Faille et al. BMC Evolutionary Biology 2013, 13:248 http://www.biomedcentral.com/1471-2148/13/248

RESEARCH ARTICLE Open Access A molecular phylogeny of Alpine subterranean Trechini (Coleoptera: Carabidae) Arnaud Faille1*, Achille Casale2, Michael Balke1 and Ignacio Ribera3

Abstract Background: The Alpine region harbours one of the most diverse subterranean faunas in the world, with many species showing extreme morphological modifications. The ground beetles of tribe Trechini (Coleoptera, Carabidae) are among the best studied and widespread groups with abundance of troglobionts, but their origin and evolution is largely unknown. Results: We sequenced 3.4 Kb of mitochondrial (cox1, rrnL, trnL, nad1) and nuclear (SSU, LSU) genes of 207 specimens of 173 mostly Alpine species, including examples of all subterranean genera but two plus a representation of epigean taxa. We applied Bayesian methods and maximum likelihood to reconstruct the topology and to estimate divergence times using a priori rates obtained for a related ground beetle genus. We found three main clades of late Eocene-early Oligocene origin: (1) the genus Doderotrechus and relatives; (2) the genus Trechus sensu lato, with most anisotopic subterranean genera, including the Pyrenean lineage and taxa from the Dinaric Alps; and (3) the genus Duvalius sensu lato, diversifying during the late Miocene and including all subterranean isotopic taxa. Most of the subterranean genera had an independent origin and were related to epigean taxa of the same geographical area, but there were three large monophyletic clades of exclusively subterranean species: the Pyrenean lineage, a lineage including subterranean taxa from the eastern Alps and the Dinarides, and the genus Anophthalmus from the northeastern Alps. Many lineages have developed similar phenotypes independently, showing extensive morphological convergence or parallelism. Conclusions: The Alpine Trechini do not form a homogeneous fauna, in contrast with the Pyrenees, and show a complex scenario of multiple colonisations of the subterranean environment at different geological periods and through different processes. Examples go from populations of an epigean widespread species going underground with little morphological modifications to ancient, geographically widespread lineages of exclusively subterranean species likely to have diversified once fully adapted to the subterranean environment.

Background [2-4]. The high degree of parallelism or convergence in Different Arthropod lineages have successfully colonised these modifications has always been an added difficulty to subterranean environments, prevalent among them are reveal phylogenetic relationships among the subterranean aquatic and terrestrial crustaceans, arachnids, myriapods species [5-8], but at the same time poses a very interesting and insects, in particular Coleoptera [1]. In the western evolutionary problem, as the mechanisms through which it Palaearctic, two groups of Coleoptera include the majority is achieved remain largely unknown. of the underground diversity: the tribes Trechini (family According to the traditional view, virtually every Carabidae) and Leptodirini (family Leiodidae), with hun- species of subterranean Coleoptera developed the troglo- dreds of species with different degrees of morphological morphic characters independently, but recent work on modifications assumed to be adaptations to the subterra- the Pyrenean fauna has challenged this assumption by nean environment – different degrees of “troglomorphism” demonstrating a single origin for ancient and diverse clades of exclusively subterranean species [9,10]. At the same time, the phylogeny of Pyrenean Trechini shows * Correspondence: [email protected] 1Zoologische Staatsammlung, Muenchhausenstrasse 21, Munich 81247, Germany Full list of author information is available at the end of the article

© 2013 Faille et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 2 of 16 http://www.biomedcentral.com/1471-2148/13/248

that the currently recognised genera (Aphaenops (nomen The Trechini fauna of the Alpine range is one of the protectum [11]), Hydraphaenops and Geotrechus), which best known in the world due to two centuries of studies were recognised mainly based on strong similarities in by professional and amateur speleologists and biospe- the general body shape [9,10,12], are largely poly- or leologists. The subterranean species are currently paraphyletic, with a striking degree of morphological grouped into 14 genera, 13 of them endemic to the Alps convergence. [11,20-22]. The origin of this subterranean fauna has In a wider study, Faille et al. [13] included other highly been debated at length by different authors, who pro- modified western Mediterranean cave Trechini consid- posed contrasting hypotheses [2,14,18-20]. Some of the ered by some authors to be related to the Pyrenean most specialised and emblematic species have been fauna (i.e. to be members of the “phyletic lineage” of related to the Pyrenean fauna due to their strikingly similar Aphaenops in the sense of Jeannel [2]), such as the Iber- external appearance, in particular some ultra-specialized ian Apoduvalius and Paraphaenops, Speotrechus from Trechini very similar to the Pyrenean Aphaenops (the so southeastern France, or the Sardinian Sardaphaenops. called “aphaenopsian” shape [1,23]). Within the Alps, some All these species were found to be not related to the genera have fragmented distributions, such as Duvalius or Pyrenean fauna but to other lineages in the same geo- Trichaphaenops, or morphologically similar genera occupy graphical areas, showing again a strong morphological isolated areas, such as Boldoriella and Orotrechus, and yet convergence among them [13]. However, in that study some others have divergent morphologies with unknown the basal relationships among the main lineages of the affinities, such as Doderotrechus, Italaphaenops, Allegrettia western Mediterranean fauna of Trechini could not be or Lessinodytes [14,18-20,24-27]. With this study we at- established, likely due to the lack of representation of tempt to clarify the geographical and temporal origin of all more eastern lineages. these subterranean taxa with the use of molecular data and Here we extend the study of subterranean Trechini to a comprehensive representation of the subterranean the fauna of the Alps, which include members of the and epigean European Trechini, including a wide sam- Aphaenops lineage assumed to be related to the Pyren- ple of the most diverse and widespread genera (Trechus ean fauna but also members of the traditionally recog- and Duvalius)aswellasexamplesofallAlpinetroglo- nised second major division of Trechini, the “isotopics” biont genera but two. Using c. 4Kb of a combination of (in opposition to the “anisotopics”, which include all the mitochondrial and nuclear markers of 207 specimens in species of the Aphaenops lineage). These two divisions 173 species we use maximum likelihood and Bayesian refer to morphological characters of the male genitalia methods to build a calibrated phylogeny to estimate the (see below). The fauna of the Alps is extremely rich in temporal origin and the relationships of the subterra- both epigean (i.e., living “above ground”, in the surface) nean taxa, with a special interest in the most morpho- and hypogean (i.e. living “below ground”) Carabidae, logically deviant species, showing the highest degree of with more than 650 species in the eastern part –approxi- troglomorphism and the most enigmatic origin. mately half of the Italian ground beetle fauna, and a fifth of all European species, from the Canary Islands to the Taxonomic background of the Alpine Trechini Urals. This area includes more than 200 endemic spe- Trechini is a highly diverse and cosmopolitan tribe of cies, most of them concentrated on the eastern pre- carabid beetles, divided in well characterised subtribes Alpine belt (the “Southern Alps”, from the Como lake to [22] (see [28] for an overview of the phylogenetic place- Trieste) and many of them subterranean [14]. It is con- ment of Trechini). All subterranean European species, sidered a hotspot of subterranean biodiversity, compar- together with their related epigean groups, belong to able to the Dinaric Alps or the Pyrenean chain [15]. The subtribe Trechina, which are traditionally divided into easternmost area of the Alps (the “Suprapannonian sec- two groups of genera on the basis of differences in the tor”sensu Ozenda & Borel [16], around Graz) lacks lime- male genitalia. Thus, in the isotopics the endophallus stone formations and is less rich in subterranean species has a symmetric copulatory piece in ventral position (Additional file 1: Figure S1). Similarly, the western part (“série phylétique de Duvalius” sensu Jeannel, 1928 [2]), of the chain, from the Lepontine to the Maritime- while in the anisotopics the copulatory piece is asym- Ligurian Alps, is poor in subterranean species due to metric and placed in lateral position (Additional file 2: the scarcity of limestone in the area north of Torino Figure S2) [6]. [17], despite having a very diverse fauna, with 440 species There are nine anisotopic and eight isotopic genera of of Carabidae and a high number – c. 30% – of endemics Trechina in the Alpine chain (see Additional file 3: Table [18]. Only the Ligurian Alps are entirely calcareous and S1 for a list of genera, their distribution and number of markedly karstified, with deep and large subterranean species, and the number of specimens included in our systems even at high altitude [19] (Additional file 1: analyses). Seven of the anisotopic genera are found in Figure S1). the southeastern part of the chain, from the Como Lake Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 3 of 16 http://www.biomedcentral.com/1471-2148/13/248

Figure 1 Simplified map of the distribution of the anisotopic genera of Trechina in the Alpine region (the widespread genus Trechus is not represented). See Additional file 5: Table S2 and Additional file 4: Figure S3 for details of the sampled localities.

(Lombardy, Italy) to Trieste and Slovenia (Figure 1). The has a wider distribution (Figure 2). The ecological pref- only exceptions are Doderotrechus, an endemic to the erences and degree of troglomorphism of the members Cottian Alps in the Italian Piedmont living in natural of the speciose genus Duvalius are very diverse: some limestone caves, artificial mines and the MSS (“millieu are depigmented and blind, hygrophilous, nivicolous and souterrain superficiel”, or mesovoid shallow substratum), living in caves, deep soil or MSS; but others are epigean, and the diverse, widespread and mostly epigean genus living in forest litter and alpine pastures, and are slightly Trechus. Trechus has more than 800 species, mostly in pigmented and/or with reduced eyes, and even (albeit the Palearctic region [12,22], and includes widespread exceptionally) winged [32]. The genus is widely distrib- winged species as well as short-range wingless endemics, uted from Spain, Maghreb (Algeria) and France in the many of them restricted to individual mountain massifs West to central Asia and China in the East. It is diversi- [29-31]. There are many species with different degrees fied mostly in the Alps, Italian and Balkan peninsulas of troglomorphism. Faille et al. [9,13] shown that the and the Carpathian region, with some species in Catalonia, genus is a paraphyletic assemblage with some troglobitic Mallorca, Sicily and Sardinia. Easter of the Alps the genus genera or species nested within it. In the Alpine chain is recorded from the Caucasus, Middle East and Iran, there are no species of Trechus exclusive of the subterra- reaching the Tien Shan Mountains in China [12]. The Al- nean environment, although some species are regularly pine species belong to the subgenus Duvalius and have found in it, and some high altitude orophilous species been divided into various species groups (14 for the Italian (e.g. in the T. strigipennis group) show depigmentation species [20]), which in turn have been divided in more nu- and reduced eyes. merous “lineages” [33,34], mostly based on the structure Seven of the eight isotopic genera of Trechina present of the copulatory piece. The genus was considered as a in the Alps are subterranean and endemic to this area complex by Jeannel [23], with more troglomorphic genera (Additional file 3: Table S1). Only one of them, Duvalius, derived from local species pools. Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 4 of 16 http://www.biomedcentral.com/1471-2148/13/248

Figure 2 Simplified map of the distribution of the isotopic genera of Trechina in the Alpine region. See Additional file 5: Table S2 and Additional file 4: Figure S3 for details of the sampled localities.

