INAUGURAL DISSERTATION Florian Herrmann

INAUGURAL DISSERTATION

submitted to the

Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany

for the degree of

Doctor of Natural Sciences

Presented by

Florian Herrmann Apotheker (Staatsexamen) born in Karlsruhe, Germany

Oral examination: 12.10.2011

TCM Plants: DNA Barcoding, Cytotoxic and Trypanocidal Properties of Drugs and Their Active Constituents

This work was carried out in the Department of Biology, Institute for Pharmacy and Molecular Biotechnology (IPMB), Im Neuenheimer Feld 364, 69120 Heidelberg at the Ruprecht-Karls-University of Heidelberg between February 2006 and August 2011.

Head of division: Prof. Dr. Michael Wink

Supervisor: Prof. Dr. Michael Wink Department of Biology, IPMB Ruprecht-Karls-University Heidelberg

1st Referee: Prof. Dr. Michael Wink Department of Biology, IPMB Ruprecht-Karls-Universiität Heidelberg

2nd Referee: Prof. Dr. Thomas Efferth Institute for Pharmacy and Biochemistry Johannes Gutenberg-Universität Mainz

Publications

F. Herrmann , R. Hamoud, F. Sporer, A. Tahrani, M. Wink: Carlina oxide – a natural polyacetylene from Carlina acaulis (Asteraceae) with potent antitrypanosomal and antimicrobial properties! In press, Planta Medica; published online June 15, 2011 DOI http://dx.doi.org/10.1055/s-0031-1279984

F. Herrmann , M. Wink: Synergistic interactions of saponins and monoterpenes in HeLa cells, Cos7 cells and in erythrocytes In press, Phytomedicine

F. Herrmann , F. Sporer, A. Tahrani, M. Wink: Antitrypanosomal properties of Panax ginseng CA Meyer – new possibilities for a remarkable traditional drug! Submitted, Phytotherapy Research

F. Herrmann , M. Wink: Cytotoxicity of structurally diverse ginsenosides from Panax ginseng in HeLa cells is linked to membrane disturbances Submitted, Journal of Pharmacy and Pharmacology

F Herrmann , M. R. Romero, A.G. Blazquez, D. Kaufmann, M. L. Ashour, S. Kahl, J.J.G. Marin, T. Efferth, M. Wink: Cytotoxicity, antiviral and antitrypanosomal screening of 82 plants from Chinese and European phytomedicine Submitted, Diversity

F. Herrmann , M. Wink: Use of rbc L sequences for DNA barcoding and authentication of plant drugs used in Traditional Chinese Medicine Submitted, Zeitschrift für Naturforschung

N.Z. Mamadalieva §, F. Herrmann §, M.Z. El-Readi, A. Tahrani, R. Hamoud, D. Egamberdieva, Sh.S. Azimova, M. Wink: Flavonoids in Scutellaria immaculata and S. ramosissima and their biological activities In press, Journal of Pharmacy and Pharmacology §Equal distributed authors

T. Efferth, F. Herrmann , A. Tahrani, M. Wink: Cytotoxic activity towards cancer cells of arteanuine B, artemisitene, scopoletin and 1.8-cineole derived from Artemisia annua L. in comparison to artemisinin In press, Phytomedicine 2011 DOI 10.1016/j.phymed.2011.06.008

D. Hamdan, M. Z. El-Readi, A. Tahrani, F. Herrmann , D. Kaufmann, N. Farrag, A. El-Shazly, M. Wink: Chemical composition and biological activity of Citrus jambhiri Lush. Food Chemistry 2011, 127: 394-403

D. Hamdan, M. Z. El-Readi, A. Tahrani, F. Herrmann , D. Kaufmann, N. Farrag, A. El-Shazly, M. Wink: Secondary metabolites of ponderosa lemon (Citrus pyriformis Hassk) and their antioxidant, anti-inflammatory and cytotoxic activities In press, Zeitschrift für Naturforschung 2011

S. Mulyaningsih, M. Youns, M. Z. El-Readi, M. L. Ashour, E. Nibret, F. Sporer, F. Herrmann , J. Reichling, M. Wink: Biological activity of the essential oil of Kadsura longipedunculata (Schisandraceae) and its major components Journal of Pharmacy and Pharmacology 2010, 62: 1037–1044

Table of Contents Summary ………………...………………………………………………………………..….…....7 Summary (German) ……………………………………………………………………...………..8 1. General Introduction …………………………………………...………...…………….………9 1.1 Traditional Chinese Medicine……………………………………………….………..9 1.1.1 Traditional Chinese Medicine…………………………………….……………...9 1.1.2 Chinese herbal medicine………………………………………………………..11 1.2 Secondary metabolites………………………………………………………………12 1.2.1 Ecological function…………………………………………………………...12 1.2.2 Biosynthesis…………………………………………………………………..12 1.2.3 Storage………………………………………………………………………..12 1.2.4 Classes of secondary metabolites……………………………………………….13 1.2.5 Mode of action………………………………………………………………..14 1.3 African Trypanosomiasis……………………………………………………………17 1.3.1 Epidemiology…………………………………………………………………17 1.3.2 Classification……………………………………………………………………17 1.3.3 Biology………………………………………………………………………..17 1.3.4 Control………………………………………………………………………..19 1.3.5 Targets……...………...……………………………………………………….21 1.4 References…………………………………………………………………………...24 2. Use of rbc L sequences for DNA barcoding and authentication of plant drugs used in Traditional Chinese Medicine ………………..………………………...……………………….31 2.1 Abstract……………………………………………………………………………...31 2.2 Introduction………………………………………………………………………….31 2.3 Material and Methods……………………………………………………………….34 2.4 Results……………………………………………………………………………….34 2.5 Discussion…………………………………………………………………………...36 2.6 References…………………………………………………………………………...42 3. Cytotoxicity, antitrypanosomal and antiviral screening of 82 plants from Chinese and European phytomedicine ………………………..………………………………………………45 3.1 Abstract……………………………………………………………………………...45 3.2 Introduction………………………………………………………………………….45 3.3 Material and Methods……………………………………………………………….48 3.4 Results and Discussion……………………………………………………………...56 3.5 References…………………………………………………………………………...74

4. Cytotoxicity of 12 structurally diverse ginsenosides from Panax ginseng in HeLa cells is linked to membrane disturbance …………………………...………...…………………………81 4.1 Abstract……………………………………………………………………………...81 4.2 Introduction………………………………………………………………………….81 4.3 Material and Methods……………………………………………………………….84 4.4 Results……………………………………………………………………………….85 4.5 Discussion…………………………………………………………………………...85 4.6 References…………………………………………………………………………...91 5. Antitrypanosomal properties of Panax ginseng CA Meyer – new possibilities for a remarkable traditional drug! ...... 95 5.1 Abstract……………………………………………………………………………...95 5.2 Introduction………………………………………………………………………….95 5.3 Material and Methods……………………………………………………………...101 5.4 Results…………………………………………………………………………..….105 5.5 Discussion……………………………………………………………………….....107 5.6 References………………………………………………………………………….116 6. Carlina oxide – a natural polyacetylene from Carlina acaulis (Asteraceae) with potent antitrypanosomal and antimicrobial properties! ...... 126 6.1 Abstract…………………………………………………………………………….136 6.2 Introduction………………………………………………………………………...126 6.3 Material and Methods……………………………………………………………...127 6.4 Results……………………………………………………………………………...132 6.5 Discussion………………………………………………………………………….133 6.6 References………………………………………………………………………….138 7. Synergistic Interactions of Saponins and Monoterpenes in HeLa cells, Cos7 Cells and in Erythrocytes .…………………...…………………………………...…………………………..141 7.1 Abstract…………………………………………………………………………….141 7.2 Introduction………………………………………………………………………...141 7.3 Material and Methods……………………………………………………………...144 7.4 Results……………………………………………………………………………...146 7.5 Discussion………………………………………………………………………….148 7.6 References………………………………………………………………………….157 8. General conclusion and outlook ………………………………………..…………………...160 9. Acknowledgements …..………………………………………………..……………………..163 10. Appendix ………………………………………………………………………..…………...165

Summary

Our extensive screening of 82 herbal drugs used in traditional Chinese and European Phytomedicine revealed the great potential still hidden in this field of research. The correct authentication of plants used in research on traditional medicinal systems such as TCM is crucial before any serious research can be started. DNA barcoding offers a reliable, fast possibility to overcome this obstacle. Only one adulteration could be detected where Arctium lappa was wrongly labelled Fraxinus rhynchophylla . After screening 246 extracts of herbal drugs against a variety of targets such as trypanosomes, viruses and cancer cells we were able to select several highly promising plants for further research. We decided to focus our research on Panax ginseng , Araliaceae, a well known herbal medicine of international fame and a long history of traditional use. Our experiments revealed that ginsenosides, a highly variable group of saponins, disturb the biomembrane of cells, while the exact position of the sugar moieties and the resulting ability to be incorporated into the lipid bilayer of the cell membrane explain the great differences in their cytotoxicity. The membrane activity of the ginsenosides however was not responsible for the trypanocidal effect of ginseng revealed in our screening. Panaxynol, the major polyacetylene of ginseng was with an IC 50 concentration of 0.01 µg/ml and a selectivity index of 858 three times as selective against Trypanosoma brucei brucei as established antitrypanosomal drugs like suramin. We were able to discover with Carlina oxide isolated from Carlina acaulis , Asteraceae, a second polyacetylene highly selective in its cytotoxicity against T. b. brucei with an IC 50 of 1.0 µg/ ml and a selectivity index of 446. We suggest that the inhibition of the trypanothione reductase, essential for the resistance of the parasite against oxidative stress and unique to trypanosomes, is the primary principle of this selectivity. Our previous results obtained from the activity of ginsenosides had shown us the efficacy, but also the structure dependency of the membrane effects of saponins. With monoterpenes we have a second group of structurally completely different natural products that also target the biomembrane. The question arose if their omnipresence in phytomedicine and their application in combination would be more than just a coincidence. We combined several saponins with three monoterpenes and explored their effect on biomembranes modelled by erythrocytes and living cells. Astonishingly, the combination lowered the dosis necessary for haemolysis up to the factor 100, which was also confirmed in living cells. This revealed that monoterpenes and saponins are working together synergistically by enhancing their activity far above a simple additive effect.

Summary (German) Wir untersuchten in einem umfangreichen Screening 82 Pflanzendrogen der traditionellen Chinesischen und Europäischen Phytomedizin. Dabei bildet die korrekte Identifizierung der zu testenden Arten die entscheidende Voraussetzung für jegliche weiterführende Untersuchung. Wir benutzten erfolgreich DNA Barcoding zur Identifizierung und fanden nur eine einzige Verfälschung: Arctium lappa war fälschlicherweise als Fraxinus rhynchophylla ausgegeben worden. Durch unser umfangreiches Screening von 246 Extrakten gegen Trypanosomen, Viren und Krebszellen gelang es uns, mehrere vielversprechende Pflanzen für weiterführende Untersuchungen auszuwählen. Besonders interessant erschien uns dabei Panax ginseng , Araliaceae, eine bemerkenswerte Heilpflanze mit langer Geschichte. Die Wirkung von Ginseng wird üblicherweise den Ginsenosiden, einer speziellen Gruppe von Saponinen, zugeschrieben. Dementsprechend untersuchten wir die Wirkung von 12 Ginsenosiden und konnten feststellen, dass die Position der Zuckergruppe am Molekül hauptverantwortlich für die großen Unterschiede in ihrer zytotoxischen Wirkung auf Zellmembranen ist. Eine Erklärung für die im Screening beobachtete Wirkung der Ginsengextrakte gegenüber Trypanosomen lieferten diese Ergebnisse jedoch nicht. Bei näherer Untersuchung der Hexanextrakte konnten wir feststellen, dass Panaxynol, das

Hauptpolyacetylen von Ginseng Trypanosoma brucei brucei gegenüber hoch selektiv ist (IC 50 1.0 µg/ ml). Der Selektivitätsindex war mit 858 dreimal höher als der gängiger Arzneistoffe wie Suramin. Mit Carlinaoxid aus Carlina acaulis , Asteraceae, konnten wir ein weiteres gegenüber Trypanosomen hochselektives Polyacetylen entdecken (IC 50 1.0 µg/ ml bei einem Selektivitätsindex von 446). Als Wirkungsmechanismus für beide Polyacetylene schlagen wir die Hemmung der Trypanothionreduktase vor; dieses Enzym kommt nur in Trypanosomen vor und ist unverzichtbar für deren Schutz vor oxidativem Stress. Die Membranaktivität der Ginsenoside veranlasste uns, die Wirkung von Saponinen in der Phytomedizin näher zu untersuchen. Besonders auffällig ist dabei, dass Saponindrogen oft mit Monoterpendrogen in Erkältungstees kombiniert werden. Da sich beide Stoffgruppen strukturell stark unterscheiden, aber trotzdem denselben Angriffspunkt, die Biomembran, besitzen, wollten wir wissen, ob diese Kombination die Wirkung verstärken würde. Wir kombinierten mehrere Saponine mit Monoterpenen und untersuchten ihre Wirkung auf kernlose Erythrozyten und lebende Zellen. Erstaunlicherweise senkte diese Kombination die für Hämolyse nötige Dosis an Saponin um den Faktor 100, was sich auch in lebenden Zellen bestätigte. Dies zeigt, dass Monoterpene und Saponine ihre Aktivität weit über einen additiven Effekt hinaus synergistisch verstärken.

1. General Introduction 1.1 Traditional Chinese Medicine 1.1.1 Traditional Chinese Medicine Traditional Chinese Medicine is as old as China itself. The beginnings of acupuncture and herbal medicine seem to date back to even before the Shang Dynasty (c. 1600 to 1045 BC) [1-4]. Our main knowledge besides historical descriptions from later dynasties such as the Shiji by Sima Qian is based on oracle bones with an archaic form of Chinese characters and bronze vessels. Basic Chinese imperial ideas such as the legitimization of the ruler by the Mandate of Heaven or ancestor worship date to this period [2-4]. The philosophical concept of the TCM theory however developed during the Han Dynasty (202 BC to 220 AD) [1,5]. The Han Dynasty is generally regarded as the period when classical Chinese

Fig. 1: Shi si jing fa hui (Expression of the Fourteen culture became consolidated. Meridians) Confucianism was adopted as state Tokyo : Suharaya Heisuke kanko, Kyoho gan 1716 philosophy, and the country made great advances in many areas of the arts and sciences. Military expansion enabled the Han Dynasty to form trade links across the Silk Road to the west [2-4]. In this climate of progress medicine could also flourish and changed from local traditions to a theoretical concept that was accepted all over China. Confucianism was essential for this development by creating the ideological framework the different local adaptations could be fitted into [1]. The famous Huangdi Neijing, commonly regarded as the beginning of TCM, dates to the second century BC [1]. From then, the medicinal theory developed continuously until the system we know today was created. This development is always linked to individual, outstanding physicians, such as Hua Tuo, who lived during the late Han Dynasty and introduced surgery, or Sun Simiao who wrote the first Chinese encyclopedia of medicine during the Tang Dynasty (618 to 907 AD) [1]. Li Shizhen wrote the essential book on the Chinese herbal medicine, the

Compendium of Materia Medica (Bencao Gangmu) during the Ming Dynasty (1368 to 1644 AD) [1]. TCM experienced a revival in simplified form under Mao who wanted the system standardized to overcome the catastrophic healthcare situation in the countryside. Based on this, the modern TCM developed and became increasingly popular in the west.

Theoretical concept of TCM Contrary to western medicine, TCM has a holistic approach to illness and medical treatment. The main concept is to balance the different functions of the body [5]. According to TCM, all aspects of the human body are linked, which can be exemplified by the pulse or tongue diagnosis used to draw conclusions about the general state of health of the patient [6]. An illness is commonly regarded as a disturbance of the harmony, which can be diagnosed in various ways [5]. Due to the holistic approach, the treatment also has to be a holistic one. Rather than to treat the symptoms or a specific illness, the concept seeks to restore the harmony and thus to treat the roots of the illness.

To understand TCM, it is necessary to know some of the basic principles. The concept of dualism, commonly refered to as yin and yang is crucial for TCM [5,6]. Yin and yang, the two aspects of everything, are the basis of all treatment. Stemming from this are the qi, the five elements, and the meridians [5,6]. Qi is often explained as life energy, but has a far broader application in Chinese philosophy. The five elements are closely linked to the organs of the body and are essential for the general diagnosis. The meridian system, on the other hand, is used in the treatment and detailed analysis of the health disorder (Fig. 1). Disturbances of the flow of qi, the life energy, can be diagnosed in this way. The theoretical basis of acupuncture can be found here as well [5].

From the western point of view the complex theoretical system of TCM is a way to discribe symptoms. The resulting treatment is based on long evidence based experimental knowledge integrated into the philosophical world view of the Chinese cultural tradition.

Major methods of treatment Acupuncture is the best known aspect of TCM and is increasingly used in the west as well to treat pain related health problems [6]. Patients are treated by insertion of needles into the body on the meridian points. It is often combined with moxibustion, the burning of Artemisia closely above the meridian points. Two variations exist – either the moxa ( Artemisia spec.) is

held above the meridian points and burned or it is added on top of an acupuncture needle and then ignited. Another common method to treat health problems is the cupping (Ba Guan) [6]. Several glass cups are placed on top of specific body parts, commonly the back. Due to an applied vacuum, the cups form pressure on the skin. The physician can diagnose the health problem from the effect on the skin. It is also used to treat muscle pain and back ache, and is partly related to massage techniques. The Tui Na massage is another method to restore the undisturbed flow of qi in the body and thus forms an important part in the holistic treatment traditionally applied in TCM [6].

1.1.2 Chinese herbal medicine Chinese herbal medicine is integrated into the theoretical concept of TCM by sorting the herbs according to attributed properties such as cooling, heating, etc [7-11]. According to the theoretical concept, they are used to counterbalance deficiencies caused by diseases. Diseases causing a lack of heat thus are treated with herbs that possess heating properties to restore the balance in the human body [5,6,9]. However, we should not regard it as so simple since the long historical use and the huge number of herbs used in TCM allows a very individualized and specific treatment (Fig. 2). The combination of 10 or more herbs per Fig. 2: Chinese herbal medicine store in formulation gives the physician the Beijing, 2006 possibility to individualize the treatment in a way not possible in western medicine [9]. Behind the theoretical concept of TCM thus is a solid phytotherapy based on thousands of years of experience. The large area of China combines various climatic zones from tropics over deserts to high altitudes, providing the basis for an especially rich flora [2]. Consequently TCM uses a huge number of medicinal plants that by far exceeds those used in European phytotherapy [7-11]. Currently, 4773 herbs are officially recognised for treatment in TCM, not to mention locally used plants that are not part of the Chinese pharmacopoeia [8].

1.2 Secondary metabolites 1.2.1 Ecological function Lacking the ability to avoid predators by flight or fight and lacking an immune system to fight microbes, plants developed two other methods to survive during 500 million years of evolution. One is the physical protection by bark or thorns, the other, secondary metabolites [12-18]. They are present in one form or another in all plants and form the most effective yet often unspecific defence system imaginable. So far more than 100 000 different substances have been identified that can be grouped in nitrogen-containing (alkaloids, amines, nonprotein amino acids, peptides, etc) and nitrogen-free (terpenes, phenolics, saponins, polacetylenes, etc) molecules [12]. They are synthesized in specific pathways and stored in specifically for this task developed compartments and cells. Due to their complexity, they form a highly effective defence system against herbivores, fungi, bacteria and even viruses. Additionally, they are also used in the struggle between plants for ecological advantages by attracting animals for pollination or by hindering the growth of competing plants for light or water [12]. Especially rich in secondary metabolites are usually those parts vital for reproduction such as seeds, flowers, etc [12].

1.2.2 Biosynthesis Contrary to the huge variability of natural products, the pathways used for their biosynthesis are few. Precursors are usually products of the primary metabolic pathways such as glucose or amino acids. These primary metabolites are the basis for the secondary metabolism. Here, the primary metabolites are transformed into secondary metabolites such as terpenes, saponins, alkaloids or tannins. Especially three pathways are essential for all plants: The glycolysis, the Krebs cycle and the Shikimate pathway. They are not only essential for the common processes in the cells such as respiration but also transform the primary metabolites into secondary metabolites. The different classes of secondary metabolites can generally be attributed to different pathways. While terpenes, saponins or fatty acids are among the products of the glycolysis, alkaloids are either products of the Krebs cycle or the Shikimate pathway. The Shikimate pathway is also involved in the production of flavonoids and tannins [19-25].

1.2.3 Storage Secondary metabolites usually need to be transported from their place of origin to the storage compartments. This transportation can occur within the cell or via the xylem and phloem to specific storage cells in remote parts of the plant.

Hydrophilic secondary metabolites are mainly stored in the vacuole but also in laticifers and cell walls [19,26-32]. Most alkaloids, saponins and flavonoids are commonly found in the vacuole, while several specific alkaloids are concentrated in the laticifers. Tannins are usually found in the vacuoles and cell walls. One peculiar feature is that many hydrophilic molecules such as saponins are stored as prodrugs and are only activated once the cell is hurt. The disruption of the cell compartments leads to the release of enzymes that activate the molecules to their final form. Lipophilic secondary metabolites can be stored in specific oil cells, the cuticle, resin ducts or simply in the plastid membranes [19,26,33]. Oil cells are a specific defence mechanism rich in terpenoids. Closely related is the storage of waxes and terpenoids in the cuticle. Resin ducts and plastid membranes also contain terpenoids and even lipophilic flavonoids.

1.2.4 Classes of secondary metabolites Alkaloids are the most variable group of secondary metabolites [14-17,34-38]. They usually interact with specific target proteins such as ion channels, receptors or enzymes. Similarities to neurotransmitters like acetylcholine or noradrenalin enable them to modify neuronal signal transduction [15,34,39-45]. Non-protein amino acids are analogues of the protein amino acids. They can be incorporated into proteins by enzymes instead of common amino acids, resulting in the malfunction of vital processes [34,46]. Cyanogenic glucosides are in the vacuole stored prodrugs that are activated by the rupture of the cell. β-glucosidases cleave the sugar off the molecule which is hydrolyzed into hydrocyanic acid (HCN) and an aldehyde. HCN is extremely reactive and blocks the mitochondrial respiration [34,40,47-50]. Glucosynolates are also stored as prodrugs and only activated by cell damage. They are cleaved into mustard oil by myrosinase and interact with biomembranes, enzymes or DNA [34,48-50]. Terpenes are a group of highly variable lipophilic molecules that interact with biomembranes and the lipophilic core of proteins. Their membrane activity is rather unspecific, resulting in an increase of membrane fluidity [34,50]. Saponins also target the biomembrane [34,50,51]. They are glycosides of triterpenes or steroids and appear as mono- and bidesmosidic molecules. Bidesmosidic saponins are prodrugs that need enzymatic activation prior to be able to interact with biomembranes. Monodesmosidic saponins are amphiphilic molecules that interact with the lipid bilayer and

proteins of the biomembrane. One subgroup of the saponins is the cardiac glycosides that target the Na +-K+-ATPase. Flavonoids and polyphenols are phydrophilic molecules that interact with proteins via phenolic hydroxyl groups. While flavonoids are sometimes target specific and interact with enzymes, the polyphenols with more phenolic hydroxygroups are usually much less specific and interact with all proteins present [14,34,50,52,53].

Fig. 3: Targets for secondary metabolites in animal cells after Wink 2008 [14]

1.2.5 Mode of action The animal cell offers a wide range of targets for secondary metabolites (Fig. 3). The principal ones are proteins, the biomembrane and nucleic acids.

Proteins are responsible for almost all processes in the cell. They act as receptors, ion channels, regulatory molecules such as transcription factors or signal molecules, transporters, catalytic enzymes and structural molecules. Their functionality depends on their three dimensional structure – any conformational change Fig. 4: Unspecific inter- usually modifies the activity of the protein [19,34]. Most action of polyphenols with secondary metabolites interact with proteins unselectively (Fig. 4). proteins after Wink 2008 [14]

They are not specific for certain proteins but interact with all proteins by forming covalent or ionic bonds with free amino-, SH- or OH-groups. Molecules with epoxide or aldehyde groups bind to amino groups, while molecules with double or triple bonds interact with free SH- groups and epoxides. The Hydroxylgroups of polyphenols dissociate under physiological conditions into O - ions that form hydrogen and ionic bonds with electronegative atoms and positively charged side chains of the amino acids. The presence of several polyphenols leads to interactions that are strong enough to inactivate proteins [19,34]. Besides the unselective interaction of polyphenols a lot of secondary metabolites interact quite specifically with enzymes and receptors. They bind to the active binding site of the molecule due to structural similarities to endogenous ligands. There, they either activate or inactivate proteins and disturb

for example the signal transduction of vital Fig. 5: Interaction of saponins [1], mono- [2,3] and sesquiterpenes [4] with the biomembrane of processes. This effect can be either reversible or, animal cells after Wink and Schimmer 2009 [34] in worst case, irreversible. Many neurotoxic alkaloids work this way [19,34,35,40].

The biomembrane (Fig. 5) is the second major target of secondary metabolites [19,34]. Contrary to many interactions with proteins is the interference with the biomembrane purely unspecific. Monodesmosidic saponins are amphiphilic molecules whose lipophilic part integrates into the biomembrane while the hydrophilic part interacts with proteins or sugars on the membrane surface. Thus the fluidity of the lipid bilayer is enhanced while the conformation of proteins is disturbed. Additionally the interactions with cholesterol in the lipid bilayer influence the microstructure of the biomembrane which also leads to conformational changes of receptors on the surface. Monoterpenes interact with the same target by integrating into the lipid bilayer and the lipophilic core Fig. 6: Intercalation of planar natural products into the DNA after Wink 2008 [14] of membrane proteins. Their interaction is

usually even less specific than that of saponins. They simply increase the membrane fluidity which results in leakage and eventually the rupture of the biomembrane.

The third major target of secondary metabolites is nucleic acids such as DNA (Fig. 6) and RNA [15,19,34,41,44,45]. Several natural products interfere with proteins necessary for the replication of DNA and mRNA. However, there exist also natural products that interact with the DNA directly. Epoxides and aldehydes like pyrrolizidine alkaloids or furanocoumarins bind covalently to functional groups of the DNA bases. Planar molecules with aromatic rings like the alkaloids berberine, emetine, quinidine or furanocumarins intercalate into the DNA by fitting between adenine-thymine or guanine-cytosine base pairs. There, they can cross-link DNA strands; a disturbed replication leads to apoptosis, mutations and even cancer.

1.3 African Trypanosomiasis 1.3.1 Epidemiology African trypanosomiasis or sleeping sickness is a parasitic disease found in most sub-Saharan countries. Human trypanosomiasis is caused by the protozoon Trypanosoma brucei rhodesiense and T. b. gambiense , while T. b. brucei, T. congolense, T. simiae and T. vivax are responsible for the cattle disease nagana [54-56]. T. b. gambiense is responsible for the chronic form of sleeping sickness with 90% of the cases. It occurs in west and central Africa, while T. b. rhodesiense , found in eastern and southern Africa, represents less than 10% of the cases and causes the acute form of the disease [57]. African trypanosomiasis is responsible for severe health and economic problems. After being nearly extinct in the middle of the 20 th century, it has been increasing since the independence of the African countries due to several reasons. The development of resistances against the commonly used drugs together with a decentralisation of the measures taken to fight African trypanosomiasis is among the reasons to explain this unfortunate trend. Nowadays, African trypanosomiasis is endemic again to 36 countries with 60 million people threatened by its consequences. Estimations of the WHO speak of 300 000 to 500 000 cases of human trypanosomiasis per year, while at least 46 million cattle are exposed to nagana, the cattle version of the disease [58-60].

1.3.2 Classification The different trypanosome species with Trypanosoma Domain Eukaryota brucei and Trypanosoma cruzi as famous representatives Kingdom Excavata form part of the order of the Trypanosomatida, a group of Phylum Euglenozoa Class Kinetoplastida exclusively parasitic, single-cell uniflagellates. The Order Trypanosomatida Trypanosomatida are an order of the class of the Genera Trypanosoma

Kinetoplastida, which consists mainly of parasitic, single-cell flagellates. Kinetoplastida can be separated into uniflagellates (Trypanosomastida) and biflagellates (Bodonida). The Kinetoplastida are part of the phylum Euglenozoa. Euglenozoa, which are separated into Kinetoplastida and Euglenida are unicellular organisms. While Euglenida often contain chloroplasts Kinetoplastida mostly are parasitic organisms. Euglenozoa are part of the kingdom of Excavata, one of the six kingdoms of the Eukaryota [61].

1.3.3 Biology Human African trypanosomiasis and nagana are transmitted to their mammalian hosts by the tsetse fly ( Glossina species) [54]. Accordingly, the occurrence of sleeping sickness is limited to the distribution of the tsetse fly. They inhabit most of mid-continental Africa between the Sahara and the Kalahari deserts. Tsetse flies are usually separated into savannah flies, forest flies and riverine flies based on their usual habitat and behaviour [62]. Only high altitudes and deserts are free of them. The name tsetse derives from Tswana, a language spoken in southern Africa and simply means fly [63].

Fig. 7: Life cycle of Trypanosoma brucei after CDC [64]

Life Cycle The life cycle of African trypanosomiasis includes a Tsetse fly stage and a human stage (Fig. 7). By taking a blood meal, the infected tsetse fly injects the metacyclic trypomastigotes into the host. Now the human stage starts with the transformation of the metacyclic trypomastigotes into bloodstream trypomastigotes. These are distributed in the human body and multiply by binary fission. At first they occur mostly in the blood and the lymphatic system. After crossing the blood-brain barrier, they invade the central nervous system and

cause irreparable damage to the brain. If left untreated, the disease is in most cases fatal. The human stage ends for the parasite with the uptake of the bloodstream trypomastigotes by a new tsetse fly bite. Once the parasite is in the tsetse fly midgut, the bloodstream trypomastigotes transform into the procyclic trypomastigotes which multiply again by binary fission. In the next step the procyclic trypomastigotes leave the midgut and transform into epimastigotes. These wander into the salivary glands of the fly where they multiply once more by binary fission. Finally, they transform into metacyclic trypomastigotes and the cycle is closed [64,65].

Kinetoplast The Kinetoplastida are named after their kinetoplast, a unique feature existing only in this class of single cell eucaryots. It is found at the base of the flagella and connected to the flagellum basal body via the cytoskeleton. The kinetoplast is a dense granule containing the mitochondrial genome with the associated structural proteins and DNA and RNA polymerases in the single mitochondrion of the cell [66]. The genome of T. brucei is made up of 11 pairs of large chromosomes, 3 to 5 intermediate chromosomes containing mostly genes responsible for the antigenic variation such as the VSG genes and up to 100 mini chromosomes [66]. The genes are organised in polycistronic units, so that they are transcribed at an equivalent rate. This requires post-transcriptional regulations to control the gene expression. The advantage of this system is the avoidance of transcription factors which allows a fast reaction to adapt to a new environment that occurs during the change of the host from tsetse fly to human [67].

Variable Surface Glycoprotein The Variable Surface Glycoprotein (VSG) hides T. brucei from the host’s immune system, enabling a chronic infection. The surface of the trypanosome is densely covered with approximately 1x10 7 molecules of highly variable VSG, which shields the plasma membrane from the immune reaction of the host. Each trypanosome expresses only one VSG gene at a time, while the other genes are inactive [68,69]. VSGs occur in dimers and have a highly variable N terminal domain of between 300 and 350 amino acids, a conserved C terminal domain of approximately 100 amino acids and are anchored in the cell membrane by a glycophosphatidylinositol (GPI) anchor. Their tertiary structure is conservative enough to form a physical barrier to protect the cell membrane [70]. The immune system reacts strongly to the VSG protein and would destroy the trypanosome. However, each cell division of the parasite results in a stochastic genetic modification of the VSG, which makes an immune

reaction against T. brucei almost impossible due to the short period between each division cycle. Accordingly, the trypanosomes occur in waves in the blood and the disease persists chronically in the host [71].

1.3.4 Control The control of African trypanosomiasis includes the control of its vector, the tsetse fly and the treatment of the disease in the patient. Frequently applied measures of vector control include pesticides, trapping and the release of sterile males. The use of sterile male tsetse flies has been especially successful due to the specific breeding habit of the flies since tsetse fly females mate only once in their life. Sterile males are released in an infected area in great numbers, where they will compete with the local males and mate with the local females. Accordingly, all unions with sterile males will have no offspring, thus dropping the numbers of tsetse flies in the area significantly. Land clearing can be locally of use by removing the habitat of the tsetse fly but are not practicable in the larger scale [54].

Fig. 8: Approved drugs against African trypanosomiasis

The medical treatment of African trypanosomiasis is still problematic. Only four drugs are licensed for the treatment of African trypanosomiasis (Fig. 8): Suramin, pentamidine, melarsoprol and eflornithine [56,72-78].

Pentamine is the drug of choice against T. b. gambiense while suramin can be used as alternative. T. b. rhodesiense is preferably treated with suramin. Once the disease invades the central nervous system, either eflornithine or melarsoprol are applied [79]. Except for eflornithine, which was introduced in 1990, all drugs for the treatment of African trypanosomiasis date to the first half of the 20 th century. The mode of action of suramin and melarprosol are unknown, while pentamidine is enriched in the parasite and attacks a whole range of unspecific targets. Eflornithine is a suicide inhibitor of the ornithine decarboxylase [80,81]. Unfortunately, all of these drugs have strong side effects and several resistances were reported recently [82-85], so that the discovery of new drugs is an urgent necessity [86-88].

1.3.5 Targets Trypanothione reductase

Fig. 9: Trypanothione reductase with binding site after Bond et al ., 1999 [92]

The trypanothione reductase (Fig. 9) is an enzyme specific to trypanosomastids and essential for the protection of the cell against oxidative stress [81,89-92] and an exciting new target for

drugs against African trypanosomiasis. Mammalian cells use the closely related gluthatione reductase instead. Both enzymes are members of the FAD-dependent NADPH oxidoreductase family. These dimeric molecules protect the cell against reactive oxygen species formed during the aerobic metabolism, since trypanosomes are extremely sensitive to oxidative stress.

Fig. 10: The equilibrium of trypanothione disulfide and trypanothione is kept on the side of trypanothione by NADPH and the trypanothione reductase after Krauth-Siegel et al ., 2005 [81]

Trypanothione is kept in its reduced form in the cell by NADPH and the trypanothione reductase (Fig. 10). In the presence of reactive oxygen species like hydroperoxides trypanothione reacts to trypanothione disulfide while the reactive oxygen species are reduced

[92]. The equilibrium of TS 2 and T(SH) 2 can only be kept on the side of T(SH) 2 if the trypanothione reductase is working properly. Once it is inactive, the equilibrium changes rapidly to

TS 2 which can not inactive the reactive oxygen species resulting in the death of the cell.

The two enzymes are able to distinguish their substrates trypanothione disulfide and glutathione disulfide by the factor 1000 because of differences in size and charge [92]. Glutathione disulfide is smaller and -2 charged at physiological pH, while trypanothione disulfide is +1 charged with a hydrophobic body of 7 methylene groups (Fig. 11).

The trypanothione disulfide binding site in the Fig. 11: Glutathione disulfide (a) and trypanothione disulfide (b) after Bond et trypanothione reductase is larger with a negatively al., 1999 [9 2]

charged glutamate side chain and a hydrophobic cleft for the polyamine moiety. Contrary to this, the glutathione reductase has a positively charged, smaller active centre. Recently, the importance of the trypanothione reductase as a target for the selective inhibition of trypanosomes has gained wide recognition. Research is focusing on the discovery of selective inhibitors with several promising findings such as polyamine-based inhibitors or tricyclic compounds [81]. However, none have reached the clinical phase yet. Other trypanothione disulfide dependent enzymes can also be regarded as potential targets for a selective inhibition of T. brucei . Especially interesting are those enzymes important for the biosynthesis of trypanothione disulfide such as S-adenosylmethionine decarboxylase [93,94] or trypanothione synthetase [93,95].

Trypanosome alternative oxidase The bloodstream forms of trypanosomes entirely depend on the conversion of glucose into pyruvate for their ATP production. Under aerobic conditions, only pyruvate is produced, while under anaerobic conditions glucose is converted into similar amounts of pyruvate and glycerol. Characteristically for trypanosomes is that glycolysis occurs to the biggest part in compartments and not in the cytoplasma [96]. The production of ATP depends on a reoxidation system with the trypanosome alternative oxidase (TAO) as one of the essential enzymes [93]. TAO is unique for trypanosomes and located in the inner membrane of the mitochondrion. In the process of ATP production glycerol 3-phosphate is converted into glycerol, while ADP is converted into ATP. As an essential part of the ATP production TAO is accordingly an interesting target for the development of new antitrypanosomal drugs. Without it, the production of ATP depends on high glycerol 3-phosphate concentrations and a high ADP/ATP ratio. The inhibition of TAO decreases the ATP concentration significantly; in combination with additional glycerol the ATP production is completely blocked [97]. Accordingly, the complete energy production of trypanosome is inhibited with fatal consequences for the parasite.

Topoisomerase and kinetoplast DNA A second important target is the kinetoplast with its unique mitochondrial DNA and topoisomerases [66]. Several natural products are known to inhibit cell growth by intercalation into the DNA. Examples are berberine and sanguinarine [93,98]. Camptothecin is a DNA topoisomerase inhibitor known for its selective cytotoxicity against tumor cells. It exhibits also a strong cytotoxitic effect against T. brucei [93,99] .

1.4 References

1 Unschuld PU (1980). Medizin in China. Eine Ideengeschichte. 1 st ed., C.H. Beck, München.

2 Ebrey PB, Walthall A, Palais JB (2006). East Asia. A Cultural, Social and Political History. 1st ed., Houghton Mifflin Comp., Boston.

3 Ebrey PB (1996). China. 1 st ed., Cambridge University Press.

4 Goepper R, Brinker H, Dietsch KA (1988). Das alte China. 1 st ed., C. Bertelsmann, München.

5 Sapriel M, Stoltz P (2006). Une introduction a la médicine traditionelle chinoise: Le corps théorique. 1st ed., Sringer, Berlin.

6 Meng A (2005). Gesundheitsvorsorge mit TCM. Philosophie – Krankheitslehre – Diagnostik – Therapie. 1st ed., Springer, Wien.

7 Wu JN (2005). An illustrated Chinese materia medica, 1 st ed., Oxford University Press

8 Chinese Pharmacopoeia (2005)

9 Reid D (2001). A handbook of Chinese healing herbs, 1 st ed., Periplus, Singapore

10 Jiangsu New Medicine College Editorial Board (1995). A Grand Dictionary of Chinese Medicinal Herbs, 3rd ed., Shanghai Science Technology Publishing Co., Shanghai

11 van Wyk BE, Wink M (2004): Medicinal Plants of the World, BRIZA, Pretoria

12 Wink M (2009). Introduction, Chapter 1. Annu Plant Rev . 39, 1-20.

13 Wink M (2009). Introduction: biochemistry, physiology and ecological function of secondary metabolites, in Annual Plant Reviews Vol. 20: Biochemistry of Plant Secondary Metabolism , 2nd edn (ed. M. Wink), Blackwell, Oxford.

14 Wink M (2008). Evolutionary advantage and molecular modes of action of multicomponent mixtures used in phytomedicine. Curr Drug Metab . 9, 996-1009.

15 Wink M (1993). Allelochemical properties and the raison d’être of alkaloids, in The Alkaloids , Vol. 43 (ed. G. Cordell), Academic Press, Orlando, pp. 1-118.

16 Wink M (1992). The role of quinolizidine alkaloids in plant insect interactions, in Insect- Plant Interactions , Vol. IV (ed. E.A.Bernays), CRC Press, Boca Raton, pp. 133-169.

17 Wink M (1988). Plant breeding: importance of plant secondary metabolites for protection against pathogens and herbivores. Theor Appl Gen . 75, 225-233.

18 Hartmann T (2007). From waste products to ecochemicals: fifty years research of plant secondary metabolism. Phytochemistry . 68, 2831-2846.

19 Wink M (2010). Biochemistry, Physiology and Ecological Function of Secondary Metabolites. Chapter 1, Introduction. Annu Plant Rev . 40, 1-19.

20 Dewick PM (2002). Medicinal Plant Products. A Biosynthetic Approach , 2 nd edn. Wiley, New York.

21 Seigler DS (1998). Plant Secondary Metabolism . Kluwer, Norwell.

22 Dey PM, Harborne JB (1997). Plant Biochemistry . Academic Press, San Diego.

23 Luckner M (1990). Secondary Metabolism in Microorganisms, Plants and Animals . Springer, Heidelberg.

24 Conn EE (1981). Secondary plant products, in The Biochemistry of Plants , Vol. 7. Academic Press, New York.

25 Bell EA, Charlwood BV (1980). Secondary Plant Products . Springer, Heidelberg.

26 Kutchan TM (2005). A role for intra- and intercellular translocation in natural product biosynthesis. Curr Opin Plant Biol . 8, 292-300.

27 Yazaki K (2005). Transporters of secondary metabolites. Curr Opin Plant Biol . 8, 301-307.

28 Wink M (1997). Compartmentation of secondary metabolites and xenobiotics in plant vacuoles. Adv Bot Res . 25, 141-169.

29 Wink M (1993). The plant vacuole: a multifunctional compartment. J Exp Bot . 44, 231-246.

30 Boller T, Wiemken A (1986). Dynamics of vacuolar compatmentation. Annu Rev Plant Physiol . 37, 137-164.

31 Matile P (1984). Das toxische Kompartiment der Pflanzenzelle. Naturwissenschaften . 71, 18-24.

32 Matile P (1978). Biochemistry and function of vacuoles. Annu Rev Plant Physiol . 29, 193- 213.

33 Wiermann R (1981). Secondary plant products and cell and tissue differentiation, in The Biochemistry of Plants , Vol 7. Academic Press, New York.

34 Wink M, Schimmer O (2010). Molecular Modes of Action of Defensive Secondary Metabolites. Chapter 2. Annu Plant Rev . 39, 21-161.

35 Roberts MF, Wink M (1998). Alkaloids: Biochemistry, Ecology and Medicinal Applications . Plenum Press, New York.

36 Hartmann T (1991). Alkaloids, in Herbivores: Their Interaction with Secondary Metabolites , Vol. 1 (eds G.A. Rosenthal and M.R. Berenbaum), Academic Press, San Diego, pp. 79-121.

37 Swain T (1977). Secondary compounds as protective agents. Ann Rev Plant Physiol . 28, 479-501.

38 Levin DA (1976). The chemical defenses of plants to pathogens and herbivores. Ann Rev Ecol Syst . 7, 121-159.

39 Roberts MF, Strack D (1999). Biochemistry and physiology of alkaloids and betalains, in Annual Plant Reviews, Vol. 2: Biochemistry of Plant Secondary Metabolism (ed. M. Wink), Sheffield Academic Press, Sheffield, England, pp. 17-78.

40 Wink M, van Wyk BE (2008). Mind-Altering and Poisonous Plants of the World . BRIZA, Pretoria.

41 Wink M (2007). Molecular modes of action of cytotoxic alkaloids: from DNA intercalation, spindle poisoning, topoisomerase inhibition to apoptosis and multiple drug resistance, in The Alkaloids (ed. G. Cordell), Vol. 64, Elsevier, London, pp. 1-48.

42 Wink M (2000). Interference of alkaloids with neuroreceptors and ion channels, in Bioactive Natural Products (ed. Atta-ur-Rahman), Elsevier, Amsterdam pp. 1-127.

43 Wink M (1999). Annual Plant Reviews , Vol. 3: Function of Plant Secondary Metabolites and Their Exploitation in Biotechnology. Sheffield Academic Press, Sheffield, England.

44 Wink M, Latz-Brüning B, Schmeller T (1998). Biochemical effects of allelopathic alkaloids, in Principles and Practices in Chemical Ecology (eds Inderjit, K.M.M. Dakshini and C.L. Foy), CRC Press, Boca Raton.

45 Wink M, Schmeller T, Latz-Brüning B (1998). Modes of action of allelochemical alkaloids: interaction with neuroreceptors, DNA and other molecular targets. J Chem Ecol . 24, 1881- 1937.

46 Rosenthal GA (1982). Plant Nonprotein Amino and Imino Acid . Academic Press, New York.

47 Conn (1980). Cyanogenic glycosides, in Secondary Plant Products (eds E.A. Bell and B.V. Charlwood), Springer, Berlin, pp. 461-492.

48 Selmar D (2010). Biosynthesis of cyanogenic glycosides, glucosinolates and nonprotein amino acids, in Annual Plant Reviews, Vol. 40: Biochemistry of Plant Secondary Metabolism (ed. M. Wink), Blackwell, Oxford, Chapter 3.

49 Selmar D (1999). Biosynthesis of cyanogenic glycosides, glucosinolates and nonprotein amino acids, in Annual Plant Reviews, Vol. 2: Biochemistry of Plant Secondary Metabolism (ed. M. Wink), Sheffield Academic Press, Sheffield, England, pp. 79-150.

50 van Wyk BE, Wink M (2004). Medicinal Plants of the World . BRIZA, Pretoria.

51 Ashour M, Wink M, Gershenzon J (2010). Biochemistry of terpenoids: sterols, cardiac glycosids and steroid saponins, in Annual Plant Reviews, Vol. 40: Biochemistry of Plant Secondary Metabolism (ed. M. Wink), Blackwell, Oxford, Chapter 5.

52 Petersen M, Hans J, Matem U (2010). Biosynthesis of phenylpropanoids and related compounds, in Annual Plant Reviews, Vol. 40: Biochemistry of Plant Secondary Metabolism (ed. M. Wink), Blackwell, Oxford, Chapter 4.

53 Petersen M, Strack D, Matem U (1999). Biosynthesis of phenylpropanoids and related compounds, in Annual Plant Reviews, Vol. 2: Biochemistry of Plant Secondary Metabolism (ed. M. Wink), Sheffield Academic Press, Sheffield, England, pp. 151-221.

54 Maudlin I (2006). African trypanosomiasis. Ann Trop Med Parasitol . 100, 679-701.

55 Pink R, Hudson A, Mouriès MA, Bending M (2005). Opportunities and challenges in antiparasitic drug discovery. Nat Rev Drug Discov . 4, 727-740.

56 Hoet S, Opperdoes F, Brun R, Quetin-Leclerq J (2004). Natural products active against African trypanosomes: a step towards new drugs. Nat Prod Rep . 21, 353-364.

57 Simarro PP, Jannin J, Cattand P (2008). Eliminating human African trypanosomiasis: where do we stand and what comes next? PloS Med . 5, e55.

58 WHO/CDS/CSR/ISR/2000.1: WHO report on global surveillance of epidemic-prone infectious diseases, World Health Organisation (2000) http://www.who.int/csr/resources/publications/surveillance/en/a_tryps.pdf Last access: June 2011

59 Barrett MP (1999). The fall and rise of sleeping sickness. Lancet . 353, 1113-1114.

60 Cattand P, Jannin J, Lucas P (2001). Sleeping sickness surveillance: an essential step towards elimination. Trop Med Int Health . 6, 348-361.

61 Adl SM, Simpson AG, Farmer MA, Andersen RA, Anderson OR, Barta JR, Bowser SS, Brugerolle G, Fensome RA, Fredericq S, James TY, Karpov S, Kugrens P, Krug J, Lane CE, Lewis LA, Lodge J, Lynn DH, Mann DG, McCourt RM, Mendoza L, Moestrup O, Mozley- Standridge SE, Nerad TA, Shearer CA, Smirnov AV, Spiegel FW, Taylor MF (2005). The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. J Eukaryot Microbiol . 52, 399-451.

62 A. M. Jordan (1993). "Tsetse-flies (Glossinidae)". In R. P. Lane & R. W. Crosskey. Medical Insects and Arachnids . Chapman and Hall.

63 D. T. Cole (1995). Setswana — Animals and Plants (Setswana — Ditshedi le ditlhare) . Gaborone: The Botswana Society. pp. 11 & 173.

64 Centers for Disease Control and Prevention (CDC) http://www.dpd.cdc.gov/dpdx/HTML/TrypanosomiasisAfrican.htm Last access: June 2011

65 Vickerman K, Tetley L, Hendry KA, Turner CM (1988). Biology of African trypanosomes in the tsetse fly. Biol Cell . 64,109-119.

66 Ogbadoyi E, Ersfeld K, Robinson D, Sherwin T, Gull K (2000). Architecture of the Trypanosoma brucei nucleus during the interphase and mitosis. Chromosoma . 108, 501-513.

67 Gomez C, Ramirez EM, Calixto-Galvez M, Medel O, Rodríguez MA (2010). Regulation of gene expression in protozoa parasites. J Biomed Biotechnol . 2010:726045. Epub 2010 Mar 2.

68 Machado CR, Augusto-Pinto L, McCulloch R, Teixeira SM (2006). DNA metabolism and genetic diversity in Trypanosomes. Mutat. Res . 612, 40-57.

69 Martínez-Calvillo S, Vizuet-de-Rueda JC, Florencio-Martínez LE, Manning-Cela RG, Figueroa-Angulo EE (2006). Gene expression in trypanosomatid parasites. J. Biomed. Biotechnol . 2010:525241. Epub 2010 Feb 11.

70 Overath P, Chaudhri M, Steverding D, Ziegelbauer K (1994). Invariant surface proteins in bloodstream forms of Trypanosoma brucei . Parasitol Today . 10, 53-58.

71 Barry JD, McCulloch R (2001). Antigenic variation in trypanosomes: enhanced phenotypic variation in a eukaryotic parasite. Adv Parasitol . 49, 1-70.

72 Jannin J, Cattand P (2004). Treatment and control of human African trypanosomiasis. Curr Opin Infect Dis . 17, 565-571.

73 Bouteille B, Oukem O, Bisser S, Dumas M (2003). Treatment perspectives for human African trypanosomiasis. Fundam Clin Pharmacol . 17, 171-181.

74 Docampo R, Moreno SN (2003). Current chemotherapy of human African trypanosomiasis. Parasitol Res . 90, S10-S13.

75 Nok AJ (2003). Arsenicals (melarprosol), pentamidine and suramin in the treatment of human African trypanosomiasis. Parasitol Res . 90, 71-79.

76 Burchmore RJ, Ogbunude PO, Enanga B, Barrett MP (2002). Chemotherapy of Human African Trypanosomiasis. Curr Pharm Des . 8, 256-267.

77 Denise H, Barrett MP (2001). Uptake and mode of action of drugs used against sleeping sickness. Biochem Pharmacol . 61, 1-5.

78 Nussbaum K, Honek J, Cadmus CMCvC, Efferth T (2010). Trypanosomatid Parasites Causing Neglected Diseases. Curr Med Chem . 17, 1594-1617.

79 The Medical letter (Drugs for Parasitic Infections), CDC. http://www.dpd.cdc.gov/dpdx/HTML/PDF_Files/MedLetter/Trypanosomiasis.pdf Last access: June 2011

80 Phillips MA, Coffino P, Wang CC (1987). Cloning and sequencing of the ornithine decarboxylase gene from Trypanosoma brucei. Implications for enzyme turnover and selective difluoromethylornithine inhibition. J Biol Chem . 262, 8721-8727.

81 Krauth-Siegel RL, Bauer H, Schirmer RH (2005). Dithiol proteins as guardians of the intracellular redox milieu in parasites: old and new targets in trypanosomes and malaria- causing plasmodia. Angew Chem Int Ed Engl . 44, 690-715.

82 Fairlamb AH (2003). Chemotherapy of human African trypanosomiasis: current status and future prospects. Trends Parasitol . 19, 488-494.

83 Croft SL (1997). The current status of antiparasitic chemotherapy. Parasitology . 114 Sup, 3-15.

84 Ross CA, Sutherland DV (1997). Drug resistance in trypanosomatids. In: Hide G, Mottram JC, Coombs GH, Holmes PH, editors. Trypanosomiasis and leishmaniasis: biology and control. CAB international, Wallinford, Oxon. 259-269.

85 Gehrig S, Efferth T (2008). Development of drug resistance in Trypanosoma brucei rhodesiense and Trypanosoma brucei gambiense . Treatment of human African trypanosomiasis with natural products. Int J Mol Med . 22,411-419.

86 Newman DJ, Cragg GM, Snader KM (2003). Natural products as sources of new drugs over the period 1981-2002. J Nat Prod . 66, 1022-1037.

87 Legros D, Ollivier G, Gastellu-Etchegorry M, Paquet C, Burri C, Jannin J, Büscher P (2002). Treatment of human African trypanosomiasis--present situation and needs for research and development. Lancet Infect Dis . 2, 437-440.

88 Brun R, Schumacher R, Schmid C, Kunz C, Burri C (2001). The phenomenon of treatment failures in Human African Trypanosomiasis. Trop Med Int Health . 6, 906-914.

89 Fairlamb AH (2003). Target discovery and validation with special reference to trypanothione. In Fairlamb AH, Ridley RG, Vial HJ eds. Drugs against parasitic diseases: R&D methodologies and issues. Ed. Geneva: WHO TDR. pp 107-118.

90 Fairlamb AH, Blackburn P, Ulrich P, Chait BT, Cerami A (1985). Trypanothione: a novel bis (glutathionyl) spermidine cofactor for glutathione reductase in trypanosomatids. Science 227, 1485-1487.

91 Fairlamb AH, Cerami A (1985). Identification of a novel, thiol-containing co-factor essential for glutathione reductase enzyme activity in trypanosomatids. Mol Biochem Parasitol . 14, 187-198.

92 Bond CS, Zhang Y, Berriman M, Cunningham ML, Fairlamb AH, Hunter WH (1999). Crystal structure of Trypanosoma cruzi trypanothione reductase in complex with trypanothione, and the structure-based discovery of new natural product inhibitors. Structure 7, 81-89.

93 Hannaert V (2011). Sleeping Sickness Pathogen ( Trypanosoma brucei ) and Natural Products: Therapeutic Targets and Screening Systems. Planta Med . 77, 586-597.

94 Willert EK, Phillips MA (2008). Regulated expression of an essential allosteric activator of polyamie biosynthesis in African trypanosomes. PLoS Pathog . 4, e1000183.

95 Comini MA, Guerrero SA, Haile S, Menge U, Lunsdorf H, Flohé L (2004). Validation of Trypanosoma brucei trypanothione synthase as drug target. Free Radic Biol Med . 36, 1289- 1302.

96 Verlinde CL, Hannaert V, Blonski C, Willson M, Périé JJ, Fothergill-Gilmore LA, Opperdoes FR, Gelb MH, Hol WG, Michels PA (2001). Glycolysis as a target for the design of new anti-trypanosome drugs. Drug Resist Updat . 4, 50-65.

97 Clarkson AB Jr, Grady RW, Grossman SA, McCallum RJ, Brohn FH (1981). Trypanosoma brucei brucei : a systematic screening for alternatives to the salicylhydroxamic acid-glycerol combination. Mol Biochem Parasitol . 3, 271-291.

98 Merschjohann K, Sporer F, Steverding D, Wink M (2001). In vitro effect of alkaloids on bloodstream forms of Trypanosoma brucei and Trypanosoma congolense . Planta Med . 67, 623-627.

99 Bodley AL, Shapiro TA (1995). Molecular and cytotoxic effects of camptothecin, a topoisomerase I inhibitor, on trypanosomes and Leishmania. Proc Natl Acad Sci USA . 92, 3726-3730.

2. Use of rbc L sequences for DNA barcoding and authentication of plant drugs used in Traditional Chinese Medicine

2.1 Abstract Traditional Chinese medicine has become increasingly popular in Europe and North America. There is evidence that quality control in terms of species authentication is sometimes inappropriate. Repeated incidents of adulterations and wrong identification, some even with serious consequences have occurred recently. The necessity of a quality control for TCM plants to avoid these incidents is given since many years. DNA barcoding was used in this study to authenticate drugs which are often used in Chinese herbal medicine. 37 plants from 28 families were identified using the rbc L gene. Only one adulteration could be detected where Fraxinus rhynchophylla was substituted with Arctium lappa . Both the advantages and limitations of rbc L as a marker gene for identification were analysed and discussed. We could show that DNA barcoding is a valid and fast method to identify medicinal herbs, showing some advantages over chemical profiling because of its universal application even for unknown plant species.

2.2 Introduction The complex nomenclature in Traditional Chinese Medicine is an acknowledged yet unsolved problem, responsible for potentially fatal confusions [1]. Currently, 4773 botanicals are listed as used in TCM [2]. The scientific term “species” often does not correlate with the nomenclature used in TCM. We would like to elaborate this in a few examples. Four main classifications are common in TCM nomenclature. 1. Drug and plant name are identical, e.g. Panax ginseng is called ren shen ( ࡸ参) both as a drug and as a plant species. 2. Drug and plant name differ, even though the drug is derived from a single species. Ginkgo biloba is called bai guo ( Ʌ果 ) as a drug while the species is referred to as yin xing ( 银අ). 3. The different parts of a particular species have different names as drugs. Trichosanthes kirilowii is a good example where the plant is called gua lou ( 瓜蒌); the fruit bears the same name, while the seed is called gua lou zi ( 瓜蒌ࢲ), the pericarpum gua lou pi (瓜蒌ഘ) and the root tian hua fen ( ୏ส˴ ). 4. Several plant species can be combined under one drug name, making it impossible to know which exact species has been used. One example is lao guan cao ( h鹳ண)

which can be either Erodium stephanianum, Geranium carolinianum or G. wilfordii (Tab. 1).

