An Endogenous Suppressor of Hairy-Wing Insulator Separates Regulatory Domains in Drosophila

An endogenous Suppressor of Hairy-wing insulator separates regulatory domains in Drosophila

Timothy J. Parnell, Michaela M. Viering, Astrid Skjesol, Cecilia Helou, Emily J. Kuhn, and Pamela K. Geyer*

Department of Biochemistry, University of Iowa College of Medicine, Iowa City, IA 52242

Edited by Mary-Lou Pardue, Massachusetts Institute of Technology, Cambridge, MA, and approved September 22, 2003 (received for review May 22, 2003) Insulators define independent domains of gene function through- DNA-binding protein, Suppressor of Hairy-wing [Su(Hw)], and out the genome. The Drosophila gypsy insulator was isolated from the BTB͞POZ domain protein Modifier of mdg4 [Mod- the gypsy retrotransposon as a region that contains a cluster of (mdg4)]67.2 that is recruited to chromosomes through protein– binding sites for the Suppressor of Hairy-wing [Su(Hw)] protein. To protein interactions with the Su(Hw) protein (19–22). The gypsy study the effects of the gypsy insulator on gene expression within insulator proteins colocalize at hundreds of genomic sites, with a single genomic domain, targeted gene replacement was used to Ͻ1% of these sites representing positions of the gypsy retro- exchange the endogenous yellow gene, located at cytological transposon (23). Although the function of the non-gypsy sites is location 1A, with a set of gypsy-modified yellow genes. Replaced unclear, it is proposed that these regions represent sites of yellow genes carried a gypsy insulator positioned between the endogenous insulators. yellow promoter and either the upstream or the downstream Recent studies demonstrate that gypsy insulators interact, tissue-specific enhancers. Whereas the gypsy insulator blocked the altering gene expression in complex ways. A single gypsy insu- function of the upstream enhancers at the endogenous location, lator placed between an enhancer and promoter blocks enhanc- the downstream enhancers were not blocked. Investigation of the er-activated transcription, whereas two gypsy insulators placed in 1A region revealed two clustered Su(Hw)-binding sites down- this position do not block the enhancer, an effect termed stream of the yellow gene, named 1A-2, that bind Su(Hw) in vivo insulator neutralization or bypass (24–26). Based on these and possess enhancer blocking function. We propose that interac- observations, it was proposed that the outcome of interactions tion between 1A-2 and the gypsy insulator permits activation of between a pair of gypsy insulators depends on the location of the insulators (27). Interactions between gypsy insulators that flank yellow expression by enhancers in the neighboring achaete–scute an enhancer may prevent enhancer action by defining a loop complex, causing an apparent absence of the block of the down- domain of higher order chromatin structure that prevents en- stream yellow enhancers. Based on these data, we suggest that hancer–promoter communication, whereas interactions between 1A-2 is an endogenous Su(Hw) insulator that separates regulatory two insulators located between the enhancer and promoter may domains within the Drosophila genome. facilitate enhancer action by decreasing the linear distance between the enhancer and promoter. These data imply that the enhancers ͉ chromatin ͉ gypsy ͉ gene replacement gypsy insulator proteins may have versatile roles within the Drosophila genome. ukaryotic chromosomes are partitioned into distinct chro- To gain insights into gypsy insulator function, targeted gene Ematin domains. These domains reflect the assembly of higher replacement was used to insert the gypsy insulator at several order structures that are proposed to fold in a manner that positions within the endogenous yellow gene, located within imparts functional independence (1, 2). Recent observations cytological region 1A near the tip of the X chromosome. This that up to 30% of genes within a eukaryotic genome are arranged gene encodes a protein responsible for dark pigmentation of in coexpressed clusters indicate that formation of independent larval and adult cuticle structures. Several independent tissue- structural domains may represent an important mechanism by specific enhancers, located upstream and downstream of the which transcriptional fidelity is maintained within the genome yellow promoter, are required for transcription (1). Studies of (3–5). transgenic flies carrying gypsy insulator-modified yellow genes Mechanisms used to delimit independent structural and func- demonstrated that the gypsy insulator blocks every yellow en- tional domains are poorly understood. A specialized class of hancer when positioned between the enhancer and promoter DNA elements, known as insulators, is implicated in these (11). Surprisingly, enhancer blocking was not observed when a gypsy insulator was placed within the intron of the endogenous processes (6). Insulators are defined by two properties. First, yellow gene, positioned between the bristle and tarsal claw insulators protect genes from chromosomal position effects that enhancers and promoter. Investigation of the 1A region revealed result from positive and negative influences of nearby chromatin an endogenous Su(Hw)-binding region, 1A-2, that has insulator (7–10). Second, insulators block enhancer and silencer action properties. We propose that interactions between the intronic when positioned between these control elements and a pro- gypsy insulator and 1A-2 promote activation of yellow transcrip- moter, but not when located upstream of the regulatory elements tion by enhancers in the neighboring achaete–scute complex (11–14). The link between chromatin domains and insulators has (AS-C). Our studies suggest that 1A-2 is an endogenous insulator been suggested by many studies, such as those of the chicken ␤ that establishes the independence of two neighboring regulatory -globin locus. This domain is defined by binding sites for the domains. insulator protein, CCCTC-binding factor (CTCF), that separate the cluster of globin genes from the neighboring 5Ј-region of Materials and Methods Ј condensed chromatin and the independently regulated 3 -folate Targeted Gene Replacement. Template plasmids used for gene receptor gene (15, 16). CTCF sites mark the transitions of replacement had an Ϸ7.7-kb yellow fragment (from a SalItoa distinct nuclease susceptibility, histone hyperacetylation and methylation of lysine 4 of histone H3 (16–18). These observations imply that the CTCF insulator protein defines a structural This paper was submitted directly (Track II) to the PNAS office. domain that imparts independent regulatory function. Abbreviations: Su(Hw), Suppressor of Hairy-wing; pSI, putative Su(Hw) insulator; AS-C, One well characterized Drosophila insulator is the gypsy insu- achaete–scute complex; ChIP, chromatin immunoprecipitation; CS, Canton S. lator, which was isolated from the gypsy retrotransposon. The *To whom correspondence should be addressed. E-mail: [email protected]. function of this insulator depends on two proteins, the zinc finger © 2003 by The National Academy of Sciences of the USA