Other subterranean Trechini potentially related to the Results Alpine fauna Phylogenetic analysis We included in our study three species of the two aniso- The estimated optimal evolutionary model was GTR + I + topic genera Neotrechus and Adriaphaenops from the G for the three mitochondrial gene partitions (cox1, rrnL + Dinaric Alps, to test for potential relationships with the trnL and nad1) and the nuclear small ribosomal unit species of the Alpine fauna. The Dinaric karst is a recog- (SSU), and GTR + G for the nuclear large ribosomal unit nised hotspot of subterranean biodiversity [35] especially (LSU). In each of two independent MrBayes analyses the rich in highly specialised troglomorphic Trechini, with two runs (i.e. a total of four runs) reached convergence new genera and species described every year (see e.g. after 34 MY generations as measured with the effective [36,37]). The phylogenetic relationships of this highly di- sample size (ESS). The combination of the four runs verse trechine fauna are unknown, but the two genera also converged for most of the parameters (including included here have been related to Alpine or Pyrenean the total likelihood of the trees), but had two alternative taxa: Neotrechus is currently considered as close to the Al- states (with two runs each) differing substantially in pine genus Orotrechus, whereas Adriaphaenops was con- some parameters that did not converge, such as e.g. the sidered a representative of the former Aphaenops lineage. total branch length, double in one state than in the Nevertheless, recent molecular results cast doubts on the other, or the alpha parameter of the gamma distribution possibility of such relationships [9,38]. We also include an in all partitions except the nuclear LSU.Despitethe example of Pheggomisetes (with three described species), large differences in some of the parameters the two known from some caves in the Bulgarian and Serbian Bal- topologies were congruent for all well supported nodes kans and with a highly derived morphology. It was consid- (Figure 3). The topology obtained with Maximum Like- ered as an isolated relict of the Eocene fauna, without lihood in RAxML was also generally congruent with clear affinities with the extant Trechini [2]. the MrBayes trees, with only some poorly supported Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 5 of 16 http://www.biomedcentral.com/1471-2148/13/248

Figure 3 Phylogram of Alpine Trechina obtained in RAxML using the combined data matrix. Number in nodes, Bayesian posterior probability obtained in the two alternative states of MrBayes (see main text) ⁄ ML bootstrap obtained in RAxML. Subterranean genera and lineages are indicated by asterisks (see Additional file 3: Table S1). -: unresolved or poorly supported node (bt ≤ 70%, Bpp ≤ 70); x: contradictory node. 3a: clade 1; 3b: clade 1.3.2.2; 3c: clade 1.3.2.1; 3d: clades 2 and 3. nodes showing incongruence (Figure 3) (see detailed clade 1.2) and a large group including most species of comments below). the genus Trechus plus a number of subterranean gen- In all cases the monophyly of Trechina was strongly eranestedwithinit(clade1.3).Theseincludedallthe supported, with three main clades that were recovered Alpine and Dinaric subterranean anisotopic genera in all analyses. Clade 1 (Figures 3a-c and 4) included with the only exception of Doderotrechus,plussome most of the anisotopic species: the Pyrenean hypogean other genera from nearby areas (Speotrechus, Jeannelius, lineage (clade 1.1, Figures 3a and 4), the genus Epaphius Typhlotrechus, Sardaphaenops and Paraphaenops, and relatives (Blemus and some species of Trechus, Figures 1 and 3). Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 6 of 16 http://www.biomedcentral.com/1471-2148/13/248

Figure 4 Summary tree with the main clades of Alpine Trechini, as obtained with RAxML. Stars, nodes with a support of pp = 1 for both Bayesian topologies and bt = 100 for RAxML. -, unresolved or poorly supported node (bt ≤ 70%, Bpp ≤ 70); x, node not present. Node labels refer to major clades (see text and Figure 3); For each of the clades the number of genera and species included in the analyses is given in brackets.

Clade 2 (Figures 3d and 4), well-supported in all ana- Clade 1.2, the “Epaphius” group lyses (Bayesian posterior probability, pp = 1; ML boot- Epaphius and two species of Trechus, one widespread strap support, bt = 100), included all the isotopic species, (T. rubens) and an Alpine endemic (T. ovatus), were with a largely paraphyletic Duvalius and the five subterra- grouped in a well-supported clade (pp = 1; bt = 100). We nean genera (Anophthalmus, Arctaphaenops, Agostinia, found the genus Blemus sister of this clade, although sup- Luraphaenops and Trichaphaenops)nestedwithinitin ported only in the Bayesian analyses (pp = 0.9; bt < 50). uncertain positions. The Balkan genus Pheggomisetes was found sister to this clade 2, although with only moderated support (pp = 0.92/0.89; bt = 52). Clade 3, also Clade 1.3, Trechus and other hypogean anisotopics well-supported (pp = 1; bt = 100) (Figures 3d and 4), in- This well-supported clade (pp = 1; bt = 88) was subdi- cluded the remaining anisotopics: the Alpine genus vided into two groups, the first (1.3.1) with Circum- Doderotrechus plus a species of Trechus from Tibet, T. Mediterranean species, gathering two Iberian Trechus bastropi. The isolated genus Iberotrechus was in some with the highly modified genera Sardaphaenops (Sardinia), analyses recovered as sister to this clade, with low Paraphaenops (Iberia) and the Adriatic Typhlotrechus. support. This group was not well supported, although it was re- covered both in the ML (bt < 50) and the Bayesian ana- lyses (pp = 0.83/0.79). The second main group (1.3.2) Clade 1.1, the Pyrenean hypogean lineage was very well-supported (pp = 1; bt = 99) and included In agreement with previously published phylogenies the Caucasian endemic genus Jeannelius,theFrench [9,13], none of the three Pyrenean genera Aphaenops, hypogean genus Speotrechus, a clade (1.3.2.1) with all Geotrechus and Hydraphaenops were recovered as the hypogean genera of anisotopic Trechina from the monophyletic. The Pyrenean lineage was sister to Alps (except Doderotrechus) plus the Dinaric hypogean therestofclade1inallreconstructions,butthis genera, and a clade (1.3.2.2) with most of the Trechus sister relationship was not well supported (Figures 3a species including many Alpine endemics and the type and 4). species of the genus, T. quadristriatus. Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 7 of 16 http://www.biomedcentral.com/1471-2148/13/248

The clade 1.3.2.1 was well-supported (bt = 80; pp = 0.99/1) phylogenetic method used it was sister to the rest of and included the subterranean genera Orotrechus, Bol- Duvalius species plus the subterranean genera Agostinia, doriella, Lessinodytes, Allegrettia, Italaphaenops and Trichaphaenops,andArctaphaenops (ML), or nested thetwoDinaricgeneraAdriaphaenops and Neotrechus within this group (Bayesian), in both cases with low (Figure 3c). No epigean species were nested within this support (Figures 3d and 4). In all cases the rest of the clade. The monophyly of both genera Orotrechus and subterranean isotopic genera were nested within a Boldoriella was confirmed, whereas the position of Les- largely paraphyletic Duvalius. Some of the supported sinodytes, Allegrettia and Italaphaenops,aswellasthat lineages had a well defined geographical distribution, of the Dinaric species, was uncertain. A sister relationship such as a clade of species from the Maritime and Ligurian was suggested in the ML analysis between Allegrettia and Alps, including the subterranean Agostinia launi plus the Italaphaenops, but without support and not recovered in Duvalius carantii, canevai, clairi and gentilei species the Bayesian analyses. groups (sensu Vigna Taglianti [20]) (although with The sampled species of the genus Orotrechus were re- good support only in the Bayesian analyses, pp = 1/0.98; covered as monophyletic, and divided in two groups of bt = 56); or D. berthae from Catalonia, unambiguously re- species: the first, poorly supported (pp = 0.54/0.97; bt = 66) lated to D. raymondi from Provence (Southern France) including O. vicentinus, O. fabianii, O. giordanii and O. (pp = 1; bt = 94). Some other lineages corresponded to montellensis, and the second, well-supported (pp = 1; species groups defined on the basis of morphology, such bt = 99), with all other sampled species (Figure 3c). The as the subgenus Euduvalius,theD. longhii (pars) and D. two aphaenopsian species O. jamae and O. messai,cur- baldensis groups sensu Vigna Taglianti [20], or the D. rently attributed to different species groups [20], were in- microphthalmus group sensu Jeannel [2]. cluded in the same clade. The genus Boldoriella was found monophyletic with low support (pp = 0.86/0.92; bt = 54), Clade 3, Doderotrechus but the separation of two subgenera within Boldoriella The phylogenetic position of the genus Doderotrechus (Boldoriella and Insubrites [26]) was not supported by within Trechina was not well supported, although the our analyses, as B. (Insubrites) focarilei was closer to B. Bayesian analyses suggested a closer relationship to the (Boldoriella) carminatii than to B. (Boldoriella) humeralis. isotopics than to the main clade of anisotopics (Figures 3d The clade 1.3.2.2 was also well-supported (pp = 0.97/ and 4). Doderotrechus casalei, which was considered 0.99; bt = 81), and included most of the species of close to D. crissolensis [41], was recovered as sister to Trechus sensu stricto (including the type species of the the rest of the species. The genus was found to be sister genus). Seven sub-clades were recovered with general to a Himalayan Trechus recently described from south- good support, together with some isolated species of central Tibet, T. bastropi, with strong support (pp = 1; uncertain position (T. karadenizus and T. lepontinus, bt = 100). Figure 3b): (1) a Pyrenean-Cantabrian clade (pp = 1; bt = 77), which included 16 species, some of them hypogean Estimation of divergence dates (T. beusti, T. navaricus, T. bouilloni, T. escalerae and According to our results, based on the rates estimated Apoduvalius alberichae); (2) the group of T. fair- for a related ground beetle genus using the same genes mairei and closely related species; (3) two species of [42], the origin of the Trechina radiation dates back to the Maritime and Ligurian Alps, T. liguricus and T. putzeysi, the middle Eocene (Figure 5). The origin of the main lin- as sister (with low support) to a species from the Eastern eages within Trechina dates back to the late Eocene- Alps, T. gracilitarsis;(4)thetwospeciesoftheT. strigipen- early Oligocene, although the last common ancestor of nis species group as currently defined [14,39] (T. pochoni the sampled species of some of them was estimated to and T. piazzolii); (5) two species of Apoduvalius,withun- be of much more recent origin, in the Miocene. Thus, certain affinities; (6) the Trechus fulvus group, here repre- the origin of the Pyrenean lineage was estimated to be at sented by the species T. fulvus and T. gigoni (the latter the end of Eocene, but the present-day species diversi- described as Antoinella [40]); and (7) a clade containing T. fied from the early Miocene (c. 23 Ma, Figure 5). Simi- quadristriatus and T.obtusus, plus some Alpine and Pyren- larly, the isotopic clade (clade 2) separated from the ean endemics as well as species from Turkey. basal Trechina in the upper Oligocene, but the diversifi- cation of the group was estimated to be at the late Clade 2, the isotopic Trechina Miocene, c. 10 Ma, in a rapid succession. Some of the sub- The isotopic Trechina in the traditional sense [2,30] terranean clades (e.g. Luraphaenops + Trichaphaenops or were confirmed as monophyletic with strong support Anophthalmus) originated short after the origin of the diver- (pp = 1; bt = 100), although the internal resolution was sification of the clade, whereas the two other genera (Arcta- poor. The genus Anophthalmus was recovered as phaenops and Agostinia) originated later, in the Lower monophyletic (pp = 1; bt = 100), but depending on the Pliocene. The estimated age of the isolation between the Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 8 of 16 http://www.biomedcentral.com/1471-2148/13/248

Figure 5 Ultrametric time-calibrated tree obtained with BEAST for the combined dataset. Grey bars, 95% confidence intervals of the estimated ages for the nodes. Hypogean clades and species are in red or identified by an asterisk. only Iberian species, D. berthae,andtheFrenchD. occurred during the middle and late Miocene, as well raymondi was estimated to be at the end of the Miocene. as the separation between the Himalayan Trechus bastropi Other lineages had an earlier diversification, as esti- and the hypogean genus Doderotrechus. On the contrary, mated from our results. The hypogean Dinaric-Alpine the subterranean genera Sardaphaenops, Paraphaenops, clade (clade 1.3.2.1, Figure 3b) diversified in the late Typhlotrechus, Speotrechus and Jeannelius were estimated to Oligocene, with an early isolation of the Dinaric species be of Oligocene origin (Figure 5). The estimated age of the plus Italaphaenops from the other Alpine genera (although origin of the Sardinian endemic Sardaphaenops was 33 Ma. the phylogenetic position of Italaphaenops was not well supported, see above). The origin of the radiation including Discussion all the subterranean anisotopic genera but Italaphaenops Phylogeny of the Alpine Trechina was contemporaneous with that of the Pyrenean clade, in In agreement with previous phylogenetic analyses the early Miocene. Similarly, the diversification of the main [13,28,43] we found strong support for the monophyly clade of Trechus (clade 1.3.2.2) was also dated in the of the subtribe Trechina, although the phylogenetic rela- late Oligocene. Most of the subterranean colonisations tionships among the main lineages of this subtribe re- within the Trechus lineage were also estimated to have main uncertain. Contrary to the Pyrenean lineage, the Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 9 of 16 http://www.biomedcentral.com/1471-2148/13/248