Table 1: Examples for the complex nomenclature in Traditional Chinese Medicine

Case Scientific name of the Chinese name of Part used Chinese name of plant the plant the drug

Case 1 Panax ginseng ren shen root ren shen ࡸ参 ࡸ参

Case 2 Ginkgo biloba yin xing seed bai guo 银අ Ʌ果

Case 3 Trichosanthes kirilowii gua lou fruit gua lou 瓜蒌瓜蒌 seed gua lou zi 瓜蒌ࢲ roasted seed chao gua lou zi ங瓜蒌ࢲ pericarpum gua lou pi 瓜蒌ഘ root tian hua fen ୏ส˴

Case 4 Erodium stephanianum mang niu er miao herb lao guan cao 牻ݧ儿ƍ h鹳ண Geranium wilfordii lao guan cao herb lao guan cao h鹳ண h鹳ண Geranium ye lao guan cao herb lao guan cao carolinianum ׄh 鹳ண h鹳ண

To make things worse, several substitutions are allowed in TCM, so that han fang ji ( ീȪ己 ), Stephania tetrandra can be substituted by mu fang ji ( ŷȪ己 ), Cocculus trilobus or C. orbiculatus or by guang fang ji ( 廣Ȫ己 ), Aristolochia fangchi [1]. Intoxication with renal failure due to carcinogenic aristolochic acids, as reported in 1993, might be due to such nomenclature difficulties [3]. These difficulties are intrinsic problems based on the complex nature of TCM. However, frequent adulterations of expensive drugs with cheap, similar looking species cause additional problems [4-6]. Therefore, TCM needs rigorous quality control which allows a reliable authentication of the plant material.

Plant drugs can be authenticated by several methods: 1. Microscopic and macroscopic analysis 2. Identification via the phytochemical profiling 3. Identification via DNA sequences of marker genes

Place of origin, age, season and treatment all affect the chemical profile [7], while they have no influence on the DNA. Chemical markers are further sensible to severe errors, since they need to be specific for the species, stable during storage and modification processes and should represent the therapeutically relevant compound. Especially the latter is often extremely difficult to achieve, since the active principle is either not known or ignores the other compounds responsible for modifying the pharmaceutical effect [8]. A more holistic approach is chemical profiling by HPLC and mixture NMR (metabolomics). Here, many of the problems of individual chemical markers are avoided since the profile represents the whole spectrum of compounds [9-11]. One major drawback is that the profile is extremely sensitive to origin, age, season and modification processes the drug went through before being sold on the market and thus no profile is identical. To cope with these problems, authentication of the herbs can be accessed from a less variable character, the DNA. The genetic information is not affected by the factors mentioned before but remains constant allowing the reliable identification of a plant [12,13]. The comparison of nucleotide sequences of marker genes is often referred to as DNA barcoding. Using this method, conclusions regarding the relationship between plant families, species and even individuals can be drawn. The choice of the marker gene determines the grade of separation that can be detected. Different DNA methods to identify Chinese medical materials have recently been reviewed [14,15].

As discussed above, several aspects require to be considered addressing the complex problem of quality control of TCM. To get reproducible results, a combination of chemical profiling together with the identification of the plant via DNA is crucial to avoid toxic substitutions. We will show in this study the practicability of DNA barcoding to authenticate TCM plants using sequences of the chloroplast gene rbc L, which is widely used in plant systematics.

2.3 Material and Methods Plant material We analysed 37 herbal drugs purchased in the herbal market of Shanghai, China, belonging to 29 families and 23 orders. Plant samples were deposited at the IPMB, Heidelberg. Authentic species were obtained from the Botanical Garden, Heidelberg, and 886 DNA sequences were retrieved from the online database GenBank.

DNA extraction, amplification and sequencing Chloroplast DNA was extracted from the herbal material using the chloroform extraction method [16]. Chloroplast DNA was amplified using a primer pair for ribulose-bisphosphate carboxylase large chain ( rbc L) obtained from MWG Biotech AG. As forward primer rbc L-N (5’ ATGTCACCACAAACAGAAACTAAAGC 3’) was used, as reverse primer rbc L-leg7 (5’ TTCRCATGTACCYGCAGTAGCA 3’), obtaining a PCR product of approximately 700 bp length (TRIO Thermoblock Biometra). The PCR-mix contained 5 µl buffer, 1.5 µl nucleotide mix (100µM), 0.5 µl BSA (10mg/ ml), 0.2 µl Taq polymerase (5 units/ µl), 0.5 µl primer rbc L-N and 0.5 µl primer rbc L-leg7 (concentration: 10 pM/ µl) and 2 µl DNA solution. The temperature program was 94 °C 5 min, 94 °C 43 sec, 50 °C 1 min, 72 °C 2 min (38 times), 72 °C 20 min. The purified PCR products were sequenced on a MegaBace 1000 instrument (GE Healthcare). Dye-terminator sequencing provided reliable >1000 nucleotide long fragments [17,18], sufficient for the 700 bp fragments obtained in the PCR.

Sequence alignment and data analysis Clustal W was used to align the sequences [19]; the genetic distances were calculated using MEGA 4.0 following the Kimura 2-Parameter (K2P) model [20]. BLAST database search was performed as described previously [21]; Neighbour-joining (NJ) and Maximum Likelihood (ML) performed with MEGA 4.0 were used to reconstruct the phylogenetic tree [22].

2.4 Results 37 herbal drugs traditionally used in TCM were authenticated according to partial nucleotide sequences of rbc L. The 37 plants belong to 28 families and 23 orders; they were chosen to represent the high diversity of plants used in TCM and to test the utility of rbc L for barcoding of herbal medicine. In 75% of the plants, species identity could be confirmed by comparison

with authentic DNA sequences (plants or GenBank accessions); in 25% this was possible only at the genus level, which is similar to the findings of Arif et al. [23] (Tab. 2).

Table 2: Plants studied and identified by rbc L

A. Identification: Species level

IPMB Genbank No Accession Accession Species, Family, Order number number 1 P6839 / 05 JF949994 Arctium lappa , Asteraceae, Asterales 2 P6843 / 09 JF949995 Belamcanda chinensis , Iridaceae, Asparagales 3 P6883 / 49 JF949996 Berberis bealei , Berberidaceae, Ranunculales 4 P6846 / 12 JF949997 Capsella bursa-pastoris , Brassicaceae, Brassicales 5 P6859 / 25 JF949998 Cyrtomium fortunei , Dryopteridaceae, Polypodiales 6 P6860 / 26 JF949999 Dendrobium loddigesii , Orchidaceae, Asparagales 7 P6863 / 29 JF950000 Eclipta prostrata , Asteraceae, Asterales 8 P6864 / 30 JF950001 Ephedra sinica , Ephedraceae, Gnetales 9 P6865 / 31 JF950002 Epimedium koreanum , Berberidaceae, Ranunculales 10 P6866 / 32 JF950003 Equisetum hiemale , Equisetaceae, Equisetales 11 P6894 / 60 JF950004 Fallopia japonica , Polygonaceae, Caryophyllales 12 P6872 / 38 JF950005 Ginkgo biloba , Ginkgoaceae, Ginkgoales 13 P6875 / 41 JF950006 Houttuynia cordata , Saururaceae, Piperales 14 P6879 / 45 JF950007 Kadsura longipedunculata , Schisandraceae, Austrobaileyales 15 P6882 / 48 JF950008 Magnolia officinalis , Magnoliaceae, Magnoliales 16 P6885 / 51 JF950009 Ophioglossum vulgatum , Ophioglossaceae, Ophioglossales 17 P8088 / 81 JF950028 Panax ginseng , Araliaceae, Apiales 18 P6888 / 54 JF950010 Paris polyphylla , Melanthiaceae, Liliales 19 P6891 / 57 JF950011 Platycladus orientalis , Cupressaceae, Pinales 20 P6893 / 59 JF950012 Polygonum aviculare , Polygonaceae, Caryophyllales 21 P6896 / 62 JF950013 Prunella vulgaris , Lamiaceae, Lamiales 22 P6897 / 63 JF950014 Punica granatum , Lythraceae, Myrtales 23 P6898 / 64 JF950015 Rheum officinale , Polygonaceae, Caryophyllales 24 P6901 / 67 JF950016 Sanguisorba officinalis , Rosaceae, Rosales 25 P6903 / 69 JF950017 Scutellaria baicalensis , Lamiaceae, Lamiales 26 P6904 / 70 JF950018 Selaginella tamariscina , Selaginellaceae, Selaginellales 27 P6908 / 74 JF950019 Taraxacum officinale , Asteraceae, Asterales 28 P6910 / 76 JF950020 Verbena officinalis , Verbenaceae, Lamiales

B. Identification: Genus level

29 P6844 / 10 JF950021 Bupleurum chinense , Apiaceae, Apiales 30 P6849 / 15 JF950022 Centella asiatica , Apiaceae, Apiales 31 P6853 / 19 JF950023 Cinnamomum cassia , Lauraceae, Laurales 32 P6855 / 21 JF950024 Coptis chinensis , Ranunculaceae, Ranunculales 33 P6873 / 39 JF950025 Glycyrrhiza inflata , Fabaceae, Fabales 34 P6886 / 52 JF950026 Paeonia lactiflora , Paeoniaceae, Saxifragales 35 P6887 / 53 JF950030 Panax notoginseng , Araliaceae, Apiales 36 P6892 / 58 JF950027 Polygonatum kingianum , Ruscaceae, Asparagales

C. Identification: Substitution of the TCM drug Fraxinus rhynchophylla with Arctium lappa

37 P6871 / 37 Arctium lappa , Oleaceae, Lamiales

In 8 cases, the interspecific variations of rbc L within a genus were too small to allow the distinction of species while in 28 cases, this was possible. One drug ( Fraxinus rhynchophylla ) was substituted with Arctium lappa . BLAST search resulted in 100% identity (627/ 627 bp) with 0 gaps. DNA isolation and amplification of the rbc L gene sequence was repeated three times with similar results.

Two examples are given to exemplify this (Tab. 3, 4). Equisetum hiemale , (Equisetaceae) could be identified with p-distances within the genus ranging between 0.003 and 0.03. The next family, Lycopodiaceae, has already p-distances of 0.15. The second example is the genus Coptis . TCM does not differentiate between the three used species; rbc L did not allow the exact identification since the sequence of C. chinensis and C. deltoidea was identical. C. teeta could be excluded because of a difference at position 498. The p-distances within the genus range between 0.000 and 0.009, within the family Ranunculaceae between 0.03 and 0.04 and within the order between 0.05 and 0.09. The phylogenetic trees of these two examples further visualize the relationships (Fig. 1, 2).

2.5 Discussion The genetic authentication via DNA barcoding is an important aspect of quality control to increase the safety of TCM drugs. Unfortunately, substitutions and adulterations with cheaper plants are a well-known phenomenon in TCM [15]. DNA barcoding is increasingly used to identify these substitutes [14,24]. In one study by Mihalov et al. [25], soybean was detected as an adulteration in P. ginseng preparations. We could also detect an alteration in our sample of Fraxinus rhynchophylla . Instead, A. lappa was present, as BLAST and comparison of the gene sequence revealed.

However, adulterations are not the only problem quality control of TCM has to face. The more common problem lies in the system of TCM itself. As explained above, the complex nomenclature of TCM plants can be responsible for unintentional substitutions with fatal consequences [1].

A major problem every DNA barcoding approach of TCM drugs has to face is the often problematic condition of the DNA [14]. Due to the various processes such as drying, steaming, bleaching etc TCM drugs have to undergo before being sold, the DNA is often badly damaged.

Table 3: Phylogeny of Equisetum hiemale , Equisetaceae, with Lycopodium and Polypodium as outgroups

Genbank Species Family Order Accession number 1 Equisetum hiemale (TCM) Equisetaceae Equisetales JF950003 2 Equisetum hiemale Equisetaceae Equisetales EU677110 3 Equisetum hiemale Bot. Garden Heidelberg Equisetaceae Equisetales - 4 Equisetum arvense Equisetaceae Equisetales L11053 5 Equisetum bogotense Equisetaceae Equisetales AY226139 6 Equisetum diffusum Equisetaceae Equisetales AY226141 7 Equisetum fluviatile Equisetaceae Equisetales DQ463101 8 Equisetum palustre Equisetaceae Equisetales GQ248601 9 Equisetum pratense Equisetaceae Equisetales AY226137 10 Equisetum sylvaticum Equisetaceae Equisetales AY226136 11 Equisetum telmateia Equisetaceae Equisetales AF313580 12 Equisetum variegatum Equisetaceae Equisetales AY226134 13 Equisetum x ferrissii Equisetaceae Equisetales AF313579 14 Lycopodium annotinum Lycopodiaceae Lycopodiales EU352290 15 Polypodium scouleri Polypodiaceae Filicales FJ825693

87 Equisetum arvense 95 Equisetum fluviatile 32 Equisetum diffusum

97 Equisetum telmateia Equisetum sylvaticum

51 Equisetum palustre 69 42 Equisetum pratense

78 Equisetum variegatum Equisetum x ferrissii 100 100 Equisetum hiemale TCM Equisetum hiemale 63 Equisetum hiemale Bot. Garden Heidelberg Equisetum bogotense Lycopodium annotinum Polypodium scouleri

0.02 Fig. 1: Phylogenetic NJ tree of E. hiemale based on nucleotide sequences of the rbc L gene with bootstrap values

Table 4: Phylogeny of Coptis chinensis , Ranunculaceae, and other families of the Ranunculales

Genbank Species Family Accession number 1 Coptis chinensis (TCM) Ranunculaceae JF950024 2 Coptis chinensis Ranunculaceae AB163775 3 Coptis deltoidea Ranunculaceae AB163774 4 Coptis teeta Ranunculaceae AB163773 5 Coptis aspleniifolia Ranunculaceae AB163777 6 Coptis japonica_var._anemonifolia Ranunculaceae AB163764 7 Coptis japonica_var._major Ranunculaceae AB163765 8 Coptis laciniata Ranunculaceae AB163778 9 Coptis lutescens Ranunculaceae AB163766 10 Coptis occidentalis Ranunculaceae AB163779 11 Coptis omeiensis Ranunculaceae AB163776 12 Coptis quinquefolia Ranunculaceae AB163770 13 Coptis quinquesecta Ranunculaceae AB163772 14 Coptis ramosa Ranunculaceae AB163769 15 Coptis trifolia Ranunculaceae AF093730 16 Coptis trifoliolata Ranunculaceae AB163768 17 Aconitum napellus Ranunculaceae EU053898 18 Anemone hupehensis Ranunculaceae FJ626577 19 Aquilegia vulgaris Ranunculaceae FJ449851 20 Clematis montana Ranunculaceae FJ449855 21 Delphinium bonvalotii Ranunculaceae FJ626583 22 Glaucidium palmatum Ranunculaceae L75848 23 Hydrastis canadensis Ranunculaceae L75849 24 Ranunculus japonicus Ranunculaceae FJ449862 25 Thalictrum simplex Ranunculaceae FJ449863 26 Berberis bealei Berberidaceae FJ449858 27 Circaeaster agrestis Circaeasteraceae FJ626607 28 Euptelea pleiosperma Eupteleaceae AY048174 29 Lardizabala biternata Lardizabalaceae D85693 30 Menispermum dauricum Menispermaceae FJ026493 31 Papaver rhoeas Papaveraceae FJ626614

Coptis chinensis Coptis omeiensis 63 Coptis deltoidea

38 Coptis sp. TCM Coptis teeta 22 Coptis quinquesecta Coptis aspleniifolia

38 52 Coptis laciniata 94 Coptis occidentalis Coptis japonica var. anemonifolia 87 Coptis japonica var. major 77 Coptis lutescens

99 Coptis quinquefolia

57 Coptis ramosa 46 Coptis trifoliolata 30 Coptis trifolia Glaucidium palmatum

89 Aquilegia vulgaris 13 Thalictrum simplex

61 97 Aconitum napellus 36 Delphinium bonvalotii

43 Ranunculus japonicus 24 45 Anemone hupehensis 96 Clematis montana 35 Hydrastis canadensis

75 Euptelea pleiosperma Menispermum dauricum 73 Berberis bealei Lardizabala biternata Papaver rhoeas Circaeaster agrestis

0.01 Fig. 2: Phylogenetic NJ tree of Coptis species TCM ( C. chinensis or C. deltoidea ) based on nucleotide sequences of the rbc L gene with bootstrap values. The rbc L gene does not allow the distinction between these two Coptis species.

Additionally, the secondary metabolites such as flavonoids, tannins or alkaloids inhibit the PCR amplification of the selected marker gene. Intercalating substances can disturb the PCR resulting in mismatched base pairs and erroneous DNA sequences. Purification of the DNA is essential to reduce the secondary metabolites before a successful amplification can be tried [26,27].

The challenge is to discover a DNA marker that is general enough not to raise false alarm but specific enough to discover all adulterations. Furthermore, the marker must be universal to cover the large variety of plant species applied in TCM. And, last but not least, the DNA must ideally exist in many copies to increase the chance of detection in TCM drugs which are usually dried and grounded and thus often contain degraded DNA. Several studies showed that a marker fulfilling all these requirements hardly exists and we need to live with certain restrictions [15,28]. However, the level of identification can be directed by carefully choosing the adequate target region of the genome. Promising for the identification of herbal medicine are especially chloroplast genes since chloroplasts contain many copies of the same gene and thus increase the chances of successful detection [29]. The interspecific variations change from plant species to plant species which means the decision for the right marker gene can not be absolute but needs to be adapted to the particular situation [15,30].

Nevertheless, two marker genes, rbc L and ITS (a commonly used nuclear marker), are widely used in DNA barcoding. Several examples of successful identification of TCM drugs both of rbc L [25,30] and ITS [24,31-33] were published recently.

To choose the right gene, we have to remember the nature of TCM. Quite often, several closely related members of the same genus are used as one drug; a marker gene distinguishing between these species or even subspecies might raise false alarm. ITS is useful to detect a plant at the species level, while rbc L is in 75% of the cases precise enough to determine the species but can not distinguish drugs on the species level in the remaining 25% of the cases [15,23,29]. This disadvantage of rbc L for phylogenetic research might be an advantage in quality control of herbal medicine. It is important to detect adulterations beyond doubt, but the exact species within a genus is only of secondary importance, since TCM itself does not differentiate to that level and also phytochemical profiles are similar between closely related species. rbc L can fulfil these requirements successfully and can guarantee the safety of the drug, as we could demonstrate in our study. The level of detection of rbc L is high enough to

discover possibly toxic substitutions within the traditional system of TCM, such as Aristolochia species as substitutes for Stephania . Adulterations can be identified using database search since an extensive library of most families and even most genera exists already for these two marker genes. Furthermore, the rbc L marker is present in many copies in each plant cell, making a successful amplification more probable than for nuclear genes.

In our study we have demonstrated the utility of rbc L as marker for DNA barcoding, but have to point out its limitations as well. Since genetic information does not cover the morphology, chemical profile, quality control should always try to consider different techniques. The Medicinal Materials DNA Barcode Database [34] offers with 1297 species the possibility to authenticate TCM herbal medicine. For roughly 400 species the rbc L gene sequence is provided, while currently 4773 botanicals are officially used in TCM [2]. It is advisable to extend this and similar TCM libraries with the rbc L and ITS sequences of all botanicals officially used in TCM for international use to allow rapid detection since authentic species examples are rather difficult to obtain outside of Asia. This would improve the acceptance of TCM internationally beyond the image of traditional medicine.

2.6 References

1 Wu KM, Farrelly JG, Upton R, Chen J (2007). Complexities of herbal nomenclature system in traditional Chinese medicine (TCM): Lessons learned from the misuse of Aristolochia -related species and the importance of pharmaceutical name during botanical drug development. Phytomedicine. 14, 273-279.

2 Jiangsu New Medicine College Editorial Board (1995). A Grand Dictionary of Chinese Medicinal Herbs, 3 rd Ed., Shanghai Science Technology Publishing Co., Shanghai, p. 2754.

3 CFSAN/US FDA, Office of Nutritional Products, Labelling and Dietary Supplements (2001). Letter to industry associations regarding safety concerns related to the use of botanical products containing aristolochic acid. http://www.fda.gov/Food/DietarySupplements/Alerts/ucm096374.htm Accessed June 30, 2011

4 But PP (1993). Need for correct identification of herbs in herbal poisoning. Lancet . 341, 637.

5 But PP (1994). Herbal poisoning caused by adulterants or erroneous substitutes. J Trop Med Hyg. 97, 371-374.

6 But PP, Tomlinson B, Cheung KO, Yong SP, Szeto ML, Lee CK (1996). Adulterations of herbal products can cause poisoning. BMJ. 313, 117.

7 Xie PS, Leung AY (2009). Understanding the traditional aspect of Chinese medicine in order to achieve meaningful quality control of Chinese materia medica. J Chromatogr A. 1216, 1933-1940.

8 Li S, Han Q, Qiao C, Song J, Cheng CL, Xu H (2008). Chemical markers for the quality control of herbal medicines: an overview. Chin Med. 3, 7.

9 Van Beek TA, Montoro P (2009). Chemical analysis and quality control of Ginkgo biloba leaves, extracts, and phytopharmaceuticals. J Chromatogr A. 1216, 2002-2032.

10 Yi L, Liang Y, Wu H, Yuan D (2009). The analysis of Radix Angelicae Sinensis (Danggui). J Chromatogr A. 1216, 1991-2001.

11 Zhang Q, Ye M (2009). Chemical analysis of the Chinese herbal medicine Gan-Cao (licorice). J Chromatogr A. 1216, 1954-1969.

12 Chang WT, Thissen U, Ehlert KA, Koek MM, Jellema RH, Hankemeier T, van der Greef J, Wang M (2006). Effects of growth conditions and processing on Rehmannia glutinosa using fingerprint strategy. Planta Med. 72, 458-467.

13 Ma XQ, Shi Q, Duan JA, Dong TT, Tsim KW (2002). Chemical analysis of Radix Astragali (Huangqi) in China: a comparison with its adulterations and seasonal variations. J Agr Food Chem. 50, 4861-4866.

14 Heubl G (2010). New aspects of DNA-based authentication of Chinese medicinal plants by molecular biological techniques. Planta Med. 76, 1963-1974.

15 Yip PY, Chau CF, Mak CY, Kwan HS (2007). DNA methods for identification of Chinese medicinal materials. Chin Med. 2, 9.

16 Doyle JJ, Doyle JL (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull, BSA. 19, 11–15.

17 Olsvik O, Wahlberg J, Petterson B, Uhlén M, Popovic T, Wachsmuth IK, Fields PI (1993). Use of automated sequencing of polymerase chain reaction-generated amplicons to identify three types of cholera toxin subunit B in Vibrio cholerae O1 strains. J Clin Microbiol. 31, 22-25.

18 Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH (2005). Use of DNA barcodes to identify flowering plants. Proc Natl Acad Sci. 102, 8369-8374.

19 Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680.

20 Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 24, 1596-1599.

21 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool. J Mol Biol. 215, 403-410.

22 Saitou N, Nei M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 4, 406-425.

23 Arif IA, Bakir MA, Khan HA, Al Farhan AH, Al Homaidan AA, Bahkali AH, Al Sadoon M, Shobrak M (2010). A brief review of molecular techniques to assess plant diversity. Int J Mol Sci. 11, 2079-2096.

24 Lu KT, Lo CF, Chang HC, Lin JH (2005). Identification of Saposhnikoviae radix in concentrated Chinese medicine preparations by nested PCR and DNA sequencing methods. J Food Drug Anal. 13, 219-224.

25 Mihalov JJ, Marderosian AD, Pierce JC (2000). DNA identification of commercial ginseng samples. J Agr Food Chem. 48, 3744-3752.

26 Shahzadi I, Ahmed R, Hassan A, Shah MM (2010). Optimization of DNA extraction from seeds and fresh leaf tissues of wild marigold ( Tagetes minuta ) for polymerase chain reaction analysis. Genet Mol Res. 9, 386-393.

27 Ribeiro RA, Lovato MB (2007). Comparative analysis of different DNA extraction protocols in fresh and herbarium specimens of the genus Dalbergia. Genet Mol Res. 6, 173- 187.

28 Rubinoff D, Cameron S, Will K (2006). Are plant DNA barcodes a search for the Holy Grail? Tends Ecol Evol. 21, 1-2.

29 Chase MW, Soltis DE, Olmstead RG, Morgan D, Les DH, Mishler BD, Duvall MR, Price RA, Hills HG, Qiu YL (1993). Phylogenetics of seed plants: An analysis of nucleotide sequences from plastid gene rbc L. Ann Missouri Bot Gard. 80, 528-580.

30 Song J, Yao H, Li Y, Li X, Lin Y, Liu C, Han J, Xie C, Chen S (2009). Authentication of the family Polygonaceae in Chinese pharmacopoeia by DNA barcoding technique. J Ethnopharmacol. 124, 434- 439.

31 Chen S, Yao H, Han J, Liu C, Song J, Shi L, Zhu Y, Ma X, Gao T, Pang X, Luo K, Li Y, Li X, Jia X, Lin Y, Leon C (2010). Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE. 5, 1.

32 Gao T, Yao H, Song J, Liu C, Zhu Y, Ma X, Pang X, Xu H, Chen S (2010). Identification of medicinal plants in the family Fabaceae using a potential DNA barcode ITS2. J Ethnopharmacol. 130, 116-121.

33 Yang ZY, Chao Z, Huo KK, Xie H, Tian ZP, Pan SL (2007). ITS sequence analysis used for molecular identification of the Bupleurum species from northwestern China. Phytomedicine. 14, 416- 423.

34 Lou SK, Wong KL, Li M, Butt PP, Tsui SK, Shaw PC (2010). An integrated web medicinal materials DNA database: MMDBD (Medicinal materials DNA Barcode Database). BMC Genomics. 11, 402.

3. Cytotoxicity, antiviral and antitrypanosomal screening of 82 plants from Chinese and European phytomedicine

3.1 Abstract In an extensive screening the antiviral, antitrypanosomal and anticancer properties of extracts from 82 plants used in traditional Chinese medicine and European phytomedicine were determined. Several promising plants that were highly effective against hepatitis B virus (HBV), bovine viral diarrhoea virus (BVDV) - a flavivirus used here as a surrogate in vitro model of hepatitis C virus -, trypanosomes ( Trypanosoma brucei brucei ) and several cancer cell lines were identified. Six aqueous extracts from Celosia cristata, Ophioglossum vulgatum, Houttuynia cordata, Selaginella tamariscina, Alpinia galanga and Alpinia oxyphylla showed significant antiviral effects against BVDV without toxic effects on host EBTr cells, while Evodia lepta , Hedyotis diffusa and Glycyrrhiza spp. demonstrated promising activities against the HBV without toxic effects on host HepG2 2.2.15 cells. Seven organic extracts from Alpinia oxyphylla, Coptis chinensis, Kadsura longipedunculata, Arctium lappa, Panax ginseng, Panax notoginseng and Saposhnikovia divaricata inhibited T. b. brucei. Moreover, among fifteen water extracts that combined high antiproliferative activity (IC 50 0.5-20 µg/ml) and low acute in vitro toxicity (0-10% reduction in cell viability at IC 50 ), Coptis chinensis presented the best beneficial characteristics. In conclusion, traditional herbal medicine from Europe and China still has a potential for new therapeutic targets and therapeutic applications.

3.2 Introduction

Traditional Chinese medicine (TCM) has a long history of almost 5000 years and officially uses approximately 4773 herbs, while the number of locally used plants is probably much higher [1]. Clinical efficacy was shown in various examples, one of the best known is that of artemisinin from Artemisia annua , commonly used against malaria, but also effective against T. b. brucei , viral infections and cancer [2-8].

European medicine also has a long tradition of at least 2500 years with the two important early scholars Hippocrates and Dioscorides who described more than 400 medicinal plants 2000 years ago of which many are still in use today [9]. Many pure therapeutic agents used in modern medicine were originally based on herbal medicine; in fact, the process of developing new drugs from European herbal medicine is still alive and important discoveries are regularly made [10,11]. Even though the theoretical concept of traditional medicine differs between Europe and China, often the same plants were and are still used in both cultures to

treat the same or similar health disorders. Modern European phytotherapy also includes important herbal medicines from Africa and America.

Even though the diversity of plants and possible natural products is vast, the number of targets is usually limited (Tab. 1). Most natural products target proteins, biomembranes or DNA unselectively. Selective interaction is often the case when especially alkaloids mimic signal molecules and interact with receptors or enzymes. It is often possible to conclude from the type of the natural products to their most likely mode of action. Saponins and monoterpenes are active on the biomembrane, while polyphenols usually interact with proteins. Alkaloids also interact with proteins or the DNA.

The formations of covalent and of non-covalent bonds are the two modes of action that form the basis of all interactions between proteins and natural products. The two main targets for the formation of covalent bonds are free amino and free SH groups. Aldehydes, isothiocyanates and epoxids can form covalent bonds with free amino groups while sesquiterpene lactones, disulfides (e.g. allicin), polyacetylenes and epoxides can form covalent bonds with free SH groups. The second mechanism of maybe even greater importance due to its universality is the formation of non-covalent bonds between phenolic OH-groups and amino groups. The proton of the phenolic OH-group can partly dissociate under physiological conditions so that unspecific interactions by forming strong, ionic bonds occur with proteins. Tannins are especially effective due to their large number of hydroxygroups.

All of these interactions will change the three dimensional structure of the protein and thus inactivate it. The omnipresence of these unspecific natural products in plants explains the efficacy of many plant extracts. They are responsible for the great number of “hits” usually occurring in extended screenings of medicinal plant extracts (Tab. 2).

Hepatitis B (HBV) and hepatitis C (HCV) are responsible for 75% of all cases of liver diseases worldwide, often causing cirrhosis and hepatocellular carcinoma [12,13]. HBV and HCV account for the most problematic viral infections, since the standard treatment with pegylated IFN-α and the purine nucleoside analogues lamivudine and ribavirin have severe side effects while being at the same time ineffective for 50% of the patients [12,14]. Thus, new drugs are urgently needed [15]. Together with the bovine viral diarrhoea virus (BVDV),

and the Japanese Encephalitis virus, HCV belongs to the Flaviviridae family. As BVDV, whose cytopathic strains induce a lytic infection in some cell lines, such as embryonic bovine trachea (EBTr) cells, is easier to manipulate and lacks human infectivity, this is commonly used as in vitro model for infections of this viral family [16].

Our knowledge of the natural products of many plants used in European and Chinese phytomedicine is broad (Tab. 2), however, many new discoveries are still possible. Previously, several studies demonstrated the promising potential of traditional phytomedicine for the discovery of new antiviral drugs. Artemisinin and related compounds proved effective in screening assays against viral hepatitis [6,7,17]. In water extracts of Terminalia chebula , Sanguisorba officinalis , Rubus coreanus and Rheum palmatum Kim et al . [18] discovered prominent anti-HBV activities. The ethanolic extract of Hypericum perforatum, a well- established drug for treatment of depression [9] was also shown to be active against the hepatitis B virus [19]. Laxative anthraquinones isolated from Rheum palmatum demonstrated significant effects against hepatitis B virus [20] and saikosaponins from Bupleurum species were previously shown to lower significantly the hepatitis B virus level in the HepG2 2.2.15 assay [21]. HepG2 2.2.15 is a stable cell line infected with the hepatitis B virus. The assay measures the production of secreted HBV from the cell by using real time quantitative PCR.

Parasites such as protozoa and helminths cause a major health threat in many tropical countries [22], while suitable drugs are still rare [23]. Blood parasites of the genus Trypanosoma ( Trypanosoma brucei rhodesiense and T. b. gambiense ) are responsible for African trypanosomiasis (sleeping sickness) with serious consequences for human health and economy. Due to the high infectivity of African human trypanosomes, T. b. brucei is commonly used as model organism with similar morphology and biochemical processes, while being only infective for cattle [22,24,25]. This subspecies causes the cattle epidemic nagana, it is responsible for severe financial loss of 1340 billion USD per year [26].

Currently, only four drugs are approved internationally for the treatment of humans against sleeping sickness: suramin, pentamidine, melarsoprol and eflornithine. Diminazene, another effective antitrypanosomal drug, is only approved for the use on animals because of severe side effects [24]. Even the drugs approved for human use are responsible for serious side effects, and furthermore, the parasites develop increasing resistance to them [27-30]. This

situation makes the discovery of new, effective drugs an urgent task of the 21 st century [31- 33].

When considered together, enterohepatic tumours, i.e., those affecting the liver, the biliary duct, gallbladder and the intestine, constitute the first cause of death due to cancer. Although in many cases surgery and radiotherapy are efficacious, these therapeutic strategies cannot always be applied. Moreover, even when the removal of tumours is possible, pre- and post- operative pharmacological adjuvant regimens are often needed. However, one important limitation to the use of cytostatic drugs to treat enterohepatic tumours is that they generally exhibit marked resistance to currently available pharmacological approaches and the development of resistance during treatment [34].

Many natural products and derivatives thereof belong to the standard repertoire of cancer chemotherapy. Examples are Vinca alkaloids, such as vincristine, vinblastine and vinorelbine, obtained from Madagascar periwinkle ( Catharanthus rosea ). Also taxanes such as paclitaxel and docetaxel, which are produced from the bark of Pacific yew ( Taxus ), podophyllotoxins, such as etoposide and teniposide, derivatives of the genus Podophyllum , and camptothecin, derived from the Asian "Tree of Happiness" ( Camptotheca acuminata ) and its derivatives, irinotecan and topotecan, are natural products from TCM plants [4].

In this study extracts from 82 traditional medicinal plants were screened against hepatitis B virus and flaviviruses, T. b. brucei and several cancer cell lines. Our aim was to detect new sources of active compounds for the possible treatment of these important causes of diseases.

3.3 Material and Methods

Chemicals Dimethylsulfoxide (DMSO), trypsin-EDTA, DMEM and MEM with GLUTAMAX media, fetal bovine serum (FBS) and supplementary chemicals were bought from Gibco  Invitrogen; Germany. Antibiotic/antimycotic solution, gentamicin, Neutral Red (NR, 3- amino-7-dimethylamino-2-methylphenazine), NaHCO 3, L-glutamine and MEM media were purchased from Sigma-Aldrich (Madrid, Spain). Geneticin® (G418) was from Roche (Barcelona, Spain). Dried TCM plants were obtained in Shanghai; South African plants were provided by Prof. van Wyk, University of Johannesburg, South Africa.

Table 1: Targets in animal cells, bacteria cells and viruses [35]

Target Activity Secondary metabolites Biomembrane Membrane disruption Saponins Disturbance of membrane Saponins, monoterpenes fluidity Disturbance of membrane Monoterpenes proteins Proteins (unspecific interaction) Phenolic molecules (flavonoids, Non-covalent bonding (change catechins, tannins, anthraquinones, of 3D protein conformation) quinones, lignans, phenylpropanoids) Allicin, furanocoumarins, Covalent bonding (change of 3D isothiocyanates, sesquiterpene lactones, protein conformation) aldehydes, epoxids, triple bonds Proteins (specific interaction) Structural mimetics of signal molecules Inhibition of enzymes (many alkaloids, e.g. nicotin), hydrogen cyanide from cyanogens Inhibition of Na +Ka + pumps Cardiac glycosides Inhibition of microtubule Colchicine, podophyllotoxin, taxol,

formation vinblastine Inhibition of protein Emetine, lectins biosynthesis Inhibition of transporters Non-protein amino acids Modulation of hormone Isoflavonoids receptors Modulation of ion channels Many alkaloids, aconitine Many alkaloids, some non-protein amino Modulation of neuroreceptors acids Modulation of regulatory Caffeine, phorbol esters proteins Modulation of transcription Structural mimetics of hormones (e.g.

factors isoflavones genistein, daidzein) DNA/ RNA Aristolochic acids, furanocoumarins, Covalent modification pyrrolizidine alkaloids, molecules with (alkylation) epoxy groups Inhibition of DNA Berberine, camptothecin topoisomerase I Inhibition of transcription Amanitine Planar, aromatic and lipophilic molecules Intercalation (anthraquinones, berberine, emetine, quinine, sanguinarine, furanocoumarins)

Table 2: Main Compounds of Plants used in this study [9,36] Family Species Main Compounds Acanthaceae Andrographis paniculata Diterpenelactones Lectins (amarathin, isoamaranthin, Celosia cristata Amaranthaceae celosianin), ferulic acid Flavonoids (quercetin, rutin, isoquercetin, isorhamnetin), β-sitosterol, Bupleurum chinense Apiaceae β-sitosterol-3-O-glucosid, α-spinasterol, α-spinasterol-3-O-glucoside Flavonoids (quercetin, rutin, isoquercetin, isorhamnetin), β-sitosterol, Bupleurum marginatum β-sitosterol-3-O-glucosid, α-spinasterol, α-spinasterol-3-O-glucoside Triterpenes (asiaticoside, asiatic acid, madecassic acid), flavonoids Centella asiatica (kaempferol), monoterpenes (camphor), fatty acids (palmitic acid) Cnidium monnieri Monoterpenes (pinene), cnidium lactone Polyacetylenes, furanocoumarins, Saposhnikovia divaricata chromones Saponins (ginsenosides), polyacetylenes, Eleutherococcus senticosus Araliaceae fatty acids, amino acids, polysaccharides Saponins (ginsenosides Rb 1, Rb 2, Rc, Rd, Re and Rg ), polyacetylenes (panaxynol, Panax ginseng China 1 panaxydol, panaxytriol, falcarindiol), fatty acids, amino acids, polysaccharides Saponins (ginsenosides Rb 1, Rb 2, Rc, Rd, Re and Rg ), polyacetylenes (panaxynol, Panax ginseng Korea 1 panaxydol, panaxytriol, falcarindiol), fatty acids, amino acids, polysaccharides Saponins (ginsenosides Rb 1, Rb 2, Rc, Rd, Re and Rg ), polyacetylenes (panaxynol, Panax notoginseng 1 panaxydol, panaxytriol, falcarindiol), fatty acids, amino acids, polysaccharides Alkaloids (arecoline, arecaidin, Areca catechu Arecaceae arecolidin, guvacolin, guvacin) Asclepiadaceae Cynanchum paniculatum Glucosides (cynanchocerin, cynanchin) Sesquiterpene lactones (artemisinin, arteannuin, artemisitene), monoterpenes Artemisia annua Asteraceae (1,8 cineol, borneol, camphor, menthol), coumarins (coumarin, scopoletin) Sesquiterpene lactones, monoterpenes Artemisia capillaris (1,8 cineol, borneol, camphor, menthol), coumarins (coumarin, scopoletin) Monoterpenes, polyacetylenes Arctium lappa (falcarinol), fatty acids, sterols Monoterpenes (thymol), terpene Centipeda minima glycosids, sesquiterpene lactones Chrysanthemum indicum Monoterpenes (1,8 cineole, pinene,

borneol, camphor), tannins Monoterpenes (1,8 cineole, pinene, Chrysanthemum morifolium borneol, camphor), tannins Monoterpenes, volatile compounds (Heptadecane, 6,10,14-trimethyl-2- pentadecanone, n-hexadecanoic acid, Eclipta prostrata pentadecane, eudesma-4(14),11-diene, phytol, octadec-9-enoic acid, 1,2- benzenedicarboxylic acid diisooctyl ester, (Z,Z)-9,12-octadecadienoic acid) Senecio scandens Pyrrolizidine alkaloids, terpenoids Siegesbeckia orientalis Phytosterols ( β-sitosterol) Sesquiterpene lactones, phenolic acids, Taraxacum officinale triterpene saponins, inulin, phytosterols (β-sitosterol) Alkaloids (berberine, columbamine, Berberis bealei Berberidaceae jatrorrhizine, palmatine) Dysosma versipellis Flavonoids, podophyllotoxin lignans Flavonoids (quercetin, maohuoside B, epimedin A, epimedin B, icariin, icriside Epimedium koreanum II, icariside I, epimedoside A, hexandraside E) Flavonoids, terpenes, glucosinolates, Capsella bursa-pastoris Brassicaceae saponins, tannins Flavonoids, glucosinolates, alkaloids Isatis indigotica (root) (isatisine A, indican, isatin, indirubin and indigotin) Flavonoids, glucosinolates, alkaloids Isatis indigotica (leaf) (isatisine A, indican, isatin, indirubin, indigotin) Flavonoids (rutin, quercetin, luteilin-7- O-beta-D-galactoside, lonicerin), Lonicera confusa Caprifoliaceae chlorogenic acid, beta-sitosterol, tetratriacontane) Convallariaceae Polygonatum kingianum Flavonoids, steroidal saponins Crassulaceae Rhodiola rosea Glucosides (salidroside, tyrosol) Cupressaceae Platycladus orientalis Monoterpenes Dryopteridaceae Cyrtomium fortunei Flavonoids Ephedraceae Ephedra sinica Phenylethylamine alkaloids (ephedrine) Equisetaceae Equisetum hiemale Flavonoids, silicic acids Glyceryl crotonate, crotonic acid, crotonic resin, phorbol esters (phorbol Croton tiglium Euphorbiaceae formate, phorbol butyrate, phorbol crotonate) Fabaceae Abrus cantoniensis Lectins, indolalkaloids Flavonoids (quercetin, rutin), catechin, Acacia catechu epicatechin Flavonoids, dianthrone glycosides Cassia tora (sennoside A, B), anthraquinones

(anthrones, emodin, rhein) Desmodium styracifolium Monoterpenes, alkaloids Flavonoids, isoflavonoids, chalcone (liquiritin, isoliquiritin), saponins (glycyrrhizic acid, 4-hydroxy- Glycyrrhiza inflata glycyrrhtinic acid), monoterpenes (1-(2- Furyl)propan-2-one, pyrazine (2-acetyl- 1-furfuryl pyrrole), benzene (1-methoxy- 4-isopropylbenzene) Spatholobus suberectus Flavonoids, catechin, pyranoside Flavonoids, triterpene saponins, L- Sutherlandia frutescens canavanin, pinitol Geraniaceae Geranium wilfordii Flavonoids, tannins, monoterpenes Flavonoids, tannins, coumarines, Pelargonium sidoides monoterpenes Flavonoids (glycosides of kaempferol, quercetin, isorhamnetin), bisflavonoids, Ginkgoaceae Ginkgo biloba proanthocyanidins, ginkgolic acid, the sesqiterpene alcohol bilobalide, terpene lactones, diterpene lactones (ginkgolides) Hypericin, hyperforin, monoterpenes, Hypericum japonicum Hypericaceae flavonoids, tannins, saponins Iridaceae Belamcanda chinensis Flavonoids (belamcandin, iridin) Lamiaceae Mentha haplocalyx Monoterpenes (menthol) Triterpene saponins, flavonoids (rutin) Prunella vulgaris tannins, rosmarinic acid, monoterpenes (camphor) Scutellaria baicalensis Flavonoids, iridoid glycosides Monoterpenes (1,8-cineol, pinene, Cinnamomum cassia Lauraceae cinnamaldehyde), coumarins, tannins Loranthaceae Taxillus chinensis Flavonoids (avicularin, quercetin) Tannins (punicalin, punicalagin), Punica granatum Lythraceae piperidine alkaloids Tannins, flavonoids (rutin), Magnoliaceae Magnolia officinalis sesquiterpenes, monoterpenes (1,8- cineol) Steroidal saponins (dioscin, polyphyllin Paris polyphylla Melanthiaceae D) Myrsinaceae Lysimachia christinae Flavonoids, tannins, triterpene saponins Monoterpenes (1,8-cineol) Eucalyptus robusta Myrtaceae sesquiterpenes Ophioglossaceae Ophioglossum vulgatum Quercetin 3-O-methyl ether, ophioglonin Orchidaceae Dendrobium loddigesii Alkaloids (dendrobine, nobiline) Flavonoids, (kaempferol), β-sitosterol, Paeoniaceae Paeonia lactiflora resveratrol derivatives, phytoestrogens, monoterpene glycosid (paeoniflorin) Iridoid glycosides (harpagide, Harpagophytum procumbens Pedaliaceae harpagoside)

Monoterpenes (1,8-cineol, pinene, Cymbopogon distans Poaceae cymbopogone, cymbopogonol) Anthraquinones (emodin, rhein, Fallopia japonica (syn. chrysophanol), tetrahydroxystilbene Polygonaceae Polygonum cuspidatum) glucosides, steroidal saponins, tannins Fallopia multiflora (syn. Flavonoids, tannins Polygonum multiflorum) Polygonum aviculare Flavonoids, tannins Flavonoids, tannins, anthraquinone Rheum officinale glycosides (emodin, rhein) Alkaloids (berberine, palmatine, Coptis chinensis Ranunculaceae coptisine, columbamine, epiberberine) Flavonoids, tannins, carotinoids, vitamin Rosa chinensis Rosaceae C Flavonoids, tannins, carotinoids, vitamin Rosa laevigata C Tannins, flavonoids, saponins, Sanguisorba officinalis proanthocyanidins Rubiaceae Hedyotis diffusa Iridoid glycosides Indole alkaloids, (evodiamin, rutecarpin), Evodia lepta Rutaceae chromenes Evodia rutaecarpa Indole alkaloids, (evodiamin, rutecarpin) Isoquinoline alkaloids (berberine, Phellodendron chinense palmatine, jatrorrhizine), sesquiterpene lactones Flavonoids (quercetin, quercetin 3- Houttuynia cordata Saururaceae rhamnoside), norcepharadione B Lignans (kadsurilignans), triterpenoid Schisandraceae Kadsura longipedunculata acids, triterpene dilactones, camphene, borneol Flavonoids (amentoflavone, Selaginella tamariscina Selaginellaceae isocryptomerin, biflavonoids), sterols Triterpene saponins, iridoid glycosides Patrinia scabiosaefolia Valerianaceae (patrinoside) Verbenaceae Verbena officinalis Iridoid glycosides, flavonoids Violaceae Viola yezoensis Falavonoids, saponins Monoterpenes (camphor, cineole, d- pinene, eugenol, cadinene), flavonoids Alpinia galanga Zingiberaceae (galangin, riboflavin), niacin, 1'- acetoxychavicol acetate, ascorbic acid Monoterpenes (camphor, cineole, d- pinene, eugenol, cadinene), flavonoids Alpinia oxyphylla (galangin, riboflavin), niacin, 1'- acetoxychavicol acetate, ascorbic acid

Genetic authentication of plant material The TCM plants were genetically identified by DNA barcoding. DNA was isolated from plant drugs; their chloroplast rbc L gene was amplified and sequenced. The obtained sequences were authenticated with sequences obtained from sample species of the Botanical Garden of Heidelberg and databases. Voucher specimens of the plant material were deposited at the Department of Biology, Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Germany.

Extract preparation 500 g of dry plant material was powdered and extracted with dichloromethane, methanol and water under moderate heat using a reflux condenser for 4 hours. The extracts obtained were concentrated using the rotation evaporator, stored at -40 °C under exclusion of light and dried under vacuum prior to the experiments. Dried extracts were dissolved in DMSO for the experiments.

Test organisms T. b. brucei TC 221 were originally obtained from Prof. Peter Overath (Max-Plank Institut für Bioloie, Tübingen) by Dr. D. Steverding before being cultured at the IPMB, Heidelberg since 1999. HeLa cancer cells and Cos7 fibroblast cells (African green monkey kidney cells immortalized with the monkey virus SV40) were cultured at the IPMB, Heidelberg for several years; Hep G2, Sk Hep1 and LS 174 T, HepG2 2.2.15 and EBTr cells were cultured at the Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), University of Salamanca, CIBERehd, Spain.

Methods Cancer Cells (Hep G2, Sk Hep1 and LS 174 T) were basically grown as previously described 1 2 [35], HeLa and Cos7 cells were grown at 37 °C with 5% CO 2 in DMEM complete media (10% heat-inactivated FBS; 5% penicillin/ streptomycin; 5% non-essential amino acids). Hep

G2, Sk Hep1, and LS 174 T cells were grown at 37 ºC with 5% CO 2 in MEM complete media (10% heat-inactivated FBS; 1% antibiotic-antimycotic solution).

1 Experiments performed by Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), University of Salamanca, CIBERehd, Spain: Marta R. Romero, Alba G. Blazquez, Jose J.G. Marin 2 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Dorothea Kaufmann 54

HepG 2.2.15 cells were cultured as previously described 3 [7] in DMEM complete medium with 10% FBS and 20 mg/ml gentamicin. EBTr cells were cultured as described elsewhere 3 [6], they were maintained in MEM-GLUTAMAX medium with 10% heat-inactivated FBS; 1% penicillin/ streptomycin, and 0.1 % gentamicin.

T. b. brucei TC221 cells were cultured in BALTZ medium [36] supplemented with 20% inactivated FBS and 0.001% β-mercaptoethanol.

The MTT cell viability assay was used to determine cytotoxicity in Cos7 4 and HeLa cells [37,38]. Cells during the logarithmic growth period were seeded in 96 well plates (Greiner Labortechnik) at concentrations of 2 x 10 4 cells/ well and grown for 24 h. Dried and powdered extracts were dissolved in DMSO before being serially diluted to 10 concentrations in 96 well plates. Cells were incubated with the extract for 24 h before the medium was removed and replaces with fresh medium containing 0.5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT). The formazan crystals were dissolved in DMSO 4 h later; the absorbance was measured at 570 nm with a Tecan Safire II Reader.

T. b. brucei TC221 cell viability was additionally to the MTT assay confirmed and evaluated using microscopic techniques. Toxicity of the extracts for T. b. brucei was compared to HeLa and Cos7 cells and the

Selectivity index (SI) was calculated. SI: ratio of the IC 50 value of mammalian cells divided by the IC 50 value of trypanosomes.

To test the antiproliferative effect, 5x10 3 or 15x10 3 cells per well (depending on the cell line) were seeded in 96 well plates and incubated with 5, 10, 25, 50, 100, and 200 µg/ml water extract for 72 h. The cell viability was also determined using the MTT assay with minor modifications. Acute toxicity was similarly measured using MTT assay but after short-term (6 h) incubation with the extracts at the concentrations of IC 50 calculated for each cell line.

To determine the antiviral effect of the extracts, BVDV was used here as a substitute in vitro model for hepatitis C virus infection 3. Bovine epithelial cells obtained from embryonic

3 Experiments performed by Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), University of Salamanca, CIBERehd, Spain: Marta R. Romero, Alba G. Blazquez, Jose J.G. Marin 4 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Dorothea Kaufmann 55

trachea (EBTr) were cultured in MEM medium as described previously [6]. They were seeded in 96 well plates (15 x 10 3 cells/well; 50 µl/well) and left to attach for 2 h. Afterwards, the cells were infected with 50 µl/well of the desired dilution in culture medium of an initial suspension of BVDV (cytopathic strain Oregon C24V, genotype I, subgenotype b) to reach 40% cytopathic effect. After 48 h of incubation the medium was replaced with dilutions in culture medium of the extracts (1, 5, 10, 50, 100 µg/ml). The viability of the EBTr cells was measured using the MTT assay after 72 h incubation.

An HBV antiviral assay based on the HepG2 2.2.15 model was used to determine the antiviral activity of the extracts 5 [39]. HepG2 2.2.15 cells were seeded in six-wells plates (35x10 4 per well) before being incubated for 21 days with 50 µg/ml, 25 µg/ml and 12.5 µg/ml extract. The culture medium was replaced every 3 days with fresh medium, containing the extract dilutions. Quantitative real-time PCR (QPCR) was used to measure the HBV-DNA levels in the culture medium (representing HBV virion production) as described previously [7]. Cytotoxicity was determined using the uptake of NR dye at the end of treatment [40].

At least three cultures for each experimental condition were carried out. Data points were obtained in triplicate form ( T. b. brucei , cancer cell lines, Cos7, HepG2 2.2.15 cells) and in 8 different wells (EBTr). The IC 50 value was calculated using SigmaPlot® 11.0 (4 parameter logistic curve). Statistical significance determined via paired t-test or the Bonferroni method of multiple-range testing.

3.4 Results and Discussion The great diversity of natural products occurring in plants is of the utmost importance for the discovery of new pharmaceutical lead compounds. Through millions of years of evolution the defence mechanisms of plants were perfected. The great variety of natural products clearly demonstrates the efficacy of this defence strategy against herbivores, but also fungi, bacteria and viruses (Tab. 2). In many cases the plants do not rely on specific interactions but also rely on unspecific molecules that interact with a great number of targets (Tab. 1). Of highest importance are the interactions with free amino and free SH groups. While aldehydes, isothiocyanates and epoxids are able to form covalent bonds with free amino groups, sesquiterpene lactones, disulfides, polyacetylenes and epoxides interact with free SH groups.

5 Experiments performed by Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), University of Salamanca, CIBERehd, Spain: Marta R. Romero, Alba G. Blazquez, Jose J.G. Marin 56

Phenolic OH-groups interact on a non-covalent basis with free amino groups by forming strong hydrogen and ionic bonds. The cytotoxicity of water and organic solvent extracts from 82 medicinal plants was determined in the fibroblast cells Cos7 and in four cancer cell lines: HeLa, HepG2, SK Hep1 and LS 174T (Tab. 3, 4). The aqueous extracts were also screened against BVDV and HBV (Tab. 3), whereas organic solvent extracts were assayed on T. b. brucei (Tab. 4). Our results revealed promising results in order to use several of these plants as sources for therapeutic agents.

The viral cell offers three main targets to the natural products (Tab. 1). They can interact with the surface proteins, the biomembrane and the DNA or RNA. While most plants interact unselectively with the virus, selective interactions do also occur.

Ten plants demonstrated antiviral protection against BVDV in combination with low cytotoxicity. Four plants ( Panax ginseng, Cassia tora, Ginkgo biloba and Viola yezoensis ) exerted protective antiviral effect only at high doses, whereas other six plant extracts ( Celosia cristata, Ophioglossum vulgatum, Houttuynia cordata, Selaginella tamariscina, Alpinia galanga and Alpinia oxyphylla ) were effective at lower concentrations (Tab. 3).

Regarding the six plants with higher potential interest as a source of anti-HCV drugs, antiviral glycoproteins, CCP-25 and CCP-27, purified from the leaves of Celosia cristata [43] have been previously studied [44-48]. Their ability to inhibit viral RNA translation activities against several plant viruses have been described [49].

Quercetin 3-O-methyl ether and ophioglonin obtained from plants belonging to Ophioglossaceae genus have shown slight activity against HBV [50]. Since 1995 when antiviral activities against enveloped viruses were discovered in extracts of Houttuynia cordata [51], such as influenza, HIV, herpes, SARS and also in enteroviruses [51-54], 40 compounds have been isolated from the whole plant [55].

Among all of them, norcepharadione B has been identified as anti-herpes virus type 1 compound [55], quercetin may reduce virions production of HCV [56], but not against HBV [7] and quercetin 3-rhamnoside may be effective against influenza A virus [57].

Selaginella tamariscina has been a source of several drugs with anti-bacterial and antifungal activities such as amentoflavone [58], isocryptomerin [59-61], or with antitumor effects such as sterols [62] and biflavonoids [63]. Alpinia galanga crude extracts have been shown to have antibacterial activities [64] which seem to be enhanced in combination with other plants such as rosemary and lemon iron bark [65]. Compounds obtained from this plant, have also demonstrated other antimicrobial activities, such as anti-leishmanial phenylpropanoids [66] or 1'-acetoxychavicol acetate, and its halogenated derivatives (inhibitors of HIV-regulator protein Rev-export) [67-70].

The insecticidal properties of diarylheptanoid [71] as well as protective effects on anaphylactic reactions of the aqueous extracts from the fruit of Alpinia oxyphylla [72] have been described in the past. Recently anti-angiogenic properties of the fruit have been also discovered [73].

The water extracts were also screened against HBV in HepG2 2.2.15 cells (Tab. 3). Evodia lepta , Hedyotis diffusa and several Glycyrrhiza species lowered the HBV DNA significantly while being not toxic to the HepG2 2.2.15 cell line (Fig. 1).

Hardly anything is known about the other natural products of Evodia lepta , while the highly bioactive chromenes seem to be among the major constituents [74]. Glycyrrhiza species, on the other hand, are well known for their anti-inflammatory effects due to glycyrrhizic acid [9]. This genus is also known for its antiviral, especially antihepatitis properties [15,75]. Its ability to reduce the HBV-DNA in the culture medium of HepG2 2.2.15 at high doses has been previously reported [7]. Heydiotis diffusa again is a plant rich in iridoid glycosides with anti- inflammatory and hepatoprotective activities [76-78]. These compounds are most likely to be responsible for the effects against HBV.

Three enterohepatic cancer cell lines, HepG2 and SK Hep1 (from human hepatoblastoma and hepatoma) and LS 174T (from human colon adenocarcinoma), were used to determine the antitumor ability of water extracts (Tab. 3). Twenty extracts were found to induce a significant antiproliferative effect with IC 50 values between 0.5 and 20 µg/ml on these cell lines. These were further investigated to elucidate whether this was due to cytotoxicity.

Fig. 1: Effect of water extracts on hepatitis B virus (HBV) release as determined by HBV-DNA content in the culture medium and cell viability as determined by Neutral Red uptake by human hepatoblastoma cells HepG2 2.2.15 infected with HBV. Values are means ± SD of three experiments carried out in triplicate by incubation with the extracts for 21 days.

Fig. 2: Acute cell toxicity as determined by MTT assay in human hepatoblastoma HepG2 cells. Values are means ± SD of four experiments carried out in triplicate.

Fig. 3: Acute cell toxicity as determined by MTT assay in human hepatoma SK-Hep1 cells. Values are means ± SD of four experiments carried out in triplicate.

Fig. 4: Acute cell toxicity as determined by MTT assay in human colon adenocarcinoma LS 174T cells. Values are means±SD of four experiments carried out in triplicate.

In HepG2, none of the four extracts with ability to inhibit cell growth ( Coptis chinensis, Epimedium brevicornum, Equisetum hiemale and Senecio scandens ) were found to induce acute cell toxicity when they were incubated with the IC 50 of the extracts for 6 h (Fig. 2). In SK Hep1, among the ten extracts with antitumour effect seven did not induce acute toxicity (Arctium lappa, Cassia tora, Centipeda minima, Chrysanthemum indicum, Coptis chinensis, Phellodendron chinense and Rheum palmatum ), whereas Dysosma versipellis was especially active by lowering the cell viability in comparison to the control to 40% (Fig. 3). This is consistent with the inhibitory effects known for the lignans of D. versipellis against prostate cancer cell lines [79].

Evodia lepta and Kadsura longipedunculata lowered also the cell viability of Sk Hep1 in comparison to the control to 50-60%. Recently, it has been reported that the essential oil of Kadsura longipedunculata and its major components (delta-cadinene, camphene, borneol, cubenol, and delta-cadinol) have some degree of cytotoxic activity against some human cell lines [80]. In LS 174T cells, water extracts from Coptis chinensis, Dysosma versipellis, Epimedium brevicornum, Hedyotis diffusa and Houttunia cordata have antiproliferative effects without affecting cell viability (Fig. 4), whereas Paeonia lactiflora, Platycladus orientalis , and Polygonum aviculare , in addition to inhibition of cell growth were able to acutely lower cell viability in comparison to the control to 60-70%.