13436–13441 ͉ PNAS ͉ November 11, 2003 ͉ vol. 100 ͉ no. 23 www.pnas.org͞cgi͞doi͞10.1073͞pnas.2333111100 Downloaded by guest on September 23, 2021 BglII) that was modified by insertion of a gypsy insulator cassette 6% polyacrylamide gel and digital images of ethidium bromide at positions Ϫ900, Ϫ700, Ϫ300, or ϩ660 relative to the tran- stained gels were quantitated by using IMAGEJ software (Na- scription start site. The gypsy insulator cassette had the 350-bp tional Institutes of Health). ChIP was performed on three insulator cloned between direct repeats of lox P sites, target sites separate chromatin preparations. for the Cre recombinase (28). Targeted gene replacement was Primers for ChIP PCR, listed 5Ј–3Ј, and their product sizes carried out as described (29). The structure of the yellow gene in were as follows: gypsy (311 bp) TCAAAAAATAAGTGCTG- each putative replacement strain was assessed by Southern CATACTTTTT and GAGCACAATTGATCGGCTA; hsp26 analysis. If this analysis showed evidence of an appropriately (306 bp) TTCGCTTGTGGATGAACTC and TCCACCACCT- sized insertion, the promoter and insulator regions were PCR TCACGTTGA; 1A-1 (276 bp) TTGCCTTGAAGAGATTG- amplified and the resulting fragments sequenced. In all cases, GTCG and CCTCAGACATAATTTGCCTGC; 1A-2 (269 bp) only those lines that had the predicted sequence were studied CTGCAAGCTAGATCCACCTG and CTTCGTCTACCGTT- further. GTGC; and 1A-6 (371 bp) TCTACCTGTTGCATTATTCTCC Phenotypic analysis involved crossing transgenic males to y1 and GCCTTTTAAGGTTACCTATTACAG. w67c23 females and analysis of wing and body pigmentation in females, as described (26). Pigmentation was scored in 3- to Analysis of 1A-2. A 520-bp fragment, termed 1A-2, encompassed 4-day-old female progeny by comparison to five parallel controls, two gypsy consensus sites and was PCR amplified from CS DNA where 1 represents null or nearly null, 5 represents WT, and by using the primers 5Ј-TTTGAAGGTTAAGAGTTTACG-3Ј scores of 2, 3, and 4 represent phenotypes of y2͞y1, y82f29͞y1#8, and 5Ј-CTTCGTCTACCGTTGTGC-3Ј. The PCR product was and y2͞y1#8 flies, respectively. For each cross, 20–30 females cloned in the Topo II vector (Invitrogen) and sequenced. An were scored independently by at least two people. Flies of a given intact 1A-2 was cloned between direct repeats of lox P sites and genotype, scored at different times, may show small differences inserted into the yellow gene at position Ϫ900 relative to the in pigmentation score. For this reason, we only consider differ- transcription start site in the P element transformation vector ences between scores of a unit or more to be significant (26). that had the yellow and mini-white genes (26). Seven transgenic lines with a single transposon insertion were established in the Su(Hw) Ab and Western Analysis. The Su(Hw) Ab was an affinity host strain y1w67c23. Flies from five lines were crossed into the purified, polyclonal rabbit Ab raised against a carboxyl-terminal su(Hw)v͞su(Hw)f genetic background to determine the contri- peptide (RENKKKPVGEQEKA, Bethyl Laboratories, Mont- bution of the Su(Hw) protein to the observed yellow phenotype. gomery, TX). Western analysis was done on protein extracts isolated from Canton S (CS, WT) and su(Hw) mutant third Results instar larvae. The su(Hw) genotypes studied were su(Hw)v͞ P element-mediated germ line transformation has shown that su(Hw)f and su(Hw)v͞su(Hw)v, where the su(Hw)f allele encodes the gypsy insulator blocks all of the yellow enhancers in a a protein mutated in finger 10 and su(Hw)v is a protein null, position-dependent manner (11). To test whether these effects carrying a deletion of the su(Hw) and the neighboring RpII15 were recapitulated at a single genomic location, we used targeted promoter (30, 31). Both su(Hw) mutant backgrounds completely gene replacement to exchange the WT yellow gene with a gene