Trechina of the Alps do not form a geographically well- (Winkler), O. stephani (J. Müller), O. jamae, O. theresiae defined unit, even when the widespread genera Trechus Casale, Etonti & Giachino, O. gigas Vigna Taglianti and and Duvalius are not considered. Some genera of subter- others). Our preliminary results suggest a complex history ranean blind Trechini of the Dinarides (Adriaphaenops of the genus, with various species groups colonizing the and Neotrechus, the two included in our study) were same area at different times (e.g. several sympatric species nested within the lineage of subterranean anisotopic with different degrees of troglomorphism are known in the Trechini from the Alps (our clade 1.3.2.1), stressing the Cansiglio-Cavallo massif in the Eastern Italian Alps [14]), need to include more Dinaric genera to establish the as observed in the Trechus lineage. Although our sampling phylogenetic relationships of the group and understand- only included less than half of the described species, it is ing its origin and the colonisation of the area by subter- apparent that the genus needs a taxonomic revision, as ranean Trechini. Recent discoveries of unexpected and none of the species groups previously suggested was found remarkable genera in the Dinaric karst suggest that the to be monophyletic [2,20,30,44,45]. We did not find, how- subterranean fauna of this area needs further investiga- ever, evidence for the assumed close relationship between tion [36-38]. this genus and Neotrechus (the “Neotrechus lineage” of Our age estimations were based on rates obtained in Jeannel [2], accepted by all subsequent authors), although [42] for a related genus of groundbeetle using a combin- the lack of support does not allow to completely discard ation of fossil and biogeograhic events (see Methods this hypothesis. below), but were remarkably similar to those obtained We also did not found a close relationship between by a previous work on western Mediterranean Trechini the highly modified subterranean genera Allegrettia, using as a calibration point the vicariant separation of from the Italian Alps, and Jeannelius, from the Caucasus, the genus Sardaphaenops due to the tectonic drift of the as hypothesized by some authors due to their strikingly Sardinian plate from the continent ca. 33 Ma [13]. Thus, similar external morphology [27,46,47]. The inclusion of even when the tectonic separation of Sardinia was not other Caucasian genera will allow to test the alternative used as a calibration point in [42], our estimate for the hypothesis of Jeannel [48], who suggested that Jeannelius origin of Sardaphaenops was 32.7 Ma, fully in agreement is more related to other Caucasian genera than to the with a vicariant tectonic origin. Similarly, the estimated Italian Allegrettia. ages of e.g. the Pyrenean, Duvalius sensu lato,maingroup An unexpected relationship was that of the western- of Trechus and Doderotrechus + Iberotrechus crown clades Alpine genus Doderotrechus with a Himalayan Trechus were respectively 22.7, 9.6, 24.8 and 23.4 Ma in [13], ver- from south-central Tibet. Trechus bastropi belongs to a sus 23.0, 9.7, 27.5 and 27.8 Ma here. group of species (the T. dacatraianus group) considered to be isolated within the Himalayan Trechus fauna owing The anisotopic genera to the structure of the male genitalia [31]. Such affinities Our results confirm the monophyly of the Pyrenean were unexpected but not unique: in the western Alps lineage [9], as none of the hypogean highly modified there is a very isolated endemic subterranean species of Trechini of the Alps and Dinaric chains were found to Sphodrina ground beetle, Sphodropsis ghilianii (Schaum), be related to it. The Pyrenean hypogean lineage remains the type species and only Alpine representative of a genus isolated, with no clear affinities with other Trechini, and that includes several Asiatic species [49]. Furthermore, the the similarities in the body shape of the species included presence in the Alps of other species of ground beetles in the Aphaenops lineage of Jeannel [2] should thus be considered to be relicts, belonging to genera mainly diver- the result of convergence or parallelism (see below). We sified in Asia (e.g. Broscosoma Rosenhauer [14]), is well also found support for the monophyly of the genus known. Orotrechus, characterised by the presence of a peculiar, synapomorphic structure of the lamellar parameres in the The isotopic genera male genitalia and by having only the first tarsomere di- We found support for the monophyly of the isotopics, as lated in the male. These well defined morphological syn- a derived lineage nested within the anisotopics. Al- apomorphies prevented authors from describing species though the dichotomy isotopics-anisotopics is usually with an aphaenopsian and non-aphaenopsian general body applied only to the species of Trechina [6], the asym- shape as different genera [2], as it happened in other cases. metry of the endophallus is a character present in all Thus,inthesamegenusitispossibletofindalldegreesof species of Trechini, and thus can be assumed to be ple- troglomorphism, from the small-sized, poorly specialised siomorphic. According to our results, the diversification endogean species (such as O. mandriolae (Ganglbauer) or of the Duvalius clade occurred later than that of most of O. cavallensis Jeannel), to the anophthalmous hypogean the anisotopics lineages, but was more geographically species (such as O. holdhausi (Ganglbauer)) and finally the widespread and species rich than most of them. The highly modified aphaenopsid species (such as O. venetianus possible relationship of the symmetry of the male Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 10 of 16 http://www.biomedcentral.com/1471-2148/13/248

genitalia with an increased diversification and geograph- gap between Arctaphaenops in the northeastern Alps ical expansion seems difficult to explain from an evolu- and Trichaphaenops in the southwestern Alps and the tionary point of view, and due to its unique character it Jura was explained by an hypothetical extinction of all also cannot be statistically tested. The detailed study of intermediate forms by Pleistocene glaciers on the north- the diversification of the isotopic lineage would require a ern side of the Alps [6]. However, the ecology of some more complete sampling of the high number of species Arctaphaenops species, able to live at high altitude in of Duvalius from other geographical areas, from the cold, ice caves [55], contributes to weaken this hypoth- Iberian peninsula and the Maghreb to central Asia. esis of an extinction by glacial episodes, not supported Similarly, the incomplete sampling of the species of by our phylogeny. The inclusion of some of the north- Anophthalmus did not allow us to unambiguously solve ernmost species of Trichaphaenops and the easternmost if Duvalius (in its widest sense) is monophyletic and sis- Duvalius may help to clarify the phylogenetic relation- ter to it, or if Anophthalmus is a lineage nested within ships of Arctaphaenops. Duvalius, as previously hypothesized [2]. The sister rela- Another example of unexpected affinities between tionship between Anophthalmus and the French Duvalius geographically close taxa is that of the species Duvalius delphinensis, even if poorly supported and present only raymondi (French Provence) and D. berthae (Catalonia). with Bayesian methods, is intriguing as this is considered Duvalius berthae, the only Iberian species of the genus, to be an isolated species within Duvalius, but with some was thought to be very close to D. lespesi [2], from the morphological characters common with Anophthalmus French Causses. On the contrary, this later species was (shape of the male genitalia, pubescence of the head found to be related to D. exaratus, from the Eastern [2,23]). As seen with other genera, Anophthalmus includes Alps, included in a different species group by Jeannel [2] species with various degrees of specialisation to the sub- (the D. longhii group) because it was pigmented and terranean environment, from endogean or nivicolous to oculated. Vigna Taglianti [20] recognised the morpho- strictly troglobitic. The genus differs from Duvalius logical peculiarities of D. exaratus, considering it an iso- mainly in the elytral chaetotaxy [2], and previous attempts lated species within the D. longhii group. Although not to clarify its taxonomy based on morphological characters definitely discarded, the hypothesis of possible affinities have not reached a wide consensus (e.g. [50-54]). between Duvalius and Doderotrechus previously sug- The lack of resolution within the Duvalius lineage gested [13] was not supported by our results. suggests a rapid diversification, which according to our estimations happened mostly in the late Miocene. The Origin of the subterranean lineages of Alpine (and nearby origin of some of the most troglomorphic genera, such areas) Trechini as Arctaphaenops, Agostinia, Luraphaenops and Tricha- Subterranean Trechini can be considered a good ex- phaenops, with a marked aphaenopsian habitus, was esti- ample of abiotically limited relicts [56,57]. Karstic areas, mated to be Plio- or Pleistocene, more recent than that and more generally the deep soil fissures, may act as a of other similarly modified genera from the area (e.g. buffer zone protecting subterranean animals from rapid Italaphaenops or Lessinodytes, from the early Miocene). and strong fluctuations of hygrometry, allowing the per- The detailed phylogenetic affinities of these genera are sistence of strict hygrophilous species with very reduced still uncertain, although some of our results contradict dispersal power outside this environment in the present assumed relationships. Thus, Agostinia launi appears to day climate conditions. Subterranean species are known be closer to Duvalius ochsi and D. gentilei than to D. to be able to colonize all kinds of underground compart- carantii, contrary to previous hypotheses [2,20]. Tricha- ments [58-60], but, despite the physiological limitations, phaenops and Luraphaenops were found to be sister some amount of surface dispersal must have also oc- taxa, suggesting a common origin of the morphological curred at some time in some taxa with already a high modifications of the two genera, but it would be neces- degree of troglomorphism, as shown by recent phylogen- sary to study species of Duvaliaphaenops to further con- etic contributions [9,12,61]. The ancient origin of some firm this hypothesis. In all these cases the subterranean of the subterranean lineages is in agreement with the taxa tended to be related with other geographically close age of many alpine caves (excluding paleokarst), which lineages, as found in previous works with subterranean are of Pliocene or even Miocene age, although the karst- Trechini and Leptodirini [9,10]. In agreement with this ification of some massifs colonised by hypogean Trechini general pattern, our expectation is that the genus Arcta- (e.g. the Vercors massif in southeast France, the Lessini phaenops should also be closer to some Duvalius species Mountains in northeast Italy, and others) has been more of the same geographical area (which could not be in- or less continuous since the Eocene [17]. cluded in our study) than to other aphaenopsian isotopic Some of the discontinuities in the current distribution Trechini from the western Alps to which it was tradition- of the subterranean genera may also be explained by the ally related (Trichaphaenops [6]). The large geographical geological history of the area. Thus, the geographical gap Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 11 of 16 http://www.biomedcentral.com/1471-2148/13/248

between the hypogean anisotopic Alpine and Dinaric populations colonising the subterranean environment genera may be explained by marine transgressions that (as schematised in Figure 6a), some of them recognised occurred during the middle Miocene north of Zagreb as distinct species but others only as subspecies or sim- [62], which could have led to the destruction of the ple varieties, and most of them –but not all– wingless fauna of this area and/or promoted the isolation of the and with different degree of eye reduction [64]. This ancestors of the extant species. It is interesting to note seems also to be the case of the widespread genus the presence in this area of the polytypic, enigmatic spe- Duvalius, nested within which there are some highly cies Typhlotrechus bilimeki, the phylogenetic position of troglomorphic species currently considered as distinct which was not well supported although our results sug- genera (Arctaphaenops, Agostinia, Trichaphaenops and gested it may be related to the Iberian species Trechus Luraphaenops). In the Duvalius lineage, and contrary schaufussi (“groupe pandellei” sensu Jeannel [2]), with to what happens with the T. fulvus group, the origin of an ancient (Oligocene) divergence. By the late middle the highly troglomorphic taxa cannot be directly traced Miocene the marine transgresion between the Dinarides to a single, widespread species, so there is the possibil- and the Alps had definitively disappeared, and the ances- ity that the colonisation of the subterranean environ- tors of the isotopic genus Anophthalmus should have ment was preceded by local speciation of still epigean colonised the area. species (Figure 6b). According to our results, and in agreement with previ- It is, however, remarkable that some monophyletic and ous work of a more limited geographical scope [13], exclusively subterranean lineages, without recent epigean there are multiple origins of the highly modified hypo- relatives, are of ancient origin and include a high num- gean Trechini in the western Palaearctic, with a high de- ber of taxa in a relatively large geographical area, such gree of convergence or parallelism among species as e.g. the Pyrenean lineage (clade 1.1 in Figure 4), the occupying the same microenvironment. Both within the Dinaric-Alpine hypogean clade (clade 1.3.2.1) or the hypogean Alpine anisotopic and the Dinaric clades it is genus Anophthalmus.Fortheselineages,themostparsimo- possible to recognise the same morphological types nious scenario is a single origin of the subterranean habit found in the Pyrenees [2,6,9]. Species occurring mostly in and the associated troglomorphic characters (Figure 6c). the soil, in superficial fissures or in the mesovoid shallow This would imply the possibility that highly modified substratum (MSS), sometimes also nivicolous at high alti- species were able to expand their geographical ranges tude, such as the genera Orotrechus and Boldoriella,have and diversify, in some instances necessarily requiring a similar general morphology than the species of Geotre- surface displacements. This arguably happened in the chus in the Pyrenees, more stout and robust and with highly modified Leptodirini genus Troglocharinus from shorter legs and antennae. Highly hygrophilic, small spe- the Pyrenees, which colonised the coastal area south of cies living in deep fissures and only exceptionally appear- Barcelona during a climatically favourable time window ing in accessible caves, such as Lessinodytes, are very in the early Pliocene [61]. In the case of the Dinaric- similar to the Pyrenean Hydraphaenops, with a narrow Alpine subterranean clade (1.3.2.1), which includes taxa pronotum and head, often hairy body and long mandibles. from the Dinarides and the southeastern Italian Alps (i.e. Finally, species living in deep subterranean fissures and in the “Illyrian-Gardesan Dolomitic sector” sensu Ozenda & natural or artificial caves (such as some Orotrechus and Borel [16]), the almost continuous presence of karst Boldoriella, Allegrettia and Italaphaenops) share with the through this area (Additional file 1: Figure S1) may have Pyrenean Aphaenops an extreme elongation of the body, allowed the displacement of species not able to leave the specially pronotum, head and appendages, leading to the subterranean environment. The absence of subterranean typical “aphaenopsian” facies. It must be stressed that all anisotopic species in the northeastern calcareous Alps three Pyrenean genera are para- or polyphyletic, increas- (Figure 1), in where there is only an isotopic subterranean ing considerably the number of independent develop- genus of Trechini (Arctaphaenops, of a much more recent ments of each of the characteristic morphotypes [9]. origin), would be in agreement with this hypothesis. Thus, As noted above, in many cases the highly modified it seems that no anisotopic taxa of this clade was able to subterranean species can be related to other epigean (or cross the Suprapannonian sector [16,65], without karst in less modified) taxa in the same geographical area, such a large area around Graz (Additional file 1: Figure S1), as for example the species of the genera Apoduvalius suggesting that they were not able to disperse long dis- and Antoinella (the latter already proposed as a syno- tances outside the subterranean environment. It is always nym of Trechus, related to the species of the fulvus possible that the geographic expansion of this clade was group [63]), which are confirmed as polyphyletic and to be- due to epigean ancestors which are now all extinct or re- long to the Trechus lineage. In the case of the T. fulvus main unknown, and that the troglomorphic species have group, it seems likely that from an epigean, widespread spe- thus an independent, local origin. However, at present cies (T. fulvus) there were many instances of independent there is no evidence to support this hypothesis, which on Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 12 of 16 http://www.biomedcentral.com/1471-2148/13/248

