013 by Adisri Charoenpanich All Rights Reserved Analyses of Human Adipose Derived Stem Cells and Human Mesenchymal Stem Cells for Functional Tissue Engineering using Biomimetic Physical Stimuli by Adisri Charoenpanich A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Biomedical Engineering Raleigh, North Carolina 2013 APPROVED BY: _______________________________ ______________________________ Dr. Elizabeth Loboa Polefka Dr. Albert Banes Committee Chair _______________________________ ______________________________ Dr. Susan Bernacki Dr. Gregory McCarty ________________________________ Dr. Jeffrey T. Spang DEDICATION To my dearest family Mum, Dad, J Aum, and Helen. ii BIOGRAPHY Adisri (Audrey) Charoenpanich was born in Bangkok, Thailand. She has one beloved elder sister, who is pursuing her PhD in molecular microbiology at Max Planck Institute for Terrestrial Microbiology, Marburg, Germany. Audrey graduated in March, 2006 with a Bachelor of Science degree in Biology from Silpakorn University, Thailand. She started to pursue her MS/PhD in the joint Biomedical Engineering program at NCSU/UNC with the fellowship from Thai government in fall 2007. iii ACKNOWLEDGMENTS I would like to express my gratitude to my advisor, Dr. Elizabeth Loboa, for her guidance, encouragement and generous support. I am so thankful having her as my advisor. I would like to thank Dr. Susan Bernacki for her support, wisdom and very helpful advices since the first year of my graduate study. I would also like to thank Dr. Jeffrey Spang for his time, advice and contribution on my meniscus project and also taking time to serve in my committee. I would like to thank Dr. Albert Banes and Dr. Gregory McCarty for his wisdom classes, suggestions, and taking time to serve in my committee. I would also like to thank Dr. Charles Tucker, Dr. Danica Andrews, and Dr. Michelle Wall for their time, advice and contribution on my two microarray projects. Thank you for the collaboration from Dr. Peter Mente, Dr. Carol Otey’s lab, Dr. Caterina gallippi, and Tomasz Czernuszewicz. My sincere appreciation is extended to all CML members. I would also like to thank Ruwan, Wayne, and Seth. Thank you Carla for the wonderful friendship. Thank you Josie and her Titi for the amazing time we shared. Thank you Stephanie and her Honey bee for all lovely support . Thank you Mahsa for all your help and care. Thank you John, Stephen and Pattie. I also appreciate the support from the faculty and staffs at joint Department of Biomedical Engineering. Thank you to Ginger for being my supportive girlfriend, making me laughs even when it is so tough. Thank you P Top and P Kaew for settling me down in Raleigh. Thanks to Bee, Joe, and Ning for the support even before this journey began. Thank you to P A and P Top for the wonderful support and friendship. Thank you to P May and Joey for bringing iv Helen into my life. Thank you to the Hay Day support team P Orm and P Jijy, you guys are the best <3. Thank you to Tum, P Pin, Win, P Poy, N Fang, P Art, Good, and all Thai folks. Lastly and most importantly, I would like to thank my parents, my sister, and my Helen for always be there for me. I love you <3. v TABLE OF CONTENTS LIST OF TABLES……………………………………………………………………......….xii LIST OF FIGURES ............................................................................................................... xiii Preface....................................................................................................................................... 1 1. Proliferation of Human Adipose Derived Stem Cells Stem Cells in a Needle-Punched, Porous, Decellularized Human Allograft-Derived Meniscus and Synthetic Aligned PLA scaffold ...................................................................................................................................... 3 1.1 Introduction ..................................................................................................................... 3 1.2 Materials and Methods .................................................................................................... 5 1.2.1 Decellularization and Porosity Enhancement of Human Meniscus .................... 5 1.2.2 Cell seeding and cell culture ............................................................................... 6 1.2.3 Nuclei staining .................................................................................................... 6 1.2.4 Cell survival and histology ................................................................................. 6 1.2.5 Scanning Electron Microscopy ........................................................................... 7 1.3 Results ............................................................................................................................. 7 1.3.1 Decellularized of Human Meniscus .................................................................... 7 1.3.2 Proliferation of hASC on Decellularized Meniscus ............................................ 9 1.3.3 Histology ........................................................................................................... 10 1.4 Discussion ..................................................................................................................... 12 vi 2 Microarray Analysis of hASC in 3D Collagen Culture: Osteogenesis Inhibits BMP and Wnt Signaling Pathways and Cyclic Tensile Strain Causes Upregulation of Proinflammatory Cytokine Regulators and Angiogenic Factors ........................................................................ 14 2.1 Introduction ..................................................................................................................