Paeonia lactiflora , which belongs to the Paeoniacea family, is known as one of the richest sources of various resveratrol derivatives [81]. These phytoestrogens are known to exert strong antioxidant activity [81] and to inhibit growth of several cancer cell lines [82,83], including a colon human cell line [84]. Recently, the antiproliferative effects of essential oils obtained from Platycladus orientalis on human renal adenocarcinoma and amelanotic melanoma cells have been reported [85].

Coptis chinensis , which has been found active against the three enterohepatic cell lines, belongs to TCM formulations commonly used to treat liver diseases associated to infections by gastrointestinal parasite such as Blastocystis hominis [86]. Coptisine, which is used as gastric mucosa protector, and berberine, which has very interesting properties as antiinflamatory, antidiabetes, antidiarrhea, and hypocholesterolemic drug, have been obtained from this plant. Berberine has also shown antitumoral activities in other in vitro models [87- 91].

Animal cells offer several targets to natural products (Tab. 1). Of great importance are the biomembrane, the proteins and the DNA. Since human cells and trypanosomes share many similarities in the structure of the cells, it is extremely important to select those plant extracts where a great selectivity index occurred. The different cytotoxicity strongly hints to selective interactions between natural products and trypanosomes that do not occur in human cells. A great selectivity index also hints to the relative absence or relative insignificance of general cytotoxic mechanisms like the unspecific interaction of phenolic OH-groups compared to more specific interactions with certain structures in trypanosomes.

The CH 2Cl2 and MeOH extracts of 82 medicinal plants were screened against the cell lines

HeLa, Cos7 and trypanosomes ( T. b. brucei ) (Tab. 4). The Selectivity index (SI) of the IC 50 of mammalian cell/ trypanosomes was regarded as significant if it was over 80. According to this criterium, seven extracts were highly selective towards trypanosomes.

The CH 2Cl 2 extract of Alpinia oxyphylla showed IC 50 values of 119.6 µg/ ml, 30.4 µg/ ml and 0.7 µg/ ml against HeLa, Cos7 and T. b. brucei respectively with SI of 170 and 43 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively. The MeOH extract of A. oxyphylla also was effective with IC 50 values of 213.8 µg/ ml, 110.2 µg/ ml and 2.0 µg/ ml

against HeLa, Cos7 and T. b. brucei respectively. The SI was 107 and 55 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively. A. oxyphylla is basically an essential oil plant, so that we suspect the active principle to be based on the sesquiterpenes already known for their cytotoxic properties [92].

For Kadsura longipedunculata only the CH 2Cl 2 extract exhibited a significant selectivity.

Here, the IC 50 values of HeLa, Cos7 and T. b. brucei were 9.9 µg/ ml, 1.8 µg/ ml and 0.1 µg/ ml respectively, resulting in SI of 99 and 18 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively. Essential oil and lignans form the major natural compounds of K. longipedunculata [80,93] . The specific trypanocidal effect rather seems to be based on the lignans than on the more unspecific essential oil. Further studies would be necessary to confirm this assumption.

For Arctium lappa only the CH 2Cl 2 extract showed a significant selectivity with IC 50 values of 345.0 µg/ ml, 344.2 µg/ ml and 3.6 µg/ ml against HeLa, Cos7 and T. b. brucei respectively and SI of 96 between HeLa and T. b. brucei and Cos7 and T. b. brucei .

In Panax ginseng and P. notoginseng the selectivity was again limited to the CH 2Cl 2 extract.

P. ginseng gave IC 50 values of 152.4 µg/ ml, 47.7 µg/ ml and 0.9 µg/ ml against HeLa, Cos7 and T. b. brucei respectively with SI of 169 and 53 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively. P. notoginseng demonstrated IC 50 values of 263.0 µg/ ml, 6.4 µg/ ml and 0.9 µg/ ml with SI of 292 and 7 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively.

Also an extremely active plant was Saposhnikovia divaricata . Here as well, lipophilic CH 2Cl 2 extract was selective with IC 50 values of 410.1 µg/ ml, 45.9 µg/ ml and 5.1 µg/ ml against HeLa, Cos7 and T. b. brucei respectively and SI of 80 and 9 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively.

The trypanocidal effects of A. lappa, P. ginseng, P. notoginseng and S. divaricata are based on the presence of highly reactive polyacetylenes, especially panaxynol. Only the methanolic extract of Coptis chinensis showed a significant selectivity, but not the dichloromethane extract. The IC 50 values of 81.8 µg/ ml, 3.7 µg/ ml and 0.4 µg/ ml against HeLa, Cos7 and T. b. brucei respectively gave SI of 205 and 9 between HeLa and T. b. brucei and Cos7 and T. b. brucei respectively. Our analytical data confirmed berberine as the main

alkaloid of C. chinensis . The toxicity of C. chinensis is probably an effect of the DNA intercalation of its alkaloids into the DNA double helix of T. b. brucei [94,95].

The trypanocidal effect of berberine against different trypanosome species has been demonstrated previously. Merschjohann et al. [96] showed that T. congolense are sensitive to berberine at concentrations of 83 µM, while Rosenkranz and Wink [97] demonstrated a sensitivity of T. brucei to berberine at concentrations of only 0.5 µM. Recently, the effect of berberine against T. rhodesiense was also established by Freiburghaus et al. [98]. T. rhodesiense was sensitive to 4.2 µg/ml.

The significant differences in sensitivity of different trypanosome species to berberine could be of high interest regarding resistance mechanisms against mutagenic compounds. Berberine might due to its mutagenic activity never become a lead structure for the development of trypanocidal drugs, but the differences in sensitivity of these three trypanosome species might help to understand defence mechanisms against DNA intercalating substances.

Traditional Chinese and European Medicine comprise promising plants that might be used for antiviral, antitrypanosomal and anticancer therapy. The promising discoveries of highly effective plants against viral hepatitis, trypanosomiasis and liver and intestinal cancer cells however require further research to establish new lead structures or their combinations for the treatment of these important diseases.

Table 3: Cytotoxicity against cancer cells, Cos7 fibroblasts, and antiviral activity against HBV and flaviviruses of water extracts obtained from 82 medicinal plants

Antiumour Effect Antiviral Effect a b c d Cos 7 HeLa anti-BVDV anti-BVDV anti-HBV Toxicity O HepG2 Sk Hep1 LS 174T Family Species IPMB / N GenBank IC 50 IC 50 Toxicity protection in effect in Hep at effective IC 50 IC 50 IC 50 (µg / ml) (µg / ml) on EBTr cells EBTr cells G2 2.2.15 doses Acanthaceae Andrographis paniculata P6838 / 04 JF949965 255.6 576.0 170 80 > 200 0 0 ++ ++ Amaranthaceae Celosia cristata P6848 / 14 JF949970 263.9 2773.5 200 180 > 200 0 ++ 0 ND Bupleurum chinense P6844 / 10 JF950021 15.6 339.3 120 100 100 ++ 0 ND ND Bupleurum marginatum P6845 / 11 JF949968 350.6 838.1 ND ND ND ND ND ND ND Apiaceae Centella asiatica P6849 / 15 JF950022 325.8 1436.8 > 200 40 70 ++++ 0 0 ND Cnidium monnieri P6854 / 20 JF949973 339.7 775.5 > 200 > 200 > 200 ++++ 0 0 ND Saposhnikovia divaricata P6902 / 68 JF949988 153.0 1024.7 > 200 200 155 ++ 0 ++ ++ Eleutherococcus senticosus P6919 / 79 - 130.5 430.0 > 200 125 160 ++ ++ 0 ND Araliaceae Panax ginseng P8088 / 81 JF950028 151.7 2594.6 > 200 140 > 200 0 + 0 0 Panax notoginseng P6887 / 53 JF950030 182.3 1574.9 > 200 > 200 200 0 0 ND ND Arecaceae Areca catechu P6840 / 06 - 16.6 378.1 40 21 90 ++++ 0 ND ND Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 220.7 693.9 > 200 130 > 200 ++ ++ 0 ND Artemisia annua P6841 / 07 JF949966 288.6 775.5 177 50 > 200 ++++ 0 ++ ++ Artemisia capillaris P6842 / 08 JF949967 201.9 561.7 142 30 > 200 ++ 0 ++ ++ Arctium lappa P6839 / 05 JF949994 355.5 516.3 200 5 > 200 ++ 0 0 ND Centipeda minima P6850 / 16 - 55.6 207.2 72 0,5 130 ++ ++ ND ND Chrysanthemum indicum P6851 / 17 JF949971 320.9 583.4 130 8 200 ++++ 0 0 ND Asteraceae Chrysanthemum morifolium P6852 / 18 JF949972 760.4 1045.8 > 200 180 > 200 ++ 0 0 ND Eclipta prostata P6863 / 29 JF950000 291.7 667.0 > 200 30 120 ++ ++ 0 ND Senecio scandens P6905 / 71 JF949989 114.2 607.9 3.5 50 25 ++++ ++ ND ND Siegesbeckia orientalis P6906 / 72 JF949990 159.2 542.8 40 100 50 ++ ++ ND ND Taraxacum officinale P6908 / 74 JF950019 156.9 708.5 130 147 65 ++ ++ 0 ND Berberis bealei P6883 / 49 JF949996 270.0 659.4 63 60 70 ND ND ND ND Berberidaceae Dysosma versipellis P6862 / 28 - 1276.9 1274.8 > 200 3.5 3.5 ++++ 0 0 ND Epimedium koreanum P6865 / 31 JF950002 140.7 280.2 5 32 10 ++ 0 ND ND Isatis indigotica (root) P6877 / 43 JF949981 557.2 2427.4 > 200 > 200 > 200 0 0 0 ND Brassicaceae Isatis indigotica (leaf) P6878 / 44 JF949981 93.5 1223.5 170 98 80 ++ ++ 0 ND Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 446.8 812.2 > 200 > 200 > 200 ++ 0 0 ND Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 298.4 2321.7 > 200 130 42 ++ 0 0 ND Crassulaceae Rhodiola rosea P6920 / 84 - 61.9 144.4 160 110 40 ++ ++ 0 ND Cupressaceae Platycladus orientalis P6891 / 57 JF950011 97.7 428.2 > 200 155 10 ++ 0 0 ND Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 30.4 567.4 > 200 > 200 > 200 ++ ++ 0 ND Ephedraceae Ephedra sinica P6864 / 30 JF950001 69.1 193.1 200 150 > 200 ++++ ++ ND ND Equisetaceae Equisetum hiemale P6866 / 32 JF950003 265.9 1058.2 5 > 200 > 200 ++ 0 ND ND Euphorbiaceae Croton tiglium P6856 / 22 - 166.2 1052.7 140 50 > 200 ++++ 0 ++ ++ Fabaceae Abrus cantoniensis P6835 / 01 JF949964 575.2 587.1 > 200 100 > 200 ++ ++ 0 ND Acacia catechu P6836 / 02 - 35.7 157.5 > 200 25 > 200 ++ ++ ++ ++ Cassia tora P6847 / 13 JF949969 481.3 1519.3 > 200 0.5 > 200 0 + ++ ++

Desmodium styracifolium P6861 / 27 JF949976 333.5 651.4 > 200 > 200 150 0 0 0 ND Glycyrrhiza inflata P6873 / 39 JF950025 583.9 2288.0 > 200 > 200 185 0 0 ++++ 0 Spatholobus suberectus P6907 / 73 JF949991 16.6 174.1 100 135 70 ++ 0 ND ND Sutherlandia frutescens tba / 83 - 857.6 1670.7 > 200 70 > 200 0 0 0 ND Geranium wilfordii P6867 / 33 JF949977 225.8 62.1 80 45 200 ++ ++ ND ND Geraniaceae Pelargonium sidoides tba / 82 - 15.2 62.2 200 > 200 45 ++ 0 0 ND Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 450.8 1717.0 > 200 9 > 200 0 + 0 ND Hypericaceae Hypericum japonicum P6876 / 42 JF949980 151.8 445.5 165 80 100 ++ ++ 0 ND Iridaceae Belamcanda chinensis P6843 / 09 JF949995 222.1 1378.8 > 200 > 200 > 200 ++ 0 ++ ++ Mentha haplocalyx P6884 / 50 JF949984 285.7 519.1 70 82 > 200 ++++ 0 ND ND Lamiaceae Prunella vulgaris P6896 / 62 JF950013 21.5 341.3 100 145 80 ++ 0 ND ND Scutellaria baicalensis P6903 / 69 JF950017 46.4 150.0 80 50 120 ++ 0 ND ND Lauraceae Cinnamomum cassia P6853 / 19 JF950023 453.9 713.6 180 > 200 > 200 ++++ 0 ++ ++ Loranthaceae Taxillus chinensis P6909 / 75 JF949992 181.7 1023.2 > 200 > 200 155 0 0 0 ND Lythraceae Punica granatum P6897 / 63 JF950014 8.6 152.4 100 100 60 ++++ 0 ND ND Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 73.0 451.5 ND ND ND ND ND ND ND Melanthiaceae Paris polyphylla P6888 / 54 JF950010 38.4 42.6 54 168 8 ++++ ++ ND ND Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 152.1 431.4 > 200 > 200 > 200 ++ 0 0 ND Myrtaceae Eucalyptus robusta P6868 / 34 - 94.1 15.8 ND ND ND ND ND ND ND Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 344.0 1780.1 > 200 > 200 > 200 0 ++ 0 ND Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 104.0 294.4 > 200 70 160 ++ ++ 0 ND Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 148.2 287.3 > 200 > 200 10 0 0 ND ND Pedaliaceae Harpagophytum procumbens tba / 80 - 242.9 733.4 160 190 100 ++ ++ 0 ND Poaceae Cymbopogon distans P6857 / 23 JF949974 257.7 486.1 > 200 > 200 > 200 ++++ 0 ++ ++ Fallopia japonica P6894 / 60 JF950004 39.8 596.4 > 200 > 200 80 ++++ ++ 0 ND Polygonum aviculare P6893 / 59 JF950012 82.6 488.6 > 200 > 200 10 ++ 0 0 ND Polygonaceae Polygonum multiflorum P6895 / 61 JF949987 61.3 928.0 ND ND ND ND ND ND ND Rheum officinale P6898 / 64 JF950015 51.5 670.9 200 25 200 ++ 0 0 ND Ranunculaceae Coptis chinensis P6855 / 21 JF950024 118.3 101.0 10 2 18 ++++ 0 ND ND Rosa chinensis P6899 / 65 - 24.3 135.8 ND ND ND ND ND ND ND Rosaceae Rosa laevigata P6900 / 66 - 93.6 781.7 190 135 60 ++ ++ 0 ND Sanguisorba officinalis P6901 / 67 JF950016 20.5 87.0 ND ND ND ND ND ND ND Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 158.7 1542.7 > 200 > 200 5 ++ ++ ++++ 0 Evodia lepta P6869 / 35 JF949978 419.2 971.0 > 200 20 > 200 ++++ 0 ++++ 0 Rutaceae Evodia rutaecarpa P6870 / 36 - 1176.9 185.6 > 200 25 100 ++++ ++ 0 ND Phellodendron chinense P6890 / 56 JF949986 282.9 750.3 50 10 85 ++ ++ ND ND Saururaceae Houttuynia cordata P6875 / 41 JF950006 633.2 2835.9 > 200 135 5 0 ++ 0 ND Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 6.8 167.6 > 200 20 20 ++ ++ 0 ND Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 103.9 703.4 > 200 > 200 200 0 ++ 0 0 Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 147.3 525.5 168 87 35 ++ ++ 0 ND Verbenaceae Verbena officinalis P6910 / 76 JF950020 93.9 416.9 100 168 117 ++ 0 ND ND Violaceae Viola yezoensis P6911 / 77 JF949993 135.0 1459.2 170 200 140 0 + ND ND Alpinia galanga P6837 / 03 - 952.8 2357.3 > 200 > 200 > 200 0 ++ ++ ++ Zingiberaceae Alpinia oxyphylla P6917 / 78 - 105.8 1802.2 > 200 > 200 155 0 ++ 0 ND

a Toxicity on EBTr cells: 0, not toxic; ++, toxic at high concentrations; ++++, toxic in all concentrations. b Anti-BVDV protection in EBTr cells: 0, without effect; +, protection at high concentrations; ++, protection at low concentrations c Anti-HBV effect in Hep G2 2.2.15 cells: 0, without effect; ++, effect comparable to toxicity; ++++, high ability to reduce HBV DNA. d Toxicity at effective dose on Hep G2 2.2.15 cells: 0, not toxic; ++, effect comparable to reduction in HBV DNA. ND: Not determined

Table 4: Cytotoxicity against HeLa cancer cells, Cos7 fibroblasts and Trypanosoma brucei brucei of organic extracts obtained from 82 medicinal plants

CH 2Cl 2 CH 2Cl 2 CH 2Cl 2 MeOH MeOH MeOH Ratio Ratio Ratio Ratio Family Species IPMB / N O GenBank HeLa Cos 7 T. b. brucei HeLa/ T. Cos7/ T. b. HeLa Cos 7 T. b. brucei HeLa/ T. Cos7/ T. b. b. brucei brucei b. brucei brucei Acanthaceae Andrographis paniculata P6838 / 04 JF949965 188.4 104.7 16.8 11 6 323.3 344.7 28.8 11 12 Amaranthaceae Celosia cristata P6848 / 14 JF949970 472.0 136.0 55.2 9 2 499.8 28.4 77.2 6 0.3 Bupleurum chinense P6844 / 10 JF950021 235.2 87.1 17.0 14 5 646.4 358.7 120.8 5 3 Bupleurum marginatum P6845 / 11 JF949968 176.0 67.4 16.2 11 4 1147.0 576.0 111.9 10 5 Apiaceae Centella asiatica P6849 / 15 JF950022 175.0 64.9 14.0 13 4 773.0 392.8 44.7 17 8 Cnidium monnieri P6854 / 20 JF949973 127.1 37.0 14.9 9 2 251.1 120.0 17.9 14 6 Saposhnikovia divaricata P6902 / 68 JF949988 410.1 45.9 5.1 80 9 1515.6 1575.4 999.5 2 1 Eleutherococcus senticosus P6919 / 79 - 300.0 61.4 13.5 22 4 692.0 190.1 17.3 40 11 Araliaceae Panax ginseng P8088 / 81 JF950028 152.4 47.7 0.9 169 53 1427.9 510.8 319.0 4 1 Panax notoginseng P6887 / 53 JF950030 263.0 6.4 0.9 292 7 1241.6 229.5 469.6 2 0.4 Arecaceae Areca catechu P6840 / 06 - 1023.3 117.0 22.5 45 5 414.2 31.0 118.1 4 0.2 Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 395.6 114.2 53.1 7 2 500.5 227.7 39.3 13 5 Artemisia annua P6841 / 07 JF949966 107.9 34.5 8.1 13 4 287.2 201.1 51.2 6 4 Artemisia capillaris P6842 / 08 JF949967 93.5 29.4 10.6 9 3 314.9 215.4 51.9 6 4 Arctium lappa P6839 / 05 JF949994 345.0 344.2 3.6 96 96 1467.7 1813.0 2229.0 0.7 0.8 Centipeda minima P6850 / 16 - 63.3 10.4 2.2 29 5 219.1 54.2 13.3 16 4.0 Chrysanthemum indicum P6851 / 17 JF949971 152.1 63.5 16.0 10 4 355.7 287.2 15.3 23 18 Asteraceae Chrysanthemum P6852 / 18 JF949972 129.4 42.8 19.3 7 2 349.2 166.7 24.9 14 6 morifolium Eclipta prostata P6863 / 29 JF950000 266.4 112.0 38.1 7 3 329.7 186.1 39.6 8 4.6 Senecio scandens P6905 / 71 JF949989 268.6 143.5 13.1 21 11 299.3 126.2 18.6 16 6 Siegesbeckia orientalis P6906 / 72 JF949990 101.5 17.7 7.9 13 2 237.5 84.4 12.3 19 6 Taraxacum officinale P6908 / 74 JF950019 232.8 177.1 17.5 13 10 636.7 485.3 64.9 10 7 Berberis bealei P6883 / 49 JF949996 93.8 13.3 5.9 16 2 149.7 35.3 7.8 19 4 Berberidaceae Dysosma versipellis P6862 / 28 - 213.9 49.9 39.5 5 1 385.2 54.9 53.2 7 1.0 Epimedium koreanum P6865 / 31 JF950002 48.7 3.5 4.2 12 0.8 257.5 30.7 12.6 20 2 Isatis indigotica (root) P6877 / 43 JF949981 196.4 42.3 2.9 68 14 674.3 324.4 94.6 7 3 Brassicaceae Isatis indigotica (leaf) P6878 / 44 JF949981 321.5 0.6 45.3 7 0.01 274.2 90.6 14.6 19 6 Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 226.5 58.9 16.2 14 3 923.5 118.9 38.0 24 3 Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 279.6 53.9 52.6 5 1 1517.9 1535.3 119.5 13 12 Crassulaceae Rhodiola rosea P6920 / 84 - 164.1 74.6 43.9 4 1 - 87.4 - - - Cupressaceae Platycladus orientalis P6891 / 57 JF950011 121.7 21.8 17.7 7 1 705.5 158.2 84.2 8 1 Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 572.4 132.1 37.1 15 3 722.0 348.7 61.0 12 5 Ephedraceae Ephedra sinica P6864 / 30 JF950001 95.3 41.8 20.9 5 2 163.5 36.7 23.4 7 1 Equisetaceae Equisetum hiemale P6866 / 32 JF950003 125.6 35.7 30.9 4 1 241.2 243.5 51.6 4 4 Euphorbiaceae Croton tiglium P6856 / 22 - 422.9 225.9 86.5 5 2 297.0 222.1 150.4 2 1 Fabaceae Abrus cantoniensis P6835 / 01 JF949964 494.4 129.4 14.5 34 9 612.4 733.1 73.5 8 10 Acacia catechu P6836 / 02 - 164.1 31.5 13.1 12 2 318.0 34.8 50.8 6 0.6

Cassia tora P6847 / 13 JF949969 1335.4 189.1 185.9 7 1 670.9 75.9 276.9 2 0.2 Desmodium styracifolium P6861 / 27 JF949976 156.0 139.8 16.3 10 8 324.3 104.1 40.1 8 2 Glycyrrhiza inflata P6873 / 39 JF950025 26.4 6.9 6.4 4 1 528.3 126.8 39.0 14 3 Spatholobus suberectus P6907 / 73 JF949991 299.1 154.6 25.4 12 6 237.5 54.8 67.8 4 0.8 Sutherlandia frutescens tba / 83 - 367.7 259.3 41.8 9 6 586.6 352.0 87.4 7 4 Geranium wilfordii P6867 / 33 JF949977 99.1 17.0 23.0 4 0.7 236.0 169.8 13.3 18 12 Geraniaceae Pelargonium sidoides tba / 82 - 488.2 218.2 52.1 9 4 112.3 95.7 18.3 6 5 Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 768.3 15.3 71.9 11 0.2 302.9 260.1 39.3 8 6 Hypericaceae Hypericum japonicum P6876 / 42 JF949980 163.3 10.8 21.3 8 0.5 177.5 100.9 23.6 8 4 Iridaceae Belamcanda chinensis P6843 / 09 JF949995 324.4 89.2 22.3 15 4 522.6 319.5 80.2 7 4 Mentha haplocalyx P6884 / 50 JF949984 108.5 34.1 14.7 7 2 375.0 147.8 16.2 23 9 Lamiaceae Prunella vulgaris P6896 / 62 JF950013 282.1 90.4 13.2 21 7 475.4 494.5 25.1 19 19 Scutellaria baicalensis P6903 / 69 JF950017 90.9 287.9 7.4 12 39 367.6 28.8 86.2 4 0.3 Lauraceae Cinnamomum cassia P6853 / 19 JF950023 138.9 23.2 11.0 13 2 272.4 108.4 13.4 20 8 Loranthaceae Taxillus chinensis P6909 / 75 JF949992 417.8 68.6 27.2 15 2 1213.4 378.2 59.2 20 6 Lythraceae Punica granatum P6897 / 63 JF950014 583.3 126.6 14.6 40 8 211.2 218.6 8.1 26 27 Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 23.6 5.4 0.9 26 6 49.1 13.1 4.3 11 3 Melanthiaceae Paris polyphylla P6888 / 54 JF950010 952.6 24.0 73.6 13 0.3 35.0 5.5 11.8 3 0.4 Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 53.4 137.3 20.6 3 7 1752.6 436.3 52.1 34 8 Myrtaceae Eucalyptus robusta P6868 / 34 - - - - 181.4 15.2 16.3 11 1 Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 188.9 62.8 19.8 10 3 469.0 68.8 33.2 14 2 Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 83.0 25.7 13.5 6 2 232.8 61.6 27.6 8 2 Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 166.9 34.0 9.1 18 3 294.6 309.8 11.7 25 26 Harpagophytum Pedaliaceae tba / 80 - 36.2 15.8 0.9 40 17 692.6 217.2 21.4 32 10 procumbens Poaceae Cymbopogon distans P6857 / 23 JF949974 425.9 114.5 31.1 14 3 98.8 17.6 18.9 5 1 Fallopia japonica P6894 / 60 JF950004 88.0 2.8 13.1 7 0.2 317.3 19.5 19.0 17 1 Polygonum aviculare P6893 / 59 JF950012 118.5 53.3 18.2 7 3 342.3 226.5 49.1 7 4 Polygonaceae Polygonum multiflorum P6895 / 61 JF949987 469.4 107.7 98.6 5 1 437.4 48.8 62.1 7 0.7 Rheum officinale P6898 / 64 JF950015 22.5 - 34.0 0.6 - 270.9 35.3 24.5 11 1 Ranunculaceae Coptis chinensis P6855 / 21 JF950024 100.0 39.5 12.9 8 3 81.8 3.7 0.4 205 9 Rosa chinensis P6899 / 65 - 559.4 141.5 20.1 28 7 266.6 36.7 12.5 21 3 Rosaceae Rosa laevigata P6900 / 66 - 712.3 151.8 20.6 35 7 1855.4 1100.1 102.9 18 10 Sanguisorba officinalis P6901 / 67 JF950016 66.5 26.7 12.3 5 2 158.5 41.6 4.0 40 10 Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 147.8 45.3 13.3 11 3 796.1 418.1 24.9 32 16 Evodia lepta P6869 / 35 JF949978 232.0 42.0 13.9 17 3 350.7 427.7 44.4 8 9 Rutaceae Evodia rutaecarpa P6870 / 36 - 50.4 8.7 16.8 3 0.5 297.4 178.5 29.5 10 6 Phellodendron chinense P6890 / 56 JF949986 370.1 71.3 15.6 24 4 487.6 85.5 14.1 35 6 Saururaceae Houttuynia cordata P6875 / 41 JF950006 279.9 48.2 68.3 4 0.7 575.2 63.9 97.6 6 0.6 Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 9.9 1.8 0.1 99 18 86.1 43.9 11.8 7 3 Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 339.2 98.8 13.6 25 7 393.9 150.9 33.4 12 4 Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 140.5 38.7 13.7 10 3 159.4 15.9 19.0 8 0.8 Verbenaceae Verbena officinalis P6910 / 76 JF950020 298.1 145.9 16.5 18 9 334.7 37.7 20.5 16 1 Violaceae Viola yezoensis P6911 / 77 JF949993 59.6 60.8 3.3 18 18 297.5 19.1 24.7 12 0.7 Alpinia galanga P6837 / 03 - 55.7 5.7 1.4 39 4 111.7 53.4 15.4 7 3 Zingiberaceae Alpinia oxyphylla P6917 / 78 - 119.6 30.4 0.7 170 43 213.8 110.2 2.0 107 55

Origin and current area of use of the medicinal plants included in our study

Family Species Origin Area of Use Andrographis paniculata India, Sri Lanka, Acanthaceae India SE Asia, East Asia Amaranthaceae Celosia cristata India, SE Asia, Tropical Asia China, Africa, South America Apiaceae Bupleurum chinense China East Asia, China Bupleurum marginatum China East Asia, China Centella asiatica East Asia, India, East Asia, India, Sri Lanka, Sri Lanka, Australia, northern Australia, Melanesia, Papua Iran, Melanesia, New Guinea, Papua New Middle East, Guinea Africa Cnidium monnieri China East Asia, China Saposhnikovia divaricata Central Asia Central Asia, East (steppe region) Asia, China Eleutherococcus senticosus Siberia, China, Araliaceae Siberia Korea, Japan Panax ginseng China Siberia, China, China Korea, Japan Panax ginseng Korea Siberia, China, Korea Korea, Japan Panax notoginseng Siberia, China, China Korea, Japan Arecaceae Areca catechu SE Asia, East Malaysia, Asia, India, Sri Philipines Lanka, Papua New Guinea Asclepiadaceae Cynanchum paniculatum SE Asia East Asia, SE Asia Artemisia annua Asia, introduced Asteraceae worldwide worldwide Artemisia capillaris Asia Asia Arctium lappa Northern Hemisphere Europe, Asia (Europe, Asia, North America) Centipeda minima Asia, Himalaya Asia Chrysanthemum indicum India Asia Chrysanthemum morifolium Asia Asia Eclipta prostrata Tropical Asia, Tropical Asia, East Asia, South South America America Senecio scandens Asia Asia Siegesbeckia orientalis Tropical Asia Tropical Asia, 70

East Asia, Africa Taraxacum officinale Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Berberidaceae Berberis bealei Asia, introduced in Asia, America, America, Europe Europe Dysosma versipellis East Asia East Asia, China Epimedium koreanum East Asia (Korea) East Asia, China Brassicaceae Capsella bursa-pastoris Northern Hemisphere Europe, Asia (Europe, Asia, North America) Isatis indigotica (root) Central Asia Central Asia, East (steppe region) Asia, China Isatis indigotica (leaf) Central Asia Central Asia, East (steppe region) Asia, China Caprifoliaceae Lonicera confusa East Asia East Asia, China Convallariaceae Polygonatum kingianum Asia Asia Crassulaceae Rhodiola rosea Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Platycladus orientalis China, introduced Cupressaceae Asia in most of Asia Cyrtomium fortunei Asia, introduced in Dryopteridaceae Asia America, Europe Ephedraceae Ephedra sinica China East Asia Equisetaceae Equisetum hiemale Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Euphorbiaceae Croton tiglium SE Asia East Asia, SE Asia Fabaceae Abrus cantoniensis Southern China East Asia, SE Asia Acacia catechu East Asia, SE Asia East Asia, SE Asia Cassia tora East Asia, SE Asia, introduced to Europe, Asia, Middle and South America, Africa America, Africa, Middle East Desmodium styracifolium SE Asia East Asia, SE Asia Glycyrrhiza inflata Central Asia East Asia, Central (Mongolia, China) Asia Spatholobus suberectus India, East Asia, Tropical Asia SE Asia Sutherlandia frutescens South Africa, South Africa Europe Geraniaceae Geranium wilfordii East Asia East Asia, China

Pelargonium sidoides South Africa, South Africa Europe Ginkgo biloba Asia, Europe, Ginkgoaceae China North America Hypericaceae Hypericum japonicum Japan East Asia, China Iridaceae Belamcanda chinensis China East Asia, China Lamiaceae Mentha haplocalyx China East Asia, China Prunella vulgaris Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Scutellaria baicalensis Central Asia East Asia, Central (Russia, Mongolia, Asia China) Cinnamomum cassia Tropical Asia Lauraceae India, East Asia, (India, East Asia, SE Asia SE Asia) Loranthaceae Taxillus chinensis China East Asia, China Lythraceae Punica granatum Middle East, Europe, Asia, Himalaya America, Africa Magnoliaceae Magnolia officinalis Himalaya, China East Asia, China Melanthiaceae Paris polyphylla Himalaya, China East Asia, China Myrsinaceae Lysimachia christinae China East Asia, China Myrtaceae Eucalyptus robusta Europe, Asia, East Australia America, Africa, Australia Ophioglossaceae Ophioglossum vulgatum Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Orchidaceae Dendrobium loddigesii SE Asia East Asia, SE Asia Paeoniaceae Paeonia lactiflora China East Asia Harpagophytum procumbens South Africa, Pedaliaceae South Africa Europe Poaceae Cymbopogon distans Himalaya, China East Asia, China Fallopia japonica (syn. East Asia, China Polygonaceae East Asia Polygonum cuspidatum) Fallopia multiflora (syn. East Asia, China East Asia Polygonum multiflorum) Polygonum aviculare Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Rheum officinale Europe, Asia, Asia North America Ranunculaceae Coptis chinensis China East Asia, China Rosaceae Rosa chinensis China East Asia, China Rosa laevigata SE Asia, China Europe, Asia,

North America Sanguisorba officinalis Northern Hemisphere Europe, Asia, (Europe, Asia, North America North America) Rubiaceae Hedyotis diffusa East Asia East Asia, China Rutaceae Evodia lepta East Asia East Asia, China Evodia rutaecarpa East Asia East Asia, China Phellodendron chinense Himalaya, China East Asia, China Saururaceae Houttuynia cordata East Asia, SE Asia East Asia, SE Asia Schisandraceae Kadsura longipedunculata East Asia East Asia, China Selaginellaceae Selaginella tamariscina East Asia East Asia, China Valerianaceae Patrinia scabiosaefolia East Asia East Asia, China Verbena officinalis Europe, Asia, Verbenaceae Europe North America Violaceae Viola yezoensis East Asia East Asia, China Zingiberaceae Alpinia galanga SE Asia East Asia, SE Asia Alpinia oxyphylla SE Asia East Asia, SE Asia

3.5 References 1 Jiangsu New Medicine College Editorial Board (1995). A Grand Dictionary of Chinese Medicinal Herbs, 3rd Ed., Shanghai Science Technology Publishing Co., Shanghai, p. 2754.

2 Efferth T, Herrmann F, Tahrani A, and Wink M (2011). Cytotoxic activity towards cancer cells of arteanuine B, artemisitene, scopoletin and 1,8-cineole derived from Artemisia annua L. in comparison to artemisinin. Phytomedicine (in press)

3 Efferth T, Romero MR, Wolf DG, Stamminger T, Marin JJ, Marschall M (2008). The antiviral activities of artemisinin and artesunate. Clin Infect Dis. 47, 804-811.

4 Efferth T, Li PC, Konkimalla VS, Kaina B (2007). From traditional Chinese medicine to rational cancer therapy. Trends Mol Med. 13, 353-361.

5 Wohlfarth C, Efferth T (2009). Natural products as promising drug candidates for the treatment of hepatitis B and C. Acta Pharmacol Sin. 30, 25-30.

6 Romero MR, Serrano MA, Vallejo M, Efferth T, Alvarez M, Marin JJ (2006). Antiviral effect of artemisinin from Artemisia annua against a model member of the Flaviviridae family, the bovine viral diarrhoea virus (BVDV). Planta Med. 72, 1169-1174.

7 Romero MR, Efferth T, Serrano MA, Castaño B, Macias RI, Briz O, Marin JJ (2005). Effect of artemisinin/artesunate as inhibitors of hepatitis B virus production in an "in vitro" replicative system. Antiviral Res. 68, 75-83.

8 Youns M, Hoheisel JD, Efferth T (2010). Traditional Chinese medicines (TCMs) for molecular targeted therapies of tumours. Curr Drug Discov Technol. 7, 37-45.

9 van Wyk BE, Wink M (2004). Medicinal Plants of the World, BRIZA, Pretoria

10 Heinrich M, Leonti M, Nebel S, Peschel W (2005). "Local Food - Nutraceuticals": an example of a multidisciplinary research project on local knowledge. J Physiol Pharmacol 56 Suppl 1, 5-22.

11 Heinrich M, Lee Teoh H (2004). Galanthamine from snowdrop--the development of a modern drug against Alzheimer's disease from local Caucasian knowledge. J Ethnopharmacol 92, 147-162.

12 Tanikawa K (2004). Pathogenesis and treatment of hepatitis C virus-related liver diseases. Hepatobiliary Pancreat Dis Int. 3, 17-20.

13 Liang TJ, Rehermann B, Seeff LB, Hoofnagle JH (2000). Pathogenesis, natural history, treatment, and prevention of hepatitis C. Ann Intern Med. 132, 296-305.

14 McHutchison JG, Gordon SC, Schiff ER, Shiffman ML, Lee WM, Rustgi VK, Goodman ZD, Ling MH, Cort S, Albrecht JK (1998). Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. Hepatitis Interventional Therapy Group. N Engl J Med. 339, 1485-1492.

15 Coon JT, Ernst E (2004). Complementary and alternative therapies in the treatment of chronic hepatitis C: a systematic review. J Hepatol. 40, 491-500.

16 Buckwold VE, Beer BE, Donis RO (2003). Bovine viral diarrhea virus as a surrogate model of hepatitis C virus for the evaluation of antiviral agents. Antiviral Res. 60, 1-15.

17 Romero MR, Serrano MA, Efferth T, Alvarez M, Marin JJ (2007). Effect of cantharidin, cephalotaxine and homoharringtonine on "in vitro" models of hepatitis B virus (HBV) and bovine viral diarrhoea virus (BVDV) replication. Planta Med. 73, 552-558.

18 Kim TG, Kang SY, Jung KK, Kang JH, Lee E, Han HM, Kim SH (2001). Antiviral activities of extracts isolated from Terminalis chebula Retz., Sanguisorba officinalis L., Rubus coreanus Miq. and Rheum palmatum L. against hepatitis B virus. Phytother Res. 15, 718-20.

19 Pang R, Tao J, Zhang S, Zhu J, Yue X, Zhao L, Ye P, Zhu Y (2010). In vitro anti-hepatitis B virus effect of Hypericum perforatum L. J Huazhong Univ Sci Technolog Med Sci. 30, 98- 102.

20 Li Z, Li LJ, Sun Y, Li J (2007). Identification of natural compounds with anti-hepatitis B virus activity from Rheum palmatum L. ethanol extract. Chemotherapy. 53, 320-326.

21 Chiang LC, Ng LT, Liu LT, Shieh DE, Lin CC (2003). Cytotoxicity and anti-hepatitis B virus activities of saikosaponins from Bupleurum species. Planta Med. 69, 705-709.

22 Pink R, Hudson A, Mouriès MA, Bending M (2005). Opportunities and challenges in antiparasitic drug discovery. Nat Rev Drug Discov. 4, 727-740.

23 Trouiller P, Olliaro P, Torreele E, Orbinski J, Laing R, Ford N (2002). Drug development for neglected diseases: a deficient market and a public-health policy failure. Lancet. 359, 2188-2194.

24 Hoet S, Opperdoes F, Brun R, Quetin-Leclerq J (2004). Natural products active against African trypanosomes: a step towards new drugs. Nat Prod Rep. 21, 353-364.

25 Räz B, Iten M, Grether-Bühler Y, Kaminsky R, Brun R (1997). The Alamar Blue assay to determine drug sensitivity of African trypanosomes ( T.b. rhodesiense and T.b. gambiense ) in vitro. Acta Trop. 68, 139-147.

26 Kristjanson PM, Swallow BM, Rowlands GJ, Kruska RL, de Leeuw PN (1999). Measuring the costs of African animal trypanosomiasis, the potential benefits of control and returns to research. Agr Sys. 59, 79-98.

27 Fairlamb AH (2003). Chemotherapy of human African trypanosomiasis: current status and future prospects. Trends Parasitol. 19, 488-494.

28 Fairlamb AH (2003). Target discovery and validation with special reference to trypanothione. In Fairlamb AH, Ridley RG, Vial HJ eds. Drugs against parasitic diseases: R&D methodologies and issues. Ed. Geneva: WHO TDR. pp 107-118.

29 Croft SL (1997). The current status of antiparasitic chemotherapy. Parasitology. 114 Suppl, 3-15.

30 Ross CA, Sutherland DV (1997). Drug resistance in trypanosomatids. In: Hide G, Mottram JC, Coombs GH, Holmes PH, editors. Trypanosomiasis and leishmaniasis: biology and control. CAB international, Wallinford, Oxon. 259-269.

31 Newman DJ, Cragg GM, Snader KM (2003). Natural products as sources of new drugs over the period 1981-2002. J Nat Prod. 66, 1022-1037.

32 Legros D, Ollivier G, Gastellu-Etchegorry M, Paquet C, Burri C, Jannin J, Büscher P (2002). Treatment of human African trypanosomiasis--present situation and needs for research and development. Lancet Infect Dis. 2, 437-440.

33 Brun R, Schumacher R, Schmid C, Kunz C, Burri C (2001). The phenomenon of treatment failures in Human African Trypanosomiasis. Trop Med Int Health. 6, 906-914.

34 Marin JJ, Castaño B, Blazquez AG, Rosales R, Efferth T, Monte MJ (2010). Strategies for overcoming chemotherapy resistance in enterohepatic tumours. Curr Mol Med. 10, 467-485.

35 Wink, M (2010). Molecular modes of action of defensive secondary metabolites. Chapter 2. Annual Plant Reviews. 39, 21-161

36 Dr. Duke's Phytochemical and Ethnobotanical Databases http://www.ars-grin.gov/duke/plants.html last access: august 2011

37 Vallejo M, Castro MA, Medarde M, Macias RI, Romero MR, El-Mir MY, Monte MJ, Briz O, Serrano MA, Marin JJ (2007). Novel bile acid derivatives (BANBs) with cytostatic activity obtained by conjugation of their side chain with nitrogenated bases. Biochem Pharmacol. 73, 1394-1404.

38 Baltz T, Baltz D, Giroud C, Crockett J (1985). Cultivation in a semi-defined medium of animal infective forms of Trypanosoma brucei, T. equiperdum, T. evansi, T. rhodesiense and T. gambiense . EMBO J. 4, 1273-1277.

39 Kniazeff AJ, Wopschall LJ, Hopps HE, Morris CS (1975). Detection of bovine viruses in fetal bovine serum used in cell culture. In Vitro. 11, 400-403.

40 Mosmann T (1983). Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. Journal of Immunological Methods. 65, 55–63.

41 Korba BE, Gerin JL (1992). Use of a standardized cell culture assay to assess activities of nucleoside analogs against hepatitis B virus replication. Antiviral Res. 19, 55-70.

42 Fautz R, Husein B, Hechenberger C (1991). Application of the neutral red assay (NR assay) to monolayer cultures of primary hepatocytes: rapid colorimetric viability determination for the unscheduled DNA synthesis test (UDS). Mutat Res. 253, 173-179.

43 Balasubrahmanyam A, Baranwal VK, Lodha ML, Varma A, Kapoor HC (2000). Purification and properties of growth stage-dependent antiviral proteins from the leaves of Celosia cristata . Plant Sci. 154, 13-21.

44 Begam M, Kumar S, Roy S, Campanella JJ, Kapoor HC (2006). Molecular cloning and functional identification of a ribosome inactivating/antiviral protein from leaves of post-

flowering stage of Celosia cristata and its expression in E. coli . Phytochemistry. 67, 2441- 2449.

45 Begam M, Narwal S, Roy S, Kumar S, Lodha ML, Kapoor HC (2006). An antiviral protein having deoxyribonuclease and ribonuclease activity from leaves of the post-flowering stage of Celosia cristata . Biochemistry (Mosc). 71 Suppl 1, S44-8, 3.

46 Gholizadeh A, Kohnehrouz BB, Santha IM, Lodha ML, Kapoor HC (2005). Cloning and expression of small cDNA fragment encoding strong antiviral peptide from Celosia cristata in Escherichia coli . Biochemistry (Mosc). 70, 1005-1010.

47 Gholizadeh A, Santha IM, Kohnehrouz BB, Lodha ML, Kapoor HC (2005). Cystatins may confer viral resistance in plants by inhibition of a virus-induced cell death phenomenon in which cysteine proteinases are active: cloning and molecular characterization of a cDNA encoding cysteine-proteinase inhibitor (celostatin) from Celosia cristata (crested cock's comb). Biotechnol Appl Biochem. 42, 197-204.

48 Gholizadeh A, Kapoor HC (2004). Modifications in the purification protocol of Celosia cristata antiviral proteins lead to protein that can be N-terminally sequenced. Protein Pept Lett. 11, 551-561.

49 Baranwal VK, Tumer NE, Kapoor HC (2002). Depurination of ribosomal RNA and inhibition of viral RNA translation by an antiviral protein of Celosia cristata . Indian J Exp Biol. 40, 1195-1197.

50 Lin YL, Shen CC, Huang YJ, Chang YY (2005). Homoflavonoids from Ophioglossum petiolatum . J Nat Prod. 68, 381-384.

51 Hayashi K, Kamiya M, Hayashi T (1995). Virucidal effects of the steam distillate from Houttuynia cordata and its components on HSV-1, influenza virus, and HIV. Planta Med. 61, 237-241.

52 Lin TY, Liu YC, Jheng JR, Tsai HP, Jan JT, Wong WR, Horng JT (2009). Anti-enterovirus 71 activity screening of chinese herbs with anti-infection and inflammation activities. Am J Chin Med. 37, 143-158.

53 Lau KM, Lee KM, Koon CM, Cheung CS, Lau CP, Ho HM, Lee MY, Au SW, Cheng CH, Lau CB, Tsui SK, Wan DC, Waye MM, Wong KB, Wong CK, Lam CW, Leung PC, Fung KP (2008). Immunomodulatory and anti-SARS activities of Houttuynia cordata . J Ethnopharmacol. 118, 79-85.

54 Ren X, Sui X, Yin J (2011). The effect of Houttuynia cordata injection on pseudorabies herpesvirus (PrV) infection in vitro. Pharm Biol. 49, 161-166.

55 Chou SC, Su CR, Ku YC, Wu TS (2009). The constituents and their bioactivities of Houttuynia cordata . Chem Pharm Bull (Tokyo). 57, 1227-1230.

56 Gonzalez O, Fontanes V, Raychaudhuri S, Loo R, Loo J, Arumugaswami V, Sun R, Dasgupta A, French SW (2009). The heat shock protein inhibitor Quercetin attenuates hepatitis C virus production. Hepatology. 50, 1756-1764.

57 Choi HJ, Song JH, Park KS, Kwon DH (2009). Inhibitory effects of quercetin 3-rhamnoside on influenza A virus replication. Eur J Pharm Sci. 37, 329-333.

58 Jung HJ, Sung WS, Yeo SH, Kim HS, Lee IS, Woo ER, Lee DG (2006). Antifungal effect of amentoflavone derived from Selaginella tamariscina . Arch Pharm Res. 29, 746-751.

59 Lee J, Choi Y, Woo ER, Lee DG (2009). Antibacterial and synergistic activity of isocryptomerin isolated from Selaginella tamariscina . J Microbiol Biotechnol. 19, 204-207.

60 Lee J, Choi Y, Woo ER, Lee DG (2009). Isocryptomerin, a novel membrane-active antifungal compound from Selaginella tamariscina . Biochem Biophys Res Commun. 379, 676-680.

61 Lee JS, Lee MS, Oh WK, Sul JY (2009). Fatty acid synthase inhibition by amentoflavone induces apoptosis and antiproliferation in human breast cancer cells. Biol Pharm Bull. 32, 1427-1432.

62 Gao LL, Yin SL, Li ZL, Sha Y, Pei YH, Shi G, Jing YK, Hua HM (2007).Three novel sterols isolated from Selaginella tamariscina with antiproliferative activity in leukemia cells. Planta Med. 73, 1112-1115.

63 Lee CW, Choi HJ, Kim HS, Kim DH, Chang IS, Moon HT, Lee SY, Oh WK, Woo ER (2008). Biflavonoids isolated from Selaginella tamariscina regulate the expression of matrix metalloproteinase in human skin fibroblasts. Bioorg Med Chem. 16, 732-738.

64 Rao K, Ch B, Narasu LM, Giri A (2010). Antibacterial activity of Alpinia galanga (L) Willd crude extracts. Appl Biochem Biotechnol. 162, 871-884.

65 Weerakkody NS, Caffin N, Lambert LK, Turner MS, Dykes GA (2011). Synergistic antimicrobial activity of galangal ( Alpinia galanga ), rosemary ( Rosmarinus officinalis ) and lemon iron bark ( Eucalyptus staigerana ) extracts. J Sci Food Agric. 91, 461-468.

66 Kaur A, Singh R, Dey CS, Sharma SS, Bhutani KK, Singh IP (2010). Antileishmanial phenylpropanoids from Alpinia galanga (Linn.) Willd. Indian J Exp Biol. 48, 314-317.

67 Tamura S, Shiomi A, Kimura T, Murakami N (2010). Halogenated analogs of 1'- acetoxychavicol acetate, Rev-export inhibitor from Alpinia galanga , designed from mechanism of action. Bioorg Med Chem Lett. 20, 2082-2085.

68 Tamura S, Shiomi A, Kaneko M, Ye Y, Yoshida M, Yoshikawa M, Kimura T, Kobayashi M, Murakami N (2009). New Rev-export inhibitor from Alpinia galanga and structure- activity relationship. Bioorg Med Chem Lett. 19, 2555-2557.

69 Liu Y, Murakami N, Zhang S, Xu T (2007). Structure-activity relationships of 1'- acetoxychavicol acetate homologues as new nuclear export signal inhibitors. Pharmazie. 62, 659-662.

70 Ye Y, Li B (2006). 1'S-1'-acetoxychavicol acetate isolated from Alpinia galanga inhibits human immunodeficiency virus type 1 replication by blocking Rev transport. J Gen Virol. 87, 2047-2053.

71 Miyazawa M, Nakamura Y, Ishikawa Y (2001). Insecticidal diarylheptanoid from Alpinia oxyphylla against larvae of Drosophila melanogaster . Nat Prod Lett. 15, 75-79.

72 Shin TY, Won JH, Kim HM, Kim SH (2001). Effect of Alpinia oxyphylla fruit extract on compound 48/80-induced anaphylactic reactions. Am J Chin Med. 29, 293-302.

73 He ZH, Ge W, Yue GG, Lau CB, He MF, But PP (2010). Anti-angiogenic effects of the fruit of Alpinia oxyphylla . J Ethnopharmacol. 132, 443-449.

74 Li GL, Zhu DY (1999). Two dichromenes from Evodia lepta . J Asian Nat Prod Res. 1, 337- 341.

75 Fiore C, Eisenhut M, Krausse R, Ragazzi E, Pellati D, Armanini D, Bielenberg J (2008). Antiviral effects of Glycyrrhiza species. Phytother Res. 22, 141-148.

76 Zhang Y, Chen Y, Fan C, Ye W, Luo J (2010). Two new iridoid glucosides from Hedyotis diffusa. Fitoterapia. 81, 515-517.

77 Li C, Xue X, Zhou D, Zhang F, Xu Q, Ren L, Liang X (2008). Analysis of iridoid glucosides in Hedyotis diffusa by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry. J Pharm Biomed Anal. 48, 205-211.

78 Lin CC, Ng LT, Yang JJ, Hsu YF (2002). Anti-inflammatory and hepatoprotective activity of peh-hue-juwa-chi-cao in male rats. Am J Chin Med. 30, 225-234.

79 Jiang RW, Zhou JR, Hon PM, Li SL, Zhou Y, Li LL, Ye WC, Xu HX, Shaw PC, But PP (2007). Lignans from Dysosma versipellis with inhibitory effects on prostate cancer cell lines. J Nat Prod. 70, 283-286.

80 Mulyaningsih S, Youns M, El-Readi MZ, Ashour ML, Nibret E, Sporer F, Herrmann F, Reichling J, Wink M (2010). Biological activity of the essential oil of Kadsura longipedunculata (Schisandraceae) and its major components. J Pharm Pharmacol. 62, 1037- 1044.

81 Kim HJ, Chang EJ, Cho SH, Chung SK, Park HD, Choi SW (2002). Antioxidative activity of resveratrol and its derivatives isolated from seeds of Paeonia lactiflora . Biosci Biotechnol Biochem. 66, 1990-1993.

82 Fuggetta MP, D'Atri S, Lanzilli G, Tricarico M, Cannavò E, Zambruno G, Falchetti R, Ravagnan G (2004). In vitro antitumour activity of resveratrol in human melanoma cells sensitive or resistant to temozolomide. Melanoma Res. 14, 189-196.

83 Kang JH, Park YH, Choi SW, Yang EK, Lee WJ (2003). Resveratrol derivatives potently induce apoptosis in human promyelocytic leukemia cells. Exp Mol Med. 35, 467-474.

84 Kim HJ, Chang EJ, Bae SJ, Shim SM, Park HD, Rhee CH, Park JH, Choi SW (2002). Cytotoxic and antimutagenic stilbenes from seeds of Paeonia lactiflora . Arch Pharm Res. 25, 293-299.

85 Loizzo MR, Tundis R, Menichini F, Saab AM, Statti GA, Menichini F (2008). Antiproliferative effects of essential oils and their major constituents in human renal adenocarcinoma and amelanotic melanoma cells. Cell Prolif. 41, 1002-1012.

86 Yang LQ, Singh M, Yap EH, Ng GC, Xu HX, Sim KY (1996). In vitro response of Blastocystis hominis against traditional Chinese medicine. J Ethnopharmacol. 55, 35-42.

87 Hirano H, Osawa E, Yamaoka Y, Yokoi T (2001). Gastric-mucous membrane protection activity of coptisine derivatives. Biol Pharm Bull. 24, 1277-1281.

88 Joshi PV, Shirkhedkar AA, Prakash K, Maheshwari VL (2011). Antidiarrheal activity, chemical and toxicity profile of Berberis aristata . Pharm Biol. (in press)

89 Liu X, Li G, Zhu H, Huang L, Liu Y, Ma C, Qin C (2011). Beneficial effect of berberine on hepatic insulin resistance in diabetic hamsters possibly involves in SREBPs, LXRalpha and PPARalpha transcriptional programs. Endocr J. (in press)

90 Dvorak Z (2010). Berberine: A multipotent remedy with unknown cellular target? Poult Sci. 89, 1787.

91 Patil JB, Kim J, Jayaprakasha GK (2010). Berberine induces apoptosis in breast cancer cells (MCF-7) through mitochondrial-dependent pathway. Eur J Pharmacol. 645, 70-78.

92 Miyazawa M, Nakamura Y, Ishikawa Y (2000). Insecticidal sesquiterpene from Alpinia oxyphylla against Drosophila melanogaster . J Agric Food Chem. 48, 3639-3641.

93 Pu JX, Gao XM, Lei C, Xiao WL, Wang RR, Yang LB, Zhao Y, Li LM, Huang SX, Zheng YT, Sun HD (2008). Three new compounds from Kadsura longipedunculata . Chem Pharm Bull (Tokyo). 56, 1143-1146.

94 Kamath S, Skeels M, Pai A (2009). Significant differences in alkaloid content of Coptis chinensis (Huanglian), from its related American species. Chin Med. 4, 17.

95 Rosenkranz V, Wink M (2008). Alkaloids induce programmed cell death in bloodstream forms of trypanosomes ( Trypanosoma b. brucei ). Molecules. 13, 2462-2473.

96 Merschjohann, K.; Sporer, F.; Steverding, D.; Wink, M (2001). In vitro effect of alkaloids on bloodstream forms of Trypanosoma brucei and T. congolense . Planta Med. 67, 623-627.

97 Rosenkranz, V.; Wink, M (2008). Alkaloids induce programmed cell death in bloodstream forms of trypanosomes ( Trypanosoma b. brucei ). Molecules. 13, 2462-2473.

98 Freiburghaus, F.; Kaminsky, R.; Nkunya, M.H.H.; Brun, R (1996). Evaluation of African medicinal plants for their in vitro trypanocidal activity. J. Ethnopharmacol. 55, 1-11.

4. Cytotoxicity of 12 structurally diverse ginsenosides from Panax ginseng in HeLa cells is linked to membrane disturbance

4.1 Abstract Panax ginseng is widely regarded as an important herbal medicine with a broad range of pharmacological properties. We investigated the cytotoxicity of 12 structurally diverse ginsenosides to gain further insight in their mode of action. The monodesmosidic ginsenosides Rg 3 and Rh 2 with the sugar moiety attached to C3 exhibit a stronger cytotoxicity with IC 50 values of 245 and 29 µg/ml, respectively than monodesmosidic ginsenosides with the sugar moiety attached to C6 or bidesmosidic ginsenosides. Only Rg3 and Rh2 behave as typical monodesmosidic saponins which can intercalate in cell membranes and interact with membrane proteins and cholesterol. The disturbance of membrane fluidity and permeability can lead to apoptosis and cell death.

4.2 Introduction Panax ginseng (Araliaceae) has been used in China, Korea, Japan and eastern Russia as a medicinal plant for several thousand years. Its first record was on Chinese oracle bones 1600 BC while the first surviving detailed description of its medicinal properties dates to the Han dynasty around 200 AD [1]. Since then ginseng root has always been regarded as one of the most precious herbal medicines known. Recently, it got worldwide attention due to its various medicinal properties.

The main secondary metabolites of ginseng are ginsenosides, but polyacetylenes, fatty acids, polysaccharides and peptides are also present [2,3]. Today, 38 ginsenosides have been isolated from P. ginseng . Taking P. quinquefolius and P. notoginseng into account, 66 ginsenosides are presently known [4]. The ginsenosides Rb 1, Rb 2, Rc, Rd, Re and Rg 1 contribute to over 90% of the total ginsenosides in P. ginseng while the other 32 ginsenosides are present as minor components [5].

Ginsenosides can be regarded as steroidal saponins with four trans-ring rigid steroid skeletons. Several structural types of ginsenosides are known, such as bidesmosidic and monodesmosidic ginsenosides and their aglycones. The bidesmosidic and monodesmosidic ginsenosides again differ according to the sugar moieties and the position of their attachment to the steroidal moiety. Sugars are attached to C3, C6 or C20 [6]. The structural diversity of ginsenosides is due to the variation of the sugar moieties, their chain length and the position

of glycoside attachment. Common sugars are glucose, maltose, fructose and sucrose. The position and number of hydroxyl groups on the steroidal moiety is variable as well. The structural elements influence the biological activity.

