US 200700 15237A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0015237 A1 Bailey et al. (43) Pub. Date: Jan. 18, 2007
(54) PRODUCTION OF CAROTENOIDS IN Related U.S. Application Data OLEAGNOUS YEAST AND FUNG (60) Provisional application No. 60/663,621, filed on Mar. (76) Inventors: Richard Bailey, South Natick, MA 18, 2005. (US); Kevin T. Madden, Arlington, MA (US); Joshua Trueheart, Concord, Publication Classification MA (US) (51) Int. C. Correspondence Address: CI2P 23/00 (2006.01) CHOATE, HALL & STEWART LLP CI2N 15/74 (2006.01) TWO INTERNATIONAL PLACE CI2N L/18 (2007.01) BOSTON, MA 02110 (US) (52) U.S. Cl...... 435/67; 435/254.2: 435/483 (21) Appl. No.: 11/385,580 (57) ABSTRACT The present invention provides systems for producing engi (22) Filed: Mar. 20, 2006 neered oleaginous yeast or fungi that express carotenoids
Patent Application Publication Jan. 18, 2007 Sheet 2 of 26 US 2007/0015237 A1 HO ºHOOOO HO |×
S2:S.LºS:SL^S
Patent Application Publication Jan. 18, 2007 Sheet 3 of 26 US 2007/0015237 A1 3u9uodsounou
S„KS:S:~~~^S
HOHO?IHö
(~~ Patent Application Publication Jan. 18, 2007 Sheet 4 of 26 US 2007/0015237 A1
HO
Patent Application Publication Jan. 18, 2007 Sheet 6 of 26 US 2007/0015237 A1
[email protected]?ºllVNOTVARIVN
Patent Application Publication Jan. 18, 2007 Sheet 7 of 26 US 2007/0015237 A1
ddO/K)?se??uÁS dd ddI [email protected]/NOTVARVN (ddI)ame?dsoudouÁd-IÁsaule, ??OO/K)asequÁS
ddI Patent Application Publication Jan. 18, 2007 Sheet 8 of 26 US 2007/0015237 A1
Pyruvate + Glyceraldehyde-3-phosphate I DOXP synthase (dxs) CO2 1-Deoxy-'-xylulose-5-phosphate (DOXP) DOXP reductoisomerase (dxr or ispC) II (+NADPH) 2-C-Methyl-P-erythritol-4-phosphate (MEP) III CDP-ME synthase (ispl) (+ CTP) 4-(Cytidine-5'-diphospho)-2-C-methyl-P-erythritol (CDP-ME) IV CDP-ME kinase (ispE) (+ ATP) 2-Phospho-4-(Cytidine-5'-diphospho)-2-C-methyl-P-erythritol (PCDP-ME) V MECP synthase (ispF) CMP 2-C-Methyl-P-erythritol-2,4, cyclodiphosphate (MECP) VI | HMBPP synthase (ispG) 1-Hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) VII HMBPP reductase (ispH)\ (+NADH) Isopentenyl diphosphate b. Dimethylallyl diphosphate (IPP) (DMAPP) FIG. 4 Patent Application Publication Jan. 18, 2007 Sheet 9 of 26 US 2007/0015237 A1
mevalonate pathway non-mevalonate pathway (operates in humans) (operates in some human N. pathogens/not in humans) Isopentenyl diphosphate - I - Dimethylallyl diphosphate
(IPP:Cs) Isomerase (DMAPP;C3)
Head-to-tail condensation GPP synthase Phytosterols Geranyl diphosphate --> Monoterpenes (GPP; Co) t FPP synthase (+ IPP)
Squalene Synthase Squalene - Farnasyl diphosphate --> Sesquiterpenes, Triterpenes
Choosterol, Bile Acids GGPP synthase Steroids Hormones (+ IPP) (in Human) Geranylgeranyl diphosphate -> Diterpenes, Carotenoids, (GGPP; C20) Ubiquinones, Menaquinones, Plastoquinones Prenyl diphosphate synthase (+ IPP), Polyprenyl diphosphate e - Polyprenyl-phosphate (Pol-P) (Pol-PP) P (e.g. C35-C50 in Mycobacteria)
F.G. 5 Patent Application Publication Jan. 18, 2007 Sheet 10 of 26 US 2007/0015237 A1
ase?nuÁSGIGIOO@140 eseIOKO9u9dooKIA1.13
[143+
Patent Application Publication Jan. 18, 2007 Sheet 11 of 26 US 2007/0015237 A1
FPP 1s-a-s-a-le-aORP synthaseR C
phytoene crt YB synthase
dia-Phytoene 99 | Phytofluene/ crt1 Zeta-carotene
all--~~rNeuraporene 2 (I)Crf YB Crit l de?? Clell-a-r-2 (II) (III) Beta-zeacarotene Sa/Sa. LycopeneSal wn/nas-n/ n N. crt (1) erre cyclase (II) 1s n1n 1s ra s (III) S. Sat1n 1s s-a- 3,4-didehydrolycopene crt/ (I) Gamma-carotene CrtI crtYB (II) crityB cyclase (III)
Sa1a1a YS1 was n Beta-carotene kerolase
hydroxylase l hydroxylase HO O Hydroxyechinone xetolase kerolase O
HO Phoenicoxanthin O hydroxylase O OH Sales/S/S HO O Astaxanthin Patent Application Publication Jan. 18, 2007 Sheet 12 of 26 US 2007/0015237 A1
ziòNA41.?OHO1.!
140Z140Þºrs!AM Z1-40AM140 OH
Patent Application Publication Jan. 18, 2007 Sheet 13 of 26 US 2007/0015237 A1
C-carotene desaturate 7-8 ----- R M. neurosporene B cyclase8. | desaturate cyclase 7'-8" O- R ~~~~ V O- R ~~~ a-zeacarotene --~-a- R --~~~ B-zeacarotene desaturate lycopene desaturate 7'-3' 8 B 7'-8" cyclase cyclase V O- R ~~~~V O- R1a-a-a-ran/tra ras 6-CarOtene B 8 B y-caroteine cycl8 s 'cyclase cyclass. , cyciase A 15 1854' de B-caroteneR-2 23,3 8 R32,761-17 de B-caroteneR-2 P 4518 O-CarOtene16: B . B hydroxylase A hydroxylase OH OH
HO O-cryptoxanthinirr- -ZelOXal) inoxanthi- - -->f3-cryptoxanthin : B (B hydroxylase OH hydroxylase O Ra-C OH O- R-A- HO lutein HO zeaxanthin
F.G. 6D
Patent Application Publication Jan. 18, 2007 Sheet 23 of 26 US 2007/0015237 A1
pMB4628 8470 bp Patent Application Publication Jan. 18, 2007 Sheet 24 of 26 US 2007/0015237 A1
BSU361
Accó51 Patent Application Publication Jan. 18, 2007 Sheet 25 of 26 US 2007/0015237 A1
Patent Application Publication Jan. 18, 2007 Sheet 26 of 26 US 2007/0015237 A1
US 2007/0015237 A1 Jan. 18, 2007
PRODUCTION OF CAROTENOIDS IN invention also provides methods of constructing such yeast OLEAGNOUS YEAST AND FUNG and fungi, methods of using Such yeast and fungi to produce carotenoids, and methods of preparing carotenoid-contain RELATED APPLICATIONS ing compositions, such as food or feed additives, or nutri tional Supplements, using carotenoids produced in Such 0001) This application claims the benefit of U.S. Provi oleaginous yeast or fungi. In particular, the present invention sional Application No. 60/663,621, filed Mar. 18, 2005, the provides systems and methods for generating yeast and contents of which are hereby incorporated by reference in fungi containing one or more oleaginic and/or carotenogenic their entirety. modifications that increase the oleaginicity and/or alter their carotenoid-producing capabilities as compared with other BACKGROUND OF THE INVENTION wise identical organisms that lack the modification(s). 0002 Carotenoids are organic pigments ranging in color 0007. The present invention further encompasses the from yellow to red that are naturally produced by certain general recognition that lipid-accumulating systems are use organisms, including photosynthetic organisms (e.g., plants, ful for the production and/or isolation of lipophilic agents algae, cyanobacteria), and some fungi. Carotenoids are (such as, but not limited to isoprenoids, or isoprenoid responsible for the orange color of carrots, as well as the derived compounds). Thus, according to the present inven pink in flamingos and salmon, and the red in lobsters and tion, it is desirable to engineer organisms to produce Such shrimp. Animals, however, cannot produce carotenoids and lipophilic agents and/or to accumulate lipid. must receive them through their diet. 0008 Various other aspects of the present invention will 0003 Carotenoid pigments (e.g., f-carotene and astax be apparent to those of ordinary skill in the art from the anthin) are used industrially as ingredients for food and feed present description, including the appended claims. stocks, both serving a nutritional function and enhancing consumer acceptability. For example, astaxanthin is widely used in Salmon aquaculture to provide the orange coloration BRIEF DESCRIPTION OF THE DRAWING characteristic of their wild counterparts. Some carotenoids 0009 FIG. 1A-1D depicts certain common carotenoids. are also precursors of vitamin A. Also, carotenoids have antioxidant properties, and may have various health benefits 0010 FIG. 2 depicts how sufficient levels of acetyl-CoA (see, for example, Jyonouchi et al., Nutr. Cancer 16:93, and NADPH may be accumulated in the cytosol of oleagi 1991; Giovannucci et al., J. Natl. Cancer Inst. 87: 1767, nous organisms to allow for production of significant levels 1995; Miki, Pure Appl. Chem 63:141, 1991; Chew et al., of cytosolic lipids. Enzymes: 1. pyruvate decarboxylase; 2. Anticancer Res. 19:1849, 1999: Wang et al., Antimicrob. malate dehydrogenase; 3, malic enzyme: 4, pyruvate dehy Agents Chemother. 44:2452, 2000). Some carotenoids such drogenase; 5, citrate synthase; 6, ATP-citrate lyase; 7, cit as B-carotene, lycopene, and lutein are currently sold as rate/malate translocase. nutritional Supplements. 0011 FIGS. 3A and 3B depict the mevalonate isoprenoid 0004. In general, the biological systems that produce biosynthesis pathway, which typically operates in eukary carotenoids are industrially intractable and/or produce the otes, including fungi. compounds at Such low levels that commercial scale isola 0012 FIG. 4 depicts the mevalonate-independent iso tion is not practicable. Thus, most carotenoids used in prenoid biosynthesis pathway, also known as the DXP industry are produced by chemical synthesis. There is a need pathway, which typically operates in bacteria and in the for improved biological systems that produce carotenoids. plastids of plants. Some efforts have previously been made to genetically engineer certain bacteria or fungi to produce higher levels of 0013 FIG. 5 depicts intermediates in the isoprenoid carotenoids (see, for example, Misawa et al., J. Biotechnol. biosynthesis pathway and how they feed into biosynthetic 59:169, 1998: Visser et al., FEMS Yeast Research 4:221, pathways of other biomolecules, including carotenoids as 2003). However, improved systems, allowing higher levels well as non-carotenoid compounds such as Sterols, steroids, of production and greater ease of isolation, are needed. and vitamins, such as vitamin E or vitamin K. 0014 FIGS. 6A-6D illustrate various carotenoid biosyn SUMMARY OF THE INVENTION thetic pathways. FIG. 6A highlights branches leading to 0005 The present invention provides improved systems various cyclic and acyclic Xanthophylls: FIG. 6B shows for the biological production of carotenoids. In one aspect, certain X. dendrorhous pathways that generate dicyclic and the invention encompasses the discovery that it is desirable monocyclic carotenoids, including astaxanthin; FIG. 6C to produce carotenoids in oleaginous organisms. Without shows interconnecting pathways for converting B-carotene wishing to be bound by any particular theory, the present into any of a variety of other carotenoids, including astax inventors propose that biological systems may be able to anthin; FIG. 6D depicts possible routes of synthesis of cyclic accumulate higher levels of carotenoids if the compounds carotenoids and common plant and algal Xanthophylls from are sequestered in lipid bodies. Regardless of whether abso neurosporene. lute levels are higher, however, carotenoids that are accu 0.015 FIGS. 7A-7C show an alignment of certain repre mulated within lipid bodies in oleaginous organisms are sentative fungal HMG-CoA reductase polypeptides. As can readily isolatable through isolation of the lipid bodies. be seen, these polypeptides show very high identity across 0006 The present invention therefore provides oleagi the catalytic region, and also have complex membrane nous fungi (including, for example, yeast or other unicellular spanning domains. In some embodiments of the invention, fungi) that produce one or more carotenoids. The present these membrane-spanning domains are disrupted or are US 2007/0015237 A1 Jan. 18, 2007 removed, so that, for example, a hyperactive version of the pounds having a conjugated polyene carbon skeleton for polypeptide may be produced. mally derived from the five-carbon compound 1 PP, includ ing triterpenes (Cso diapocarotenoids) and tetraterpenes (Cao 0016 FIGS. 8A-8D depict schematic representations of carotenoids) as well as their oxygenated derivatives and plasmids generated and described in detail in the exempli other compounds that are, for example, Cas, Cso, Co, Czo. fication. Cso in length or other lengths. Many carotenoids have strong light absorbing properties and may range in length in excess DEFINITIONS of Coo. Co diapocarotenoids typically consist of six iso 0017 Carotenogenic modification: The term “caroteno prenoid units joined in Such a manner that the arrangement genic modification', as used herein, refers to a modification of isoprenoid units is reversed at the center of the molecule of a host organism that adjusts production of one or more so that the two central methyl groups are in a 1.6-positional carotenoids, as described herein. For example, a caroteno relationship and the remaining non-terminal methyl groups genic modification may increase the production level of one are in a 1.5-positional relationship. Such Co carotenoids or more carotenoids, and/or may alter relative production may be formally derived from the acyclic CoH structure, levels of different carotenoids. In principle, an inventive having a long central chain of conjugated double bonds, by: carotenogenic modification may be any chemical, physi (i) hydrogenation (ii) dehydrogenation, (iii) cyclization, (iv) ological, genetic, or other modification that appropriately oxidation, (v) esterification/glycosylation, or any combina alters production of one or more carotenoids in a host tion of these processes. Cao carotenoids typically consist of organism produced by that organism as compared with the eight isoprenoid units joined in Such a manner that the level produced in an otherwise identical organism not Sub arrangement of isoprenoid units is reversed at the center of ject to the same modification. In most embodiments, how the molecule so that the two central methyl groups are in a ever, the carotenogenic modification will comprise a genetic 1.6-positional relationship and the remaining non-terminal modification, typically resulting in increased production of methyl groups are in a 1.5-positional relationship. Such Cao one or more selected carotenoids. In some embodiments, the carotenoids may be formally derived from the acyclic CHs. selected carotenoid is one or more of astaxanth in, B-caro structure, having a long central chain of conjugated double tene, canthaxanth in, lutein, lycopene, phytoene, Zeaxanth bonds, by (i) hydrogenation, (ii) dehydrogenation, (iii) in, and/or modifications of Zeaxanthin or astaxanthin (e.g., cyclization, (iv) oxidation, (V) esterification/glycosylation, glucoside, esterified Zeaxanthin or astaxanthin). In some or any combination of these processes. The class of Cao embodiments, the selected carotenoid is one or more Xan carotenoids also includes certain compounds that arise from thophylls, and/or a modification thereof (e.g., glucoside, rearrangements of the carbon skeleton, or by the (formal) esterified xanthophylls). In certain embodiments, the removal of part of this structure. More than 600 different selected Xanthophyl is selected from the group consisting of carotenoids have been identified in nature; certain common carotenoids are depicted in FIG. 1. Carotenoids include but astaxanthin, lutein, Zeaxanthin, lycopene, and modifications are not limited to: antheraxanthin, adonirubin, adonixanthin, thereof. In some embodiments, the selected carotenoid is astaxanthin, canthaxanthin, capsorubrin, 3-cryptoxanthin, one or more of astaxanthin, B-carotene, canthaxanthin, C-carotene, B-carotene, B. p-carotene, 6-carotene, e-caro lutein, lycopene, and Zeaxanthin and/or modifications of tene, echinenone, 3-hydroxyechinenone, 3'-hydrox Zeaxanthin or astaxanthin. In some embodiments, the caro yechinenone, Y-carotene, up-carotene, 4-keto-y-carotene, tenoid is B-carotene. In some embodiments, the selected -carotene, C-cryptoxanthin, deoxyflexixanthin, diatoxan carotenoid is astaxanthin. In some embodiments, the thin, 7,8-didehydroastaxanthin, didehydrolycopene, fucox selected carotenoid is other than B-carotene. anthin, fucoxanthinol, isorenieratene, B-isorenieratene, lac 0018 Carotenogenicpolypeptide: The term “caroteno tucaxanthin, lutein, lycopene, myxobactone, neoxanthin, genic polypeptide', as used herein, refers to any polypeptide neurosporene, hydroxyneurosporene, peridinin, phytoene, that is involved in the process of producing carotenoids in a rhodopin, rhodopin glucoside, 4-keto-rubixanthin, sipho cell, and may include polypeptides that are involved in naxanthin, spheroidene, spheroidenone, spirilloxanthin, processes other than carotenoid production but whose activi torulene, 4-keto-torulene, 3-hydroxy-4-keto-torulene, uri ties affect the extent or level of production of one or more olide, uriolide acetate, violaxanthin, Zeaxanthin-3-digluco carotenoids, for example by scavenging a substrate or reac side, Zeaxanthin, and C30 carotenoids. Additionally, caro tant utilized by a carotenoid polypeptide that is directly tenoid compounds include derivatives of these molecules, involved in carotenoid production. Carotenogenic polypep which may include hydroxy-, methoxy-, oxo-, epoxy-, car tides include isoprenoid biosynthesis polypeptides, caro boxy-, or aldehydic functional groups. Further, included tenoid biosynthesis polypeptides, and isoprenoid biosynthe carotenoid compounds include ester (e.g., glycoside ester, sis competitor polypeptides, as those terms are defined fatty acid ester) and Sulfate derivatives (e.g., esterified herein. The term also encompasses polypeptides that may Xanthophylls). affect the extent to which carotenoids are accumulated in 0020 Carotenoid biosynthesis polypeptide: The term lipid bodies. “carotenoid biosynthesis polypeptide' refers to any 0.019 Carotenoid: The term “carotenoid is understood in polypeptide that is involved in the synthesis of one or more the art to refer to a structurally diverse class of pigments carotenoids. To mention but a few, these carotenoid biosyn derived from isoprenoid pathway intermediates. The com thesis polypeptides include, for example, polypeptides of mitment step in carotenoid biosynthesis is the formation of phytoene synthase, phytoene dehydrogenase (or desaturase), phytoene from geranylgeranyl pyrophosphate. Carotenoids lycopene cyclase, carotenoid ketolase, carotenoid hydroxy can be acyclic or cyclic, and may or may not contain oxygen, lase, astaxanthin synthase, carotenoid epsilon hydroxylase, so that the term carotenoids include both carotenes and lycopene cyclase (beta and epsilon Subunits), carotenoid Xanthophylls. In general, carotenoids are hydrocarbon com glucosyltransferase, and acyl CoA:diacyglycerol acyltrans US 2007/0015237 A1 Jan. 18, 2007 ferase. Representative examples of carotenoid biosynthesis for isoprenoid biosynthesis. Each of these proteins is also an polypeptide sequences are presented in Tables 17-25. isoprenoid biosynthesis polypeptide for purposes of the present invention, and sequences of representative examples 0021 Gene: The term “gene', as used herein, generally refers to a nucleic acid encoding a polypeptide, optionally of these enzymes are provided in Tables 7-15. including certain regulatory elements that may affect expres 0027 Isoprenoidpathway: The "isoprenoid pathway' is sion of one or more gene products (i.e., RNA or protein). understood in the art to refer to a metabolic pathway that either produces or utilizes the five-carbon metabolite iso 0022 Heterologous: The term "heterologous', as used pentyl pyrophosphate (IPP). As discussed herein, two dif herein to refer to genes or polypeptides, refers to a gene or ferent pathways can produce the common isoprenoid pre polypeptide that does not naturally occur in the organism in cursor IPP the “mevalonate pathway' and the “non which it is being expressed. It will be understood that, in mevalonate pathway'. The term “soprenoid pathway' is general, when a heterologous gene or polypeptide is selected Sufficiently general to encompass both of these types of for introduction into and/or expression by a host cell, the pathway. Biosynthesis of isoprenoids from IPP occurs by particular source organism from which the heterologous polymerization of several five-carbon isoprene subunits. gene or polypeptide may be selected is not essential to the Isoprenoid metabolites derived from IPP are of varying size practice of the present invention. Relevant considerations and chemical structure, including both cyclic and acyclic may include, for example, how closely related the potential molecules. Isoprenoid metabolites include, but are not lim Source and host organisms are in evolution, or how related ited to, monoterpenes, sesquiterpenes, diterpenes, Sterols, the source organism is with other source organisms from and polyprenols such as carotenoids. which sequences of other relevant polypeptides have been selected. 0028 Oleaginic modification: The term "oleaginic modi fication', as used herein, refers to a modification of a host 0023 Host cell: As used herein, the “host cell is a yeast organism that adjusts the desirable oleaginy of that host or fungal cell that is manipulated according to the present organism, as described herein. In some cases, the host invention to accumulate lipid and/or to express one or more organism will already be oleaginous in that it will have the carotenoids as described herein. A "modified host cell', as ability to accumulate lipid to at least about 20% of its dry that term is used herein, is a host cell that contains at least cell weight. It may nonetheless be desirable to apply an one oleaginic modification and/or at least one carotenogenic oleaginic modification to such an organism, in accordance modification according to the present invention. with the present invention, for example to increase (or, in 0024. Isolated: The term "isolated, as used herein, Some cases, possibly to decrease) its total lipid accumula means that the isolated entity has been separated from at tion, or to adjust the types or amounts of one or more least one component with which it was previously associ particular lipids it accumulates (e.g., to increase relative ated. When most other components have been removed, the accumulation of triacylglycerol). In other cases, the host isolated entity is “purified'. Isolation and/or purification organism may be non-olleaginous (though may contain some may be performed using any techniques known in the art enzymatic and regulatory components used in other organ including, for example, fractionation, extraction, precipita isms to accumulate lipid), and may require oleaginic modi tion, or other separation. fication in order to become oleaginous in accordance with the present invention. The present invention also contem 0.025 Isoprenoid biosynthesis competitor polypeptide: plates application of oleaginic modification to non-olleagi The term "isoprenoid biosynthesis competitor polypeptide'. nous host strains such that their oleaginicity is increased as used herein, refers to a polypeptide whose expression in even though, even after being modified, they may not be a cell reduces the level of geranylgeranyl diphosphate oleaginous as defined herein. In principle, the oleaginic (GGPP) available to enter the carotenoid biosynthesis path modification may be any chemical, physiological, genetic, way. For example, isoprenoid biosynthesis competitor or other modification that appropriately alters oleaginy of a polypeptides include enzymes that act on isoprenoid inter host organism as compared with an otherwise identical mediates prior to GGPP, such that less GGPP is generated organism not subjected to the oleaginic modification. In (see, for example, FIG. 5). Squalene synthase is but one most embodiments, however, the oleaginic modification will isoprenoid biosynthesis competitor polypeptide according to comprise a genetic modification, typically resulting in the present invention; representative squalene synthase increased production and/or activity of one or more ole sequences are presented in Table 16. Prenyidiphosphate aginic polypeptides. In some embodiments, the oleaginic synthase enzymes and para-hydroxybenzoate (PHB) poly modification comprises at least one chemical, physiological, prenyltransferase are yet additional isoprenoid biosynthesis genetic, or other modification; in other embodiments, the competitor polypeptides according to the present invention; oleaginic modification comprises more than one chemical, representative prenyldiphosphate synthase enzymes and physiological, genetic, or other modification. In certain PHB polyprenyltransferase polypeptides are presented in aspects where more than one modification is utilized. Such Table 29 and 30 respectively. modifications can comprise any combination of chemical, 0026 Isoprenoid biosynthesis polypeptide: The term physiological, genetic, or other modification (e.g., one or "isoprenoid biosynthesis polypeptide' refers to any more genetic modification and chemical or physiological polypeptide that is involved in the synthesis of isoprenoids. modification). For example, as discussed herein, acetoacetyl-CoA thiolase, 0029 Oleaginicpolypeptide: The term “oleaginic HMG-CoA synthase, HMG-CoA reductase, mevalonate polypeptide', as used herein, refers to any polypeptide that kinase, phosphomevalonate kinase, mevalonate pyrophos is involved in the process of lipid accumulation in a cell and phate decarboxylase, IPP isomerase, FPP synthase, and may include polypeptides that are involved in processes GGPP synthase, are all involved in the mevalonate pathway other than lipid biosynthesis but whose activities affect the US 2007/0015237 A1 Jan. 18, 2007