Figure 6 Simplified representation of three idealised scenarios of subterranean colonization leading to an extant monophyletic hypogean lineage (see Discussion). Different combinations of the three, in all possible degrees, can be found among the subterranean Trechini from the Alps. a: Three independent subterranean colonizations from a widespread epigean ancestor. b: Same as (a), but preceded by speciation of the epigean ancestor. The three resulting epigean species colonize independently the subterranean medium. c: Single subterranean colonization, with subsequent dispersal and diversification of the hypogean species. the other hand could never be falsified – only made processes. To understand the origin and evolution of the unlikely. subterranean fauna it is thus necessary to comprehensively investigate the evidence provided by the phylogenetic and Conclusions geographical context of each lineage individually. We have unveiled the complex history of a ground bee- tle lineage with multiple instances of independent colon- Methods isation of the subterranean world, showing that there is Taxon sampling, DNA extraction and sequencing no simple, unique evolutionary pathway in which this Sampling was carried out in the Alps and nearby areas could be achieved. Thus, among the Alpine fauna of during 2011 and 2012. We included examples of all the Trechini we have recognised recent radiations with mul- endemic genera of hypogean Trechini from their entire tiple origins of subterranean species (e.g. Duvalius, some known distribution area, with the only exception of lineages within Trechus); isolated, highly modified tro- Aphaenopidius and Duvaliaphaenops, of which no speci- globitic genera of uncertain affinities (e.g. Doderotrechus, mens could be obtained. Of the two Alpine genera with Speotrechus); and ancient, diverse lineages likely to have a widespread distribution (Duvalius and Trechus) nu- diversified and expanded once fully adapted to the under- merous localities of hypogean and epigean species were ground life (the Dinaric-Alpine subterranean clade). It sampled (Additional file 4: Figure S3; Additional file 5: seems clear that the use of simplistic models may only Table S2). We also added some taxa from other geo- lead to the artificial recognition of exclusive alternative graphical areas that have been related to the Alpine hypotheses where there is a continuum of different fauna (Pyrenees and Sardinia), plus two genera of hypogean Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 13 of 16 http://www.biomedcentral.com/1471-2148/13/248

Trechini from the Dinarides, one orophilous Himalayan values and convergence were determined through the ef- species originally described as belonging to the genus fective sample size (ESS) in Tracer v1.5 [71]. Results of Trechus,andasampleofthegeneraPheggomisetes and the two runs were combined using LogCombiner v1.4.7 Jeannelius from the Balkans and the Caucasus respect- and consensus trees were compiled with TreeAnnotator ively. In total, we analysed 207 individuals of 173 spe- v1.4.7 (Drummond & Rambaut 2007). Maximum likeli- cies belonging to 31 genera (Additional file 5: Table S2, hood analyses were conducted on the combined data where authors and year of description of the studied matrix with RAxML GUI [72-74], using four partitions species can also be found). Specimens were collected by corresponding to the cox1, rrnL + trnL + nad1, SSU and hand or by means of pitfall traps containing propylene LSU fragments with a GTR + I + G evolutionary model glycol, known to preserve DNA [66,67], and subsequently and default values for other parameters of the search [73]. preserved in 96% ethanol. For some species we extracted DNA from dried specimens deposited in the ZSM. Extrac- Estimation of divergence times tions of single specimens were non-destructive, using the We used the Bayesian relaxed phylogenetic approach DNeasy Blood & Tissue Kit (Qiagen GmbH, Hilden, implemented in BEAST v1.7 to estimate the age of diver- Germany). After extraction, specimens were mounted on gence of the different clades [72,75]. We pruned the out- cards and genitalia stored in water–soluble dimethyl groups and implemented a GTR + G model of DNA hydantoin formaldehyde (DMHF) on transparent cards, substitution to the same partition by genes used in the pinned beneath the specimen. Vouchers and DNA phylogenetic analyses. We used as priors the rates esti- aliquotes are stored in the collections of ZSM, IBE and mated for the same gene fragments in [42] for a related MNHN. group of ground beetles (genus Carabus) based on a set The tree was rooted with a species of Patrobini (Penetretus of fossils and biogeographic events. We sequenced three temporalis), found to be sister to Trechinae (or Trechitae) fragments not included in [42], nad1, trnL and SSU, for [28,43]. In preliminary analyses other Trechini out- which we used the same rates as cox1, rrnL and LSU re- groups closer to Trechina (as e.g. Trechodina, Perileptus spectively. The rates used were a strict clock for the or Thalassophilus) were found to have extremely long mitochondrial genes, with mean rates of 0.0145 for the branches and were not used to avoid analytical artifacts. genes nad1 and cox1 and 0.0016 for the fragment rrnL + The topologies obtained were, however, very similar trnL; and a lognormal clock with mean rates of 0.0010 (results not shown). and 0.0013 for the SSU and LSU genes respectively. We We amplified fragments of four mitochondrial genes: used a Yule process of speciation as the tree prior, sampled 3′ end of cytochrome c oxidase subunit (cox1) and a sin- the chain each 5,000 generations and used TRACER to gle fragment including the 3′ end of the large ribosomal determine convergence, measure the effective sample size unit (rrnL), the whole tRNA–Leu gene (trnL)andthe5′ of each parameter and calculate the mean and 95% highest end of the NADH dehydrogenase 1 (nad1). We also ampli- posterior density interval for divergence times. fied two nuclear genes, an internal fragment of the large ribosomal unit 28S rRNA (LSU)andthe5′ end of the small Availability of supporting data ribosomal unit 18S rRNA (SSU) (see Additional file 6: Table All supporting data are included in the Supplementary files S3 for the primers used). Sequences were assembled and with the exception of the sequences, deposited in the EMBL edited using Sequencher TM 4.8 (Gene Codes, Inc., Ann database with accession numbers HG514501-HG514996, Arbor, MI). Some sequences were obtained from Faille and the alignments and trees, deposited in tree BASE: et al. [9,13] (Additional file 5: Table S2). New sequences http://purl.org/phylo/treebase/phylows/study/TB2:S14674. have been deposited in the EMBL database (Accession Numbers: Additional file 5: Table S2). Additional files

Phylogenetic analyses Additional file 1: Figure S1. Map of the main alpine karsts (in black) We aligned the sequences using the MAFFT online v.6 (modified from [17]). with the Q-INS-i algorithm and default parameters [68]. Additional file 2: Figure S2. Lateral (a) and dorsal (b) views of a Trechini male genitalia, showing the anisotopic (1) and isotopic (2) Analyses were conducted on the combined data matrix positions of the copulatory piece (modified from [2]). with MrBayes 3.1.2 [69], using five partitions corre- Additional file 3: Table S1. List of the genera of Alpine Trechini, sponding to the five genes used (the trnL and rrnL genes including number of species and previous hypotheses of relationships were included in the same partition). We used jModelTest [2,11-13,20,22-25,27,30,46,47,76-83]. 3.7 [70] to identify the best model of nucleotide substitu- Additional file 4: Figure S3. Map of the sampled localities. tion fitting each gene (partition). Two independent ana- Additional file 5: Table S2. Material used in the study, with locality data, voucher number and accession numbers of the sequences. lyses of MrBayes ran until convergence using default Additional file 6: Table S3. Primers used in the PCR amplification. values, saving trees each 5,000 generations. ‘Burn-in’ Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 14 of 16 http://www.biomedcentral.com/1471-2148/13/248