Traditionally, P. ginseng has been used as a general tonic, while modern research revealed many more applications such as the positive influence on reaction time, concentration and mental fitness [7-10]. The ginsenosides Rg 1 and Rb 1 modulate the neurotransmission in the brain [11,12] while the ginsenosides Rb 1, Rg 1, Rg 2 and Re prevent scopolamine-induced memory deficits by increasing the cholinergic activity [4,13-15]. Neuroprotective effects of the ginsenosides Rb 1, Rg 1, Rg 3, and Rh 2 were shown in several studies [16-20].

Effects on the cardiovascular system are also well documented. The ginsenosides Rg 1 and Rg 3 were shown to relax vascular smooth muscles [21,22] and to inhibit endothelin production

[23], causing an antihypertensive effect. The ginsenosides Rb 1, Re and Rg 1 were shown to enhance the recovery of the brain and organs after damage [20,24]. Anti-atheriosclerotic and wound healing effects were demonstrated [25], which together with the inhibition of platelet aggregation [26] might be one reason for the traditionally assumed increase of life expectancy attributed to P. ginseng .

Another aspect of P. ginseng is the stimulation of the immune system [27,28]. The ginsenoside Rb 1 inhibits leukotriene release while Rg 1 increases the activity of T-helper cells

[24]. The ginsenosides Rb 1, Rg 1 and Rg 3 further inhibit cytokine production, COX-2 gene expression and block histamine release [29-31]. P. ginseng was shown to lower the blood glucose level, thus having a positive effect on diabetes [32-34].

One of the most important aspects of P. ginseng , however, is the induction of apoptosis in tumour cells attributed to the ginsenosides Rg 3 and Rh 2 [35-38]. Several studies demonstrated that P. ginseng has cancer preventive effects [39-41].

In this study, we investigated the cytotoxicity of 12 selected ginsenosides (Fig. 1) in cancer cells (HeLa) representing all major groups with a special focus on mono- and bidesmosidic molecules and their possible interference with membrane fluidity and permeability.

Fig. 1: Ginsenosides

Group I: Bidesmosidic saponins

Ginsenoside Rd Ginsenoside Rb 1 Ginsenoside Rc

Ginsenoside Re Ginsenoside Rg 1

Group II: Monodesmosidic saponins (C3-gly)

Ginsenoside Rg 3 Ginsenoside Rh 2

Group III: Monodesmosidic saponins (C6-gly)

Ginsenoside Rg 2 Ginsenoside Rh 1

Pseudoginsenoside F 11

Group IV: Aglycones

Protopanaxatriol Protopanaxadiol

4.3 Material and Methods Chemicals DMEM media, supplements, fetal bovine serum (FBS), trypsin-EDTA and dimethyl sulfoxide (DMSO) was purchased from Gibco  Invitrogen; Germany. Ginsenosides of known purity were purchased in China by Wan Chuangxing, Tarim University, PR China.

Methods Cytotoxicity HeLa (human cervical cancer) cells were cultured in DMEM complete medium supplemented with 10% FBS, 5% antibiotics (penicillin/ streptomycin) and 5% non-essential amino acids.

Cultures were maintained in a humidified atmosphere of 5 % CO 2 at 37 °C.

Sample preparation Ginsenosides were dissolved in DMSO prior to the experiment. The test samples were serially diluted in medium, so that the final concentrations of DMSO did not exceed 0.05%. Doxorubicin was used as positive control.

MTT assay The MTT viability assay [42] was used to determine the cytotoxicity of the ginsenosides. 2 x 10 4 cells/well were seeded in 96-well plates (Greiner Labortechnik, Frickenhausen), cultured for 24 h to 80% confluence before the test samples were added. Cells were incubated for 24 h before the medium was replaced by fresh medium containing 0.5 mg/ml MTT. After 4 h, the medium was discarded to be replaced with 100 µl DMSO. The absorbance was recorded at 570 nm with a Tecan Safire II Reader.

Statistical analysis

The IC 50 values were calculated from 9 data points per concentration using a four parameter logistic curve (SigmaPlot® 11.0).

4.4 Results The cytotoxicity of 12 ginsenosides HeLa IC 50 [µg/ml] with differing structures was analysed Bidesmosidic saponins Ginsenoside Rb 1 1373.3 in the cervical cancer cell line HeLa. Ginsenoside Rc 1431.5 The commonly occurring ginsenosides Ginsenoside Rd 161.3 Ginsenoside Re 1291.8 Rb 1, Rc, Re and Rg 1, had IC 50 values Ginsenoside Rg 1 1408.8 around 1.2 mg/ml. However, the Monodesmosidic saponins: ginsenoside Rd, another major C3-gly Ginsenoside Rg 3 245.7 ginsenosides had an IC 50 value of 161 Ginsenoside Rh 2 29.1

µg/ml, ten times lower than of the other Monodesmosidic saponins: C6-gly main compounds. Rh 2, protopanaxadiol Ginsenoside Rg 2 1172.7 Ginsenoside Rh 1 452.9 and protopanaxatriol had IC 50 values of Pseudoginsenoside F 11 2332.9 below 30 µg/ml, indicating a high Aglycones cytotoxicity (Tab. 1). Protopanaxadiol 13.2 Protopanaxatriol 31.6

4.5 Discussion Ginsenosides are generally regarded as Reference substance Doxorubicin (positive 0.6 the main active secondary metabolites control) of ginseng. They are saponins with Table 1: Cytotoxic effects of ginsenosides amphiphilic properties which can exhibit three main modes of action. Monodesmosidic ginsenosides can intercalate into the biomembrane of a cell, complex membrane cholesterol and thus can change membrane fluidity and permeability. By modifying the lipid environment of ion channels, transporter proteins and receptors in the lipid bilayer of the cell membrane it is possible to modify the function of membrane proteins [43,44].

Membrane proteins are either in cholesterol rich or cholesterol poor parts of the biomembrane; the exact environment is crucial for their correct function [45]. Ginsenosides are able to interact with the polar head of the phospholipids and the C3-OH group of cholesterol through polar function groups such as hydroxyl groups of the sugar moieties. They are also able to intercalate into the hydrophobic interior of the bilayer with their lipophilic

steroidal part. In the biomembrane, they are able to displace cholesterol from the immediate environment of membrane proteins, thus increasing membrane fluidity and permeability. Any change in the close environment of the membrane proteins can facilitate conformational changes that can modulate the activity of the protein. In accordance with this observation, ginsenosides were shown to modify the activity of voltage-dependent and ligand-gated ion channels [16]. The steroidal structure of lipophilic ginsenoside aglycones facilitates diffusion across the cell membrane. Another mode of action is based on their structural similarities to steroid hormones. Thus they are likely to modify gene expression [43,46,47]. Their presence in the nucleus was shown by Wakabayashi et al . [48]; their ability to bind to the glucocorticoid receptor has also been demonstrated [49,50], leading to a modification of the transcription of mRNA and the protein synthesis.

We selected 12 representative ginsenosides of the three general saponin types, the bidesmosides, the monodesmosides and the aglycones (Fig. 1). The monodesmosides were again subdivided into two groups with the sugar moiety attached to C3 or C6. The first group, the bidesmosidic saponins, contains the ginsenosides Rb 1, Rc, Rd, Re and Rg 1. The second group, the monodesmosidic saponins with the sugar moiety attached to C3, contains the ginsenosides Rg 3 and Rh 2. The third, also monodesmosidic group with the sugar moiety attached to C6, includes the ginsenosides Rg 2, Rh 1 and PF 11 , while the fourth group, the aglycones, comprises the protopanaxadiol and protopanaxatriol.

The monodesmosidic ginsenosides Rg 3 and Rh 2 have glucopyranose sugar chains attached only to C3 similar to the situation in many other steroidal and triterpenoid saponins. The IC 50 values of Rg 3 and Rh 2 with 245 and 29 µg/ml demonstrated strong cytotoxic activity.

Although ginsenoside Rd is a bidesmosidic saponin, it acts more like the monodesmosidic ginsenosides Rg 3 and Rh 2. Its IC 50 of 161 µg/ml is in the range of the IC 50 values of Rg 3 and

Rh 2. The strong cytotoxicity of ginsenoside Rd had already been reported by Yang et al . [37] with a similar IC 50 of 150 µg/ml also in HeLa cells. Like the ginsenosides Rg 3 and Rh 2, ginsenoside Rd has a glucopyranose sugar chains on C3, but has also a one-molecule glucopyranose sugar chain on C20. We suppose a hydrolysis of the glucopyranose at C20, transforming the bidesmosidic ginsenoside Rd into a monodesmosidic molecule. Despite its originally bidesmosidic structure, we group the ginsenoside Rd for the discussion together with the monodesmosidic saponins Rg 3 and Rh 2 because of structural and cytotoxic

similarities. The same cleavage probably happens with the ginsenosides Re and Rg 1, changing them into monodesmosidic ginsenosides of the group III. Due to the low cytotoxic activity of monodesmosidic ginsenosides with the sugar moiety on C6, this transformation is not visible in the cytotoxic results.

Rd was found to induce apoptosis in HeLa cells through down-regulation of Bcl-2 expression [37], which explains the observed cytotoxicity (Tab. 1). Furthermore, it decreases MDR in MCF-7/ADR cells [51], which makes it a highly promising cancer drug.

The monodesmosidic ginsenosides Rg 3 and Rh 2 have been regarded as potent anticancer drugs [38]. Mochizuki [52] reported a decrease of lung metastasis of B16-BL6 melanoma cells due to ginsenoside Rg 3. Ginsenoside Rg 3 has been shown to be angiosuppressive [53], thus adding another mode of action to suppress cancer growth Rh 2 induces apoptosis through ligand-independent Fas activation [54] and arrests the cell cycle in the G1 phase [55]. This is in agreement with the substantial cytotoxicity of Rg 3 and Rh 2 against the cancer cell line HeLa (Tab. 1).

The activity of the three ginsenosides Rd, Rg 3 and Rh 2 is connected to their sugar moiety on C3, leaving C6 free. The sugar moiety on C3 enables the molecule to be incorporated into the bilayer of the biomembrane next to cholesterol. This is not possible for either the bidesmosidic or monodesmosidic ginsenosides with the sugar moiety attached to C6 due to sterical reasons. We conclude that a monodesmosidic structure with the sugar moiety attached to C3 seems to be crucial for the cytotoxic effect of ginsenosides.

The monodesmosidic ginsenosides Rg 2, Rh 1 and PF 11 , tested in group III, all showed a very low cytotoxicity. They were up to 80 times less cytotoxic than the ginsenosides with the sugar moiety attached to C3. The sugar moiety attached to C6 prevents the integration of the steroidal part into the bilayer.

Ginsenosides with the sugar moiety attached to C6 such as Rg 2 or Re and bidesmosidic ginsenosides such as Rb 1 were shown to be active in the CNS [4,14]. Most likely they are specific ligands for receptor proteins involved in psychologic effects. A direct integration into the biomembrane does not seem to be necessary for this effect.

The bidesmosidic ginsenosides of group I were, as expected, inactive. Their bidesmosidic structures prevent their intercalation into the biomembrane.

The aglycones protopanaxadiol and protopanaxatriol (group IV) showed strong cytotoxicity with IC 50 values of 13 and 31 µg/ml, respectively. As aglycones, they are highly lipophilic, so that they can easily cross the cell membrane and enter the nucleus or other compartments in the cell. Their high cytotoxicity is probably based on their effects either on membrane proteins or on cell compartments such as the nucleus. Due to their structural similarity to steroidal hormones, they are likely to have an impact on gene transcription and might even provoke apoptosis.

Fig. 2: Cytotoxic effects of ginsenosides against HeLa cells

150 Ginsenoside Rb1 Ginsenoside Rc Ginsenoside Rd Ginsenoside Re Ginsenoside Rg1

100

Survival [%] 50

0 5 10 20 39 78 2.5 156 312 625 0.63 1.25 1250 2500 Concentration [µg/ml]

A: Cytotoxic effect of the ginsenoside group I

150 Ginsenoside Rg3 Ginsenoside Rh2

100

Survival [%] 50

0 5 10 20 39 78 2.5 156 312 0.63 1.25 Concentration [µg/ml]

B: Cytotoxic effect of the ginsenoside group II

150 Ginsenoside Rg2 Ginsenoside Rh1 Pseudoginsenoside F11

100

Survival [%] 50

0 10 20 39 78 156 312 625 1250 2500 5000 Concentration [µg/ml]

C: Cytotoxic effect of the ginsenoside group III

150 Protopanaxatriol Protopanaxadiol

100

Survival [%] 50

0 5 10 20 39 78 2.5 156 312 0.63 1.25 Concentration [µg/ml]

D: Cytotoxic effect of the ginsenoside group IV

4.6 References

1 Chen CF, Chiou WF, Zhang JT (2008). Comparison of the pharmacological effects of Panax ginseng and Panax quinquefolium . Acta Pharmacol Sin. 29, 1103-1108.

2 Kiefer D, Pantuso T (2003). Panax ginseng . Am Fam Physician. 68, 1539-1542.

3 Lee FC (1992). Facts about ginseng, the elexir of life. Hollyn International Corp., Elizabeth, NJ.

4 Choi KT (2008). Botanical characteristics, pharmacological effects and medicinal components of Korean Panax ginseng C A Meyer. Acta Pharmacol Sin. 29, 1109-1118.

5 Lee TK, Johnke RM, Allison RR, O’Brien KF, Dobbs LJ Jr (2005). Radioprotective potential of ginseng. Mutagenesis. 20, 237-243.

6 Shibata S, Tanaka O, Shoji J, Saito H (1985). Chemistry and pharmacology of Panax . In: Economic and Medicinal Plant Research (Eds. Wagner H, Hikino H and Farnsworth NR), Vol. 1, pp. 217- 284. Academic Press, New York.

7 Kennedy DO, Scholey AB, Wesnes KA (2002). Modulation of cognition and mood following administration of single doses of Ginkgo biloba , ginseng, and a ginkgo/ ginseng combination to healthy young adults. Physiol Behav. 75, 739-751.

8 Mahady GB, Gyllenhall C, Fong HH, Farnsworth NR (2000). Ginseng: a review of safety and efficacy. Nutr Clin Care. 3, 90-101.

9 Sorensen H, Sonne J (1996). A double-masked study of the effects of ginseng on cognitive functions. Curr Ther Res Clin E. 57, 959-968.

10 D’Angelo L, Grimaldi R, Caravaggi M, Marcoli M, Perucca E, Lecchini S, Frigo GM, Crema A (1986). A double-blind, placebo-controlled clinical study on the effect of a standardized ginseng extract on psychomotor performance in healthy volunteers. J Ethnopharmacol. 16, 15- 22.

11 Benishin CG (1992). Actions of ginsenoside Rb1 on choline uptake in central cholinergic nerve endings. Neurochem Int. 21, 1-5.

12 Tsang D, Yeung HW, Tso WW, Peck H (1985). Ginseng saponins: influence on neurotransmitter uptake in rat brain synaptosomes. Planta Med. 221-224.

13 Yamaguchi Y, Haruta K, Kobayashi H (1995). Effects of ginsenosides on impaired performance induced in the rat by scopolamine in a radial-arm maze. Psychoneuroendocrinology. 20, 645-653.

14 Yamaguchi Y, Higashi M, Kobayashi H (1996). Effects of ginsenosides on impaired performance caused by scopolamine in rats. Eur J Pharmacol. 312, 149-151.

15 Benishin CG, Lee R, Wang LC, Liu HJ (1991). Effects of ginsenoside Rb1 on central cholinergic metabolism. Pharmacology. 42:223-229.

16 Nah SY, Kim DH, Rhim H (2007). Ginsenosides: Are any of them candidates for drugs acting on the central nervous system? CNS Drug Rev. 13, 381- 404.

17 López MV, Cuadrado MP, Ruiz-Poveda OM, Del Fresno AM, Accame ME (2007). Neuroprotective effect of individual ginsenosides on astrocytes primary culture. Biochim Biophys Acta. 1770, 1308-1316.

18 Radad K, Gille G, Moldzio R, Saito H, Ishige K, Rausch WD (2004). Ginsenosides Rb1 and Rg1 effects on survival and neurite growth of MPP+-affected mesencephalic dopaminergic cells. J Neural Transm. 111, 37-45.

19 Tian J, Fu F, Geng M, Jiang Y, Yang J, Jiang W, Wang C, Liu K (2005). Neuroprotective effect of 20(S)-ginsenoside Rg3 on cerebral ischemia in rats. Neurosci Lett. 374, 92-97.

20 Lim JH, Wen TC, Matsuda S, Tanaka J, Maeda N, Peng H, Aburaya J, Ishihara K, Sakanaka M (1997). Protection of ischemic hippocampal neurons by ginsenoside Rb1, a main ingredient of ginseng root. Neurosci Res. 28, 191-200.

21 Kang SY, Kim SH, Schini VB, Kim ND (1995). Dietary ginsenosides improve endothelium-dependent relaxation in the thoracic aorta of hypercholesterolemic rabbit. Gen Pharmacol. 26, 483-487.

22 Kang SY, Schini-Kerth VB, Kim ND (1995). Ginsenosides of the protopanaxatriol group cause endothelium-dependent relaxation in the rat aorta. Life Sci. 56, 1577-1586.

23 Nakajima S, Uchiyama Y, Yoshida K, Mizukawa H, Haruki E (1998). The effects of ginseng radix rubra on human vascular endothelial cells. Am J Chin Med. 26, 365-373.

24 Sun K, Wang CS, Guo J, Horie Y, Fang SP, Wang F, Liu YY, Liu LY, Yang JY, Fan JY, Han JY (2007). Protective effects of ginsenoside Rb1, ginsenoside Rg1, and notoginsenoside R1 on lipopolysaccharide-induced microcirculatory disturbance in rat mesentery. Life Sci. 81, 509-518.

25 Sengupta S, Toh SA, Sellers LA, Skepper JN, Koolwijk P, Leung HW, Yeung HW, Wong RN, Sasisekharan R, Fan TP (2004). Modulating angiogenesis: the yin and the yang in ginseng. Circulation. 110, 1219-1225.

26 Park HJ, Lee JH, Song YB, Park KH (1996). Effects of dietary supplementation of lipophilic fraction from Panax ginseng on cGMP and cAMP in rat platelets and on blood coagulation. Biol Pharm Bull. 19, 1434-1439.

27 Scaglione F, Weiser K, Alessandria M (2001). Effects of the standardized ginseng extract G115® in patients with chronic bronchitis: a nonblind, randomised, comparative pilot study. Clin Drug Invest [New Zealand] 21, 41-45.

28 Scaglione F, Ferrara F, Dugnani S, Falchi M, Santoro G, Fraschini F (1990). Immunomodulatory effects of two extracts of Panax ginseng C.A. Meyer. Drugs Exp Clin Res. 16, 537-542.

29 Park EK, Shin YW, Lee HU, Kim SS, Lee YC, Lee BY, Kim DH (2005). Inhibitory effect of ginsenoside Rb1 and compound K on NO and prostaglandin E2 biosyntheses of RAW264.7 cells induced by lipopolysaccharide. Biol Pharm Bull. 28, 652-656.

30 Keum YS, Han SS, Chun KS, Park KK, Park JH, Lee SK, Surh YJ (2003). Inhibitory effects of the ginsenoside Rg3 on phorbol ester-induced cyclooxygenase-2 expression, NF- kappaB activation and tumor promotion. Mutat Res. 523-524, 75-85.

31 Ro JY, Ahn YS, Kim KH (1998). Inhibitory effect of ginsenoside on the mediator release in the guinea pig lung mast cells activated by specific antigen-antibody reactions. Int J Immunopharmacol. 20, 625-641.

32 Cho WC, Yip TT, Chung WS, Lee SK, Leung AW, Cheng CH, Yue KK (2006). Altered expression of serum protein in ginsenoside Re-treated diabetic rats defected by SELDI-TOF MS. J Ethnopharmacol. 108, 272- 279.

33 Lee WK, Kao ST, Liu IM, Chen JT (2006). Increase of insulin secretion by ginsenoside Rh2 to lower plasma glucose in Wister rats. Clin Exp Pharmacol Physiol. 33, 27- 32.

34 Sotaniemi EA, Haapakosi E, Rautio A (1995). Ginseng therapy in non-insulin-dependent diabetic patients. Diabetes Care. 18, 1373-1375.

35 Lee WH, Choi JS, Kim HY, Park JH, Park BD, Cho SJ, Lee SK, Surh YJ (2010). Potentiation of etoposide-induced apoptosis in HeLa cells by co-treatment with KG-135, a quality-controlled standardized ginsenoside formulation. Cancer Lett. 294, 74-81.

36 Park SE, Park C, Kim SH, Hossain MA, Kim MY, Chung HY, Son WS, Kim GY, Choi YH, Kim ND (2009). Korean red ginseng extract induces apoptosis and decreases telomerase activity in human leukemia cells. J Ethnopharmacol. 121, 304-312.

37 Yang ZG, Sun HX, Ye YP (2006). Ginsenoside Rd from Panax notoginseng is cytotoxic towards HeLa cancer cells and induces apoptosis. Chem Biodivers. 3, 187-197.

38 Shibata S (2001). Chemistry and cancer preventing activities of ginseng saponins and some related triterpenoid compounds. J Korean Med Sci. 16 (Suppl), 28-37.

39 Yun TK (2003). Experimental and epidemiological evidence on non-organ specific cancer preventive effect of Korean ginseng and identification of active compounds. Mutat Res. 523- 524, 63-74.

40 Yun TK (2001). Panax ginseng —a non-organ-specific cancer preventive? Lancet Oncol. 2, 49-55.

41 Shin HR, Kim JY, Yun TK, Morgan G, Vainio H (2000). The cancer-preventive potential of Panax ginseng : a review of human and experimental evidence. Cancer Causes Control. 11, 565-576.

42 Mosmann T (1983). Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immunol Methods. 65, 55–63.

43 Wink M (2008). Evolutionary advantage and molecular modes of action of multicomponent mixtures in phytomedicine. Curr Drug Metab. 9, 996-1009.

44 Bastiaanse EM, Höld KM, Van der Laarse A (1997). The effect of membrane cholesterol content in ion transport processes in plasma membranes. Cardiovasc Res. 33, 272-283.

45 Schroeder F, Jefferson JR, Kier AB, Knittel J, Scallen TJ, Wood WG, Hapala I (1991). Membrane cholesterol dynamics: Cholesterol domains and kinetic pools. Proc Soc Exp Biol Med. 196, 235-252.

46 Wink M (2007). Bioprospecting: The search for bioactive lead structures from nature. In: Medicinal Plant Biotechnology. From Basic Research to Industrial Applications. Ed O Kayser and WJ Quax, Wiley-VCH, Weinheim, pp. 97-116.

47 Attele AS, Wu JA, Yuan CS (1999). Ginseng Pharmacology: multiple constituents and multiple actions. Biochem Pharmacol. 58, 1685-1693.

48 Wakabayashi C, Murakami K, Hasegawa H, Murata J, Saiki I (1998). An intestinal bacterial metabolite of ginseng protopanaxadiol saponins has the ability to induce apoptosis in tumor cells. Biochem Biophys Res Commun. 246, 725-730.

49 Chan RYK, Chen WF, Dong A, Guo D, Wong MS (2002). Estrogen-like activity of ginsenoside Rg1 derived from Panax notoginseng . J Clin Endocrinol Metab. 87, 3691-3695.

50 Lee YJ, Chung E, Lee YJ, Lee YH, Huh B, Lee SK (1997). Ginsenoside Rg1, one of the major active molecules from Panax ginseng , is a functional ligand of glucocorticoid receptor. Mol Cell Endocrinol. 133, 135-140.

51 Pokharel YR, Kim ND, Han HK, Oh WK, Kang KW (2010). Increased ubiquitination of multidrug resistance 1 by ginsenoside Rd. Nutr Cancer. 62, 252-259.

52 Mochizuki M, Yoo YC, Matsuzawa K, Sato K, Saiki I, Tono-Oka S, Samukawa KI, Azuma I (1995). Inhibitory effect of tumor metastasis in mice by saponins, ginsenoside-Rb2, 20(R)- and 20(S)-ginsenoside-Rg3, of Red ginseng. Biol Pharm Bull. 18, 1197-1202.

53 Yue PYK, Wong DYL, Wu PK, Leung PY, Mak NK, Yeung HW, Liu L, Cai Z, Jiang ZH, Fan TPD, Wong RNS (2006). The angiosuppressive effects of 20(R)- ginsenoside Rg3. Biochem Pharmacol. 72,437-445.

54 Yi JS, Choo HJ, Cho BR, Kim HM, Kim YN, Ham YM, Ko YG (2009). Ginsenoside Rh2 induces ligand-independent Fas activation via lipid raft disruption. Biochem Biophys Res Commun. 385, 154-159.

55 Choi S, Kim TW, Singh SV (2009). Ginsenoside Rh2-mediated G1 phase cell cycle arrest in human breast cancer cells is caused by p15 Ink4B and p27 Kip1-dependent inhibition of cyclin-dependent kinases. Pharm Res. 26, 2280-2288.

5. Antitrypanosomal properties of Panax ginseng CA Meyer – new possibilities for a remarkable traditional drug!

5.1 Abstract African trypanosomiasis is still a major health problem in many sub-Saharan countries in Africa. We investigated the effects of three preparations of Panax ginseng , P. notoginseng , isolated ginsenosides and the polyacetylene panaxynol on Trypanosoma brucei brucei and the human cancer cell line HeLa. Hexane extracts and the pure panaxynol were toxic and at the same time highly selective against T. b. brucei , while methanol extracts and 12 isolated ginsenosides were significantly less toxic and showed only weak selectivity. Panaxynol was cytotoxic against T. b. brucei at the concentration of 0.01 µg/ml with a selectivity index of 858, superior even to established anti-trypanosomal drugs. We suggest that the inhibition of trypanothione reductase which is only found in trypanosomes, might explain the observed selectivity. The high selectivity together with a cytotoxic concentration in the range of the bioavailability make panaxynol and other polyacetylenes in general very promising lead compounds for the treatment of African trypanosomiasis.

5.2 Introduction Protozoa and helminths still cause severe damage to the health of people and their properties in many tropical countries [1]. Nevertheless, suitable drugs are scarce since these diseases are often neglected by commercially oriented research and development [2], so that new and reliable drugs are hardly available.

One of the most important parasitic diseases in sub-Saharan Africa is African trypanosomiasis, causing major health and economic problems. The parasites are protozoa of the genus Trypanosoma : Trypanosoma brucei rhodesiense and T. b. gambiense are causing human sleeping sickness while T. b. brucei is causing the cattle disease nagana. T. b. brucei , lacking human infectivity, is commonly used as a model for human sleeping sickness due to its morphological and biochemical similarities [1,3,4].

After becoming nearly extinct in the 1960s, sleeping sickness is again continually increasing due to various reasons. Endemic to 36 countries, 60 million people are threatened by its consequences. The WHO estimates 300 000 to 500 000 cases of human trypanosomiasis to

occur per year [5,6]. 46 million cattle are exposed to nagana, which causes annual costs of 1340 billion USD [7].

The medical situation is far from ideal with only four approved drugs: Suramin, pentamidine, melarsoprol and eflornithine. Diminazene is approved for the treatment of animals but not humans [3]. All of these drugs have strong side effects and several resistances were reported recently [8-10]. Thus, the discovery of new drugs is an urgent necessity [11-13].

The root of ginseng ( Panax ginseng C. A. Meyer) has been used as a highly praised medicinal plant in China, Korea, Japan and eastern Russia since several thousand years. The first surviving records of its use are Chinese oracle bones from around 1600 BC. Later descriptions dating to the Han dynasty around 200 AD elaborate on its medicinal properties [14]. It is still regarded as the most valuable herbal medicine in the traditional medicinal concept of China, Korea and Japan. Research is ongoing worldwide to explain its various medical properties.

Traditionally, P. ginseng from Korea is regarded to be of higher quality compared to the Chinese product. Korean red ginseng is a special preparation of P. ginseng where the root is steamed and boiled over several hours before drying it [15]. This method of preparation has a long history in Korea and is said to improve the pharmaceutical qualities of the ginseng root. Korean red ginseng was first mentioned in the Sonhoa Bongsa Goryeo Dogyoung in the year 1123 AD. Successively, Korean red ginseng is valued much higher and accordingly is much more expensive compared to the untreated, sundried root.

The main compounds of ginseng are ginsenosides and polyacetylenes, while fatty acids, polysaccharides and peptides seem to be of minor importance [16,17]. Till now, 38 ginsenosides have been isolated from P. ginseng ; by further adding P. quinquefolius and P. notoginseng , a total of 66 ginsenosides have been isolated [18]. The ginsenosides Rb 1, Rb 2,

Rc, Rd, Re and Rg 1 form over 90% of the total amount of ginsenosides in P. ginseng while the other 32 ginsenosides are present in only minor quantities [19].

Ginsenosides (Fig. 1, Tab. 1), generally regarded as the main pharmaceutical compounds of P. ginseng , are steroidal saponins with a four trans-ring rigid steroid skeleton and modified side chains at C3, C6 and C20 [20]. The chain length, site of attachment and the different sugar moieties result in a high diversity of structures. Common sugars are glucose, maltose, fructose and sucrose. The structural modifications influence on the biological activity and explain the

various effects described for P. ginseng. We focused especially on their individual effects on HeLa and T. b. brucei . The tested 12 ginsenosides can be sorted into four groups according to their structure as mono- or bidesmosidic saponins and depending on the C atom to which the sugar chain is linked (Fig. 1). These variations explain the strong differences in toxicity, since aglycones and monodesmosidic saponins are able to enter and modify the biomembrane while bidesmosidic saponins remain outside of the lipid bilayer [21].

Fig. 1: Ginsenosides

Group I: Bidesmosidic saponins

Ginsenoside Rd Ginsenoside Rb 1 Ginsenoside Rc

Ginsenoside Re Ginsenoside Rg 1

Group II: Monodesmosidic saponins (C3-gly)

Ginsenoside Rg 3 Ginsenoside Rh 2

Group III: Monodesmosidic saponins (C6-gly)

Ginsenoside Rg 2 Ginsenoside Rh 1

Pseudoginsenoside F 11

Group IV: Aglycones

Protopanaxatriol Protopanaxadiol

Table 1: Ginsenosides Compound: Ginsenoside Molecular Formula Molar Mass

Bidesmosidic saponins Ginsenoside Rb 1 C54 H92 O23 1109.29 Ginsenoside Rc C53 H90 O22 1079.27 Ginsenoside Rd C48 H82 O18 947.15 Ginsenoside Re C48 H82 O18 947.15 Ginsenoside Rg 1 C42 H72 O14 801.01

Monodesmosidic saponins: C3-gly Ginsenoside Rg 3 C42 H72 O13 785.01 Ginsenoside Rh 2 C36 H62 O8 622.87

Monodesmosidic saponins: C6-gly Ginsenoside Rg 2 C42 H72 O13 785.01 Ginsenoside Rh 1 C36 H62 O9 638.87 Pseudoginsenoside F 11 C41 H70 O14 786.99

Aglycones Protopanaxadiol C30 H52 O3 460.73 Protopanaxatriol C30 H52 O4 476.73

As a traditional tonic, P. ginseng has surprised scientists with a broad series of pharmaceutical effects [22]. One of the main applications could be confirmed by the positive effect on reaction time, concentration and mental fitness [23-25]. Many studies were conducted to

demonstrate the effects on the cardiovascular system [26,27]. Additionally, P. ginseng has positive effects on the immune system [28,29], lowered the blood glucose level and thus having a positive effect on diabetes [30-33].

One of the most important aspects of P. ginseng , however, is inhibition of tumour cell growth and induction of apoptosis [34,35]. Cancer preventive effects could be demonstrated by several studies both using extracts and pure ginsenosides [36,37].

Polyacetylenes (Fig. 2, Tab. 2) are the second major group of compounds found in P. ginseng . They are lipophilic molecules and constitute the main active group of compounds in the hexane extracts. In P. ginseng , panaxynol, panaxydol, panaxytriol and falcarindiol are the main polyacetylenes (Fig. 2). Polyacetylenes are not limited to the genus Panax , but are widely distributed in Apiaceae, Araliaceae and Asteraceae. Nearly all polyacetylenes found in food and medicinal plants (carrot, celeriac, parsnip, parsley and ginseng) are of the panaxynol type [32,38-48]. Panaxynol was discovered twice; the first isolation was performed by Takashi and Yoshikura [49], 1964, who named the molecule panaxynol. Bohlman et al . [50] isolated the same compound shortly afterwards, not knowing that it was already described and called it falcarinol. Unfortunately, both names became established in scientific literature and are used as synonyms, adding to the confusion. We give credit to the first isolation and will use the name panaxynol. Panaxynol is sensitive to heat and not stable in pure form or DMSO at room temperature while being relatively stable in organic solvents such as hexane and dichloromethane [51-53].

Polyacetylenes possess a surprisingly wide range of biological activities: They are direct antioxidants due to their CC triple bond [40,41], while at the same time up regulating the antioxidant response element (ARE) [54]. The triple bonds are reactive and can covalently bond to SH-groups of proteins [21].

Polyacetylenes are potent anti-inflammatory compounds [55-57]. The inhibition of lipoxygenases and the modulation of prostaglandin catabolism by inhibiting the prostaglandin-catabolizing enzyme 15-hydroxy-prostaglandin dehydrogenase seem to be the major mechanism [58-60]. However, the inhibition of the inducible nitric oxide synthase (iNOS) [61] and the inhibition of COX-1 [62] seem to be important as well.

Fig. 2: Polyacetylenes

Panaxynol Falcarindiol

Panaxytriol Panaxydol

Table 2: Polyacetylene Compound: Polyacetylene Molecular Formula Molar Mass

Panaxynol C17 H24 O 244.37 Falcarindiol C17 H24 O2 260.37 Panaxydol C17 H24 O2 260.37 Panaxytriol C17 H26 O3 278.39

Polyacetylenes were shown to be cytotoxic to various cancer cell lines [63-79]. Both in vitro and in the rat model an anticancer activity could be shown [80-82]. The effect of cancer drugs was shown to be enhanced in combination with polyacetylenes due to membrane effects and multiple attacks on proteins and other targets [83]. The antioxidant, the anti-inflammatory and the cytotoxic effects seem to be important and connected for cancer prevention by polyacetylenes.

An anti-platelet-aggregation effect by regulating the levels of cGMP and TXA 2 to inhibit platelet aggregation induced by thrombin was shown, too [84-86].

Panaxynol causes allergic contact dermatitis and irritant skin reactions while related polyacetylenes do not seem to be allergenic [51,87-89].

100

Polyacetylenes are toxic to a wide range of organisms: Crustaceans were sensitive in the brine shrimp assay [76]. Antiviral activity was also demonstrated [90]. Antifungal and spore germination inhibiting properties are well known [46,91-96], as are the effects against bacteria and mycoplasma [97-102].

Interestingly, polyacetylenes possess high antimalarial activities in vitro and in vivo [103,104], whereas medium antiprotozoal activities were demonstrated for some rare polyacetylenes of Tanzanian medicinal plants in vitro [105]. The mode of action, however, was not established by these authors.

We studies the effects of different ginseng preparations as well as of 12 pure ginsenosides and panaxynol on African trypanosomiasis, revealing a new, very promising application for this important medicinal plant.

5.3 Material and Methods Chemicals and plant material DMEM media, supplements, fetal bovine serum (FBS), trypsin-EDTA and dimethyl sulfoxide (DMSO) were purchased from Gibco  Invitrogen (Germany). The positive controls diminazene (D7770, ≥90% purity), DL-α-difluoromethylornithine (D193, ≥97% purity), metronidazole (M3761, analytical purity), ornidazole (O5879, analytical purity), suramin (S2671, ≥95% purity) were purchased from Sigma-Aldrich , Germany. Chinese Panax ginseng C. A. Meyer was bought in a store specialized on P. ginseng in China (P8088). Korean Panax ginseng C. A. Meyer (P8086) and red Panax ginseng C. A. Meyer (P8087) (6 years old; land of origin Korea) were purchased from Cheong Kwan Jang ginseng store in Korea. Panax notoginseng (Burkill) F. H. Chen (P6887) was provided by Prof. Dr. T. Efferth, Johannes Gutenberg University, Mainz. Ginsenosides and panaxynol were purchased in China by Wan Chuangxing, Tarim University, PR China.

Genetic identification of plant material P. ginseng and P. notoginseng were authenticated by visual and microscopic identification and by DNA barcoding. DNA was isolated from dried plant material; their chloroplast rbc L gene was amplified and sequenced. The obtained sequences were authenticated with sequences obtained from sample species of the Botanical Garden of Heidelberg and databases. Voucher specimens of the plant material were deposited at the Department of Biology,

101

Institute of Pharmacy and Molecular Biotechnology, Heidelberg University (P. ginseng China: IPMB number P8088, GenBank accession number JF950028; P. ginseng Korea: IPMB number P8086, GenBank accession number JF950029; P. ginseng Red IPMB number P8087; P. notoginseng IPMB number P6887, GenBank accession number JF950030).

Extract preparation 100 g of dried fine milled root powder was exhaustively extracted in a Soxhlet Extractor first with hexane, then dichloromethane and finally methanol under moderate heat for 20 h each. The solvents were removed with a rotavapour. The resulting residues were dried in oil vacuum and stored under exclusion of light at -40 °C. The yield of the hexane extracts were 0.46 g, 0.48 g, 0.47 g and 0.35 g dry extract. The yield of the dichloromethane extracts were 0.31 g, 0.39 g, 0.33 g and 0.28 g dry extract. The yield of the methanol extracts were 9.87 g, 9.75 g, 9.99 g and 8.76 g dry extract for P. ginseng (Korea), P. ginseng (China), P. notoginseng and P. ginseng (red) respectively. Prior to the experiments the remaining solvent was evaporated and the extract solved in DMSO before being applied to the cells. This was performed prior to each experiment to minimize the error due to the instability of polyacetylenes in DMSO.

Mass spectrometry GLC-MS: GLC-MS analysis 6 was done on a 5890 Series II Gas Chromatograph (Hewlett-Packard, Palo Alto, California, USA) coupled to a Finnigan SSQ 7000 Mass Spectrometer (Thermo Finnigan, Bremen, Germany). The head pressure of the 30 meter long capillary column with an inner diameter of 0.25 mm and an OV-1 bonded phase layer of 0.25 micrometer (Ohio Valley Speciality Company Marietta, Ohio, USA) was 100 kPa Helium. The temperature of the split injector (split ratio 1:30) was 250 deg C. Oven temperature was kept at 120 deg C for 1 min isotherm at the start. Then the temperature was raised at a rate of 6 deg C/min up to 300 deg/C and kept isotherm for 10 min. The Quadrupol Mass Spectrometer was operated in MID mode (m/z =40-500), ion source temperature was 175 deg C, electron energy 70 eV. The datasystem (Xcalibur version 1.3, Thermo Finnigan) was started after a delay time of 5 min. 2 mikro l samples of solutions in hexane were analysed.

6 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Frank Sporer 102

HPLC-MS: Mass spectrometry 7 was performed on a VG Quattro II system form Micromass provided with ESI source at a negative scan mode under the parameters Capillary: 3.00 kV, HV Lens: 0.50 o kV, Cone: 40 V. Drying and nebulising gas N 2. Source temp. 120 C. Scan range: 400-1200. Ginsenosides were identified using pure authentic compounds. HPLC was performed on a Merck-Hitachi L-6200A system with 1 mL/min step gradient flow rate. The used stationary phase was an RP18 e column (LiChrospher, 250-4mm, 5 µm, Darmstadt, Germany). Data were processed using MassLynx 4.0 software. HPLC and LC-MS were used to analyse ginseng preparations, extracts and the purity of ginsenosides and polyacetylenes.

Cell culture Trypanosomes: T. b. brucei TC 221 derived from stock 427 and were originally obtained from Prof. Peter Overath (Max-Plank Institut für Biologie, Tübingen) by Dr. D. Steverding; they were cultured in the IPMB since 1999. HeLa and T. b. brucei culture: HeLa (cervical cancer) cell lines were maintained in DMEM complete media (L-glutamine supplemented with 10% heat-inactivated fetal bovine serum, 5% penicillin/ streptomycin and 5% non-essential amino acids). Cells were grown at 37 °C in a humidified atmosphere of 5%

CO 2. Bloodstream forms of T. b. brucei cells were grown in BALTZ medium [106], supplemented with 20% inactivated fetal bovine serum (FBS) and 0.001% β-mercaptoethanol. DMEM media, supplements, fetal bovine serum (FBS), trypsin-EDTA and dimethyl sulfoxide (DMSO) were purchased from Gibco  Invitrogen (Germany). All experiments were performed with cells in the logarithmic growth phase.

MTT assay: Cytotoxicity was determined in triplicate using the 3-(4.5-dimethylthiazol-2-yl)-2.5- diphenyltetrazolium bromide (MTT) cell viability assay [107]. Extracts, ginsenosides and panaxynol were dissolved in dimethylsulfoxide (DMSO) and serially diluted in medium into ten different concentrations. A 100 µl sample containing medium was dispensed into each well. The concentration of the solvent, DMSO, did not exceed 0.05% in the medium that contained the highest concentration tested. Controls included wells with untreated cells and without cells. Cells (2 x 10 4 cells/well) were seeded in 96-well plates (Greiner Labortechnik).

7 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Ahmad Tahrani 103

Cells were cultured for 24 h to 80% confluence before treating them with the test samples. After incubation for 24 h the medium was replaced with fresh medium containing 0.5 mg/ml MTT. 4 h later the formed formazan crystals were dissolved in 100 µl DMSO; the absorbance was detected at 570 nm with a Tecan Safire II Reader. Doxorubicin was used as positive control for HeLa cells, artemisinin, diminazene, DL-α-difluoromethylornithine, metronidazole, ornidazole and suramin were used as positive control for T. b. brucei . Cell viability of T. b. brucei was additionally confirmed and evaluated using microscopical techniques. Screening: T. b. brucei was compared to HeLa cells and the Selectivity index (SI) was calculated as:

SI: ratio of the IC 50 value of mammalian cells divided by the IC 50 value of trypanosomes.

Statistical analysis: The results were obtained as means and standard errors of triplicates repeated at least three times for each measurement point. The IC 50 values were calculated using a four parameter logistic curve (SigmaPlot® 11.0) representing 50% reduction of viability compared to the positive control.

Table 3: Relative abundance of polyacetylenes detected in the Panax extracts via GLC-MS

P. ginseng Korea P. ginseng China P. ginseng Red P. notoginseng

C6H14 CH 2Cl 2 CH 4O C6H14 CH 2Cl 2 CH 4O C6H14 CH 2Cl 2 CH 4O C6H14 CH 2Cl 2 CH 4O Panaxynol 9.4 % trace - 10.9 % trace - 30.7 % trace - 7.8 % trace - Peak 2 60.1 % trace - 67.7 % trace - 5.9 % trace - 20.4 % trace - Peak 3 2.6 % - - 1.9 % - - 20.4 % trace - 21.7 % trace -

Table 4: Relative abundance of ginsenosides detected in the Panax extracts via HPLC-MS

P. ginseng Korea P. ginseng China P. ginseng Red P. notoginseng

C6H14 CH 2Cl 2 CH 4O C6H14 CH 2Cl 2 CH 4O C6H14 CH 2Cl 2 CH 4O C6H14 CH 2Cl 2 CH 4O Rd - - ND - - 3.9 % - ND 3.4 % - - 3.2 % 28.8 Rg 1 - 2.2 % ND - 1.4 % 1.3 % - ND 10 % - 0.4 % %

PF 11 - 0.3 % ND - trace 1.7 % - ND 2 % - - 1.1 %

Rh 1 - 0.5 % ND - trace trace - ND 1.8 % - 0.3 % trace

Rg 2 - - ND - 0.8 % 1.5 % - ND 0.3 % - - 4.3 % 16.1 Rb 1 - - ND - - 6.4 % - ND 6 % - - % Rc - - ND - - 5.2 % - ND 0.5 % - - 1.4 % Re - - ND - - 4.5 % - ND 3 % - - 6.9 %

Rg 3 - - ND - trace trace - ND 0.9 % - - -

Rh 2 - - ND - 2.1 % trace - ND - - - - Protopanaxa diol - trace - - - - - trace - - trace - Protopanaxat riol ------

104

5.4 Results The GLC-MS data of the four hexane extracts revealed that panaxynol is one of the main polyacetylenes and present in all extracts (Fig. 3,4, Tab. 3). The RI (OV-1) was similar to the one published previously [108]. The second major polyacetylene is an unidentified polyacetylene similar in structure to panaxynol. The MS spectrum shows the close structural relationship to panaxynol (Fig. 4). The third major polyacetylene also of the panaxynol type is present in significant amounts only in the hexane extract of P. notoginseng and the red P. ginseng .

The HPLC-MS data of the extracts showed that ginsenosides are the major compounds of the methanol extracts. They appear only in traces in the dichloromethane extracts and are completely absent in the hexane extracts (Tab. 4). The major ginsenosides of all four ginseng variations are the ginsenosides Rd, Rg 1, Rb 1 and Re while the exact amount of the ginsenosides varies significantly.

Three variations of P. ginseng (origin China, origin Korea and red ginseng from Korea), P. notoginseng , panaxynol and 12 ginsenosides were tested against the human cancer cell line HeLa and T. b. brucei . Suramin, DL-α-difluoromethylornithine and diminazene plus three further drugs were used as control substances in comparison to P. ginseng extracts, 12 isolated ginsenosides and panaxynol (Tab. 5,6). Suramin and DL-α-difluoromethylornithine are established drugs for the treatment of human trypanosomiasis, while diminazene is licensed for veterinary treatment only [109,110]. The lipophilic hexane and dichloromethane extracts of the P. ginseng varieties and P. notoginseng showed a remarkably selective cytotoxicity against T. b. brucei , while the polar methanol extracts were significantly less toxic and less selective (Tab. 5; Fig. 5-8). The cytotoxicity of the hexane extracts against T. b. brucei and HeLa cells was 0.1 to 2.6 µg/ml and 52.9 to 1085.9 µg/ml, respectively. The resulting selectivity index was between 101 and 529, while the selectivity index of the polar methanol extracts was only between 1 and 4 (Tab. 5).

The effects of the pure compounds of P. ginseng were even more remarkable. The polyacetylene panaxynol showed a toxicity of 0.01 µg/ml against T. b. brucei and 8.58 µg/ml against HeLa, giving a substantially high selectivity index of 858 (Tab. 6; Fig. 9).

105

Table 5: Cytotoxic effects of the hexane, dichloromethane and methanol extracts of four Panax drugs

T. b. HeLa T. b. HeLa T. b. HeLa Ratio Ratio Ratio brucei IC brucei IC brucei IC (HeLa/ 50 (HeLa/ 50 (HeLa/ 50 IC [µg/ml] IC [µg/ml] IC [µg/ml] T. b. 50 T. b. 50 T. b. 50 [µg/ml] [µg/ml] [µg/ml] brucei ) brucei ) brucei ) C6H14 C6H14 CH 2Cl 2 CH 2Cl 2 CH 4O CH 4O Panax ginseng 2.1 506.1 241.0 0.9 152.4 169.3 319.0 1427.9 4.4 China Panax ginseng 0.6 138.6 231.0 3.3 173.1 52.4 1075.0 1317.9 1.2 Korea Panax ginseng 0.1 52.9 529.0 3.1 279.3 90.0 782.7 1310.6 1.6 Red Panax 0.4 150.3 0.9 263.0 469.6 1241.6 375.7 292.2 2.6 notoginseng

Table 6: Cytotoxic effect of panaxynol and ginsenosides

Cytotoxic effect of T. b. brucei HeLa Ratio polyacetylenes IC 50 [µg/ml] IC 50 [µg/ml] (HeLa/ T. b. brucei ) Panaxynol 0.01 8.58 858.00

Cytotoxic effects of T. b. brucei HeLa Ratio ginsenosides IC 50 [µg/ml] IC 50 [µg/ml] (HeLa/ T. b. brucei ) Bidesmosidic saponins Ginsenoside Rb 1 411.1 1373.3 3.3 Ginsenoside Rc 157.3 1431.5 9.1 Ginsenoside Rd 71.9 161.3 2.2 Ginsenoside Re 974.5 1291.8 1.3 Ginsenoside Rg 1 1003.4 1408.8 1.4

Monodesmosidic saponins: C3-gly Ginsenoside Rg 3 37.0 245.7 6.6 Ginsenoside Rh 2 21.3 29.1 1.3

Monodesmosidic saponins: C6-gly Ginsenoside Rg 2 240.3 1172.7 4.8 Ginsenoside Rh 1 295.8 452.9 1.5 Pseudoginsenoside F 11 2181.0 2332.9 1.0

Aglycones Protopanaxadiol 12.4 13.2 1.0 Protopanaxatriol 11.5 31.6 2.7

Cytotoxicity of control T. b. brucei HeLa Ratio compounds IC 50 [µg/ml] IC 50 [µg/ml] (HeLa/ T. b. brucei ) Artemisinin 98.0 451.8 4.6 Diminazene 0.1 170.6 1706.0 DL-α-difluoromethylornithine 11.7 1502.6 128.4 Metronidazole 18.8 1180.5 62.7 Ornidazole 18.8 849.8 45.2 Suramin 4.7 1317.1 280.2

106

Compared to this, the established drugs against human trypanosomiasis, DL-α- difluoromethylornithine and suramin have only a selectivity index of 128 and 277, respectively. The selectivity index of panaxynol is with 858 three times higher than the one of the standard drug suramin with 277. Only diminazene, which is not licensed for the treatment of humans, showed a higher selectivity index of approximately 1706 as compared to panaxynol (Tab. 6).

The 12 ginsenosides had a toxicity range from 11.5 to 2181.0 µg/ml for T. b. brucei and 13.2 to 2332.9 µg/ml for HeLa with selectivity indices between 1 and 9 (Tab. 6; Fig. 10-13).

5.5 Discussion Due to the high importance of P. ginseng in Asian medicine, we chose to investigate three types of P. ginseng : P. ginseng with the origin of China, P. ginseng with the origin of Korea and Red ginseng from Korea . Additionally, we decided to compare these three varieties of P. ginseng with P. notoginseng. Being closely related, it also contains ginsenosides as well as polyacetylenes. Just as in P. ginseng , its main polyacetylene is panaxynol.

Our HPLC-MS results confirm that ginsenosides are mainly present in the methanol extracts; tiny amounts could also be found in the dichloromethane extracts, while none were present in the hexane extracts (Tab. 4). Our GLC-MS data demonstrated that polyacetylenes with panaxynol as main representative are major compounds of the hexane extracts of all ginseng variations (Fig. 3).

Red ginseng is traditionally believed to be of higher efficacy than the untreated root. Certain ginsenosides are said to be degraded, while others are concentrated [36,111]. Yun [36] describes the monodesmosidic ginsenosides Rh 1, Rh 2, Rg 3 and Rg 5 as the major saponin components of red ginseng, while our results showed that they occur only in low amounts.

Contrary to this, the bidesmosidic ginsenosides Rb 1, Rd, Re and Rg 1 were most abundant in our red ginseng (Tab. 4). These findings show that unlike to the common opinion, bidesmosidic saponins are not necessarily degraded but can survive the preparation process of red ginseng unaltered, which explains the similar cytotoxicity of the methanol extracts of the four ginseng variations. The preparation method of steaming and boiling seems to be less aggressive than commonly thought and thus also allows the survival of the other group of sensitive molecules, the polyacetylenes.

107

Polyacetylenes, especially panaxynol, are commonly assumed to be instable in heat treatment and so we supposed that the effect of the treated red ginseng should be reduced compared to the untreated root. However, the results showed an enhanced activity both against HeLa cells and T. b. brucei of the hexane extract of red ginseng. Additionally, our GLC-MS data showed that panaxynol and other polyacetylenes are present in all four hexane extracts (Fig. 3,4). This demonstrates that no significant loss of activity occurred by the treatment to transform the fresh ginseng into the red ginseng.

P. notoginseng is valued as an important drug with similar medicinal properties as P. ginseng in Chinese Medicine. Our experiments showed comparable results, suggesting that it can be used under certain circumstances as a substitute.

No differences were seen in the cytotoxicity of the methanol and dichloromethane extracts between all four ginseng variations. The activity of the methanol extracts was with IC 50 values of around 1300 µg/ml comparable to that of the bidesmosidic ginsenosides of group I, which are also the main compounds detected by mass spectrometry in these extracts (Tab. 4-6).

While the ginsenosides and methanol extracts showed no selectivity and no remarkable cytotoxicity towards T. b. brucei , panaxynol and the hexane extracts were not only highly cytotoxic, but also extremely selective towards T. b. brucei . Panaxynol was superior to all licensed drugs applied in the treatment of African trypanosomiasis (Tab. 6). We conclude that the polyacetylenes, especially panaxynol are the active principle in ginseng against T. b. brucei .

The general cytotoxic mechanism of panaxynol is well understood. The hydrophobic molecule can easily penetrate the cells. There, the loss of water at the C3 hydroxyl group forms an extremely stable carbocation. This carbocation is a very reactive alkylating agent towards SH and amino groups in proteins and other biomolecules

Fig. 14: Glutathione disulfide (a) and [21,40,41,112]. One example is the inactivation of trypanothione disulfide (b) after Bond et al ., + 1999 [117] Na channels [113].

108

The reason for the selectivity of panaxynol against T. b. brucei seems to be based on several mechanisms working together. The most important target seems to be the inhibition of the trypanothione reductase. This enzyme is specific for trypanosomastids, while mammalian cells use the glutathione reductase instead. These enzymes are members of the FAD- dependent NADPH oxidoreductase family. They are dimeric molecules and protect the cell against reactive oxygen species formed during the aerobic metabolism [110,114-116]. The two enzymes are able to distinguish their substrates trypanothione disulfide and glutathione disulfide by the factor 1000 because of differences in size and charge. Glutathione disulfide is smaller and -2 charged at physiological pH, while trypanothione disulfide is +1 charged with a hydrophobic body of seven methylene groups (Fig. 14). The trypanothione disulfide binding site in the trypanothione reductase is larger with a negatively charged glutamate side chain and a hydrophobic cleft for the polyamine moiety (Fig. 15). Contrary to this, the glutathione reductase has a positively charged, smaller active centre [110,118].

The panaxynol carbocation can enter the active centre of the trypanothione reductase due to its positive charge and lipophilic chain. There, it can bind to the active centre and block the enzyme. This is not possible with the glutathione reductase where it is repelled Fig. 15: Trypanothione reductase with binding site after Bond et al ., because of its positive charge. 1999 [117] There, the CC triple bonds of the carbocation can form irreversible bonds with the active centre. Additionally, panaxynol is known to modify AMP levels in mammalian cells by direct inhibition of the mitochondrial respiration resulting in a significant reduction of ATP in the cells [75,118,119]. The immediate consequence is a cell cycle arrest [42,120,121]. Thus, fast proliferating cells are especially sensitive to panaxynol, as was demonstrated by several investigations [69,112,122-124]. This is probably happening in rapidly proliferating T. b. brucei as well. Trypanosomes require specific sterols for their cell viability and are extremely sensitive to ergosterol biosynthesis inhibitors [125-127]. Polyacetylenes, on the other side, have been

109

shown to inhibit the cholesterol acyltransferase (ACAT) [128-130]. We suggest that the observed selectivity of panaxynol is based on these three mechanisms, while the most important one seems to be the inhibition of the trypanothione reductase.

For future drug developments, the bioavailability of panaxynol is crucial. This was already established by Christensen and Brandt [40], who demonstrated that the oral uptake of 300, 600 and 900 ml carrot juice with 13.3 mg panaxynol/l resulted in a maximum serum concentration of 2.5 ng/ml. The amount of panaxynol in P. ginseng is 5 times higher than in carrots, lowering the necessary amount of drug to obtain sufficient serum concentration levels [53,131]. This concentration is already in the active range demonstrated in our experiments, making panaxynol and other polyacetylenes in general very promising compounds for the treatment of African trypanosomiasis.

110

Fig. 3: GLC-profiles of hexane extracts (TIC)

Hexane extracts: A: Panax ginseng (Korea) B: Panax ginseng (China) C: Panax notoginseng D: Panax ginseng (Red) Major peaks: 1: Panaxynol 2: unidentified polyacetylene of panaxynol type 3: unidentified polyacetylene

111

Fig. 4: MS-spectra of polyacetylenes

1: MS of panaxynol 2: MS of unidentified polyacetylene of panaxynol type 3: MS of unidentified polyacetylene

112

Fig. 5: Cytotoxic effects of the hexane and methanol extracts of P. ginseng (Korea) against T. b. brucei and HeLa cells.

150 150 Hexane Hexane

Methanol Methanol

100 100 Survival [%] 50 Survival [%] 50

0 0 39 78 0.3 0.6 1.2 2.4 4.9 9.8 39 78 9.8 156 313 625 0.15 19.5 156 313 625 19.5 1250 2500 5000 0.075 1250 2500 5000 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of P. ginseng (Korea) extracts against T. b. brucei B: Cytotoxic effect of P. ginseng (Korea) extracts against HeLa cells

Fig. 6: Cytotoxic effects of the hexane and methanol extracts of P. ginseng (China) against T. b. brucei and HeLa cells.

150 150 Hexane Hexane

Methanol Methanol

100 100 Survival [%] Survival Survival [%] Survival 50 50

0 0 39 78 0.3 0.6 1.2 2.4 4.9 9.8 39 78 9.8 156 313 625 0.15 19.5 156 313 625 19.5 1250 2500 5000 0.075 1250 2500 5000 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of P. ginseng (China) extracts against T. b. brucei B: Cytotoxic effect of P. ginseng (China) extracts against HeLa cells

Fig. 7: Cytotoxic effects of the hexane and methanol extracts of P. notoginseng against T. b. brucei and HeLa cells.

150 150 Hexane Hexane

Methanol Methanol

100 100 Survival [%] 50 [%] Survival 50

0 0 39 78 0.3 0.6 1.2 2.4 4.9 9.8 39 78 9.8 156 313 625 0.15 19.5 156 313 625 19.5 1250 2500 5000 0.075 1250 2500 5000 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of P. notoginseng extracts against T. b. brucei B: Cytotoxic effect of P. notoginseng extracts against HeLa cells

113

Fig. 8: Cytotoxic effects of the hexane and methanol extracts of P. ginseng (Red) against T. b. brucei and HeLa cells.