extent or level of accumulation of one or more lipids, for 90% or even 95%, 96%, 97%, 98%, or 99% in one or more example by Scavenging a Substrate or reactant utilized by an highly conserved regions (e.g., isocitrate dehydrogenase oleaginic polypeptide that is directly involved in lipid accu polypeptides often share a conserved AMP-binding motif: mulation. For example, as discussed herein, acetyl-CoA HMG-CoA reductase polypeptides typically include a carboxylase, pyruvate decarboxylase, isocitrate dehydroge highly conserved catalytic domain (see, for example, FIG. nase, ATP-citrate lyase, malic enzyme, and AMP deaminase, 7); acetyl coA carboxylase typically has a carboxyl trans among other proteins, are all involved in lipid accumulation ferase domain; see, for example, Downing et al., Chem. Abs. in cells. In general, reducing the activity of pyruvate decar boxylase or isocitrate dehydrogenase, and/or increasing the 93:484, 1980; Gilet al., Cell 41:249, 1985; Jitrapakdee et al. activity of acetyl CoA carboxylase, ATP-citrate lyase, malic Curr Protein Pept Sci. 4:217, 2003: U.S. Pat. No. 5,349,126, enzyme and/or AMP deaminase is expected to promote each of which is incorporated herein by reference in its oleaginy. Each of these proteins is an oleaginic polypeptide entirety), usually encompassing at least 3-4 and often up to for purposes of the present invention, and sequences of 20 or more amino acids, with another polypeptide of the representative examples of these enzymes are provided in same class, is encompassed within the relevant term Tables 1-6. “olypeptide' as used herein. 0030 Oleaginous: The term “oleaginous”, refers to the 0032 Source organism: The term “source organism’, as ability of an organism to accumulate lipid to at least about used herein, refers to the organism in which a particular 20% of its dry cell weight. In certain embodiments of the polypeptide sequence can be found in nature. Thus, for invention, oleaginous yeast or fungi accumulate lipid to at example, if one or more heterologous polypeptides is/are least about 25% of their dry cell weight. In other embodi being expressed in a host organism, the organism in which ments, inventive oleaginous yeast or fungi accumulate lipid the polypeptides are expressed in nature (and/or from which within the range of about 20-45% of their dry cell weight. In their genes were originally cloned) is referred to as the Some embodiments, oleaginous organisms may accumulate “source organism'. Where more than one heterologous lipid to as much as about 70% of their dry cell weight. In polypeptides are being expressed in a host organism, one or Some embodiments of the invention, oleaginous organisms more source organism(s) may be utilized for independent may accumulate a large fraction of total lipid accumulation selection of each of the heterologous polypeptide(s). It will in the form of triacylglycerol. In certain embodiments, the be appreciated that any and all organisms that naturally majority of the accumulated lipid is in the form of triacylg contain relevant polypeptide sequences may be used as lycerol. Alternatively or additionally, the lipid may accumu source organisms in accordance with the present invention. late in the form of intracellular lipid bodies, or oil bodies. In Representative source organisms include, for example, ani certain embodiments, the present invention utilizes yeast or mal, mammalian, insect, plant, fungal, yeast, algal, bacterial, fungi that are naturally oleaginous. In some aspects, natu cyanobacterial, archaebacterial and protozoal source organ rally oleaginous organisms are manipulated (e.g., geneti 1SS. cally, chemically, or otherwise) So as to futher increase the level of accumulated lipid in the organism. In other embodi DETAILED DESCRIPTION OF CERTAIN ments, yeast or fungi that are not naturally oleaginous are PREFERRED EMBODIMENTS OF THE manipulated (e.g., genetically, chemically, or otherwise) to INVENTION accumulate lipid as described herein. For the purposes of the present invention, Xanthophyllomyces dendrorhous (Phafia 0033. As noted above, the present invention encompasses rhodozyma) and Candida utilis are not naturally oleaginous the discovery that carotenoids can desirably be produced in fungi. oleaginous yeast and fungi. According to the present inven tion, strains that both (i) accumulate lipid, often in the form 0031 Polypeptide: The term “polypeptide', as used of cytoplasmic oil bodies and typically to at least about 20% herein, generally has its art-recognized meaning of a poly of their dry cell weight; and (ii) produce carotenoid(s) at a mer of at least three amino acids. However, the term is also level at least about 1%, and in some embodiments at least used to refer to specific functional classes of polypeptides, about 3-20%, of their dry cell weight, are generated through Such as, for example, oleaginic polypeptides, carotenogenic manipulation of host cells (i.e., Strains, including, e.g., polypeptides, isoprenoid biosynthesis polypeptides, caro naturally-occurring strains, strains which have been previ tenoid biosynthesis polypeptides, and isoprenoid biosynthe ously modified, etc.). These manipulated host cells are then sis competitor polypeptides. For each Such class, the present used to produce carotenoids, so that carotenoids that parti specification provides several examples of known sequences tion into the lipid bodies can readily be isolated. of such polypeptides. Those of ordinary skill in the art will appreciate, however, that the term “polypeptide' is intended 0034. In general, it will be desirable to balance oleaginy to be sufficiently general as to encompass not only polypep and carotenoid production in inventive cells such that, as tides having the complete sequence recited herein (or in a Soon as a minimum desirable level of oleaginy is achieved, reference or database specifically mentioned herein), but substantially all further carbon which is capable of being also to encompass polypeptides that represent functional utilized and diverted into biosynthesis of products is fragments (i.e., fragments retaining at least one activity) of diverted into a carotenoid production pathway. In some Such complete polypeptides. Moreover, those of ordinary embodiments of the invention, this strategy involves engi skill in the art understand that protein sequences generally neering cells to be oleaginous; in other embodiments, it tolerate Some Substitution without destroying activity. Thus, involves engineering cells to accumulate a higher level of any polypeptide that retains activity and shares at least about lipid, particularly cytoplasmic lipid, than they would accu 30-40% overall sequence identity, often greater than about mulate in the absence of Such engineering even though the 50%. 60%, 70%, or 80%, and further usually including at engineered cells may not become "oleaginous” as defined least one region of much higher identity, often greater than herein. In other embodiments, the extent to which an ole US 2007/0015237 A1 Jan. 18, 2007 aginous host cell accumulates lipid is actually reduced so Cryptococcus curvatus, Cunninghamella echinulata, C. that remaining carbon can be utilized in carotenoid produc elegans, C. japonica, Lipomyces starkeyi, L. lipoferus, Mor tion. tierella alpina, M. isabellina, M. ramanniana, M. vinacea, Mucor circinelloides, Phycomyces blakesleanus, Pythium Host Cells irregulare, Rhodosporidium toruloides, Rhodotorula glutin 0035) Those of ordinary skill in the art will readily is, R. gracilis, R. graminis, R. mucilaginosa, R. pinicola, appreciate that a variety of yeast and fungal strains exist that TrichospOron pullans, T. cutaneum, and Yarrowia lipolytica are naturally oleaginous or that naturally produce caro are used. tenoids. Any of Such strains may be utilized as host strains 0038. Of these naturally oleaginous strains, some also according to the present invention, and may be engineered naturally produce carotenoids and some do not. In most or otherwise manipulated to generate inventive oleaginous, cases, only low levels (less than about 0.05% dry cell carotenoid-producing strains. Alternatively, strains that weight) of carotenoids are produced by naturally-occurring naturally are neither oleaginous nor carotenoid-producing carotenogenic, oleaginous yeast or fungi. Higher levels of may be employed. Furthermore, even when a particular Bcarotene are sometimes produced, but high levels of other strain has a natural capacity for oleaginy or for carotenoid production, its natural capabilities may be adjusted as carotenoids are generally not observed. described herein, so as to change the production level of 0039. In general, any organism that is naturally oleagi lipid and/or carotenoid. In certain embodiments engineering nous and non-carotenoid-producing (e.g., produce less than or manipulation of a strain results in modification of a type about 0.05% dry cell weight, do not produce the carotenoid of lipid and/or carotenoid which is produced. For example, of interest) may be utilized as a host cell in accordance with a strain may be naturally oleaginous and/or carotenogenic, the present invention. In some embodiments, the organism is however engineering or modification of the strain may be a yeast or fungus from a genus Such as, but not limited to, employed so as to change the type of lipid which is accu Candida, Cryptococcus, Cunninghamella, Lipomyces, Mor mulated and or to change the type of carotenoid which is tierella, Pythium, Tricho sporon, and Yarrowia; in some produced. embodiments, the organism is of a species including, but not limited to, Mortierella alpina and Yarrowia lipolytica. 0.036 When selecting a particular yeast or fungal strain for use in accordance with the present invention, it will 0040 Comparably, the present invention may utilize any generally be desirable to select one whose cultivation char naturally oleaginous, carotenoid-producing organism as a acteristics are amenable to commercial scale production. For host cell. In general, the present invention may be utilized to example, it will generally (though not necessarily always) be increase carbon flow into the isoprenoid pathway in natu desirable to avoid filamentous organisms, or organisms with rally carotenoid-producing organisms (particularly for particularly unusual or Stringent requirements for growth organisms other than Blakeslea and Phycomyces), and/or to conditions. However, where conditions for commercial scale shift production from one carotenoid (e.g., B-carotene) to production can be applied which allow for utilization of another (e.g., astaxanthin). Introduction of one or more filamentous organisms, these may be selected as host cells. carotenogenic modifications (e.g., increased expression of In some embodiments of the invention, it will be desirable one or more endogenous or heterologous carotenogenic to utilize edible organisms as host cells, as they may polypeptides), in accordance with the present invention, can optionally be formulated directly into food or feed additives, achieve these goals. or into nutritional Supplements, as desired. For ease of 0041. In certain embodiments of the invention, the uti production, Some embodiments of the invention utilize host lized oleaginous, carotenoid-producing organism is a yeast cells that are genetically tractable, amenable to molecular genetics (e.g., can be efficiently transformed, especially with or fungus, for example of a genus Such as, but not limited to, established or available vectors; optionally can incorporate Blakeslea, Mucor, Phycomyces, Rhodosporidium, and and/or integrate multiple genes, for example sequentially; Rhodotorula; in some embodiments, the organism is of a and/or have known genetic sequence; etc), devoid of com species such as, Mucor circinelloides and Rhodotorula glu plex growth requirements (e.g., a necessity for light), meso timis. philic (e.g., prefer growth temperatures with in the range of 0042. When it is desirable to utilize strains that are about 25-32° C.), able to assimilate a variety of carbon and naturally non-olleaginous as host cells in accordance with the nitrogen sources and/or capable of growing to high cell present invention, genera of non-olleaginous yeast or fungi density. Alternatively or additionally, various embodiments include, but are not limited to, Aspergillus, Botrytis, Cer of the invention utilize host cells that grow as single cells cospora, Fusarium (Gibberella), Kluyveromyces, Neuro rather than multicellular organisms (e.g., as mycelia). spora, Penicillium, Pichia (Hansenula), Puccinia, Saccha 0037. In general, when it is desirable to utilize a naturally romyces, Sclerotium, Trichoderma, and Xanthophyllomyces oleaginous organism in accordance with the present inven (Phaffia); in some embodiments, the organism is of a species tion, any modifiable and cultivatable oleaginous organism including, but not limited to, Aspergillus nidulans, A. niger, may be employed. In certain embodiments of the invention, A. terreus, Botrytis cinerea, Cercospora nicotianae, yeast or fungi of genera including, but not limited to, Fusarium filikuroi (Gibberella zeae), Kluyveromyces lactis, Blakeslea, Candida, Cryptococcus, Cunninghamella, Lipo K. lactis, Neurospora crassa, Pichia pastoris, Puccinia myces, Mortierella, Mucor, Phycomyces, Pythium, Rho distincta, Saccharomyces cerevisiae, Sclerotium rolfsii, Tri dosporidium, Rhodotorula, TrichospOron, and Yarrowia are choderma reesei, and Xanthophyllomyces dendrorhous employed. In certain particular embodiments, organisms of (Phafia rhodozyma). species that include, but are not limited to, Blakeslea 0043. It will be appreciated that the term “non-olleagi trispora, Candida pulcherrima, C. revkaufi, C. tropicalis, nous”, as used herein, encompasses both Strains that natu US 2007/0015237 A1 Jan. 18, 2007
rally have some ability to accumulate lipid, especially cyto Gibberella are considered relatively tractable from an plasmically, but do not do so to a level Sufficient to qualify experimental standpoint. Both are filamentous fungi, Such as “oleaginous” as defined herein, as well as strains that do that production at commercial scales can be a challenge not naturally have any ability to accumulate extra lipid, e.g., necessary to overcome in utilization of Such strains. extra-membranous lipid. It will further be appreciated that, in some embodiments of the invention, it will be sufficient 0050 Mucor circinelloides is another available useful to increase the natural level of oleaginy of a particular host species. While its molecular genetics are generally less cell, even if the modified cell does not qualify as oleaginous accessible than are those of some other organisms, it natu as defined herein. rally produces B-carotene, thus may require less modifica tion than other species available. 0044 As with the naturally oleaginous organisms, some of the naturally non-olleaginous fungi naturally produce 0051 Molecular genetics can be performed in Blakeslea, carotenoids, whereas others do not. Genera of naturally though significant effort may be required. Furthermore, non-olleaginous fungi that do not naturally produce caro cost-effective fermentation conditions can be challenging, tenoids (e.g., produce less than about 0.05% dry cell weight, as, for example, it may be required that the two mating types do not produce carotenoid of interest) may desirably be used are mixed. Fungi of the genus Phycomyces are also possible as host cells in accordance with the present invention Sources which have the potential to pose fermentation pro include, but are not limited to, Aspergillus, Kluyveromyces, cess challenges, and these fungi are also may be less Penicillium, Saccharomyces, and Pichia; species include, amenable to manipulate than several other potential host but are not limited to, Aspergillus niger and Saccharomyces organisms. cerevisiae. Genera of naturally non-olleaginous fungi that do 0052 Those of ordinary skill in the art will appreciate naturally produce carotenoids and that may desirably be that the selection of a particular host cell for use in accor used as host cells in accordance with the present invention dance with the present invention will also affect, for include, but are not limited to. Botrytis, Cercospora, example, the selection of expression sequences utilized with Fusarium (Gibberella), Neurospora, Puccinia, Sclerotium, any heterologous polypeptide to be introduced into the cell, Trichoderma, and Xanthophyllomyces (Phaffia); species and will also influence various aspects of culture conditions, include, but are not limited to, Xanthophyllomyces dendror etc. Much is known about the different gene regulatory hous (Phafia rhodozyma). requirements, protein targeting sequence requirements, and 0045. As discussed above, any of a variety of organisms cultivation requirements, of different host cells to be utilized may be employed as host cells in accordance with the in accordance with the present invention (see, for example, present invention. In certain embodiments of the invention, with respect to Yarrowia, Barth et al. FEMS Microbiol Rev. host cells will be Yarrowia lipolytica cells. Advantages of Y 19:219, 1997: Madzak et al. J Biotechnol. 109:63, 2004; see, lipolytica include, for example, tractable genetics and for example, with respect to Xanthophyllomyces, Verdoes et molecular biology, availability of genomic sequence (see, al. Appl Environ Microbiol 69: 3728-38, 2003; Visser et al. for example. Sherman et al. Nucleic Acids Res. 32(Database FEMS Yeast Res 4: 221-31, 2003; Martinez et al. Antonie issue):D315-8, 2004), suitability to various cost-effective Van Leeuwenhoek. 73(2): 147-53, 1998; Kim et al. Appl growth conditions, and ability to grow to high cell density. Environ Microbiol. 64(5):1947-9, 1998; Wery et al. Gene. In addition, Y lipolytica is naturally oleaginous, Such that 184(1):89-97, 1997: see, for example, with respect to Sac fewer manipulations may be required to generate an oleagi charomyces, Guthrie and Fink Methods in Enzymology nous, carotenoid-producing Y lipolytica strain than might be 194: 1-933, 1991). In certain aspects, for example, targeting required for other organisms. Furthermore, there is already sequences of the host cell (or closely related analogs) may extensive commercial experience with Y lipolytica. be useful to include for directing heterologous proteins to Subcellular localization. Thus, such useful targeting 0046 Saccharomyces cerevisiae is also a useful host cell sequences can be added to heterologous sequence for proper in accordance with the present invention, particularly due to intracellular localization of activity. In other aspects (e.g., its experimental tractability and the extensive experience addition of mitochondrial targeting sequences), heterolo that researchers have accumulated with the organism. gous targeting sequences may be eliminated or altered in the Although cultivation of Saccharomyces under high carbon selected heterologous sequence (e.g., alteration or removal conditions may result in increased ethanol production, this of Source organism plant chloroplast targeting sequences). can generally be managed by process and/or genetic alter ations. Engineering Oleaginy 0047. Additional useful hosts include Xanthophyllomy 0053 All living organisms synthesize lipids for use in ces dendrorhous (Phafia rhodozyma), which is experimen their membranes and various other structures. However, tally tractable and naturally carotenogenic. Xanthophyllo most organisms do not accumulate in excess of about 10% myces dendrorhous (Phafia rhodozyma) strains can produce of their dry cell weight as total lipid, and most of this lipid several carotenoids, including astaxanthin. generally resides within cellular membranes. 0.048 Aspergillus niger and Mortierella alpina accumu 0054 Significant biochemical work has been done to late large amounts of citric acid and fatty acid, respectively; define the metabolic enzymes necessary to confer oleaginy Mortierella alpina is also oleaginous. on microorganisms (primarily for the purpose of engineering single cell oils as commercial Sources of arachidonic acid 0049 Neurospora or Gibberella are also useful. They are and docosahexaenoic acid; see for example Ratledge Bio not naturally oleaginous and tend to produce very low levels chimie 86:807, 2004, the entire contents of which are of carotenoids, thus extensive modification may be required incorporated herein by reference). Although this biochemi in accordance with the present invention. Neurospora and cal work is compelling, prior to the present invention, there US 2007/0015237 A1 Jan. 18, 2007 have been no reports of de novo oleaginy being established comparable activity, although it is expected that a dedicated through genetic engineering with the genes encoding the key source of NADPH is probably required for fatty acid syn metabolic enzymes. thesis (see, for example, Wynn et al., Microbiol 145:1911, 0055. It should be noted that oleaginous organisms typi 1999; Ratledge Adv. Appl. Microbiol. 51:1, 2002, each of cally only accumulate lipid when grown under conditions of which is incorporated herein by reference in its entirety). carbon excess and nitrogen or other nutrient limitation. Under these conditions, the organism readily depletes the 0061 Thus, according to the present invention, the ole limiting nutrient but continues to assimilate the carbon aginy of a host organism may be enhanced by modifying the source. The “excess' carbon is channeled into lipid biosyn expression or activity of one or more polypeptides involved thesis so that lipids (usually triacylglycerols) accumulate in in generating cytosolic acetyl-CoA and/or NADPH. For example, modification of the expression or activity of one or the cytosol, typically in the form of bodies. more of acetyl-CoA carboxylase, pyruvate decarboxylase, 0056. In general, it is thought that, in order to be oleagi isocitrate dehydrogenase, ATP-citrate lyase, malic enzyme, nous, an organism must produce both acetyl-CoA and and AMP-deaminase can enhance oleaginy in accordance NADPH in the cytosol, which can then be utilized by the with the present invention. Exemplary polypeptides which fatty acid synthase machinery to generate lipids. In at least can be utilized or derived so as to enhance oleaginy in Some oleaginous organisms, acetyl-CoA is generated in the accordance with the present invention include, but are not cytosol through the action of ATP-citrate lyase, which cata limited to those acetyl-CoA carboxylase, pyruvate decar lyzes the reaction: boxylase, isocitrate dehydrogenase, ATP-citrate lyase, malic state:CoA-ATP-acetyl-CoA:oxaloacetate ADP- (1) enzyme, and AMP-deaminase polypeptides provided in Table 1, Table 2, Table 3, Table 4, Table 5, and Table 6, 0057 Of course, in order for ATP-citrate lyase to generate respectively. appropriate levels of acetyl-CoA in the cytosol, it must first have an available pool of its substrate citric acid. Citric acid 0062. In some embodiments of the invention, where an is generated in the mitochondria of all eukaryotic cells oleaginous host cell is employed, enzymes and regulatory through the tricarboxylic acid (TCA) cycle, and can be components relevant to oleaginy are already in place but moved into the cytosol (in exchange for malate) by citrate/ could be modified, if desired, by for example altering malate translocase. expression or activity of one or more oleaginic polypeptides and/or by introducing one or more heterologous oleaginic 0058. In most oleaginous organisms, and in some non polypeptides. In those embodiments of the invention where oleaginous organisms, the enzyme isocitrate dehydrogenase, a non-olleaginous host cell is employed, it is generally which operates as part of the TCA cycle in the mitochondria, expected that at least one or more heterologous oleaginic is strongly AMP-dependent. Thus, when AMP is depleted polypeptides will be introduced. from the mitochondria, this enzyme is inactivated. When isocitrate dehydrogenase is inactive, isocitrate accumulates 0063. The present invention contemplates not only intro in the mitochondria. This accumulated isocitrate is then duction of heterologous oleaginous polypeptides, but also equilibrated with citric acid, presumably through the action adjustment of expression or activity levels of heterologous of aconitase. Therefore, under conditions of low AMP. or endogenous oleaginic polypeptides, including, for citrate accumulates in the mitochondria. As noted above, example, alteration of constitutive or inducible expression mitochondrial citrate is readily transported into the cytosol. patterns. In some embodiments of the invention, expression patterns are adjusted Such that growth in nutrient-limiting 0059 AMP depletion, which in oleaginous organisms is conditions is not required to induce oleaginy. For example, believed to initiate the cascade leading to accumulation of genetic modifications comprising alteration and/or addition citrate (and therefore acetyl-CoA) in the cytoplasm, occurs of regulatory sequences (e.g., promoter elements, terminator as a result of the nutrient depletion mentioned above. When elements) may be utilized to confer particular regulation of oleaginous cells are grown in the presence of excess carbon expression patterns. Such genetic modifications may be Source but under conditions limiting for nitrogen or some utilized in conjunction with endogenous genes (e.g., for other nutrient(s), the activity of AMP deaminase, which regulation of endogenous oleagenic polypeptide(s)): alter catalyzes the reaction: natively, Such genetic modifications may be included so as AMP->inosine 5'-monophosphate--NH (2) to confer regulation of expression of at least one heterolo is strongly induced. The increased activity of this enzyme gous polypeptide (e.g., oleagenic polypeptide(s)). For depletes cellular AMP in both the cytosol and the mitochon example, promoters including, but not limited to Tefl. Gpd1 dria. Depletion of AMP from the mitochondria is thought to promoters can be used in conjunction with endogenous inactivate the AMP-dependent isocitrate dehydrogenase, genes and/or heterolous genes for modification of expression resulting in accumulation of citrate in the mitochondria and, patterns of endogenous oleaginic polypeptides and/or het therefore, the cytosol. This series of events is depicted erolous oleagenic polypeptides. Similarly, exemplary termi diagrammatically in FIG. 2. nator sequences include, but are not limited to, use of Y. lipolytica XPR2 terminator sequences. 