Competing interest subfamily Leptodirinae.InPhylogeny and evolution of subterranean and The authors declare that they have no competing interest. endogean Cholevidae (= Leiodidae, Cholevinae) Proceedings of XX International Congress of Entomology, Firenze, 1996. Edited by Giachino PM, Authors’ contributions Peck SB. Torino: Atti Museo Regionale di Scienze Naturali; 1998:179–209. AF, AC and IR conceived the study. AF and AC coordinated the sampling. AF 5. Racovitza EG: Essai sur les problèmes biospéologiques. Arch Zool Exp Gen obtained the sequences. All authors contributed materials/reagents. AF and (4ème sér.) 1907, 6:371–488. IR did the analyses and drafted the manuscript. All authors contributed to 6. Jeannel R: Les fossiles vivants des cavernes. Paris: Gallimard; 1943. the writing and improving the manuscript, and approved the final version. 7. Culver DC: Analysis of simple cave communities. I. Caves as islands. Evolution 1970, 24:463–474. Acknowledgements 8. Wiens JJ, Chippindale PT, Hillis DM: When Are phylogenetic analyses We are particularly indebted to numerous colleagues and friends for their misled by convergence? a case study in texas cave salamanders. Syst Biol – invaluable help and constant support in sampling specimens of many of the 2003, 52(4):501 514. species studied in this contribution, most of them with narrow distributions 9. Faille A, Ribera I, Deharveng L, Bourdeau C, Garnery L, Quéinnec E, Deuve T: and often restricted to localities of very difficult access (caves, high A molecular phylogeny shows the single origin of the Pyrenean mountains). In particular, we wish to thank Charles Bourdeau, Hervé Bouyon, subterranean Trechini ground beetles (Coleoptera: Carabidae). Mol – Petr Bulirsch, Gianfranco Caoduro, Dávid Čeplíck, Alain Coache, Giorgio Phylogenet Evol 2010, 54:97 105. Colombetta, Louis Deharveng, Thierry Deuve, Giorgio Fornasier and all the 10. Ribera I, Fresneda J, Bucur R, Izquierdo A, Vogler AP, Salgado JM, Cieslak A: members of the Unione Speleologica Pordenonese, Javier Fresneda, Fulvio Ancient origin of a western Mediterranean radiation of subterranean – Gasparo, Michael Geiser, Mario Grottolo, Pier Mauro Giachino, Bernard beetles. BMC Evol Biol 2010, 10(29):1 14. doi:10.1186/1471-2148-10-29. Junger, Manfred Kahlen, Alexandr Koval, Ján Lakota, Enrico Lana, Leonardo 11. Quéinnec E, Ollivier E: Tribu Trechini.InFaune de France 94. Coléoptères Latella, Jean-Michel Lemaire, Roman Lohaj, Paolo Magrini, Paolo Marcia, carabiques, compléments et mise à jour, Volume 1. Edited by Coulon J, Pupier Harald Mixanig, Roman Mlejnek, Riccardo Monguzzi, Vittorino Monzini, Carlo R, Quéinnec E, Ollivier E, Richoux P. Paris: Fédération française des Sociétés – Onnis, Alessandro Pastorelli, Erminio Piva, Jean Raffaldi, Jean Raingeard, Jose de Sciences Naturelles; 2011:119 254. Maria Salgado, Joachim Schmidt, and Dante Vailati. We also sincerely thank 12. Moravec P, Uéno SI, Belousov IA: Carabidae: Trechinae: Trechini.In Alberto Ballerio (Brescia) for his very helpful support with the ICZN, which Catalogue of Palaearctic Coleoptera, Volume 1. Edited by Löbl I, Smetana A. allowed us to confirm the generic name Aphaenops (corrected to Aphoenops Stenstrup: Apollo Books; 2003:288–346. in recent catalogues) as nomen protectum and conservandum in agreement 13. Faille A, Casale A, Ribera I: Phylogenetic relationships of west with articles 33.2.3.1 and 33.3.1 of the Code. Mediterranean troglobitic Trechini ground beetles (Coleoptera: Although none of the species sampled is included in international lists for Carabidae). Zool Scr 2011, 40(3):282–295. the conservation of endangered species of wild fauna (Annexes of the 14. Casale A, Vigna Taglianti A: Coleotteri caraboidei delle Alpi e Prealpi Habitat Directive 92/43/EEC, Berna Convention or CITES), we thank the local centrali e orientali, e loro significato biogeografico (Coleoptera, administrations, speleological associations or responsibles of Natural Parks for Caraboidea). Biogeographia 2005, 26:129–201. the licenses to access closed, touristic or protected areas or caves. License 15. Culver DC, Deharveng L, Bedos A, Lewis JJ, Madden M, Reddell JR, Sket B, for the subterranean taxa protected in France was obtained as specified in Trontelj P, White D: The mid-latitude biodiversity ridge in terrestrial cave [9] (arrêtés N°2003-06, 25/2003, 2004–01). We thank Diego Lonardoni fauna. Ecography 2006, 29:120–128. (Director of the the Lessinia Natural Parc, Verona, Italy) for his authorisation 16. Ozenda P, Borel JL: The Alpine Vegetation of the Alps.InAlpine Biodiversity to conduct scientific investigations in this area and Slavko Polak (Notranjski in Europe. Ecological Studies 167. Edited by Nagy L, Grabherr G, Körner C, muzej Postojna) for his support in sampling in some Slovenian caves. We Thompson DBA. Berlin Heidelberg: Springer; 2003:53–64. also thank the ZSM for allowing the use of specimens of the Daffner 17. Audra P, Bini A, Gabrovšek F, Häuselmann P, Hobléa F, Jeannin PY, Kunaver collection for DNA extractions, Enrico Lana for the picture of Italaphaenops J, Monbaron M, Šušteršič F, Tognini P, Trimmel H, Wildberger A: Cave and dimaioi and two anonymous referees for comments to the manuscript. karst evolution in the Alps and their relation to paleoclimate and This work has been partly funded by an Alexander von Humboldt paleotopography. Acta carsologica 2007, 36(1):53–67. Foundation grant and German Research Foundation projects (BA2152/14-1 18. Casale A, Vigna Taglianti A: I coleotteri carabidi delle Alpi occidentali e and FA 1042/1-1), the Italian PRIN (Research Programmes of National Interest, centro-occidentali (Coleoptera, Carabidae). Biogeographia 1993, University of Sassari) “The endemism in Italy” and the R.A.S. Project CRP-60215 16(1992):331–399. (2012) “Conservation and valorisation of the Sardinian caves: biodiversity and 19. Casale A, Vigna Taglianti A: I coleotteri carabidi delle Alpi Liguri. social, cultural and economic rules” to AC, and project CGL2010-15755 from the Composizione della fauna ed origine del popolamento. Lav Soc ital Spanish government to IR. Biogeog (ns) 1985, 9(1982):567–598. 20. Vigna Taglianti A: Le attuali conoscenze sui coleotteri carabidi cavernicoli Author details italiani. Lav Soc Ital Biogeogr (ns) 1982, 7(1978):339–430. 1Zoologische Staatsammlung, Muenchhausenstrasse 21, Munich 81247, 21. Vigna Taglianti A: Checklist e corotipi delle specie di Carabidae della Germany. 2Dipartimento di Scienze della Natura e del Territorio, Sez. fauna italiana. Appendice B.InI Coleotteri Carabidi per la valutazione Zoologia, Università di Sassari, Via Muroni 25, Sassari 07100, Italy. 3Institute of ambientale e la conservazione della biodiversità. Manuale operativo. APAT, Evolutionary Biology (CSIC-Universitat Pompeu Fabra), Passeig Maritim de la Manuali e Linee Guida. 34th edition. Edited by Brandmayr P, Zetto T, Barceloneta 37-49, Barcelona 08003, Spain. Pizzolotto R. Roma: APAT; 2005:186–225. 22. Lorenz W: Systematic list of extant ground beetles of the world (Insecta Received: 8 June 2013 Accepted: 8 October 2013 Coleoptera “Geadephaga”: Trachypachidae, and Carabidae incl. Paussinae, Published: 13 November 2013 Cicindelinae, Rhysodinae). Secondth edition. Tutzing: published by the author; 2005. References 23. Jeannel R: Faune de France. Vol. 39: Coléoptères carabiques I. Paris: 1. Vandel A: Biospéologie. La Biologie des Animaux Cavernicoles. Paris: Gauthier- Lechevalier; 1941. Villars; 1964. 24. Casale A, Vigna Taglianti A: Note su Italaphaenops dimaioi Ghidini 2. Jeannel R: Monographie des Trechinae. Morphologie comparée et (Coleoptera, Carabidae). Boll Mus Civ Stor Nat Verona 1975, 2:293–314. distribution d’un groupe de Coléoptères. Troisième Livraison: les Trechini 25. Vigna Taglianti A, Sciaky R: Il genere Lessinodytes Vigna Taglianti, 1982 cavernicoles. L’Abeille 1928, 35:1–808. (Coleoptera, Carabidae, Trechinae). Fragm Entomol 1988, 20(2):159–180. 3. Casale A, Vigna Taglianti A, Juberthie C: Coleoptera Carabidae.In 26. Monguzzi R: Studi sul genere Boldoriella Jeannel: sistematica, geonemia, Encyclopaedia Biospeologica. Volume 2nd edition. Edited by Juberthie C, ecologia (Coleoptera, Carabidae, Trechinae). Atti Soc Ital Sci Nat Mus Civ Decu V. Moulis-Bucarest: Société Internationale de Biospéologie; Stor Nat Milano 1982, 123(2–3):189–236. 1998:1047–1081. 27. Monguzzi R: Sintesi delle attuali conoscenze sul genere Allegrettia 4. Giachino PM, Vailati D, Casale A: Major questions in the phylogeny and Jeannel, 1928 (Coleoptera, Carabidae, Trechinae). Ann Mus Civ Stor Nat biogeography of Cholevidae (Coleoptera), with emphasis on the ‘Giacomo Doria’ 2011, 103:1–70. Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 15 of 16 http://www.biomedcentral.com/1471-2148/13/248

28. Grebennikov VV, Maddison DR: Phylogenetic analysis of Trechitae 52. Sciaky R: Proposte sulla Sistematica del genere Anophthalmus e (Coleoptera: Carabidae) based on larval morphology, with a description descrizione di tre nuove sottospecie del Friuli orientale (Coleoptera, of first-instar Phrypeus and a key to genera. Syst Entomol 2005, 30:38–59. Carabidae, Trechinae). Fragm Entomol 1987, 20(1):51–69. 29. Jeannel R: Monographie des Trechinae 2. Morphologie comparée et 53. Daffner H: Revision der Anophthalmus-Arten und -Rassen mit lang und distribution géographique d’un groupe de coléoptères. L’Abeille 1927, dicht behaarter Korperoberseite (Coleoptera, Carabidae, Trechinae). 33:1–592. Mitt Muench Entomol Ges 1996, 86:33–78. 30. Casale A, Laneyrie R: Trechodinae et Trechinae du monde. Tableau des 54. Daffner H: Die Arten und Rassen der Anophthalmus schmidti und -mariae sous-Familles, Tribus, séries phylétiques, genres, et catalogue général Gruppe (Coleoptera: Carabidae: Trechinae). Acta Entomol Slovenica 1998, des espèces. Mem Biospeol 1982, 9:1–226. 6(2):99–128. 31. Schmidt J: Taxonomic and biogeographical review of the genus Trechus 55. Daffner H: Die Arten der Gattung Arctaphaenops Meixner, 1925 Clairville, 1806, from the Tibetan Himalaya and the southern central (Coleoptera: Carabidae). Koleopterol Rundsch 1993, 63:1–18. Tibetan plateau (Coleoptera: Carabidae: Trechini). Zootaxa 2009, 56. Assmann T, Casale A, Drees C, Habel JC, Matern A, Schuldt A: Review: The 2178:1–72. dark side of relict species biology: cave animals as ancient lineages.In 32. Deuve T: La vie déserticole dans le genre Duvalius Delarouzée, 1854. Relict species: phylogeography and conservation biology. Edited by Habel JC, Description d’une forme macroptère du Golfe Persique [Coleoptera, Assmann T. Heidelberg: Springer; 2010:91–103. Trechidae]. Revue Française d’Entomologie 2000, 22(4):159–163. 57. Hampe A, Jump AS: Climate relicts: Past, present, future. Annu Rev Ecol 33. Magrini P: Première révision des Duvalius s. str. Italiens (Coleoptera, Evol Syst 2011, 42:313–33. Carabidae, Trechinae). Les Comptes-rendus du L.E.F.H.E. 1997, 2:202–292. 58. Juberthie C, Delay B, Bouillon M: Extension du milieu souterrain en zone 34. Magrini P: Première révision des Duvalius s. str. Italiens (deuxième partie: non calcaire. Description d’un nouveau milieu et de son peuplement par atlas biogéographique des Duvalius Italiens; ajouts et corrections de la les coléoptères troglobies. Mem Biospeol 1980, 7:19–52. première partie) (Coleoptera, Carabidae, Trechinae). Les Comptes-rendus 59. Juberthie C, Bouillon M: Présence des Aphaenops (Coléoptères Trechinae) du L.E.F.H.E 1998, 3:55–149. dans le milieu souterrain superficiel des Pyrénées françaises. Mem 35. Culver DC, Sket B: Hotspots of subterranean biodiversity in caves and Biospeol 1983, 10:91–98. wells. J Cave Karst Stud 2000, 62:11–17. 60. Giachino PM, Vailati D: The subterranean environment. Hypogean life, 36. Lohaj R, Lakota J: Two new genera and species of aphaenopsoid concepts and collecting techniques. WBA Handbooks - Vol. 3. Verona: World cave-dwelling Trechini beetles from Croatia and Montenegro (Coleoptera: Biodiversity Association onlus; 2010. Carabidae: Trechinae). Natura Croatica 2010, 19(1):77–97. 61. Rizzo V, Comas J, Fadrique F, Fresneda J, Ribera I: Early Pliocene range 37. Casale A, Jalžić B, Lohaj R, Mlejnek R: Two new highly specialised expansion of a clade of subterranean Pyrenean beetles. JBiogeogr. In press. subterranean beetles from the Velebit massif (Croatia): Velebitaphaenops 62. Popov SV, Rögl F, Rozanov AY, Steininger FF, Shcherba, Kovac M: (new genus) giganteus Casale & Jalžić, new species (Coleoptera: Lithological-Paleogeographic maps of Paratethys. 10 Maps late Eocene Carabidae: Trechini) and Velebitodromus ozrenlukici Lohaj, Mlejnek & to Pliocene. Courier Forschungsinstitut Senckenberg 2004, 250:1–46. Jalžić, new species (Coleoptera: Cholevidae: Leptodirini). Nat Croat 2012, 63. Casale A: Two new subterranean, microphthalmous trechine beetles 21:129–153. from the Mediterranean area, and a synonymic note (Coleoptera: 38. Lohaj R, Mlejnek RA: New species of the genus Acheroniotes Lohaj & Carabidae, Trechini). Contributions to Natural History 2011, 16:1–16. Lakota from Ljubišna Mts, Bosnia & Herzegovina (Coleoptera: Carabidae: 64. Jeannel R: Etude sur le Trechus fulvus Dej. Sa phylogénie, son intérêt Trechini). Natura Croatica 2012, 21(1):155–163. biogéographique. Trabajos del Museo Nacional de Ciencias Naturales, Serie 39. Monguzzi R: Note sul “gruppo di Trechus strigipennis” con descrizione di Zoologica 1920, 41:1–25. una nuova specie (Coleoptera Carabidae). Bollettino della Società 65. Erhard C, Spötl C: Karst geology and cave fauna of Austria: a concise entomologica italiana 1998, 130:199–220. review. Int J Speleol 2010, 39(2):71–90. 40. Casale A: Nuovi Carabidi di Marocco, di Grecia e di Papua - Nuova 66. Rubink WL, Murray KD, Baum KA, Pinto MA: Long term preservation of Guinea (Coleoptera). Rev Suisse Zool 1982, 89:229–244. DNA from honey bees (Apis mellifera) collected in aerial pitfall traps. 41. Vigna Taglianti A: Un nuovo Doderotrechus cavernicolo delle Alpi Tex. J. Sci 2003, 55:159–168. Occidentali (Coleoptera, Carabidae). Fragm Entomol 1969, 6:253–269. 67. López H, Oromí P: A pitfall trap for sampling the mesovoid shallow 42. Andújar C, Serrano J, Gómez-Zurita J: Winding up the molecular clock in substratum (MSS) fauna. Speleobiology Notes 2010, 2:7–11. the genus Carabus (Coleoptera: Carabidae): assessment of 68. Katoh K, Toh H: Recent developments in the MAFFT multiple sequence methodological decisions on rate and node age estimation. BMC Evol Biol alignment program. Briefings Bioinformatics 2008, 9:286–298. 2012, 12:40. doi:10.1186/1471-2148-12-40. 69. Huelsenbeck JP, Ronquist F: MRBAYES: bayesian inference of phylogenetic 43. Maddison DR, Ober KA: Phylogeny of minute carabid beetles and their trees. Bioinformatics 2001, 17:754–755. relatives based upon DNA sequence data (Coleoptera, Carabidae, 70. Posada D: JModelTest: phylogenetic model averaging. Mol Biol Evol 2008, Trechitae). Zookeys 2011, 147:229–260. doi: 10.3897/zookeys.147.1871 25:1253–1256. DOI:10.3897%2Fzookeys.147.1871. 71. Drummond AJ, Rambaut A: BEAST: bayesian evolutionary analysis by 44. Daffner H: Orotrechus haraldi n.sp. aus Kärnten – Austria (Coleoptera, sampling trees. BMC Evol Biol 2007, 7:214. Carabidae, Trechinae). Acta Coleopterologica 1990, 6(2):51–60. 72. Stamatakis A, RAxML-VI-HPC: Maximum likelihood-based phylogenetic 45. Monguzzi R, Trezzi G: Note sul “Gruppo di Orotrechus gigas Vigna analyses with thousands of taxa and mixed models. Bioinformatics 2006, Taglianti, 1981”, sensu novo, con descrizione di una nuova entità 22(21):2688–2690. (Coleoptera Carabidae). Fragm Entomol 2005, 37(1):9–31. 73. Stamatakis A, Hoover P, Rougemont J: A rapid bootstrap algorithm for the 46. Kurnakov VN: Les Trechini de la faune souterraine de l’Abkhazie. RAxML web-servers. Syst Biol 2008, 75(5):758–771. Revue Française d’Entomologie 1959, 26:231–236. 74. Silvestro D, Michalak I: RaxmlGUI: a graphical front-end for RAxML. 47. Makarov KV, Koval AG: A contribution to the knowledge of the biology Org Divers Evol 2012, 12:335–337. doi:10.1007/s13127-011-0056-0. of a troglobiont carabid Jeannelius birsteini Ljovuschkin, 1963 75. Drummond AJ, Suchard MA, Xie D, Rambaut A: Bayesian phylogenetics (Coleoptera, Carabidae, Trechini). Entomol Obozr 2003, 82(4):836–845 with BEAUti and the BEAST 1.7. Mol Biol Evol 2012, 29:1969–1973. (in Russian). 76. Bucciarelli I: Quattro nuove Boldoriella ed osservazioni sull’habitat 48. Jeannel R: Révision des Trechini du Caucase (Coleoptera, Trechidae). (Coleoptera Carabidae). Mem Soc Entomol Ital 1978, 56(1977):217–228. Mém Mus Nation Hist Nat Série A 1960, 17(3):155–216. 77. Vigna Taglianti A: Un nuovo genere di Trechinae endogei e cavernicoli delle 49. Casale A: Revisione degli Sphodrina (Coleoptera, Carabidae, Sphodrini). Alpi Occidentali (Coleoptera, Carabidae). Fragm Entomol 1968, 5:181–201. Monografie 5. Torino: Museo regionale di Scienze naturali; 1988. 78. Casale A: Coleotteri ipogei ed endogei (Carabidae Anillini, Trechini e 50. Müller J: I coleotteri della Venezia Giulia. Catalogo ragionato. Parte I: Sphodrini, Catopidae Bathysciinae) delle Alpi Cozie e Graje (versante Adephaga. Studi entomologici, Trieste 1926, 1(2):1–306. italiano). Mem Biospeol 1980, 7:53–61. 51. Drioli G: Anophthalmus hirtus stygius n. ssp. ed osservazioni morfologiche 79. Ghidini GM: Un nuovo eccezionale Trechino cavernicolo italiano: sul “rassenkreis” dell’Anophthalmus hirtus Sturm (Coleoptera Carabidae). Italaphaenops dimaioi n. gen., n. sp. (Coleoptera: Trechidae). Boll Soc Gortania – Atti Museo Friul Storia nat 1981, 3:245–270. entomol ital 1964, 94:32–36. Faille et al. BMC Evolutionary Biology 2013, 13:248 Page 16 of 16 http://www.biomedcentral.com/1471-2148/13/248