reverse gypsy insulator effects. Protein from one larval equiva- carrying a gypsy insulator inserted 900-, 700-, or 300-bp upstream GENETICS lent was loaded on an 8% SDS polyacrylamide gel. Proteins were or 660-bp downstream of the promoter (Fig. 1). Successful gene detected on Western blots by using the Su(Hw) Ab (1:3,300 replacement stocks were called yϪ900gin,yϪ700gin, yϪ300gin, and dilution) followed by an anti-rabbit secondary Ab-conjugated to yϩ660gin, named for a gypsy insulator located at the indicated horseradish peroxidase. These analyses showed an Ϸ130-kDa position. protein that was present in CS larvae but reduced or absent in In the yϪ900gin, yϪ700gin, and yϪ300gin lines, the gypsy insulator was su(Hw) mutant larvae (see Fig. 3A), with two additional cross- between the wing and body enhancers and yellow promoter. reacting bands demonstrating equal loading between lanes. Phenotypic analysis showed that flies from each line had low Importantly, the Su(Hw) Ab recognized only one protein in levels of wing and body pigmentation (average pigmentation nuclear extracts isolated from CS embryos (see Fig. 3, N.E., 10 scores of 2, 2) and WT levels of bristle and tarsal claw pigmen- ␮g loaded). tation; a phenotype that matched that of y2 flies that carry a gypsy retrotransposon inserted at Ϫ700 bp (Fig. 1). These data dem- Chromatin Immunoprecipitation (ChIP). Chromatin was prepared onstrate that the gypsy insulator produces a consistent block of from nuclei isolated from third instar larvae. This stage was the yellow wing and body enhancers when positioned between chosen because large quantities of larvae were available, and these enhancers and the promoter, irrespective of the precise procedures for nuclear isolation were established (32). The location within the upstream regulatory region (11). Previous Su(Hw) protein is ubiquitously expressed, suggesting that this studies of gypsy insulator effects in the Drosophila affinidisjuncta stage accurately reflects genomic binding of protein. Nuclei were alcohol dehydrogenase gene showed that insertion of the gypsy isolated as described (32), except that buffer A was prepared insulator within 500 bp of the promoter activated transcription with Hepes-KOH (pH 7.6) and supplemented with 1ϫ protease in a manner that depended on the Su(Hw) protein (33). Such inhibitor mixture (Roche) and 0.1 mg͞ml PMSF. Purified nuclei activating effects are not a general property of this insulator were resuspended in buffer A plus 0.1% Nonidet P-40 (Ϸ108 because we find that the gypsy insulator impedes the upstream nuclei͞ml) and cross-linked with 1% formaldehyde for 5 min at enhancers in yϪ300gin flies. room temperature. Nuclei were lysed and the chromatin sheared In the yϩ660gin line, the gypsy insulator was inserted between the to an average length of Ϸ700 bp by sonication and immunopre- downstream bristle and tarsal claw enhancers and yellow pro- cipitated as described (Upstate Biotechnology, Lake Placid, moter. Flies isolated from three independent yϩ660gin replace- NY). In each ChIP experiment, a chromatin solution containing ment lines showed WT pigmentation in all tissues, including the Ϸ20 ␮g of genomic DNA was incubated with either 1 ␮gof bristles and tarsal claws (average pigmentation scores of 5, 5 in Su(Hw) Ab or normal rabbit IgG (Sigma). The precipitated the wing and body, Fig. 1). These results indicate that the gypsy products were analyzed by PCR, by using 10% of the precipitated insulator did not block the downstream enhancers, even though DNA or 0.1% of the input DNA for all primers except the gypsy previous transgene studies demonstrated that a ϩ660 gypsy primers where 1% and 0.01% were used, respectively. PCR insulator was functional in this yellow position (11). conditions were tested for each primer set to ensure amplifica- Southern analysis was undertaken to analyze the structure of tion was in the linear range. PCR products were analyzed on a the yellow gene in yϩ660gin flies. Genomic DNA was isolated,