0060. As noted above, oleaginy requires both cytosolic acetyl-CoA and cytosolic NADPH. It is believed that, in 0064. In some embodiments, at least one oleaginic many oleaginous organisms, appropriate levels of cytosolic polypeptide is introduced into a host cell. In some embodi NADPH are provided through the action of malic enzyme ments of the invention, a plurality (e.g., two or more) of (Enzyme 3 in FIG. 2). Some oleaginous organisms (e.g., different oleaginic polypeptides is introduced into the same Lipomyces and some Candida) do not appear to have malic host cell. In some embodiments, the plurality of oleaginic enzymes, however, so apparently other enzymes can provide polypeptides contains polypeptides from the same source US 2007/0015237 A1 Jan. 18, 2007 organism; in other embodiments, the plurality includes organisms. Moreover, various aspects of the isoprenoid polypeptides independently selected from different source biosynthesis pathway are conserved throughout the fungal, organisms. bacterial, plant and animal kingdoms. For example, 0065 Representative examples of a variety of oleaginic polypeptides corresponding to the acetoacetyl-CoA thiolase, polypeptides that may be introduced into or modified within HMG-CoA synthase, HMG-CoA reductase, mevalonate host cells according to the present invention, include, but are kinase, phosphomevalonate kinase, mevalonate pyrophos not limited to, those provided in Tables 1-6. As noted above, phate decarboxylase, IPP isomerase, FPP synthase, and it is expected that at least Some of these polypeptides (e.g., GGPP synthase shown in FIG. 3 have been identified in and malic enzyme and ATP-citrate lyase) should desirably act in isolated from a wide variety of organisms and cells. Rep concert, and possibly together with one or more components resentative examples of a wide variety of Such polypeptides offatty acid synthase, such that, in Some embodiments of the are provided in Tables 7-15. One or more of the polypeptides invention, it will be desirable to utilize two or more ole selected from those provided in any one of Tables 7-15 may aginic polypeptides from the same source organism. be utilized or derived for use in the methods and composi 0066. In general, source organisms for oleaginic polypep tions in accordance with the present invention. tides to be used in accordance with the present invention 0070 According to the present invention, carotenoid include, but are not limited to, Blakeslea, Candida, Cryp production in a host organism may be adjusted by modifying tococcus, Cunninghamella, Lipomyces, Mortierella, Mucor the expression or activity of one or more proteins involved Phycomyces, Pythium, Rhodosporidium, Rhodotorula, Tri in isoprenoid biosynthesis. In some embodiments. Such chospOron, Yarrowia, Aspergillus, Botrytis, Cercospora, modification involves introduction of one or more heterolo Fusarium (Gibberella), Kluyveromyces, Neurospora, Peni gous isoprenoid biosynthesis polypeptides into the host cell; cillium, Pichia (Hansenula), Puccinia, Saccharomyces, alternatively or additionally, modifications may be made to Sclerotium, Trichoderma, and Xanthophyllomyces (Phafia). the expression or activity of one or more endogenous or In some embodiments, the source species for acetyl CoA heterologous isoprenoid biosynthesis polypeptides. Given carboxylase, ATP-citrate lyase, malice enzyme and/or AMP the considerable conservation of components of the iso deaminase polypeptides include, but are not limited to, prenoid biosynthesis polypeptides, it is expected that heter Aspergillus nidulans, Cryptococcus neoformans, Fusarium ologous isoprenoid biosynthesis polypeptides will often fiujikuroi, Kluyveromyces lactis, Neurospora crassa, Saccha function even in significantly divergent organisms. Further romyces cerevisiae, Schizosaccharomyces pombe, Ustilago more, should it be desirable to introduce more than one maydis, and Yarrowia lipolytica; in some embodiments, heterologous isoprenoid biosynthesis polypeptide, in many Source species for pyruvate decarboxylase or isocitrate cases polypeptides from different source organisms will dehydrogenase polypeptides include, but are not limited to function together. In some embodiments of the invention, a Neurospora crassa, Xanthophyllomyces dendrorhous (Phaf plurality of different heterologous isoprenoid biosynthesis fia rhodozyma), Aspergillus niger, Saccharomyces cerevi polypeptides is introduced into the same host cell. In some siae, Mucor circinelloides, Rhodotorula glutinis, Candida embodiments, this plurality contains only polypeptides from utilis, Mortierella alpina and Yarrowia lipolytica. the same source organism (e.g., two or more sequences of Engineering Carotenoid Production or sequences derived from, the same source organism); in other embodiments the plurality includes polypeptides inde 0067 Carotenoids are synthesized from isoprenoid pre pendently selected from from different source organisms cursors, some of which are also involved in the production (e.g., two or more sequences of, or sequences derived from, of steroids and sterols. The most common isoprenoid bio at least two independent source organisms). synthesis pathway, sometimes referred to as the “mevalonate pathway', is generally depicted in FIG. 3. As shown, acetyl 0071. In some embodiments of the present invention that CoA is converted, via hydroxymethylglutaryl-CoA (HMG utilize heterologous isoprenoid biosynthesis polypeptides, CoA), into mevalonate. Mevalonate is then phosphorylated the source organisms include, but are not limited to, fungi of and converted into the five-carbon compound isopentenyl the genera Blakeslea, Candida, Cryptococcus, Cunning pyrophosphate (IPP). Following isomerization of IPP into hamella, Lipomyces, Mortierella, Mucor, Phycomyces, dimethylallyl pyrophosphate (DMAPP), three sequential Pythium, Rhodosporidium, Rhodotorula, Tricho sporon, Yar condensation reactions with additional molecules of IPP rowia, Aspergillus, Botrytis, Cercospora, Fusarium (Gib generate the ten-carbon molecule geranyl pyrophosphate berella), Kluyveromyces, Neurospora, Penicillium, Pichia (GPP), followed by the fifteen-carbon molecule famesyl (Hansenula), Puccinia, Saccharomyces, Schizosaccharomy pyrophosphate (FPP), and finally the twenty-carbon com ces, Sclerotium, Trichoderms, Ustilago, and Xanthophyllo pound geranylgeranyl pyrophosphate (GGPP). myces (Phaffia). In certain embodiments, the Source organ 0068 An alternative isoprenoid biosynthesis pathway, isms are of a species including, but not limited to, that is utilized by Some organisms (particularly bacteria) and Cryptococcus neoformans, Fusarium filiikuroi, Kluyveriny is sometimes called the “mevalonate-independent pathway'. ces lactis, Neurospora crassa, Saccharomyces cerevisiae, is depicted in FIG. 4. This pathway is initiated by the Schizosaccharomyces pombe, Ustilago maydis, and Yar synthesis of 1-deoxy-D-xyloglucose-5-phosphate (DOXP) rowia lipolytica. from pyruvate and glyceraldehyde-3-phosphate. DOXP is 0072. As noted above, the isoprenoid biosynthesis path then converted, via a series of reactions shown in FIG. 4, way is also involved in the production of non-carotenoid into IPP, which isomerizes into DMAPP and is then con compounds, such as sterols, steroids, and vitamins, such as verted, via GPP and FPP into GGPP as shown in FIG.3 and vitamin E or vitamin K. Proteins that act on isoprenoid discussed above. biosynthesis pathway intermediates, and divert them into 0069 Various proteins involved in isoprenoid biosynthe biosynthesis of non-carotenoid compounds are therefore sis have been identified and characterized in a number of indirect inhibitors of carotenoid biosynthesis (see, for US 2007/0015237 A1 Jan. 18, 2007
example, FIG. 5, which illustrates points at which iso oxo-5-(2,3-dimethoxyphenyl)-4,1-benzoxazepine-3-yl) prenoid intermediates are channeled into other biosynthesis acetylpiperidin-4-acetic acid; Eur J Pharmacol. 2003 April pathways). Such proteins are therefore considered iso 11:466(1-2): 155-61), YM-5360 ((E)-2-2-fluoro-2-(duinu prenoid biosynthesis competitor polypeptides. Reductions clidin-3-ylidene)ethoxy-9H -carbazole monohydrochlo of the level or activity of such isoprenoid biosynthesis ride; Br J Pharmacol. 2000 September; 131(1):63-70), or competitor polypeptides are expected to increase carotenoid squalestatin I that inhibit squalene synthase; terbinafine that production in host cells according to the present invention. inhibits squalene epoxidase; various azoles that inhibit cyto 0073. In some embodiments of the present invention, chrome P450 lanosterol 14C-demethylase; and fempropi production or activity of endogenous isoprenoid biosynthe morph that inhibits the C-14 sterol reductase and the C-8 sterol isomerase. In other embodiments, heterologous iso sis competitor polypeptides may be reduced or eliminated in prenoid biosynthesis competitor polypeptides may be uti host cells. In some embodiments, this reduction or elimina tion of the activity of an isoprenoid biosynthesis competitor lized (whether functional or non-functional; in some polypeptide can be achieved by treatment of the host organ embodiments, dominant negative mutants are employed). ism with small molecule inhibitors of enzymes of the 0076 One particular isoprenoid biosynthesis competitor ergosterol biosynthetic pathway. Enzymes of the ergosterol polypeptide useful according to the present invention is biosynthetic pathway include, for example, squalene Syn squalene synthase which has been identified and character thase, squalene epoxidase, 2.3-oxidosqualene-lanosterol ized from a variety of organisms; representative examples of cyclase, cytochrome P450 lanosterol 14C-demethylase, squalene synthase polypeptide sequences are included in C-14 sterol reductase, C-4 sterol methyl oxidase, SAM:C-24 Table 16. In some embodiments of the invention that utilize sterol methyltransferase, C-8 sterol isomerase, C-5 sterol squalene synthase (or modifications of squalene synthase) desaturase, C-22 sterol desaturase, and C-24 sterol reduc Source organisms include, but are not limited to, Neurospora tase. Each of these enzymes is considered an isoprenoid crassa, Xanthophyllomyces dendrorhous (Phafia biosynthesis competitor polypeptide. Regulators of these rhodozyma), Aspergillus niger, Saccharomyces cerevisiae, enzymes may also be considered isoprenoid biosynthesis Mucor circinelloides, Rhotorula glutinis, Candida utilis, competitor polypeptides (e.g., the yeast proteins Sutl (Gen Mortierella alpina, and Yarrowia lipolytica. bank Accession JC4374 GI:2133159) and Mot3 (Genbank Accession NP 013786 GI:6323715), which may or may not 0077. The carotenoid biosynthesis pathway branches off have homologs in other organisms. from the isoprenoid biosynthesis pathway at the point where GGPP is formed. The commitment step in carotenoid bio 0074. In other embodiments, reduction or elimination of synthesis is the formation of phytoene by the head-to-head the activity of an isoprenoid biosynthesis competitor condensation of two molecules of GGPP catalyzed by polypeptide can be achieved by decreasing activity of the phytoene synthase (often called crtB; see FIG. 6). A series of ubiquinone biosynthetic pathway. The commitment step in dehydrogenation reactions, each of which increases the ubiquinone biosynthesis is the formation of para-hydroxy number of conjugated double bonds by two, converts phy benzoate (PHB) from tyrosine or phenylalanine in mammals toene into lycopene via neurosporene. The pathway or chorismate in bacteria, followed by condensation of PHB branches at various points, both before and after lycopene and isoprene precursor, resulting in addition of the prenyl production, so that a wide range of carotenoids can be group. This reaction is catalyzed by PHB-polyprenyltrans generated. For example, action of a cyclase enzyme on ferase. The isoprenoid side chain of ubiquinone is deter lycopene generates Y-carotene; action of a desaturase instead mined by the prenyidiphosphate synthase enzyme. The produces 3,4-didehydrolycopene. Y-carotene is converted to 3-decaprenyl-4-hydroxybenzoic acid resulting from the con B-carotene through the action of a cyclase. B-carotene can be densation of PHB and decaprenyldiphosphate reaction processed into any of a number of products (see, for undergoes further modifications, which include hydroxyla example, FIG. 6C), including astaxanthin (via echinone, tion, methylation and decarboxylation, in order to form hydroxyechinone, and phoenicoxanthin). ubiquinone (CoQ10). Thus, inhibition of prenyidiphosphate synthase leading from fameSyldiphosphate to extended iso 0078. According to the present invention, carotenoid prenoids, or inhibition of PHB polyprenyltransferase may be production in a host organism may be adjusted by modifying useful in increasing the amount of isoprenoid available for the expression or activity of one or more proteins involved carotenoid biosynthesis. (Examples of prenyldiphosphate in carotenoid biosynthesis. As indicated, in some embodi synthase and PHB-polyprenyltransferase enzymes are ments, it will be desirable to utilize as host cells organisms depicted in Tables 29 and 30, respectively). that naturally produce one or more carotenoids. In some Such cases, the focus will be on increasing production of a 0075 Known small molecule inhibitors of isoprenoid naturally-produced carotenoid, for example by increasing biosynthesis competitor enzymes include, but are not limited the level and/or activity of one or more proteins involved in to, Zaragosic acid (including analogs thereof Such as the synthesis of that carotenoid and/or by decreasing the TAN1607A (Biochem Biophys Res Commun 1996 Feb. 15:219(2):515-520)), RPR 107393 (3-hydroxy-3-4-(quino level or activity of one or more proteins involved in a lin-6-yl)phenyl-1-azabicyclo2-2-2 octane dihydrochlo competing biosynthetic pathway. Alternatively or addition ride; J Pharmacol Exp Ther. 1997 May:281(2):746-52), ally, in some embodiments it will be desirable to generate ER-28448 (5-N-2-butenyl-3-(2-methoxyphenyl)-N-me production of one or more carotenoids not naturally pro thylamino)-1,1-penthylidenebis(phosphonic acid) trisodium duced by the host cell. salt; Journal of Lipid Research, Vol. 41, 1136-1144, July 0079 According to some embodiments of the invention, 2000), BMS-188494 (The Journal of Clinical Pharmacol it will be desirable to introduce one or more heterologous ogy, 1998; 38:1116-1121), TAK-475 (1-2-(3R,5S)-1-(3- carotenogenic polypeptides into a host cell. As will be acetoxy-2,2-dimethylpropyl)-7-chloro-1,2,3,5-tetrahydro-2- apparent to those of ordinary skill in the art, any of a variety US 2007/0015237 A1 Jan. 18, 2007 of heterologous polypeptides may be employed; selection 0082) A variety of enzymes can function to esterify will consider, for instance, the particular carotenoid whose carotenoids. For example, carotenoid glucosyltransferases production is to be enhanced. The present invention con have been identified in several bacterial species (see, e.g., templates not only introduction of heterologous caroteno Table 24). In addition, acyl CoA:diacy glycerol acyltrans genic polypeptides, but also adjustment of expression or ferase (DGAT) and acyl CoA:monoacylglycerol acyltrans activity levels of heterologous or endogenous carotenogenic ferases (MGAT), which function in the final steps of tria polypeptides, including, for example, alteration of constitu cylglycerol biosynthesis, are likely to serve an additional tive or inducible expression patterns. In some embodiments role in the esterification of xanthophylls. Representative of the invention, expression patterns are adjusted Such that DGAT polypetides are shown in Table 25. Furthermore, growth in nutrient-limiting conditions is not required to other enzymes may specifically modify carotenoids and induce oleaginy. For example, genetic modifications com molecules of similar structure (e.g. Sterols) and be available prising alteration and/or addition of regulatory sequences for modification and ester production. (e.g., promoter elements, terminator elements) may be uti 0083. In some embodiments of the invention, potential lized to confer particular regulation of expression patterns. Source organisms for carotenoid biosynthesis polypeptides Such genetic modifications may be utilized in conjunction include, but are not limited to, genera of naturally oleagi with endogenous genes (e.g., for regulation of endogenous nous or non-olleaginous fungi that naturally produce caro carotenogenic); alternatively, such genetic modifications tenoids. These include, but are not limited to, Botrytis, may be included so as to confer regulation of expression of Cercospora, Fusarium (Gibberella). Mucor, Neurospora, at least one heterologous polypeptide (e.g., carotenogenic Phycomyces, Puccina, Rhodotorula, Sclerotium, Tricho derma, and Xanthophyllomyces. Exemplary species include, polypeptide(s)). For example, promoters including, but not but are not limited to, Neurospora crassa, Xanthophyllomy limited to Tef1, Gpd1 promoters can be used in conjunction ces dendrorhous (Phafia rhodozyma), Mucor circinel with endogenous genes and/or heterolous genes for modi loildes, and Rhodotorula glutinis. Of course, carotenoids are fication of expression patterns of endogenous carotenogenic produced by a wide range of diverse organisms such as polypeptide(s) and/or heterolous carotenogenic polypep plants, algae, yeast, fungi, bacteria, cyanobacteria, etc. Any tide(s). Similarly, exemplary terminator sequences include, Such organisms may be source organisms for carotenoid but are not limited to, use of Y lipolytica XPR2 terminator biosynthesis polypeptides according to the present inven Sequences. tion. 0080. As indicated in FIG. 6 and in the literature, proteins 0084. It will be appreciated that the particular caroteno involved in carotenoid biosynthesis include, but are not genic modification to be applied to a host cell in accordance limited to, phytoene synthase, phytoene dehydrogenase, with the present invention will be influenced by which lycopene cyclase, carotenoid ketolase, carotenoid hydroxy carotenoid(s) is desired to be produced. For example, iso lase, astaxanthin synthase (a single multifunctional enzyme prenoid biosynthesis polypeptides are relevant to the pro found in Some source organisms that typically has both duction of most carotenoids. Carotenoid biosynthesis ketolase and hydroxylase activities), carotenoid epsilon polypeptides are also broadly relevant. Ketolase is particu hydroxylase, lycopene cyclase (beta and epsilon Subunits), larly relevant for production of canthaxanthin, as hydroxy carotenoid glucosyltransferase, and acyl CoA:diacy glycerol lase is for production of lutein and Zeaxanthin, among acyltransferase. Representative example sequences for these others. Both hydroxylase and ketolase (or astaxanthin Syn carotenoid biosynthesis polypeptides are provided in Tables thase) are particularly useful for production of astaxanthin. 17-25. Production and Isolation of Carotenoids 0081 Xanthophylls can be distinguished from other caro 0085. As discussed above, accumulation of lipid bodies tenoids by the presence of oxygen containing functional in oleaginous organisms is generally induced by growing the groups on their cyclic end groups. For instance, lutein and relevant organism in the presence of excess carbon source Zeaxanthin contain a single hydroxyl group on each of their and limiting nitrogen. Specific conditions for inducing Such terminal ring structures, while astaxanthin contains both a keto group and a hydroxyl on each terminal ring. This accumulation have previously been established for a number property makes Xanthophylls more polar than carotenes Such of different oleaginous organisms (see, for example, Wolf as beta-carotene and lycopene, and thus dramatically (ed.) Nonconventional yeasts in biotechnology Vol. 1, reduces their solubility in fats and lipids. Naturally occur Springer-Verlag, Berlin, Germany, pp. 313-338; Lipids ring Xanthophylls are often found as esters of the terminal 18(9):623, 1983: Indian J. Exp. Biol. 35(3):313, 1997: J. hydroxyl groups, both mono- and diesters of fatty acids. Ind. Microbiol. Biotechnol. 30(1):75, 2003: Bioresour Tech They also occur as glucosides in certain species of bacteria. mol. 95(3):287, 2004, each of which is incorporated herein The solubility and dispersibility of xanthophylls can be by reference in its entirety). greatly modified by the addition of ester moieties, and it is 0086. In general, it will be desirable to cultivate inventive known that esterification can also affect the absorbability modified host cells under conditions that allow accumulation and/or bioavailability of a given carotenoid. It is an objective of at least about 20% of their dry cell weight as lipid. In other of this invention to maximize the amount of a particular embodiments, the inventive modified host cells are grown Xanthophyll accumulating within the intracellular triacylg under conditions that permit accumulation of at least about lyceride fraction of oleaginous yeasts, and one mechanism 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, for achieving this goal is to increase the hydrophobic nature 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, of the xanthophyll product that accumulates. One way of 75%, or even 80% or more of their dry cell weight as lipid. achieving this is to engineer the production of fatty-acyl In certain embodiments, the host cells utilized are cells mono- and/or diesters of the target Xanthophyll compound. which are naturally oleaginous, and induced to produce lipid US 2007/0015237 A1 Jan. 18, 2007
to the desired levels. In other embodiments, the host cells are 14%, at least about 15%, at least about 16%, at least about cells which naturally produce lipid, but have been engi 17%, at least about 18%, at least about 19%, at least about neered to increase production of lipid such that desired 20% or more of the total dry weight of the cells. levels of lipid production and accumulation are achieved. 0090 Bacterial carotenogenic genes have already been 0087. In certain embodiments, the host cells of the inven demonstrated to be transferrable to other organisms, and are tion are not naturally oleaginous, but have been engineered therefore particularly useful in accordance with the present to produce lipid such that desired levels of lipid production invention (see, for example, Miura et al., Appl. Environ. are obtained. Those of ordinary skill in the art will appreciate Microbiol. 64:1226, 1998). In other embodiments, it may be that, in general, growth conditions that are effective for desirable to utilize genes from other source organisms such inducing lipid accumulation in a source organism, may well as plant, alga, or microalgae; these organisms provide a also be useful for inducing lipid accumulation in a host cell variety of potential sources for ketolase and hydroxylase into which the source organism’s oleaginic polypeptides polypeptides. Still additional useful source organisms have been introduced. Of course, modifications may be include fungal, yeast, insect, protozoal, and mammalian required in light of characteristics of the host cell, which Sources of polypeptides. modifications are within the skill of those of ordinary skill 0091. In certain embodiments, the Mucor circinelloides in the art. multi-functional phytoene synthase/lycopene cyclase and 0088. It will also be appreciated by those of ordinary skill the Neurospora crassa phytoene dehydrogenase genes can in the art that it will generally be desirable to ensure that be expressed in Yarrowia lipolytica. Subsequent overexpres production of the desired carotenoid by the inventive modi sion of the catalytic domain from N. crassa hydroxymeth fied host cell occurs at an appropriate time in relation to the ylglutaryl-CoA reductase and/or treatment of the modified Y induction of oleaginy such that the carotenoid(s) accumu lipolytica strains with the squalene synthase inhibitor Zara late(s) in the lipid bodies. In some embodiments, it will be gozic acid further increases carotenoid production. Finally, desirable to induce production of the carotenoid(s) in a host Paracoccus marcusii genes encoding carotenoid hydroxy cell which does not naturally produce the carotenoid(s). Such lase and carotenoid ketolase enzymes are expressed in Y. that detectable levels of the carotenoid(s) is/are produced. In lipolytica B-carotene-producing strains, and this modifica certain aspects the host cells which do not naturally produce tion results in the accumulation of astaxanthin. Similar a certain carotenoid(s) are capable of production of other approaches to enhance carotenoid production could be carotenoid(s) (e.g. certain host cells may, for example, employed in other oleaginous or non-olleaginous host organ naturally produce B-carotene but may not naturally produce isms can be undertaken, using the same, homologous, or astaxanthin); in other aspects the host cells do not naturally functionally similar carotogenic polypeptides. produce any carotenoid(s). In other embodiments, it will be 0092. It should be noted that, for inventive organisms that desirable to increase production levels of carotenoid(s) in a produce more than one carotenoid, it will sometimes be host cell which does naturally produce low levels of the possible to adjust the relative amounts of individual caro carotenoid(s), such that increased detectable levels of the tenoids produced by adjusting growth conditions. For carotenoid(s) are produced. In certain aspects, the host cells example, it has been reported that controlling the concen which do naturally produce the carotenoid(s) (e.g., B-caro tration of dissolved oxygen in a culture during cultivation tene) also produce additional carotenoid(s) (e.g., astaxan can regulate relative production levels of certain carotenoids thin, etc.); in still other aspects, the cells which naturally Such as B-carotene, echinenone, B-cryptoxanthin, 3-hydrox produce the carotenoid(s) (e.g., B-carotene) do not produce yechinenone, asteroidenone, canthaxanthin, Zeaxanthin, additional carotenoid(s). adonirubin, adonixanthin and astaxanthin (see, for example, 0089. In certain embodiments of the invention, it will be U.S. Pat. No. 6,825,002 to Tsubokura et al., the entire desirable to accumulate carotenoids to levels (i.e., consid contents of which are incorporated herein by reference). ering the total amount of all produced carotenoids together) 0093 Particularly for embodiments of the present inven that are greater than at least about 1% of the dry weight of tion directed toward production of astaxanthin, it will often the cells. In some embodiments, the total carotenoid accu be desirable to utilize one or more genes from a natural mulation in the lipid bodies will be to a level at least about astaxanthin-producing organism. Where multiple heterolo 2%, at least about 3%, at least about 4%, at least about 5%, gous polypeptides are to be expressed, it may be desirable to at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at utilize the same source organism for all, or to utilize closely least about 12%, at least about 13%, at least about 14%, at related Source organisms. least about 15%, at least about 16%, at least about 17%, at 0094. One advantage provided by the present invention is least about 18%, at least about 19%, at least about 20% or that, in addition to allowing the production of high levels of more of the total dry weight of the cells. In certain embodi carotenoids, the present invention allows those produced ments of the invention, it will be desirable to achieve total compounds to be readily isolated because they accumulate levels of carotenoid accumulation in the lipid bodies (i.e., in the lipid bodies within oleaginous organisms. Methods considering the total amount of all produced carotenoids and systems for isolating lipid bodies have been established together) that are greater than at least about 1% of the dry for a wide variety of oleaginous organisms (see, for weight of the cells. In some embodiments, the total caro example, U.S. Pat. Nos. 5,164.308; 5,374,657; 5,422,247; tenoid accumulation in the lipid bodies will be to a level at 5,550,156; 5,583,019; 6,166,231; 6,541,049; 6,727,373; least about 2%, at least about 3%, at least about 4%, at least 6,750,048; and 6,812.001, each of which is incorporated about 5%, at least about 6%, at least about 7%, at least about herein by reference in its entirety). In brief, cells are typi 8%, at least about 9%, at least about 10%, at least about cally recovered from culture, often by spray drying, filtering 11%, at least about 12%, at least about 13%, at least about or centrifugation. In some instances, cells are homogenized US 2007/0015237 A1 Jan. 18, 2007