150 150 Hexane Hexane

Methanol Methanol

100 100 Survival [%] Survival 50 [%] Survival 50

0 0 39 78 0.3 0.6 1.2 2.4 4.9 9.8 39 78 9.8 156 313 625 0.15 19.5 156 313 625 19.5 1250 2500 5000 0.075 1250 2500 5000 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of P. ginseng (Red) extracts against T. b. brucei B: Cytotoxic effect of P. ginseng (Red) extracts against HeLa cells

Fig. 9: Panaxynol

150 150 Panaxynol Panaxynol

100 100

Survival [%] Survival 50

0 0 0.5 25 50 0.25 0.1 0.2 0.4 0.8 1.6 3.2 6.4 0.001 0.002 0.004 0.008 0.016 0.032 0.064 0.125 12.5 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of panaxynol against T. b. brucei B: Cytotoxic effect of panaxynol against HeLa cells

Fig. 10: Ginsenosides group I

150 Ginsenoside Rb1 Ginsenoside Rc 150 Ginsenoside Rb1 Ginsenoside Rd Ginsenoside Rc Ginsenoside Re Ginsenoside Rd Ginsenoside Rg1 Ginsenoside Re Ginsenoside Rg1 100 100

Survival [%] 50 Survival [%] 50

0 0 5 5 10 20 39 78 10 20 39 78 2.5 2.5 156 312 625 156 312 625 0.63 1.25 0.63 1.25 1250 2500 1250 2500 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of the ginsenoside group I against T. b. brucei B: Cytotoxic effect of the ginsenoside group I against HeLa cells

114

Fig. 11: Ginsenosides group II

150 Ginsenoside Rg3 150 Ginsenoside Rg3 Ginsenoside Rh2 Ginsenoside Rh2

100 100

Survival[%] 50 Survival[%] 50

0 0 5 5 10 20 39 78 10 20 39 78 2.5 2.5 156 312 156 312 0.63 1.25 0.63 1.25 Concentration [µg/ml] Concentration [µg/ml] A: Cytotoxic effect of the ginsenoside group II against T. b. brucei B: Cytotoxic effect of the ginsenoside group II against HeLa cells

Fig. 12: Ginsenosides group III

150 Ginsenoside Rg2 150 Ginsenoside Rg2 Ginsenoside Rh1 Ginsenoside Rh1 Pseudoginsenoside F11 Pseudoginsenoside F11

100 100 Survival [%]

Survival[%] 50 50

0 0 625 10 20 39 78 9.76 1250 2500 5000 156 312 625 19.53 39.06 78.12 312.5 1250 2500 5000 156.25 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of the ginsenoside group III against T. b. brucei B: Cytotoxic effect of the ginsenoside group III against HeLa cells

Fig. 13: Ginsenoside group IV

150 Protopanaxatriol 150 Protopanaxatriol Protopanaxadiol Protopanaxadiol

100 100

Survival [%] Survival 50 Survival [%] Survival 50

0 0 5 5 10 20 39 78 10 20 39 78 2.5 2.5 156 312 156 312 0.63 1.25 0.63 1.25 Concentration [µg/ml] Concentration [µg/ml]

A: Cytotoxic effect of the ginsenoside group IV against T. b. brucei B: Cytotoxic effect of the ginsenoside group IV against HeLa cells

115

5.6 References

1 Pink R, Hudson A, Mouriès MA, Bending M (2005). Opportunities and challenges in antiparasitic drug discovery. Nat Rev Drug Discov. 4, 727-740.

2 Trouiller P, Olliaro P, Torreele E, Orbinski J, Laing R, Ford N (2002). Drug development for neglected diseases: a deficient market and a public-health policy failure. Lancet. 359, 2188-2194.

3 Hoet S, Opperdoes F, Brun R, Quetin-Leclerq J (2004). Natural products active against African trypanosomes: a step towards new drugs. Nat Prod Rep. 21, 353-364.

4 Räz B, Iten M, Grether-Bühler Y, Kaminsky R, Brun R (1997). The Alamar Blue assay to determine drug sensitivity of African trypanosomes ( T.b. rhodesiense and T.b. gambiense ) in vitro. Acta Trop. 68, 139-147.

5 WHO/CDS/CSR/ISR/2000.1: WHO report on global surveillance of epidemic-prone infectious diseases, World Health Organisation (2000) http://www.who.int/csr/resources/publications/surveillance/en/a_tryps.pdf Last access: June 2011

6 Barrett MP (1999). The fall and rise of sleeping sickness. Lancet. 353, 1113-1114.

7 Kristjanson PM, Swallow BM, Rowlands GJ, Kruska RL, de Leeuw PN (1999). Measuring the costs of African animal trypanosomiasis, the potential benefits of control and returns to research. Agr Sys. 59, 79-98.

8 Fairlamb AH (2003). Chemotherapy of human African trypanosomiasis: current status and future prospects. Trends Parasitol. 19, 488-494.

9 Croft SL (1997). The current status of antiparasitic chemotherapy. Parasitology. 114 Suppl, 3-15.

10 Ross CA, Sutherland DV (1997). Drug resistance in trypanosomatids. In: Hide G, Mottram JC, Coombs GH, Holmes PH, editors. Trypanosomiasis and leishmaniasis: biology and control. CAB international, Wallinford, Oxon. 259-269.

11 Newman DJ, Cragg GM, Snader KM (2003). Natural products as sources of new drugs over the period 1981-2002. J Nat Prod. 66, 1022-1037.

12 Legros D, Ollivier G, Gastellu-Etchegorry M, Paquet C, Burri C, Jannin J, Büscher P (2002). Treatment of human African trypanosomiasis--present situation and needs for research and development. Lancet Infect Dis. 2, 437-440.

13 Brun R, Schumacher R, Schmid C, Kunz C, Burri C (2001). The phenomenon of treatment failures in Human African Trypanosomiasis. Trop Med Int Health. 6, 906-914.

14 Chen CF, Chiou WF, Zhang JT (2008). Comparison of the pharmacological effects of Panax ginseng and Panax quinquefolium . Acta Pharmacol Sin. 29, 1103-1108.

116

15 Wu JN (2005). Panax ginseng . In An illustrated Chinese Materia Medica . Oxford University Press, New York; 460-461.

16 Kiefer D, Pantuso T (2003). Panax ginseng . Am Fam Physician. 68, 1539-1542.

17 Lee FC (1992). Facts about ginseng, the elexir of life. Hollyn International Corp., Elizabeth, NJ.

18 Choi KT (2008). Botanical characteristics, pharmacological effects and medicinal components of Korean Panax ginseng C A Meyer. Acta Pharmacol Sin. 29, 1109-1118.

19 Lee TK, Johnke RM, Allison RR, O’Brien KF, Dobbs LJ Jr (2005). Radioprotective potential of ginseng. Mutagenesis. 20, 237-243.

20 Shibata S, Tanaka O, Shoji J, Saito H (1985). Chemistry and pharmacology of Panax . In: economic and medicinal plant research (Eds. Wagner H, Hikino H and Farnsworth NR), Vol. 1, pp. 217- 284. Academic Press, New York.

21 Wink M (2008). Evolutionary advantage and molecular modes of action of multicomponent mixtures in phytomedicine. Curr Drug Metab. 9, 996-1009.

22 Mahady GB, Gyllenhall C, Fong HH, Farnsworth NR (2000). Ginseng: a review of safety and efficacy. Nutr Clin Care. 3, 90-101.

23 Kennedy DO, Scholey AB, Wesnes KA (2002). Modulation of cognition and mood following administration of single doses of Ginkgo biloba, ginseng, and a ginkgo/ ginseng combination to healthy young adults. Physiol Behav. 75, 739-751.

24 Sorensen H, Sonne J (1996). A double-masked study of the effects of ginseng on cognitive functions. Curr Ther Res Clin E. 57, 959-968.

25 D’Angelo L, Grimaldi R, Caravaggi M, Marcoli M, Perucca E, Lecchini S, Frigo GM, Crema A (1986). A double-blind, placebo-controlled clinical study on the effect of a standardized ginseng extract on psychomotor performance in healthy volunteers. J Ethnopharmacol. 16, 15-22.

26 Nakajima S, Uchiyama Y, Yoshida K, Mizukawa H, Haruki E (1998). The effect of ginseng radix rubra on human vascular endothelial cells. Am J Chin Med. 26, 365-373.

27 Kang SY, Schini-Kerth VB, Kim ND (1995). Ginsenosides of the protopanaxatriol group cause endothelium-dependent relaxation in the rat aorta. Life Sci. 56, 1577-1586.

28 Scaglione F, Ferrara F, Dugnani S, Falchi M, Santoro G, Fraschini F (1990). Immunomodulatory effects of two extracts of Panax ginseng C A Meyer. Drugs Exp Clin Res. 16, 537-542.

29 Scaglione F, Weiser K, Alessandria M (2001). Effects of the standardized ginseng extract G115® in patients with chronic bronchitis: a nonblind, randomised, comparative pilot study. Clin Drug Investig [New Zealand] 21, 41-45.

117

30 Cho WC, Yip TT, Chung WS, Lee SK, Leung AW, Cheng CH, Yue KK (2006). Altered expression of serum protein in ginsenoside Re-treated diabetic rats defected by SELDI-TOF MS. J Ethnopharmacol. 108, 272- 279.

31 Lee WK, Kao ST, Liu IM, Chen JT (2006). Increase of insulin secretion by ginsenoside Rh 2 to lower plasma glucose in Wister rats. Clin Exp Pharmacol Physiol. 33, 27-32.

32 Lee SW, Kim K, Rho MC, Chung MY, Kim YH, Lee S, Lee HS, Kim YK (2004). New polyacetylenes, DGAT inhibitors from the roots of Panax ginseng . Planta Med. 70, 197-200.

33 Sotaniemi EA, Haapakosi E, Rautio A (1995). Ginseng therapy in non-insulin-dependent diabetic patients. Diabetes Care. 18, 1373-1375.

34 Park SE, Park C, Kim SH, Hossain MA, Kim MY, Chung HY, Son WS, Kim GY, Choi YH, Kim ND (2009). Korean red ginseng extract induces apoptosis and decreases telomerase activity in human leukemia cells. J Ethnopharmacol. 121, 304- 312.

35 Yang ZG, Sun HX, Ye YP (2006). Ginsenoside Rd from Panax notoginseng is cytotoxic towards HeLa cancer cells and induces apoptosis. Chem Biodivers. 3, 187-197.

36 Yun TK (2003). Experimental and epidemiological evidence on non-organ specific cancer preventive effect of Korean ginseng and identification of active compounds. Mutat Res. 523- 524, 63-74.

37 Shin HR, Kim JY, Yun TK, Morgan G, Vainio H (2000). The cancer-preventive potential of Panax ginseng : a review of human and experimental evidence. Cancer Causes Control. 11, 565-576.

38 Huang HQ, Zhang X, Shen YH, Su J, Liu XH, Tian JM, Lin S, Shan L, Zhang WD (2009). Polyacetylenes from Bupleurum longiradiatum . J Nat Prod. 72, 2153-2157.

39 Liu JH, Lee CS, Leung KM, Yan ZK, Shen BH, Zhao ZZ, Jiang ZH (2007). Quantification of two polyacetylenes in radix ginseng and roots of related Panax species using a gas chromatography-mass spectrometric method. J Agric Food Chem. 55, 8830-8835.

40 Christensen LP, Brandt K (2006). Bioactive polyacetylenes in food plants of the Apiaceae family: Occurrence, bioactivity and analysis. J Pharmaceut Biomed Anal. 41, 683-693.

41 Brandt K , Christensen LP, Hansen-Møller J, Hansen SL, Haraldsdottir J, Jespersen L, Purup S, Kharazmi A, Barkholt V, Frøkiær H, Kobæk-Larsen M (2004). Health promoting compounds in vegetables and fruits: A systematic approach for identifying plant components with impact on human health. Trends Food Sci Tech. 15, 384-393.

42 Kuo YC, Lin YL, Huang CP, Shu JW, Tsai WJ (2002). A tumor cell growth inhibitor from Saposhnikovae divaricata . Cancer Invest. 20, 955-964.

43 Christensen LP (1992). Acetylenes and related compounds in Anthemideae. Phytochemistry. 31, 7-49.

44 Christensen LP, Lam J (1990). Acetylenes and related compounds in Cynareae. Phytochemistry. 29, 2753-2785.

118

45 Christensen LP, Lam J (1991). Acetylenes and related compounds in Heliantheae. Phytochemistry. 30, 11-49.

46 Hansen L, Boll PM (1986). Polyacetylenes in Araliaceae: Their chemistry, biosynthesis and biological significance. Phytochemistry. 25, 285-293.

47 Shim SC, Koh HY, Han BH (1983). Polyacetylenes from Panax ginseng roots. Phytochemistry. 22, 1817-1818.

48 Popzawski J, Wrobel JT, Glinka T (1980). Panaxydol, a new polyacetylenic epoxide from Panax ginseng roots. Phytochemistry. 19, 1539-1541.

49 Takashi M, Yoshikura M (1964). Studies on the components of Panax ginseng C. A. Meyer. 3. On the ethereal extract of ginseng radix alba. (3). On the structure of a new acetylene derivative “panaxynol”. Yakugaku Zasshi. 84, 757-759.

50 Bohlmann F, Niedballa U, Rode KM (1966). New polyines with a C17-chain. Chem Ber. 99, 3552-3558.

51 Leonti M, Casu L, Raduner S, Cottiglia F, Floris C, Altmann KH, Gertsch J (2010). Falcarinol is a covalent cannabinoid CB1 receptor antagonist and induces pro-allergic effects in skin. Biochem Pharmacol.79, 1815-1826.

52 Kidmose U, Hansen SL, Christensen LP, Edelenbos M, Larsen E, Nørbæk R (2004). Effects of genotype, root size, storage, and processing on bioactive compounds in organically grown carrots ( Daucus carota L.). J Food Sci. 69, 388-394.

53 Hansen L, Purup S, Christensen LP (2003). Bioactivity of falcarinol and the influence of processing and storage on its content in carrots ( Daucus carota L). J Sci Food Agr. 83, 1010- 1017.

54 Halim M, Yee DJ, Sames D (2008). Imaging induction of cytoprotective enzymes in intact human cells: coumberone, a metabolic reporter for human AKR1C enzymes reveals activation by panaxytriol, an active component of red ginseng. J Am Chem Soc. 130, 14123-14128.

55 Resch M, Heilmann J, Steigel A, Bauer R (2001). Further phenols and polyacetylenes from the rhizomes of Atractylodes lancea and their anti-inflammatory activity. Planta Med. 67, 437-442.

56 Pereira RLC, Ibrahim T, Lucchetti L, da Silva AJR, Gonçalves de Moraes VL (1999). Immunosuppressive and anti-inflammatory effects of methanolic extract and the polyacetylene isolated from Bidens pilosa L. Immunopharmacology 43, 31–37.

57 Alanko J, Kurahashi Y, Yoshimoto T, Yamamoto S, Baba K (1994). Panaxynol, a polyacetylene compound isolated from oriental medicines, inhibits mammalian lipoxygenases. Biochem Pharmacol. 48, 1979-1981.

58 Schneider I, Bucar F (2005). Lipoxygenase inhibitors from natural plant sources. Part 1: Medicinal plants with inhibitory activity on arachidonate 5-lipoxygenase and 5- lipoxygenase/cyclooxygenase. Phytother Res. 19, 81-102.

119

59 Schneider I, Bucar F (2005). Lipoxygenase inhibitors from natural plant sources. Part 2: Medicinal plants with inhibitory activity on arachidonate 12-lipoxygenase, 15-lipoxygenase and leukotriene receptor antagonists. Phytother Res. 19, 263-272.

60 Fujimoto Y, Sakuma S, Komatsu S, Sato D, Nishida H, Xiao YQ, Baba K, Fujita T (1998). Inhibition of 15-hydroxyprostaglandin dehydrogenase activity in rabbit gastric antral mucosa by panaxynol isolated from oriental medicines. J Pharm Pharmacol. 50, 1075-1078.

61 Wang CN, Shiao YJ, Kuo YH, Chen CC, Lin YL (2000). Inducible nitric oxide synthase inhibitors from Saposhnikovia divaricata and Panax quinquefolium . Planta Med. 66, 644-647.

62 Prior RM, Lundgaard NH, Light ME, Stafford GI, van Staden J, Jäger AK (2007). The polyacetylene falcarindiol with COX-1 activity isolated from Aegopodium podagraria L. J Ethnopharmacol. 113, 176-178.

63 Yang MC, Seo DS, Choi SU, Park YH, Lee KR (2008). Polyacetylenes from the roots of cultivated-wild ginseng and their cytotoxicity in vitro. Arch Pharm Res. 31, 154-159.

64 Young JF, Duthie SJ, Milne L, Christensen LP, Duthie GG, Bestwick CS (2007). Biphasic effect of falcarinol on CaCo-2 cell proliferation, DNA damage and apoptosis. J Agric Food Chem. 55, 618-623.

65 Ito A, Cui B, Chávez D, Chai HB, Shin YG, Kawanishi K, Kardono LB, Riswan S, Farnsworth NR, Cordell GA, Pezzuto JM, Kinghorn AD (2001). Cytotoxic polyacetylenes from the twigs of Ochanostachys amentacea . J Nat Prod. 64, 246-248.

66 Setzer WN, Green TJ, Whitaker KW, Moriarity DM, Yancey CA, Lawton RO, Bates RB (1995). A cytotoxic diacetylene from Dendropanax arboreus . Planta Med. 61, 470-471.

67 Setzer WN, Gu X, Wells EB, Setzer MC, Moriarity DM (2000). Synthesis and cytotoxic activity of a series of diacetylenic compounds related to falcarindiol. Chem Pharm Bull (Tokyo). 48, 1776-1777.

68 Kim JS, Lim YJ, Im KS, Jung JH, Shim CJ, Lee CO, Hong J, Lee H (1999). Cytotoxic polyacetylenes from the marine sponge Petrosia sp. J Nat Prod. 62, 554-559.

69 Nakano Y, Matsunaga H, Saita T, Mori M, Katano M, Okabe H (1998). Antiproliferative constituents in Umbelliferae plants II. Screening for polyacetylenes in some Umbelliferae plants, and isolation of panaxynol and falcarindiol from the root of Heracleum moellendorffii . Biol Pharm Bull. 21, 257-261.

70 Bernart MW, Cardellina JH 2nd, Balaschak MS, Alexander MR, Shoemaker RH, Boyd MR (1996). Cytotoxic falcarinol oxylipins from Dendropanax arboreus . J Nat Prod. 59, 748-753.

71 Ebermann R, Alth G, Kreitner M, Kubin A (1996). Natural products derived from plants as potential drugs for the photodynamic destruction of tumor cells. J Photochem Photobiol B. 36, 95-97.

72 Miyazawa M, Shimamura H, Bhuva RC, Nakamura S, Kameoka H (1996). Antimutagenic activity of falcarindiol from Peucedanum praeruptorum . Agric Food Chem. 44, 3444-3448.

120

73 Matsunaga H, Katano M, Yamamoto H, Fujito H, Mori M, Takata K (1990). Cytotoxic activity of polyacetylene compounds in Panax ginseng C. A. Meyer. Chem Pharm Bull (Tokyo). 38, 3480-3482.

74 Matsunaga H, Katano M, Yamamoto H, Mori M, Takata K (1989). Studies on the panaxytriol of Panax ginseng C. A. Meyer. Isolation, determination and antitumor activity. Chem Pharm Bull (Tokyo). 37, 1279-1281.

75 Matsunaga H, Saita T, Nagumo F, Moil M, Katano M (1995). A possible mechanism for the cytotoxicity of a polyacetylenic alcohol, panaxytriol inhibition of mitochondrial respiration. Cancer Chemother Pharmacol 35, 291-296.

76 Cunsolo F, Ruberto G, Amico V, Piattelli M (1993). Bioactive metabolites from Sicilian marine fennel, Crithmum maritimum . J Nat Prod. 56, 1598-1600.

77 Fujimoto Y, Satoh M, Takeuchi N, Kirisawa M (1991). Cytotoxic acetylenes from Panax quinquefolium . Chem Pharm Bull (Tokyo). 39, 521-523.

78 Fujimoto Y, Satoh M (1988). A new cytotoxic chlorine-containing polyacetylene from the callus of Panax ginseng . Chem Pharm Bull (Tokyo). 36, 4206-4208.

79 Ahn BZ (1988). Beziehung zwischen Struktur und cytotoxischer Aktivitat von Panaxydol- Analogen gegen L 12 10 Zellen. Arch. Pharm. (Weinheim) 321, 6143.

80 Kobaek-Larsen M, Christensen LP, Vach W, Ritskes-Hoitinga J, Brandt K (2005). Inhibitory effects of feeding with carrots or (-)-falcarinol on development of azoxymethane- induced preneoplastic lesions in the rat colon. J Agric Food Chem. 53, 1823-1827.

81 McLellan EA, Bird RP (1988). Aberrant crypts: potential preneoplastic lesions in the murine colon. Cancer Res. 48, 6187-6192.

82 McLellan EA, Bird RP (1988). Specificity study to evaluate induction of aberrant crypts in murine colons. Cancer Res. 48, 6183-6186.

83 Matsunaga H, Katano M, Saitai T, Yamamoto H, Mori M (1994). Potentiation of cytotoxicity of mitomycin C by a polyacetylenic alcohol, panaxytriol. Cancer Chemother Pharmacol 33, 291-297.

84 Park HJ, Rhee MH, Park KM, Nam KY, Park KH (1995). Effect of non-saponin fraction from Panax ginseng on cGMP and thromboxane A 2 in human platelet aggregation. J Ethnopharmacol. 49, 157-162.

85 Kuo SC, Teng CM, Lee JC, Ko FN, Chen SC, Wu TS (1990). Antiplatelet components in Panax ginseng . Planta Med. 56, 164-167.

86 Teng CM, Kuo SC, Ko FN, Lee JC, Lee LG, Chen SC, Huang TF (1989). Antiplatelet actions of panaxynol and ginsenosides isolated from ginseng. Biochim Biophys Acta. 990, 315-320.

121

87 Murdoch SR, Dempster J (2000). Allergic contact dermatitis from carrot. Contact Dermatitis. 42, 236.

88 Hausen BM, Bröhan J, König WA, Faasch H, Hahn H, Bruhn G (1987). Allergic and irritant contact dermatitis from falcarinol and didehydrofalcarinol in common ivy ( Hedera helix L.). Contact Dermatitis. 17, 1-9.

89 Hansen L, Hammershoy O, Boll PM (1986). Allergic contact dermatitis from falcarinol isolated from Schefflera arboricola . Contact Dermatitis. 14, 91-93.

90 Hudson JB (1989). Plant photosensitizers with antiviral properties. Antiviral Res. 12, 55-74.

91 Rahman AA, Cho SC, Song J, Mun HT, Moon SS (2007). Dendrazawaynes A and B, antifungal polyacetylenes from Dendranthema zawadskii (Asteraceae). Planta Med. 73, 1089- 1094.

92 Olsson K, Svensson R (1996). The influence of polyacetylenes on the susceptility of carrots to storage diseases. J Phytopathology. 144, 441-447.

93 Harding VK, Heale JB (1980). Isolation and identification of the antifungal compounds accumulating in the induced resistance response of carrot root slices to Botrytis cinerea . Physiol Mol Plant Pathol. 17, 277-289.

94 Harding VK, Heale JB (1981). The accumulation of inhibitory compounds in the induced resistance response of carrot root slices to Botrytis cinerea . Physiol Mol Plant Pathol. 18, 7-15.

95 Garrod B, Lewis BG (1978). Cis-heptadeca-1,9-diene-4,6-diyne-3,8-diol, an antifungal polyacetylene from carrot root tissue. Physiol Mol Plant Pathol. 13, 241-246.

96 Kemp MS (1978). Falcarindiol: An antifungal polyacetylene from Agopodium podagraria . Phytochemistry. 17, 1002.

97 Schinkovitz A, Stavri M, Gibbons S, Bucar F (2008). Antimycobacterial polyacetylenes from Levisticum officinale . Phytother Res. 22, 681-684.

98 Lechner D, Stavri M, Oluwatuyi M, Pereda-Miranda R, Gibbons S (2004). The anti- staphylococcal activity of Angelica dahurica (Bai Zhi). Phytochemistry. 65, 331-335.

99 Rollinger JM, Zidorn C, Dobner MJ, Ellmerer EP, Stuppner H (2003). Lignans, phenylpropanoids and polyacetylenes from Chaerophyllum aureum L. (Apiaceae). Z Naturforsch C. 58, 553-557.

100 Bae EA, Han MJ, Baek NI, Kim DH (2001). In vitro anti-Helicobacter pylori activity of panaxytriol isolated from ginseng. Arch Pharm Res. 24, 297-299.

101 Kobaisy M, Abramowski Z, Lermer L, Saxena G, Hancock REW, Towers GHN (1997). Antimycobacterial Polyynes of Devil’s Club ( Oplopanax horridus ), a North American Native Medicinal Plant. J Nat Prod. 60, 1210-1213.

102 Muir AD, Cole AL, Walker JR (1982). Antibiotic compounds from New Zealand plants. I. Falcarindiol, an anti-dermatophyte agent from Schefflera digitata . Planta Med. 44, 129-133.

122

103 Tobinaga S, Sharma MK, Aalbersberg WG, Watanabe K, Iguchi K, Narui K, Sasatsu M, Waki S (2009). Isolation and identification of a potent antimalarial and antibacterial polyacetylene from Bidens pilosa . Planta Med. 75, 624-628.

104 Oliveira FQ, Andrade-Neto V, Krettli AU, Brandão MG (2004). New evidences of antimalarial activity of Bidens pilosa roots extract correlated with polyacetylene and flavonoids. J Ethnopharmacol. 93, 39-42.

105 Senn M, Gunzenhauser S, Brun R, Séquin U (2007). Antiprotozoal polyacetylenes from the Tanzanian medicinal plant Cussonia zimmermannii . J Nat Prod. 70, 1565-1569.

106 Baltz T, Baltz D, Giroud C, Crockett J (1985). Cultivation in a semi-defined medium of animal infective forms of Trypanosoma brucei, T. equiperdum, T. evansi, T. rhodesiense and T. gambiense. EMBO J. 4, 1273-1277.

107 Mosmann T (1983). Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immunol Methods. 65, 55–63.

108 Nunes IS, Faria JM, Figueiredo AC, Pedro LG, Trinidade H, Barroso JG (2009). Menthol and geraniol biotransformation and glycosylation capacity of Levisticum officinale hairy roots. Planta Med 75, 387-391.

109 Barrett MP, Boykin DW, Brun R, Tidwell RR (2007). Human African trypanosomiasis: pharmacological re-engagement with a neglected disease. Br J Pharmacol. 152, 1155-1171.

110 Fairlamb AH (2003). Target discovery and validation with special reference to trypanothione. In Fairlamb AH, Ridley RG, Vial HJ eds. Drugs against parasitic diseases: R&D methodologies and issues. Ed. Geneva: WHO TDR. pp 107-118.

111 Yun TK (2001). Panax ginseng —a non-organ-specific cancer preventive? Lancet Oncol. 2, 49-55.

112 Purup S, Larsen E, Christensen LP (2009). Differential effects of falcarinol and related aliphatic C 17 -polyacetylenes on intestinal cell proliferation. J Agr Food Chem. 57, 8290-8296.

113 Choi SJ, Kim TH, Shin YK, Lee CS, Park M, Lee HS, Song JH (2008). Effects of a polyacetylene from Panax ginseng on Na + currents in rat dorsal root ganglion neurons. Brain Res. 1191, 75-83.

114 Krauth-Siegel RL, Bauer H, Schirmer RH (2005). Dithiol proteins as guardians of the intracellular redox milieu in parasites: old and new targets in trypanosomes and malaria- causing plasmodia. Angew Chem Int Ed Engl. 44, 690-715.

115 Fairlamb AH, Blackburn P, Ulrich P, Chait BT, Cerami A (1985). Trypanothione: a novel bis (glutathionyl) spermidine cofactor for glutathione reductase in trypanosomatids. Science 227, 1485-1487.

116 Fairlamb AH, Cerami A (1985). Identification of a novel, thiol-containing co-factor essential for glutathione reductase enzyme activity in trypanosomatids. Mol Biochem Parasitol. 14, 187-198.

123

117 Bond CS, Zhang Y, Berriman M, Cunningham ML, Fairlamb AH, Hunter WH (1999). Crystal structure of Trypanosoma cruzi trypanothione reductase in complex with trypanothione, and the structure-based discovery of new natural product inhibitors. Structure 7, 81-89.

118 Hao W, Xing-Jun W, Yong-Yao C, Liang Z, Yang L, Hong-Zhuan C (2005). Up- regulation of M 1 muscarinic receptors expressed in CHOm 1 cells by panaxynol via cAMP pathway. Neurosci Lett. 383, 121-126.

119 Kim YS, Jin SH, Kim SI, Hahn DR (1989). Studies on the mechanism of cytotoxicities of polyacetylenes against L1210 cells. Arch Pharm Res. 12, 207-213.

120 Kim JY, Lee KW, Kim SH, Wee JJ, Kim YS, Lee HJ (2002). Inhibitory effect of tumor cell proliferation and induction of G2/M cell cycle arrest by panaxytriol. Planta Med. 68, 119- 122.

121 KIP1 Moon J, Yu SJ, Kim HS, Sohn J (2000). Induction of G 1 cell cycle arrest and p27 increase by panaxydol isolated from Panax ginseng . Biochem Pharmacol. 59, 1109-1116.

122 Hai J, Lin Q, Lu Y, Zhang H, Yi J (2007). Induction of apoptosis in rat C6 glioma cells by panaxydol. Cell Biol Int. 31, 711-715.

123 Zidorn C, Jöhrer K, Ganzera M, Schubert B, Sigmund EM, Mader J, Greil R, Ellmerer EP, Stuppner H (2005). Polyacetylenes from the Apiaceae vegetables carrot, celery, fennel, parsley, and parsnip and their cytotoxic activities. J Agric Food Chem. 53, 2518-2523.

124 Sohn J, Lee CH, Chung DJ, Park SH, Kim I, Hwang WI (1998). Effect of petroleum ether extract of Panax ginseng roots on proliferation and cell cycle progression of human renal cell carcinoma cells. Exp Mol Med. 30, 47-51.

125 Gerpe A, Odreman-Nuñez I, Draper P, Boiani L, Urbina JA, González M, Cerecetto H (2007). Heteroallyl-containing 5-nitrofuranes as new anti-Trypanosoma cruzi agents with a dual mechanism of action. Bioorg Med Chem. 16, 569-577.

126 Urbina JA (2002). Chemotherapy of Chagas disease. Curr Pharm Des. 8, 287-295.

127 Harmon MA, Scott TC, Li Y, Boehm MF, Phillips MA, Mangelsdorf DJ (1997). Trypanosoma brucei : effects of methoprene and other isoprenoid compounds on procyclic and bloodstream forms in vitro and in mice. Exp Parasitol. 87, 229-236.

128 Rho MC, Lee HS, Lee SW, Chang JS, Kwon OE, Chung MY, Kim YK (2005). Polyacetylenic compounds, ACAT inhibitors from the roots of Panax ginseng . J Agric Food Chem. 53, 919-922.

129 Kwon BM, Nam JY, Lee SH, Jeong TS, Kim YK, Bok SH (1996). Isolation of cholesteryl ester transfer protein inhibitors from Panax ginseng roots. Chem Pharm Bull (Tokyo). 44, 444-445.

124

130 Kwon BM, Ro SH, Kim MK, Nam JY, Jung HJ, Lee IR, Kim YK, Bok SH (1997). Polyacetylene analogs, isolated from hairy roots of Panax ginseng , inhibit Acyl-CoA : cholesterol acyltransferase. Planta Med. 63,552-553.

131 Kitagawa I, Yoshikawa M, Yoshihara M, Hayashi T, Taniyama T (1983). Chemical studies of crude drugs (1). Constituents of Ginseng radix rubra. Yakugaku Zasshi. 103, 612- 622.

125

6. Carlina oxide – a natural polyacetylene from Carlina acaulis (Asteraceae) with potent antitrypanosomal and antimicrobial properties!

6.1 Abstract Carlina acaulis (Asteraceae) has a long history of medicinal use in Europe due to its antimicrobial properties. The strong activity of Carlina oxide, the main compound of the essential oil of C. acaulis against two MRSA strains, Streptococcus pyogenes , Pseudomonas aeruginosa , Candida albicans and C. glabrata was confirmed. A strong and selective activity against Trypanosoma brucei brucei with an IC 50 of 1.0 µg/ mL and a SI of 446 compared to human HeLa cells was recorded. The selective toxicity of Carlina oxide makes it a promising lead compound for the development of drugs to treat African trypanosomiasis and multiresistant gram positive bacteria.

6.2 Introduction Parasites are still a major cause of diseases in most tropical countries. Especially protozoa and helminths are responsible for great damage to the health of people and their domestic animals [1]. However, suitable drugs are rare: Between 1975 and 1999, only 13 drugs were developed against tropical diseases, compared to 1300 new drugs in total against other health disorders [2]. The situation improved slightly since 2000; yet, a reliable cure for tropical diseases is often missing.

African trypanosomiasis is a parasitic disease in sub-Saharan Africa causing major health and economic problems. The parasites are protozoa of the genus Trypanosoma : Trypanosoma brucei rhodesiense and T. b. gambiense are causing human sleeping sickness while T. b. brucei is responsible for the cattle disease nagana. T. b. brucei is commonly used as a model for human sleeping sickness due to its morphological and biochemical similarity but lack of infectivity for the human researcher [1,3,4].

Since 1970 sleeping sickness is increasing due to various factors. Nowadays, it is endemic in 36 countries and 60 million people are threatened. The WHO estimates that 300 000 to 500 000 cases of human trypanosomiasis occur per year [5,6]. 46 million cattle are exposed to trypanosomes, resulting in annual costs of 1340 billion USD [7].

126

Currently, only four drugs are approved: Suramin, pentamidine, melarsoprol and eflornithine. Diminazene is approved for the treatment of animals but not humans [3]. Unfortunately, these drugs have strong side effects and several cases of resistance were reported recently [8-10]. Thus, the discovery of new drugs is urgently required [11-13].

Carlina acaulis (Asteraceae) is originated in central Europe and has a long history as a medicinal plant with diuretic, stomachic, antimicrobial and antihelminthic properties [14- 16]. The same effects have been reported for C. acanthifolia , a close relative and legal substitute for C. acaulis . The main compounds of Carlina spp. are inulin (18-20%), flavonoids and an essential oil (2%) with 80% Carlina oxide [17- 19]. We selected Carlina oxide (Fig.1), the main F ig 1: Carlina oxide compound of the essential oil of C. acaulis (Asteraceae) and tested it for its antitrypanosomal activity in comparison with known antibacterial and antifungal properties.

6.3 Material and Methods Chemicals All chemicals were purchased from Gibco  Invitrogen, Germany.

The positive controls diminazene (D7770, ≥90% purity), DL-α-difluoromethylornithine (D193, ≥97% purity), metronidazole (M3761, analytical purity), ornidazole (O5879, analytical purity), suramin (S2671, ≥95% purity) were purchased from Sigma-Aldrich , Germany.

Plant material Dried C. acaulis root was purchased from Caesar & Loretz GmbH, Hilden, Germany (669a Radix Carlinae, Lot: 81805079). Voucher specimen (P8082) was stored at the IPMB, Heidelberg. Identity was confirmed according to visual and microscopic characteristics.

127

Extract preparation 8 100 g of dried C. acaulis root powder was exhaustively extracted with first hexane, then dichloromethane and finally methanol under moderate heat using a reflux condenser. 100 g root powder gave 1.39 g dry hexane extract, 0.84 g dry dichloromethane extract and 6.9 g dry methanol extract. Extracts were concentrated using a rotation evaporator. The highly condensed extracts were stored at -40 °C under exclusion of light. Prior to the experiments the extracts were vacuum dried, powdered and dissolved in DMSO.

Test organisms Trypanosomes: T. b. brucei TC 221 derived from stock 427 and was originally obtained from Prof. Peter Overath (Max-Plank Institut für Biologie, Tübingen) to Dr. D. Steverding; they were cultured at the IPMB since 1999.

Gram- positive bacteria 9: Methicillin-resistant Staphylococcus aureus (MRSA ATCC 10442), vancomycine resistant Enterococcus (VRE VanB ATCC 31299) and Streptococcus pyogenes (ATCC12344) in addition to two clinical isolates; MRSA 1000/93 and VRE 902291 were used in antimicrobial tests.

Gram-negative bacteria 9: Escherichia coli (ATCC 25922), Klebsiella pneumonia (ATCC 700603) and Pseudomonas aeruginosa (ATCC 27853) were employed as representatives of gram-negative bacteria.

Fungi 9: Candida albicans (ATCC 90028) and Candida glabrata (ATCC MYA 2950) were selected as representatives of fungi with pathogen potential. All microorganism cultures were supplied by Medical Microbiology Lab., Hygiene Institute, Heidelberg University, Germany.

8 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Frank Sporer 9 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Razan Hamoud 128

Methods HeLa and T. b. brucei culture

Human HeLa cells were grown at 37 °C in a humidified atmosphere of 5 % CO 2 in DMEM complete media (L-glutamine supplemented with 10 % heat-inactivated fetal bovine serum, 5% penicillin/ streptomycin and 5% non-essential amino acids). T. b. brucei cells were cultured in BALTZ medium [20]. The experiments were performed during the logarithmic growth phase of the cells. MTT assay Cell viability was determined according to the 3-(4.5-dimethylthiazol-2-yl)-2.5- diphenyltetrazolium bromide (MTT) cell viability assay [21]. Extracts and Carlina oxide were dissolved prior to the experiment in dimethylsulfoxide (DMSO). Ten different concentrations were obtained by serial dilution in medium, so that the highest concentration of DMSO did not exceed 0.05%. Cells were (2 x 10 4 cells/well) were seeded in 96-well plates (Greiner Labortechnik), cultured for 24 h till 80% confluence was reached before the test samples were applied. The medium was replaced after 24 h incubation with fresh medium containing 0.5 mg/mL MTT. 4 h later, the medium was replaced by 100 µL DMSO to dissolve the formazan crystals. The absorbance was detected at 570 nm with a Tecan Safire II Reader. Diminazene, DL-α-difluoromethylornithine, metronidazole, ornidazole and suramin were used as positive control; cell viability of T. b. brucei was additionally evaluated using microscopical techniques.

Screening Cytotoxicity in T. b. brucei was compared to HeLa cells and an SI index was calculated.

SI index: ratio of the IC 50 value of mammalian cells divided by the IC 50 value of trypanosomes.

Statistical analysis The results are shown as means and standard errors of at least three times repeated triplicates for each measurement. The IC 50 values were calculated using a four parameter logistic curve (SigmaPlot® 11.0) representing 50% reduction of viability compared to the positive control.

129

Bacterial and fungal cultures10 Columbia with 5% sheep blood (BD) was used for bacterial subculturing and MBC determination. Mueller-Hinton Broth (MHB) and Brain Heart Infusion (BHI) (Fluka) were used for bacterial inoculum dilutions and MIC determination. All bacterial cultures were incubated at 37 °C for 24 h. CHROMagar Candida (BD) was used for fungal sub-culturing and MMC determination. Sabouraud Dextrose Broth (SDB) (Oxid) was used for fungal inoculum dilutions and MIC determination. All fungal cultures were incubated at 25 °C for 48 h.

Inoculum preparations 10 One or two bacterial or fungal colonies from an 18-24 h agar plate were suspended in saline to a turbidity matching 0.5 McFarland ≈ 1x 108 CFU/mL (bacteria) and ≈ 1x 106 CFU/mL (fungi), 100 µL of the bacterial suspension was diluted 1:100 with 9900 µL broth to 1x106 CFU/mL and 1000 µL of the fungal suspension was diluted 1:10 with 9000 µL broth to 1x105 CFU/mL [22].

Well Diffusion Test 11 Colombia medium with 5% sheep blood and CHROMagar Candida were inoculated with 1 x 10 6 CFU/mL of bacterial and fungal suspensions, respectively. Wells with a diameter of 6 mm were cut out and filled with 40 µL of the extract. DMSO was used as a negative control; ampicillin, vancomycin and nystatin were used as positive controls. Zones of inhibition were recorded at 37 °C after 24 h (bacteria) and at 25 °C after 48 h (fungi).

Determination of Minimum Inhibitory concentration (MIC) and Minimum Microbiocidal concentration (MMC) 11 Micro dilution method was used to determine MIC as described by CLSI [22]. The plant extract was first dissolved in 5% DMSO to the concentration of 8 mg/mL, and then diluted two fold with MHB (bacteria) and SDB (fungi) in 96-well plates to obtain a range of concentrations between 0.015 and 8 mg/mL. Carlina oxide was dissolved in DMSO to a concentration 1.25 mg/mL and diluted two fold to obtain a range of concentration between 7 and 125 µg/mL. The bacterial and fungal suspensions of 1 x 10 6 CFU/mL were then added

10 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Razan Hamoud 11 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Razan Hamoud 130

and the plates were incubated at 37 °C for 24 h (bacteria) and at 25 °C for 48 h (fungi). The first well that showed no visible turbidity matching with a negative control was defined as MIC. Each test was performed in duplicate. 3 µL of each clear well (with no visible turbidity) were incubated in appropriate agar media and incubated under the appropriate conditions for bacteria and fungi. MMC was determined as the concentration that did not result in growth on agar.

Isolation and identification of Carlina oxide 12 As starting material a hexane extract of the milled drug was used. Carlina oxide was isolated via column chromatography on silica gel (70-230 mesh, Merck KGaA, Darmstadt, Germany). Eluation was achieved by increasing polarity of a hexane-ethylacetate gradient. GLC-MS analysis was carried out on a Hewlett-Packard gas chromatograph (GLC 5890 II), coupled to a Finnigan SSQ 7000 Quadrupol Mass Spectrometer (Thermo-Finnigan, Bremen, Germany). The head pressure of the GLC column was 15 kPa Helium, the temperature program 40- 300 °C at a rate of 4 °C/ min. For injection the sample was solved in hexane. 2 µL samples were injected with the carrier gas helium at a flow rate of 2 mL/ min in split mode (split ratio 1:30) at the injector temperature of 250°C. The MS spectrum was recorded at the electron energy 70 eV operated in EI mode with the ion source at 175°C. The purity and identity of isolated Carlina oxide were confirmed by GLC-MS. The mass fragmentation pattern of the isolated pure compound was identical with that of the previously published data of Carlina oxide (benzyl-2-furylacetylene) [17]. The published retention index for Carlina oxide (RI=1613.1) on a HP-5MS phase was in good correlation with our retention index (RI=1614) obtained by using an OV-5 column with the same dimensions (30 m x 0.25 mm ID, film thickness 0.25 µm; Ohio Valley Specialty, Marietta, OH, USA).

LC-MS analysis of C. acaulis extracts 13 Mass spectrometry was performed on a VG Quattro II system from Micromass provided with ESI source at positive scan mode under the parameters: Capillary: 3.5 kV, HV Lens: 0.5 kV, o Cone: 30 V. Drying and nebulising gas N 2. Source temperature 120 C. Scan range: 100-700. HPLC was performed on a Merck-Hitachi L-6200A system with 1 mL/min flow rate under a water/0.5% formic acid/ ACN gradient; split 10%. The stationary phase was an RP18 e column

12 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Frank Sporer 13 Experiments performed by Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany: Ahmad Tahrani 131

(LiChrospher, 250-4mm, 5 µm, Darmstadt, Germany). Data were processed using MassLynx 4.0 software.

6.4 Results Table 1: Cytotoxicity of Carlina acaulis extracts and Carlina oxide Carlina acaulis T. b. brucei HeLa Ratio (HeLa/ T. b. IC 50 [µg/mL] IC 50 [µg/mL] brucei ) Hexane extract 3.7 1722.4 465.5 DCM extract 4.5 1995.0 443.3 MeOH extract 698.1 1236.0 1.7 Carlina oxide 1.0 446.0 446.0

Controls Diminazene 0.1 170.6 1706.0 DL-α- 11.7 1502.6 128.4 Difluoromethylornithine Metronidazole 18.8 1180.5 62.7 Ornidazole 18.8 849.8 45.2 Suramin 4.7 1317.1 280.2

Fig 2: Cytotoxic effect of C. acaulis and Carlina oxide

120 120 HeLa HeLa T. b. brucei T. b. brucei 100 100

80 80

60 60

40 40 Survival[%] Survival [%] 20 20

0 0 0.37 0.75 1.5 3 6 12 24 49 98 195 390 780 15603130625012500 0.75 1.5 3 6 12 24 49 98 195 390 780 1560 3130 6250 1250025000

-20 -20 Concentration [µg/mL] Concentration [µg/mL] A: Cytotoxic effect of Carlina oxide B: Cytotoxic effect of a hexane extract of C. acaulis

120 120 HeLa HeLa T. b. brucei T. b. brucei 100 100

80 80

60 60

40 40 Survival [%] Survival Survival [%] Survival 20 20

0 0 0.75 1.5 3 6 12 24 49 98 195 390 780 1560 3130 625012500 0.098 0.195 0.39 0.78 1.56 3.13 6.25 12.5 25 50 -20 -20 Concentration [mg/mL] Concentration [µg/mL] C: Cytotoxic effect of a dichloromethane extract of C. acaulis D: Cytotoxic effect of a methanol extract of C. acaulis

132

The isolated Carlina oxide had 100% purity. The hexane extract contained seven times more Carlina oxide than the dichloromethane extract while no Carlina oxide could be detected in the methanol extract (Fig. 3, 4).

The cytotoxic effects of the hexane, dichloromethane and methanol extracts of C. acaulis were tested against the human cell line HeLa and T. b. brucei . In addition, cytotoxicity of the main compound of the essential oil of C. acaulis , Carlina oxide, was determined. The lipophilic hexane and dichloromethane extracts showed similar cytotoxicity as Carlina oxide while the polar methanol extract was significantly less active (Tab. 1; Fig. 2). The IC 50 values for both hexane and dichloromethane extract in T. b. brucei are 3.7 µg/mL and 4.5 µg/mL while they are 1722.4 µg/mL and 1995.0 µg/mL for HeLa. The resulting SI is 465 and 443 respectively. Pure Carlina oxide has an IC 50 value for T. b. brucei of 1.0 µg/mL while the IC 50 value for HeLa cells is 446.0 µg/mL, giving a SI of 446. In comparison to the positive control substance suramin, one of four licensed drugs against African human trypanosomiasis, the SI of Carlina oxide is approximately twice as high. Only diminazene, which is licensed only for the treatment of animals, has a higher SI than Carlina oxide (Tab. 1).

The antimicrobial activity of extracts from C. acaulis is illustrated in table 2. The hexane extract of C. acaulis has a strong activity against both strains of fungi with MIC values of 0.25 mg/mL and 0.5 mg/mL. It achieved an MIC between 0.125 mg/mL against Streptococcus pyogenes and 4 mg/mL against the clinical isolate VRE 902291; a weak antimicrobial activity was found against gram negative bacteria with an MIC between 4 and 8 mg/mL. Carlina oxide exhibited strong antimicrobial activity against all the strains of bacteria and fungi even against the multiresistant strains and the clinical isolates, MIC range was between 15 and 60 µg/mL.

6.5 Discussion The essential oil of C. acanthifolia with Carlina oxide as major compound has antimicrobial, anti-inflammatory, anti-ulcer and antioxidant activities [14]. Strong effects against the gram positive bacteria Bacillus subtilis , Enterococcus faecalis and Staphylococcus aureus , against the gram negative bacteria Klebsiella pneumoniae and against the fungi Candida albicans and Aspergillus niger have been reported [14]. The main compound of the essential oil, Carlina oxide, was isolated for the first time in 1889, making it one of the oldest known polyacetylenes [23].

133

Table 2: Bacterial and fungal test results

Carlina acaulis Carlina oxide Ampicilline Vancomycine Nystatine hexane extract

Inhibition Microorganism Inhibition Inhibition Inhibition zone MIC MMC MIC MMC MIC MMC MIC MMC MIC MMC zone (mm) zone zone (mm) mg/mL mg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL µg/mL 1 mg/mL (mm) (mm) 80 mg/mL MRSA G+ 5.1±0.1 2 4 15 60 14.5±0.5 25 >25 10.0±0.2 0.8 12.5 NT NT NT ATCC 10442 MRSA G+ 4.8±0.1 0.5 1 15 60 13.5±0.5 50 >50 NT 7 12.5 NT NT NT 1000/93 VRE G+ 4.8±0.1 2 8 60 125 15 1 7 NT 25 >50 NT NT NT ATCC 31299 VRE G+ 4.8±0.1 4 >4 60 125 NA NA NA NA NA NA NT NT NT 902291 Streptococcus pyogenes G+ 6.1±0.1 0.125 0.2 15 30 25.0±1.0 0.05 0.1 15.0±1.0 0.1 0.4 NT NT NT ATCC 12344 Escherichia coli G- 4.8±0.1 8 >8 60 >60 14 12.5 25 NA NA NA NT NT NT ATCC 25922 Klebsiella pneumonia G- 3.1±0.1 4 >4 60 >60 - 25 25 NT 25 50 NT NT NT ATCC 700603 Pseudomonas aeruginosa G- 4.1±0.1 4 >4 60 >60 NA NA NA NA NA NA NT NT NT ATCC 27853 Candida albicans Fungi 7.7±0.1 0.25 0.5 15 30 NT NT NT NT NT NT 10±1.2 0.2 0.4 ATCC 90028 Candida glabrata Fungi 10 0.5 1 15 30 NT NT NT NT NT NT 12±1 0.2 0.2 ATCC MYA 2950 NT; Not tested, NA; Not active

134

The exact chemical constitution of Carlina oxide was established in 1933 [24]. Other polyacetylenes and the biogenesis of Carlina oxide were studied in the 1960s [25,26].

Our results confirm the previous findings that the essential oil of Carlina has an important potential to inhibit and kill bacteria and fungi as compared with standard antimicrobial drugs. Carlina oxide was more active against all the strains than the oil. The highest antimicrobial activity of Carlina extract and Carlina oxide was recorded against S. pyogenes , Candida albicans and C. glabrata , respectively.

Carlina oxide showed significant activity against the gram positive MRSA strains ATCC 10442 and 1000/93. The MIC was in both cases with 15 µg/ ml below that of Ampicilline with 25 and 50 µg/mL, respectively, while vancomycine showed stronger activities with 0.8 µg/mL and 7 µg/mL, respectively.

Only a weak activity was exerted by Carlina extract and Carlina oxide against Gram negative strains of bacteria, especially Pseudomonas aeruginosa , that are well known to be insensitive to essential oils in general and a wide range of antibiotics [27,28]. The previous results lead us to the conclusion that Carlina has a significant antimicrobial activity compared to the antimicrobial drugs used in this study. In view of the low cytotoxicity for human cells Carlina oxide might be an interesting candidate for the treatment of multiresistant bacteria.

For the first time the high activity of both Carlina extracts and Carlina oxide against T. b. brucei was recorded. Carlina oxide was active against T. b. brucei at IC 50 1.0 µg/mL, while being cytotoxic to HeLa at IC 50 446.0 µg/mL. The hexane and dichloromethane extracts also showed significant cytotoxicity against T. b. brucei at IC 50 3.7 µg/mL and 4.5 µg/mL, respectively while the activity against HeLa was significantly less toxic at IC 50 1722.4 µg/mL and 1995.0 µg/mL, respectively. The high SI of 465 to 443 of the extracts and the SI of 446 of Carlina oxide make it a very promising lead structure for the development of antitrypanosomal drugs. The SI of Carlina oxide is with 446 even higher than the one of suramin with a SI of 280, one of four licensed drugs for the treatment of African trypanosomiasis.

We suggest that Carlina oxide inhibits trypanothione reductase, an enzyme specific for trypanosomastids. Mammalian cells use the glutathione reductase instead, which could

135

explain the different sensitivity to Carlina oxide. Both enzymes belong to the FAD-dependent NADPH oxidoreductase family which are essential for the protection of the cell against reactive oxygen species [29-32]. The enzymes are highly selective regarding their substrates trypanothione disulfide and glutathione disulfide. The larger trypanothione disulfide is +1 charged, while the smaller glutathione disulfide is -2 charged. The binding site of the trypanothione reductase contains a negatively charged glutamate side chain together with a hydrophobic cleft for the polyamine moiety, while the active centre of the glutathione reductase is smaller and positively charged [30,33].

Carlina oxide seems to fit into the active centre of the trypanothione reductase because of its lipophilic side chain and the electropositive C-atom of the furan ring. Inside of the cleft, the CC triple bond can form irreversible links to the SH groups of the active centre, thus blocking the enzyme. Due to its size and electropositively charged C-atom, Carlina oxide seems to be unable to enter the active centre of the glutathione reductase. This proposed mechanism needs to be experimentally confirmed in future studies.

136

Fig 3: GLC- profile of a hexane extract of C. acaulis and isolated Carlina oxide analysed by GLC-MS

Fig 4: Carlina oxide [1] in hexane, dichloromethane and methanol extracts of C. acaulis analysed by LC-MS

137

6.6 References

1 Pink R, Hudson A, Mouriès MA, Bending M (2005). Opportunities and challenges in antiparasitic drug discovery. Nature Reviews Drug Discovery. 4, 727-740.

2 Trouiller P, Olliaro P, Torreele E, Orbinski J, Laing R, Ford N (2002). Drug development for neglected diseases: a deficient market and a public-health policy failure. Lancet. 359, 2188-2194.

3 Hoet S, Opperdoes F, Brun R, Quetin-Leclerq J (2004). Natural products active against African trypanosomes: a step towards new drugs. Natural Products Review. 21, 353-364.

4 Räz B, Iten M, Grether-Bühler Y, Kaminsky R, Brun R (1997). The Alamar Blue assay to determine drug sensitivity of African trypanosomes ( T. b. rhodesiense and T. b. gambiense ) in vitro. Acta Trop. 68, 139-147.

5 WHO/CDS/CSR/ISR/2000.1: WHO report on global surveillance of epidemic-prone infectious diseases, World Health Organisation (2000). http://www.who.int/csr/resources/publications/surveillance/en/a_tryps.pdf Accessed June 30, 2011

6 Barrett MP (1999). The fall and rise of sleeping sickness. Lancet. 353, 1113-1114.

8 Fairlamb AH (2003). Chemotherapy of human African trypanosomiasis: current status and future prospects. Trends Parasitol. 19, 488-494.

9 Croft SL (1997). The current status of antiparasitic chemotherapy. Parasitology. 114 (Suppl), 3-15.

11 Newman DJ, Cragg GM, Snader KM (2003). Natural products as sources of new drugs over the period 1981-2002. J Nat Prod. 66, 1022-1037.

13 Brun R, Schumacher R, Schmid C, Kunz C, Burri C (2001). The phenomenon of treatment failures in human African trypanosomiasis. Trop Med Int Health. 6, 906-914.

14 Dordevi ć S, Petrovi ć S, Dobri ć S, Milenkovi ć M, Vuci ćevi ć D, Zizi ć S, Kuki ć J (2007). Antimicrobial, anti-inflammatory, anti-ulcer and antioxidant activities of Carlina acanthifolia root essential oil. Journal of Ethnopharmacology. 109, 458-463.

138

15 van Wyk BE, Wink C, Wink M (2004). Medicinal Plants of the World. Briza, Pretoria, South Africa, p. 87.

16 Wichtl M (2002). Teedrogen und Phytopharmaca. Wissenschaftliche Verlagsgesellschaft mbH, Stuttgart, Germany, pp114-115.

17 Djordjevic S, Petrovic S, Ristic M, Djokovic D (2005). Composition of Carlina acanthifolia root essential oil. Chemistry of Natural Compounds. 41, 410-412.

18 Vitkova A, Evstatieva L (2002). Plants rich in inulin from family Asteraceae. Godishnik na Sofiskiya Universitet “Sv. Kliment Okhridski”, Kniga 2. Botanika. 92, 107-111.

19 Chalchat JC, Dordevi ć S, Gorunovi ć M (1996). Composition of the essential oil from the root of Carlina acaulis L. Asteraceae. Journal of Essential oil Research. 8, 577-578.

20 Baltz T, Baltz D, Giroud C, Crockett J (1985). Cultivation in a semi-defined medium of animal infective forms of Trypanosoma brucei, T. equiperdum, T. evansi, T. rhodesiense and T. gambiense . EMBO J. 4, 1273-1277.

21 Mosmann T (1983). Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immun. Methods. 65, 55–63.

22 CLSI (Clinical and Laboratory Standards Institute). Methods for dilution antimicrobial susceptibility testing of anaerobic bacteria. In: Approved Standards. 7th ed. Wayne: Pennsylvania, 2007: M11–A7.

23 Semmler FW (1889). Zusammensetzung des aetherischen Oels der Eberwurzel ( Carlina acaulis L.). Chemiker Zeitung. 13, 1158.

24 Gilman H, van Ess PR, Burtner RR (1933). The constitution of Carlina oxide. Journal of the American Chemical Society. 55, 3461-3463.

25 Bohlmann F, Rode KM (1967). Die Polyine der Gattung Carlina L. Chemische Berichte. 100, 1507-1514.

26 Bohlmann F, von Kap-herr W (1966). Polyacetylenverbindungen, XCII. Zur Biogenese des Carlinaoxyds. Chemische Berichte. 99, 148-150.

27 Cosentino S, Tuberoso CLG, Pisano B, Satta M, Mascia V, Arzedi E, Palmas F (1999). In- Vitro antimicrobial activity and chemical composition of Sardinian Thymus essential oils. Letters in Applied Microbiology. 29, 130-135.

28 Nair R, Vaghasiya Y, Chanda S (2007). Antibacterial activity of Eucalpytus citriodora HK. oil on few clinically important bacteria. African Journal of Biotechnology 7, 025-026.