Parnell et al. PNAS ͉ November 11, 2003 ͉ vol. 100 ͉ no. 23 ͉ 13437 Downloaded by guest on September 23, 2021 contained 5Ј-yellow sequences and a second 1.1-kb band that contained the yellow promoter and extended Ϸ0.15 kb downstream of the ϩ660 insertion point. A third fragment, corresponding to sequences downstream of the 1.1-kb KpnI fragment, was not detected, possibly because the size was Ͼ39 kb. Analysis of genomic DNA isolated from each of the yϩ660gin convertant lines showed the Ϸ5-kb fragment, suggesting that a gross rear- rangement of the gene during replacement did not occur. The yϩ660gin flies had a second band of 1.4 kb that differed from the band in CS flies and was the expected size for insertion of the gypsy insulator. PCR amplification and sequence analysis of the promoter and insulator regions in the yϩ660gin lines confirmed that the yϩ660gin alleles had a WT promoter and gypsy insulator inserted at ϩ660. These data suggest that the lack of enhancer blocking in flies may be caused by sequences other than the ϩ660 gypsy insulator.

Su(Hw)-Binding Sites Downstream of the yellow Gene. We postulated that the loss of enhancer blocking by the ϩ660 gypsy insulator might reflect insulator neutralization caused by interactions between the ϩ660 insulator and a nearby endogenous Su(Hw) insulator. To identify a putative Su(Hw) insulator (pSI), several features of the gypsy insulator were considered. The gypsy insulator contains 12, closely spaced, degenerate Su(Hw)- binding sites that share a TGCATA core and are embedded in AT-rich sequences (19, 34). Insertion into, or deletion of, binding sites within the region disrupts the insulator function (35–37), with an apparent threshold of four binding sites required for Fig. 1. Gypsy insulators converted into the endogenous yellow gene. (A)A map of the yellow gene. The coding region is represented by black rectangles, activity (38). Based on these data, we predicted that a pSI would untranslated regions are represented by open rectangles, and enhancers are have two features. First, the pSI would have sites that match the represented by shaded ovals. Enhancers are wing (W), body (B), bristle (Br), gypsy consensus site (YRYTGCATAYYY), with an intact TG- and tarsal claw (TC). The gypsy insulators (ﬁlled triangles) were inserted at CATA core (Fig. 2). Second, the pSI would contain at least four positions Ϫ900, Ϫ700, Ϫ300, and ϩ660 relative to the start site of transcription closely spaced Su(Hw) sites. Analysis of a 20-kb region encom- (bent arrow). Restriction sites are SalI (S), HinD III (H), BglII (G), and KpnI (K). passing the yellow gene revealed six regions that matched the gin (B) The level of yellow expression in the y lines is indicated for the wing, consensus sequence, none of which met all of our predictions body, bristle, and tarsal claw tissues and was inferred by analyses of cuticle (Fig. 2). Three regions (1A-1, 1A-2, and 1A-6) had gypsy phenotype. (C) Southern blot analysis of the yϩ660gin genomic DNA digested with KpnI and probed with a SalItoBglII fragment of yellow that includes the consensus sites with an intact TGCATA core, whereas the other entire gene. The ﬁrst lane is CS, and the remaining lanes are three indepen- sites had mutated core sequences. Only 1A-2 and 1A-6 contained dent yϩ660gin lines. Sizes in kilobases are indicated on the left, with arrows on two or more sites, causing us to consider these as pSIs. the right showing the sizes of hybridizing bands. ChIP experiments were undertaken to determine whether the Su(Hw) protein bound any of the Su(Hw) consensus sites in vivo (Fig. 3). As a positive control, primers in the gypsy retrotrans- digested with KpnI, transferred to Nytran, and hybridized with poson that surrounded the gypsy insulator were used. These a fragment including the complete yellow gene (Fig. 1). Hybrid- primers produced a robust PCR signal from material precipi- ization in WT flies (CS) showed two bands, an Ϸ5-kb band that tated by the Su(Hw) Ab (2.0 Ϯ 0.7% of the input DNA), whereas

Fig. 2. Location of predicted Su(Hw)-binding sites surrounding the yellow locus. The positions of predicted Su(Hw)-binding sites in the yellow-achaete region are indicated, with intact () or polymorphic (ƒ) TGCATA motifs as raised triangles. The sequence of each binding site compared to the gypsy consensus is shown. The TGCATA core is boxed, polymorphic nucleotides are in lowercase, and the number of nucleotides between core sites in a cluster is listed at the right.