and then subjected to Supercritical liquid extraction or Jan. 26, 2000(JPAppl No. 2005-301156 filed Oct. 17, 2005): Solvent extraction (e.g., with solvents such as chloroform, Japanese Publication No. 2006016408, published Jan. 19, hexane, methylene chloride, methanol, isopropanol, ethyl 2006(JP Appl No. 2005-301 155 filed Oct. 17, 2005); Japa acetate, etc.), yielding a crude oil suspension. This oil nese Publication No. 2006016409, published Jan. 19, Suspension may optionally be refined as known in the art. 2006(JP Appl No. 2005-301 157 filed Oct. 17, 2005); Japa Refined oils may be used directly as feed or food additives. nese Publication No. 2006016407, published Jan. 19, Alternatively or additionally, carotenoids can be isolated 2006(JP Appl No. 2005-301 153 filed Oct. 17, 2005); Japa from the oil using conventional techniques. nese Publication No. 2006008717, published Jan. 12, 2006(JP Appl No. 2005-301 151 filed Oct. 17, 2005); Japa 0.095 Given the sensitivity of carotenoids generally to nese Publication No. 2006008716, published Jan. 12, oxidation, many embodiments of the invention employ 2006(JP Appl No. 2005-301 150 filed Oct. 17, 2005); Japa oxidative stabilizers (e.g., tocopherols, vitamin C; ethox nese Publication No. 2006008720, published Jan. 12, ycuin; vitamin E, BHT, BHA, TBHQ, etc, or combinations 2006(JP Appl No. 2005-301158 filed Oct. 17, 2005); Japa thereof) during and/or after carotenoid isolation. Alterna nese Publication No. 2006008719, published Jan. 12, tively or additionally, microencapsulation, for example with 2006(JP Appl No. 2005-301 154 filed Oct. 17, 2005); Japa proteins, may be employed to add a physical barrier to nese Publication No. 2006008718, published Jan. 12, oxidation and/or to improve handling (see, for example, U.S. 2006(JP Appl No. 2005-301 152 filed Oct. 17, 2005); Japa Patent Application 2004/0191365). nese Publication No. 2006008713, published Jan. 12, Uses 2006(JP Appl No. 2005-301147 filed Oct. 17, 2005); Japa nese Publication No. 2006008715, published Jan. 12, 0.096 Carotenoids produced according to the present 2006(JP Appl No. 2005-301149 filed Oct. 17, 2005); Japa invention can be utilized in any of a variety of applications, nese Publication No. 2006008714, published Jan. 12, for example exploiting their biological or nutritional prop 2006(JP Appl No. 2005-301148 filed Oct. 17, 2005); and erties (e.g., anti-oxidant, anti-proliferative, etc.) and/or their Japanese Publication No. 2006008712, published Jan. 12, pigment properties. For example, according to the present 2006(JP Appl No. 2005-301146 filed Oct. 17, 2005). invention, carotenoids may be used in pharmaceuticals (see, for example, Bertram, Nutr. Rev. 57.182, 1999: Singh et al., 0098. It will be appreciated that, in some embodiments of Oncology 12:1643, 1998: Rock, Pharmacol. Ther. 75:185, the invention, carotenoids produced by manipulated host 1997: Edge et al., J. Photochem Photobiol 41:189, 1997: cells as described herein are incorporated into a final product U.S. Patent Application 2004/0116514; U.S. Patent Appli (e.g., food or feed supplement, pharmaceutical, cosmetic, cation 2004/0259959), food supplements (see, for example, dye-containing item, etc.) in the context of the host cell. For Koyama et al., J. Photochem Photobiol 9:265, 1991; Bauem example, host cells may be lyophilized, freeze dried, frozen feind, Carotenoids as colorants and vitamin A precursors, or otherwise inactivated, and then whole cells may be Academic Press, NY, 1981; U.S. Patent Application 2004/ incorporated into or used as the final product. The host cell 0115309; U.S. Patent Application 2004/0234579), electro may also be processed prior to incorporation in the product optic applications, animal feed additives (see, for example, to increase bioavailability (e.g., via lysis). Alternatively or Krinski, Pure Appl. Chem. 66:1003, 1994; Polazza et al., additionally, a final product may incorporate only a portion Meth. Enzymol. 213:403, 1992), cosmetics (as anti-oxidants of the host cell (e.g., fractionated by size, Solubility), sepa and/or as cosmetics, including fragrances; see for example rated from the whole. For example, in some embodiments of U.S. Patent Application 2004/0127554), etc. Carotenoids the invention, lipid droplets are isolated from the host cells produced in accordance with the present invention may also and are incorporated into or used as the final product. In be used as intermediates in the production of other com other embodiments, the carotenoids themselves, or indi pounds (e.g., Steroids, etc.). vidual carotenoid compounds are isolated and reformulated into the final product. 0097. For example, astaxanthin and/or esters thereof may be useful in a variety of pharmaceutical applications and 0099. As stated above, fatty acid and glucoside esters are health foods including treatment of inflammatory diseases, the predominant carotenoid esters found in nature, whereas asthma, atopic dermatitis, allergies, multiple myeloma, arte additional esters (e.g. with organic acids or inorganic phos riosclerosis, cardiovascular disease, liver disease, cere phate) can be synthesized to generate useful product forms. brovascular disease, thrombosis, neoangiogenesis-related For delivery, carotenoid esters can also be formulated as diseases, including cancer, rheumatism, diabetic retinopa salts of the ester form. See, e.g., US Publication No. thy; macular degeneration and brain disorder, hyperlipi 2005OO96477. demia, kidney ischemia, diabetes, hypertension, tumor pro 0.100 The amount of carotenoid incorporated into a given liferation and metastasis; and metabolic disorders. product may vary dramatically depending on the product, Additionally, carotenoids and astaxanthin may be useful in and the particular carotenoid(s) involved. Amounts may the prevention and treatment of fatigue, for improving range, for example, from less than 0.01% by weight of the kidney function in nephropathy from inflammatory diseases, product, to more than 1%, 10%. 20%, 30% or more; in some as well as prevention and treatment of other life habit-related cases the carotenoid may comprise 100% of the product. diseases. Still further, astaxanthin has been found to play a role as inhibitors of various biological processes, including 0101. In some embodiments of the invention, one or interleukin inhibitors, phosphodiesterase inhibitors inhibi more produced carotenoids is incorporated into a component tors, phospholipase A2 inhibitors, cyclooxygenase-2 inhibi of food or feed (e.g., a food Supplement). Types of food tors, matrix metalloproteinase inhibitors, capillary endothe products into which carotenoids can be incorporated accord lium cell proliferation inhibitors, lipoxygenase inhibitors. ing to the present invention are not particularly limited, and See, e.g., Japanese Publication No. 2006022121, published include beverages such as teas, juices, and liquors; confec US 2007/0015237 A1 Jan. 18, 2007
tions such as jellies and biscuits; fat-containing foods and EXEMPLIFICATION beverages such as dairy products; processed food products Such as rice and soft rice (or porridge); infant formulas; or 0107 Table 26 below describes certain Yarrowia lipoly the like. In some embodiments of this aspect of the inven tica strains used in the following exemplification: tion, it may be useful to incorporate the carotenoids within bodies of edible lipids as it may facilitate incorporation into TABLE 26 certain fat-containing food products. arrowia lipolytica strains. 0102) Examples offeedstuffs into which carotenoids pro duced in accordance with the present invention may be NRRL Y-1095 Wild type diploid incorporated include, for instance, pet foods such as cat ATCC76861 MATB ura2-21 lyc1-5 LYS1-5B foods, dog foods and the like, feeds for aquarium fish, ATCC76982 MATB ade1 leu2-35 lyc1-5 xpr2 cultured fish or crustaceans, etc., feed for farm-raised ani ATCC201249 MATAura-3.02 leu2-270 lys8-11 PEX17-HA mals (including livestock and further including fish or MF346 MATAura2-21 ATCC76861 x crustaceans raised in aquaculture). Food or feed material ATCC2O1249 into which the carotenoid(s) produced in accordance with MF350 MATB ura-21 leu2-35 ade1 ATCC76982 x MF346 the present invention is incorporated is preferably palatable to the organism which is the intended recipient. This food or feed material may have any physical properties currently 0108) (The genotypes at LYC1, LYS1, XPR2, and PEX17 known for a food material (e.g., Solid, liquid, Soft). were not determined in crosses nor verified for ATCC 0103) In some embodiments of the invention, one or strains.) more produced carotenoids is incorporated into a cosmetic product. Examples of Such cosmetics include, for instance, 0.109 All basic molecular biology and DNA manipula skin cosmetics (e.g., lotions, emulsions, creams and the tion procedures described herein are generally performed like), lipsticks, anti-Sunburn cosmetics, makeup cosmetics, according to Sambrook et al. or Ausubel et al. (Sambrook J. fragrances, products for daily use (e.g., toothpastes, mouth Fritsch E. F. Maniatis T (eds). 1989. Molecular Cloning. A washes, bad breath preventive agents, solid Soaps, liquid Laboratory Manual. Cold Spring Harbor Laboratory Press: Soaps, shampoos, conditioners), etc. New York; Ausubel FM, Brent R, Kingston RE, Moore D 0104. In some embodiments, one or more produced caro D, Seidman J. G. Smith JA, Struhl K (eds). 1998. Current tenoids is incorporated into a pharmaceutical. Examples of Protocols in Molecular Biology. Wiley: New York). Such pharmaceuticals include, for instance, various types of tablets, capsules, drinkable agents, troches, gargles, etc. In Example 1 Some embodiments, the pharmaceutical is suitable for topi cal application. Dosage forms are not particularly limited, Production of Plasmids for Carotenoid Strain and include capsules, oils, granula, granula Subtilae, pull Construction veres, tabellae, pilulae, trochisci, or the like. Oils and oil-filled capsules may provide additional advantages both 0110 Plasmids were generated for construction of caro because of their lack of ingredient decomposition during tenoid producing Strains. The following Subparts describe manufacturing, and because inventive carotenoid-containing production of plasmids encoding carotenogenic polypep lipid droplets may be readily incorporated into oil-based tides. Plasmids used in these studies and details of their formulations. construction are described in Table 27. Additional plasmid construction details and descriptions of their use are found 0105 Pharmaceuticals according to the present invention in the text of the relevant subsection. All PCR amplifications may be prepared according to techniques established in the used NRRL Y-1095 genomic DNA as template unless oth art including, for example, the common procedure as erwise specified. The URA5 gene described below is allelic described in the United States Pharmacopoeia, for example. with the ura2-21 auxotrophy above. The GPD1 and TEF1 0106 Carotenoids produced according to the present promoters are from Y lipolytica as is the XPR2 terminator. invention may be incorporated into any pigment-containing product including, for example, fabric, paint, etc. They may 0.111 GGS1 is the gene encoding the Y lipolytica gene also be incorporated into a product which is an environmen encoding geranylgeranylpyrophosphate synthase. The tal indicator, or an instrument such as a biosensor for use as nucleic acid coding sequence, and encoded Gigs1 protein of a detection agent. pMB4591 and pMB4683 are as follows:
atggattataac agcgcggatttcaaggagatatggggcaaggcc.gc.cgacaccgc.gctgctgg gaccgtacaactac citc.gc.caacaa.ccggggccacaa.catcagagaacacttgatcgcagogttcggag cqgttatcaaggtggacaagagc gatctoga gaccattt cgcacat caccalagattittgcatalactogtogctgcttgttgatgacgtggalagacaacto gatgcto cqac gaggcctg.ccggcagoc cattgtc tgtttggagtc.ccc.caaaccatcaactcc.gc.calactacatgtactttgttggctotgcaggaggtgctoaa.gctdaagttctitat gatgcc.gtc.to cattitt
caccgaggaaatgatcaacttgcatagaggtoaggg tatggatctotactggagagaaacact cacttgc.ccct cq galagacgagtatctggaga
US 2007/0015237 A1 Jan. 18, 2007
genase: MF350 (MATB ura2-21 leu2-35 ade1) was trans geranylgeranylpyrophosphate synthase: MF364 is crossed formed with pMB4591 (teflip-GGS1) that had been cleaved with MF578, and spores from the resulting diploid are plated upstream of URA5 with Ssp I; a Ura"transformant carrying on YPD for two to three days at 30° C. Orange Leu"Ade the plasmid at the ura2 locus was identified and named Ura colonies are screened for the presence of tefp-carB, MF364. It was subsequently transformed with plMB4.638 tefip-carRP, and tefp-GGS1 by PCR, and for high carotenoid (teflip-carB) that had been cleaved at ADE1 with SspI and (>4 mg/g dry cell weight) production after growth in YPD a prototrophic transformant was chosen that harbored the liquid medium. Colonies meeting these criteria, as well as plasmid at the adel locus. This strain was named MF502. displaying resistance to 5-fluorootic acid, an indication that 0131 2B. Production of Y lipolytica expressing gera they harbor the ura3-302 allele, are chosen for further nylgeranylpyrophosphate synthase, phytoene dehydroge studies and hereafter referred to as GBRPua strains. Such a nase and phytoene synthase/lycopene cyclase MF502 was strain is selected for further analysis and modification. transformed with pMB4628 (teflip-carRP) that had been Example 3 treated with SspI. Nine prototrophic colonies were chosen that were uncolored, orange, or very orange on the trans Extraction of Carotenoids from Yarrowia lipolytica formation plate (YNB agar with 1% glucose and 0.1% Cells glutamate YNBglut) after two to three days of growth. Two, MF597 and MF600 (the very orange ones), produced 0.136 Shake-flask testing of generated strains was con greater than 4 mg carotene perg dry cell weight (DCW) after ducted using YPD medium (1% yeast extract, 2% peptone, four days of growth in YPD at 30° C. Southern analysis 2% glucose). 20 ml cultures in 125 ml flasks were grown at reveals a different single Kipni-HindIII band in genomic 30° C. Y lipolytica cells were harvested from 72-96 hour DNA from MF597 and MF600, neither of which suggested cultures, and extractions were performed to determine caro that homologous integration occurred at leu2-270. tenoid form and quantity. 1.8 ml of culture was placed into an Eppendorf tube. Cells were pelleted and washed twice 0132) 2C. Production of Y lipolytica expressing phytoene with 1 ml H.O. After the second wash, the resuspended cells synthase/lycopene cyclase and phytoene dehydrogenase: were transferred to a pre-weighed Snap-cap tube with a hole ATCC201249 (MATA ura3-302 leu2-270 lys8-11) was poked in the top, and the cells were lyophilized overnight. transformed with SspI-cleaved pMB4628. Hundreds of Leu" After drying to completion, the tube was weighed in order colonies were pooled, re-grown, and transformed with to calculate dry cell weight. 0.25 ml from the same shake pMB4660 (teflip-carB) that had been cleaved upstream of flask culture was placed into a 2 ml screw-cap tube for URA3 with SalI. One colony that was noticeably yellow carotenoid extraction. Cells were pelleted and the superna after 5 days at 30° C. on YNBglut plus 0.6 mM lysine was tant was aspirated. Pelleted cells may be frozen at -80° C. selected, named MF447, and found to produce 0.2 mg and stored. An equal Volume of cubic Zirconia beads was carotene per gram dry cell weight after 4 days of growth in added to cell pellets, along with 1 ml ice-cold extraction YPD. solvent (a 50/50 V/v mix of hexane and ethyl acetate 0.133 MF447 was challenged with 1 g/L 5-fluoroorotic containing 0.01% butylhydroxytoluene (BHT)). The mix acid and Urasegregants selected. Surprisingly, they were all ture was then agitated (Mini-BeadBeater-8, BioSpec Prod found to retain the identical yellow appearance of their ucts, Inc.) at maximum speed for 5 minutes at 4°C. The parent, implying that the loss of a functional URA3 gene did mixture was then spun at maximum speed for 1 minute, and not coincide with the loss of a functional CarB enzyme. the Supernatant was collected and deposited in a cold 16 ml Southern analysis demonstrates that two fragments from a glass vial. The remaining cell debris was re-extracted at least Kpni-HindlIl digest of MF447 DNA contain URA3p-hy three times, without the addition of zirconia beads; all bridizing sequences, only one of which also hybridizes to Supernatants were pooled in the 16 ml glass vial. Following carB. The other is absent in MF578, the Ura3 segregant extraction, the glass vial was spun for 5 minutes at 2000 rpm chosen for further manipulation. Plasmid rescue and analy at 4°C. in a Sorvall tabletop centrifuge, and the supernatant sis of the DNA sequence encompassing the carrP intron in was transferred to a new cold 16 ml glass vial. A Speed Vac strains MF447, MF597 (example 2c), and MF600 (example was used to concentrate the Supernatant (room temperature 2c) revealed that exons 1 and 2 were contiguous and were in dark), and the samples were stored at -20°C. or -80° C. each separated by an intron sequence that lacked the original until immediately before HPLC analysis. Prior to HPLC internal SspI site (present in pMB4628). analysis, the samples were resuspended in 1 ml ice-cold solvent and then transferred to a cold amber vial. Through 0134) 2D. Production of Y lipolytica expressing phytoene out the protocol, care was taken to avoid contact with synthase/lycopene cyclase, phytoene dehydrogenase and oxygen, light, heat, and acids. geranylgeranylpyrophosphate synthase: MF578 was trans formed with pMB4683 (teflip-GGS1) that had been cleaved Example 4 with SalI (upstream of URA3) or with StuI (within the GGS1 ORF). Ura'Leu"colonies in both cases appeared Quantification of Carotenoid Production by HPLC bright orange on YNBglut--Lys and on YPD, and several produced greater than 4 mg carotene per gram of dry cell 0.137 For carotenoid analysis, samples were resuspended weight when grown as above. One, MF633, contained a in ice-cold extraction solvent (a 50/50V/v mix of hexane and single copy of the plasmid at the GGS1 locus, as inferred ethyl acetate containing 0.01% butylhydroxytoluene from Southern analysis. The others arose by non-homolo (BHT)). An Alliance 2795 HPLC (Waters) equipped with a gous or more complex integrations. Waters XBridge C18 column (3.5 um, 2.1 x50 mm) and Thermo Basic 8 guard column (2.1 x 10 mm) was used to 0135 2E. Production of Y lipolytica expressing phytoene resolve carotenoid at 25° C.; authentic carotenoid samples synthase/lycopene cyclase, phytoene dehydrogenase and were used as standards. The mobile phases and flow rates are US 2007/0015237 A1 Jan. 18, 2007
shown below (Solvent A=Ethyl Acetate; Solvent B=Water; Solvent C=Methanol; Solvent D=Acetonitrile). The injec tion volume was 10 uL. The detector is a Waters 996 GPDdist: photodiode array detector. The retention times for lipophilic 5' CACACGGTacct gtaggttgggttgggtg molecules include astaxanthin (1.159 min), Zeaxanthin GPDprox: (1.335), B-apo-8-carotenal (2.86 min), ergosterol (3.11 5' CACACGGATCCtgtttaattcaagaatgaatatagaga agagaag, min), lycopene (3.69 min), B-Carotene (4.02 min), and phytoene (4.13 min). Astaxanthin, Zeaxanthin, B-apo-8- and the resulting fragment (0.7 kb) is cleaved with BamHI carotenal, lycopene and B-Carotene are detected at 475 nm, and Kipni, and ligated to BamHI- and Kipni-cleaved p641 P. whereas ergosterol and phytoene were detected at 286 nm. creating the plasmid “p641Pgpd'. The ble gene under the control of the A. nidulans GPD promoter is then excised from pBCphleo (Silar, Fungal Genetics Newsletter 42:73) as TABLE 28 a 3.2 kb Bcl-BamHI fragment and inserted into the unique Retention Times for Lipophilic Molecules BamHI site of “p641Pgpd', in the orientation that preserves the BamHI site proximal to the GPD promoter, to create Time (min) Flow (mL/min) 9%. A 96 B 96 C 96 D Curve “p641Pgpdble', OSO O.O 20.O O.O 8O.O 3.00 1.00 2O.O O.O O.O 8O.O 6 0.142 N. crassa genomic DNA is amplified with two 4...SO 1.00 8O.O. O.O 20.O O.O 6 primers: 5.50 1.00 O.O O.O 6O.O 40.O 6 6.50 1.00 O.O O.O 8O.O 20.O 6 7.50 1.00 O.O OO 100.O. O.O 6 Neuhmg fwd: 8.50 1.00 O.O OO 100.O. O.O 6 5' CACACGGATCCACATCAACAatgg catctg.ccaccctitcccc 9.SO 1.00 O.O 20.O O.O 8O.O 6 1O.SO OSO O.O 20.O O.O 8O.O 6 Neuhmg rev: 5' CACACGGATCcaagtgctgacgcggaacttg and the resulting fragment is cleaved with BamHI and Example 5 inserted into BamHI-digested “p641Pgpdble' in the correct orientation. The resulting plasmid, “pZ.g. contains Expression of a Truncated form of HMG-CoA sequences encoding a truncated cytosolic catalytic domain Reductase Results in Increased Carotenoid of hydroxymethylglutaryl-CoA reductase from N. crassa Production (Genbank accession: XP 324892) under the control of the constitutive GPD promoter. This plasmid can be introduced 0138. In order to increase carotenoid production, carbon into the Y lipolytica strain created in Example 2E above, and flow through the isoprenoid pathway is enhanced by intro transformants are selected by their resistance to phleomycin ducing a truncated variant of the HMG-CoA reductase gene. (100 g/ml). Resulting transformants are tested for B-caro 0.139. In one approach, a truncated variant of the HMG tene production, as described above. CoA reductase gene which also encodes a 77 amino acid Example 6 leader sequence derived from S. cerevisiae Hmg1 is intro duced into a GRPBua strain (described in Example 2E Introduction of Heterologous Carotene Hydroxylase above). Plasmid pTefHMG can be cleaved with SnaBI, and Carotene Ketolase Genes Into Y lipolytica BbvCI, or Bsu36I to direct integration at the adel locus, or Strains Producing Carotenoid for Production of with BamHI to direct integration at the HMG1 locus, or with Astaxanthin EcoRV to promote random integration, in the GRPBua strains, restoring them to adenine prototrophy. Resulting 0.143 For introduction of carotene hydroxylase and caro Adetransformants are screened for increased carotenoid tene ketolase into carotenoid producting Y lipolytica, production. pMB4692 and pMB4698, described as in Example 1E and 1F above, can be sequentially introduced into the GRPBua 0140 Alternatively, the native HMG1 gene from Y strain (described in Example 2E). For the introduction of lipolytica may be modified without S. cerevisiae sequences pMB4692, the plasmid may be cleaved with SalI or BSrGI as described in Example 1D above, to create pMB4637. This to direct integration at the ura3 locus, or with Xbal to plasmid can be digested as described for pTefhMG and promote random integration, selecting for uracil prototro transformed into GRPBua strains, and resulting transfor phy. GRPBua Ura"transformants harboring pMB4692 are mants screened as described for increased carotenoid pro screened for zeaxanthin production in YPD. Zeaxanthin duction. producing cells are transformed with pMB4698 (which can 0141. In still another approach, a truncated variant of the be cleaved with PpuMI, SspI or BbvCI to direct integration N. crassa HMG-CoA reductase gene may be utilized and at the adel locus, or with EcoRV to promote random introduced into Y lipolytica strains. In order to generate a integration) and prototrophic colonies are screened for plasmid suitable for expression of the heterologous HMG astaxanthin production. CoA reductase, p641P (Yeast 2001; 18 (2001): 97-113) is 0144. Alternatively, the order of plasmid transformation modified by replacing the ICL1 promoter with the GPD may be reversed wherein pMB4698 is transformed first and promoter, and by the addition of sequences conferring transformants are selected for adenine prototrophy. GRPBua resistance to phleomycin. Y lipolytica genomic DNA is Adetransformants harboring pMB4698 are screened for amplified with two primers. canthaxanthin production. Canthaxanthin-producing GRP US 2007/0015237 A1 Jan. 18, 2007 20