80. Caoduro G, Osella G, Ruffo S: La fauna cavernicola della regione veronese. Memorie del Museo civico di Storia naturale di Verona, (IIa serie), sezione Scienze della Vita (A: Biologica) 1994, 11:1–145. 81. Gestro R: Nuovi materiali per lo studio degli Anophthalmus italiani. Ann Mus Civ St Nat Genova 1892, 32:79–85. 82. Drovenik B: Eine neue Art der Gattung Aphaenopidius Müller 1913 (Coleoptera: Carabidae: Trechinae). Entomol Z Insektenborse 1987, 97(5):49–64. 83. Winkler A: Eine zweite höhlenlaufkäferart aus den nordalpen: arctaphaenops styriacus sp. n. Koleopterol Rundsch 1933, 19:237–240.

doi:10.1186/1471-2148-13-248 Cite this article as: Faille et al.: A molecular phylogeny of Alpine subterranean Trechini (Coleoptera: Carabidae). BMC Evolutionary Biology 2013 13:248.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

Additional file 4: Table S1. List of the genera of Alpine Trechini, including number of species and previous hypotheses of relationships. genus author and species species distribution previous publication number included hypotheses of date relationships

Anisotopics

Allegrettia Jeannel, 4 2 Brescia area Speotrechus [2], 1928 (Lombardy, Jeannelius [29, Italy) 30, 27], Italaphaenops [27], Duvalius [27]

Boldoriella Jeannel, 16 4 Italian central Speotrechus 1928 pre-Alps [2,32], Doderotrechus [13]

Doderotrechus Vigna 3 3 Cottian Alps, Typhlotrechus Taglianti, Piedmont [2], Speotrechus 1968 & Boldoriella [47, 76]

Italaphaenops Ghidini, 1 1 Lessini Arctaphaenops 1964 Mountains [77], Allegrettia [77,78] & Orotrechus [24,27]

Lessinodytes Vigna 3 1 central pre- Aphaenops Taglianti, Alps from 1982 Brescia to phyletic lineage [13] Verona [25]

Orotrechus J. Müller, 37 14 from the Neotrechus 1913 Garda lake [2,13]

(Italy) to northeastern Slovenia Speotrechus Jeannel, 1 1 French Alps Paraphaenops 1922 and the [2], Trechus [12] Cevennes [2, 22, 23]

Trechus Clairville, >800 59 Mostly 1806 Palearctic region [11, 20]

Typhlotrechus J. Müller, 2 1 Dinaric area Doderotrechus 1913 (Croatia, [2] Slovenia,

Bosnia Herzegovina and Italy near Trieste)

Isotopics

Agostinia Jeannel, 1 1 Marguareis Anophthalmus 1928 and Mongioie [80], massifs in the Trichaphaenops Ligurian- [2], Duvalius Maritime Alps carantii group [2,13]

Anophthalmus Sturm, 1844 48 11 Slovenia, southern Austria, northeastern Italy and Croatia [11,20]

Aphaenopidius J. Müller, 2 - Austria, Duvalius and 1909 Slovenia Anophthalmus [2,81]

Arctaphaenops Meixner, 3 [11,83] 1 Austrian Alps Trichaphaenops 1925 [2,82] Duvaliaphaenops Giordan, 1 - French Agostinia [79] 1984 Maritime Alps

Duvalius Delarouzée, >300 37 widely 1859 distributed from Spain, Maghreb (Algeria) and

France in the west to central Asia and China in the East

Luraphaenops Giordan, 2 1 Southeastern Duvalius [22] 1984 France

Trichaphaenops Jeannel, 4 1 Southeastern Duvalius [2,22], 1916 France Arctaphaenops [2,82]

Additional file 5: Table S2. Material used in the study, with locality data, voucher number and accession numbers of the sequences.

N° Species code localities SSU LSU Cox1 rrnL trnaLeu NAD1 1 Adriaphaenops Noesske, 1928 Adriaphaenops sp. ZSM-L361 Montenegro- Žijovo Mts HG514764 HG514878 HG514647 HG514994 - -

2 Agostinia Jeannel, 1928 A. launi Gestro, 1892 ZSM-L435 Italy- Val Pesio- Grotta superiore delle Camosciere HG514778 HG514897 - HG514544 HG514544 HG514544

3 Allegrettia Jeannel, 1928 A. boldorii Jeannel, 1928 ZSM-L479 Italy- Passirano, Camignone- Bus di San Fausti HG514799 HG514920 HG514679 HG514564 HG514564 HG514564 A. pavani Bari & Rossi, 1965 ssp. ZSM-L660 Italy- Rota d´Imagna- grotta Tomba del Polacco - HG514950 HG514701 HG514591 HG514591 HG514591

4 Anophthalmus Sturm, 1844 A. hirtus Sturm, 1853 ZSM-L319 Slovenia- Mt Krim- Jama Velika Pasica HG514752 HG514866 - HG514983 - - A. kerteszi kerteszi Csiki, 1912 ZSM-L317 Croatia- Lokve, Delnice- Ledena špilja HG514750 HG514864 - HG514982 - - A. pretneri fodinae Mandl, 1940 ZSM-L531 Austria- Schaidassattel, Kärnten- Gitter Stollen HG514808 HG514930 - HG514572 HG514572 HG514572 A. ravasinii ravasinii J. Müller, 1922 ZSM-L691 Slovenia- Predmeja- Ledenica pri Dolu HG514829 HG514957 - HG514598 HG514598 HG514598 A. schatzmayri Moravec & Lompe, 2003 ZSM-L468 Austria- Villach–Warmbad- Eggaloch HG514793 HG514914 - HG514560 HG514560 HG514560 A. schmidti gspani Reitter, 1918 ZSM-L695 Slovenia- Škofja Loka, Monte Ljubnik- Kevderca na Lubniku HG514830 HG514959 HG514708 HG514600 HG514600 HG514600 A. scopolii scopolii F.J. Schmidt, 1850 ZSM-L673 Slovenia- Žaga Belsko- Osojca jama HG514828 HG514955 HG514706 HG514596 HG514596 HG514596 A. severi Ganglbauer, 1897 ZSM-L325 Slovenia- Mt Nanos- Volčja Jama - HG514870 - HG514525 HG514525 HG514525 A. severi Ganglbauer, 1897 ZSM-L326 Slovenia- Mt Nanos- Volčja Jama HG514754 - - HG514986 - - A. spectabilis istrianus Ganglbauer, 1913 ZSM-L693 Slovenia- Divača- Jama v Bukovniku - HG514958 - HG514599 HG514599 HG514599 A. spectabilis orehovscensis Daffner, 1996 ZSM-L320 Slovenia- Orecca- Žeguana jama - HG514867 - HG514984 - - A. spectabilis orehovscensis Daffner, 1996 ZSM-L324 Slovenia- Orecca- Žeguana jama HG514753 HG514869 - HG514524 HG514524 HG514524 A. tolminensis J. Müller, 1922 ZSM-L686 Slovenia- Zatolmin (Tolmin)- Zadlaška jama - HG514956 HG514707 HG514597 HG514597 HG514597 A. sp ZSM-L615 Austria- Windischbleiberg, Singerberg- Stollen - HG514944 HG514696 HG514586 HG514586 HG514586

5 Aphaenops Bonvouloir, 1862 A. alberti Jeannel, 1939 MNHN-AF12 France- Aussurucq- Aven prox. Istaurdy FR733955 GQ293595 GQ293662 GQ293700 GQ293782 GQ293829 A. catalonicus Escolà & Canció, 1983 MNHN-AF2 Bonansa- Cova des Toscllosses GQ293508 HM921082 GQ293674 GQ293699 GQ293756 GQ293821 A. leschenaulti Bonvouloir, 1861 MNHN-AF1 France- Bagnères-de-Bigorre- Grotte de Castelmouly FR733945 GQ293593 GQ293629 GQ293739 GQ293757 GQ293822 A. (Geaphaenops) ludovici Colas & Gaudin, 1935 MNHN-AF15 France- Arette- Grotte d’Ambielle FR733947 GQ293550 GQ293676 GQ293716 GQ293775 GQ293828 A. (Cerbaphaenops) cerberus (Dieck, 1869) MNHN-AF30 France- Moulis- Grotte du Sendé FR733948 GQ293589 GQ293646 GQ293718 GQ293779 GQ293835 A. (Cerbaphaenops) chappuisi Coiffait, 1955 MNHN-AF61 France- Izaut-de-l'Hôtel- Grotte de la Maouro GQ293525 GQ293563 GQ293684 FR729569 FR729569 FR729569 A. (Cerbaphaenops) crypticola (Linder, 1859) MNHN-AF47 France- Aspet- Grotte de Gouillou FR733952 GQ293577 GQ293671 GQ293709 GQ293765 GQ293812 A. (Hydraphaenops) ehlersi (Abeille de Perrin, 1872) MNHN-AF64 France- Arbas- Goueil-di-Her FR733957 GQ293565 GQ293683 FR729571 FR729571 FR729571 A. (Hydraphaenops) galani Español, 1968 MNHN-AF67 Spain- Usurbil- Guardetxe Koleccia GQ293524 GQ293602 FR733899 GQ293697 GQ293746 GQ293817 A. (Hydraphaenops) giraudi delicatulus Coiffait, 1962 MNHN-AF66 France- Sainte-Engrâce- Salle de la Verna FR733958 GQ293600 GQ293663 GQ293695 GQ293753 GQ293818 A. (Hydraphaenops) vasconicus (Jeannel, 1913) MNHN-AF65 France- Aussurucq- Aven d'Istaurdy GQ293530 GQ293622 GQ293628 GQ293698 GQ293759 GQ293803