13438 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.2333111100 Parnell et al. Downloaded by guest on September 23, 2021 Fig. 4. 1A-2 acts as an enhancer blocker. (Top) Structure of the P[y1A-2] transposon. A DNA fragment containing 1A-2 (ƒ) was inserted between the upstream enhancers and promoter of a yellow gene in a P transposon (black boxes with P show P element ends). Symbols are described in Fig. 1. (Bottom) Fig. 3. ChIP of pSI-binding sites. (A) Shown is a Western blot of third-instar Phenotype of P[y1A-2] flies. The average wing and body (W, B) pigmentation ϩ Ϫ larval proteins isolated from three different su(Hw) genotypes probed with a score in a WT [su(Hw) ] and mutant [su(Hw) ] background is listed. A “ϩ” Su(Hw) Ab. The v͞f allele represents su(Hw)v͞su(Hw)f heterozygotes, and v͞v indicates average level of pigmentation was slightly greater than that of the represents su(Hw)v͞su(Hw)v flies. N.E. corresponds to embryonic nuclear ex- corresponding control. tract from CS. Sizes in kilodaltons are shown on the left. (B) Representative examples of PCR products obtained from chromatin material that was directly purified (Input, IN) or immunoprecipitated with Su(Hw) or nonspecific (N.S.) to the level found in transgenic P[En G] flies that carry a gypsy Ab. (C) The average of at least three ChIP experiments is displayed. Results are insulator inserted at the same position in the yellow gene expressed as percentage of input DNA. Gray bars, Su(Hw); black bars, non- (pigmentation scores of 3, 2; 26). Importantly, the bristle and specific Ab. tarsal claw phenotypes of the P[y1A-2] flies were WT, demonstrating that the low level of expression in the wing and body was not caused by insertion of a silencer. Although the average PCR amplification of the gypsy insulator in ChIP material from 1A-2 the nonspecific Ab produced a low signal (0.2 Ϯ 0.1% of the phenotype among the P[y ] lines was similar to that of P[En G] flies, none of these lines had pigmentation levels as low as that

input DNA; Fig. 3). As a negative control, primers correspond- 2 gin GENETICS ing to the heat shock protein (hsp) 26 coding region were used, found in y flies or the flies from the upstream y convertant because this gene is devoid of consensus Su(Hw)-binding sites. lines (pigmentation scores of 2, 2), whereas several P[En G] lines Only a low level of PCR amplification occurred from the ChIP did. These data suggest that 1A-2 establishes a weaker enhancer material from either Ab (Ͻ0.1% of the input DNA; Fig. 3), block than the gypsy insulator, consistent with the fewer number confirming that the Su(Hw) protein does not associate with this of Su(Hw)-binding sites associated with this insulator. Insertion gene. of 1A-2 upstream of the yellow wing and body enhancers did not The association of the Su(Hw) protein was tested by using interfere with enhancer function (data not shown), demonstrat- primers that flanked the pSIs. The 1A-2 primers amplified a ing that 1A-2 effects on gene expression are position-dependent. robust product from chromatin precipitated by the Su(Hw) Ab, The 1A-2 region was independently identified due to disruption whereas only a low level of product was produced from the of enhancer activated transcription in the achaete–scute gene ChIP material produced by incubation with the nonspecific Ab cluster and subsequently shown to block the white eye enhancer (1.3 Ϯ 0.3% and Ͻ0.1%, respectively; Fig. 3). The level of the (39). Taken together these data suggest that 1A-2 has general 1A-2 PCR product from the Su(Hw) ChIP material implies enhancer blocking effects. that the Su(Hw) protein associates with this region in vivo.In To test the contribution of the Su(Hw) protein to enhancer contrast, a low level of PCR product was produced by primers blocking by 1A-2, we crossed flies from five P[y1A-2] lines into a v͞ f surrounding 1A-6 in chromatin that was precipitated by either su(Hw) su(Hw) mutant background. In four of five cases, the the Su(Hw) or nonspecific Ab (Ͻ0.1% of input, Fig. 3). level of pigmentation in su(Hw) WT and mutant P[y1A-2] flies was Similarly, a low level of PCR amplification of ChIP material not substantially different, whereas the fifth line showed an was obtained by using primers surrounding the four pSIs with increase in body pigmentation only (Fig. 4). Our findings suggest a single Su(Hw)-binding site (Fig. 3 and data not shown). that enhancer blocking by 1A-2 is less dependent on the Su(Hw) Based on these in vivo studies, we conclude that 1A-2 is the protein than previously reported (39) and imply that the Su(Hw) only pSI that binds the Su(Hw) protein. protein cooperates with other protein(s) bound to 1A-2 to prevent enhancer–promoter communication. Enhancer Blocking by the pSI 1A-2. To test whether 1A-2 had properties of an insulator, an enhancer-blocking assay was used. Discussion This assay provides a direct assessment of the ability of a The Su(Hw) insulator protein binds hundreds of sites within the sequence to prevent regulatory interactions. To this end, the Drosophila genome. The vast majority of these regions have not P[y1A-2] transposon was constructed that carried 1A-2 inserted been characterized because few correspond to the gypsy insula- 900 bp upstream of the yellow transcription start, between the tor. Isolation of endogenous Su(Hw) sites has been hampered by wing and body enhancers and promoter. Seven P[y1A-2] lines were the distinct sequence organization of these sites relative to the established and phenotypic analyses were conducted. We found gypsy insulator. Here we report the identification of the first that P[y1A-2] flies had low levels of wing and body pigmentation endogenous Su(Hw)-binding region, 1A-2, which was discovered (Fig. 4, an average pigmentation score of 3, 2ϩ), which is similar through effects on enhancer blocking by the gypsy insulator.