BuapMB4698 cells are transformed with pMB4692 and hp4d/carRP/LIP2t; GPDp/HMGR), and transformants prototrophic colonies are screened for astaxanthin produc selected for leucine prototrophy. tion. 0145. In another approach, the carotenoid ketolase and Example 7 carotenoid hydroxylase genes from P. marcusii can be introduced into the strains described in Example 2 above, in Partial Inactivation of Y lipolytica ERG9 Gene order to convert B-carotene into astaxanthin. P. marcusii Encodinq Squalene Synthase Results in Increased genomic DNA is amplified with two primers. Carotenoid Production 0150 7A. In order to partially inactivate the ERG9 gene encoding squalene synthase, the neighboring FOL3 gene is CrtZfwd: 5' CACACCGTCTCAAatgaccaattitcctgatcgtogto disrupted, resulting in a folinic acid requirement. This strain CrtZrev: 5' CACACAGATCtcacgtgcgctcctg.cgcc. is then transformed with a mutagenized fragment of DNA partially spanning the two genes, and Foltransformants are and the resulting fragment is cleaved with BsmBI, modified screened for decreased squalene synthase activity. with the Klenow fragment of DNA polymerase, and cleaved with BglII. This fragment is inserted into PmlI- and BamHI 0151. The following oligonucleotides are synthesized: cleaved plNA1269 (J. Mol. Microbiol. Biotechnol. 2 (2000): 207-216), containing the hp4d promoter, the XPR2 termi nator, the selectable LEU2 gene, and sequences necessary PRIMER K 5'-CCTTCTAGTCGTACGTAGTCAGC; for selection and propagation in E. coli. The resulting PRIMER L. 5'-CCACTGACTAGAATCTCTTTCGG plasmid 'pA contains sequences encoding carotene hydroxylase from P. marcusii (crtZ gene) (Genbank acces and used to amplify a 2.3 kb fragment from Y lipolytica sion: CAB56060.1) under the control of the hp4d promoter. genomic DNA spanning most of the FOL3 gene, using Pfu 0146) “pYEG1TEF is modified by substituting the LIP2 polymerase. The resulting fragment is cleaved with Xbal terminator for the XPR2 terminator as follows. plNA1291 is and phosphorylated, then ligated into pEBluescriptSK that digested with Avril, modified with the Klenow fragment of has been cleaved with KpnI, treated with T4 DNA poly DNA polymerase, and cleaved with EcoRI, and the small merase (T4pol) in the presence of dNTPs, and subsequently LIP2t containing fragment is ligated to “YEG1TEF’ that has cleaved with Xbal. The resultant plasmid, designated pBS been digested with SacII, modified with T4 DNA poly fol3, is then cleaved with AccG5I and EcoRI, treated with merase in the presence of dNTP and cleaved with EcoRI. T4pol as above, and ligated to the 3.4 kb EcoRV-Spel ADE1 The resulting plasmid is named “pYEG1 TEF-LIP2t”. fragment (treated with T4pol) from pMB4529. 0147 In order to amplify the carotenoid ketolase gene, P. 0152 The resulting plasmid, pBSfol3 Aade, can be marcusii genomic DNA is amplified with two primers. cleaved with BsiWI and Xbal to liberate a 5.5 kb fragment that is used to transform the GRBPua strains described above to adenine prototrophy. Resulting Adetransformants CrtWfwd: 5' CACACCCTAGGCCatgag cqcacatgccctg.c are screened for a folinic acid requirement, and for homolo gous integration by PCR analysis. CrtWrev: 5' CACACAAGCTTtcatgcggtgtc.ccccittg 0153 Strains that harbor the resultant fol3AADE1 allele and the resulting fragment is cleaved with Avril and HindIII, can be transformed with a 3.5 kb DNA fragment generated and inserted into Avril- and HindIII-cleaved “pYEG1TEF by mutagenic PCR amplification using the primers: LIP2t'. The resulting plasmid, “Bt, contains sequences encoding the carotene ketolase (crtW gene) (Genbank acces sion: CAB56059.1) under the control of the constitutive PRIMER M. 5'-GGCTCATTGCGCATGCTAACATCG; TEF1 promoter. PRIMER IN 5'-CGACGATGCTATGAGCTTCTAGACG 0148. In order to combine the two expression cassettes into a single plasmid, “pBt is cleaved with ClaI, modified and Y lipolytica genomic DNA as template. The resulting with the Klenow fragment of DNA polymerase, and cleaved fragment containing the N-terminal three-quarters of the with EcoRI, and the crtW-containing fragment is isolated, FOL3 ORF and the C-terminal nine-tenths of the ERG9 mixed with the phosphorylated oligonucleotide adaptor pair: ORF is used to transform strains. The resulting Fol"Ade" transformants are screened for decreased squalene synthase activity by sensitivity to agents such as Zaragozic acid, 5' AATTCGCGGCCGCT itraconazole, or fluconazole. Additionally, the resulting and transformants are screened for increased carotenoid produc 5' AGCGGCCGCG, tion. 0154) 7B. Alternatively, the PCR fragment produced in cleaved with NotI, and ligated to Not-digested “pA. The 7A could be cloned and altered in such a way as to remove resulting plasmid, “pABt, contains both the TEF1p/crtW/ the 3'-untranslated region of ERG9 gene. Replacement of LIP2t cassette and the hp4d/crtz/XPR2t cassette as well as the fol3 AADE1 disruption by this fragment results in the selectable LEU2 gene. decreased expression of squalene synthase Schuldiner et al. 0149) “pABt can be introduced into the Y lipolytica (2005), Cell 123:507-519 Muhlrad and Parker (1999), strain described above in Example 4 (TEF1p/al-1/XPR2t; RNA 5:1299-1307), which can be confirmed as in 7A. This US 2007/0015237 A1 Jan. 18, 2007 approach may also be used in a Fol" Adestrain, using the and the resulting 0.67 kb fragment is cleaved with BamHI ADE1 marker to disrupt the ERG93'-UTR. and ligated in either orientation to BamHI-digested “p 12 to 0155 7C. In still another approach, partially defective create “plgal2 and “p2gall, containing GAL1-acl1/ ERG9 alleles can be identified in S. cerevisiae using plasmid GAL 10-acl2 and GAL 10-acl1/IGAL1-acl2, respectively shuffling techniques Boeke et al. (1987), Methods Enzy (Genbank accession: ac11: CAB91740.2; ac12: mol. 154: 164-175), and using drug sensitivities as a pheno CAB91741.2). type. Defective genes can be transferred to Y lipolytica 0.160 In order to amplify the S. cereviseae gene encoding using standard molecular genetic techniques. AMP deaminase and a promoter suitable for expressing this gene, S. cerevisiae genomic DNA is amplified using two Example 8 primer pairs in separate reactions: Treatment of Y lipolytica Strains Producing Carotenoid With Inhibitor of an Isoprenoid AMD1 ORF Biosynthesis Competitor Polypeptide Results in AMD1FWD: 5' CACACGAGCTCAAAAatgg acaatcaggctacacagag Increased Carotenoid Production AMD1 rev: 5' CACACCCTAGGtcacttittcttcaatggttctdttgaa 0156 Cultures produced in Example 2 are treated with attg the squalene synthase inhibitor, Zaragozic acid (Zaragozic GAL7p : acid at 0.5 LM) and monitored for B-carotene production, as gal7 prox: 5' CACACGAGCTCggaatattoaactgtttittttittatca described above. tgttgatg gal7 dist: 5' CACACGGAtccttcttgaaaatatgcactctatatott Example 9 ttag Constructing an Oleaginous Strain of and the resulting fragment from the AMD1 reaction (2.4 kb) Saccharomyces crevisiae is cleaved with SacI and AVr, and that from the GAL7 0157 The genes encoding the two subunits of ATP-citrate reaction (0.7 kb) is cleaved with BamHI and SphI, and both lyase from N. crassa, the AMP deaminase from Saccharo are ligated together into YEp13 that has been digested with myces cerevisiae, and the cytosolic malic enzyme from M. Nhel and BamHI, creating the plasmid “pAMPD. This circinelloides are overexpressed in S. cereviseae strains in plasmid carries the S. cerevisiae gene, AMD1, encoding order to increase the total lipid content. Similar approaches AMP deaminase, under the control of the galactose-induc to enhance lipid production could be employed in other host ible GAL7 promoter. organisms such as Xanthophyllomyces dendrorhous (Phafia 0.161 Messenger RNA is prepared from lyophilized bio rhodozyma), using the same, homologous, or functionally mass of M. circinelloides, as described above, and the similar oleaginic polypeptides. mRNA template is used in a RT-PCR reaction with two 0158 Qiagen RNAEasy kits (Qiagen, Valencia, Calif.) primers: are used to prepare messenger RNA from lyophilized bio mass prepared from cultures of N. crassa. Subsequently, MAEfwc RT-PCR is performed in two reactions containing the mRNA 5' CACACGCTAGCTACAAAatgttgtcactcaaacgcatagdaac template and either of the following primer pairs. MAErew: 5' CACACGTCGACttaatgatctoggtatacga gaggaac, acl1 : 1fwd: 5' CACACGGATCCTATAatgcctitcc.gcaacg accg and the resulting fragment is cleaved with NheI and SalI. and ligated to Xbal- and XhoI-digested pRS413TEF (Mum 1rev: 5' CACACACTAGttaaatttgg accitcaiacacg acco berg, D. et al. (1995) Gene, 156:119-122), creating the acl2: plasmid “pTEFMAE, which contains sequences encoding 2fwd: 5' CACACGGATCCAATATAAatgtctg.cgaagag catccitcg the cytosolic NADP-dependant malic enzyme from M. circinelloides (E.C. 1.1.1.40; mce gene; Genbank accession: 2rev: 5' CACACGCATGCittaagcttggaactccaccgcac AY209191) under the control of the constitutive TEF1 promoter. 0159. The resulting fragment from the ac11 reaction is cleaved with Spel and BamHI, and that from the ac12 0162 The plasmids “plgal2”, “pAMPD, and “pTEF reaction is cleaved with BamHI and SphI, and both are MAE are sequentially transformed into a strain of S. ligated together into YEp24 that has been digested with Nhel cereviseae to restore prototrophy for uracil (p1 gal2), leu and SphI, creating the plasmid “p 12. The bi-directional cine (“pAMPD), and histidine (“pTEFMAE) (Guthrie and GAL1-10 promoter is amplified from S. cerevisiae genomic Fink Methods in Enzymology 194:1-933, 1991). The result DNA using the primers. ing transformants are tested for total lipid content following shake flask testing in either synthetic complete (SC) medium lacking uracil, leucine and histidine, as described in gal10: Example 3, or in a 2-step fermentation process. In the 2-step 5' CACACGGATCCaattittcaaaaattcttacttitttittittggatggac process, 1.5 ml of cells from an overnight 2 ml roll tube gal1 : culture containing SC medium lacking uracil, leucine and 5' CACACGGATCCtttitttctoctitgacgittaaagtatagagg, histidine are centrifuged, washed in distilled water, and resuspended in 20 ml of a nitrogen-limiting medium Suitable US 2007/0015237 A1 Jan. 18, 2007 22 for lipid accumulation (30 g/L glucose, 1.5 g/L yeast extract, 0.5 g/L NHC1, 7 g/L KHPO, 5 g/L NaHPO-12H2O, 1.5 TABLE 1-continued g/L MgSO-7H2O, 0.08 g/L FeC1-6H2O, 0.01 g/L ZnSO 7HO, 0.1 g/L CaCl-2HO, 0.1 mg/L MnSO-5HO, 0.1 Examples of acetyl-CoA carboxylase polypeptides. mg/L CuSO-5H2O, 0.1 mg/L Co(NO)-6H.O; pH 5.5 (J Gen bank Am Oil Chem Soc 70:891-894 (1993)). Row ACCESSION Genbank GI 0163 Intracellular lipid content of the modified and con 24 AAR37018 40019048 trol S. cerevisiae Strains is analyzed using the fluorescent 25 C 001 . . . S7164283 26 C 776649 27806341 probe, Nile Red (J Microbiol Meth (2004) 56:331-338). In 27 AI2S271 562O5878 brief, cells diluted in buffer are stained with Nile Red, 28 P 109883 S1828611 excited at 488 nm, and the fluorescent emission spectra in 29 P 942134 38679971 the wavelength region of 400-700 nm are acquired and 30 P 942131 38679960 compared to the corresponding spectra from cells not stained 31 C 942135 386799.74 32 C 942136 38679977 with Nile Red. To confirm results from the rapid estimation 33 AAP94122 3.311288S method, the total lipid content is determined by gas chro 34 NP 071529 11559962 matographic analysis of the total fatty acids directly trans 35 2006.242A 740964 36 AAS13685 42405896 methylesterified from dried cells, as described (Appl Micro 37 P 598665 48976O2S biol Biotechnol. 2002 November:60(3):275-80). Non 38 3O85 2493.311 transformed S. cerevisiae strains produce 6% and 10% total 39 C 548250 57091783 lipid (dry cell weight basis) after growth in YPD and lipid 40 C 314071 5838.5597 41 AGO8536 4722652O accumulation medium, respectively. Yeast strains expressing 42 P 724636 2458.6460 the multiple oleaginic polypeptides produce 17% and 25% 43 P 610342 24586458 total lipid following growth in YPD and lipid accumulation 44 P 001084 45O1855 medium, respectively. 45 P 446374 16758804 46 E AL63219 6O46S120 47 P 921034 37S33464 Example 10 48 TO7084 743.8099 49 AAP78896 32264940 Introduction of Heterologous Carotene Hydroxylase 50 AAO629O3 29.123370 into Y lipolytica Strains Producing Carotenoid for 51 BAAO7O12 110O2S3 Production of Zeaxanthin 52 AALO2O56 15558947 53 AAG40563 11869927 S4 D864.83 25293894 0164 MF578 (tef-carRP tef-carB) was transformed with 55 TO792O 743.8090 pMB4692 that had been cleaved with SalI. Several Ura" 56 A57710 213.0099 colonies inferred to contain tef-critz by PCR analysis were 57 AAO629O2 29.123376 able to produce zeaxanthin in YPD shake flasks, and in one 58 22O8491A 1588584 59 TO9.538 7438102 case, all of the carotene was depleted. 60 CAC19875 12057067 0165. The following tables are referenced throughout the 61 AAP788.97 32264942 description: 62 TO2235 743.809S 63 AAG40564 11869928 64 E864.83 25293893 TABLE 1. 65 CAC841.61 20975574 66 TO7081 7438097 Examples of acetyl-CoA carboxylase polypeptides. 67 CAC19876 12057069 Gen bank Row ACCESSION Genbank GI 1 XP 410263 49097606 0166) 2 XP 32958O 32418.204 3 XP 386756 46124405 TABLE 2 4 XP 367702 39972623 5 XP 501721 SOS48503 Examples of pyruvate decarboxylase polypeptides. 6 EAK99708 464.404O2 7 XP 457211 SO413128 Genbank 8 NP 98.2612 45184894 Row ACCESSION Genbank GI 9 XP 449236 SO293649 10 NP 593271 19114-183 1QPBB 7245977 11 NP O14413 6324343 CAAS4522 871533 12 XP 45.5355 SO310667 1PYDB 515237 13 T42531 1127 2737 CAA2838O 4109 14 AAA2OO73 171504 1PVDB 1127233 15 EAL 20176 50257469 CAA33709 4114 16 XP 571316 S826832O AAN77243 25992752 17 XP 402244 49076566 NP 013235 63.231.63 18 S6O2OO 2133343 Q6FJA3 57O12668 19 BAA24410 28041.73 1 S363.63 486.942 2O P32874 1708.192 Q12629 52788279 21 S55089 743.8088 AAP75898 37359468 22 NP 9.90836 45382859 S7O684 21311S2 23 CAEO 1471 32526576 NP 011601 6321524
US 2007/0015237 A1 Jan. 18, 2007 28
TABLE 10-continued TABLE 10-continued Examples of mevalonate kinase polypeptides. Examples of mevalonate kinase polypeptides. Genbank Genbank Row ACCESSION Genbank GI Row ACCESSION Genbank GI 45 Q50559 2497518 115 EAD97024 43484567 46 CAF88123 472O0914 116 BAD86.800 57753870 47 P 275189 15678075 48 EAI88745 4.4383877 49 ZP 002040 46141948 50 XP 543435 5710.5916 0175) 51 EAI3892O 44313360 52 NP 148611 1460206S TABLE 11 53 E ADO8953 43286228 S4 AD45697 43361720 Examples of phosphomevalonate kinase polypeptides. 55 P 134862 5537-7012 56 P 720650 24378695 Genbank 57 P 614276 20094429 Row ACCESSION Genbank GI 58 84270 2S4O9931 59 691146 23097.68O 1 AAA34596 171479 60 p OO3233 48870579 2 XP 452514 SO3OS111 61 AAGO2440 993.7386 3 NP 985210 45190956 62 EAD12278 43292898 4 XP 446144 SO287.429 63 P 498328 17555862 5 XP 462340 50427455 64 AB31483 42928976 6 EAL04096 46444824 65 O03319 SOS90618 7 EALO3941 46444.668 66 814642 2937S488 8 XP 503619 SOSS2418 67 1434 2SS14495 9 XP 389940 46136497 : C 68 003577 53796847 10 XP 329795 32418634 69 1. AD82O48 43454743 11 XP 369652 39976529 70 AE73618 39S86491 12 XP 406448 49089559 71 P 012624 46906235 13 NP 593421 19114333 72 P 98.8455 453588.98 14 XP 568385 S8261950 73 P 002348 47097.293 15 EAL17628 SO2S4887 74 P 002862 48824993 16 AAL18926 16417948 75 P 002307 47093O2O 17 BAD43274 S1969 164 76 P 5971.02 19173299 18 BAD44652 51971975 77 AD24422 20429111 19 XP 398.375 49068172 78 P 785308 28378416 2O BAD44486 S1971 643 79 AA39098 2924.7539 21 F90479 2S3932.14 8O P 819638 29653946 22 YP 194039 58337454 81 AH49746 44.16876S 82 AH49745 44168,764 83 P 378182 15922513 84 P 000459 23OO2259 0176) 85 90181 25393827 86 P 054120 SO4OSO28 TABLE 12 87 ABO7790 9695270 88 AAGO2435 993.7379 Examples of mevalonate pyrophosphate decarboxylase polypeptides. 89 NP 560495 18313828 90 YP 187834 578661.87 Genbank 91 EAK4O782 446O2942 Row ACCESSION Genbank GI 92 CACS1370 15212070 93 AAGO2424 99.37364 1 AAT93171 51013755 94 P 185521 57651465 2 1F4A 1378.6942 95 P 040044 4948282O 3 XP 455548 SO311049 96 P 194037 58337452 4 XP 4.45335 SO285813 97 86675 2S4OO96S 5 XP 456912 SO4O9853 98 P 763916 274.67279 6 NP 98.6435 4520O865 99 CAF89434 471.978.10 7 AAF19399 6625790 OO EAF38.333 43767792 8 XP 328845 32416734 O1 EAK46841 44611394 9 XP 505041 50555265 O2 H39827 255.07776 10 NP 594027 19114939 O3 ZP OO3149 4.8861O61 11 XP 364.905 399634.52 O4 EAK17824 44570143 12 XP 390600 46137817 05 EAH86276 44235719 13 XP 408551 4909418O 14 AAA34506 7544604 O6 S4O24176 YP 118418 15 EAL18927 SO2S62OO O7 ZP OO3196 48865749 16 XP 568247 S8261674 O8 AAGO2430 993.7372 17 XP 402794 49077992 09 NP 269075 15674901 18 AAH81784 S1980639 10 NP 802520 28896170 19 EALOO166 46440864 11 AAL97S79 197481 O2 2O NP 619597 20149736 12 ZP OO3666 568O8907 21 NP 112324 13592005 13 NP 965060 42S191.30 22 BAC4O852 26354448 14 NP 819639 29653947 23 XP 546783 57087071
US 2007/0015237 A1 Jan. 18, 2007 41
0186
TABLE 22 Examples of carotenoid epsilon hydroxylase polypeptides.
ACCESSION GI PROTEIN DESCRIPTION ABBS2O76 79155148 putative epsilon-ring caroteine hydroxylase Daucus carota subsp. sativus BAD941.36 62319017 Cytochrom P450-like protein Arabidopsis thaliana ABD2856S 87162770 E-class P450, group I Medicago truncatula AAT28222 47498772 putative 97B2-like cytochrome P450 Ginkgo bilobal ABC68396 85001685 cytochrome P450 monooxygenase CYP97A Glycine max ABCS9110 84514203 cytochrome P450 monooxygenase CYP97B Medicago truncatula NP 190881 42565881 LUT1 (LUTEIN DEFICIENT 1); oxygen binding Arabidopsis thaliana ABB47954 78708979 cytochrome P450 monooxygenase, putative Oryza sativa (japonica cultivar-group) NP 92,2604 37536604 putative cytochrome P450 monooxygenase Oryza sativa (japonica cultivar-group)
0187)
TABLE 23 Examples of lycopene cyclase polypeptides, beta and epsilon subunits.
ACCESSION GI PROTEIN DESCRIPTION AAKO7431 12746307 lycopene epsilon-cyclase Adonis palaestina ABBS2O73 79154988 putative lycopene epsilon cyclase Daucus carota subsp. sativus Q38932 27735211 Lycopene epsilon cyclase, chloroplast precursor AABS3336 1399181 lycopene epsilon cyclase AAG10428 9971816 epsilon cyclase Tagetes erecta AAKO7434 12746313 lycopene epsilon-cyclase Lactuca satival AAM45382 21360359 epsilon cyclase Tagetes erecta O65837 11132841 Lycopene epsilon cyclase, chloroplast precursor AAL69394 18419661 lycopene epsilon-cyclase Spinacia oleracea BAE79549 87299433 lycopene epsilon-cyclase Chrysanthemum X morifolium XP 463,351 50901836 putative lycopene epsilon-cyclase Oryza sativa (japonica cultivar-group) AAS.48096 44887640 epsilon lycopene cyclase Citrus sinensis AAX92679 62638188 lycopene epsilon cyclase Citrus maxima AAL92114 19569601 lycopene epsilon-cyclase Citrus X paradisi AAKO7433 12746311 lycopene epsilon-cyclase Solanum tuberosum AAL47019 17864021 lycopene epsilon-cyclase Citrus sinensis AAT46065 48686703 chloroplast lycopene epsilon-cyclase precursor Chlamydomonas reinhardtii BADO7293 40809769 lycopene epsilon-cyclase Citrus limon BADO7285 40809753 lycopene epsilon-cyclase Citrus sinensis BADO7277 40809737 lycopene epsilon-cyclase Citrus unshiu EA62839 44489138 unknown environmental sequence BAE43547 73993068 putative lycopene beta cyclase Taxodium distichum var. distichum BAE435SO 73993074 putative lycopene beta cyclase Taxodium distichum var. distichum BAE43557 73993088 putative lycopene beta cyclase Taxodium distichum var. imbricarium BAE43558 73993090 putative lycopene beta cyclase Taxodium distichum var. imbricarium BAE43553 73993080 putative lycopene beta cyclase Taxodium distichum var. imbricarium BAE43545 73993064 putative lycopene beta cyclase Taxodium distichum var. distichum BAE43556 73993086 putative lycopene beta cyclase Taxodium distichum var. imbricarium BAE43552 73993078 putative lycopene beta cyclase Taxodium distichum var. distichum BAE43560 73993094 putative lycopene beta cyclase Taxodium distichum var. imbricarium US 2007/0015237 A1 Jan. 18, 2007 42
TABLE 23-continued Examples of lycopene cyclase polypeptides, beta and epsilon subunits.
ACCESSION GI PROTEIN DESCRIPTION BAE43554 putative lycopene beta cyc ase Taxodium distichum var. imbricarium BAE43551 putative lycopene beta cyc ase Taxodium distichum var. distichum BAE43519 73993012 putative lycopene beta cyc ase Cryptomeria japonica BAE43535 73993O44 putative lycopene beta cyc ase Cryptomeria japonica BAE43541 739.93056 putative lycopene beta cyc ase Cryptomeria japonica BAE43542 739.930.58 putative lycopene beta cyc ase Cryptomeria japonica BAE43517 739930O8 putative lycopene beta cyc ase Cryptomeria japonica BAE43534 73993O42 putative lycopene beta cyc ase Cryptomeria japonica BAE43537 73993O48 putative lycopene beta cyc ase Cryptomeria japonica BAE43533 73993040 putative lycopene beta cyc ase Cryptomeria japonica BADO2774 38603277 putative lycopene beta cyc ase Cryptomeria japonica BADO2766 386O3261 putative lycopene beta cyc ase Cryptomeria japonica BAE43540 73993054 putative lycopene beta cyc ase Cryptomeria japonica BAE43514 739930O2 putative lycopene beta cyc ase Cryptomeria japonica BAE43544 73993062 putative lycopene beta cyc ase Cryptomeria japonica BAE43538 739.93.050 putative lycopene beta cyc ase Cryptomeria japonica BAE43528 739.93O3O putative lycopene beta cyc ase Cryptomeria japonica BAE43546 73993066 putative lycopene beta cyc ase Taxodium distichum var. distichum BAE43526 73993O26 putative lycopene beta cyc ase Cryptomeria japonica BAE43543 73993060 putative lycopene beta cyc ase Cryptomeria japonica BADO2742 386O3213 putative lycopene beta cyc ase Cryptomeria japonica BADO2770 386O3269 putative lycopene beta cyc ase Cryptomeria japonica BAE43522 73993018 putative lycopene beta cyc ase Cryptomeria japonica BAE43559 739.93092 putative lycopene beta cyc ase Taxodium distichum var. BAE43527 73993028 ive lycopene beta cyc ase Cryptomeria japonica BAE43548 739.93O70 ive lycopene beta cyc ase Taxodium distichum var. AA 14.SSO425 pene beta-cyclase Citrus sinensis BA. 73993084 putative lycopene beta cyc ase Taxodium distichum var. imbricarium BA. E43549 putative lycopene beta cyc ase Taxodium distichum var. distichum U14144 S1922O63 ycopene beta-cyclase Citrus sinensis N86060 27261727 ycopene cyclase Citrus unshiu R89632 407S6518 ycopene-beta-cyclase Citrus maxima M21152 2O53O862 ycopene beta-cyclase Citrus sinensis D38049 13959731 ycopene cyclase Citrus X paradisi UOS146 51511939 ycopene beta-cyclase Citrus sinensis UOS145 51511937 ycopene beta-cyclase Citrus sinensis KO7430 127463OS ycopene beta-cyclase Adonis palaestina B72443 82394.885 ycopene beta-cyclase Citrus sinensis BAE79544 87299423 ycopene beta-cyclase Chrysanthemum X morifolium BAE78471 85717882 ycopene beta cyclase Taraxacum officinale Q43415 11133019 Lycopene beta cyclase, chloroplast precursor AA F23013 666.5782 ycopene epsilon-cyclase Daucus carota A. BBS2O71 791,54899 putative lycopene beta cyclase Daucus carota Subsp. sativus AAW88382 S966SO24 ycopene beta-cyclase Lycium barbarium AAG10429 9971818 beta cyclase Tagetes erecta AAM45381 21360357 beta cyclase Tagetes erecta AAM14335 2O2S9239 putative lycopene beta cyclase Arabidopsis thaliana AAO18661 277285.15 ycopene beta-cyclase Zea mays AAA8188O 735882 ycopene cyclase Q43503 11133022 Lycopene beta cyclase, chloroplast precursor S663SO 2129931 ycopene beta-cyclase (EC 5.5.1.—) - tomato XP 464409 SO905841 putative lycopene beta-cyclase Oryza sativa (japonica cultivar-group) 45237491 ycopene cyclase Bixa orellana 11133O2S Lycopene beta cyclase, chloroplast precursor AAL921.75 19569782 beta-lycopene cyclase Sandersonia aurantiaca AAXS4906 61742130 putative chloroplast lycopene beta cyclase precursor Chlamydomonas reinhardtii S66349 2129954 ycopene beta-cyclase (EC 5.5.1.—) - common tobacco AAG21133 10644119 chromoplast-specific lycopene beta-cyclase Lycopersicon esculentum CAB92977 82473S4 neoxanthin synthase Solanum tuberosum CAB93342 82.49885 neoxanthin synthase Lycopersicon esculentum Q9SEAO 11131528 Capsanthin capsorubin synthase, chloroplast precursor Q42435 1264.3508 Capsanthin capsorubin synthase, chloroplast precursor US 2007/0015237 A1 Jan. 18, 2007 43
TABLE 23-continued Examples of lycopene cyclase polypeptides, beta and epsilon subunits.