29 Krauth-Siegel RL, Bauer H, Schirmer RH (2005). Dithiol proteins as guardians of the intracellular redox milieu in parasites: old and new targets in trypanosomes and malaria- causing plasmodia. Angewandte Chemie International Edition. 44, 690-715.

139

30 Fairlamb AH (2003). Target discovery and validation with special reference to trypanothione. In Fairlamb AH, Ridley RG, Vial HJ eds. Drugs against parasitic diseases: R&D methodologies and issues. Ed. Geneva: WHO TDR. pp 107-118.

31 Fairlamb AH, Blackburn P, Ulrich P, Chait BT, Cerami A (1985). Trypanothione: a novel bis (glutathionyl) spermidine cofactor for glutathione reductase in trypanosomatids. Science 227, 1485-1487.

32 Fairlamb AH, Cerami A (1985). Identification of a novel, thiol-containing co-factor essential for glutathione reductase enzyme activity in trypanosomatids. Molecular and Biochemical Parasitology. 14, 187-198.

33 Bond CS, Zhang Y, Berriman M, Cunningham ML, Fairlamb AH, Hunter WH (1999). Crystal structure of Trypanosoma cruzi trypanothione reductase in complex with trypanothione, and the structure-based discovery of new natural product inhibitors. Structure 7, 81-89.

140

7. Synergistic Interactions of Saponins and Monoterpenes in HeLa cells, Cos7 cells and in Erythrocytes

7.1 Abstract In phytomedicine complex extracts consisting of phenolics, monoterpenes or saponins are traditionally used. It is often impossible to attribute the biological activity of an extract to one or few compounds. As an explanation of the superior activity of extracts, a synergistic effect of combinations of active compounds has been suggested. Since lipophilic monoterpenes or saponins targeting the biomembrane usually accompany polar polyphenols in phytomedical preparations, we decided to investigate their effect as single substances and in combination to gain further insight into potential synergistic effects of herbal medicine. Combinations of the monoterpenes α-pinene, thymol and menthol with the monodesmosidic saponins digitonin, aescin, glycyrrhizic acid and Quillaja saponin demonstrated strong synergistic activity. The

IC 50 of haemolysis was lowered by a factor of 10 to 100 from 316 µg/ml to 2 µg/ml for aescin, 157 µg/ml to 11 µg/ml for Quillaja saponins and 20 µg/ml to 3 µg/ml for digitonin when combined with thymol. A similar significant synergistic cytotoxicity occurred both in HeLa and Cos7 cells by combining the α-pinene, thymol and menthol with the saponins. The IC 50 of glycyrrhizic acid was lowered by a factor 100 from around 300 µg/ml to around 1 to 10 µg/ml and the IC 50 of aescin, digitonin and Quillaja saponins about the factor 10. Monoterpenes and monodesmosidic saponins have a common target, the biomembrane, which is present in all animal, fungal and bacterial cells. Disturbance of membrane fluidity and permeability is the mode of action. This activity is non-specific which makes it extremely difficult for bacteria and fungi to develop resistance. This explains the overall success of these molecules as defence chemicals in the plant kingdom. The synergistic effect of combinations of saponins with monoterpenes opens a complete new field of possible applications in medicine to overcome resistance in multidrug resistant microbial and human cell.

7.2 Introduction In approximately 90% of medicinal plants used in phytomedicine a single active compound which could explain the activity of the extract could not be detected. The most common groups of natural products found in plants are polyphenols, flavonoids and terpenoids ranging from monoterpenes to saponins [1]. While phenolic compounds are the most common natural products, saponins are still produced by more than 50% of the plants [2,3].

141

Fig. 1: Saponins

Fig. 2: Monoterpenes

Because the mode of action of complex mixtures from herbal medicines cannot be attributed to a single compound in most cases, additive or even synergistic interactions of combinations are postulated [4]. Synergy is present if the “effect seen by a combination of substances is greater than would have been expected from a consideration of individual contributions” [5]. In this context it is important to distinguish between polyvalence and synergy. Synergy means that several compounds acting on one target have an enhanced effect, while in polyvalence a range of activity on several targets results in an overall effect [6].

In Western medicine, research has traditionally been focused on single compounds to treat a specific disease (mono-target therapy), while many traditional systems apply a mixture of herbs to treat the patient. In traditionally used herbal infusions available in European pharmacies, mixtures of several herbs are still common. This is also true for the two important medicinal systems of Asia, the Ayurvedic medicine and the Traditional Chinese medicine (TCM). Especially in TCM, herbal mixtures of 10 or more herbs are common [7,8]. It has been assumed that these mixtures act synergistically to enhance the healing effect while minimizing the side effects. Several studies have been conducted to show this mode of action

142

of TCM [9,10]. High throughput screening of these traditional medicine combinations offers a new approach to potentially effective drug formulations [11].

Synergy is important to explain the efficacy and mode of action of herbal medicine and should not be neglected in the discovery of new treatments [12-14]. In recent years a change of attitude towards complex extracts and mixtures of drugs (multi-target therapies) both in phytomedicine and in modern drug therapy has taken place [15,16]. Examples include the use of drug combinations in the treatment of HIV or in cancer therapy [17].

Several recent publications treat the phenomenon of synergy in phytomedicine; mainly focusing on the effect of extracts but hardly explaining the detailed mode of action [18-20]. Several scientifically proven examples of synergy exist however. In this context, two examples are especially interesting. The effect of the essential oil of Zingiber officinalis in the treatment of ulcer could be related to four molecules which in combination are 66 times more effective than the sum of the individual compounds [21]. The other example is a double-blind, crossover trial of 20 volunteers treated with Panax ginseng and Ginkgo biloba . A stronger improvement of the cognitive performance was detected in combination as compared to the single treatments [22]. The influence of the saponins of P. ginseng is most likely responsible for an increased uptake of flavonoids from G. biloba , explaining the detected effect.

It is striking that most publications on synergy either deal with the combination of anti cancer drugs with saponins or the combination of monoterpenes with antibiotics. Saponins are well known to modify the cell membrane and thus facilitate the uptake of chemotherapeutics. Several well documented cases exist where this combination leads to synergistic effects effective against tumour cells [23-26]. The second, equally important synergistic combination between therapeutics and natural products is between antibiotics and monoterpenes. Here as well the synergy is explained by the modification of the cell membrane by monoterpenes to increase the uptake of antibiotics into the bacteria cell. Several studies document this synergistic interaction [27-32].

Combinations of monoterpenes and saponins have not been analysed for a potential synergistic effect. Biomembranes, which are present in animals, fungal and bacterial cells are the main target of both monoterpenes and saponins. Monoterpenes interact with the lipophilic side chain of phospholipids or cholesterol and thus increase the membrane fluidity and

143

permeability. Another target for monoterpenes is the lipophilic core of proteins. The lipophilic moiety of monodesmosidic saponins forms complexes with cholesterol while at the same time the hydrophilic part interacts with membrane proteins, thus modifying the membrane fluidity and the conformation of membrane proteins [14,33]. At higher concentrations saponins act as detergents which can lyse cell membranes.

To gain further insight into the potential synergistic effect in herbal medicine, we decided to investigate the effects of combinations of monoterpenes and saponins on cancer cells and biomembranes. We used haemolysis of erythrocytes as a model for the physical membrane effects and cytotoxicity against the two cancer cell lines HeLa and Cos7 to monitor the effects on living cells.

7.3 Material and methods Chemicals Aescin (E1378; ≥95%), digitonin (D141, pure), glycyrrhizic acid (50531; ≥95%), saponin from Quillaja bark (S4521; 20-35% sapogenin), menthol (M2772; ≥99%), thymol (T0501; ≥99.5%), α-pinene (268070; ≥99%) and 3- (4, 5 dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT; M2128; ≥98%) were purchased from Sigma-Aldrich  GmbH, Germany. Defibrinated sheep blood was purchased from Oxoid  Deutschland GmbH, Germany. DMEM media, supplements, fetal bovine serum (FBS), trypsin-EDTA and dimethyl sulfoxide (DMSO) were purchased from Gibco Invitrogen; Germany.

Methods In the haemolysis assay 1 ml sample in isotonic sodium chloride solution was mixed carefully with 1 ml defibrinated sheep blood, incubated for 30 min at 37 °C and centrifuged at 10000 rpm for 5 min. The supernatant which contains haemoglobin after haemolysis was detected photometrically at 554 nm. Controls included water and isotonic sodium chloride solution.

Cos7 (African green monkey epithelial kidney cells) and HeLa (cervical cancer) cell lines were maintained in DMEM complete media (L-glutamine supplemented with 10 % heat- inactivated fetal bovine serum, 5% penicillin/ streptomycin and 5% non-essential amino acids). Cells were grown at 37 °C in a humidified atmosphere of 5 % CO 2. All experiments were performed with cells in the logarithmic growth phase.

144

The 3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide (MTT) cell viability assay [34] was used to determine the cytotoxicity of monoterpenes and saponins in the cancer cell lines HeLa and Cos7. The pure compounds were dissolved in dimethylsulfoxide (DMSO) and serially diluted in medium into ten different concentrations. A 100 µl sample containing medium was dispensed into each well. The concentration of DMSO did not exceed 0.05% in the medium that contained the highest concentration of compound tested. Cells (2 x 10 4 cells/ well) were seeded in 96-well plates (Greiner Labortechnik) and cultured for 24 h to 80% confluence before treating them with the test samples. The test samples were replaced with fresh medium containing 0.5 mg/ml MTT after 24 h incubation. 4 h later the formed formazan crystals were dissolved in 100 µl DMSO; the absorbance was detected at 570 nm with a Tecan Safire II Reader. Experiments were repeated at least three times with triplicates of each measurement point. Controls included wells with not treated cells, wells without cells and the cytotoxic compound doxorubicin (IC 50 0.6 µg/ ml).

IC 50 values were calculated using a four parameter logistic curve (SigmaPlot® 11.0) representing 50% reduction of viability or 50% haemolysis compared to the positive control. Results were expressed as mean and standard error. Williamson [35] compared the different methods to distinguish synergy from other effects with the result that the FIC index, usually represented in the isobole method of Berenbaum [36] is the method of choice to demonstrate synergy. Drug interaction was classified as either synergistic, additive, indifferent, or antagonistic based on the fractional inhibitory concentration (FIC) index. The fractional effect (FE) of two compounds is calculated from the effect caused by two compounds in combination in relation to the effect of one compound alone: FEa = IC 50 a+b / IC 50 a; FEb = IC 50 a+b / IC 50 b. By plotting these values against each other the isobologram showing the areas of synergy is obtained. The FIC index is the sum of both FE indexes. According to Berenbaum [36], FIC ≤ 1.0 signifies synergy, FIC = 1.0 an additive effect and FIC ≥ 1.0 antagonism. Schelz [37] regards FIC ≤ 0.5 as synergy, FIC > 0.5 to 1.0 as additive, FIC = 1.0 to 4.0 as indifferent and FIC ≥ 4.0 as antagonism. We follow the second perspective.

145

7.4 Results Haemolysis The three saponins aescin, digitonin and Quillaja saponin have substantial haemolytic properties with IC 50 values between 316, 20 and 157 µg/ml, respectively. The monoterpene thymol exhibits a much lower haemolytic activity with an IC 50 value of 763 µg/ml (Tab. 1). These three saponins were combined with thymol to investigate an influence on the haemolytic efficacy of saponins (Fig. 3). The combination of ascending concentrations of saponins with a low constant concentration of thymol corresponding to its IC 30 value increased the haemolytic activity dramatically. All three combinations produced FIC values between 0.01 and 0.1, indicating a very strong synergistic effect (Tab. 1). The monoterpenes α-pinene and menthol could not be tested in the haemolytic assay since their solubility was too poor to reach the concentrations necessary for a haemolytic effect.

Table 1: Synergistic haemolytic activities of saponins and monoterpenes. *The concentration of thymol was kept constant at IC 30 , while the saponins were serially diluted.

Compound Erythrocytes FIC IC 50 [µg/ ml] Aescin 316.5 Digitonin 20.3 Quillaja saponin 157.5 Thymol 763.3

Combination Aescin + thymol* 2.3 0.011 Digitonin + thymol * 3.6 0.184 Quillaja saponin + thymol * 11.5 0.088

Cytotoxicity Cos7 and HeLa cells were treated with a dilution series of the saponins aescin, digitonin, glycyrrhizic acid and Quillaja saponin (containing 20-35 % quillajic acid) (Fig. 1) and the monoterpenes α-pinene, menthol and thymol (Fig. 2). The cytotoxic activities of aescin, digitonin and Quillaja saponin were similar with IC50 values between 12.2 µg/ml and 41.3 µg/ml (Tab. 2). Glycyrrhizic acid was an exception with a 10 times lower cytotoxicity of 311.8 and 313.4 µg/ml respectively (Tab. 2). The monoterpenes α-pinene and menthol showed a medium cytotoxicity with IC 50 values between 243.0 µg/ml and 357.9 µg/ml, while

146

thymol was four times more toxic with 82.5 µg/ml and 83.6 µg/ml respectively in Cos7 and HeLa cells (Tab. 2).

Table 2: Cytotoxic activities of saponins and monoterpenes

Compound HeLa Cos7 IC 50 [µg/ ml] IC 50 [µg/ ml] Aescin 41.3 37.4 Digitonin 12.2 14.7 Glycyrrhizic acid 313.4 311.8 Quillaja saponin 33.5 23.4 α-Pinene 357.9 337.5 Menthol 243.0 319.9 Thymol 83.6 82.5

In a consecutive experiment, Cos7 cells were treated with a dilution series of the saponins aescin, digitonin, glycyrrhizic acid and Quillaja saponin in combination with α-pinene and thymol. In HeLa cells menthol was employed as a combination partner. Cos7 cells were extremely sensitive to the combinations aescin, digitonin, glycyrrhizic acid and Quillaja saponins with thymol with IC 50 values between 0.1 µg/ml and 1.0 µg/ml; while the combinations of the saponins with α-pinene were 10 times less active (Tab. 3, Fig. 4). In HeLa cells the combinations aescin, digitonin, glycyrrhizic acid and Quillaja saponins with thymol and menthol had IC 50 values between 4.9 µg/ml and 35.7 µg/ml, while the combinations of the saponins with α-pinene were again up to 10 times less active (Tab. 3).

Table 3: Synergistic cytotoxic effects of saponins and monoterpenes; monoterpenes were applied at their corresponding IC 50 concentration. ND = not determined

Compound HeLa FIC Cos7 FIC IC 50 IC 50 [µg/ ml] [µg/ ml] Aescin + α-pinene 51.3 1.387 11.1 0.330 Aescin + thymol ND 1.0 0.039 Digitonin + α-pinene 7.7 0.651 1.8 0.788 Digitonin + thymol 4.9 0.465 0.1 0.013 Digitonin + menthol 7.6 0.657 ND Glycyrrhizic acid + α-pinene 213.6 1.278 18.6 0.115 Glycyrrhizic acid + thymol ND 0.7 0.001 Quillaja saponin + α-pinene 25.4 0.828 0.7 0.033 Quillaja saponin + thymol 35.7 1.491 0.7 0.039

147

For Cos7 cells FIC values between 0.001 and 0.3 were found while HeLa cells showed FIC values between 0.4 and 1.

Menthol, thymol and α-pinene were combined with each other in varying concentrations in HeLa cells. These combinations were not synergistic and FIC values of the different combinations ranged between 0.5 and 1.0, signifying an additive effect (Tab. 4, Fig. 5).

Table 4: Synergistic cytotoxic effects of monoterpenes combined at their corresponding IC 50 concentrations

Compound HeLa FIC IC 50 [µg/ ml] Menthol + α-pinene 150.0 1.036 Menthol + thymol 38.5 0.619 α-Pinene + menthol 89.1 0.615 α-Pinene + thymol 115.1 1.697 Thymol + menthol 19.2 0.309 Thymol + α-pinene 62.1 0.916

7.5 Discussion Saponins and monoterpenes are a highly variable class of molecules found all over the plant kingdom. So far, approximately 2500 monoterpenes and 5000 saponins are known today [33]. They play an important role in plant defence against bacteria, fungi and herbivores. Mankind has long learned to use these plants for the treatment of various diseases, such as the common cold and infections.

Several studies were conducted showing the synergistic effect of monoterpenes on bacterial membranes [31,32,38-40], but so far no combination with saponins has been tested. Saponins on the other hand have been studied for their supportive effect in cancer chemotherapy where they seem to facilitate the absorption of cytotoxic drugs [25,41,42]. By enhancing the membrane permeability they also facilitate the absorption of proteins [43] and antibiotics [44], often with a synergistic effect.

Our haemolysis experiment revealed a synergistic effect of the combination of monoterpenes and saponins (Tab. 1). The enhanced haemolysis is primarily a physical membrane effect by making membranes leaky. The combinations of thymol with saponins were far more active than one substance alone. Sheep erythrocytes are an excellent model for studying the

148

haemolytic effect of natural products on natural biomembranes. Their biomembranes are not a simple lipid bilayer but contain also proteins and a sugar-coat on their surface. The major difference to common cells however is the absence of a nucleus, which excludes apoptosis as explanation for the shown effects.

In a second set of experiments the cell lines HeLa and Cos7 were treated with saponins in combination with monoterpenes. Interestingly, HeLa and Cos7 were up to 10 times more sensitive than erythrocytes. Combinations of monoterpenes and saponins exhibited synergistic cytotoxic effects (Tab. 2, 3).

Fig.6: Biomembrane as target for saponins and monoterpenes after Wink 2008 [14]

Both saponins and monoterpenes act on the same biological target, the biomembrane (Fig. 6). Due to their completely different chemical structures, their mode of action differs. Saponins, especially the biologically active monodesmosides with only one sugar moiety intercalate with their lipophilic part in the lipid bilayer of the membrane while their hydrophilic part, the sugar chain, remains outside. Accordingly, saponins are able to change the membrane fluidity and make it leaky.

149

Monoterpenes, on the other hand, are small, lipophilic molecules that can easily penetrate the lipid bilayer of the biomembrane. Because of their lipophily they can accumulate within the bilayer and increase its fluidity. Thymol is a phenol which can dissociate to a phenolate ion under physiological conditions. In this case the polar part will drive the molecule to the membrane borders, whereas the lipopophilic parts will dive into the bilayer. This may explain the different activity of thymol as compared to the less polar menthol and α-pinene. When saponins and monoterpenes are combined, however, the effect is triggered to new levels of synergistic interactions. While monoterpenes are weakening the biomembrane, saponins form little pores that eventually cause the rupture of the membrane. The exact nature of the saponins does not seem to be of primary importance as long as they are monodesmosides. The more molecules of monoterpenes are incorporated into the membrane, the less stable it becomes, potentiating the effect of low doses of saponins.

It is not necessary for a plant to produce a specific saponin in combination with a specific monoterpene to evoke lytic action against biomembranes. Although the physicochemical mechanism is relatively simple and nonspecific it is highly efficient. Furthermore it is nearly impossible for bacteria and fungi to develop resistances against this synergetic interaction. This explains the overall success and abundance of these molecules in the plant kingdom as defence compounds [45].

The synergistic effect of saponins with monoterpenes opens a complete new field of possible applications. The efficacy of the treatment of antibiotic resistant bacterial infections could be improved by combining antibiotics with monoterpenes and saponins. A combination therapy of both monoterpenes and saponins together with cancer chemotherapeutics could also be another option worth of consideration.

150

Fig. 3: Haemolytic effect of saponins in combination with monoterpenes. The concentration of thymol was kept constant at IC 30 , while the saponin was serially diluted.

120 Aescin Thymol Thymol + Aescin 100

40 Haemolysis [%] 20

0 2 3 1.5 2.5 125 200 225 250 275 300 325 350 375 400 425 500 0.01 0.02 0.09 0.19 0.75 1.75 2.25 2.75 7.81 62.5 1000 2000 0.005 0.047 0.375 3.905 15.63 31.25 -20 Concentration [µg/ ml]

A: Haemolytic effect of aescin in combination with thymol

120 Digitonin Thymol Thymol + Digitonin 100

40 Haemolysis[%] 20

0 15 20 25 50 0.7 1.6 100 200 225 250 275 300 325 350 375 400 425 500 0.06 0.25 0.35 3.13 6.25 12.5 17.5 22.5 1000 2000 0.125 -20 Concentration [µg/ ml]

B: Haemolytic effect of digitonin in combination with thymol

151

120 Quillaja saponin Thymol 100 Thymol + Quillaja saponin

40 Haemolysis [%] 20

0 0.6 1.2 2.3 125 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950 7.81 62.5 1000 2000 3.905 15.63 31.25 -20 Concentration [µg/ ml]

C: Haemolytic effect of Quillaja saponin in combination with thymol

152

Fig. 4: Cytotoxicity of saponins in combination with monoterpenes in Cos7 cells. The concentration of the monoterpene was kept constant at IC 50, while the saponin was serially diluted.

120 Aescin Thymol Thymol + Aescin 100

40 Survival Survival [%]

0 0.781 1.562 3.125 6.25 12.5 25 50 100 200 400

-20 Concentration [µg/ ml]

A: Effect of aescin in combination with thymol against Cos7 cells

120 Digitonin Thymol Thymol + Digitonin 100

40 Survival [%]

0 0.117 0.234 0.468 0.937 1.875 3.75 7.5 15 30 60 100 200 400

-20 Concentration [µg/ ml]

B: Effect of digitonin in combination with thymol against Cos7 cells

153

140 Glycyrrhizic Acid Thymol Thymol + Glycyrrhizic Acid 120

100

60 Survival Survival [%]

0 0.781 1.562 3.125 6.25 12.5 25 50 100 200 400 Concentration [µg/ ml]

C: Effect of glycyrrhizic acid in combination with thymol against Cos7 cells

140 Quillaja saponin Thymol 120 Thymol + Quillaja saponin

100

40 Survival [%]

0 0.781 1.562 3.125 6.25 12.5 25 50 100 200 400

-20 Concentration [µg/ ml]

D: Effect of Quillaja saponin in combination with thymol against Cos7 cells

154

Fig. 5: Cytotoxicity of monoterpene combinations in HeLa cells. One monoterpene was kept constant at IC 50 , while the other was serially diluted.

120 α-Pinene Menthol 100 Menthol + α-Pinene

40 Survival Survival [%]

0 1.171 2.441 4.882 9.765 19.531 39.062 78.125 156.25 312.5 625 1250

-20 Concentration [µg/ ml]

A: Effect of α-pinene in combination with menthol against HeLa cells

120 α-Pinene Thymol 100 Thymol + α-Pinene

40 Survival [%]

0 0.781 1.562 3.125 6.25 12.5 25 50 100 200 400 625 1250

-20 Concentration [µg/ ml]

B: Effect of α-pinene in combination with thymol against HeLa cells

155

120 Thymol Menthol 100 Menthol + Thymol

40 Survival[%]

0 0.781 1.171 2.343 4.687 9.375 18.75 37.5 75 150 300 600

-20 Concentration [µg/ ml]

C: Effect of thymol in combination with menthol against HeLa cells

156

7.6 References

1 Wink M (2005). Die Verwendung pflanzlicher Vielstoffgemische in der Phytotherapie: eine evolutionäre Sichtweise. Phytotherapie. 5, 33-39.

2 Hänsel R, Sticher O (2007). Pharmacognosie – Phytopharmazie, 8 th ed., Springer, Heidelberg.

3 van Wyk BE, Wink M (2004). Medicinal Plants of the World, BRIZA, Pretoria.

4 Wittstock U, Gershenzon J (2002). Constitutive plant toxins and their role in defence against herbivores and pathogens. Curr Opin Plant Biol. 5, 300-307.

5 Heinrich M, Barnes J, Gibbons S, Williamson EM (2004). Fundamentals of pharmacognosy and phytotherapy. Churchill Livingstone, London, p. 161.

6 Houghton P, Mukherjee PK (2009). Evaluation of herbal medicinal products: Perspectives on quality, safety and efficacy. Pharmaceutical Press, London, p. 88.

7 Hou JP, Jin Y (2005). The healing power of Chinese herbs and medicinal recipes. Haworth Press, New York.

8 Xue CC, O’Brien K (2003). Modalities in Chinese medicine. In: A Comprehensive Guide to Chinese Medicine , Ed PC Leung. World Scientific Publishing, Singapore, p. 25.

9 Gong X, Sucher NJ (2002). Stroke therapy in traditional Chinese medicine (TCM): prospects for drug discovery and development. Phytomedicine. 9, 478-484.

10 Sheehan MP, Atherton DJ (1992). A controlled trial of traditional Chinese plants in widespread non-exhudative atopic eczema. Br J Dermatol. 126, 179-184.

11 Ulrich-Merzenich G, Panek D, Zeitler H, Vetter H, Wagner H (2010). Drug development from natural products: exploiting synergistic effects. Indian J Exp Biol. 48, 208-219.

12 Wagner H, Ulrich-Merzenich G (2009). Synergy research: approaching a new generation of phytopharmaceuticals. Part I. Phytomedicine. 16, 97–107.

13 Wagner H (1999). New approaches in phytopharmacological research. Pure Appl Chem. 71, 1649-1654.

14 Wink M (2008). Evolutionary advantage and molecular modes of action of multicomponent mixtures in phytomedicine. Curr Drug Metab. 9, 996-1009.

15 Wagner H (2004). Natural products chemistry and phytomedicine research in the new millennium: new developments and challenges. ARKIVOC VII, 277-284.

16 Wagner H (2006). Multitarget therapy—the future of treatment for more than just functional dyspepsia. Phytomedicine. 13, 122–129.

17 Volberding PA, Deeks SG (2010). Antiretroviral therapy and management of HIV infection. Lancet. 376, 49-62.

157

18 Jia J, Zhu F, Ma X, Cao Z, Li Y, Chen YZ (2009). Mechanisms of drug combinations: interaction and network perspectives. Nat Rev Drug Discov. 8, 111-128.

19 Ma XH, Zheng CJ, Han LY, Xie B, Jia J, Cao ZW, Li YX, Chen YZ (2009). Synergistic therapeutic actions of herbal ingredients and their mechanisms from molecular interaction and network perspectives. Drug Discov Today. 14, 579-588.

20 Gilbert B, Ferreira Alves L (2003). Synergy in plant medicines. Curr Med Chem. 10, 13-20.

21 Beckstrom-Sternberg SM, Duke JA (1994). Potential for synergistic action of phytochemicals in spices, In: Spices, Herbs and Edible Fungi . Ed. Charalambous, G. Elsevier, Amsterdam, p. 210-233.

22 Kennedy DO, Scholey AB, Wesnes KA (2001). Differential, dose dependent changes in cognitive performance following acute administration of a Ginkgo biloba/Panax ginseng combination to healthy young volunteers. Nutr Neurosci. 4, 399-412.

23 Fuchs H, Bachran D, Panjideh H, Schellmann N, Wenig A, Melzig MF, Sutherland M, Bachran C (2009). Saponins as tool for improved targeted tumor therapies. Curr Drug Targets. 10, 140-151.

24 Bachran C, Bachran S, Sutherland M, Bachran D, Fuchs H (2008). Saponins in tumor therapy. Mini Rev Med Chem. 8, 575-584.

25 Heisler I, Sutherland M, Bachran C, Hebestreit P, Schnitger A, Melzig MF, Fuchs H (2005). Combined application of saponin and chimeric toxins drastically enhances the targeted cytotoxicity on tumor cells. J Control Release. 106, 123-137.

26 Gee JM, Wortley GM, Johnson IT, Price KR, Rutten AA, Houben GF, Penninks AH (1996). Effects of saponins and glycoalkaloids on the permeability and viability of mammalian intestinal cells and on the integrity of tissue preparations in vitro. Toxicol In Vitro. 10, 117- 128.

27 Palaniappan K, Holley RA (2010). Use of natural antimicrobials to increase antibiotic susceptibility of drug resistant bacteria. Int J Food Microbiol. 140, 164-168.

28 Gallucci MN, Oliva M, Casero C, Dambolena J, Luna A, Zygadlob J, Demoa M (2009). Antimicrobial combined action of terpenes against the food-borne microorganisms Escherichia coli , Staphylococcus aureus and Bacillus cereus . Flavour Fragr. 24, 348-354.

29 Hemaiswarya S, Doble M (2009). Synergistic interaction of eugenol with antibiotics against gram negative bacteria. Phytomedicine. 16, 997-1005.

30 Aiyegoro O, Afolayan A, Okoh A (2009). Synergistic interaction of Helichrysum pedunculatum leaf extracts with antibiotics against wound infection associated bacteria. Biol Res. 42, 327-338.

31 Mulyaningsih S, Sporer F, Zimmermann S, Reichling J, Wink M (2010). Synergistic properties of the terpenoids aromadendrene and 1,8-cineole from the essential oil of

158

Eucalyptus globulus against antibiotic-susceptible and antibiotic resistant pathogens. Phytomedicine. 17, 1061-1066.

32 Mulyaningsih S, Youns M, El-Readi MZ, Ashour ML, Nibret E, Sporer F, Herrmann F, Reichling J, Wink M (2010). Biological activity of the essential oil of Kadsura longipedunculata (Schisandraceae) and its major components. J Pharm Pharmacol. 62, 1037- 1044.

33 Wink M (2007). Bioprospecting: The search for bioactive lead structures from nature. In: Medicinal Plant Biotechnology. From Basic Research to Industrial Applications . Ed O Kayser and WJ Quax, Wiley-VCH, Weinheim, pp. 97-116.

34 Mosmann T (1983). Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immun Methods. 65, 55–63.

35 Williamson EM (2001). Synergy and other interactions in phytomedicines. Phytomedicine. 8, 401-409.

36 Berenbaum M (1989). What is synergy? Pharmacol Rev. 41, 93-141.

37 Schelz Z, Molmar J, Hohmann J (2006). Antimicrobial and antiplasmid activities of essential oils. Fitoterapia 77, 279-285.

38 Pei RS, Zhou F, Ji BP, Xu J (2009). Evaluation of combined antibacterial effects of eugenol, cinnamaldehyde, thymol, and carvacrol against E. coli with an improved method. J Food Sci. 74, 379-383.

39 Braga PC, Sasso MD, Culici M, Alfieri M (2007). Eugenol and thymol, alone or in combination, induce morphological alterations in the envelope of Candida albicans . Fitoterapia. 78, 396-400.

40 Didry N, Dubreuil L, Pinkas M (1994). Activity of thymol, carvacrol, cinnamaldehyde and eugenol on oral bacteria. Pharm Acta Hel. 69, 25-28.

41 Kim SM, Lee SY, Cho JS, Son SM, Choi SS, Yun YP, Yoo HS, Yoon DY, Oh KW, Han SB, Hong JT (2010). Combination of ginsenoside Rg3 with docetaxel enhances the susceptibility of prostrate cancer cells via inhibition of NF-κB. Eur J Pharmacol. 631, 1-9.

42 Gaidi G, Correia M, Chauffert B, Beltramo JL, Wagner H, Lacaille-Dubois MA (2002). Saponins-mediated potentiation of cisplatin accumulation and cytotoxicity in human colon cancer cells. Planta Med. 68, 70-72.

43 Hebestreit P, Melzig MF (2003). Cytotoxic activity of the seeds from Agrostemma githago var. githago . Planta Med. 69, 921-925.

44 De Lucca AJ, Bland JM, Boue S, Vigo CB, Cleveland TE, Walsh TJ (2006). Synergism of CAY-1 with amphotericin B and itraconazole. Chemotherapy. 52, 285-287.

45 Wink M (1988). Plant breeding: Importance of plant secondary metabolites for protection against pathogens and herbivores. Theor Appl Genet. 75, 225-233.

159

8. General conclusion and outlook

The acceptance and availability of Traditional Chinese Medicine has increased tremendously in Europe and North America in recent years. However, the identity of these drugs is not always guaranteed. The correct authentication is accordingly a necessity prior to all serious research on this topic. We successfully used DNA barcoding to authenticate 66 TCM drugs tested in our study. Only one adulteration could be detected where Arctium lappa was wrongly labelled Fraxinus rhynchophylla . In the process of our project, we became aware of both the advantages and the limitations the use of the rbc L gene offers for authentication of herbal medicine drugs. We could show that DNA barcoding offers a fast, reliable way of authentication and is superior to chemical profiling because of its practicability even for unidentified plant species.

Adding to our survey several important European medicinal plants, we screened the dichloromethane, methanol and water extracts of altogether 82 plants used in phytomedicine for their antiviral, antitrypanosomal and anticancer properties. Several plants showed extremely exciting results in their activities, so that we decided to focus in our further research on the antitrypanosomal properties of Panax ginseng where our screening results were especially promising.

Being widely regarded as an important medicinal drug with a broad range of pharmacological properties, we decided to take a closer look at the natural products known from P. ginseng . The pharmacological effects are mostly attributed to the ginsenosides, a highly variable group of saponins. Accordingly, we investigated the individual effects of 12 pure ginsenosides to gain a better understanding of their mode of action. We could show that their cytotoxic effect is linked to membrane disturbance. The position of the sugar moieties and the resulting ability to be incorporated into the lipid bilayer of the cell membrane are responsible for the huge differences we could detect in their cytotoxic effects. The monodesmosidic ginsenosides Rg 3 and Rh 2 with the sugar moiety attached to C3 demonstrated a far higher cytotoxicity than monodesmosidic ginsenosides with the sugar moiety attached to C6 or bidesmosidic ginsenosides.

The antitrypanosomal activity of P. ginseng however was not due to the ginsenosides, and so we decided to investigate the other important group of natural products present in P. ginseng,

160

the polyacetylenes. This proved to be an extremely exciting research field. We detected that the hexane extracts and one of their major compounds, panaxynol, expressed an extreme selectivity in their cytotoxicity against trypanosomes. Panaxynol was cytotoxic against

Trypanosoma brucei brucei at the IC 50 concentration of 0.01 µg/ml with a selectivity index of 858. This selectivity is even superior to the established antitrypanosomal drugs like suramin with a selectivity index of only 280. We suggest that the inhibition of the trypanothione reductase, essential for the resistance of the parasite against oxidative stress and unique to trypanosomes, is the primary principle of this selectivity.

Being aware of the great potential of polyacetylenes like panaxynol against trypanosomes, we decided to investigate another polyacetylene plant, Carlina acaulis . The main compound of the essential oil of C. acaulis , Carlina oxide, differs fundamentally in its chemical structure from panaxynol. However, we could again detect a strong and selective activity against T. b. brucei with an IC 50 of 1.0 µg/ ml and a selectivity index of 446. We suggest a similar mode of action as in panaxynol as explanation for this selectivity.

Our previous results obtained from the activity of ginsenosides had shown us the efficacy, but also the structure dependency of the membrane effects of saponins. Thus, we decided to explore this effect further and to investigate possible synergistic interactions found in the multiple compound mixtures that form the natural defence system of plants. Saponins and monoterpenes are the two groups of natural products whose activity is based on their effect on the cell membrane. Since they are almost omnipresent in those plants commonly applied in phytomedicine, we wanted to know if there is more to it than just a coincidence. We combined several monoterpenes with different saponins and explored their effect on biomembranes modelled by erythrocytes and living cells. Our results were truly astonishing. The combination of a monoterpene with a saponin lowered the dosis necessary for haemolysis up to the factor 100 compared to the single substances. The same effect could be detected in living cells. Since both groups of natural products target the same structure of the cell, the biomembrane, but are completely different in their structure, they work together synergistically by enhancing their activity far above a simple additive effect.

We conclude that the potential of traditional medicinal systems such as traditional Chinese Medicine as a source for novel lead compounds is far from being exhausted. If even a well

161

know drug like ginseng can offer such astonishing results, how much more can be detected in unexplored or forgotten medicinal plants?

Being part of the so-called neglected diseases, the research on and discovery of new drugs against sleeping sickness is of international importance. We are glad to have been able to contribute to the research in this highly relevant field that might eventually influence the lives of millions of people in Africa.

162

9. Acknowledgements I am indebted to all people in the Institute of Pharmacy and Molecular Biotechnology, University of Heidelberg, who have contributed with their time, valuable advice and laboratory experience to the successful completion of this thesis. I am most grateful to my supervisor Prof. Dr. M. Wink for giving me the opportunity to do my dissertation in his laboratory. He always took the time to listen to my ideas, gave valuable advice and provided the necessary materials and space for the completion of my experiments. I am especially thankful that he was willing to let me pursue my ideas and gave me all liberty to follow those that appeared most promising and most interesting to me. To give the PhD student the chance to follow his own ideas while at the same time directing him with valuable advice is a rare trait I am most fortunate to have encountered in him. His broad knowledge in so different fields such as phytomedicine, traditional medicinal systems like TCM, evolution and zoology was a great inspiration to me and enabled me to include a broader range of exciting topics in my thesis than commonly possible. I am also very grateful to Prof. Dr. T. Efferth for his constant interest and friendly support of my research and his kind cooperation in several projects we could work at together. His strong interest in traditional Chinese Medicine was a great inspiration and influence in my thesis. I also want to thank Prof. Dr. J. Reichling whose friendly approach and whose constructive ideas were helpful to look at angles of my project that might have otherwise passed unnoticed. I am very much indebted to Prof. Dr. J.J.G. Marin and his co-workers Dr. M. R. Romero and Dr. A.G. Blazquez of the Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), University of Salamanca, CIBERehd, Spain, for their cooperation in our large screening project where they performed all the viral and some of the cancer assays. In the course of this project I am also thankful to Dorothea Kaufmann for performing the cytotoxic screening in Cos7 cells. I am very much indebted to the group of Prof. Dr. U. Müller for giving me the opportunity to measure my cytotoxic assays with their plate reader. They were always cheerful no matter how many 96 well plates I carried into their laboratory each week to measure. I am especially thankful to Frank Sporer who performed the GLC-MS analysis in our projects on Carlina acaulis and Panax ginseng . Without him the successful conclusion of these projects would not have been possible. I am indebted to several people in our institute who helped me with the daily laboratory work. First of all I want to thank Hedi Sauer-Gürth who taught me all the basics of DNA barcoding

163

and how to overcome the daily frustration when the secondary metabolites in the isolated DNA yet again made a successful PCR impossible. I also want to thank Heidi Stauder who was always cheerful and very helpful in obtaining plant samples from the botanical garden as references for the DNA barcoding. Here I also want to thank Michael Braun and Dr. Javier Gonzalez for their support with the phylogenetic analysis of my samples. Our cell culture laboratory would not have been such a good working place without Dorothea Kaufmann who tireless fought to keep it in order and to organize a schedule that allowed all of us to use the sterile benches. She was also most helpful in ordering the daily chemicals we needed to perform our research. Last, but not least made her friendship and good humor the many hours in front of the sterile bench an agreeable time! My thanks go also to Razan Hamoud who performed the antimicrobial and antifungal tests in some of our projects. It was always great to work with her and she often shared my frustration when things were not going as smoothly as hoped. I also want to thank Dr. M. Ashour for his support with the extract preparation of our TCM plants when we spent months with extracting and concentrating the TCM plants that formed the basis of many of the projects now being performed in our institute. At this place I would also want to thank Astrid Backhaus for her friendly support whenever we had new extracts to prepare in the course of our experiments. My thanks go also to Endalk Nibret for his friendly cooperation in our cultivation of the trypanosomes. I want to thank as well Ted Cole for his friendly advice regarding formal procedure occuring during the final phase of my dissertation. At last I want to thank Sami Abbas, Andreas Bauer, Amin Eimanifar, Petra Fellhauer, Ina Groß, Pille Link, Alexandre Mendes Fernandes, Dr. Holger Schäfer, Nina Strychalski, Ikhwan Resmala Sudji, Chen Wei and all the others in the lab for their friendship and help.

Not part of our institute but equally important for the successful termination of my thesis is my family. I am most grateful for their constant support and love. Without them, this project would not have been possible.

164

10. Appendix

10.1 List of plants used in the screening with IPMB and GenBank accession number Family Species IPMB / No GenBank Acanthaceae Andrographis paniculata P6838 / 04 JF949965 Amaranthaceae Celosia cristata P6848 / 14 JF949970 Apiaceae Bupleurum chinense P6844 / 10 JF950021 Bupleurum marginatum P6845 / 11 JF949968 Centella asiatica P6849 / 15 JF950022 Cnidium monnieri P6854 / 20 JF949973 Saposhnikovia divaricata P6902 / 68 JF949988 Araliaceae Eleutherococcus senticosus P6919 / 79 - Panax ginseng China P8088 / 81 JF950028 Panax ginseng Korea P8086 / 81 JF950029 Panax notoginseng P6887 / 53 JF950030 Arecaceae Areca catechu P6840 / 06 - Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 Asteraceae Artemisia annua P6841 / 07 JF949966 Artemisia capillaris P6842 / 08 JF949967 Arctium lappa P6839 / 05 JF949994 Centipeda minima P6850 / 16 - Chrysanthemum indicum P6851 / 17 JF949971 Chrysanthemum morifolium P6852 / 18 JF949972 Eclipta prostata P6863 / 29 JF950000 Senecio scandens P6905 / 71 JF949989 Siegesbeckia orientalis P6906 / 72 JF949990 Taraxacum officinale P6908 / 74 JF950019 Berberidaceae Berberis bealei P6883 / 49 JF949996 Dysosma versipellis P6862 / 28 - Epimedium koreanum P6865 / 31 JF950002 Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 Isatis indigotica (root) P6877 / 43 JF949981 Isatis indigotica (leaf) P6878 / 44 JF949981 Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 Crassulaceae Rhodiola rosea P6920 / 84 - Cupressaceae Platycladus orientalis P6891 / 57 JF950011 Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 Ephedraceae Ephedra sinica P6864 / 30 JF950001 Equisetaceae Equisetum hiemale P6866 / 32 JF950003 Euphorbiaceae Croton tiglium P6856 / 22 -

165

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 Acacia catechu P6836 / 02 - Cassia tora P6847 / 13 JF949969 Desmodium styracifolium P6861 / 27 JF949976 Glycyrrhiza inflata P6873 / 39 JF950025 Spatholobus suberectus P6907 / 73 JF949991 Sutherlandia frutescens tba / 83 - Geraniaceae Geranium wilfordii P6867 / 33 JF949977 Pelargonium sidoides tba / 82 - Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 Hypericaceae Hypericum japonicum P6876 / 42 JF949980 Iridaceae Belamcanda chinensis P6843 / 09 JF949995 Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 Prunella vulgaris P6896 / 62 JF950013 Scutellaria baicalensis P6903 / 69 JF950017 Lauraceae Cinnamomum cassia P6853 / 19 JF950023 Loranthaceae Taxillus chinensis P6909 / 75 JF949992 Lythraceae Punica granatum P6897 / 63 JF950014 Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 Melanthiaceae Paris polyphylla P6888 / 54 JF950010 Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 Myrtaceae Eucalyptus robusta P6868 / 34 - Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 Pedaliaceae Harpagophytum procumbens tba / 80 - Poaceae Cymbopogon distans P6857 / 23 JF949974 Polygonaceae Fallopia japonica (syn. Polygonum cuspidatum) P6894 / 60 JF950004 Fallopia multiflora (syn. Polygonum multiflorum) P6895 / 61 JF949987 Polygonum aviculare P6893 / 59 JF950012 Rheum officinale P6898 / 64 JF950015 Ranunculaceae Coptis chinensis P6855 / 21 JF950024 Rosaceae Rosa chinensis P6899 / 65 - Rosa laevigata P6900 / 66 - Sanguisorba officinalis P6901 / 67 JF950016 Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 Rutaceae Evodia lepta P6869 / 35 JF949978 Evodia rutaecarpa P6870 / 36 - Phellodendron chinense P6890 / 56 JF949986 Saururaceae Houttuynia cordata P6875 / 41 JF950006 Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007

166

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 Verbenaceae Verbena officinalis P6910 / 76 JF950020 Violaceae Viola yezoensis P6911 / 77 JF949993 Zingiberaceae Alpinia galanga P6837 / 03 - Alpinia oxyphylla P6917 / 78 -

167

10.2 TCM plants with photos and Chinese name

Family Species Chinese Name

Chuanxinlian Andrographis Acanthaceae paniculata 穿心莲

Jiguanhua

Amaranthaceae Celosia cristata 鸡冠花

Chaihu Apiaceae Bupleurum chinense 柴胡

Nanchaihu Bupleurum Apiaceae marginatum 南柴胡

Leigonggen Apiaceae Centella asiatica 雷公根

Shechuangzi

Apiaceae Cnidium monnieri 蛇床子

Fangfeng Saposhnikovia Apiaceae divaricata 防风

168

Renshen Araliaceae Panax ginseng China 人参

Renshen Araliaceae Panax ginseng Korea 人参

Sanqi

Araliaceae Panax notoginseng 三七

Binglang

Arecaceae Areca catechu 槟榔

Liaodiaozhu Cynanchum Asclepiadaceae paniculatum 了刁竹

Huanghuahao

Asteraceae Artemisia annua 黄花蒿

Yinchenhao

Asteraceae Artemisia capillaris 茵陈蒿

169

Niubang

Asteraceae Arctium lappa 牛蒡

Ebushicao Asteraceae Centipeda minima 鹅不食草

Yejuhua Chrysanthemum Asteraceae indicum 野菊花

Juhua Chrysanthemum Asteraceae morifolium 菊花

Hanliancao

Asteraceae Eclipta prostata 旱莲草

Qianliguang

Asteraceae Senecio scandens 千里光

Xixiancao Siegesbeckia Asteraceae orientalis 稀莶草

170

Pugongying

Asteraceae Taraxacum officinale 蒲公英

Shidagonglao Berberidaceae Berberis bealei 十大功劳

Bajiaolian

Berberidaceae Dysosma versipellis 八角莲

Yinyanghuo Berberidaceae Epimedium koreanum 淫羊霍

Jicai Capsella bursa- Brassicaceae pastoris 荠菜

Banlangen

Brassicaceae Isatis indigotica (root) 板蓝根

Daqingye Brassicaceae Isatis indigotica (leaf) 大青叶

171

Rendongteng

Caprifoliaceae Lonicera confusa 忍冬藤

Huangjing Polygonatum Convallariaceae kingianum 黄精

Hongjingtian Crassulaceae Rhodiola rosea 红景天

Cebaiye

Cupressaceae Platycladus orientalis 侧柏叶

Guanzhong

Dryopteridaceae Cyrtomium fortunei 贯众

Mahuang

Ephedraceae Ephedra sinica 麻黄

Muzei

Equisetaceae Equisetum hiemale 木贼

172

Badou

Euphorbiaceae Croton tiglium 巴豆

Jigucao

Fabaceae Abrus cantoniensis 鸡骨草

Ercha

Fabaceae Acacia catechu 儿茶

Juemingzi

Fabaceae Cassia tora 决明子

Guangjinqiancao Desmodium Fabaceae styracifolium 广金钱草

Gancao

Fabaceae Glycyrrhiza inflata 甘草

Jixueteng Spatholobus Fabaceae suberectus 鸡血藤

173

Laoguancao

Geraniaceae Geranium wilfordii 老鹳草

Yinxing

Ginkgoaceae Ginkgo biloba 银杏

Tianjihuang

Hypericaceae Hypericum japonicum 田基黄

Shegan

Iridaceae Belamcanda chinensis 射干

Bohe

Lamiaceae Mentha haplocalyx 薄荷

Xiakucao

Lamiaceae Prunella vulgaris 夏枯草

Huangqin

Lamiaceae Scutellaria baicalensis 黄芩

174

Guizhi Lauraceae Cinnamomum cassia 桂枝

Sangjisheng

Loranthaceae Taxillus chinensis 桑寄生

Shiliu Lythraceae Punica granatum 石榴

Houpu

Magnoliaceae Magnolia officinalis 厚朴

Qiyeyizhihua

Melanthiaceae Paris polyphylla 七叶一枝花

Jinqiancao

Myrsinaceae Lysimachia christinae 金钱草

Anshu

Myrtaceae Eucalyptus robusta 桉树

175

Yizhijian Ophioglossum Ophioglossaceae vulgatum 一支箭

Shihu Dendrobium Orchidaceae loddigesii 石斛

Chishao

Paeoniaceae Paeonia lactiflora 赤芍

Yunxiancao

Poaceae Cymbopogon distans 芸香草

Huzhang Fallopia japonica Polygonaceae (syn. Polygonum 虎杖 cuspidatum)

Heshouwu Fallopia multiflora Polygonaceae (syn. Polygonum 何首乌 multiflorum)

Pianxu

Polygonaceae Polygonum aviculare 扁蓄

176

Dahuang

Polygonaceae Rheum officinale 大黄

Huanglian

Ranunculaceae Coptis chinensis 黄连

Yuejihua

Rosaceae Rosa chinensis 月季花

Jinyingzi

Rosaceae Rosa laevigata 金樱子

Diyu Sanguisorba Rosaceae officinalis 地榆

Baihuasheshecao

Rubiaceae Hedyotis diffusa 紫花地丁草

Sanchaku Rutaceae Evodia lepta 三叉苦

177

Wuzhuyu

Rutaceae Evodia rutaecarpa 吴茱萸

Huangbai Phellodendron Rutaceae chinense 黄柏

Yuxingcao

Saururaceae Houttuynia cordata 鱼腥草

Zigingpi Kadsura Schisandraceae longipedunculata 紫荆皮

Juanbai Selaginella Selaginellaceae tamariscina 卷柏

Baijiang Patrinia Valerianaceae scabiosaefolia 败酱

Mabiancao

Verbenaceae Verbena officinalis 马鞭草

178

Zihuadidingcao

Violaceae Viola yezoensis 紫花地丁草

Hongdoukou

Zingiberaceae Alpinia galanga 红豆蔻

Yizheren Zingiberaceae Alpinia oxyphylla 益智仁

179

10.3 DNA Barcoding Sequences Documentation of the authentication of the TCM drugs: DNA sequence and GenBank accession number of the rbc L gene sequences of the TCM drugs aligned with species obtained from GenBank.