Parnell et al. PNAS ͉ November 11, 2003 ͉ vol. 100 ͉ no. 23 ͉ 13439 Downloaded by guest on September 23, 2021 Several features of 1A-2 differ from the gypsy insulator. The 1A-2 contains two Su(Hw)-binding sites with nonidentical core sequences, spaced by 49 bp. In contrast, the gypsy insulator has 12 Su(Hw) sites that contain an invariant TGCATA core and are distanced an average of 26–28 bp. The mutated core site in 1A-2 binds the Su(Hw) protein in vitro (B. L. Gilmore, M. S. Wold, and P. K. G., unpublished data), demonstrating that the TGCATA core is not essential for DNA association. These data support the proposition that the Su(Hw) protein binds a broad spectrum of endogenous sequences. The in vivo requirements of DNA binding by the Su(Hw) protein are unclear. We characterized a second cluster of three Su(Hw) sites, called pSI 1A-6, and found that these sequences do not bind the Su(Hw) protein in vivo. Previous studies suggest that one critical determinant of Su(Hw) association is the spacing between binding sites (38). In 1A-6, the Su(Hw) sites are spaced at Ϸ100 bp apart, a greater distance than found in the gypsy or 1A-2 insulators. These observations indicate that in vivo binding Fig. 5. A model for yellow activation in the bristles of yϩ660gin ﬂies. In a WT by the Su(Hw) protein may require the presence of at least two chromosome, the 1A-2 insulator (ƒ) separates the yellow and AS-C regulatory sites within 100 bp. Further studies are needed to more fully domains and prevents cross-regulation by enhancers (curved black and gray ϩ660gin understand the determinants of Su(Hw) DNA binding. arrows, Top). In the y allele, the gypsy insulator () interacts with the Transgene studies demonstrated that 1A-2 prevented transcrip- 1A-2 insulator, allowing bypass of enhancers from the AS-C to activate yellow transcription. The thick arrows indicate the possible participation of additional activation by the yellow enhancers in a position-dependent tional enhancers in AS-C other than those shown. manner, without inactivation of the promoter. Based on these findings, we conclude that 1A-2 has properties of a genomic insulator. It was unexpected that Su(Hw)-binding regions with helix–loop–helix transcription factors required for the develop- fewer than four sites would establish a block of enhancers, as ment of extra sensory organs in the fly, such as the bristles and previous studies showed that synthetic insulators with fewer than hairs (reviewed in ref. 43). This complex contains multiple four tandem copies of a gypsy insulator site did not (38). The distinct enhancer regions distributed over a Ϸ90-kb region (44). We sequence composition of 1A-2 relative to the synthetic gypsy postulate that enhancers from the AS-C drive transcription in insulators may account for these differences. The Su(Hw) sites in the bristles and tarsal claws of the yϩ660gin flies because these 1A-2 may have a higher intrinsic affinity than the gypsy insulator elements are active at the same time and in the same tissues as sites, thereby increasing DNA occupancy by the Su(Hw) protein the yellow intronic enhancers. such that only two sites are needed for an enhancer block. Alter- Several lines of evidence support the proposal that the en- natively, 1A-2 may bind additional protein(s) that cooperate with dogenous role of 1A-2 is to prohibit regulatory interactions the Su(Hw) protein to block enhancer action. This possibility is between the yellow gene and enhancers in the AS-C (Fig. 5). consistent with our observation that mutation of the Su(Hw) First, the 1A-2 element demonstrates insulator properties in an protein, as assessed by phenotypic analysis of su(Hw)v͞su(Hw)f flies, enhancer blocking assay. Second, data from genetic studies had a minimal, if any, effect on enhancer blocking by 1A-2. indicate that cross-regulatory interactions occur between the Although it is possible that the distinct sequence of 1A-2 permits f yellow and AS-C regulatory regions when a gypsy insulator is DNA association by the Su(Hw) protein due to different zinc finger ϩ inserted. These data include our studies of y 660gin flies and requirements for binding, we favor the alternative that other previous studies of the ‘‘hairy-wing’’ class of achaete–scute proteins are needed for the residual block. Interestingly, a 125-bp fragment of 1A-2 that includes only the Su(Hw)-binding sites does alleles, a set of dominant, gain of function mutations that not confer enhancer blocking (39), demonstrating that the 1A-2 produce supernumerary chaetae and sensilla and were respon- Su(Hw) sites are not sufficient for insulator activity. The identity of sible for the original identification of the su(Hw) gene (45, 46). the putative insulator protein is unknown, as 1A-2 does not contain Our discovery of 1A-2 provides new insights into the changes in binding sites for the known Drosophila insulator proteins, Zw5, expression associated with the hairy-wing class of mutations. Two alleles, Hw1 and a spontaneous derivative of Hw1 called BEAF, or GAGA factor (40–42). BS The 1A-2 element was identified because a gypsy insulator Hw , carry an insertion of a gypsy retrotransposon within inserted at ϩ660 in the yellow intron did not reduce pigmentation achaete that increases achaete mRNA levels, leading to an in the bristle and tarsal claws of yϩ660gin flies, although it was overproduction of a transcription factor that directs sensilla positioned between the bristle and tarsal claw enhancers and development (47). We propose that the increased achaete promoter. We propose that these effects result from interactions mRNA levels result from an interaction between 1A-2 and the between the ϩ660 gypsy insulator and the downstream 1A-2 gypsy insulator in the gypsy retrotransposon that brings yellow element, located Ϸ4.4 kb away (Fig. 5). Previous studies have enhancers to the AS-C to activate transcription. This model is demonstrated that interactions between two gypsy insulators supported by two X-ray-induced revertants of Hw1 that appear result in an apparent neutralization of insulator function because to be associated with chromosomal rearrangements that have these associations bring distant enhancers to a target promoter, breakpoints in or downstream of the yellow regulatory region not because the insulators are inactivated (25). Based on these that contains the bristle enhancer (47), indicating that the yellow findings, we predict that transcription in the bristles and tarsal enhancers participate in the generation of the hairy-wing phe- ϩ claws in yϩ660gin flies results from the action of enhancers notype. Our y 660gin flies do not have a hairy-wing phenotype, downstream of the loop formed by 1A-2 and the gypsy insulator, suggesting that the yellow bristle or tarsal claw enhancers are the not from the yellow bristle and tarsal claw enhancers that are regulatory elements participating in the Hw1 phenotype but fail ϩ present in the constrained loop that is presumed to prevent to do so in y 660gin flies because these enhancers are in a enhancer action. This supposition is supported by the properties constrained loop (Fig. 5). We note that there are no discernable of the neighboring genes. 1A-2 is 8.5 kb upstream of the achaete changes in AS-C gene expression in a su(Hw) mutant back- gene, one of a cluster of genes within AS-C that encode basic ground. We propose that these effects may reflect functional