ACCESSION GI PROTEIN DESCRIPTION AAO64977 37730608 lycopene beta cyclase Haematococcus pluvialis Q40424 11133011 Lycopene beta cyclase, chloroplast precursor ABBS2O72 79154940 putative capsanthin-capsorubin synthase Daucus carota subsp. sativus AAQ02668 33304511 lycopene cyclase Setaria italica CAA54961 840729 putative chromoplastic oxydo-reductase Capsicum annuum EA62838 44489136 unknown environmental sequence YP 401079 813 00871 Lycopene cyclase, beta and epsilon Synechococcus elongatus PCC 7942 YP 172741 56752040 lycopene cyclase Synechococcus elongatus PCC 6301 ZP 011 . . . 888.08972 lycopene beta cyclase Synechococcus sp. WH 7805 EAKSOOS2 44615956 unknown environmental sequence NP 892751 33861190 putative lycopene epsilon cyclase Prochlorococcus marinus subsp. pastoris str. CCMP1986 NP 875182 33240240 Lycopene epsilon cyclase Prochlorococcus marinus subsp. marinus str. CCMP1375 YP 382237 78213458 Lycopene cyclase, beta and epsilon Synechococcus sp. CC9605 YP 397130 78779018 Lycopene cyclase, beta and epsilon Prochlorococcus marinus str. MIT 9312 NP 896821 33865262 lycopene beta cyclase Synechococcus sp. WH 8102 YP 397570 78779458 Lycopene cyclase, beta and epsilon Prochlorococcus marinus str. MIT 9312 ZP 010 . . . 87302144 lycopene cyclase Synechococcus sp. WH 5701 EAK17149 44569190 unknown environmental sequence YP 291882 72382527 lycopene cyclase, beta and epsilon Prochlorococcus marinus str. NATL2A NP 875.528 33240586 Lycopene beta cyclase related dehydrogenase Prochlorococcus marinus subsp. marinus str. CCMP1375 NP 893181 33861620 putative lycopene beta cyclase Prochlorococcus marinus subsp. pastoris str. CCMP1986 NP 895600 338.64040 putative lycopene epsilon cyclase Prochlorococcus marinus str. MIT 9313 EAI47456 44325573 unknown environmental sequence YP 291268 7238 1913 lycopene cyclase, beta and epsilon Prochlorococcus marinus str. NATL2A ZP 010 . . . 845 17806 Lycopene beta cyclase related dehydrogenase Prochlorococcus marinus str. MIT 9211 AAF34191 6970079 lycopene epsilon cyclase Daucus carota ZP 010 . . . 84518202 Lycopene epsilon cyclase Prochlorococcus marinus str. MIT 9211 YP 376736 78.184301 Lycopene cyclase, beta and epsilon Synechococcus sp. CC9902 ZP 003. . . 66796756 Lycopene cyclase, beta and epsilon Deinococcus geothermalis DSM 11300 NP 894.954 33863394 putative lycopene beta cyclase Prochlorococcus marinus str. MIT 9313 AATF6051 50365502 lycopene cyclase Citrus clementina EAK22047 44576122 unknown environmental sequence NP 294525 15805827 lycopene cyclase Deinococcus radiodurans R1
0188)
TABLE 24 Examples of carotenoid glucosyltransferase polypeptides.
ACCESSION GI PROTEIN DESCRIPTION AAA21261 148395 CrtX Pantoea agglomerans AAN85597 27228291 Zeaxanthin Glucosyl Transferase Pantoea stewartii BAB796O1 18143446 crtX Pantoea agglomerans pv. milletiae AAZ73147 72536082 zeaxanthin glucosyl transferase Enterobacteriaceae bacterium DC413 AAZ73128 725.36060 zeaxanthin glucosyl transferase Enterobacteriaceae bacterium DC260 AAZ73140 72536074 zeaxanthin glucosyl transferase Enterobacteriaceae bacterium DC416 US 2007/0015237 A1 Jan. 18, 2007 44
TABLE 24-continued Examples of carotenoid glucosyltransferase polypeptides.
ACCESSION GI PROTEIN DESCRIPTION Q01330 231911 Zeaxanthin glucosyl transferase ZP 006 . . . 71674312 UDP-glycosyltransferase, MGT Trichodesmium erythraeum IMS101 NP 439972 16329244 zeaxanthin glucosyl transferase Synechocystis sp. PCC 6803 EAH29368 44130903 unknown environmental sequence ZP 005 . . . 67926135 zeaxanthin glucosyl transferase, hypothetical protein Crocosphaera watsonii WH 8501 YP 378763 78188425 hypothetical protein Cag 0447 Chlorobium chlorochromatii CaD3 ZP 005 . . . 6854.9418 Glycosyl transferase, group 1 Pelodictyon phaeoclathratiforme BU-1 ZP 010 . . . 85713606 glycosyl transferase, group 1 Nitrobacter sp. Nb-311A YP 317171 75674750 glycosyl transferase, group 1 Nitrobacter winogradskyi Nb 255 ZP 006 . . . 69929171 Glycosyl transferase, group 1 Nitrobacter hamburgensis X14 ZP 009. . . 845.00589 hypothetical protein OB2597 11541 Oceanicola batsensis HTCC2597 ZP 009. . . 83953176 hypothetical protein NAS141 12746 Sui?itobacter sp. NAS 4.1 ZP 009. . . 83942121 hypothetical protein EE36 07793 Sui?itobacter sp. EE-36 YP 508020 89052569 glycosyl transferase, group 1 Jannaschia sp. CCS1 ZP 010 . . . 85704103 hypothetical protein ROS217 13931 Roseovarius sp. 217 ZP 009. . . 83370850 probable glycosyltransferase Rhodobacter sphaeroides ATCC 7025 ZP 006 . . . 69934465 Glycosyl transferase, group 1 Paracoccus denitrificans PD1222 ZP 009. . . 839498.80 probable glycosyltransferase Roseovarius nubinhibens ISM YP 376237 78183803 putative glycosyltransferase Synechococcus sp. CC9902 YP 376129 78183695 probable glycosyltransferase Synechococcus sp. CC9902 YP 374296 78.186253 hypothetical protein Plut 0365 Pelodictyon luteoium DSM 273 ZP 010 . . . 87301651 Putative glycosyltransferase Synechococcus sp. WH 5701 ZP 011 . . . 88.809938 Putative glycosyltransferase Synechococcus sp. WH 7805 BAE47471 78483937 carotenoid glucosyltransferase Paracoccus sp. N81106 ZP 010 . . . 87303273 probable glycosyltransferase Synechococcus sp. WH 5701 YP 376127 78183693 probable glycosyltransferase Synechococcus sp. CC9902 YP 5O1334 88196509 hypothetical protein SAOUHSC 02880 Staphylococcus aureus Subsp. aureus NCTC 8325 YP 187370 57652300 glycosyl transferase, group 2 family protein Staphylococcus aureus Subsp. aureus COL CAA666.27 1340131u nnamed protein product Staphylococcus aureus YP 04.1987 49484763 putative glycosyl transferase Staphylococcus aureus subsp. aureus MRSA252 YP 41 7885 82752144 hypothetical protein SAB2436c Staphylococcus aureus RF122 YP 252404 70725490 hypothetical protein SHO489 Staphylococcus haemolyticus JCSC1435 NP 693379 23099913 hypothetical protein OB2458 IOceanobacilius iheyensis HTE831 ZP 008 . . . 82501285 conserved hypothetical protein Caldicellulosinuptor saccharolyticus DSM 8903 ZP 010 . . . 87303565 hypothetical protein WH5701 09900 Synechococcus sp. WH 5701
0189)
TABLE 25
Examples of acyl CoA: diacwglycerol acyltransferase (DGAT) polypeptides.
ACCESSION GI PROTEIN DESCRIPTION XP 957022 85082953 hypothetical protein Neurospora crassa N150 XP 386864 46124621 hypothetical protein FGO6688.1 Gibberella zeae PH-1 XP 755172 71000982 diacylglycerol O-acyltransferase DGAT Aspergillus fumigatus Af293 XP 663763 67539978 hypothetical protein AN6159.2 Aspergillus nidulans FGSC A4 US 2007/0015237 A1 Jan. 18, 2007 45
TABLE 25 continued
Examples of acyl CoA: diac lvcerol acyltransferase (DGAT) polypeptides.
ACCESSION GI PROTEIN DESCRIPTION BAE653O2 83775179 unnamed protein product Aspergillus oryzae XP 502557 5055O169 hypothetical protein Yarrowia lipolytical S786.62 S6199782 diacylglycerol acy transferase Glycine max BB84383 82S82915 diacylglycerol acy transferase Jatropha curcas V31083 S4145459 1,2-diacyl-sn-glycerol: acyl-CoA acyltransferase Euonymus alatus G23696 108O3053 diacylglycerol acy transferase Perilla frutescens F6406S 7576941 putative diacylglycerol acyltransferase Brassica napus SO1606 41387497 acyl-CoA: diacylg ycerol acyltransferase 1 Olea europaea T73629 SO299S42 acyl CoA: diacylg ycerol acyltransferase Glycine max sMO3340 67.043496 putative diacylglycerol acyltransferase Tropaeoluim maius X P 645633 66824S57 hypothetical protein DDB0202877 Dictyostelium discoideum F19345 662S653 diacylglycerol acy CoA acyltransferase Nicotiana tabacum 4O785 63376239 diacylglycerol acy transferase DGAT2 Brassica iunceal WA7581 57231736 diacylglycerol acy transferase Oryza sativa (japonica S. cultivar-group) R114.79 38146080 diacylglycerol acy transferase Ricinus communis 4O 7 84 63376,226 diacylglycerol acy transferase DGAT1 Brassica iunceal P68322 31711932 At2g 19450 Arabidopsis thaliana S. 57545061 diacylglycerol acy transferase Lotus corniculatus var. japonicus 55794.08 putative diacylglycerol acyltransferase Brassica napus 53791817 putative acyl-CoA: diacylglycerol acyltransferase Oryza Saiiva (japonica cultivar-group) P 956024 41054343 hypothetical protein LOC325875 Danio rerio AA 18642598 diacylglycerol acyltransferase 1 Bos taurus 8902838S similar to Diacylglycerol O-acyltransferase 1 (Diglyceride acyltransferase) (ACAT-related gene) Homo sapiens P 777118 27819636 diacylglycerol O-acyltransferase 1 Bos taurus 9GMF1 182O2926 Diacylglycerol O-acyltransferase 1 (Diglyceride acyltransferase) P 036211 6912332 diacylglycerol O-acyltransferase 1 Homo sapiens AAHO6263 34782.946 DGAT1 protein Homo sapiens XP 780515 72OO6039 similar to Diacylg ycerol O-acyltransferase 1 Strongylocentrotus purpuratus AAD40881 5225.382 putative diacylglycerol acyltransferase Brassica napus XP 539214 739.74769 similar to Diacylg ycerol O-acyltransferase 1 (ACAT related gene product 1) isoform 1 Canis familiaris AAZ22403 71063860 diacylglycerol O-acyltransferase 1 Bubalus bubais P 9992.16 47522918 diacylglycerol acy transferase Sus scrofa P 001 . . . 50539976 hypothetical protein LOC436731 Danio rerio P 84.9176 739.74767 similar to Diacylg ycerol O-acyltransferase 1 (ACAT related gene product 1) isoform 2 Canis familiaris P 505828 71997.360 H19NO7.4 Caenorhabditis elegans AAF82410 9049538 diacylglycerol acy transferase Caenorhabditis elegans CAE75170 3959 1950 Hypothetical protein CBG23107 Caenorhabditis briggsae XP 626337 66358318 diacylglycerol acy transferase 1 Cryptosporidium parvum owa II 67624239 acyl-CoA: diacylg ycerol acyltransferase 1-related enzyme Cryptosporidium hominis TU502 33 113253 acyl-CoA: diacylg ycerol acyltransferase 1-related enzyme Toxoplasma gondii AAP94209 33113255 acyl-CoA: diacylg ycerol acyltransferase 1-related enzyme Toxoplasma gondii XP 579557 62652535 PREDICTED: diacylglycerol O-acyltransferase 1 Rattus norvegicus BAC66171 29170489 diacylglycerol acy transferase Mus musculus Q9ERM3 182O2872 Diacylglycerol O-acyltransferase 1 (Diglyceride acyltransferase) AAL78366 18698.659 acyl coenzyme A: diacylglycerol acyltransferase Drosophila melanogaster NP 995,724 45SS2403 CG31991-PD, isoform D Drosophila melanogaster NP 724017 24584734 CG31991-PC, isoform C Drosophila melanogaster XP 858062 739.74765 similar to Diacylglycerol O-acyltransferase 1 (ACAT related gene product 1) isoform 3 Canis familiaris XP 728984 8.2915156 hypothetical protein PYO1256 Plasmodium yoeli yoeii str. 17XNL CAG11944 47225461 unnamed protein product Tetraodon nigroviridis BAD27526 SO1994.38 acyl-CoA: diacylglycerol acyltransferase eukaryotic Synthetic construct US 2007/0015237 A1 Jan. 18, 2007 46
TABLE 25-continued Examples of acyl CoA: diacwglycerol acyltransferase (DGAT) polypeptides.
ACCESSION GI PROTEIN DESCRIPTION XP 317656 31.226099 ENSANGP00000002281 Anopheles gambiae str. PEST AAVS9457 55733.950 putative diacylglycerol acyltransferase Oryza sativa (japonica cultivar-group) E AL33593 S4644.853 GA16599-PADrosophila pseudoobscura P 678753 68073677 diacylglycerol O-acyltransferase Plasmodium berghei strain ANKA P 520014 SS631434 PREDICTED: similar to Diacylglycerol O-acyltransferase 1 (Diglyceride acyltransferase) Pan troglodytes AG10815 47219451 unnamed protein product Tetraodon nigroviridis P 624754 66522700 PREDICTED: similar to ENSANGP00000002281 Apis mellifera C AC698.84 1562O769 diacylglycerol acyltransferase I Rattus norvegicus P 686181 68.363630 PREDICTED: similar to Diacylglycerol O-acyltransferase 1 (Diglyceride acyltransferase) Danio rerio 7092.1323 diacylglycerol O-acyltransferase Plasmodium chabaudi chabaudi P 673128 68062248 hypothetical protein PB300300.00.0 Plasmodium berghei strain ANKA AAS72376 45642963 acyl-CoA: cholesterol acyltransferase beta Toxoplasma gondii AAS72375 45642961 acyl-CoA: cholesterol acyltransferase alpha Toxoplasma gondii NP 586145 19074639 STEROL O-ACYLTRANSFERASE Encephalitozoon cuniculi GB-M1 XP 640280 668122O2 hypothetical protein DDB0205259 Dictyostelium discoideum AAY4O783 63376,221 diacylglycerol acyltransferase Brassica iunceal XP 765774 71032265 diacylglycerol O-acyltransferase Theileria parva strain Muguga Q876L2 345823 O1 Sterol O-acyltransferase 2 (Sterol-ester synthase 2) XP 571260 S8268208 sterol O-acyltransferase Cryptococcus neoformans var. neoformans JEC21 EAL2OO32 50257323 hypothetical protein CNBF3580 Cryptococcus neoformans var. neoformans B-3501A XP 954.478 84.999514 acyl transferase Theileria annulata strain Ankara XP 505086 5055.5355 hypothetical protein Yarrowia lipolytical NP 588558 19076058 hypothetical protein SPCP1E11.05c Schizosaccharomyces pombe 972h AAC49441 1389739 acyl-CoA: Sterol acyltransferase P O14416 6324346 Acyl-CoA:sterol acyltransferase, isozyme of Arelp: Are2p Saccharomyces cerevisiae 750354 7099.1010 sterol O-acyltransferase APE2 Aspergillus fumigatus Af293 38.2192 46110268 hypothetical protein FGO2016.1 Gibberella zeae PH-1 ES4934 83764790 unnamed protein product Aspergillus oryzae P 885914 76617939 similar to Sterol O-acyltransferase 2 (Cholesterol acyltransferase 2) (ACAT-2) isoform 2 Bos taurus P 591.251 76617937 similar to Sterol O-acyltransferase 2 (Cholesterol acyltransferase 2) (ACAT-2) isoform 1 Bos taurus ACOO846 21392392 AcylCoA: Cholesterol Acyltransferase 2 Rattus norvegicus 649816 28571583 CG8112-PADrosophila melanogaster 666.176 22122547 sterol O-acyltransferase 2 Mus musculus 88908 182022.45 Sterol O-acyltransferase 2 (Cholesterol acyltransferase 2) (ACAT-2) P 761502 710225.45 hypothetical protein UMO5355.1 Ustilago maydis 521 P 714950 4O2S4723 sterol O-acyltransferase 2 Rattus norvegicus EAQ86094 88178626 hypothetical protein CHGG 07347 Chaetomium globosum CBS 148.51 X P 461395 50425599 hypothetical protein DEHAOF25652g Debaryomyces hansenii CBS767 XP 661812 67527926 hypothetical protein AN4208.2 Aspergillus nidulans FGSC A4 AAH96091 64-654094 Sterol O-acyltransferase 2 Homo sapiens O75908 182O2149 Sterol O-acyltransferase 2 (Cholesterol acyltransferase 2) (ACAT-2) AAH96090 64652990 Sterol O-acyltransferase 2 Homo sapiens AAK48829 13898.623 acyl coenzyme A: cholesterol acyltransferase-2 Homo sapiens XP 543637 73996435 PREDICTED: similar to sterol O-acyltransferase 2 Canis familiaris O77759 18202176 Sterol O-acyltransferase 2 (Cholesterol acyltransferase 2) (ACAT-2) US 2007/0015237 A1 Jan. 18, 2007 47
TABLE 25-continued Examples of acyl CoA: diacwglycerol acyltransferase (DGAT) polypeptides.
ACCESSION GI PROTEIN DESCRIPTION AAO32474 28564.191 ARE2 Saccharomyces castellii XP 323485 32405744 hypothetical protein Neurospora crassa NP 98.2606 45184888 AARO65Cp Eremothecium gossypii NP 593708 1911462O hypothetical protein SPAC13G7.06 Schizosaccharomyces pombe 972h AAO32554 28564940 ARE2 Saccharomyces kluyveri E AL28962 S4639560 GA20833-PADrosophila pseudoobscura P 449806 SO294790 hypothetical protein CAGLOM10571g Candida glabrata CBS138 P 033.256 84619697 sterol O-acyltransferase 1 Mus musculus 61263 182O2591 Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) AC3492S 2634,2537 unnamed protein product Mus musculus P 452607 50305295 unnamed protein product Kluyveromyces lactis P 001 . . . 777353.63 hypothetical protein LOC504287 Bos taurus 60457 182O2S85 Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) 320321 S8393811 ENSANGP00000016512 Anopheles gambiae str. PEST 320320 S8393809 ENSANGP00000016486 Anopheles gambiae str. PEST 70536 18202126 Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) P 714776 684.82S33 acyl-CoA cholesterol acyltransferase Candida albicans SC5314) P8428S 564O4462 Sterol O-acyltransferase 2 (Sterol-ester synthase) (ASAT) AAH77916 SO416229 Soat1-prov protein Xenopus laevis XP 692855 68364838 PREDICTED: similar to Soat1-prov protein Danio rerio CAI13574 5596O156 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 Homo sapiens AAL56227 18028942 cholesterol acyltransferase 1 Gorilla gorilla AAL56228 18028944 cholesterol acyltransferase 1 Pongo pygmaeus AAC37S32 4878022 acyl-coenzyme A: cholesterol acyltransferase Homo sapiens 22O1440A 1585676 acyl-CoA cholesterol acyltransferase Q876L3 345823O2 Sterol O-acyltransferase 1 (Sterol-ester synthase 1) BAEO1048 67969393 unnamed protein product Macaca fascicularis XP 514030 55588.858 PREDICTED: hypothetical protein XP 514030 Pan troglodytes XP 547445 73961.286 similar to Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) Canis familiaris EAQ84619 88.1771.51 hypothetical protein CHGG 08633 Chaetomium globosum CBS 148.51 O77761 182021.78 Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) XP 422267 50751122 PREDICTED: similar to Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) Gallus gallus XP 693284 68.39298O PREDICTED: similar to Sterol O-acyltransferase 1 (Cholesterol acyltransferase 1) (ACAT-1) Danio rerio AAT92940 S1013293 YCRO48W Saccharomyces cerevisiae P 956576 85080625 hypothetical protein Neurospora crassa N150 P 624691 665.64061 PREDICTED: similar to ENSANGP00000016486 Apis mellifera C AF96514 47222847 unnamed protein product Tetraodon nigroviridis P 788209 72O85563 PREDICTED: similar to sterol O-acyltransferase 1 Strongylocentrotus purpuratus P 445307 50285757 unnamed protein product Candida glabrata AE7OOO2 39596364 Hypothetical protein CBG16409 Caenorhabditis briggsae AGO7990 47225647 unnamed protein product Tetraodon nigroviridis NP 510623 17549960 B0395.2 Caenorhabditis elegans AAX28331 76157393 SJCHGC04421 protein Schistosoma japonicum AI961.58 66347204 Diacylglycerol O-acyltransferase Bubalus bubais P 390039 46136695 hypothetical protein FG09863. 1 Gibberella zeae PH-1 s P 643169 66819019 hypothetical protein DDB0203882 Dictyostelium discoideum AAOS309S 288SO306 hypothetical protein Dictyostelium discoideum AABO6959 1515472 acyl-CoA: cholesterol acyltransferase Oryctolagus cuniculus NP 945619 399.33343 putative alginate O-acetyltransferase Alg Rhodopseudomonas palustris CGA009 ZP 008 . . . 7769.1302 Membrane bound O-acyl transferase, MBOAT Rhodopseudomonas palustris Bisb5 XP 465546 SO908115 putative wax synthase Oryza sativa (japonica cultivar group) US 2007/0015237 A1 Jan. 18, 2007 48
0190.