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • RNA Expression Patterns in Serum Microvesicles from Patients With
    Noerholm et al. BMC Cancer 2012, 12:22 http://www.biomedcentral.com/1471-2407/12/22 RESEARCHARTICLE Open Access RNA expression patterns in serum microvesicles from patients with glioblastoma multiforme and controls Mikkel Noerholm1,2*, Leonora Balaj1, Tobias Limperg1,3, Afshin Salehi1,4, Lin Dan Zhu1, Fred H Hochberg1, Xandra O Breakefield1, Bob S Carter1,4 and Johan Skog1,2 Abstract Background: RNA from exosomes and other microvesicles contain transcripts of tumour origin. In this study we sought to identify biomarkers of glioblastoma multiforme in microvesicle RNA from serum of affected patients. Methods: Microvesicle RNA from serum from patients with de-novo primary glioblastoma multiforme (N = 9) and normal controls (N = 7) were analyzed by microarray analysis. Samples were collected according to protocols approved by the Institutional Review Board. Differential expressions were validated by qRT-PCR in a separate set of samples (N = 10 in both groups). Results: Expression profiles of microvesicle RNA correctly separated individuals in two groups by unsupervised clustering. The most significant differences pertained to down-regulated genes (121 genes > 2-fold down) in the glioblastoma multiforme patient microvesicle RNA, validated by qRT-PCR on several genes. Overall, yields of microvesicle RNA from patients was higher than from normal controls, but the additional RNA was primarily of size < 500 nt. Gene ontology of the down-regulated genes indicated these are coding for ribosomal proteins and genes related to ribosome production. Conclusions: Serum microvesicle RNA from patients with glioblastoma multiforme has significantly down- regulated levels of RNAs coding for ribosome production, compared to normal healthy controls, but a large overabundance of RNA of unknown origin with size < 500 nt.
    [Show full text]
  • Intersectin 1 Forms Complexes with SGIP1 and Reps1 in Clathrin-Coated
    Biochemical and Biophysical Research Communications 402 (2010) 408–413 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc Intersectin 1 forms complexes with SGIP1 and Reps1 in clathrin-coated pits ⇑ Oleksandr Dergai a, ,1, Olga Novokhatska a,1, Mykola Dergai a, Inessa Skrypkina a, Liudmyla Tsyba a, Jacques Moreau b, Alla Rynditch a a Department of Functional Genomics, Institute of Molecular Biology and Genetics, NASU, 150 Zabolotnogo Street, 03680 Kyiv, Ukraine b Molecular Mechanisms of Development, Jacques Monod Institute, Development and Neurobiology Program, UMR7592 CNRS – Paris Diderot University, 15 rue Hélène Brion, 75205 Paris Cedex 13, France article info abstract Article history: Intersectin 1 (ITSN1) is an evolutionarily conserved adaptor protein involved in clathrin-mediated endo- Received 7 October 2010 cytosis, cellular signaling and cytoskeleton rearrangement. ITSN1 gene is located on human chromosome Available online 12 October 2010 21 in Down syndrome critical region. Several studies confirmed role of ITSN1 in Down syndrome pheno- type. Here we report the identification of novel interconnections in the interaction network of this endo- Keywords: cytic adaptor. We show that the membrane-deforming protein SGIP1 (Src homology 3-domain growth Endocytosis factor receptor-bound 2-like (endophilin) interacting protein 1) and the signaling adaptor Reps1 (RalBP Adaptor proteins associated Eps15-homology domain protein) interact with ITSN1 in vivo. Both interactions are mediated Intersectin 1 by the SH3 domains of ITSN1 and proline-rich motifs of protein partners. Moreover complexes compris- Protein interactions SGIP1 ing SGIP1, Reps1 and ITSN1 have been identified. We also identified new interactions between SGIP1, Reps1 Reps1 and the BAR (Bin/amphiphysin/Rvs) domain-containing protein amphiphysin 1.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Sulfite Dehydrogenases in Organotrophic Bacteria : Enzymes