13440 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.2333111100 Parnell et al. Downloaded by guest on September 23, 2021 redundancy in the 1A-2 insulator, a proposition that is supported We thank Stephanie Grade, Lori Wallrath, Ting Wu, and Oya Yazgan by our experiments on enhancer blocking by 1A-2 in a su(Hw) for critical reading of the manuscript and comments on the experimental mutant background. Further studies are needed to determine design and interpretation. This work was supported by National Institute whether the natural role of 1A-2 is to establish an insulator that of Health Grants GM42539 (to P.K.G.) and GM61936 (to P.K.G. and separates the yellow and AS-C regulatory domains. C.-t. Wu, Harvard Medical School, Boston).

1. Kuhn, E. J. & Geyer, P. K. (2003) Curr. Opin. Cell Biol. 15, 259–265. 27. Mongelard, F. & Corces, V. G. (2001) Nat. Struct. Biol. 8, 192–194. 2. Labrador, M. & Corces, V. G. (2002) Cell 111, 151–154. 28. Siegal, M. L. & Hartl, D. L. (1996) Genetics 144, 715–726. 3. Boutanaev, A. M., Kalmykova, A. I., Shevelyov, Y. Y. & Nurminsky, D. I. 29. Morris, J. R., Geyer, P. K. & Wu, C. T. (1999) Genes Devel. 13, 253–258. (2002) Nature 420, 666–669. 30. Harrison, D. A., Gdula, D. A., Coyne, R. S. & Corces, V. G. (1993) Genes Devel. 4. De Gregorio, E., Spellman, P. T., Tzou, P., Rubin, G. M. & Lemaitre, B. (2002) 7, 1966–1978. EMBO J. 21, 2568–2579. 31. Harrison, D. A., Mortin, M. A. & Corces, V. G. (1992) Mol. Cell. Biol. 12, 5. Spellman, P. T. & Rubin, G. M. (2002) J. Biol. 1, 5. 928–935. 16, 6. West, A. G., Gaszner, M. & Felsenfeld, G. (2002) Genes Dev. 271–288. 32. Wallrath, L. L., Swede, M. J. & Elgin, S. C. R. (1998) in Chromatin: A Practical 7. Roseman, R. R., Pirrotta, V. & Geyer, P. K. (1993) EMBO J. 12, 435–442. Approach, ed. Gould, H. (Oxford Univ. Press, Oxford), pp. 59–77. 8. Roseman, R. R., Johnson, E. A., Rodesch, C. K., Bjerke, M., Nagoshi, R. N. 33. Wei, W. & Brennan, M. D. (2001) Mol. Cell. Biol. 21, 7714–7720. & Geyer, P. K. (1995) Genetics 141, 1061–1074. 34. Marlor, R. L., Parkhurst, S. M. & Corces, V. G. (1986) Mol. Cell. Biol. 6, 9. Kellum, R. & Schedl, P. (1991) Cell 64, 941–950. 10. Chung, J. H., Whiteley, M. & Felsenfeld, G. (1993) Cell 74, 505–514. 1129–1134. 11. Geyer, P. K. & Corces, V. G. (1992) Genes Devel. 6, 1865–1873. 35. Hoover, K. K., Gerasimova, T. I., Chien, A. J. & Corces, V. G. (1992) Genetics 12. Kellum, R. & Schedl, P. (1992) Mol. Cell. Biol. 12, 2424–2431. 132, 691–697. 13. Holdridge, C. & Dorsett, D. (1991) Mol. Cell. Biol. 11, 1894–1900. 