6 Apoduvalius Jeannel, 1953 A. anseriformis Salgado et Peláez, 2004 MNCN-AF1 Spain- Caravia Alta, Palencia- Cueva de Entrecuevas - FR733999 FR733916 FR729582 FR729582 FR729582 A. anseriformis Salgado et Peláez, 2004 MNCN-AF2 Spain- Ludeña (Infiesto)- Cueva del Perro FR733979 FR733999 FR733916 FR729582 FR729582 FR729582 A. alberichae Español, 1971 MNHN-AF105 Spain- Cardano de abajo, Palencia- Cueva de Agudir GQ293536 GQ293618 GQ293632 GQ293732 GQ293794 GQ293840 Apoduvalius sp MNHN-AF106 Spain- Piloñeta- Cueva Requexada GQ293537 GQ293609 - GQ293736 GQ293736 GQ293736

7 Arctaphaenops Meixner, 1925 A. angulipennis styriacus Winkler, 1933 ZSM-L628 Austria- Göstling/Ybbs- Hochkarschacht HG514821 HG514946 - HG514587 HG514587 HG514587

8 Blemus Dejean, 1821 B. discus (Fabricius, 1792) ZSM-L611 Germany- Admannshagen HG514820 HG514943 HG514695 HG514585 HG514585 HG514585

9 Boldoriella Jeannel, 1928 B. carminatii carminatii (Dodero, 1917) ZSM-L288 Italy- Rota d'Imagna- grotta Tomba del Polacco HG514741 HG514856 - HG514979 - - B. carminatii bucciarelli Monguzzi, 1982 ZSM-L746 Italy- Gorno- Miniera - HG514967 - HG514609 HG514609 HG514609 B. focarilei (R. Rossi, 1965) ZSM-L271 Italy- Mte Resegone HG514731 HG514847 - HG514975 - - B. humeralis (Dodero, 1924) ZSM-L293 Italy- Serle-Buco del Budrio HG514744 HG514859 HG514638 HG514980 - - B. humeralis (Dodero, 1924) ZSM-L343 Italy- Prevalle- Buco del Frate HG514756 HG514871 - HG514987 - - B. monguzzii Bucciarelli, 1978 ZSM-L351 Italy- Marmentino- Piani di Vaghezza HG514761 HG514875 - HG514992 - -

10 Duvalius Delarouzée, 1859

Duvalius Delarouzée, 1859 D. baldensis cartolarii Pomini, 1936 ZSM-L286 Italy- Bosco Chiesanuova - Bocca Gaibana, Buso de la Neve HG514739 HG514854 HG514634 HG514978 - - D. berthae (Jeannel, 1910) MNHN-AF115 Spain- Pratdip- Cova d’en Xoles - GQ293606 GQ293626 FR729588 FR729588 FR729588 D. berthae (Jeannel, 1910) MNHN-AF114 Spain- Llaberia- Cova Massega GQ293531 FR734004 FR733922 - - - D. boldorii boldorii Jeannel, 1926 ZSM-L290 Italy- Buco del Budrio HG514743 HG514858 HG514637 - - - D. boldorii vaghezzae Ghidini, 1937 ZSM-L352 Italy- Marmentino- Piani di Vaghezza HG514762 HG514876 HG514645 HG514526 HG514526 HG514526 D. breiti Ganglbauer, 1900 ZSM-L345 Italy- Valdobbiadene- M. Cesen HG514758 HG514872 - HG514989 - - D. brujasi (Sainte-Claire Deville, 1901) ZSM-L407 France- Caussols- Grotte de la vieille Poste - HG514886 HG514655 HG514533 HG514533 HG514533 D. brujasi (Sainte-Claire Deville, 1901) ZSM-L429 France- Andon, Canaux- Grotte du Cafard HG514774 HG514893 HG514660 HG514540 HG514540 HG514540 D. cailloli cailloli (Sainte-Claire Deville, 1902) IBE-L192 France- Sospel- Grotte de Sues HG514722 HG514839 HG514620 HG514505 HG514505 HG514505 D. cailloli cailloli (Sainte-Claire Deville, 1902) IBE-L50 France- Sospel- Perthus de l'Agoumina HG514804 HG514926 HG514683 HG514569 HG514569 HG514569 D. canevae (Gestro, 1885) ZSM-L740 Italy- Toirano, Savona- Tana di Spettari - HG514963 - HG514604 HG514604 HG514604 D. carantii (Sella, 1874) ZSM-L283 Italy- Vernante, Sotterranei militari HG514737 HG514852 HG514632 HG514516 HG514516 HG514516 D. carantii (Sella, 1874) ZSM-L542 Italy- Certosa di Pesio- Grotta superiore delle Camosciere - - HG514689 HG514577 HG514577 HG514577 D. convexicollis (Peyerimhoff, 1904) IBE-AF4 France- Saint-Auban- Faille du Pensier HG514718 FR734005 FR733923 FR729589 FR729589 FR729589 D. delphinensis delphinensis (Abeille de Perrin, 1869) ZSM-L422 France- Saint Nazaire-en-Royans- Grotte de Thaïs HG514770 HG514888 - HG514535 HG514535 HG514535 D. diniensis diniensis (Peyerimhoff, 1904) ZSM-L428 France- Dignes-les-Bains- Doline de Cousson HG514773 HG514892 HG514659 HG514539 HG514539 HG514539 D. diniensis melanensis Giordan & Raffaldi, 1999 ZSM-L423 France- Le Castellard-Mélan- Grotte de Saint Vincent - HG514889 - HG514536 HG514536 HG514536 D. doderii group ZSM-L662 Italy- Genova - Val Graveglia HG514825 HG514952 HG514703 HG514593 HG514593 HG514593 D. doderii (Gestro, 1885) ZSM-L741 Italy- Viganego Tana da Scaggia– - HG514964 - HG514605 HG514605 HG514605 D. doriae (Fairmaire, 1859) ZSM-L742 Italy- Pignone- La Spezia- Grotta Grande di Pignone - - - HG514606 HG514606 HG514606 D. exaratus exaratus (Schaum, 1860) ZSM-L394 Austria- Gallizien, Obir- Wildensteiner Wasserfall - HG514882 HG514651 HG514529 HG514529 HG514529 D. gentilei gentilei (Gestro, 1885) ZSM-L294 Italy- Ponte di Nava- Grotta dell' Orso HG514745 HG514860 HG514639 HG514519 HG514519 HG514519 D. gentilei vaccai (Gestro, 1885) ZSM-L295 France- Vievola- Gte de Vievola HG514746 HG514861 - HG514520 HG514520 HG514520 D. lanai Casale & Giachino, 2010 ZSM-L476 Italy- Montaldo di Mondovì- Pozzo del Rospo HG514797 HG514918 HG514677 HG514562 HG514562 HG514562 D. lespesii cadurcus Jeannel, 1955 ZSM-L312 France- Caylus- Igue de Cabeque HG514748 - HG514641 HG514522 HG514522 HG514522 D. lespesii lespesii (Fairmaire, 1867) IBE-L243 France- Janoye, Penne- Gte des trois cloches - HG514845 HG514627 HG514510 HG514510 HG514510 D. longhii (Comolli, 1837) ZSM-L482 Italy- Bocchetta di San Simone HG514801 HG514923 - HG514566 HG514566 HG514566 D. ochsi joffrei Ochs, 1926 IBE-L23 France- Duranus- Faille du Chaos de la Vésubie HG514729 - HG514625 HG514509 HG514509 HG514509 D. ochsi ochsi (Dodero, 1921) IBE -L172 France- Cipières- Aven de la Bulle HG514719 HG514836 HG514617 HG514502 HG514502 HG514502 D. pecoudi Jeannel, 1937 ZSM-L275 Italy- Limonetto - Galleria di Napoleone HG514734 HG514850 HG514630 HG514514 HG514514 HG514514 D. perrinae Giordan, 1989 ZSM-L426 France- Peille, Plateau de Segra- Aven Vigne HG514771 HG514890 HG514657 HG514537 HG514537 HG514537 D. raymondi magdalenae (Abeille de Perrin, 1869) ZSM-L433 France- Plan d´Aups Ste Baume- Grotte aux Œufs HG514776 HG514895 HG514662 HG514542 HG514542 HG514542 D. raymondi raymondi (Delarouzée, 1859) ZSM-L427 France- Néoules- Régaï de Néoules HG514772 HG514891 HG514658 HG514538 HG514538 HG514538 D. roberti (Abeille de Perrin, 1903) MNHN-AF129 France- Peira Cava- Gte de Peira Cava HG514714 GQ293605 HG514615 GQ293691 GQ293785 GQ293837 D. sicardi cayrosensis Giordan, 1985 IBE-L241 France- Ft de Cairos, Fontan- Fontaine d'Abéon - HG514844 HG514626 HG514974 - - D. waillyi Giordan & Raffaldi, 1982 ZSM-L434 France- Utelle- Grotte des deux Gourdes HG514777 HG514896 HG514663 HG514543 HG514543 HG514543 D. wingelmuelleri adamellensis Jeannel, 1926 ZSM-L349 Italy- Cima Caldoline HG514760 HG514874 - HG514991 - - D. winklerianus winklerianus Jeannel, 1926 ZSM-L745 Italy- Gazzaniga, Val Asnina - HG514966 - HG514608 HG514608 HG514608 Euduvalius Jeannel, 1928 D. erichsonii netolitzkyi (J. Müller, 1908) ZSM-L373 Croatia- Mosor pl.- Maklutača jama HG514766 HG514879 HG514648 HG514995 - - D. erichsonii netolitzkyi (J. Müller, 1908) ZSM-L480 Croatia- Maklutača, Dugopolje HG514800 HG514921 HG514680 HG514565 HG514565 HG514565 D. lucidus (J. Müller, 1903) ZSM-L452 Croatia- Dalmatia, Brač island, Podgažul env.- Bazgovača špilja - HG514906 - HG514552 HG514552 HG514552 Hungarotrechus Bokor, 1922 D. bokori valyanus Bokor, 1922 ZSM-L450 Slovakia -Koniarska planina Mts., Priepast´ pod Veterníkom HG514785 HG514904 HG514666 HG514550 HG514550 HG514550 D. goemoeriensis Bokor, 1922 ZSM-L451 Slovakia- Drienčanský kras, Hrušovo env. Ponor u Ridzoňov cave HG514786 HG514905 HG514667 HG514551 HG514551 HG514551 D. klimai Janák & Moravec, 2008 ZSM-L462 Bulgaria- Stara planina mts. Berkovica, Kom Mts HG514790 HG514911 HG514671 HG514557 HG514557 HG514557 D. microphthalmus (L. Miller, 1859) ZSM-L456 Slovakia- Hriňová env. Polana Mts. HG514787 HG514908 HG514669 HG514554 HG514554 HG514554 D. szaboi szaboi (Csiki, 1914) ZSM-L453 Slovakia- Muránska planina Mts., Dolina za Nehovým - HG514907 HG514668 HG514553 HG514553 HG514553 Neoduvalius J: Müller, 1913 D. opermanni Scheibel, 1933 ZSM-L754 Croatia- Ogulin, Slunj Rakovica- Stara Kršlja Dumenćića cave - HG514971 HG514712 HG514613 HG514613 HG514613 Paraduvalius Knirsch, 1924 D. regisborisi Buresch, 1926 ZSM-L461 Bulgaria- Stara planina mts- Goljama Željezna Jalovica cave HG514789 HG514910 - HG514556 HG514556 HG514556