Acanthaceae Andrographis paniculata P6838 / 04 JF949965 Aligned with Andrographis paniculata GQ436496 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATT TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATT

CCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCGGTAGCTGCCGAATCTTCCACTGGTACATGGACA CCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCGGTAGCTGCCGAATCTTCCACTGGTACATGGACA

ACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATCGAGCCCGTTCTTGGCGAAACAG ACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATCGAGCCCGTTCTTGGCGAAACAG

ATCAATATATTTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGAA ATCAATATATTTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGAA

ATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGCCTGGAAGATCTGCGAATCCCTACTGCTTATATTAAAACTTTCCAAGGTC ATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGCCTGGAAGATCTGCGAATCCCTACTGCTTATATTAAAACTTTCCAAGGTC

CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCTCTGCTGGGATGTACTATTAAACCTAAATTG CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCTCTGCTGGGATGTACTATTAAACCTAAATTG

GGATTATCCGCTAAAAACTACGGCAGAGCATGTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGT GGATTATCCGCTAAAAACTACGGCAGAGCATGTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGT

GAACTCCCAGCCATTTATGCGTTGGAGAGATCGTT GAACTCCCAGCCATTTATGCGTTG GAGAGATCGTT

Amaranthaceae Celosia cristata P6848 / 14 JF949970 Aligned with Celosia argentea GQ436716 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

CTGACCTATTATACCCCGGAATATGAAACCCTGGATACCGATATTCTGGCGGCGTTTCGTGTGACCCCGCAGCCGGGCGTGCC CTGACCTATTATACCCCGGAATATGAAACCCTGGATACCGATATTCTGGCGGCGTTTCGTGTGACCCCGCAGCCGGGCGTGCC

GCCGGAAGAAGCGGGCGCGGCGGTGGCGGCGGAAAGCAGCACCGGCACCTGGACCACCGTGTGGACCGATGGCCTGACCAG GCCGGAAGAAGCGGGCGCGGCGGTGGCGGCGGAAAGCAGCACCGGCACCTGGACCACCGTGTGGACCGATGGCCTGACCAG

CCTGGATCGTTATAAAGGCCGTTGCTATCATATTGAACCGGTGGCGGGCGAAGAAAACCAGTATATTTGCTATGTGGCGTATC CCTGGATCGTTATAAAGGCCGTTGCTATCATATTGAACCGGTGGCGGGCGAAGAAAACCAGTATATTTGCTATGTGGCGTATC

CGCTGGATCTGTTTGAAGAAGGCAGCGTGACCAACATGTTTACCAGCATTGTGGGCAACGTGTTTGGCTTTAAAGCGCTGCGT CGCTGGATCTGTTTGAAGAAGGCAGCGTGACCAACATGTTTACCAGCATTGTGGGCAACGTGTTTGGCTTTAAAGCGCTGCGT

GCGCTGCGTCTGGAAGATCTGCGTATTCCGGTGGCGTATATTAAAACCTTTCAGGGCCCGCCGCATGGCATTCAGGTGGAACG GCGCTGCGTCTGGAAGATCTGCGTATTCCGGTGGCGTATATTAAAACCTTTCAGGGCCCGCCGCATGGCATTCAGGTGGAACG

TGATAAACTGAACAAATATGGCCGTCCGCTGCTGGGCTGCACCATTAAACCGAAACTGGGCCTGAGCGCGAAAAACTATGGC TGATAAACTGAACAAATATGGCCGTCCGCTGCTGGGCTGCACCATTAAACCGAAACTGGGCCTGAGCGCGAAAAACTATGGC

CGTGCGTGCTATGAATGCCTG CGTGCGTGCTATGAATGCCTG

Apiaceae Bupleurum chinense P6844 / 10 JF950021 Aligned with Bupleurum falcatum U50224 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCAGAGTAACTCCTCAACC GATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCAGAGTAACTCCTCAACC

180

AGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGA AGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGA

CTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGGAATCGAGCCCGTTCCTGGAGAAGAAAATCAATTTATCGCTTATGT CTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGGAATCGAGCCCGTTCCTGGAGAAGAAAATCAATTTATCGCTTATGT

AGCTTACCCATTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATCGTAGGTAATGTATTTGGGTTCAAAGC AGCTTACCCATTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATCGTAGGTAATGTATTTGGGTTCAAAGC

CCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAG CCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAG

TTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAAC TTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAAC

TACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAATTCCCAACCATTTAT TACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAATTCCCAACCATTTAT

GCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCCCAAGCCGAAACTGGTGAAATCAAAGGGCATTACT GCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCCCAAGCCGAAACTGGTGAAATCAAAGGGCATTACT

TGAACGCCACTGCGGGTACATGTGAA TGAACGCCACTGCGGGTACATGTGAA

Apiaceae Bupleurum marginatum P6845 / 11 JF949968 Aligned with Bupleurum falcatum U50224 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCAGAGTAACTCCTCAACC GATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCAGAGTAACTCCTCAACC

AGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGA AGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGA

CTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGGAATCGAGCCCGTTCCTGGAGAAGAAAATCAATTTATCGCTTATGT CTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGGAATCGAGCCCGTTCCTGGAGAAGAAAATCAATTTATCGCTTATGT

AGCTTACCCATTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATCGTAGGTAATGTATTTGGGTTCAAAGC AGCTTACCCATTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATCGTAGGTAATGTATTTGGGTTCAAAGC

CCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCATTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAG CCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAG

TTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAAC TTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAAC

TACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAATTCCCAACCATTTAT TACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAATTCCCAACCATTTAT

GCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCCCAAGCCGAAACTGGTGAAATCAAAGGGCATTACT GCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCCCAAGCCGAAACTGGTGAAATCAAAGGGCATTACT

TGA TGA

Apiaceae Centella asiatica P6849 / 15 JF950022 Aligned with Centella asiatica GQ436636 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC TAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC

AACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGA AACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGA

CGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGGAATCGAGCCCGTTCCTGGAGAAGAAAATCAATTTATTGCTT CGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGGAATCGAGCCCGTTCCTGGAGAAGAAAATCAATTTATTGCTT

ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTTGGTAATGTATTTGGGTTCA ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTTGGTAATGTATTTGGGTTCA

181

AAGCCCTGCGTGCCCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTGAAAACTTTCCAAGGCCCGCCTCATGGTATC AAGCCCTGCGTGCCCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTGAAAACTTTCCAAGGCCCGCCTCATGGTATC

CAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAA CAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAA

AAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTC AAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTC

Apiaceae Cnidium monnieri P6854 / 20 JF949973 Aligned with Cnidium japonicum D44562 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC TAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC

AACCTGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGA AACCTGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGA

TGGACTTACCAGCCTTGATCGTTACAAAGGGCGCTGCTACGAAATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATCGCTT TGGACTTACCAGCCTTGATCGTTACAAAGGGCGCTGCTACGAAATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATCGCTT

ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA

AAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATC AAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATC

CAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAA CAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAA

AAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAACTCCCAACCAT AAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAACTCCCAACCAT

TTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACTGGTGAAATCAAAGGGCAT TTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACTGGTGAAATCAAAGGGCAT

TACTTGAATGCTACTGCGGGTACATG TACTTGAATGCTACTGCGGGTACATG

Apiaceae Saposhnikovia divaricata P6902 / 68 JF949988 Aligned with Saposhnikovia divaricata GQ436633 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC TAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC

AACCTGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGA AACCTGGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGA

TGGACTTACCAGCCTTGATCGTTACAAAGGGCGCTGCTACGGAATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATCGCTT TGGACTTACCAGCCTTGATCGTTACAAAGGGCGCTGCTACGGAATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATCGCTT

ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA

AAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATC AAGCCCTGCGCGCTCTACGTCTAGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATC

CAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAA CAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAA

AAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAACTCCCAACCAT AAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGACGATGAGAATGTGAACTCCCAACCAT

TTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACTGGTGAAATCAAAGGGCAT TTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACTGGTGAAATCAAAGGGCAT

TACTTGAAT TACTTGAAT

182

Araliaceae Panax ginseng China P8088 / 81 JF950028 Aligned with Panax ginseng NC_006290 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AAAGATTACAAATTGACTTATTATACTCCTGACTATGATCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA AAAGATTACAAATTGACTTATTATACTCCTGACTATGATCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA

ACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGAT ACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGAT

GGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTA GGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTA

TGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAA TGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAA

AGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCA AGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCA

AGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAA AGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAA

ACTACGGTAGAGCGGTTTATGAATGTCTCCGGGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCATTT ACTACGGTAGAGCGGTTTATGAATGTCTCCGGGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCATTT

ATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTA ATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTA

CTTGAATGCTACTG CTTGAATGCTACTG

Araliaceae Panax ginseng Korea P8086 / 81 JF950029 Aligned with Panax ginseng NC_006290 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AAAGATTACAAATTGACTTATTATACTCCTGACTATGATCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA AAAGATTACAAATTGACTTATTATACTCCTGACTATGATCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA

ACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGAT ACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGAT

GGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTA GGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTA

TGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAA TGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAA

AGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCA AGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCA

AGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAA AGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAA

ACTACGGTAGAGCGGTTTATGAATGTCTCCGGGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCATTT ACTACGGTAGAGCGGTTTATGAATGTCTCCGGGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCATTT

ATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTA ATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTA

CTTGAATGCTACTG CTTGAATGCTACTG

Araliaceae Panax notoginseng P6887 / 53 JF950030 Aligned with Panax notoginseng GQ436707 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TAAAGATTACAAATTGACTTATTATACTCCTGACTATGACCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC TAAAGATTACAAATTGACTTATTATACTCCTGACTATGACCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC

183

AACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGA AACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGA

TGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTT TGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTT

ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA

AAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCC AAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCC

AAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAA AAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAA

AACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCATT AACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCATT

TATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATT TATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATT

ACTTGAAT ACTTGAAT

Araliaceae Panax pseudoschinseng P6887 / 53 JF950030 Aligned with Panax ginseng NC_006290 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TTAAGATTACAAATTGACTTATTATACTCCTGACTATGACCCCAAAGATACTGATACCTTGGCAGCATTCCGAGTAACTCCTC TAAAGATTACAAATTGACTTATTATACTCCTGACTATGATCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC

AACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGA AACCTGGAGTTCCAGCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGA

TGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTT TGGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATAGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTT

ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA ATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCA

AAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCC AAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCC

AAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAA AAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAA

AACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCCCAACCAT AACTACGGTAGAGCGGTTTATGAATGTCTCCGGGGTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCACAACCAT

TTATGCGTTGGAGAGACCGTTTCTTATTTT TTATGCGTTGGAGAGATCGTTTCTTATTTT

Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 Aligned with Cynanchum mongolicum GQ436512 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTC GATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTC

TACTGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGGCCG TACTGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCG

TTCCTGGAGAAGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGCTTA TTCCTGGAGAAGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGCTTA

CTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTACGCGCTCTACGTCTGGAAGATTTGCGAATCCCTCCGGCTTATATTA CTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTACGCGCTCTACGTCTGGAAGATTTGCGAATCCCTCAGGCTTATGTTA

AAACCTTCCAAGGCCCGCCGCATGGCATCCAGGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCCCTGTTGGGATGTAC AAACCTTCCAAGGCCCGCCACATGGCATCCAGGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCCCTGTTGGGATGTAC

184

TATTAAACCAAAATTGGGGTTATCAGCTAAAAACTATGGTAGGGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCA TATTAAACCAAAATTGGGGTTATCAGCTAAAAACTATGGTAGGGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCA

AAGATGATGAAAACGTGAACTCCCAACCGTTTATGCGTTGGAGAGATCGTTTCTTGTTTTGTGCCGAAGCAATTTTTAAATCA AAGATGATGAAAACGTGAACTCCCAACCGTTTATGCGTTGGAGAGATCGTTTCTTGTTTTGTGCCGAAGCAATTTTTAAATCA

CAGGCTGAAACCGGCGAAATCAAAGGGCATTACTTGAAT CAGGCTGAAACCGGCGAAATCAAAGGGCATTACTTGAAT

Asteraceae Artemisia annua P6841 / 07 JF949966 Aligned with Artemisia annua DQ006057 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GGGGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC GGGGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC

TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCCTGGAGAAGAGAATCAATATA ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCCTGGAGAAGAGAATCAATATA

TTTGCTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTG TTTGCTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTG

GTTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG GTTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG

GTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCT GTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCT

GCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA GCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA

ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTTTAAATCACAAGCTGAAACAGGTGAAATCAAAG ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTTTAAATCACAAGCTGAAACAGGTGAAATCAAAG

Asteraceae Artemisia capillaris P6842 / 08 JF949967 Aligned with Artemisia annua DQ006057 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbc L) gene TGGGGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAA TGGGGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAA

CTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG CTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCCTGGAGAAGAGAATCAATATA ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCCTGGAGAAGAGAATCAATATA

TTTGCTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTG TTTGCTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTG

GTTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG GTTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG

GTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC GTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCT

GCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA GCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA

ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTTTAAATCACAAGCTGAAACAGGTGAAATCAAAG ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTTTAAATCACAAGCTGAAACAGGTGAAATCAAAG

GGCA GGCA

185

Asteraceae Arctium lappa P6839 / 05 JF949994 Aligned with Arctium lappa GU724233 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATCAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATCAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC

TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAGGGGCGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAGTCAATTTA ACCGATGGACTTACGAGCCTTGATCGTTACAAGGGGCGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAGTCAATTTA

TTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG TTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG

GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG

GCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATC GCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATC

CGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCC CGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCC

AACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAA AACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAA

GGGCATTACTTGAAT GGGCATTACTTGAAT

Asteraceae Chrysanthemum indicum P6851 / 17 JF949971 Aligned with Chrysanthemum lavandulifolium GQ436485 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGG TATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGG

AGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGACTT AGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTT

ACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCTTGGAGAAGAGAATCAATATATTTGCTATGTAGC ACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCTTGGAGAAGAGAATCAATATATTTGCTATGTAGC

TTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCT TTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCT

GCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACCGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTG GCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTG

AAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTAC AAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTAC

GGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAAAACGTGAACTCCCAACCGTTTATG GGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATG

Asteraceae Chrysanthemum morifolium P6852 / 18 JF949972 Aligned with Chrysanthemum lavandulifolium GQ436485 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGG TATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGG

AGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTT AGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTT

ACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCTTGGAGAAGAGAATCAATATATTTGCTATGTAGC ACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCTTGGAGAAGAGAATCAATATATTTGCTATGTAGC

186

TTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCT TTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCT

GCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTG GCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTG

AAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTAC AAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTAC

GGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATG GGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATG

Asteraceae Eclipta prostrata P6863 / 29 JF950000 Aligned with Eclipta prostrata GQ436455 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC

TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGG TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGCCGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAATCAATATA ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGCCGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAATCAATATA

TTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG TTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG

GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATATTAAAACTTTCGAGGGTCCGCCTCACG GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATATTAAAACTTTCGAGGGTCCGCCTCACG

GTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC GTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC

GCTAAAAACTACGGTAGAGCTTGTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA GCTAAAAACTACGGTAGAGCTTGTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA

ACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCTATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAG ACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCTATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAG

Asteraceae Senecio scandens P6905 / 71 JF949989 Aligned with Senecio scandens GQ436472 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC

TCCTCAACCAGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG TCCTCAACCAGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATCGAGCCTGTTCTTGGAGAAGAAAATCAATTTAT ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATCGAGCCTGTTCTTGGAGAAGAAAATCAATTTAT

TGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG TGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG

GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG

GCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAAATTGGGGCTATCC GCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAAATTGGGGCTATCC

GCTAAAAACTACGGTAGAGCTGTTTATGAGTGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAAAACGTGAACTCCCA GCTAAAAACTACGGTAGAGCTGTTTATGAGTGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAAAACGTGAACTCCCA

ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAAGCTGAAACAGGTGAAATCAAAG ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAAGCTGAAACAGGTGAAATCAAAG

GGCATTACTTGAAT GGCATTACTTGAAT

187

Asteraceae Siegesbeckia orientalis P6906 / 72 JF949990 Aligned with Siegesbeckia orientalis GQ436447 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAAC

TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGG TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGCCGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAATCAATTTAT ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGCCGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAATCAATTTAT

TGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG TGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG

GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCGATGGTCCGCCTCACG GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCGATGGTCCGCCTCACG

GTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC GTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC

GCTAAAAACTACGGTAGAGCTTGTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA GCTAAAAACTACGGTAGAGCTTGTTATGAATGTCTTCGTGGTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCA

ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAG ACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAG

GGCATTACTTGAAT GGCATTACTTGAAT

Asteraceae Taraxacum officinale P6908 / 74 JF950019 Aligned with Taraxacum officinale AY395562 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATTTTGGCAGCATTTCGAGTAAC GGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATTTTGGCAGCATTTCGAGTAAC

TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG TCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGG

ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCCTGGAGAAGAAAGTCAATTTAT ACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGATGCTATGGAATTGAGCCTGTTCCTGGAGAAGAAAGTCAATTTAT

TGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG TGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGG

GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTGTTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG GTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATCCCTGTTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACG

GCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC GCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCC

GCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTT GCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGCCTTGATTTT

Berberidaceae Berberis bealei P6883 / 49 JF949996 Aligned with Berberis bealei FJ449858 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AATTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACC AATTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACC

GGAAGAAGCAGGGGCCGCTGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGTCTT GGAAGAAGCAGGGGCCGCTGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGTCTT

GATCGTTACAAAGGACGATGCTACGACATTGAGCCCGTTGCTGGAGAAGACAATCAATATATTTGTTATGTAGCCTATCCTTT GATCGTTACAAAGGACGATGCTACGACATTGAGCCCGTTGCTGGAGAAGACAATCAATATATTTGTTATGTAGCCTATCCTTT

188

AGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACCTCTATTGTGGGTAATGTTTTTGGGTTCAAAGCGCTGCGCGCTCT AGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACCTCTATTGTGGGTAATGTTTTTGGGTTCAAAGCGCTGCGCGCTCT

ACGTCTGGAGGATCTGCGAATTCCTACTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATA ACGTCTGGAGGATCTGCGAATTCCTACTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATA

AATTGAACAAGTATGGTCGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGATTATCCGCTAAGAACTATGGTAGAGCG AATTGAACAAGTATGGTCGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGATTATCCGCTAAGAACTATGGTAGAGCG

GTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGCGCGA GTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGCGCGA

CCGTTTCCTATTTTGTGCCGAAGCACTTTTTAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACATTACTTAAATGCTACT CCGTTTCCTATTTTGTGCCGAAGCACTTTTTAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACATTACTTAAATGCTACT

Berberidaceae Epimedium koreanum P6865 / 31 JF950002 Aligned with Epimedium koreanum L75869 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TACAAATTGACTTATTATACTCCTGACTATGTAACGAAGGATACTGATATCTTGGCAGCATTCCGCGTCACTCCTCAACCTGG TACAAATTGACTTATTATACTCCTGACTATGTAACGAAGGATACTGATATCTTGGCAGCATTCCGCGTCACTCCTCAACCTGG

AGTTCCACCTGAAGAAGCAGGGGCCGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACNGTGTGGACCGATGGACTT AGTTCCACCTGAAGAAGCAGGGGCCGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACNGTGTGGACCGATGGACTT

ACCAGTCTTGATCGTTACAAAGGACGRTGCTACCACATTGAGCCTGTTGCTGGAGAAGACAATCAATATATTTGTTACGTAGC ACCAGTCTTGATCGTTACAAAGGACGRTGCTACCACATTGAGCCTGTTGCTGGAGAAGACAATCAATATATTTGTTACGTAGC

CTATCCTTTAGACCTTTTTNAAGAGGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTCAAAGCGCT CTATCCTTTAGACCTTTTTNAAGAGGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTCAAAGCGCT

GCGCGCTCTACGTCTGGAGGATCTGCGAATTCCTCTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGNATCCAAGTTG GCGCGCTCTACGTCTGGAGGATCTGCGAATTCCTCTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGNATCCAAGTTG

AGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTATCCGCTAAGAACTAT AGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTATCCGCTAAGAACTAT

GGTAGAGCGGTTTATGAATGTCTCCGCGGTGGRCTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAGCCATTTATGCG GGTAGAGCGGTTTATGAATGTCTCCGCGGTGGRCTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAGCCATTTATGCG

TTGGAGAGANCGTTTCCTATTTTGTGCCGAAGCTATTTATAAATCACAGGCGGAAACAGGTGAAATCAAAGGACATTACTTGA TTGGAGAGANCGTTTCCTATTTTGTGCCGAAGCTATTTATAAATCACAGGCGGAAACAGGTGAAATCAAAGGACATTACTTGA

ATGCTACT ATGCTACT

Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 Aligned with Capsella bursa-pastoris FN594844 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGG TATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGG

AGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTT AGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTT

ACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGC ACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGC

TTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACTTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCT TTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACTTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCT

GGCTGCCCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAAGGACCACCTCATGGTATCCAAGTTG GGCTGCCCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAAGGACCACCTCATGGTATCCAAGTTG

AAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTA AAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTA

TGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCATTTATGC TGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCATTTATGC

189

GTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCATTATTTG GTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCATTATTTG

AATGCTACTGC AATGCTACTGC

Brassicaceae Isatis indigotica P6877, P6878 JF949981 Aligned with Isatis pachycarpa FN594830 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGG TATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGG

AGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTT AGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTT

ACCAGCCTTGATCGTTACAAAGGAAGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAG ACCAGCCTTGATCGTTACAAAGGAAGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCATATGTAG

CTTACCCCTTAGACCTTTTTGAAGAAGGGTCGGTTACTAACATGTTTACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCC CTTACCCCTTAGACCTTTTTGAAGAAGGGTCGGTTACTAACATGTTTACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCC

TGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTG TGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTG

AAAGAGATAAATTGAACAAGTACGGACGTCCCCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCGAAGAATTA AAAGAGATAAATTGAACAAGTACGGACGTCCCCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCGAAGAATTA

TGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCATTTATGC TGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCATTTATGC

GTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCATTATTTG GTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCATTATTTG

AATGCTACTGC AATGCTACTGC

Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 Aligned with Lonicera confusa HM228484 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTT AGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTT

GGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCGGGGGCCGCGGTAGCTGCTGAATCTTCAACCGGT GGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCGGGGGCCGCGGTAGCTGCTGAATCTTCAACCGGT

ACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTG ACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTG

GAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTA GAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTA

TTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTCTCTTATGTTAAAACTT TTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTCTCTTATGTTAAAACTT

TCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGCCCCCTGTTGGGATGTACTATTAA TCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGCCCCCTGTTGGGATGTACTATTAA

ACCTAAATTGGGGTTATCTGCTAAAAACTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATG ACCTAAATTGGGGTTATCTGCTAAAAACTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATG

ATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGTT ATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGTT

GAAACAGGTGAAATCAAAGGGCATTACTTGAAT GAAACAGGTGAAATCAAAGGGCATTACTTGAAT

190

Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 Aligned with Polygonatum humile AB009947 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGCTACTGATATCTTGGCAGCATTCCGAG AGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGCTACTGATATCTTGGCAGCATTCCGAG

TAACTCCTCAACCCGGAGTTCCCGCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCCTCTACTGGTACATGGACAACTGT TAACTCCTCAACCCGGAGTTCCCGCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCCTCTACTGGTACATGGACAACTGT

GTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGGCCGTTATTGGGGAAGAAAATCAA GTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGGCCGTTATTGGGGAAGAAAATCAA

TATATTTGTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTAT TATATTTGTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTAT

TTGGTTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCCCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTC TTGGTTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCCCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTC

ATGGCATTCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTA ATGGCATTCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTA

TCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAGGATGATGAA TCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAGGATGATGAA

Cupressaceae Platycladus orientalis P6891 / 57 JF950011 Aligned with Platycladus orientalis HM024345 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCG TTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCG

AAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGA AAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGA

TCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAG TCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAG

ATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTAC ATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTAC

GTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGGGATAAA GTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGGGATAAA

TTAAATAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGT TTAAATAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGT

TTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATC TTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATC

GTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGC GTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGC

Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 Aligned with Cyrtomium fortunei AF537227 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene ATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCT ATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCT

GCGGTAGCTGCGGAATCCTCAACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCC GCGGTAGCTGCGGAATCCTCAACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCC

GATGCTACGATATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAA GATGCTACGATATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAA

GGTTCCGTCACTAATTTGTTTACCTCTATCGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTT GGTTCCGTCACTAATTTGTTTACCTCTATCGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTT

191

CGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGG CGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGG

ACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTC ACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTC

GCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTA GCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTA

GCAGAAGCTCTCTTCAAATCCCAGGCTGAAACAGGAGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTAC GCAGAAGCTCTCTTCAAATCCCAGGCTGAAACAGGAGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTAC

Ephedraceae Ephedra sinica P6864 / 30 JF950001 Aligned with Ephedra sinica AY492046 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GATTATAGATTAACTTATTATACTCCAGAGTATCAGACTAAGAACACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACC GATTATAGATTAACTTATTATACTCCAGAGTATCAGACTAAGAACACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACC

CGGAGTACCGGCCGAGGAAGCAGGCGCAGCGGTAGCTGCTGAATCTTCTACAGGTACATGGACCACAGTTTGGACTGATGGT CGGAGTACCGGCCGAGGAAGCAGGCGCAGCGGTAGCTGCTGAATCTTCTACAGGTACATGGACCACAGTTTGGACTGATGGT

CTTACTAGTCTTGATCGTTACAAAGGACGATGCTATGATATCGAACCTGTTCCGGGAGAAGACAATCAATTTATTGCTTATGT CTTACTAGTCTTGATCGTTACAAAGGACGATGCTATGATATCGAACCTGTTCCGGGAGAAGACAATCAATTTATTGCTTATGT

AGCATATCCTTTGGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGGAATGTTTTTGGTTTTAAAGCT AGCATATCCTTTGGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGGAATGTTTTTGGTTTTAAAGCT

CTACGAGCTCTACGCCTAGAAGATTTGCGAATTCCTACTGCTTATATCAAAACATTTCAAGGTCCACCTCATGGGATCCAAGT CTACGAGCTCTACGCCTAGAAGATTTGCGAATTCCTACTGCTTATATCAAAACATTTCAAGGTCCACCTCATGGGATCCAAGT

AGAAAGAGATAAATTAAACAAATACGGACGTCCTTTGTTGGGATGTACCATCAAACCTAAATTAGGTCTATCTGCTAAAAATT AGAAAGAGATAAATTAAACAAATACGGACGTCCTTTGTTGGGATGTACCATCAAACCTAAATTAGGTCTATCTGCTAAAAATT

ACGGTAGAGCAGTTTATGAATGTCTTCGTGGCGGACTAGATTTTACTAAAGATGATGAAAATGTAAATTCTCAACCCTTTATG ACGGTAGAGCAGTTTATGAATGTCTTCGTGGCGGACTAGATTTTACTAAAGATGATGAAAATGTAAATTCTCAACCCTTTATG

CGTTGGAGAGATCGCTTTGTTTTTTGCGCGGAAGCTATTTATAAAGCTCAAGCTGAAACAGGTGAAATTAAGGGACATTACTT CGTTGGAGAGATCGCTTTGTTTTTTGCGCGGAAGCTATTTATAAAGCTCAAGCTGAAACAGGTGAAATTAAGGGACATTACTT

AAATGCTACTGC AAATGCTACTGC

Equisetaceae Equisetum hyemale P6866 / 32 JF950003 Aligned with Equisetum hyemale AB574685 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TTTACTCCAGATTATGAAACCAAAGATACCGATATTTTAGCAGCATTTCGTATGACTCCGCAGCCGGGGGTACCACCGGAAGA TTTACTCCAGATTATGAAACCAAAGATACCGATATTTTAGCAGCATTTCGTATGACTCCGCAGCCGGGGGTACCACCGGAAGA

AGCAGGAGCAGCTGTAGCTGCTGAATCCTCCACGGGCACCTGGACTACCGTATGGACAGATGGACTTACTAGTCTTGATCGAT AGCAGGAGCAGCTGTAGCTGCTGAATCCTCCACGGGCACCTGGACTACCGTATGGACAGATGGACTTACTAGTCTTGATCGAT

ATAAAGGTCGCTGCTATAATATTGAGCCTGTTGCTGGAGAAGATAACCAATTCATAGCTTATGTAGCCTATCCTTTAGATCTTT ATAAAGGTCGCTGCTATAATATTGAGCCTGTTGCTGGAGAAGATAACCAATTCATAGCTTATGTAGCCTATCCTTTAGATCTTT

TTGAAGAAGGTTCTGTTACCAATCTGTTTACTTCAATTGTTGGTAATGTTTTCGGCTTCAAAGCTCTACGTGCTTTACGTTTAG TTGAAGAAGGTTCTGTTACCAATCTGTTTACTTCAATTGTTGGTAATGTTTTCGGCTTCAAAGCTCTACGTGCTTTACGTTTAG

AAGATTTACGAATTCCTCCTGCTTATTCTAAAACTTTTATAGGACCACCCCATGGTATCCAGGTTGAAAGAGATAAGTTAAAC AAGATTTACGAATTCCTCCTGCTTATTCTAAAACTTTTATAGGACCACCCCATGGTATCCAGGTTGAAAGAGATAAGTTAAAC

AAATATGGTCGTCCGTTATTAGGTTGTACAATTAAACCAAAATTGGGACTTTCTGCTAAAAACTATGGTAGAGCTGTTTATGA AAATATGGTCGTCCGTTATTAGGTTGTACAATTAAACCAAAGTTGGGACTTTCTGCTAAAAACTATGGTAGAGCTGTTTATGA

ATGTCTTCGTGGTGGACTTGACTTCACCAAAGATGATGAGAATGTAAACTCTCAACCTTTTATGCGTTGGA ATGTCTTCGTGGTGGACTTGACTTCACCAAAGATGATGAGAATGTAAACTCTCAACCTTTTATGCGTTGGA

192

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 Aligned with Abrus precatorius U74224 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGAATTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGAATTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC

AGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGTGCCGCGGTAGCTGCCGAATCTTCTACTGGTACAT AGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGTGCCGCGGTAGCTGCCGAATCTTCTACAGGTACAT

GGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGA GGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGA

AGAAAATCAATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT AGAAAATCAATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT

AGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTTTGGAGGATTTGCGAATCCCTACTTCTTATATTAAAACTTTCCA AGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTTTGGAGGATTTGCGAATCCCTACTTCTTATATTAAAACTTTCCA

AGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCGA AGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTATTGGGATGTACTATTAAACCTA

AATTGGGATTATCCGCTAAGAATTACGGTAGAGCGGTTTATGAATGTCTCCGCGGGGGGCTTGATTTTACCAAAGATGATGAA AATTGGGATTATCCGCTAAGAATTACGGTAGAGCGGTTTATGAATGTCTCCGCGGGGGGCTTGATTTTACCAAAGATGATGAA

AATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAAC AATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGACTGAAAC

GGGTGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACATGCGAA GGGTGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACATGCGAA

Fabaceae Cassia tora P6847 / 13 JF949969 Aligned with Cassia grandis AM234244 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC

AGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGTGCCGCGGTAGCTGCTGAATCTTCTACTGGTACAT AGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGTGCCGCGGTAGCTGCTGAATCTTCTACTGGTACAT

GGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGA GGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGA

AGAAAATCAATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT AGAAAATCAATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT

GGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACTTCTTATACTAAAACTTTCCA GGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTATTTCTTATATTAAAACTTTCCA

AGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACTATTAAACCT AGGTCCGCCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTATTGGGATGTACTATTAAACCT

AAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGA AAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGA

GAATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAGGCCGAAA GAATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTGCTTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAA

CAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGG CAGGTGAAATCAAAGGGCATTACTTGAATGCTACGGCAGG

Fabaceae Desmodium styracifolium P6861 / 27 JF949976 Aligned with Desmodium styracifolium GQ436338 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATCAAACCAAAGATACTGATATCTTGGC GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATCAAACCAAAGATACTGATATCTTGGC

193

AGCCTTCCGAGTAACTCCTCAACCGGGAGTTCCACCTGAAGAAGCAGGTGCTGCGGTAGCTGCGGAATCTTCTACTGGTACAT AGCCTTCCGAGTAACTCCTCAACCGGGAGTTCCACCTGAAGAAGCAGGTGCTGCGGTAGCTGCGGAATCTTCTACTGGTACAT

GGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACGGCCTCGAACCTGTTGCTGGAGA GGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACGGCCTCGAACCTGTTGCTGGAGA

AGAAAATCAATATATTGCTTATGTAGCGTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT AGAAAATCAATATATTGCTTATGTAGCGTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT

CGGTAATGTATTTGGGTTCAAGGCACTGCGCGCCCTACGTCTGGAGGATTTGCGAATCCCTAAGGCTTATATTAAAACTTTTG CGGTAATGTATTTGGGTTCAAGGCACTGCGCGCCCTACGTCTGGAGGATTTGCGAATCCCTAAGGCTTATATTAAAACTTTTG

AAGGTCCACCTCATGGCATCCAAGTTGAAGAGAGATAAATTGAACAAGTATGGCCGTCCTCTATTAGGATGTACTATTAAACT AAGGTCCACCTCATGGCATCCAAGTTGAAGAGAGATAAATTGAACAAGTATGGCCGTCCTCTATTAGGATGTACTATTAAACT

AAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTACGAATGTCTTCGTGGGGGACTTGATTTTACCAAAGATGATGA AAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTACGAATGTCTTCGTGGGGGACTTGATTTTACCAAAGATGATGA

AAATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAGGCTGAAA AAATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAGGCTGAAA

CAGGTGAAATCAAAGGGCATTACTTGAAT CAGGTGAAATCAAAGGGCATTACTTGAAT

Fabaceae Glycyrrhiza inflata P6873 / 39 JF950025 Aligned with Glycyrrhiza inflata AB012127 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGC GTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGC

AGCATTCCGAGTAACTCCTCAACCAGGAGTTCCGCCGGAAGAAGCAGGTGCAGCGGTAGCAGCCGAATCTTCCACTGGGACA AGCATTCCGAGTAACTCCTCAACCAGGAGTTCCGCCGGAAGAAGCAGGTGCAGCGGTAGCAGCCGAATCTTCCACTGGGACA

TGGACAACTGTGTGGACCGATGGTCTTACCAGTCTTGATCGTTATAAAGGACGATGCTACGGGCTAGAGCCCGTTGCTGGAGA TGGACAACTGTGTGGACCGATGGTCTTACCAGTCTTGATCGTTATAAAGGACGATGCTACGGGCTAGAGCCCGTTGCTGGAGA

AGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTGT AGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTGT

AGGTAATGTATTTGGTTTCAAGGCCTTGCGCGCTCTACGTCTTGAGGATTTGCGAATTCCTGTTTCTTACATTAAAACTTTCCA AGGTAATGTATTTGGTTTCAAGGCCTTGCGCGCTCTACGTCTTGAGGATTTGCGAATTCCTGTTTCTTACATTAAAACTTTCCA

AGGTCCGCCTCACGGAATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGCCCTCTATTGGGATGTACTATTAAACCT AGGTCCGCCTCACGGAATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGCCCTCTATTGGGATGTACTATTAAACCT

AAATTGGGGTTATCTGCTAAGAATTATGGTAGAGCAGTTTATGAATGTCTTCGCGGGGGACTTGATTTTACCAAAGATGATGA AAATTGGGGTTATCTGCTAAGAATTATGGTAGAGCAGTTTATGAATGTCTTCGCGGGGGACTTGATTTTACCAAAGATGATGA

AAATGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAA AAATGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAA

CTGGTGAAATCAAAGGGCATTATTTGAATGCTAC CTGGTGAAATCAAAGGGCATTATTTGAATGCTAC

Fabaceae Spatholobus suberectus P6907 / 73 JF949991 Aligned with Spatholobus parviflorus AB045825 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene ATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGTGCCGC ATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGTGCCGC

GGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGAT GGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGAT

GCTATCACATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTT GCTATAACATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTT

CTGTTACTAACATGTTTACTTCCATTGTCGGTAATGTATTTGGGTTCAAGGCCCTTCGCGCTCTACGTCTGGAGGATTTGCGAA CTGTTACTAACATGTTTACTTCCATTGTCGGTAATGTATTTGGGTTCAAGGCACTACGCGCTCTACGTCTGGAGGATTTGCGAA

194

TCCCTATTTCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGT TCCCTATTTCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGT

CCCCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTTCGTGG CCCCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTTCGTGG

GGGACTTGATTTTACCAAAGATGATGAAAATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCG GGGACTTGATTTTACCAAAGATGATGAAAATGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCG

AAGCGCTTTATAAAGCACAGGCTGAA ATGCGCTTTATAAAGCACAGGCTGAA

Geraniaceae Geranium wilfordii P6867 / 33 JF949977 Aligned with Geranium grandiflorum L01920 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TAGTGTTGGATTTAAAGCGGGTGTTAAAGACTATAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATACTGATATCT TAGTGTTGGATTTAAAGCGGGTGTTAAAGACTATAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATACTGATATCT

TGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCGGGGGCCGCGGTAGCTGCTGAATCTTCTACCGG TGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCAGGGGGCGCGGTAGCTGCTGAATCTTCTACCGG

TACATGGACAACCGTGTGGACCGATGGGCTTACTAGTCTGGATCGTTACAAAGGACGCTGCTATCACATCGAGCCCGTTGCTG TACATGGACAACCGTGTGGACCGATGGGCTTACTAGTCTGGATCGTTACAAAGGACGCTGCTATCACATCGAGCCCGTTGCTG

GAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACTAATATGTTTACTTCCA GAGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACTAATATGTTTACTTCCA

TCGTGGGTAATGTATTTGGGTTCAAAGCCCTTCGCGCTCTGCGTCTGGAGGATCTGCGAATCCCTCCTGCTTATGTGAAAACTT TCGTGGGTAATGTATTTGGGTTCAAAGCCCTTCGCGCTTTGCGTCTGGAGGATCTGCGAATCCCTCCTGCTTATGTGAAAACTT

TCCAGGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTATTGGGATGTACTATTAA TCCAGGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTATTGGGATGTACTATTAA

ACCGAAATTGGGATTGTCCGCTAAGAACTACGGTCGAGCGGTTTTTGAATGTCTTCGCGGTGGACTTGATTTTACTAAAGATG ACCGAAATTGGGATTGTCCGCTAAGAACTACGGTCGAGCAGTTTTTGAATGTCTTCGCGGTGGACTTGATTTTACTAAAGATG

ATGAGAACGTGAACTCCCAACCGTTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCGCTTTATAAAGCACAGGCC ATGAGAACGTGAACTCTCAACCGTTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCT

GAAACAGGTGAAATCAAGGGGCATTACTTGAATGCTACTGCAGG GAAACAGGTGAAATCAAGGGGCATTACTTGAATGCTACTGCAGG

Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 Aligned with Ginkgo biloba DQ069500 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene ATTACAGATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCT ATTACAGATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCT

GGAGTGCCACCTGAGGAAGCGGGAGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGAC GGAGTGCCACCTGAGGAAGCGGGAGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGAC

TTACCAGTCTTGATCGTTACAAGGGAAGATGCTATGACATCGAGCCCGTTCCTGGGGAGGAAAATCAATTTATTGCCTATGTA TTACCAGTCTTGATCGTTACAAGGGAAGATGCTATGACATCGAGCCCGTTCCTGGGGAGGAAAATCAATTTATTGCCTATGTA

GCTTACCCTTTGGATCTTTTCGAGGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGGAATGTATTTGGATTCAAAGCC GCTTACCCTTTGGATCTTTTCGAGGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGGAATGTATTTGGATTCAAAGCC

CTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAGGGTCCACCTCATGGTATCCAAGTT CTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAGGGTCCACCTCATGGTATCCAAGTT

GAAAGGGATAAATTGAATAAATATGGCCGTCCCCTATTGGGATGTACTATCAAGCCAAAATTGGGTTTATCTGCCAAAAATTA GAAAGGGATAAATTGAATAAATATGGCCGTCCCCTATTGGGATGTACTATCAAGCCAAAATTGGGTTTATCTGCCAAAAATTA

TGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGATGAGAACGTAAATTCCCAACCATTCATGC TGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGATGAGAACGTAAATTCCCAACCATTCATGC

GCTGGAGAGATCGTTTCTTGTTTTGTGCAGAAGCAATTTATAAAGCTCAGACCGAGACGGGTGAAATTAAGGGACATT GCTGGAGAGATCGTTTCTTGTTTTGTGCAGAAGCAATTTATAAAGCTCAGACCGAGACGGGTGAAATTAAGGGACATT

195

Hypericaceae Hypericum japonicum P6876 / 42 JF949980 Aligned with Hypericum japonicum GQ436683 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GTTGGATTCAAGGCCGGCGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGC GTTGGATTCAAGGCCGGCGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGC

AGCATTTCGAGTAACTCCTCAACCTGGGGTTCCCCCGGAGGAAGCAGGAGCAGCGGTAGCTGCGGAATCTTCTACTGGTACCT AGCATTTCGAGTAACTCCTCAACCTGGGGTTCCCCCGGAGGAAGCAGGAGCAGCGGTAGCTGCGGAATCTTCTACTGGTACCT

GGACAACTGTCTGGACGGATGGACTGACAAGTCTTGATCGTTATAAAGGACGATGCTACCACATTGAGCCTGTTGCTGGAGA GGACAACTGTCTGGACGGATGGACTGACAAGTCTTGATCGTTATAAAGGACGATGCTACCACATTGAGCCTGTTGCTGGAGA

GGAAAATCAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT GGAAAATCAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT

AGGGAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGCTTGGAGGATTTGCGAATCCCTACTGCTTATACGAAAACTTTCC AGGGAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGCTTGGAGGATTTGCGAATCCCTACTGCTTATACGAAAACTTTCC

AAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGCCCGCTATTAGGTTGTACTATTAAACCT AAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGCCCGCTATTAGGTTGTACTATTAAACCT

AAATTGGGGTTATCCGCTAAGAATTACGGTCGAGCAGTTTATGAATGTCTGCGTGGTGGGCTTGATTTTACCAAAGATGATGA AAATTGGGGTTATCCGCTAAGAATTACGGTCGAGCAGTTTATGAATGTCTGCGTGGTGGGCTTGATTTTACCAAAGATGATGA

GAACGTGAACTCCCAACCATTTAT GAACGTGAACTCCCAACCATTTAT

Iridaceae Belamcanda chinensis P6843 / 09 JF949995 Aligned with Belamcanda chinensis AJ309694 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTG TAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTG

ATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCTGCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCT ATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCTGCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCT

ACTGGTACATGGACAACAGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCCG ACTGGTACATGGACAACAGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCCG

TTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTA TTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTA

CTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCA CTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCA

AAACTTTCCAAGGCCCGCCTCATGGCATCCAGGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACT AAACTTTCCAAGGCCCGCCTCATGGCATCCAGGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACT

ATTAAACCTAAATTGGGATTATCCGCAAAAAACTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAA ATTAAACCTAAATTGGGATTATCCGCAAAAAACTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAA

GGATGATGAAAACGTGAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCGTATTTTGCGCTGAAGCAATTTATAAAGCGC GGATGATGAAAACGTGAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCGTATTTTGCGCTGAAGCAATTTATAAAGCGC

AAGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGC AAGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGC

Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 Aligned with Mentha longifolia AY570390 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATT TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATT

CCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACA CCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACA

196

ACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTCCTGGAGAAAAAG ACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTCCTGGAGAAAAAG

ATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAA ATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAA

ATGTATTTGGATTCAAAGCCCTACGTGCTCTACGTCTGGAAGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCC GTGTATTTGGATTCAAAGCCCTACGTGCTCTACGTCTGGAAGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCC

CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGCTGGGATGTACTATTAAACCTAAATTG CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGCTGGGATGTACTATTAAACCTAAATTG

GGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGT GGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGT

GAACTCCCAGCCATTTATGCGTTGGAGAGACCGCT GAACTCCCAGCCATTTATGCGTTGGAGAGACCGCT

Lamiaceae Prunella vulgaris P6896 / 62 JF950013 Aligned with Prunella vulgaris AY395556 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATT TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATT

CCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACA CCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACA

ACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTCCTGGAGAAAAAG ACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTCCTGGAGAAAAAG

ATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAA ATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAA

ATGTATTTGGATTCAAAGCCCTACGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGCC ATGTATTTGGATTCAAAGCCCTACGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGCC

CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGCTGGGATGTACTATTAAACCTAAATTG CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGCTGGGATGTACTATTAAACCTAAATTG

GGATTATCTGCTAAAAACTATGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGT GGATTATCTGCTAAAAACTATGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGT

GAACTCCCAGCCATTTATGCGTTGGAGAGACCGCT GAACTCCCAGCCATTTATGCGTTGGAGAGACCGCT

Lamiaceae Scutellaria baicalensis P6903 / 69 JF950017 Aligned with Scutellaria baicalensis FJ513152 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACCCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATT TTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACCCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATT

CCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACA CCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACA

ACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTATTGGAGAAAAAG ACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTATTGGAGAAAAAG

ATCAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAA ATCAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAA

ATGTATTTGGATTCAAAGCCCTACGTGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGCC ATGTATTTGGATTCAAAGCCCTACGTGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGCC

CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCAAAATTG CGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCAAAATTG

GGGTTATCTGCTAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGT GGGTTATCTGCTAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGT

197

GAACTCCCAGCCATTTATGCGTTGGAGAGATCGCT GAACTCCCAGCCATTTATGCGTTGGAGAGATCGCT

Lauraceae Cinnamomum cassia P6853 / 19 JF950023 Aligned with Cinnamomum aromaticum HM019459 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCAGGGG GACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCAGGGG

CTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGA CTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGA

CGATGCTACCACATCGAGCCCGTTCCTGGGGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGA CGATGCTACCACATCGAGCCCGTTCCTGGGGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGA

AGGTTCTGTTACGAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTCAAAGCTCTACGAGCTCTACGTCTGGAGGATCT AGGTTCTGTTACGAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTCAAAGCTCTACGAGCTCTACGTCTGGAGGATCT

GCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATG GCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATG

GTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAGAACTACGGTAGAGCGGTTTATGAATGTCT GTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAGAACTACGGTAGAGCGGTTTATGAATGTCT

Loranthaceae Taxillus chinensis P6909 / 75 JF949992 Aligned with Atkinsonia ligustrina EF464526 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GAGTACAAATTGACTTATTATACTCCTGATTATGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACC GAGTACAAATTGACTTATTATACTCCTGATTATGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACC

TGGAGTTCCACCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGA TGGAGTTCCACCCGAGGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGA

CTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTATGT CTTACTAGCCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTATGT

AGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGC AGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGC

CCTACGTGCTCTACGTCTGGAGGATCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGT CCTACGTGCTCTACGTCTGGAGGATCTTCGAATCCCCCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGT

TGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACT TGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAACT

ACGGTCGAGCGGTTTATGAGTGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATG ACGGTCGAGCGGTTTATGAGTGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATG

CGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCCGAAACTGGCGAAATCAAAGGGCATTATTT CGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCCGAAACTGGCGAAATCAAAGGGCATTATTT

GAATGCTACTGCAG GAATGCTACTGCAG

Lythraceae Punica granatum P6897 / 63 JF950014 Aligned with Punica granatum GQ436656 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGAATATGAAACCAAAGATACTG TAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGAATATGAAACCAAAGATACTG

ATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCTGCAGTAGCCGCTGAATCTTCT ATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCTGCAGTAGCCGCTGAATCTTCT

ACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGT ACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGT

198

TGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTAC TGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTAC

TTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAGGATCTGAGAATCCCTACTGCATATACTA TTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAGGATCTGAGAATCCCTACTGCATATACTA

AAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACT AAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACT

ATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACGAA ATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACGAA

GGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCAC GGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCAC

AGGCTGAAACTGGTGAAATCAAGGGGCATTACTTGAAT AGGCTGAAACTGGTGAAATCAAGGGGCATTACTTGAAT

Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 Aligned with Magnolia officinalis AY008933 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCC TTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCC

ACCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGC ACCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGC

CTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCC CTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCC

TTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTACGAGC TTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTACGAGC

TCTACGTCTGGAGGATCTGCGAATTCCTACTGCTTATGTCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAG TCTACGTCTGGAGGATCTGCGAATTCCTACTGCTTATGTCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAG

ATAAATTGAACAAGTATGGTCGTCCACTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAGAACTACGGTAG ATAAATTGAACAAGTATGGTCGTCCACTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAGAACTACGGTAG

GGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGA GGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGA

GAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCT GAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCT

ACTGCAGGTACATG ACTGCAGGTACATG

Melanthiaceae Paris polyphylla P6888 / 54 JF950010 Aligned with Paris polyphylla D28155 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTACACACCCAAAGATACTGATATCTTGG TGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTACACACCCAAAGATACTGATATCTTGG

CAGCATTCCGAGTAGCTCCTCAACCCGGAGTTCCGGCTGAAGAAGCGGGCGCTGCGGTAGCAGCCGAATCTTCTACTGGTAC CAGCATTCCGAGTAGCTCCTCAACCCGGAGTTCCGGCTGAAGAAGCGGGCGCTGCGGTAGCAGCCGAATCTTCTACTGGTAC

ATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCAGATCGAGAGCGTTGCTGGG ATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCAGATCGAGAGCGTTGCTGGG

GAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATT GAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATT

GTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTT GTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTT

CAAGGCCCGCCCCATGGTATCCAGGTTGAAAGAGATAAATTGAACAAATACGGTCGTCCCCTATTGGGATGTACAATTAAAC CAAGGCCCGCCCCATGGTATCCAGGTTGAAAGAGATAAATTGAACAAATACGGTCGTCCCCTATTGGGATGTACAATTAAAC

199

CAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCAGTTTATGAGTGTCTACGCGGTGGACTTGATTTTACTAAGGATGAT CAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCAGTTTATGAGTGTCTACGCGGTGGACTTGATTTTACTAAGGATGAT

GAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAGGCGCAGGCCGA GAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAGGCGCAGGCCGA

AACGGGTGAAATCAAAGGGCATTACTTGAATGC AACGGGTGAAATCAAAGGGCATTACTTGAATGC

Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 Aligned with Lysimachia vulgaris AF421095 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGCAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCC GTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGTAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCC

TCAACCAGGAGTTCCGCCCGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACC TCAACCTGGAGTTCCGCCCGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACC

GATGGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACAACATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATTTG GATGGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACGGCATCGAGCCTGTTGCTGGAGAAGAAAATCAATTTATTGC

TTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTTGGTAATGTATTTGGGTTC TTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTC

AAAGCCCTGCGCGCTCTACGTCTGGAAGATCTTCGAATCCCGCCTGCGTATGTTAAAACTTTCCAAGGACCGCCTCATGGTAT AAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCGCCTGCGTATGTTAAAACTTTCCAAGGACCGCCTCATGGTAT

CCAAGTTGAAAGAGATAAATTGAATAAATATGGTCGTCCACTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTA CCAAGTTGAAAGAGATAAATTGAATAAATATGGTCGTCCACTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTA

AAAACTACGGTAGGGCTGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCA AAAACTACGGTAGGGCTGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCA

TTTATGCGTTGGCGAGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCTGAAACTGGTGAAATCAAAGGTCA TTTATGCGTTGGCGAGACCGTTTCGTATTTTGTGCCGAAGCTATTTATAAAGCACAGTCTGAAACTGGTGAAATCAAAGGTCA

TTACTTGAATGCTACTGCAG TTACTTGAATGCTACTGCAG

Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 Aligned with Ophioglossum vulgatum HQ676505 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GAGCTGCAGTAGCTGCTGAATCCTCCACGGGTACGTGGACTACCGTATGGACCGATGGGCTTACCAGTCTCGATCGTTACAAA GAGCTGCAGTAGCTGCTGAATCCTCCACGGGTACGTGGACTACCGTATGGACCGATGGGCTTACCAGTCTCGATCGTTACAAA

GGTCGATGCTATGAAATCGAACCTGTTGCTGGGGAGGAAGATCAATACATTGCTTATGTAGCGTATCCCTTAGACCTTTTTGA GGTCGATGCTATGAAATCGAACCTGTTGCTGGGGAGGAAGATCAATACATTGCTTATGTAGCGTATCCCTTAGACCTTTTTGA

AGAAGGTTCCGTCACCAACATGTTCACCTCCATTGTAGGTAACGTATTCGGATTCAAGGCATTGAAAGCTCTACGGTTGGAGG AGAAGGTTCCGTCACCAACATGTTCACCTCCATTGTAGGTAACGTATTCGGATTCAAGGCATTGAAAGCTCTACGGTTGGAGG

ATTTACGAATTCCTCCTGCTTATTCTAAGACTTTCATGGGCCCTCCCCACGGTATCCAAGTCGAAAGGGATAAATTAAACAAA ATTTACGAATTCCTCCTGCTTATTCTAAGACTTTCATGGGCCCTCCCCACGGTATCCAAGTCGAAAGGGATAAATTAAACAAA

TATGGTCGTCCCTTACTGGGGTGTACCATCAAACCCAAATTGGGATTATCTGCCAAGAATTATGGTAGAGCCGTTTATGAATG TATGGTCGTCCCTTACTGGGGTGTACCATCAAACCCAAATTGGGATTATCTGCCAAGAATTATGGTAGAGCCGTTTATGAATG

CTTACGCGGTGGGCTCGACTTCACCAAAGATGATGAAAACGTAAATTCTCAACCATTTATGCGTTGGAGAGATCGTTTCGTAT CTTACGCGGTGGGCTCGACTTCACCAAAGATGATGAAAACGTAAATTCTCAACCATTTATGCGTTGGAGAGATCGTTTCGTAT

TTGTGGCGGAAGCTCTTTTCAAATCTCAGGCGGAAACGGGAGAGATTAAGGGGCATTACTTAAATGCTAC TTGTGGCGGAAGCTCTTTTCAAATCTCAGGCGGAAACGGGAGAGATTAAGGGGCATTACTTAAATGCTAC

200

Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 Aligned with Dendrobium loddigesii FJ216573 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCA TTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCA

GCATTCCGAGTAACTCCTCAACCGGGAGTTCCGCCTGAAGAAGCGGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATG GCATTCCGAGTAACTCCTCAACCGGGAGTTCCGCCTGAAGAAGCGGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATG

GACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGTCGTTGTTGGGGAG GACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGTCGTTGTTGGGGAG

GAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTG GAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTG

GGTAATGTATTTGGTTTCAAAGCCCTGCGAGCTCTACGTCTGGAAGATCTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAA GGTAATGTATTTGGTTTCAAAGCCCTGCGAGCTCTACGTCTGGAAGATCTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAA

GGTCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAA GGTCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAA

ATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGGGGTGGACTTGATTTTACTAAGGATGATGAA ATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGGGGTGGACTTGATTTTACTAAGGATGATGAA

AACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATCTTTAAAGCGCAAGCCGAAAC AACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATCTTTAAAGCGCAAGCCGAAAC

GGGTGAAATTAAAGG GGGTGAAATTAAAGG

Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 Aligned with Paeonia lactiflora GQ436534 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TATTATACTCCTGACTATAAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCGGA TATTATACTCCTGACTATAAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCGGA

GGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACGGGTACTTGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGAT GGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACGGGTACTTGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGAT

CGTTACAAAGGACGATGCTATCACATTGAGCCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCCTACCCACTCGA CGTTACAAAGGACGATGCTATCACATTGAGCCTGTTGCTGGAGAAGAAACTCAATTTATTGCTTATGTAGCCTACCCACTCGA

CCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCTTGCGCGCCCTACG CCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCTTGCGCGCCCTACG

TCTGGAGGATCTGCGAATTCCTCCTGCTTATGTTAAAACTTTTCAAGGTCCGCCTCACGGCATCCAGGTTGAGAGAGATAAAT TCTGGAGGATCTGCGAATTCCTACTGCTTATGTTAAAACTTTTCAAGGTCCGCCTCACGGCATCCAGGTTGAGAGAGATAAAT

TGAACAAGTATGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAAAACTACGGTAGAGCAGTT TGAACAAGTATGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAAAACTACGGTAGAGCAGTT

TATGAATGTCTTCGCGGTGGGCTTGATTTTACCAAAGATGATGAAAACGTGAATTCCCAACCATTTATGCGTTGGAGAGATCG TATGAATGTCTTCGCGGTGGGCTTGATTTTACCAAAGATGATGAAAACGTGAATTCCCAACCATTTATGCGTTGGAGAGATCG

TTTCTTATTTTGTGCAGAAGCTATTTATAAAGCACAAGCCGAAACAGGCGAAATCAAGGGGCATTACTTAAAT TTTCTTATTTTGTGCAGAAGCTCTTTATAAAGCACAAGCCGAAACAGGCGAAATCAAGGGGCATTACTTAAAT

Poaceae Cymbopogon distans P6857 / 23 JF949974 Aligned with Cymbopogon citratus AM887872 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TTTAAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAGTACGAAACCAAGGATACTGATATCTTGGCAGCATT TTTAAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAGTACGAAACCAAGGATACTGATATCTTGGCAGCATT

CCGAGTAACTCCTCAGCTCGGGGTTCCGCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACA CCGAGTAACTCCTCAGCTCGGGGTTCCGCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACA

201

ACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTCCTGGGGACCCAGA ACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTCCTGGGGACCCAGA

TCAATATATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAA TCAATATATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAA

CGTATTTGGTTTCAAAGCCTTACGCGCTCTACGTTTGGAGGATCTACGAATTCCCCCTGCTTATGCAAAAACTTTCCAAGGTCC CGTATTTGGTTTCAAAGCCTTACGCGCTCTACGTTTGGAGGATCTACGAATTCCCCCTGCTTATGCAAAAACTTTCCAAGGTCC

GCCTCACGGTATCCAAGTTGAAAGGGATAAGTTGAACAAGTACGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGG GCCTCACGGTATCCAAGTTGAAAGGGATAAGTTGAACAAGTACGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGG

GATTATCCGCAAAAAATTATGGTAGAGCGTGTTATGAGTGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTA GATTATCCGCAAAAAATTATGGTAGAGCGTGTTATGAGTGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTA

AACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACCGGTGA AACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACCGGTGA

AATCAAGGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA AATCAAGGGGCATTACTTGAATGCGACTGCAGGTACATGCGAA

Polygonaceae Fallopia japonica P6894 / 60 JF950004 Aligned with Fallopia japonica AF297131 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GGATTCAAAGCTGGTGTTAAAGAATACAAATTGACTTATTATACTCCTGAGTATGAACCCCATGATCATGATATCTTGGCAGC GGATTCAAAGCTGGTGTTAAAGAATACAAATTGACTTATTATACTCCTGAGTATGAACCCCATGATCATGATATCTTGGCAGC

ATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGG ATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGG

ACAACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCTGTTCCTGGAGAAG ACAACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCTGTTCCTGGAGAAG

AAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGG AAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGG

GTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTTCGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAG GTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTTCGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAG

GCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAA GCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAA

ATTGGGGTTGTCCGCTAAGAACTACGGTCGGGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAA ATTGGGGTTGTCCGCTAAGAACTACGGTCGGGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAA

ACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTTTAAATCACAGTGCGAAACA ACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTTTAAATCACAGTGCGAAACA

GGTGAAATCAAAGGACATTACTTGAAT GGTGAAATCAAAGGACATTACTTGAAT

Polygonaceae Fallopia multiflora P6895 / 61 JF949987 Aligned with Fallopia multiflora HM357901 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TTTCGAGTAACTCCTCAACCTGGAGTTCCGCCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC TTTCGAGTAACTCCTCAACCTGGAGTTCCGCCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC

AACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCTGTTCCTGGAGAAGAA AACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCTGTTCCTGGAGAAGAA

AATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGT AATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGT

AATGTATTTGGGTTCAAAGCCCTGCGTGCTCTTCGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAGGC AATGTATTTGGGTTCAAAGCCCTGCGTGCTCTTCGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAGGC

CCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAAATT CCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAAATT

202

GGGGTTGTCCGCTAAGAACTACGGTCGGGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAAACG GGGGTTGTCCGCTAAGAACTACGGTCGGGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAAACG

TGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTTTAAATCACAGTGCGAAACAGGT TGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTTTAAATCACAGTGCGAAACAGGT

GAAATCAAAGGACATTACTTGAAT GAAATCAAAGGACATTACTTGAAT

Polygonaceae Polygonum aviculare P6893 / 59 JF950012 Aligned with Polygonum aviculare EU554012 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GGATTCAAAGCTGGTGTTAAAGAATACAAATTGACTTATTATACTCCTGACTATGAACCGCATGATCATGATATCTTGGCAGC GGATTCAAAGCTGGTGTTAAAGAATACAAATTGACTTATTATACTCCTGACTATGAACCGCATGATCATGATATCTTGGCAGC

ATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGG ATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGG

ACAACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCTGTTCCTGGCGAAG ACAACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCTGTTCCTGGCGAAG

AAAGTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGG AAAGTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGG

GTAATGTATTTGGGTTCAAAGCCTTGCGTGCTCTTCGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAG GTAATGTATTTGGGTTCAAAGCCTTGCGTGCTCTTCGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAG

GCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAA GCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAA

ATTGGGATTGTCCGCTAAGAACTACGGTCGGGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAA ATTGGGATTGTCCGCTAAGAACTACGGTCGGGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAA

ACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTTTAAATCACAGTCCGAAACA ACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTTTAAATCACAGTCCGAAACA

GGTGAAATCAAAGGACATTACTTGAAT GGTGAAATCAAAGGACATTACTTGAAT

Polygonaceae Rheum officinale P6898 / 64 JF950015 Aligned with Rheum officinale GQ436767 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene CTGGTGTTAAAGAATACAAATTGACTTATTATACTCCTGACTATGAACCCCATGACCATGATATCTTGGCAGCATTTCGCGTA CTGGTGTTAAAGAATACAAATTGACTTATTATACTCCTGACTATGAACCCCATGACCATGATATCTTGGCAGCATTTCGCGTA

ACTCCTCAACCTGGAGTTCCACCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGT ACTCCTCAACCTGGAGTTCCACCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGT

GGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTCCTGGAGAAGAAAATCAATT GGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTCCTGGAGAAGAAAATCAATT

TATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTT TATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTT

GGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAGGCCCGCCTCA GGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAGGCCCGCCTCA

TGGTATCCAAGTTGAGAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAAATTGGGGTTGT TGGTATCCAAGTTGAGAGAGATAAATTGAACAAATATGGACGTCCCCTATTGGGATGTACTATTAAACCGAAATTGGGGTTGT

CCGCTAAGAACTACGGCCGAGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCC CCGCTAAGAACTACGGCCGAGCAGTTTATGAATGTCTTCGTGGCGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCC

CAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTCTTTTTAAAGCACAGTCTGAAACAGGTGAAATCAA CAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTCTTTTTAAAGCACAGTCTGAAACAGGTGAAATCAA

AGGACATTACTTGAAT AGGACATTACTTGAAT

203

Ranunculaceae Coptis chinensis P6855 / 21 JF950024 Aligned with Coptis chinensis FJ449856 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TACAAATTGACTTATTATACTCCTCAATATACACCCAAAGATACTGATACCCTGGCAGCATTCCGAGTAACTCCTCAACCTGG TACAAATTGACTTATTATACTCCTCAATATACACCCAAAGATACTGATACCCTGGCAGCATTCCGAGTAACTCCTCAACCTGG

AGTTCCACCGGAAGAAGCGGGGGCTGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTT AGTTCCACCGGAAGAAGCGGGGGCTGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTT

ACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGC ACCAGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGC

CTATCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAAGCGCT CTATCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAAGCGCT

ACGCGCTCTACGTTTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAGGGGCCGCCCCATGGTATCCAAGTTG ACGCGCTCTACGTTTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAGGGGCCGCCCCATGGTATCCAAGTTG

AGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCTAAGAACTAC AGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCTAAGAACTAC

GGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCATTTATGCG GGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCATTTATGCG

TTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCAATTTATAAAGCACAAGCCGAAACCGGTGAAATCAAAGGACATTACTTGA TTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCAATTTATAAAGCACAAGCCGAAACCGGTGAAATCAAAGGACATTACTTGA

ATGCTACTGC ATGCTACTGC

Rosaceae Sanguisorba officinalis P6901 / 67 JF950016 Aligned with Sanguisorba officinalis AY395560 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCGGACTATGAAACCAAAGATACTGATATCTTGGC GTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCGGACTATGAAACCAAAGATACTGATATCTTGGC

AGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCGGCGGTAGCTGCGGAATCTTCTACTGGTACAT AGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCGGCGGTAGCTGCGGAATCTTCTACTGGTACAT

GGACAACTGTATGGACTGACGGGCTTACCAGTCTTGATCGTTACAAAGGGCGCTGCTACCATATTGAACCTGTTGCTGGAGAA GGACAACTGTATGGACTGACGGGCTTACCAGTCTTGATCGTTACAAAGGGCGCTGCTACCATATTGAACCTGTTGCTGGAGAA

GAAAATCAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAGGGTTCGGTTACTAACATGTTTACTTCCATTGTA GAAAATCAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAGGGTTCGGTTACTAACATGTTTACTTCCATTGTA

GGTAATGTATTTGGGTTCAAGGCCTTGCGCGCTCTACGTCTGGAGGATTTACGAATTCCTCCTGCTTATGTTAAAACTTTCCAA GGTAATGTATTTGGGTTCAAGGCCTTGCGCGCTCTACGTCTGGAGGATTTACGAATTCCTCCTGCTTATGTTAAAACTTTCCAA

GGCCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGCCGCCCGCTATTGGGATGCACTATTAAACCTA GGCCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGCCGCCCGCTATTGGGATGCACTATTAAACCTA

AATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAG AATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAG

AATGTTAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGTCGAAGCAATTAATAAAGCGCAGGCTGAAAC AATGTTAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGTCGAAGCAATTAATAAAGCGCAGGCTGAAAC

AGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA AGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA

Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 Aligned with Hedyotis nigricans AJ288606 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTAACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTT AGTGTTGGATTTAAAGCTGGTGTTAAAGAGTACAAATTAACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTT

204

GGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCGGAAGAAGCAGGGGCCGCGGTAGCTGCCGAGTCTTCTACTGGT GGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCGGAAGAAGCCGGGGCTGCGGTAGCTGCCGAGTCTTCTACTGGT

ACATGGACAACTGTATGGACGGATGGACTTACCAGTCTTGACCGTTACAAAGGACGATGCTACCACATCGAGCCAGTTCCTG ACATGGACAACTGTATGGACGGATGGACTTACCAGTCTTGACCGTTACAAAGGACGATGCTACCACATCGAGCCAGTTCCTG

GAGAAGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCA GAGAAGAAGATCAATTTATTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCA

TCGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCCCTACGTCTGGAAGATTTGCGAATTCCCATTGCTTATGTTAAAACCT TCGTAGGTAATGTATTTGGGTTCAAAGCCTTGCGCGCCCTACGTCTGGAAGATTTGCGAATTCCCATTGCTTATGTTAAAACCT

TCGAAGGTCCACCTCACGGCATTCAGGTCGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAA TCGAAGGTCCACCTCACGGCATTCAGGTCGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAA

CCTAAATTAGGTTTATCTGCTAAAAACTACGGTAGAGCATGTTATGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGA CCTAAATTAGGTTTATCTGCTAAAAACTACGGTAGAGCATGTTATGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGA

TGAAAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCTG TGAAAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCTG

AAACTGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGT AAACTGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGT

Rutaceae Evodia lepta P6869 / 35 JF949978 Aligned with Zanthoxylum monophyllum U39282 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

TCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTC TCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTC

CGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAA CGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAA

CTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAA CTGTGTGGACCGACGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAA

TCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAA TCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAA

TGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTTCAAGGCC TGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTACCGCGTATACTAAAACTTTCCAAGGCC

CGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCGAAATT CGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCGAAATT

GGGGTTATCCGCTAAGAATTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAAC GGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAAC

GTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCGTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGG GTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGG

TGAAATCAAAGGTCATTACTTGAATGCTACTGCGGGTACATGCGAA TGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGCGAA

Rutaceae Phellodendron chinense P6890 / 56 JF949986 Aligned with Phellodendron chinense GQ436735 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene CTTATTATACTCCTGACTATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTCCACCC CTTATTATACTCCTGACTATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTCCACCC

GAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTG GAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTG

ATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTA ATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTA

GACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTA GACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTA

205

CGTCTAGAGGATCTACGAATCCCTACCGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATA CGTCTAGAGGATCTACGAATCCCTACCGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATA

AATTGAATAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCA AATTGAATAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCA

GTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGG GTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGG

Saururaceae Houttuynia cordata P6875 / 41 JF950006 Aligned with Houttuynia cordata L08762 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC GTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC

AGCATTCCGAGTAACTCCGCAACCCGGAGTTCCACCCGAGGAAGCAGGGGCTGCGGTACGTGCCGAATCCTCTACTGGTACA AGCATTCCGAGTAACTCCGCAACCCGGAGTTCCACCCGAGGAAGCAGGGGCTGCGGTACGTGCCGAATCCTCTACTGGTACA

TGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGA TGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGA

GGAAAGTCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTG GGAAAGTCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTG

GGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAA GGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAA

GGCCCACCCCATGGAATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAA GGCCCACCCCATGGAATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAA

ATTGGGGTTATCGGCTAAGAACTACGGTAGGGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTCACCAAGGATGATGAAA ATTGGGGTTATCGGCTAAGAACTACGGTAGGGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTCACCAAGGATGATGAAA

ATGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCTATTTACAAAGCGCAGGCCGAAACA ATGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCTATTTACAAAGCGCAGGCCGAAACA

GGTGAAATTAAAGGACATTACTTAAATGCTACTGCAGGTAC GGTGAAATTAAAGGACATTACTTAAATGCTACTGCAGGTAC

Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 Aligned with Kadsura japonica AF193969 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene ATTCAAGGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGACTATGAAACGAAAGATACTGATATCTTGGCAGCAT ATTCAAGGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGACTATGAAACGAAAGATACTGATATCTTGGCAGCAT

TCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGAGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACT TCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGAGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACT

ACTGTGTGGACTGATGGACTTACCAGCCTCGATCGTTATAAAGGGCGATGCTACCACATTGAGCCCGTTGCTGGGGAGGAAA ACTGTGTGGACTGATGGACTTACCAGCCTCGATCGTTATAAAGGGCGATGCTACCACATTGAGCCCGTTGCTGGGGAGGAAA

ATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAA ATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAA

TGTGTTTGGGTTCAAAGCCCTACGAGCTCTGCGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCC TGTGTTTGGGTTCAAAGCCCTACGAGCTCTGCGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCC

ACCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTA ACCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTA

GGGTTATCTGCCAAGAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGAT GGGTTATCTGCCAAGAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGAT

206

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 Aligned with Selaginella tamariscina AJ295861 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene TACAAGACCAAAAACAGCGATATCCTGGCAGCGTTCCGAATGACTCCGCAACCCGGAGTGCCCGCCGAAGAGGCAGGAGCC TACAAGACCAAAAACAGCGATATCCTGGCAGCGTTCCGAATGACTCCGCAACCCGGAGTGCCCGCCGAAGAGGCAGGAGCC

GCAGTAGCTGCGGAATCCTCTACTGGCACATGGACCACCGTTTGGACCGACGGGCTTACCAATCTTGACCGTTATAAAGGTCG GCAGTAGCTGCGGAATCCTCTACTGGCACATGGACCACCGTTTGGACCGACGGGCTTACCAATCTTGACCGTTATAAAGGTCG

GTGCTACGATATCGAACCCGTCCCTGGGGAAAAAGATCAATACATTGCCTATGTAGCCTATCCTTTGGATTTGTTTGAGGAAG GTGCTACGATATCGAACCCGTCCCTGGGGAAAAAGATCAATACATTGCCTATGTAGCCTATCCTTTGGATTTGTTTGAGGAAG

GTTCCGTTACCAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGATTCAAGGCCTTACGAGCCCTGCGTTTGGAAGATCTGC GTTCCGTTACCAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGATTCAAGGCCTTACGAGCCCTGCGTTTGGAAGATCTGC

GAATCCCCCCCGCTTATTCCAAAACCTTCGAGGGCCCGCCTCATGGTATCCAAGTCGAAAGGGATAAATCAAATAAATACGG GAATCCCCCCCGCTTATTCCAAAACCTTCGAGGGCCCGCCTCATGGTATCCAAGTCGAAAGGGATAAATCAAATAAATACGG

CCGCCCCCTGCTGGGATGCACTATCAAACCCAAGTTAGGTTTATCTGCCAAAAACTATGGCAGAGCGTGCTATGAATGTCTTC CCGCCCCCTGCTGGGATGCACTATCAAACCCAAGTTAGGTTTATCTGCCAAAAACTATGGCAGAGCGTGCTATGAATGTCTTC

GTGG GTGG

Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 Aligned with Patrinia triloba AF446951 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene AGTGCTGGATTCAAAGCGGGCGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTT AGTGCTGGATTCAAAGCGGGCGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTT

GGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCAACTGGT GGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCTGCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCAACTGGT

ACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTG ACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTG

GAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTA GAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTA

TTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTCGCTTATGTTAAAACTT TTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTCGCTTATGTTAAAACTT

TCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGCCCCCTGTTGGGATGTACTATTAAA TCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGCCCCCTGTTGGGATGTACTATTAAA

CCCAAATTGGGGTTGTCTGCTAAAAACTATGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGA CCCAAATTGGGGTTGTCTGCTAAAAACTATGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGA

TGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCCCTTTATAAAGCACAAACTG TGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCCCTTTATAAAGCACAAACTG

AAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGG AAACAGGTGAAATCAAAGGGCATTACTTGAATGCGACTGCAGG

Verbenaceae Verbena officinalis P6910 / 76 JF950020 Aligned with Verbena officinalis GQ436523 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene GTTGGATTCAAAGCGGGTGTTAAAGAGTACAAGTTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGC GTTGGATTCAAAGCGGGTGTTAAAGAGTACAAGTTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGC

AGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACAT AGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACAT

GGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTCCTGGAGA GGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTCCTGGAGA

207

CCCAGATCAATATATTTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACGAACATGTTTACTTCCATTGT CCCAGATCAATATATTTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACGAACATGTTTACTTCCATTGT

AGGAAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCCTATACTAAAACTTTCC AGGAAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCCTATACTAAAACTTTCC

AAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCT AAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCT

AAATTGGGTTTATCTGCTAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGA AAATTGGGTTTATCTGCTAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGA

GAACGTGAACTCTCAGCCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAA GAACGTGAACTCTCAGCCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAA

CAGGTGAAATCAAAGGGCA CAGGTGAAATCAAAGGGCA

Violaceae Viola yezoensis P6911 / 77 JF949993 Aligned with Viola pubescens DQ006129 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbc L) gene

GTTGGATTCAAAGCTGGGGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC GTTGGATTCAAAGCTGGGGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGC

AGCATTCCGAGTAACTCCGCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACAT AGCATTCCGAGTAACTCCGCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACAT

GGACAACTGTGTGGACCGATGGGCTTACCTCCCTTGATCGTTATAAAGGACGATGCTACGACATCGAGCCCGTTCCTGGAGAA GGACAACTGTGTGGACCGATGGGCTTACTTCCCTTGATCGTTATAAAGGACGATGCTACGACATCGAGCCCGTTCCTGGAGAA

GAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACGAACATGTTTACTTCCATTGTG GAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACGAACATGTTTACTTCCATTGTG

GGTAATGTATTTGGGTTCAAAGCCCTACGGGCTTTACGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAA GGTAATGTATTTGGGTTCAAAGCCCTACGGGCTTTACGTTTGGAGGATTTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAA

GGTCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGCTGTACTATTAAACCTAA GGTCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGCTGTACTATTAAACCGAA

ATTGGGGTTATCCGCTAAGAATTATGGGAGAGCTGTTTATGAGTGTCTCCGCGGTGGACTTGATTTTACTAAAGATGATGAGA ATTGGGGTTATCCGCTAAGAATTATGGGAGAGCTGTTTATGAGTGTCTCCGCGGTGGACTTGATTTTACTAAAGATGATGAGA

ATGTGAACTCCCAACCATTTAT ATGTGAACTCCCAACCATTTAT

208

10.4 Documentation of screening results 10.4.1 Dichloromethane extracts: HeLa

Acanthaceae Andrographis paniculata P6838 / 04 JF949965 IC 50 188.4 µg/ml

Andrographis paniculata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Amaranthaceae Celosia cristata P6848 / 14 JF949970 IC 50 472.0 µg/ml

Celosia cristata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Apiaceae Bupleurum chinense P6844 / 10 JF950021 IC 50 235.2 µg/ml Bupleurum marginatum P6845 / 11 JF949968 IC 50 176.0 µg/ml Centella asiatica P6849 / 15 JF950022 IC 50 175.0 µg/ml Cnidium monnieri P6854 / 20 JF949973 IC 50 127.1 µg/ml Saposhnikovia divaricata P6902 / 68 JF949988 IC 50 410.1 µg/ml

Bupleurum chinense Bupleurum marginatum

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

209

Centella asiatica Cnidium monnieri

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Saposhnikovia divaricata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Araliaceae Eleutherococcus senticosus P6919 / 79 - IC 50 300.0 µg/ml Panax ginseng China P8088 / 81 JF950028 IC 50 152.4 µg/ml Panax ginseng Korea P8086 / 81 JF950029 IC 50 173.1 µg/ml Panax notoginseng P6887 / 53 JF950030 IC 50 263.0 µg/ml

Eleutherococcus senticosus Panax ginseng China

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Panax ginseng Korea Panax notoginseng

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

210

Arecaceae Areca catechu P6840 / 06 - IC 50 1023.3 µg/ml

Areca catechu

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 IC 50 395.6 µg/ml

Cynanchum paniculatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Asteraceae Artemisia annua P6841 / 07 JF949966 IC 50 107.9 µg/ml Artemisia capillaris P6842 / 08 JF949967 IC 50 93.5 µg/ml Arctium lappa P6839 / 05 JF949994 IC 50 345.0 µg/ml Centipeda minima P6850 / 16 - IC 50 63.3 µg/ml Chrysanthemum indicum P6851 / 17 JF949971 IC 50 152.1 µg/ml Chrysanthemum P6852 / 18 JF949972 IC 129.4 µg/ml morifolium 50 Eclipta prostrata P6863 / 29 JF950000 IC 50 266.4 µg/ml Senecio scandens P6905 / 71 JF949989 IC 50 268.6 µg/ml Siegesbeckia orientalis P6906 / 72 JF949990 IC 50 101.5 µg/ml Taraxacum officinale P6908 / 74 JF950019 IC 50 232.8 µg/ml

Artemisia annua Artemisia capillaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

211

Arctium lappa Centipeda minima

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Chrysanthemum indicum Chrysanthemum morifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Eclipta prostrata Senecio scandens

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Siegesbeckia orientalis Taraxacum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

212

Berberidaceae Berberis bealei P6883 / 49 JF949996 IC 50 93.8 µg/ml Dysosma versipellis P6862 / 28 - IC 50 213.9 µg/ml Epimedium koreanum P6865 / 31 JF950002 IC 50 48.7 µg/ml

Berberis bealei Dysosma versipellis

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Epimedium koreanum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 IC 50 196.4 µg/ml Isatis indigotica (root) P6877 / 43 JF949981 IC 50 321.5 µg/ml Isatis indigotica (leaf) P6878 / 44 JF949981 IC 50 226.5 µg/ml

Capsella bursa-pastoris Isatis indigotica (root)

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Isatis indigotica (leaf)

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

213

Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 IC 50 226.5 µg/ml

Lonicera confusa

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 IC 50 279.6 µg/ml

Polygonatum kingianum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Crassulaceae Rhodiola rosea P6920 / 84 - IC 50 164.1 µg/ml

Rhodiola rosea

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Cupressaceae Platycladus orientalis P6891 / 57 JF950011 IC 50 121.7 µg/ml

Platycladus orientalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

214

Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 IC 50 572.4 µg/ml

Cyrtomium fortunei

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Ephedraceae Ephedra sinica P6864 / 30 JF950001 IC 50 95.3 µg/ml

Ephedra sinica

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Equisetaceae Equisetum hiemale P6866 / 32 JF950003 IC 50 125.6 µg/ml

Equisetum hiemale

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Euphorbiaceae Croton tiglium P6856 / 22 - IC 50 422.9 µg/ml

Croton tiglium

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

215

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 IC 50 494.4 µg/ml Acacia catechu P6836 / 02 - IC 50 164.1 µg/ml Cassia tora P6847 / 13 JF949969 IC 50 1335.4 µg/ml Desmodium styracifolium P6861 / 27 JF949976 IC 50 156.0 µg/ml Glycyrrhiza inflata P6873 / 39 JF950025 IC 50 26.4 µg/ml Spatholobus suberectus P6907 / 73 JF949991 IC 50 299.1 µg/ml Sutherlandia frutescens tba / 83 - IC 50 367.7 µg/ml

Abrus cantoniensis Acacia catechu

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Cassia tora Desmodium styracifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Glycyrrhiza inflata Spatholobus suberectus

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

216

Sutherlandia frutescens

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Geraniaceae Geranium wilfordii P6867 / 33 JF949977 IC 50 99.1 µg/ml Pelargonium sidoides tba / 82 - IC 50 488.2 µg/ml

Geranium wilfordii Pelargonium sidoides

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 IC 50 768.3 µg/ml

Ginkgo biloba

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Hypericaceae Hypericum japonicum P6876 / 42 JF949980 IC 50 163.3 µg/ml

Hypericum japonicum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

217

Iridaceae Belamcanda chinensis P6843 / 09 JF949995 IC 50 324.4 µg/ml

Belamcanda chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 IC 50 108.5 µg/ml Prunella vulgaris P6896 / 62 JF950013 IC 50 282.1 µg/ml Scutellaria baicalensis P6903 / 69 JF950017 IC 50 90.9 µg/ml

Mentha haplocalyx Prunella vulgaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Scutellaria baicalensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lauraceae Cinnamomum cassia P6853 / 19 JF950023 IC 50 138.9 µg/ml

Cinnamomum cassia

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

218

Loranthaceae Taxillus chinensis P6909 / 75 JF949992 IC 50 417.8 µg/ml

Taxillus chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lythraceae Punica granatum P6897 / 63 JF950014 IC 50 583.3 µg/ml

Punica granatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 IC 50 23.6 µg/ml

Magnolia officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Melanthiaceae Paris polyphylla P6888 / 54 JF950010 IC 50 952.6 µg/ml

Paris polyphylla

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

219

Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 IC 50 53.4 µg/ml

Lysimachia christinae

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 IC 50 188.9 µg/ml

Ophioglossum vulgatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 IC 50 83.0 µg/ml

Dendrobium loddigesii

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 IC 50 166.9 µg/ml

Paeonia lactiflora

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

220

Pedaliaceae Harpagophytum procumbens tba / 80 - IC 50 36.2 µg/ml

Harpagophytum procumbens

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Poaceae Cymbopogon distans P6857 / 23 JF949974 IC 50 425.9 µg/ml

Cymbopogon distans

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml] Fallopia japonica (syn. P6894 / 60 JF950004 IC 88.0 µg/ml Polygonaceae Polygonum cuspidatum) 50 Polygonum aviculare P6893 / 59 JF950012 IC 50 118.5 µg/ml Polygonum multiflorum P6895 / 61 JF949987 IC 50 469.4 µg/ml Rheum officinale P6898 / 64 JF950015 IC 50 22.5 µg/ml

Fallopia japonica Polygonum aviculare

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Polygonum multiflorum Rheum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml] 221

Ranunculaceae Coptis chinensis P6855 / 21 JF950024 IC 50 100.0 µg/ml

Coptis chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Rosaceae Rosa chinensis P6899 / 65 - IC 50 559.4 µg/ml Rosa laevigata P6900 / 66 - IC 50 712.3 µg/ml Sanguisorba officinalis P6901 / 67 JF950016 IC 50 66.5 µg/ml

Rosa chinensis Rosa laevigata

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Sanguisorba officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 IC 50 147.8 µg/ml

Hedyotis diffusa

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

222

Rutaceae Evodia lepta P6869 / 35 JF949978 IC 50 232.0 µg/ml Evodia rutaecarpa P6870 / 36 - IC 50 50.4 µg/ml Phellodendron chinense P6890 / 56 JF949986 IC 50 370.1 µg/ml

Evodia lepta Evodia rutaecarpa

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Phellodendron chinense

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Saururaceae Houttuynia cordata P6875 / 41 JF950006 IC 50 279.9 µg/ml

Houttuynia cordata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 IC 50 9.9 µg/ml

Kadsura longipedunculata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

223

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 IC 50 339.2 µg/ml

Selaginella tamariscina

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 IC 50 140.5 µg/ml

Patrinia scabiosaefolia

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Verbenaceae Verbena officinalis P6910 / 76 JF950020 IC 50 298.1 µg/ml

Verbena officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Violaceae Viola yezoensis P6911 / 77 JF949993 IC 50 59.6 µg/ml

Viola yezoensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

224

Zingiberaceae Alpinia galanga P6837 / 03 - IC 50 55.7 µg/ml Alpinia oxyphylla P6917 / 78 - IC 50 119.6 µg/ml

Alpinia galanga Alpinia oxyphylla

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

225

10.4.2 Dichloromethane extracts: T. b. brucei

Acanthaceae Andrographis paniculata P6838 / 04 JF949965 IC 50 16.8 µg/ml

Andrographis paniculata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Amaranthaceae Celosia cristata P6848 / 14 JF949970 IC 50 55.2 µg/ml

Celosia cristata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Apiaceae Bupleurum chinense P6844 / 10 JF950021 IC 50 17.0 µg/ml Bupleurum marginatum P6845 / 11 JF949968 IC 50 16.2 µg/ml Centella asiatica P6849 / 15 JF950022 IC 50 14.0 µg/ml Cnidium monnieri P6854 / 20 JF949973 IC 50 14.9 µg/ml Saposhnikovia divaricata P6902 / 68 JF949988 IC 50 5.1 µg/ml

Bupleurum chinense Bupleurum marginatum

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

226

Centella asiatica Cnidium monnieri

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Saposhnikovia divaricata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Araliaceae Eleutherococcus senticosus P6919 / 79 - IC 50 13.5 µg/ml Panax ginseng China P8088 / 81 JF950028 IC 50 0.9 µg/ml Panax ginseng Korea P8086 / 81 JF950029 IC 50 3.3 µg/ml Panax notoginseng P6887 / 53 JF950030 IC 50 0.9 µg/ml

Eleutherococcus senticosus Panax ginseng China

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.075 0.15 0.3 0.6 1.2 2.4 4.9 9.8 19.5 39 78 156 313 625 Concentration Concentration [µg/ml] [µg/ml]

Panax ginseng Korea Panax notoginseng

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.075 0.15 0.3 0.6 1.2 2.4 4.9 9.8 19.5 39 78 156 313 625 0.075 0.15 0.3 0.6 1.2 2.4 4.9 9.8 19.5 39 78 156 313 625 Concentration Concentration [µg/ml] [µg/ml]

227

Arecaceae Areca catechu P6840 / 06 - IC 50 22.5 µg/ml

Areca catechu

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 IC 50 53.1 µg/ml

Cynanchum paniculatum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Asteraceae Artemisia annua P6841 / 07 JF949966 IC 50 8.1 µg/ml Artemisia capillaris P6842 / 08 JF949967 IC 50 10.6 µg/ml Arctium lappa P6839 / 05 JF949994 IC 50 3.6 µg/ml Centipeda minima P6850 / 16 - IC 50 2.2 µg/ml Chrysanthemum indicum P6851 / 17 JF949971 IC 50 16.0 µg/ml Chrysanthemum morifolium P6852 / 18 JF949972 IC 50 19.3 µg/ml Eclipta prostrata P6863 / 29 JF950000 IC 50 38.1 µg/ml Senecio scandens P6905 / 71 JF949989 IC 50 13.1 µg/ml Siegesbeckia orientalis P6906 / 72 JF949990 IC 50 7.9 µg/ml Taraxacum officinale P6908 / 74 JF950019 IC 50 17.5 µg/ml

Artemisia annua Artemisia capillaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

228

Arctium lappa Centipeda minima

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Chrysanthemum indicum Chrysanthemum morifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Eclipta prostrata Senecio scandens

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Siegesbeckia orientalis Taraxacum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

229

Berberidaceae Berberis bealei P6883 / 49 JF949996 IC 50 5.9 µg/ml Dysosma versipellis P6862 / 28 - IC 50 39.5 µg/ml Epimedium koreanum P6865 / 31 JF950002 IC 50 4.2 µg/ml

Berberis bealei Dysosma versipellis

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Epimedium koreanum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 IC 50 13.7 µg/ml Isatis indigotica (root) P6877 / 43 JF949981 IC 50 2.9 µg/ml Isatis indigotica (leaf) P6878 / 44 JF949981 IC 50 45.3 µg/ml

Capsella bursa-pastoris Isatis indigotica (root)

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Isatis indigotica (leaf)

150

100 [%] Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

230

Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 IC 50 16.2 µg/ml

Lonicera confusa

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 IC 50 52.6 µg/ml

Polygonatum kingianum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Crassulaceae Rhodiola rosea P6920 / 84 - IC 50 43.9 µg/ml

Rhodiola rosea

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Cupressaceae Platycladus orientalis P6891 / 57 JF950011 IC 50 17.7 µg/ml

Platycladus orientalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

231

Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 IC 50 37.1 µg/ml

Cyrtomium fortunei

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Ephedraceae Ephedra sinica P6864 / 30 JF950001 IC 50 20.9 µg/ml

Ephedra sinica

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Equisetaceae Equisetum hiemale P6866 / 32 JF950003 IC 50 30.9 µg/ml

Equisetum hiemale

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Euphorbiaceae Croton tiglium P6856 / 22 - IC 50 86.5 µg/ml

Croton tiglium

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

232

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 IC 50 14.5 µg/ml Acacia catechu P6836 / 02 - IC 50 13.1 µg/ml Cassia tora P6847 / 13 JF949969 IC 50 185.9 µg/ml Desmodium styracifolium P6861 / 27 JF949976 IC 50 16.3 µg/ml Glycyrrhiza inflata P6873 / 39 JF950025 IC 50 6.4 µg/ml Spatholobus suberectus P6907 / 73 JF949991 IC 50 25.4 µg/ml Sutherlandia frutescens tba / 83 - IC 50 41.8 µg/ml

Abrus cantoniensis Acacia catechu

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Cassia tora Desmodium styracifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Glycyrrhiza inflata Spatholobus suberectus

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

233

Sutherlandia frutescens

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Geraniaceae Geranium wilfordii P6867 / 33 JF949977 IC 50 23.0 µg/ml Pelargonium sidoides tba / 82 - IC 50 52.1 µg/ml

Geranium wilfordii Pelargonium sidoides

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 IC 50 71.9 µg/ml

Ginkgo biloba

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Hypericaceae Hypericum japonicum P6876 / 42 JF949980 IC 50 21.3 µg/ml

Hypericum japonicum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

234

Iridaceae Belamcanda chinensis P6843 / 09 JF949995 IC 50 22.3 µg/ml

Belamcanda chinensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 IC 50 14.7 µg/ml Prunella vulgaris P6896 / 62 JF950013 IC 50 13.2 µg/ml Scutellaria baicalensis P6903 / 69 JF950017 IC 50 7.4 µg/ml

Mentha haplocalyx Prunella vulgaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Scutellaria baicalensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Lauraceae Cinnamomum cassia P6853 / 19 JF950023 IC 50 11.0 µg/ml

Cinnamomum cassia

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

235

Loranthaceae Taxillus chinensis P6909 / 75 JF949992 IC 50 27.2 µg/ml

Taxillus chinensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Lythraceae Punica granatum P6897 / 63 JF950014 IC 50 14.6 µg/ml

Punica granatum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 IC 50 0.9 µg/ml

Magnolia officinalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Melanthiaceae Paris polyphylla P6888 / 54 JF950010 IC 50 73.6 µg/ml

Paris polyphylla

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

236

Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 IC 50 20.6 µg/ml

Lysimachia christinae

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 IC 50 19.8 µg/ml

Ophioglossum vulgatum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 IC 50 13.5 µg/ml

Dendrobium loddigesii

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 IC 50 9.1 µg/ml

Paeonia lactiflora

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

237

Pedaliaceae Harpagophytum procumbens tba / 80 - IC 50 0.9 µg/ml

Harpagophytum procumbens

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Poaceae Cymbopogon distans P6857 / 23 JF949974 IC 50 31.1 µg/ml

Cymbopogon distans

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml] Fallopia japonica (syn. P6894 / 60 JF950004 IC 13.1 µg/ml Polygonaceae Polygonum cuspidatum) 50 Polygonum aviculare P6893 / 59 JF950012 IC 50 18.2 µg/ml Polygonum multiflorum P6895 / 61 JF949987 IC 50 98.6 µg/ml Rheum officinale P6898 / 64 JF950015 IC 50 34.0 µg/ml

Fallopia japonica Polygonum aviculare

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Polygonum multiflorum Rheum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml] 238

Ranunculaceae Coptis chinensis P6855 / 21 JF950024 IC 50 12.9 µg/ml

Coptis chinensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Rosaceae Rosa chinensis P6899 / 65 - IC 50 20.1 µg/ml Rosa laevigata P6900 / 66 - IC 50 20.6 µg/ml Sanguisorba officinalis P6901 / 67 JF950016 IC 50 12.3 µg/ml

Rosa chinensis Rosa laevigata

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Sanguisorba officinalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 IC 50 13.3 µg/ml

Hedyotis diffusa

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

239

Rutaceae Evodia lepta P6869 / 35 JF949978 IC 50 13.9 µg/ml Evodia rutaecarpa P6870 / 36 - IC 50 16.8 µg/ml Phellodendron chinense P6890 / 56 JF949986 IC 50 15.6 µg/ml

Evodia lepta Evodia rutaecarpa

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Phellodendron chinense

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Saururaceae Houttuynia cordata P6875 / 41 JF950006 IC 50 68.3 µg/ml

Houttuynia cordata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 IC 50 0.1 µg/ml

Kadsura longipedunculata

150

100 [%] Survival Survival 50

0 0.06 0.12 0.24 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 Concentration [µg/ml]

240

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 IC 50 13.6 µg/ml

Selaginella tamariscina

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 IC 50 13.7 µg/ml

Patrinia scabiosaefolia

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Verbenaceae Verbena officinalis P6910 / 76 JF950020 IC 50 16.5 µg/ml

Verbena officinalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Violaceae Viola yezoensis P6911 / 77 JF949993 IC 50 3.3 µg/ml

Viola yezoensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

241

Zingiberaceae Alpinia galanga P6837 / 03 - IC 50 1.4 µg/ml Alpinia oxyphylla P6917 / 78 - IC 50 0.7 µg/ml

Alpinia galanga Alpinia oxyphylla

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

242

10.4.3 Methanol extracts: HeLa

Acanthaceae Andrographis paniculata P6838 / 04 JF949965 IC 50 323.3 µg/ml

Andrographis paniculata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Amaranthaceae Celosia cristata P6848 / 14 JF949970 IC 50 499.8 µg/ml

Celosia cristata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Apiaceae Bupleurum chinense P6844 / 10 JF950021 IC 50 646.4 µg/ml Bupleurum marginatum P6845 / 11 JF949968 IC 50 1147.0 µg/ml Centella asiatica P6849 / 15 JF950022 IC 50 773.0 µg/ml Cnidium monnieri P6854 / 20 JF949973 IC 50 251.1 µg/ml Saposhnikovia divaricata P6902 / 68 JF949988 IC 50 1515.6 µg/ml

Bupleurum chinense Bupleurum marginatum

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

243

Centella asiatica Cnidium monnieri

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Saposhnikovia divaricata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Araliaceae Eleutherococcus senticosus P6919 / 79 - IC 50 692.0 µg/ml Panax ginseng China P8088 / 81 JF950028 IC 50 1427.9 µg/ml Panax ginseng Korea P8086 / 81 JF950029 IC 50 1317.9 µg/ml Panax notoginseng P6887 / 53 JF950030 IC 50 1241.6 µg/ml

Eleutherococcus senticosus Panax ginseng China

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Panax ginseng Korea Panax notoginseng

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

244

Arecaceae Areca catechu P6840 / 06 - IC 50 414.2 µg/ml

Areca catechu

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 IC 50 500.5 µg/ml

Cynanchum paniculatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Asteraceae Artemisia annua P6841 / 07 JF949966 IC 50 287.2 µg/ml Artemisia capillaris P6842 / 08 JF949967 IC 50 314.9 µg/ml Arctium lappa P6839 / 05 JF949994 IC 50 1467.7 µg/ml Centipeda minima P6850 / 16 - IC 50 219.1 µg/ml Chrysanthemum indicum P6851 / 17 JF949971 IC50 355.7 µg/ml Chrysanthemum morifolium P6852 / 18 JF949972 IC 50 349.2 µg/ml Eclipta prostrata P6863 / 29 JF950000 IC 50 329.7 µg/ml Senecio scandens P6905 / 71 JF949989 IC 50 299.3 µg/ml Siegesbeckia orientalis P6906 / 72 JF949990 IC 50 237.5 µg/ml Taraxacum officinale P6908 / 74 JF950019 IC 50 636.7 µg/ml

Artemisia annua Artemisia capillaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

245

Arctium lappa Centipeda minima

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Chrysanthemum indicum Chrysanthemum morifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Eclipta prostrata Senecio scandens

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Siegesbeckia orientalis Taraxacum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

246

Berberidaceae Berberis bealei P6883 / 49 JF949996 IC 50 149.7 µg/ml Dysosma versipellis P6862 / 28 - IC 50 385.2 µg/ml Epimedium koreanum P6865 / 31 JF950002 IC 50 257.5 µg/ml

Berberis bealei Dysosma versipellis

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Epimedium koreanum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 IC 50 141.0 µg/ml Isatis indigotica (root) P6877 / 43 JF949981 IC 50 674.3 µg/ml Isatis indigotica (leaf) P6878 / 44 JF949981 IC 50 274.2 µg/ml

Capsella bursa-pastoris Isatis indigotica (root)

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Isatis indigotica (leaf)

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

247

Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 IC 50 923.5 µg/ml

Lonicera confusa

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 IC 50 1517.9 µg/ml

Polygonatum kingianum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Cupressaceae Platycladus orientalis P6891 / 57 JF950011 IC 50 705.5 µg/ml

Platycladus orientalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 IC 50 722.0 µg/ml

Cyrtomium fortunei

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

248

Ephedraceae Ephedra sinica P6864 / 30 JF950001 IC 50 163.5 µg/ml

Ephedra sinica

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Equisetaceae Equisetum hiemale P6866 / 32 JF950003 IC 50 241.2 µg/ml

Equisetum hiemale

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Euphorbiaceae Croton tiglium P6856 / 22 - IC 50 297.0 µg/ml

Croton tiglium

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

249

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 IC 50 612.4 µg/ml Acacia catechu P6836 / 02 - IC 50 318.0 µg/ml Cassia tora P6847 / 13 JF949969 IC 50 670.9 µg/ml Desmodium styracifolium P6861 / 27 JF949976 IC 50 324.3 µg/ml Glycyrrhiza inflata P6873 / 39 JF950025 IC 50 528.3 µg/ml Spatholobus suberectus P6907 / 73 JF949991 IC 50 237.5 µg/ml Sutherlandia frutescens tba / 83 - IC 50 586.6 µg/ml

Abrus cantoniensis Acacia catechu

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Cassia tora Desmodium styracifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Glycyrrhiza inflata Spatholobus suberectus

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

250

Sutherlandia frutescens

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Geraniaceae Geranium wilfordii P6867 / 33 JF949977 IC 50 236.0 µg/ml Pelargonium sidoides tba / 82 - IC 50 112.3 µg/ml

Geranium wilfordii Pelargonium sidoides

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 IC 50 302.9 µg/ml

Ginkgo biloba

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Hypericaceae Hypericum japonicum P6876 / 42 JF949980 IC 50 177.5 µg/ml

Hypericum japonicum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

251

Iridaceae Belamcanda chinensis P6843 / 09 JF949995 IC 50 522.6 µg/ml

Belamcanda chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 IC 50 375.0 µg/ml Prunella vulgaris P6896 / 62 JF950013 IC 50 475.4 µg/ml Scutellaria baicalensis P6903 / 69 JF950017 IC 50 367.6 µg/ml

Mentha haplocalyx Prunella vulgaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Scutellaria baicalensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lauraceae Cinnamomum cassia P6853 / 19 JF950023 IC 50 272.4 µg/ml

Cinnamomum cassia

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

252

Loranthaceae Taxillus chinensis P6909 / 75 JF949992 IC 50 1213.4 µg/ml

Taxillus chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lythraceae Punica granatum P6897 / 63 JF950014 IC 50 211.2 µg/ml

Punica granatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 IC 50 49.1 µg/ml

Magnolia officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Melanthiaceae Paris polyphylla P6888 / 54 JF950010 IC 50 35.0 µg/ml

Paris polyphylla

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

253

Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 IC 50 1752.6 µg/ml

Lysimachia christinae

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Myrtaceae Eucalyptus robusta P6868 / 34 - IC 50 181.4 µg/ml

Eucalyptus robusta

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 IC 50 469.0 µg/ml

Ophioglossum vulgatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 IC 50 232.8 µg/ml

Dendrobium loddigesii

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

254

Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 IC 50 294.6 µg/ml

Paeonia lactiflora

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Pedaliaceae Harpagophytum procumbens tba / 80 - IC 50 692.6 µg/ml

Harpagophytum procumbens

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Poaceae Cymbopogon distans P6857 / 23 JF949974 IC 50 98.8 µg/ml

Cymbopogon distans

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml] Fallopia japonica (syn. P6894 / 60 JF950004 IC 317.3 µg/ml Polygonaceae Polygonum cuspidatum) 50 Polygonum aviculare P6893 / 59 JF950012 IC 50 342.3 µg/ml Polygonum multiflorum P6895 / 61 JF949987 IC 50 437.4 µg/ml Rheum officinale P6898 / 64 JF950015 IC 50 270.9 µg/ml

Fallopia japonica Polygonum aviculare

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml] 255

Polygonum multiflorum Rheum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ranunculaceae Coptis chinensis P6855 / 21 JF950024 IC 50 81.8 µg/ml

Coptis chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Rosaceae Rosa chinensis P6899 / 65 - IC 50 266.6 µg/ml Rosa laevigata P6900 / 66 - IC 50 1855.4 µg/ml Sanguisorba officinalis P6901 / 67 JF950016 IC 50 158.5 µg/ml

Rosa chinensis Rosa laevigata

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Sanguisorba officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

256

Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 IC 50 796.1 µg/ml

Hedyotis diffusa

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Rutaceae Evodia lepta P6869 / 35 JF949978 IC 50 350.7 µg/ml Evodia rutaecarpa P6870 / 36 - IC 50 297.4 µg/ml Phellodendron chinense P6890 / 56 JF949986 IC 50 487.6 µg/ml

Evodia lepta Evodia rutaecarpa

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Phellodendron chinense

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Saururaceae Houttuynia cordata P6875 / 41 JF950006 IC 50 575.2 µg/ml

Houttuynia cordata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

257

Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 IC 50 86.1 µg/ml

Kadsura longipedunculata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 IC 50 393.9 µg/ml

Selaginella tamariscina

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 IC 50 159.4 µg/ml

Patrinia scabiosaefolia

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Verbenaceae Verbena officinalis P6910 / 76 JF950020 IC 50 334.7 µg/ml

Verbena officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

258

Violaceae Viola yezoensis P6911 / 77 JF949993 IC 50 297.5 µg/ml

Viola yezoensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Zingiberaceae Alpinia galanga P6837 / 03 - IC 50 111.7 µg/ml Alpinia oxyphylla P6917 / 78 - IC 50 213.8 µg/ml

Alpinia galanga Alpinia oxyphylla

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

259

10.4.4 Methanol extracts: T. b. brucei

Acanthaceae Andrographis paniculata P6838 / 04 JF949965 IC 50 28.8 µg/ml

Andrographis paniculata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Amaranthaceae Celosia cristata P6848 / 14 JF949970 IC 50 77.2 µg/ml

Celosia cristata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Apiaceae Bupleurum chinense P6844 / 10 JF950021 IC 50 120.8 µg/ml Bupleurum marginatum P6845 / 11 JF949968 IC 50 111.9 µg/ml Centella asiatica P6849 / 15 JF950022 IC 50 44.7 µg/ml Cnidium monnieri P6854 / 20 JF949973 IC 50 17.9 µg/ml Saposhnikovia divaricata P6902 / 68 JF949988 IC 50 999.5 µg/ml

Bupleurum chinense Bupleurum marginatum

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

260

Centella asiatica Cnidium monnieri

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Saposhnikovia divaricata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Araliaceae Eleutherococcus senticosus P6919 / 79 - IC 50 17.3 µg/ml Panax ginseng China P8088 / 81 JF950028 IC 50 319.0 µg/ml Panax ginseng Korea P8086 / 81 JF950029 IC 50 1075.0 µg/ml Panax notoginseng P6887 / 53 JF950030 IC 50 469.6 µg/ml

Eleutherococcus senticosus Panax ginseng China

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Panax ginseng Korea Panax notoginseng

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

261

Arecaceae Areca catechu P6840 / 06 - IC 50 118.1 µg/ml

Areca catechu

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 IC 50 39.3 µg/ml

Cynanchum paniculatum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Asteraceae Artemisia annua P6841 / 07 JF949966 IC 50 51.2 µg/ml Artemisia capillaris P6842 / 08 JF949967 IC 50 51.9 µg/ml Arctium lappa P6839 / 05 JF949994 IC 50 2229.0 µg/ml Centipeda minima P6850 / 16 - IC 50 13.3 µg/ml Chrysanthemum indicum P6851 / 17 JF949971 IC 50 15.3 µg/ml Chrysanthemum morifolium P6852 / 18 JF949972 IC 50 24.9 µg/ml Eclipta prostata P6863 / 29 JF950000 IC 50 39.6 µg/ml Senecio scandens P6905 / 71 JF949989 IC 50 18.6 µg/ml Siegesbeckia orientalis P6906 / 72 JF949990 IC 50 12.3 µg/ml Taraxacum officinale P6908 / 74 JF950019 IC 50 64.9 µg/ml

Artemisia annua Artemisia capillaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

262

Arctium lappa Centipeda minima

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Chrysanthemum indicum Chrysanthemum morifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Eclipta prostrata Senecio scandens

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Siegesbeckia orientalis Taraxacum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

263

Berberidaceae Berberis bealei P6883 / 49 JF949996 IC 50 7.8 µg/ml Dysosma versipellis P6862 / 28 - IC 50 53.2 µg/ml Epimedium koreanum P6865 / 31 JF950002 IC 50 12.6 µg/ml

Berberis bealei Dysosma versipellis

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Epimedium koreanum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 IC 50 60.9 µg/ml Isatis indigotica (root) P6877 / 43 JF949981 IC 50 94.6 µg/ml Isatis indigotica (leaf) P6878 / 44 JF949981 IC 50 14.6 µg/ml

Capsella bursa-pastoris Isatis indigotica (root)

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Isatis indigotica (leaf)

150

100 [%] Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

264

Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 IC 50 38.0 µg/ml

Lonicera confusa

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 IC 50 119.5 µg/ml

Polygonatum kingianum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Cupressaceae Platycladus orientalis P6891 / 57 JF950011 IC 50 84.2 µg/ml

Platycladus orientalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 IC 50 61.0 µg/ml

Cyrtomium fortunei

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

265

Ephedraceae Ephedra sinica P6864 / 30 JF950001 IC 50 23.4 µg/ml

Ephedra sinica

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Equisetaceae Equisetum hiemale P6866 / 32 JF950003 IC 50 51.6 µg/ml

Equisetum hiemale

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Euphorbiaceae Croton tiglium P6856 / 22 - IC 50 150.4 µg/ml

Croton tiglium

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

266

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 IC 50 73.5 µg/ml Acacia catechu P6836 / 02 - IC 50 50.8 µg/ml Cassia tora P6847 / 13 JF949969 IC 50 276.9 µg/ml Desmodium styracifolium P6861 / 27 JF949976 IC 50 40.1 µg/ml Glycyrrhiza inflata P6873 / 39 JF950025 IC 50 39.0 µg/ml Spatholobus suberectus P6907 / 73 JF949991 IC 50 67.8 µg/ml Sutherlandia frutescens tba / 83 - IC 50 87.4 µg/ml

Abrus cantoniensis Acacia catechu

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Cassia tora Desmodium styracifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Glycyrrhiza inflata Spatholobus suberectus

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

267

Sutherlandia frutescens

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Geraniaceae Geranium wilfordii P6867 / 33 JF949977 IC 50 13.3 µg/ml Pelargonium sidoides tba / 82 - IC 50 18.3 µg/ml

Geranium wilfordii Pelargonium sidoides

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 IC 50 39.3 µg/ml

Ginkgo biloba

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Hypericaceae Hypericum japonicum P6876 / 42 JF949980 IC 50 23.6 µg/ml

Hypericum japonicum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

268

Iridaceae Belamcanda chinensis P6843 / 09 JF949995 IC 50 80.2 µg/ml

Belamcanda chinensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 IC 50 16.2 µg/ml Prunella vulgaris P6896 / 62 JF950013 IC 50 25.1 µg/ml Scutellaria baicalensis P6903 / 69 JF950017 IC 50 86.2 µg/ml

Mentha haplocalyx Prunella vulgaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Scutellaria baicalensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Lauraceae Cinnamomum cassia P6853 / 19 JF950023 IC 50 13.4 µg/ml

Cinnamomum cassia

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

269

Loranthaceae Taxillus chinensis P6909 / 75 JF949992 IC 50 59.2 µg/ml

Taxillus chinensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Lythraceae Punica granatum P6897 / 63 JF950014 IC 50 8.1 µg/ml

Punica granatum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 IC 50 4.3 µg/ml

Magnolia officinalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Melanthiaceae Paris polyphylla P6888 / 54 JF950010 IC 50 11.8 µg/ml

Paris polyphylla

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

270

Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 IC 50 52.1 µg/ml

Lysimachia christinae

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Myrtaceae Eucalyptus robusta P6868 / 34 - IC 50 16.3 µg/ml

Eucalyptus robusta

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 IC 50 33.2 µg/ml

Ophioglossum vulgatum

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 IC 50 27.6 µg/ml

Dendrobium loddigesii

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

271

Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 IC 50 11.7 µg/ml

Paeonia lactiflora

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Pedaliaceae Harpagophytum procumbens tba / 80 - IC 50 21.4 µg/ml

Harpagophytum procumbens

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Poaceae Cymbopogon distans P6857 / 23 JF949974 IC 50 18.9 µg/ml

Cymbopogon distans

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml] Fallopia japonica (syn. P6894 / 60 JF950004 IC 19.0 µg/ml Polygonaceae Polygonum cuspidatum) 50 Polygonum aviculare P6893 / 59 JF950012 IC 50 49.1 µg/ml Polygonum multiflorum P6895 / 61 JF949987 IC 50 62.1 µg/ml Rheum officinale P6898 / 64 JF950015 IC 50 24.5 µg/ml

Fallopia japonica Polygonum aviculare

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml] 272

Polygonum multiflorum Rheum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ranunculaceae Coptis chinensis P6855 / 21 JF950024 IC 50 0.4 µg/ml

Coptis chinensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Rosaceae Rosa chinensis P6899 / 65 - IC 50 12.5 µg/ml Rosa laevigata P6900 / 66 - IC 50 102.9 µg/ml Sanguisorba officinalis P6901 / 67 JF950016 IC 50 4.0 µg/ml

Rosa chinensis Rosa laevigata

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Sanguisorba officinalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

273

Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 IC 50 24.9 µg/ml

Hedyotis diffusa

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Rutaceae Evodia lepta P6869 / 35 JF949978 IC 50 44.4 µg/ml Evodia rutaecarpa P6870 / 36 - IC 50 29.5 µg/ml Phellodendron chinense P6890 / 56 JF949986 IC 50 14.1 µg/ml

Evodia lepta Evodia rutaecarpa

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Phellodendron chinense

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Saururaceae Houttuynia cordata P6875 / 41 JF950006 IC 50 97.6 µg/ml

Houttuynia cordata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

274

Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 IC 50 11.8 µg/ml

Kadsura longipedunculata

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 IC 50 33.4 µg/ml

Selaginella tamariscina

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 IC 50 19.0 µg/ml

Patrinia scabiosaefolia

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Verbenaceae Verbena officinalis P6910 / 76 JF950020 IC 50 20.5 µg/ml

Verbena officinalis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

275

Violaceae Viola yezoensis P6911 / 77 JF949993 IC 50 24.7 µg/ml

Viola yezoensis

150

100 [%] Survival Survival 50

0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration [µg/ml]

Zingiberaceae Alpinia galanga P6837 / 03 - IC 50 15.4 µg/ml Alpinia oxyphylla P6917 / 78 - IC 50 2.0 µg/ml

Alpinia galanga Alpinia oxyphylla

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 0.49 0.98 1.95 3.91 7.81 15.63 31.25 62.5 125 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

276

10.4.5 Water extracts: HeLa

Acanthaceae Andrographis paniculata P6838 / 04 JF949965 IC 50 576.0 µg/ml

Andrographis paniculata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Amaranthaceae Celosia cristata P6848 / 14 JF949970 IC 50 2773.5 µg/ml

Celosia cristata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Apiaceae Bupleurum chinense P6844 / 10 JF950021 IC 50 339.3 µg/ml Bupleurum marginatum P6845 / 11 JF949968 IC 50 838.1 µg/ml Centella asiatica P6849 / 15 JF950022 IC 50 1436.8 µg/ml Cnidium monnieri P6854 / 20 JF949973 IC 50 775.5 µg/ml Saposhnikovia divaricata P6902 / 68 JF949988 IC 50 1024.7 µg/ml

Bupleurum chinense Bupleurum marginatum

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

277

Centella asiatica Cnidium monnieri

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Saposhnikovia divaricata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Araliaceae Eleutherococcus senticosus P6919 / 79 - IC 50 430.0 µg/ml Panax ginseng China P8088 / 81 JF950028 IC 50 2594.6 µg/ml Panax ginseng Korea P8086 / 81 JF950029 IC 50 2594.6 µg/ml Panax notoginseng P6887 / 53 JF950030 IC 50 1574.9 µg/ml

Eleutherococcus senticosus Panax ginseng China

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Panax ginseng Korea Panax notoginseng

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

278

Arecaceae Areca catechu P6840 / 06 - IC 50 378.1 µg/ml

Areca catechu

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Asclepiadaceae Cynanchum paniculatum P6858 / 24 JF949975 IC 50 693.9 µg/ml

Cynanchum paniculatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Asteraceae Artemisia annua P6841 / 07 JF949966 IC 50 775.5 µg/ml Artemisia capillaris P6842 / 08 JF949967 IC 50 561.7 µg/ml Arctium lappa P6839 / 05 JF949994 IC 50 516.3 µg/ml Centipeda minima P6850 / 16 - IC 50 207.2 µg/ml Chrysanthemum indicum P6851 / 17 JF949971 IC 50 583.4 µg/ml Chrysanthemum morifolium P6852 / 18 JF949972 IC 50 1045.8 µg/ml Eclipta prostrata P6863 / 29 JF950000 IC 50 667.0 µg/ml Senecio scandens P6905 / 71 JF949989 IC 50 607.9 µg/ml Siegesbeckia orientalis P6906 / 72 JF949990 IC 50 542.8 µg/ml Taraxacum officinale P6908 / 74 JF950019 IC 50 708.5 µg/ml

Artemisia annua Artemisia capillaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

279

Arctium lappa Centipeda minima

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Chrysanthemum indicum Chrysanthemum morifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Eclipta prostrata Senecio scandens

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Siegesbeckia orientalis Taraxacum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

280

Berberidaceae Berberis bealei P6883 / 49 JF949996 IC 50 659.4 µg/ml Dysosma versipellis P6862 / 28 - IC 50 1274.8 µg/ml Epimedium koreanum P6865 / 31 JF950002 IC 50 280.2 µg/ml

Berberis bealei Dysosma versipellis

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Epimedium koreanum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Brassicaceae Capsella bursa-pastoris P6846 / 12 JF949997 IC 50 2406.4 µg/ml Isatis indigotica (root) P6877 / 43 JF949981 IC 50 2427.4 µg/ml Isatis indigotica (leaf) P6878 / 44 JF949981 IC 50 1223.5 µg/ml

Capsella bursa-pastoris Isatis indigotica (root)

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Isatis indigotica (leaf)

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

281

Caprifoliaceae Lonicera confusa P6880 / 46 JF949982 IC 50 812.2 µg/ml

Lonicera confusa

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Convallariaceae Polygonatum kingianum P6892 / 58 JF950027 IC 50 2321.7 µg/ml

Polygonatum kingianum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Crassulaceae Rhodiola rosea P6920 / 84 - IC 50 144.4 µg/ml

Rhodiola rosea

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Cupressaceae Platycladus orientalis P6891 / 57 JF950011 IC 50 428.2 µg/ml

Platycladus orientalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

282

Dryopteridaceae Cyrtomium fortunei P6859 / 25 JF949998 IC 50 567.4 µg/ml

Cyrtomium fortunei

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Ephedraceae Ephedra sinica P6864 / 30 JF950001 IC 50 193.1 µg/ml

Ephedra sinica

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Equisetaceae Equisetum hiemale P6866 / 32 JF950003 IC 50 1058.2 µg/ml

Equisetum hiemale

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Euphorbiaceae Croton tiglium P6856 / 22 - IC 50 1052.7 µg/ml

Croton tiglium

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

283

Fabaceae Abrus cantoniensis P6835 / 01 JF949964 IC 50 587.1 µg/ml Acacia catechu P6836 / 02 - IC 50 157.5 µg/ml Cassia tora P6847 / 13 JF949969 IC 50 1519.3 µg/ml Desmodium styracifolium P6861 / 27 JF949976 IC 50 651.4 µg/ml Glycyrrhiza inflata P6873 / 39 JF950025 IC 50 2288.0 µg/ml Spatholobus suberectus P6907 / 73 JF949991 IC 50 174.1 µg/ml Sutherlandia frutescens tba / 83 - IC 50 1670.7 µg/ml

Abrus cantoniensis Acacia catechu

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Cassia tora Desmodium styracifolium

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Glycyrrhiza inflata Spatholobus suberectus

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

284

Sutherlandia frutescens

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Geraniaceae Geranium wilfordii P6867 / 33 JF949977 IC 50 62.1 µg/ml Pelargonium sidoides tba / 82 - IC 50 62.2 µg/ml

Geranium wilfordii Pelargonium sidoides

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ginkgoaceae Ginkgo biloba P6872 / 38 JF950005 IC 50 1717.0 µg/ml

Ginkgo biloba

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Hypericaceae Hypericum japonicum P6876 / 42 JF949980 IC 50 445.5 µg/ml

Hypericum japonicum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

285

Iridaceae Belamcanda chinensis P6843 / 09 JF949995 IC 50 1378.8 µg/ml

Belamcanda chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lamiaceae Mentha haplocalyx P6884 / 50 JF949984 IC 50 519.1 µg/ml Prunella vulgaris P6896 / 62 JF950013 IC 50 341.3 µg/ml Scutellaria baicalensis P6903 / 69 JF950017 IC 50 150.0 µg/ml

Mentha haplocalyx Prunella vulgaris

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Scutellaria baicalensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lauraceae Cinnamomum cassia P6853 / 19 JF950023 IC 50 713.6 µg/ml

Cinnamomum cassia

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

286

Loranthaceae Taxillus chinensis P6909 / 75 JF949992 IC 50 1023.2 µg/ml

Taxillus chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Lythraceae Punica granatum P6897 / 63 JF950014 IC 50 152.4 µg/ml

Punica granatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Magnoliaceae Magnolia officinalis P6882 / 48 JF950008 IC 50 451.5 µg/ml

Magnolia officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Melanthiaceae Paris polyphylla P6888 / 54 JF950010 IC 50 42.6 µg/ml

Paris polyphylla

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

287

Myrsinaceae Lysimachia christinae P6881 / 47 JF949983 IC 50 431.4 µg/ml

Lysimachia christinae

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Myrtaceae Eucalyptus robusta P6868 / 34 - IC 50 15.8 µg/ml

Eucalyptus robusta

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Ophioglossaceae Ophioglossum vulgatum P6885 / 51 JF950009 IC 50 1780.1 µg/ml

Ophioglossum vulgatum

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Orchidaceae Dendrobium loddigesii P6860 / 26 JF949999 IC 50 294.4 µg/ml

Dendrobium loddigesii

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

288

Paeoniaceae Paeonia lactiflora P6886 / 52 JF950026 IC 50 287.3 µg/ml

Paeonia lactiflora

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Pedaliaceae Harpagophytum procumbens tba / 80 - IC 50 733.4 µg/ml

Harpagophytum procumbens

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Poaceae Cymbopogon distans P6857 / 23 JF949974 IC 50 486.1 µg/ml

Cymbopogon distans

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml] Fallopia japonica (syn. P6894 / 60 JF950004 IC 596.4 µg/ml Polygonaceae Polygonum cuspidatum) 50 Polygonum aviculare P6893 / 59 JF950012 IC 50 488.6 µg/ml Polygonum multiflorum P6895 / 61 JF949987 IC 50 928.0 µg/ml Rheum officinale P6898 / 64 JF950015 IC 50 670.9 µg/ml

Fallopia japonica Polygonum aviculare

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml] 289

Polygonum multiflorum Rheum officinale

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Ranunculaceae Coptis chinensis P6855 / 21 JF950024 IC 50 101.0 µg/ml

Coptis chinensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Rosaceae Rosa chinensis P6899 / 65 - IC 50 135.8 µg/ml Rosa laevigata P6900 / 66 - IC 50 781.7 µg/ml Sanguisorba officinalis P6901 / 67 JF950016 IC 50 87.0 µg/ml

Rosa chinensis Rosa laevigata

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Sanguisorba officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

290

Rubiaceae Hedyotis diffusa P6874 / 40 JF949979 IC 50 1542.7 µg/ml

Hedyotis diffusa

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Rutaceae Evodia lepta P6869 / 35 JF949978 IC 50 971.0 µg/ml Evodia rutaecarpa P6870 / 36 - IC 50 185.6 µg/ml Phellodendron chinense P6890 / 56 JF949986 IC 50 750.3 µg/ml

Evodia lepta Evodia rutaecarpa

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

Phellodendron chinense

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Saururaceae Houttuynia cordata P6875 / 41 JF950006 IC 50 2835.9 µg/ml

Houttuynia cordata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

291

Schisandraceae Kadsura longipedunculata P6879 / 45 JF950007 IC 50 167.6 µg/ml

Kadsura longipedunculata

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Selaginellaceae Selaginella tamariscina P6904 / 70 JF950018 IC 50 703.4 µg/ml

Selaginella tamariscina

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Valerianaceae Patrinia scabiosaefolia P6889 / 55 JF949985 IC 50 525.5 µg/ml

Patrinia scabiosaefolia

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Verbenaceae Verbena officinalis P6910 / 76 JF950020 IC 50 416.9 µg/ml

Verbena officinalis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

292

Violaceae Viola yezoensis P6911 / 77 JF949993 IC 50 1459.2 µg/ml

Viola yezoensis

150

100 [%] Survival Survival 50

0 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration [µg/ml]

Zingiberaceae Alpinia galanga P6837 / 03 - IC 50 2357.3 µg/ml Alpinia oxyphylla P6917 / 78 - IC 50 1802.2 µg/ml

Alpinia galanga Alpinia oxyphylla

150 150

100 100 [%] [%] Survival Survival Survival 50 50

0 0 9.8 19.5 39 78 156 313 625 1250 2500 5000 9.8 19.5 39 78 156 313 625 1250 2500 5000 Concentration Concentration [µg/ml] [µg/ml]

293

294

295