TABLE 29 Examples of Prenyldiphosphate synthase polypeptides Accession GI Description 29A: Bacteria Proteins that require a mitochondrial targeting sequence ZP 009 . . . 83373595 Trans-hexaprenyltranstransferase Rhodobacter sphaeroides ATCC 7029) ZP 009 . . . 83371280 Trans-hexaprenyltranstransferase Rhodobacter sphaeroides ATCC 17025 CAD24417 20429105 decaprenyl diphosphate synthase Paracoccus zeaxanthinifaciens ZP 010 . . . 85705714 Geranylgeranyl pyrophosphate synthase/Polyprenyl synthetase Roseovarius sp. 217 ZP 010 . . . 84515724 decaprenyl diphosphate synthase Loktanella vestfoldensis SKA53 YP 165582 56695234 decaprenyl diphosphate synthase Silicibacter pomeroyi DSS-3 ZP 010 . . . 86139019 decaprenyl diphosphate synthase Roseobacter sp. MED193 ZP 009 . . . 83941379 decaprenyl diphosphate synthase Sui?itobacter sp. EE-36 ZP 009 . . . 83854.856 decaprenyl diphosphate synthase Sui?itobacter sp. NAS-14. 1 ZP 006 . . . 692998.73 Farnesyltranstransferase Silicibacter sp. TM1040 ZP 010 . . . 8468.3979 Geranylgeranyl pyrophosphate synthase/Polyprenyl synthetase Rhodobacterales bacterium HTCC2654 ZP 009 . . . 845 00217 decaprenyl diphosphate synthase Oceanicola batsensis HTCC2597 ZP 009 . . . 83952381 decaprenyl diphosphate synthase Roseovarius nubinhibens ISM ZP 006 . . . 69937106 Trans-hexaprenyltranstransferase Paracoccus denitrificans PD1222 ZP 005 . . . 68.180845 Trans-hexaprenyltranstransferase Jannaschia sp. CCS1 ZP 008 . . . 78495595 Polyprenyl synthetase Rhodopseudomonas palustris Bisb18 AAY82368 678,66738 decaprenyl diphosphate synthase Agrobacterium tumefaciens NP 353656 15887975 hypothetical protein AGR C 1125 Agrobacterium tumefaciens str. C58 ZP 008 . . . 77688465 Farnesyltranstransferase Rhodopseudomonas palustris BishB5 NP 531334 17934544 octaprenyl-diphosphate synthase Agrobacterium tumefaciens str. C58 YP 484709 86748213 Farnesyltranstransferase Rhodopseudomonas palustris HaA2 AAPS6240 37903500 decaprenyl diphosphate synthase Agrobacterium tumefaciens YP 192388 5804.0424 Decaprenyl diphosphate synthase Gluconobacter oxydans 621H 29B: Subunit 1- Proteins that contain mitochondrial targeting sequence T431.93 11279237 trans-pentaprenyltranstransferase homolog - fission yeast (Schizosaccharomyces pombe) AAD28.559 4732024 trans-prenyltransferase Homo sapiens AAIO7275 78070698 Trans-prenyltransferase Mus musculus BAE48216 81157931 subunit 1 of decaprenyl diphosphate synthase Homo sapiens AAH492.11 29165656 PDSS1 protein Homo sapiens Q33DR2 85700953 Decaprenyl-diphosphate synthase subunit 1 (Solanesyl-diphosphate synthase subunit 1) (Trans-prenyltransferase) XP 507706 55633583 PREDICTED: similar to TPRT protein Pan troglodytes XP 586717 76632198 PREDICTED: similar to trans-prenyltransferase Bos taurus XP 849908 73948851 PREDICTED: similar to trans-prenyltransferase Canis familiaris 29C: Subunit 2- Proteins that contain mitochondrial targeting sequence O13851 60389474 Decaprenyl-diphosphate synthase subunit 2 (Decaprenyl pyrophosphate synthetase subunit 2) BAE48.218 81157935 subunit 2 of solanesyl diphosphate synthase Mus musculus BAE482.17 81157933 subunit 2 of decaprenyl diphosphate synthase Homo sapiens
0191)
TABLE 30 Examples of PHB-Polyprenyltransferase polypeptides
GI PROTEIN DESCRIPTION 51013645 YNRO41C Saccharomyces cerevisiae 50285815 unnamed protein product Candida glabrata 50311051 unnamed protein product Kluyveromyces lactis 45200866 AGL231Wp Eremothecium gossypii 50555263 hypothetical protein Yarrowia lipolytical 68473193 para-hydroxybenzoate: polyprenyl transferase Candida albicans SC5314 50410039 hypothetical protein DEHAOA14212g Debaryomyces hansenii CBS767 US 2007/0015237 A1 Jan. 18, 2007 49
TABLE 30-continued Examples of PHB-Polyprenyltransferase polypeptides
GI PROTEIN DESCRIPTION 83769349 unnamed protein product Aspergillus oryzae 70994900 para-hydroxybenzoate-polyprenyltransferase precursor Aspergillus fumigatus Af293 19114131 hypothetical protein SPAC56F8. 04c Schizosaccharomyces pombe 972h 39973573 hypothetical protein MG01067. 4 Magnaporthe grisea 70–15 85078920 protein related to para-hydroxybenzoate polyprenyltransferase precursor Neurospora crassa N150 7666.0839 PREDICTED: similar to para-hydroxybenzoate-polyprenyltransferase, mitochondrial Bos taurus 521385.78 para-hydroxybenzoate-polyprenyltransferase, mitochondrial Homo sapiens 18.088424 COQ2 protein Homo sapiens 47221448 unnamed protein product Tetraodon nigroviridis 58385249 ENSANGP00000012220 Anopheles gambiae str. PEST 50746583 PREDICTED: similar to hypothetical protein CL640 Gallus gallus 54.638587 GA21912-PADrosophila pseudoobscura 21355,567 CG9613-PA Drosophila melanogaster 71005862 hypothetical protein UMO1450. 1 Ustilago maydis 521
0192 Those skilled in the art will recognize, or be able to described herein. The scope of the present invention is not ascertain using no more than routine experimentation, many intended to be limited to the above Description, but rather is equivalents to the specific embodiments of the invention as set forth in the following claims:
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 81 <210> SEQ ID NO 1 &2 11s LENGTH 984 &212> TYPE DNA <213> ORGANISM: Artificial &22O > FEATURE <223> OTHER INFORMATION: Y. lipolytica <400 SEQUENCE: 1 atggattata acagogcgga tittcaaggag atatgggg.ca aggcc.gc.cga caccgc.gctg 60 citggg accqt acaactacct cqccaacaac cqgg gccaca acatcagaga acacttgatc 120 gcago gttcg gag.cggittat calaggtggac aagagcgatc to gagaccat titc.gcacatc 18O accalagattt to catalactic gtc.gctgctt gttgatgacg toggaag acaa citcgatgcto 240 cgacgaggcc toccggcago coattgttctg tittggagtcc cc caaaccat caacto cqcc 3OO aactacatgt actttgttggc totgcaggag gtgctoaa.gc to aagt citta to atgcc.gto 360 to catttitca co gaggaaat gatcaacttig catagagg to aggg tatgga totctactgg 420 agagaaacac to acttgc.cc citcggaagac gagtatctgg agatggtggit gcacaag acc 480 ggtgg actot titcggctggc totgagacitt atgctgtcgg togcatcgaa acaggaggac 540 catgaaaaga toaactittga totcacacac cittaccgaca cactgggagt catttaccag 600 attctggatg attacct caa cotgcagtoc acggaattga co gagaacaa gggattctgc 660 gaagatato a gcigaaggaaa gttitt.cgttt cogctgattic acagoatacg caccaa.ccc.g 720 gatalaccacg agattcticaa cattctgaaa cago gaacaa gogacgcttic acto aaaaag 78O tacgc.cgtgg actacatgag aacagaalacc aagagtttcg actact gcct caagaggata 840
caggc catgt cactcaaggc aagttcgtac attgatgatc tag cagoagc togccacgat 9 OO US 2007/0015237 A1 Jan. 18, 2007
-continued gtotccaa.gc tacgagcc at tittgcatt at tttgttgtc.ca cct citgact g to aggagaga 96.O aagtactittg aggatgcgca gtga 984
<210> SEQ ID NO 2 &2 11s LENGTH 327 &212> TYPE PRT <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Y. lipolytica <400 SEQUENCE: 2 Met Asp Tyr Asn. Ser Ala Asp Phe Lys Glu Ile Trp Gly Lys Ala Ala 1 5 10 15 Asp Thr Ala Lieu Lleu Gly Pro Tyr Asn Tyr Lieu Ala Asn. Asn Arg Gly 2O 25 30 His Asn. Ile Arg Glu His Lieu. Ile Ala Ala Phe Gly Ala Val Ile Lys 35 40 45 Val Asp Llys Ser Asp Lieu Glu Thir Ile Ser His Ile Thr Lys Ile Leu 50 55 60 His Asn. Ser Ser Lieu Lieu Val Asp Asp Val Glu Asp Asn. Ser Met Lieu 65 70 75 8O Arg Arg Gly Lieu Pro Ala Ala His Cys Lieu Phe Gly Val Pro Glin Thr 85 90 95 Ile Asin Ser Ala Asn Tyr Met Tyr Phe Val Ala Leu Gln Glu Val Leu 100 105 110 Lys Leu Lys Ser Tyr Asp Ala Val Ser Ile Phe Thr Glu Glu Met Ile 115 120 125 Asn Lieu. His Arg Gly Glin Gly Met Asp Leu Tyr Trp Arg Glu Thir Lieu 130 135 1 4 0 Thr Cys Pro Ser Glu Asp Glu Tyr Leu Glu Met Val Val His Lys Thr 145 15 O 155 160 Gly Gly Lieu Phe Arg Lieu Ala Lieu Arg Lieu Met Leu Ser Val Ala Ser 1.65 170 175 Lys Glin Glu Asp His Glu Lys Ile Asn. Phe Asp Lieu. Thir His Lieu. Thr 18O 185 19 O Asp Thr Lieu Gly Val Ile Tyr Glin Ile Leu Asp Asp Tyr Lieu. Asn Lieu 195 200 2O5 Glin Ser Thr Glu Lieu. Thr Glu Asn Lys Gly Phe Cys Glu Asp Ile Ser 210 215 220 Glu Gly Lys Phe Ser Phe Pro Leu Ile His Ser Ile Arg Thr Asn Pro 225 230 235 240 Asp Asn His Glu Ile Lieu. Asn. Ile Leu Lys Glin Arg Thr Ser Asp Ala 245 250 255 Ser Lieu Lys Lys Tyr Ala Val Asp Tyr Met Arg Thr Glu Thir Lys Ser 260 265 27 O Phe Asp Tyr Cys Lieu Lys Arg Ile Glin Ala Met Ser Lieu Lys Ala Ser 275 280 285 Ser Tyr Ile Asp Asp Leu Ala Ala Ala Gly His Asp Wal Ser Lys Lieu 29 O 295 3OO Arg Ala Ile Lieu. His Tyr Phe Val Ser Thr Ser Asp Cys Glu Glu Arg 305 310 315 320 Lys Tyr Phe Glu Asp Ala Glin 325 US 2007/0015237 A1 Jan. 18, 2007 51
-continued
<210> SEQ ID NO 3 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 3 citgggtgacc toggaag cctt 20
<210> SEQ ID NO 4 &2 11s LENGTH 23 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 4 aagatcaatc cqtagaagtt cag 23
<210 SEQ ID NO 5 &2 11s LENGTH 23 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 5 aag.cgattac aatctitccitt togg 23
SEQ ID NO 6 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 6 ccagtccatc aactcagtct ca 22
<210 SEQ ID NO 7 &2 11s LENGTH 23 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 7 gcattgctta ttacgaagac tac 23
<210 SEQ ID NO 8 &2 11s LENGTH 23 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 8 ccactgtcct coactacaaa cac 23
<210 SEQ ID NO 9 &2 11s LENGTH: 31 US 2007/0015237 A1 Jan. 18, 2007 52
-continued
&212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 9 cacaaacg.cg titcactg.cgc atccitcaaag t 31
<210> SEQ ID NO 10 &2 11s LENGTH 37 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 10 cacaatctag acacaaatgg attataa.cag cqcggat 37
<210> SEQ ID NO 11 &2 11s LENGTH: 31 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 11 cacaaactag tittgccacct acaa.gc.caga t 31
<210> SEQ ID NO 12 &2 11s LENGTH: 31 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 12 caca aggtac caatgtgaaa gtgcgc.gtga t 31
<210> SEQ ID NO 13 &2 11s LENGTH 2.8 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 13
Cacalaggtac Cagaga.ccgg gttgg.cgg 28
<210> SEQ ID NO 14 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 14 cacaag.cggc cqc.gctagoa toggggatcga totcittatat 40
<210 SEQ ID NO 15 <211& LENGTH: 41 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer US 2007/0015237 A1 Jan. 18, 2007 53
-continued
<400 SEQUENCE: 15 cacaag.cggc cqc.gctagog aatgattctt atacticagaa g 41
<210> SEQ ID NO 16 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 16 cacaag.cggc cqcacgc.gtg caattaa.cag atagtttgcc 40
<210 SEQ ID NO 17 &2 11s LENGTH 33 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 17 cacaagctag citggggatgc gatctott at atc 33
<210> SEQ ID NO 18 &2 11s LENGTH 36 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 18 cacaaacg.cg tittaaatggit atttagattt citcatt 36
<210 SEQ ID NO 19 &2 11s LENGTH 36 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 19 cacaatctag acacaaatgc tigcto accita catgga 36
<210> SEQ ID NO 20 &2 11s LENGTH 1906 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: M. circinelloides
<400 SEQUENCE: 20 atgctgctica cctacatgga agtccaccitc tactacacgc tigcctgtgct ggg.cgtoctd 60 to citggctgt cqc gg.ccgta citacacagoc accgatgcgc. tcaaattcaa atttctgaca 120 citggttgcct tcacgaccgc citcc.gc.ctgg gacaactaca ttgtc.tacca caaggcgtgg 18O to citactgcc ccacct gcigt caccgctgtc attggctacg togcc.cittgga ggagtacatg 240 ttcttcatca toatgactict gttgaccgtg gcattcacca atctggtgat gcgctgg cac 3OO citgcacagot totttatcag goctogaaacg ccc.gtcatgc agt cogtcct ggtocgtott 360 gtocccataa cagocttatt aatcactgca tacaaggctt goggtaagcaa acaaacaaat 420
US 2007/0015237 A1 Jan. 18, 2007 55
-continued
Phe Phe Ile Ile Met Thr Lieu. Leu Thir Wall Ala Phe Thr Asn Lieu Wall 85 90 95 Met Arg Trp His Leu. His Ser Phe Phe Ile Arg Pro Glu Thr Pro Val 100 105 110 Met Glin Ser Val Leu Val Arg Leu Val Pro Ile Thr Ala Leu Leu Ile 115 120 125 Thr Ala Tyr Lys Ala Trp His Leu Ala Val Pro Gly Lys Pro Leu Phe 130 135 1 4 0 Tyr Gly Ser Cys Ile Leu Trp Tyr Ala Cys Pro Val Lieu Ala Lieu Lieu 145 15 O 155 160 Trp Phe Gly Ala Gly Glu Tyr Met Met Arg Arg Pro Leu Ala Val Leu 1.65 170 175 Val Ser Ile Ala Leu Pro Thr Leu Phe Leu Cys Trp Val Asp Val Val 18O 185 19 O Ala Ile Gly Ala Gly Thr Trp Asp Ile Ser Leu Ala Thr Ser Thr Gly 195 200 2O5 Lys Phe Val Val Pro His Leu Pro Val Glu Glu Phe Met Phe Phe Ala 210 215 220 Leu Ile Asn Thr Val Leu Val Phe Gly Thr Cys Ala Ile Asp Arg Thr 225 230 235 240 Met Ala Ile Lieu. His Lieu Phe Lys Asn Lys Ser Pro Tyr Glin Arg Pro 245 250 255 Tyr Glin His Ser Lys Ser Phe Leu. His Glin Ile Leu Glu Met Thr Trp 260 265 27 O Ala Phe Cys Lieu Pro Asp Glin Val Lieu. His Ser Asp Thr Phe His Asp 275 280 285 Leu Ser Val Ser Trp Asp Ile Leu Arg Lys Ala Ser Lys Ser Phe Tyr 29 O 295 3OO Thr Ala Ser Ala Val Phe Pro Gly Asp Val Arg Glin Glu Leu Gly Val 305 310 315 320 Leu Tyr Ala Phe Cys Arg Ala Thr Asp Asp Lieu. Cys Asp Asn. Glu Glin 325 330 335 Val Pro Val Glin Thr Arg Lys Glu Gln Leu Ile Leu Thr His Glin Phe 340 345 35 O Val Ser Asp Leu Phe Gly Gln Lys Thr Ser Ala Pro Thr Ala Ile Asp 355 360 365 Trp Asp Phe Tyr Asn Asp Gln Leu Pro Ala Ser Cys Ile Ser Ala Phe 370 375 38O Lys Ser Phe Thr Arg Lieu Arg His Val Lieu Glu Ala Gly Ala Ile Lys 385 390 395 400
Glu Lieu Lieu. Asp Gly Tyr Lys Trp Asp Leu Glu Arg Arg Ser I e Arg 405 410 4 5 Asp Glin Glu Asp Leu Arg Tyr Tyr Ser Ala Cys Val Ala Ser Ser Val 420 425 43 O Gly Glu Met Cys Thr Arg Ile Ile Leu Ala His Ala Asp Llys Pro Ala 435 4 40 4 45 Ser Arg Glin Glin Thr Glin Trp Ile Ile Glin Arg Ala Arg Glu Met Gly 450 455 460 Leu Val Lieu Glin Tyr Thr Asn. Ile Ala Arg Asp Ile Val Thr Asp Ser 465 470 475 480 Glu Glu Lieu Gly Arg Cys Tyr Lieu Pro Glin Asp Trp Lieu. Thr Glu Lys US 2007/0015237 A1 Jan. 18, 2007 56
-continued
485 490 495 Glu Val Ala Lieu. Ile Glin Gly Gly Lieu Ala Arg Glu Ile Gly Glu Glu 5 OO 505 51O. Arg Lieu Lleu Ser Leu Ser His Arg Lieu. Ile Tyr Glin Ala Asp Glu Lieu 515 52O 525 Met Val Val Ala Asn Lys Gly Ile Asp Llys Lieu Pro Ser His Cys Glin 530 535 540 Gly Gly Val Arg Ala Ala Cys Asn Val Tyr Ala Ser Ile Gly Thr Lys 545 550 555 560 Leu Lys Ser Tyr Lys His His Tyr Pro Ser Arg Ala His Val Gly Asn 565 570 575 Ser Lys Arg Val Glu Ile Ala Lieu Lleu Ser Val Tyr Asn Lieu. Tyr Thr 58O 585 59 O Ala Pro Ile Ala Thr Ser Ser Thr Thr His Cys Arg Glin Gly Lys Met 595 600 605 Arg Asn Lieu. Asn Thr 610
<210> SEQ ID NO 22 &2 11s LENGTH 17 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 22 gtaaaacgac ggc.cagt 17
<210> SEQ ID NO 23 &2 11s LENGTH 38 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 23 cacacggtot catgccaagc cittgtatgca gtgattaa 38
<210> SEQ ID NO 24 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 24 ccactgttgtt togctgg.cgg 19
<210> SEQ ID NO 25 &2 11s LENGTH 34 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 25 cacacggtot citggcatttg goggtoccitg gaala 34
<210> SEQ ID NO 26 US 2007/0015237 A1 Jan. 18, 2007 57
-continued
&2 11s LENGTH 35 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 26 cacaaacg.cg tittaaatgac attagagitta taac 35
<210 SEQ ID NO 27 &2 11s LENGTH 37 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 27 cacaatctag acacaaatgt coaagaaa.ca cattgtc 37
<210> SEQ ID NO 28 &2 11s LENGTH 17 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 28 gtaaaacgac ggccagt 17
<210 SEQ ID NO 29 &2 11s LENGTH: 31 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 29 caca aggtot caag cacgca toccggaact g 31
<210 SEQ ID NO 30 &2 11s LENGTH 32 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 30 cacacggtot cagg catgtc. goccitacgat gc 32
<210> SEQ ID NO 31 &2 11s LENGTH 35 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 31 cacacggtot catgcttgca cocacaaaga atagg 35
<210> SEQ ID NO 32 &2 11s LENGTH 17 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE
US 2007/0015237 A1 Jan. 18, 2007 59
-continued catc.ccggaa citggtgttcc cattgtc.citt gcaggaag.ca agcto acctic to accaagtt 15 OO gtoaa.gagct ttggaaagac goccaa.gc.ca agaaagatcg agatggagaa cacgcaa.gca 1560 cctttggagg agcctgatgc tigaatcgaca titc.cctdtgt ggttctggitt gcgc.gct gcc. 1620 ttittgggtoa tatttatgtt cittittacttic titcccitcaat coaatggcca aacgc.ccgca 1680 tottittatca ataatttgtt acctgaagta titcc.gc.gttc ataactcitaa tdtcatttaa 1740
<210 SEQ ID NO 35 &2 11s LENGTH 579 &212> TYPE PRT <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Y. lipolytica <400 SEQUENCE: 35 Met Ser Lys Lys His Ile Val Ile Ile Gly Ala Gly Val Gly Gly Thr 1 5 10 15 Ala Thr Ala Ala Arg Lieu Ala Arg Glu Gly Phe Lys Val Thr Val Val 2O 25 30 Glu Lys Asn Asp Phe Gly Gly Gly Arg Cys Ser Lieu. Ile His His Glin 35 40 45 Gly His Arg Phe Asp Glin Gly Pro Ser Leu Tyr Leu Met Pro Llys Tyr 50 55 60 Phe Glu Asp Ala Phe Ala Asp Leu Asp Glu Arg Ile Gln Asp His Leu 65 70 75 8O Glu Lieu Lieu Arg Cys Asp Asn. Asn Tyr Lys Val His Phe Asp Asp Gly 85 90 95 Glu Ser Ile Glin Leu Ser Ser Asp Lieu. Thir Arg Met Lys Ala Glu Lieu 100 105 110 Asp Arg Val Glu Gly Pro Leu Gly Phe Gly Arg Phe Leu Asp Phe Met 115 120 125 Lys Glu Thir His Ile His Tyr Glu Ser Gly Thr Lieu. Ile Ala Lieu Lys 130 135 1 4 0 Lys Asn. Phe Glu Ser Ile Trp Asp Lieu. Ile Arg Ile Lys Tyr Ala Pro 145 15 O 155 160 Glu Ile Phe Arg Lieu. His Leu Phe Gly Lys Ile Tyr Asp Arg Ala Ser 1.65 170 175 Lys Tyr Phe Lys Thr Lys Lys Met Arg Met Ala Phe Thr Phe Glin Thr 18O 185 19 O Met Tyr Met Gly Met Ser Pro Tyr Asp Ala Pro Ala Val Tyr Ser Leu 195 200 2O5 Leu Glin Tyr Thr Glu Phe Ala Glu Gly Ile Trp Tyr Pro Arg Gly Gly 210 215 220 Phe Asn Met Val Val Glin Lys Lieu Glu Ala Ile Ala Lys Glin Lys Tyr 225 230 235 240 Asp Ala Glu Phe Ile Tyr Asn Ala Pro Val Ala Lys Ile Asn. Thir Asp 245 250 255 Asp Ala Thr Lys Glin Val Thr Gly Val Thr Leu Glu Asn Gly His Ile 260 265 27 O Ile Asp Ala Asp Ala Val Val Cys Asn Ala Asp Leu Val Tyr Ala Tyr 275 280 285 His Asn Lieu Lleu Pro Pro Cys Arg Trp Thr Glin Asn. Thir Lieu Ala Ser 29 O 295 3OO US 2007/0015237 A1 Jan. 18, 2007 60
-continued
Lys Lys Leu Thir Ser Ser Ser Ile Ser Phe Tyr Trp Ser Met Ser Thr 305 310 315 320 Lys Val Pro Glin Leu Asp Wal His Asn. Ile Phe Leu Ala Glu Ala Tyr 325 330 335 Glin Glu Ser Phe Asp Glu Ile Phe Lys Asp Phe Gly Lieu Pro Ser Glu 340 345 35 O Ala Ser Phe Tyr Val Asn Val Pro Ser Arg Ile Asp Pro Ser Ala Ala 355 360 365 Pro Asp Gly Lys Asp Ser Val Ile Val Leu Val Pro Ile Gly His Met 370 375 38O Lys Ser Lys Thr Gly Asp Ala Ser Thr Glu Asn Tyr Pro Ala Met Val 385 390 395 400 Asp Lys Ala Arg Lys Met Val Lieu Ala Val Ile Glu Arg Arg Lieu Gly 405 410 415 Met Ser Asn. Phe Ala Asp Lieu. Ile Glu His Glu Glin Val Asn Asp Pro 420 425 43 O Ala Val Trp Glin Ser Lys Phe Asn Lieu Trp Arg Gly Ser Ile Leu Gly 435 4 40 4 45 Leu Ser His Asp Val Leu Glin Val Leu Trp Phe Arg Pro Ser Thr Lys 450 455 460 Asp Ser Thr Gly Arg Tyr Asp Asn Leu Phe Phe Val Gly Ala Ser Thr 465 470 475 480 His Pro Gly Thr Gly Val Pro Ile Val Leu Ala Gly Ser Lys Leu Thr 485 490 495 Ser Asp Glin Val Val Lys Ser Phe Gly Lys Thr Pro Llys Pro Arg Lys 5 OO 505 51O. Ile Glu Met Glu Asn Thr Glin Ala Pro Leu Glu Glu Pro Asp Ala Glu 515 52O 525 Ser Thr Phe Pro Val Trp Phe Trp Leu Arg Ala Ala Phe Trp Val Met 530 535 540 Phe Met Phe Phe Tyr Phe Phe Pro Glin Ser Asn Gly Glin Thr Pro Ala 545 550 555 560 Ser Phe Ile Asin Asn Leu Leu Pro Glu Val Phe Arg Val His Asn Ser 565 570 575
Asn Wall Ile
<210 SEQ ID NO 36 &2 11s LENGTH 32 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 36 cattcactag toggtgttgttctgtggagcat to 32
<210 SEQ ID NO 37 &2 11s LENGTH 36 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 37
US 2007/0015237 A1 Jan. 18, 2007 62
-continued <223> OTHER INFORMATION: Y. lipolytica <400 SEQUENCE: 39 Met Ser Lys Lys His Ile Val Ile Ile Gly Ala Gly Val Gly Gly Thr 1 5 10 15 Ala Thr Ala Ala Arg Lieu Ala Arg Glu Gly Phe Lys Val Thr Val Val 2O 25 30 Glu Lys Asn Asp Phe Gly Gly Gly Arg Cys Ser Lieu. Ile His His Glin 35 40 45 Gly His Arg Phe Asp Glin Gly Pro Ser Leu Tyr Leu Met Pro Llys Tyr 50 55 60 Phe Glu Asp Ala Phe Ala Asp Lieu. Asp Glu Arg Ile Glin Asp His Lieu 65 70 75 8O Glu Lieu Lieu Arg Cys Asp Asn. Asn Tyr Lys Val His Phe Asp Asp Gly 85 90 95 Glu Ser Ile Glin Leu Ser Ser Asp Lieu. Thir Arg Met Lys Ala Glu Lieu 100 105 110 Asp Arg Val Glu Gly Pro Leu Gly Phe Gly Arg Phe Leu Asp Phe Met 115 120 125 Lys Glu Thir His Ile His Tyr Glu Ser Gly Thr Lieu. Ile Ala Lieu Lys 130 135 1 4 0 Lys Asn. Phe Glu Ser Ile Trp Asp Lieu. Ile Arg Ile Lys Tyr Ala Pro 145 15 O 155 160 Glu Ile Phe Arg Lieu. His Leu Phe Gly Lys Ile Tyr Asp Arg Ala Ser 1.65 170 175 Lys Tyr Phe Lys Thr Lys Lys Met Arg Met Ala Phe Thr Phe Glin Thr 18O 185 19 O Met Tyr Met Gly Met Ser Pro Tyr Asp Ala Pro Ala Val Tyr Ser Leu 195 200 2O5 Leu Glin Tyr Thr Glu Phe Ala Glu Gly Ile Trp Tyr Pro Arg Gly Gly 210 215 220 Phe Asn Met Val Val Glin Lys Lieu Glu Ala Ile Ala Lys Glin Lys Tyr 225 230 235 240 Asp Ala Glu Phe Ile Tyr Asn Ala Pro Val Ala Lys Ile Asn. Thir Asp 245 250 255 Asp Ala Thr Lys Glin Val Thr Gly Val Thr Leu Glu Asn Gly His Ile 260 265 27 O Ile Asp Ala Asp Ala Val Val Cys Asn Ala Asp Leu Val Tyr Ala Tyr 275 280 285 His Asn Lieu Lleu Pro Pro Cys Arg Trp Thr Glin Asn. Thir Lieu Ala Ser 29 O 295 3OO Lys Lys Leu Thir Ser Ser Ser Ile Ser Phe Tyr Trp Ser Met Ser Thr 305 310 315 320 Lys Val Pro Glin Leu Asp Wal His Asn. Ile Phe Leu Ala Glu Ala Tyr 325 330 335 Glin Glu Ser Phe Asp Glu Ile Phe Lys Asp Phe Gly Lieu Pro Ser Glu 340 345 35 O Ala Ser Phe Tyr Val Asn Val Pro Ser Arg Ile Asp Pro Ser Ala Ala 355 360 365 Pro Asp Gly Lys Asp Ser Val Ile Val Leu Val Pro Ile Gly His Met 370 375 38O US 2007/0015237 A1 Jan. 18, 2007 63
-continued Lys Ser Thr Gly Asp Ala Ser Thr Glu Asn Tyr Pro Ala Met Wall 385 390 395 400
Asp Ala Arg Lys Met Wall Telu Ala Wall Ile Glu Arg Arg Telu Gly 405 410 415
Met Ser Asn Phe Ala Teu Ile Glu His Glu Glin Wall Asn Asp Pro 420 425 43 O
Ala Wall Trp Glin Ser Lys Phe Asn Telu Trp Arg Gly Ser Ile Telu Gly 435 4 40 4 45
Teu Ser His Asp Wall Teu Glin Wall Telu Trp Phe Arg Pro Ser Thr Lys 450 455 460
Asp Ser Thr Gly Tyr Asp Asn Telu Phe Phe Wall Gly Ala Ser Thr 465 470 475 480
His Pro Gly Thr Gly Wall Pro Ile Wall Telu Ala Gly Ser Telu Thr 485 490 495
Ser Asp Glin Wall Wall Lys Ser Phe Gly Lys Thr Pro Pro Arg Lys 5 OO 505 51O.