36. Geyer, P. K., Green, M. M. & Corces, V. G. (1988) Proc. Natl. Acad. Sci. USA 14. Mallin, D. R., Myung, J. S., Patton, J. S. & Geyer, P. K. (1998) Genetics 148, 85, 8593–8597. 331–339. 37. Flavell, A. J., Alphey, L. S., Ross, S. J. & Leigh-Brown, A. J. (1990) Mol. Gen. 15. Prioleau, M. N., Nony, P., Simpson, M. & Felsenfeld, G. (1999) EMBO J. 18, Genet. 220, 181–185. 4035–4048. 38. Scott, K. C., Taubman, A. D. & Geyer, P. K. (1999) Genetics 153, 16. Saitoh, N., Bell, A. C., Recillas-Targa, F., West, A. G., Simpson, M., Pikaart, 787–798. M. & Felsenfeld, G. (2000) EMBO J. 19, 2315–2322. 39. Golovnin, A., Birukova, I., Romanova, O., Silicheva, M., Parshikov, A., 17. Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D. & Felsenfeld, G. (2001) Savitskaya, E., Pirrotta, V. & Georgiev, P. (2003) Development (Cambridge, Science 293, 2453–2455. U.K.) 130, 3249–3258. 18. Litt, M. D., Simpson, M., Recillas-Targa, F., Prioleau, M. N. & Felsenfeld, G. 40. Gaszner, M., Vazquez, J. & Schedl, P. (1999) Genes Devel. 13, 2098–2107. (2001) EMBO J. 20, 2224–2235. 41. Zhao, K., Hart, C. M. & Laemmli, U. K. (1995) Cell 81, 879–889. 19. Spana, C., Harrison, D. A. & Corces, V. G. (1988) Genes Devel. 2, 1414–1423. 42. Ohtsuki, S. & Levine, M. (1998) Genes Devel. 12, 3325–3330. 20. Georgiev, P. G. & Gerasimova, T. I. (1989) Mol. Gen. Genet. 220, 121–126. 43. Campuzano, S. & Modolell, J. (1992) Trends Genet. 8, 202–208. 21. Ghosh, D., Gerasimova, T. I. & Corces, V. G. (2001) EMBO J. 20, 2518–2527. 44. Gomez-Skarmeta, J. L., Rodriguez, I., Martinez, C., Culi, J., Ferres-Marco, D., 22. Gause, M., Morcillo, P. & Dorsett, D. (2001) Mol. Cell. Biol. 21, 4807–4817. 9, 23. Gerasimova, T. I., Gdula, D. A., Gerasimov, D. V., Simonova, O. & Corces, Beamonte, D. & Modolell, J. (1995) Genes Dev. 1869–1882. V. G. (1995) Cell 82, 587–597. 45. Lindsley, D. L. & Grell, E. H. (1968) Genetic Variations of Drosophila melanogaster (Carnegie Institution of Washington, Baltimore), Pub. No. 627.

24. Cai, H. N. & Shen, P. (2001) Science 291, 493–495. GENETICS 25. Muravyova, E., Golovnin, A., Gracheva, E., Parshikov, A., Belenkaya, T., 46. Modolell, J., Bender, W. & Meselson, M. (1983) Proc. Natl. Acad. Sci. USA 80, Pirrotta, V. & Georgiev, P. (2001) Science 291, 495–498. 1678–1682. 26. Kuhn, E. J., Viering, M. M., Rhodes, K. M. & Geyer, P. K. (2003) EMBO J. 22, 47. Campuzano, S., Balcells, L., Villares, R., Carramolino, L., Garcia-Alonso, L. & 2463–2471. Modolell, J. (1986) Cell 44, 303–312.

Parnell et al. PNAS ͉ November 11, 2003 ͉ vol. 100 ͉ no. 23 ͉ 13441 Downloaded by guest on September 23, 2021