    Sulfite dehydrogenases in organotrophic bacteria: enzymes, genes and regulation. Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) an der Universität Konstanz Fachbereich Biologie vorgelegt von Sabine Lehmann Tag der mündlichen Prüfung: 10. April 2013 1. Referent: Prof. Dr. Bernhard Schink 2. Referent: Prof. Dr. Andrew W. B. Johnston So eine Arbeit wird eigentlich nie fertig, man muss sie für fertig erklären, wenn man nach Zeit und Umständen das möglichste getan hat. (Johann Wolfgang von Goethe, Italienische Reise, 1787) DANKSAGUNG An dieser Stelle möchte ich mich herzlich bei folgenden Personen bedanken: . Prof. Dr. Alasdair M. Cook (Universität Konstanz, Deutschland), der mir dieses Thema und seine Laboratorien zur Verfügung stellte, . Prof. Dr. Bernhard Schink (Universität Konstanz, Deutschland), für seine spontane und engagierte Übernahme der Betreuung, . Prof. Dr. Andrew W. B. Johnston (University of East Anglia, UK), für seine herzliche und bereitwillige Aufnahme in seiner Arbeitsgruppe, seiner engagierten Unter- stützung, sowie für die Übernahme des Koreferates, . Prof. Dr. Frithjof C. Küpper (University of Aberdeen, UK), für seine große Hilfsbereitschaft bei der vorliegenden Arbeit und geplanter Manuskripte, als auch für die mentale Unterstützung während der letzten Jahre! Desweiteren möchte ich herzlichst Dr. David Schleheck für die Übernahme des Koreferates der mündlichen Prüfung sowie Prof. Dr. Alexander Bürkle, für die Übernahme des Prüfungsvorsitzes sowie für seine vielen hilfreichen Ratschläge danken! Ein herzliches Dankeschön geht an alle beteiligten Arbeitsgruppen der Universität Konstanz, der UEA und des SAMS, ganz besonders möchte ich dabei folgenden Personen danken: . Dr. David Schleheck und Karin Denger, für die kritische Durchsicht dieser Arbeit, der durch und durch sehr engagierten Hilfsbereitschaft bei Problemen, den zahlreichen wissenschaftlichen Diskussionen und für die aufbauenden Worte, .
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast Cancer
    Supplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • A Rapid Transcriptome Response Is Associated with Desiccation Resistance in Aerially-Exposed Killifish Embryos
    A Rapid Transcriptome Response Is Associated with Desiccation Resistance in Aerially-Exposed Killifish Embryos Ange`le Tingaud-Sequeira1¤a, Juan-Jose´ Lozano2, Cinta Zapater1, David Otero1, Michael Kube3¤b, Richard Reinhardt3¤c, Joan Cerda` 1* 1 Institut de Recerca i Tecnologia Agroalimenta`ries (IRTA)-Institut de Cie`ncies del Mar, CSIC, Barcelona, Spain, 2 Bioinformatics Platform, CIBERHED, Barcelona, Spain, 3 Max Planck Institute for Molecular Genetics, Berlin-Dahlem, Germany Abstract Delayed hatching is a form of dormancy evolved in some amphibian and fish embryos to cope with environmental conditions transiently hostile to the survival of hatchlings or larvae. While diapause and cryptobiosis have been extensively studied in several animals, very little is known concerning the molecular mechanisms involved in the sensing and response of fish embryos to environmental cues. Embryos of the euryhaline killifish Fundulus heteroclitus advance dvelopment when exposed to air but hatching is suspended until flooding with seawater. Here, we investigated how transcriptome regulation underpins this adaptive response by examining changes in gene expression profiles of aerially incubated killifish embryos at ,100% relative humidity, compared to embryos continuously flooded in water. The results confirm that mid-gastrula embryos are able to stimulate development in response to aerial incubation, which is accompanied by the differential expression of at least 806 distinct genes during a 24 h period. Most of these genes (,70%) appear to be differentially expressed within 3 h of aerial exposure, suggesting a broad and rapid transcriptomic response. This response seems to include an early sensing phase, which overlaps with a tissue remodeling and activation of embryonic development phase involving many regulatory and metabolic pathways.
    [Show full text]