Ile Glu Met Glu Asn Thr Glin Ala Pro Telu Glu Glu Pro Asp Ala Glu 515 525
Ser Thr Phe Pro Wall Trp Phe Trp Telu Ala Ala Phe Trp Wall Met 530 535 540
Phe Met Phe Phe Tyr Phe Phe Pro Glin Ser Asn Gly Glin Thr Pro Ala 545 550 555 560
Ser Phe Ile Asn Asn Teu Teu Pro Glu Wall Phe Arg Wall His Asn Ser 565 570 575
Asn Wall Ile
SEQ ID NO 40 LENGTH 36 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 40 ttctag acac aaaaatggct gcagacca at tdgtga
SEQ ID NO 41 LENGTH 33 TYPE ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 41 cattaattct tctaaaggac gitattittctt atc
SEQ ID NO 42 LENGTH 21 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 42 gttctotgca C gacctagag g
<210> SEQ ID NO 43
US 2007/0015237 A1 Jan. 18, 2007 65
-continued gctogcatca ttgcttctgg agttcttgca gcggagctitt cqctdtgttctgctottgct 1380 gcc.ggc catc ttgtgcaaag toatatgacc cacaa.ccggit cocaggotcc tactc.cggcc 1440 aag cagtc.tc aggcc.gatct gcagogtcta caaaacggitt cqaatatttg catacgg to a 15 OO tag 1503
<210> SEQ ID NO 46 &2 11s LENGTH 500 &212> TYPE PRT <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Y. lipolytica <400 SEQUENCE: 46 Met Thr Glin Ser Val Lys Val Val Glu Lys His Val Pro Ile Val Ile 1 5 10 15 Glu Lys Pro Ser Glu Lys Glu Glu Asp Thir Ser Ser Glu Asp Ser Ile 2O 25 30 Glu Leu Thr Val Gly Lys Gln Pro Llys Pro Val Thr Glu Thr Arg Ser 35 40 45 Leu Asp Asp Leu Glu Ala Ile Met Lys Ala Gly Lys Thr Lys Lieu Lieu 50 55 60 Glu Asp His Glu Val Val Lys Lieu Ser Lieu Glu Gly Lys Lieu Pro Leu 65 70 75 8O Tyr Ala Lieu Glu Lys Glin Leu Gly Asp Asn Thr Arg Ala Val Gly Ile 85 90 95 Arg Arg Ser Ile Ile Ser Glin Glin Ser Asn Thr Lys Thr Leu Glu Thr 100 105 110 Ser Lys Lieu Pro Tyr Lieu. His Tyr Asp Tyr Asp Arg Val Phe Gly Ala 115 120 125 Cys Cys Glu Asn Val Ile Gly Tyr Met Pro Leu Pro Val Gly Val Ala 130 135 1 4 0 Gly Pro Met Asin Ile Asp Gly Lys Asn Tyr His Ile Pro Met Ala Thr 145 15 O 155 160 Thr Glu Gly Cys Lieu Val Ala Ser Thr Met Arg Gly Cys Lys Ala Ile 1.65 170 175 Asn Ala Gly Gly Gly Val Thir Thr Val Leu Thr Glin Asp Gly Met Thr 18O 185 19 O Arg Gly Pro Cys Val Ser Phe Pro Ser Lieu Lys Arg Ala Gly Ala Ala 195 200 2O5 Lys Ile Trp Lieu. Asp Ser Glu Glu Gly Lieu Lys Ser Met Arg Lys Ala 210 215 220 Phe Asin Ser Thr Ser Arg Phe Ala Arg Leu Gln Ser Leu. His Ser Thr 225 230 235 240 Leu Ala Gly Asn Lieu Lleu Phe Ile Arg Phe Arg Thr Thr Thr Gly Asp 245 250 255 Ala Met Gly Met Asn Met Ile Ser Lys Gly Val Glu His Ser Leu Ala 260 265 27 O Val Met Val Lys Glu Tyr Gly Phe Pro Asp Met Asp Ile Val Ser Val 275 280 285 Ser Gly Asn Tyr Cys Thr Asp Llys Llys Pro Ala Ala Ile Asn Trp Ile 29 O 295 3OO Glu Gly Arg Gly Lys Ser Val Val Ala Glu Ala Thr Ile Pro Ala His US 2007/0015237 A1 Jan. 18, 2007 66
-contin ued
305 310 315 320
Ile Val Lys Ser Val Lieu Lys Ser Glu Val Asp Ala Leu Wall Glu Lieu 325 330 335
Asn. Ile Ser Lys Asn Lieu. Ile Gly Ser Ala Met Ala Gly Ser Val Gly 340 345 35 O
Gly Phe Asn Ala His Ala Ala Asn Leu Wall Thr Ala Ile Tyr Leu Ala 355 360 365
Thr Gly Glin Asp Pro Ala Glin Asn Wall Glu Ser Ser Asn. Cys Ile Thr 370 375 38O
Leu Met Ser Asn Val Asp Gly Asn Leu Lieu. Ile Ser Wal Ser Met Pro 385 390 395 400
Ser Ile Glu Val Gly. Thir Ile Gly Gly Gly. Thr Ile Leu Glu Pro Glin 405 410 415
Gly Ala Met Leu Glu Met Leu Gly Val Arg Gly Pro His Ile Glu Thr 420 425 43 O
Pro Gly Ala Asn Ala Glin Glin Leu Ala Arg Ile Ile Ala Ser Gly Val 435 4 40 4 45
Leu Ala Ala Glu Lieu Ser Lieu. Cys Ser Ala Lieu Ala Ala Gly His Lieu 455 460
Wall Glin Ser His Met Thr His Asn Arg Ser Glin Ala Pro Thr Pro Ala 465 470 475 480 Lys Glin Ser Glin Ala Asp Leu Gln Arg Leu Gln Asn Gly Ser Asn. Ile 485 490 495
Ser 5 OO
<210> SEQ ID NO 47 &2 11s LENGTH 551 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Y. lipolytica <400 SEQUENCE: 47 ttctag acac aaaaatgggit ggagc catgc agaccctic go tgctatoctd atcgtccitcg 60 gtacagtgct cgctato gag tttgtc.gctt ggtottctda taagtatato atgcatggct 120 toggatgggg atggcataga gac catcacg agc.cc catga gggatttctt gagaagaatg 18O actitatacgc catcgttggc gctg.ccctct cgatacticat gtttgcc citc ggctotcc.ca 240 tgat catggg cgctgacgcc tggtggc.ccg galacctggat cgg actoggt gtoctottct atggtgtcat citataccctic gtgcacgacg gtotggtgca ccaac gatgg tittagatggg 360 tgcc-taaacg aggttacgcc aaacgacitcg tgcaggcc.ca taagctgcac cacgccacca 420 ttggcaagga aggaggcgtc. to attcggitt togtgttc.gc cc.gagat.ccc gcc gttctga 480 agCaggagct to gagctdaa C gaga agcag gtatcgc.cgt. gctg.cgagag gctgtggacg 540 gctagacgc.g t 551
<210> SEQ ID NO 48 &2 11s LENGTH 815 &212> TYPE DNA <213> ORGANISM: Sargass Sea <400 SEQUENCE: 48 US 2007/0015237 A1 Jan. 18, 2007 67
-continued ttctag acac aaaaatgact cqatctattt cotgg cctitc. caccitactgg caccitccago 60 ccitcct gttc ttcttggg to goaaacga at totcitcc toa agc.ccgaaaa got citcgtoc 120 togctggtot cattggttcc gcttggctgc titactictogg acttggcttt tocctitcccc 18O to catcaaac gagctggctt citcatcggitt gtctogttct cottagatct titcctgcaca 240 ccgg acttitt tatcgttgcc catgacgcta tdcacgctitc. tcttgttcct gaccaccctg 3OO gccitta accg ttggattgga C gtgtctgtc. ttctgatgta toctogactic toctacaaaa 360 gatgctg.ccg aaatcaccgt. c gacaccacc aagcc cctoga aac agttgaa gaccctgact 420 accaac gatg cactaacaac aatatocticg actggtacgt to actittat g g galaattacc 480 toggatggca acaattgctt aatctotcitt gcgtttggct cqctcitcacc titcc.gtgttt 540 citgactactic tactcaattic titccacctg.c toctitttcto tgtc.ctitcct citcatcgtot 600 ccitcctgtca actictitcc to gtgggaacct ggctgccaca cc.gac gaggc gctac tactic 660 gaccc.gg.cgt taccactcga tocctgaact tccaccotgc tictittcctitc gctgcttgct 720 accactitcgg ttaccaccgt gaacaccatgaatctoccitc tacticcittgg titccaacttic 78O citaaactc.cg agaaggttct citcatctaaa cqc git 815
<210 SEQ ID NO 49 &2 11s LENGTH 29 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 49 cacacggtac citgtaggttg g gttgggtg 29
<210 SEQ ID NO 50 &2 11s LENGTH 45 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 50 cacacggatc ctdtttaatt Caagaatgaa tatagagaag agaag 45
<210 SEQ ID NO 51 <211& LENGTH 42 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 51 cacacggatc. cacatcaa.ca atggcatctg. ccaccct tcc cc 42
<210> SEQ ID NO 52 &2 11s LENGTH: 31 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 52 cacacggatc caagtgctga C goggaactt g 31 US 2007/0015237 A1 Jan. 18, 2007 68
-continued
SEQ ID NO 53 LENGTH 37 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 53 cacaccgtct caaatgacca attitcctgat cqtcgto 37
SEQ ID NO 54 LENGTH 29 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 54 cacacagatc. tcacgtgcgc ticcitgc.gc.c 29
SEQ ID NO 55 LENGTH 32 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 55 cacaccctag gocatgag cq cacatgcc cit gc 32
SEQ ID NO 56 LENGTH 30 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 56 cacacaagct titcatgcggt gtc.ccc.cittg 30
SEQ ID NO 57 LENGTH 14 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 57 aatticgcggc cqct 14
SEQ ID NO 58 LENGTH 10 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Primer
<400 SEQUENCE: 58
10
SEQ ID NO 59 LENGTH 23 TYPE DNA US 2007/0015237 A1 Jan. 18, 2007 69
-continued <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 59 ccttctag to gtacgtag to agc 23
<210 SEQ ID NO 60 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 60 ccactgatct agaatctott totgg 25
<210> SEQ ID NO 61 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 61 ggct cattgc gcatgctaac atcg 24
<210> SEQ ID NO 62 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 62 cgacgatgct atgagcttct agacg 25
<210 SEQ ID NO 63 &2 11s LENGTH 34 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 63 cacacggatc ctataatgcc titcc.gcaacg accg 34
<210> SEQ ID NO 64 &2 11s LENGTH 35 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 64 cacacactag ttaaatttgg accitcaiacac gaccc 35
<210 SEQ ID NO 65 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer US 2007/0015237 A1 Jan. 18, 2007 70
-continued <400 SEQUENCE: 65 cacacggatc caatataaat gtctg.cgaag agcatcc tog 40
<210 SEQ ID NO 66 &2 11s LENGTH 34 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 66 cacacgcatg cittaa.gcttg gaacticcacc gcac 34
<210 SEQ ID NO 67 &2 11s LENGTH 47 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 67 cacacggatc caattittcaa aaattcttac titttitttittg gatggac 47
<210 SEQ ID NO 68 <211& LENGTH: 41 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 68 cacacggatc ctitttittcto cittgacgtta aagtatagag g 41
<210 SEQ ID NO 69 &2 11s LENGTH 38 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 69 cacacgagct caaaaatgga caatcaggct acacagag 38
<210 SEQ ID NO 70 <211& LENGTH 42 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 70 cacaccctag gtcacttittc ttcaatggitt citcttgaaat tig 42
<210 SEQ ID NO 71 &2 11s LENGTH 46 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 71 cacacgagct cqgaatatto aactgtttitt ttittatcatg ttgatg 46 US 2007/0015237 A1 Jan. 18, 2007 71
-continued
<210 SEQ ID NO 72 <211& LENGTH: 41 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 72 cacacggatc cittcttgaaa atatgcactc tatatottta g 41
<210 SEQ ID NO 73 &2 11s LENGTH 43 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OOTHER INFORMATION: Primer
<400 SEQUENCE: 73 cacacgctag citacaaaatg ttgtcactica aacgcatago aac 43
<210> SEQ ID NO 74 &2 11s LENGTH 38 &212> TYPE DNA <213> ORGANISM: Artificial &220s FEATURE <223> OOTHER INFORMATION: Primer
<400> SEQUENCE: 74 cacacgtoga cittaatgatc. tcggtatacg a gaggaac 38
<210 SEQ ID NO 75 <211& LENGTH: 1126 &212> TYPE PRT <213> ORGANISM: Artificial &220s FEATURE <223> OTHER INFORMATION: A. nidulans
<400 SEQUENCE: 75 Met Ala Ser Val Lieu. Ile Arg Arg Llys Phe Gly Thr Glu Gly Gly Ser 1 5 10 15 Asp Ala Glu Pro Ser Trp Leu Lys Arg Glin Val Thr Gly Cys Lieu Glin 2O 25 30 Ser Asp Ile Ser Arg Arg Ala Cys Ile His Pro Ile His Thr Ile Val 35 40 45 Val Ile Ala Leu Leu Ala Ser Thr Thr Tyr Val Gly Leu Leu Glu Gly 50 55 60 Ser Lieu Phe Asp Ser Phe Arg Asn. Ser Asn. Asn Val Ala Gly His Val 65 70 75 8O Asp Wall Asp Ser Lieu Lleu Lleu Gly Asn Arg Ser Lieu Arg Lieu Gly Glu 85 90 95 Gly. Thir Ser Trp Lys Trp Glin Val Glu Asp Ser Lieu. Asn Glin Asp Asp 100 105 110 Glin Lys Val Gly Asn Pro Glu Lieu Lys Arg Glu Val Asp Gln His Lieu 115 120 125 Ala Leu Thir Thr Leu Ile Phe Pro Asp Ser Ile Ser Lys Ser Ala Ser 130 135 1 4 0 Thr Ala Pro Ala Ala Asp Ala Lieu Pro Val Pro Ala Asn Ala Ser Ala 145 15 O 155 160 US 2007/0015237 A1 Jan. 18, 2007 72
-continued Gln Leu Leu Pro His Thr Pro Asn Leu Phe Ser Pro Phe Ser His Asp 1.65 170 175 Ser Ser Leu Val Phe Thr Leu Pro Phe Asp Glin Val Pro Glin Phe Leu 18O 185 19 O Arg Ala Val Glin Glu Lieu Pro Asp Pro Thr Lieu Glu Asp Asp Glu Gly 195 200 2O5 Glu Gln Lys Arg Trp Ile Met Arg Ala Thr Arg Gly Pro Val Ser Gly 210 215 220 Pro Asn Gly Thr Ile Ser Ser Trp Leu Ser Asp Ala Trp Ser Ser Phe 225 230 235 240 Val Asp Lieu. Ile Lys His Ala Glu Thir Ile Asp Ile Ile Ile Met Thr 245 250 255 Leu Gly Tyr Leu Ala Met Tyr Leu Ser Phe Ala Ser Leu Glu Phe Ser 260 265 27 O Met Lys Gln Leu Gly Ser Lys Phe Trp Leu Ala Thr Thr Val Leu Phe 275 280 285 Ser Gly Met Phe Ala Phe Leu Phe Gly Leu Leu Val Thr Thr Lys Phe 29 O 295 3OO Gly Val Pro Leu Asn Lieu Lleu Lleu Lleu Ser G Gly Lieu Pro Glu Lieu 305 310 3 320 Val Thr Thr Ile Gly Phe Glu Lys Pro Ile Ile Leu Thr Arg Ala Val 325 330 335 Leu Ser Ala Ser Ile Asp Lys Lys Arg Glin Gly Ser Ala Thr Ser Thr 340 345 35 O Pro Ser Ser Ile Glin Asp Ser Ile Glin Thr Ala Ile Arg Glu Glin Gly 355 360 365 Phe Glu Ile Ile Arg Asp Tyr Cys Ile Glu Ile Ser Ile Lieu. Ile Ala 370 375 38O Gly Ala Ala Ser Gly Val Glin Gly Gly Lieu Glin Glin Phe Cys Phe Lieu 385 390 395 400 Ala Ala Trp Ile Leu Phe Phe Asp Cys Ile Leu Leu Phe Thr Phe Tyr 405 410 415 Thir Thr Ile Lieu. Cys Ile Lys Lieu Glu Ile Thr Arg Ile Arg Arg His 420 425 43 O Val Thr Lieu Arg Lys Ala Leu Glu Glu Asp Gly Thr Thr Glin Ser Val 435 4 40 4 45 Ala Glu Lys Val Ala Ser Ser Asn Asp Trp Phe Gly Ala Gly Ser Asp 450 455 460 Asn Ser Asp Ala Asp Asp Ala Ser Val Phe Gly Arg Lys Ile Lys Ser 465 470 475 480 Asn Asn Val Arg Arg Phe Lys Phe Leu Met Val Gly Gly Phe Val Leu 485 490 495 Val Asn Val Val Asn Met Thr Ala Ile Pro Phe Arg Asn Ser Ser Leu 5 OO 505 51O. Ser Pro Leu Cys Asn Val Phe Ser Pro Thr Pro Ile Asp Pro Phe Lys 515 52O 525 Val Ala Glu Asn Gly Lieu. Asp Ala Thr Tyr Val Ser Ala Lys Ser Glin 530 535 540 Lys Leu Glu Phe Leu Val Thr Val Val Pro Pro Ile Lys Val Lys Leu 545 550 555 560 Glu Tyr Pro Ser Val His Tyr Ala Lys Leu Gly Glu Ser Glin Ser Ile US 2007/0015237 A1 Jan. 18, 2007 73
-continued
565 570 575 Glu Ile Glu Tyr Thr Asp Gln Leu Lieu. Asp Ala Val Gly Gly His Val 58O 585 59 O Lieu. Asn Gly Val Lieu Lys Ser Ile Glu Asp Pro Val Ile Ser Lys Trp 595 600 605 Ile Thr Ala Val Leu Thir Ile Ser Ile Val Leu Asn Gly Tyr Leu Phe 610 615 62O Asn Ala Ala Arg Trp Ser Ile Lys Glu Pro Glin Ala Ala Pro Ala Pro 625 630 635 640 Lys Glu Pro Ala Lys Pro Llys Val Tyr Pro Llys Thr Asp Lieu. Asn Ala 645 650 655 Gly Pro Lys Arg Ser Met Glu Glu Cys Glu Ala Met Lieu Lys Ala Lys 660 665 67 O Lys Ala Ala Tyr Lieu Ser Asp Glu Lieu Lieu. Ile Glu Lieu Ser Lieu Ser 675 680 685 Gly Lys Lieu Pro Gly Tyr Ala Lieu Lleu Lys Ser Leu Glu Asn. Glu Glu 69 O. 695 7 OO Leu Met Ser Arg Val Asp Ala Phe Leu Arg Ala Wall Lys Lieu Arg Arg 705 710 715 720 Ala Val Val Ser Arg Thr Pro Ala Thr Ser Ala Val Thr Ser Ser Leu 725 730 735 Glu Thr Ser Lys Leu Pro Tyr Lys Asp Tyr Asn Tyr Ala Leu Val His 740 745 750 Gly Ala Cys Cys Glu Asn. Wal Ile Gly. Thir Lieu Pro Leu Pro Leu Gly 755 760 765 Val Ala Gly Pro Leu Val Thr Asp Gly Glin Ser Tyr Phe Ile Pro Met 770 775 78O Ala Thir Ile Glu Gly Val Lieu Val Ala Ser Ala Ser Arg Gly Ala Lys 785 790 795 8OO Ala Ile Asn Ala Gly Gly Gly Ala Val Ile Val Lieu. Thr Gly Asp Gly 805 810 815 Met Thr Arg Gly Pro Cys Val Gly Phe Pro Thr Leu Ala Arg Ala Ala 820 825 83O Ala Ala Lys Val Trp Lieu. Asp Ser Glu Glu Gly Lys Ser Val Met Thr 835 840 845 Ala Ala Phe Asn. Ser Thr Ser Arg Phe Ala Arg Lieu Gln His Lieu Lys 85 O 855 860 Thr Ala Leu Ala Gly Thr Tyr Leu Tyr Ile Arg Phe Lys Thr Thr Thr 865 870 875 88O Gly Asp Ala Met Gly Met Asn Met Ile Ser Lys Gly Val Glu Lys Ala 885 890 895 Leu. His Val Met Ala Thr Glu Cys Gly Phe Asp Asp Met A Thir Ile 9 OO 905 9 Ser Val Ser Gly Asn. Phe Cys Thr Asp Llys Lys Ala Ala Ala Lieu. Asn 915 920 925 Trp Ile Asp Gly Arg Gly Lys Ser Val Val Ala Glu Ala Ile Ile Pro 930 935 940 Gly Asp Val Val Arg Asn. Wall Leu Lys Ser Asp Wall Asp Ala Lieu Val 945 950 955 96.O Glu Lieu. Asn. Thir Ser Lys Asn Lieu. Ile Gly Ser Ala Met Ala Gly Ser 965 970 975