11 Doderotrechus Vigna Taglianti, 1968 D. casalei Vigna Taglianti, 1969 ZSM-L431 Italy- Rossana- Grotta delle Fornaci HG514775 HG514894 HG514661 HG514541 HG514541 HG514541 D. crissolensis (Dodero, 1924) IBE-L52 Italy- Prali- Val Germanasca, Miniera Gianfranco FR733986 HG514929 FR733926 FR729591 FR729591 FR729591 D. ghilianii ghilianii (Fairmaire, 1859) IBE-L53 Italy- Prali- Val Germanasca- Miniera Gianna FR733987 FR734007 FR733927 FR729592 FR729592 FR729592 D. ghilianii valpellicis Casale, 1980 ZSM-L661 Italy- Angrogna- Ghieisa d´la Tana - HG514951 HG514702 HG514592 HG514592 HG514592

12 Geotrechus Jeannel, 1919 G. discontignyi (Fairmaire, 1863) MNHN-AF92 France- Bagnères-de-Bigorre- Grotte du Tuco FR733966 GQ293560 FR733901 FR729572 FR729572 FR729572 G. orpheus (Dieck, 1869) MNHN-AF81 France- Mérigon- Grotte de la Quère GQ293528 GQ293597 GQ293665 FR729573 FR729573 FR729573 G. trophonius (Abeille de Perrin, 1872) MNHN-AF83 France- Mérigon- Grotte de Tuto Heredo FR733968 GQ293561 GQ293631 GQ293715 GQ293766 GQ293825 G. vandeli Coiffait, 1959 MNHN-AF88 France- Couflens -Aven d'Anglade GQ293523 GQ293549 FR733906 GQ293714 GQ293784 GQ293833 G. vulcanus (Abeille de Perrin, 1904) MNHN-AF91 France- Saint-Martin-de-Caralp- Perte du Fustié FR733970 GQ293599 FR733907 GQ293701 GQ293786 GQ293832

13 Iberotrechus Jeannel, 1920 I. bolivari (Jeannel, 1913) MNHN-AF111 Spain- Penilla, Santiurde de Toranzo- Cueva del Pis FR733984 GQ293615 GQ293679 GQ293735 GQ293781 GQ293819

14 Italaphaenops Ghidini, 1964 I. dimaioi Ghidini, 1964 ZSM-L470 Italy- Mt Lessini, Ala- Abisso di Bosco Scortigara HG514794 HG514915 HG514674 - - - I. dimaioi Ghidini, 1964 ZSM-L471 Italy- Velo Veronese- Grotta di Galleria Taioli HG514795 HG514916 HG514675 - - -

15 Jeannelius Kurnakov, 1959 J. birsteini Ljovuschkin, 1963 ZSM-L515 Russia- NW Caucasus, region of Sochi- Akhunskaya Cave HG514806 HG514928 - HG514571 HG514571 HG514571 J. gloriosus Ljovuschkin, 1965 ZSM-L514 Abkhazia- W Caucasus, Novyi Afon- Novoafonskaya Cave HG514805 HG514927 - HG514570 HG514570 HG514570

16 Lessinodytes Vigna Taglianti, 1982 L. cf. pivai Vigna Taglianti & Sciaky, 1988 ZSM-L272 Italy- Sant'Anna d'Alfaedo- Grotta A di Ponte di Veja HG514732 HG514848 - HG514512 HG514512 HG514512

17 Luraphaenops Giordan,1984 L. gaudini (Jeannel, 1952) MNHN-AF116 France- Dévoluy- Puits des Bauges GQ293543 GQ293604 FR733925 GQ293692 GQ293787 GQ293838

18 Neotrechus J. Müller, 1913 N. hilfi (Reitter, 1903) ZSM-L459 Montenegro- Crna Gora, Durmitor, Obla glava- Ledena pečina HG514788 HG514909 HG514670 HG514555 HG514555 HG514555 N. suturalis (Schaufuss, 1864) ZSM-L316 Montenegro- Orjen- Ledenice - Milutova jama HG514749 HG514863 HG514642 HG514981 - -

19 Orotrechus J. Müller, 1913 O. carinthiacus Mandl, 1940 ZSM-L733 Austria- Karawanken, Obir - Stollen unter Rainer Schutzhaus HG514833 HG514962 HG514709 HG514603 HG514603 HG514603 O. fabianii (Gestro, 1900) ZSM-L481 Italy- Lonigo- gr. Covolo delle Tette - HG514922 HG514681 - - - O. forojulensis Busulini, 1959 ZSM-L648 Italy- Frisanco- Bus del Larcs HG514824 HG514949 HG514700 HG514590 HG514590 HG514590 O. giordanii Agazzi, 1957 ZSM-L353 Italy- Valdobbiadene- M. Cesen HG514763 HG514877 HG514646 HG514993 - - O. globulipennis tarcentinus Meggiolaro, 1961 ZSM-L547 Italy- Nimis- Grotta di Monteprato HG514816 HG514939 - HG514581 HG514581 HG514581 O. haraldi Daffner, 1990 ZSM-L616 Austria- Bad Eisenkappel- Lobnigschacht - HG514945 HG514697 HG514995 - - O. holdhausi fortii J. Müller, 1963 ZSM-L537 Italy- Montereale Valcellina- Inghiottitoio di Val de Pai HG514810 HG514932 HG514685 HG514573 HG514573 HG514573 O. holdhausi bucciarelli Tamanini, 1954 ZSM-L544 Italy- Refrontolo- Busa delle Fave HG514814 HG514937 HG514691 HG514579 HG514579 HG514579 O. jamae G. Etonti & M. Etonti, 1979 ZSM-L535 Italy- Fregona- Bus de la Genziana HG514809 HG514931 HG514684 - - - O. messai (J. Müller, 1913) ZSM-L539 Italy- Montello, Ss Angeli- Bus delle Fade superior HG514812 HG514934 HG514687 HG514575 HG514575 HG514575 O. montellensis Agazzi, 1956 ZSM-L664 Italy- Montello, Ss Angeli- Bus delle Fade superior HG514826 HG514953 HG514704 HG514594 HG514594 HG514594 O. muellerianus (Schatzmayr, 1907) ZSM-L545 Italy- Sgonico- Grotta Azzurra HG514815 HG514938 HG514692 HG514580 HG514580 HG514580 O. springeri J. Müller, 1928 ZSM-L543 Italy- Clauzetto- Caverna Mainarda - HG514936 HG514690 HG514578 HG514578 HG514578 O. torretassoi J. Müller, 1928 ZSM-L549 Italy- Valcellina- Bus de la Fous HG514818 HG514941 HG514693 HG514583 HG514583 HG514583 O.vicentinus juccii Pomini, 1940 ZSM-L287 Italy- S. Ambrogio Valpolicella- Cave Brentani HG514740 HG514855 HG514635 HG514517 HG514517 HG514517 O.vicentinus juccii Pomini, 1940 ZSM-L538 Italy- Roveré Veronese- Grotta di Roveré Mille HG514811 HG514933 HG514686 HG514574 HG514574 HG514574 O.vicentinus juccii Pomini, 1940 ZSM-L273 Italy- Sant'Anna d'Alfaedo- Gta A di Ponte di Veja HG514733 HG514849 HG514629 HG514513 HG514513 HG514513 O. vicentinus martinellii Daffner, 1987 ZSM-L473 Italy- M. Baldo, Pai, Torri del Benaco- Grotta Tanella HG514796 HG514917 HG514676 HG514561 HG514561 HG514561

20 Paraphaenops Jeannel, 1916 P. breuilianus (Jeannel, 1916) MNHN-AF108 Spain-Tortosa- Cova Cambra GQ293541 GQ293551 GQ293685 FR729587 FR729587 FR729587

21 Perileptus Schaum, 1860 P. areolatus (Creutzer, 1799) MNHN-AF113 Morocco- Immouzer des Ida Outanane GQ293503 GQ293625 GQ293688 FR729593 FR729593 FR729593

22 Pheggomisetes Knirsch, 1923 P. globiceps globiceps Buresch, 1925 ZSM-L467 Bulgaria- Stara planina mts, Iskrec- Dušnika peštera cave HG514792 HG514913 HG514673 HG514559 HG514559 HG514559 P. globiceps ilandjevi V.B. Guéorguiev, 1964 ZSM-L466 Serbia- Dimitrovgrad Peterlaš- Peterlaška pečina cave HG514791 HG514912 HG514672 HG514558 HG514558 HG514558

23 Sardaphaenops Cerruti & Henrot, 1956 S. supramontanus supramontanus Cerruti & Henrot, 1956 MNCN-AF3 Italy- Sardinia, Urzulei- Mandara E’`Suru Manna FR733981 FR734001 FR733919 FR729585 FR729585 FR729585 S. supramontanus grafittii Casale & Giachino, 1988 MNCN-AF4 Italy- Sardinia, Baunei- Grotta Voragine Tesulali FR733982 FR734002 FR733920 FR729586 FR729586 FR729586 S. adelphus Casale, 2004 MNCN-AF5 Italy- Sardinia, Baunei- Grotta Voragine Tesulali FR733983 FR734003 FR733921 HG514973 - -

24 Speotrechus Jeannel, 1922 S. mayeti mayeti (Abeille de Perrin, 1875) MNHN-AF107/IBE-L56 France- Saint-Montant- Perte du Rimouren GQ293535 GQ293547 FR733918 FR729584 S. mayeti mayeti (Abeille de Perrin, 1875) IBE-L189 France- Labeaume- Grotte de Peyroche - HG514837 - HG514503 HG514503 HG514503

25 Trechus Clairville, 1806 T. abeillei Pandellé, 1872 ZSM -L15 France- Couflens- Cirque d´Anglade HG514716 HE817916 HE817932 HE817900 HE817900 HE817900 T. aubei Pandellé, 1867 IBE -L187 France- Maurin, Saint-Paul-sur-Ubaye HG514720 HE817918 HG514618 HE817903 HE817903 HE817903 T. aubryi Coiffait, 1953 ZSM-L370 France- Couflens- Cirque d´Anglade HG514765 - HE817934 HE817902 HE817902 HE817902 T. barnevillei Pandellé, 1867 MNHN-AF97 Spain- Penilla, Santiurde de Toranzo- Cueva del Pis GQ293533 GQ293607 GQ293680 GQ293727 GQ293783 GQ293848 T. bastropi Schmidt, 2009 ZSM-L609 China- Tibet South Centr. NE of Shoqu La pass HG514819 HG514942 HG514694 HG514584 HG514584 HG514584 T. beusti (Schaufuss 1863) ZSM-L199 Spain- Zegama- Cueva de San Adrián HG514725 HE817912 HE817928 HE817896 HE817896 HE817896 T. bonvouloiri Pandellé, 1867 ZSM-L218 France- Baudéan, Pic de Montaigu HG514726 HE817915 HE817931 HE817899 HE817899 HE817899 T. bordei Peyerimhoff, 1909 MNHN–TBA France- Larrau- Grotte d´Ayssaguer HG514834 HE817914 HE817930 HE817898 HE817898 HE817898 T. bouilloni Faille, Bourdeau & Fresneda, 2012 ZSM-L201bis Spain- Lizarraga, Puerto de Lizarraga - HE817911 HE817926 HE817894 HE817894 HE817894 T. brembanus Focarile, 1949 ZSM-L443 Italy- Laghi Ponteranica HG514782 HG514901 - HG514547 HG514547 HG514547 T. brucki Fairmaire, 1862 ZSM-L329 France- Arrens, Pic du Gabizos HG514755 HE817906 HE817921 HE817888 HE817888 HE817888 T. brucki Fairmaire, 1862 ZSM-L449 France- Laruns, Caperan d´Anéou HG514784 HE817909 HE817924 HE817892 HE817892 HE817892 T. cardioderus Putzeys, 1870 ZSM-L489 Czech Rep.- Beskydy Mts. Mor. B.- Kohutraj HG514802 HG514924 HG514682 HG514567 HG514567 HG514567 T. cardioderus Putzeys, 1870 ZSM-L708 Romania- Ormîndea- gănoasa de Ormîndea HG514831 HG514960 - HG514601 HG514601 HG514601 T. cardioderus Putzeys, 1870 ZSM-L711 Romania- Motru Sec- Peştera Lazului HG514832 HG514961 - HG514602 HG514602 HG514602 T. ceballosi Mateu, 1953 MNHN-AF128 France- Lanne-en-Barétous- Aven de Licie Etsaut FR733978 GQ293610 FR733914 GQ293728 GQ293791 GQ293850 T. controversus Binaghi, 1959 ZSM-L437 Italy- Abruzzo, Majella HG514779 HG514898 HG514664 - - - T. croaticus Dejean, 1831 ZSM-L669 Slovenia- Žaga Belsko- Osojca jama HG514827 HG514954 HG514705 HG514595 HG514595 HG514595 T. delarouzeei Pandellé, 1867 IBE-L197 France- Allos, col d'Allos HG514724 HG514841 HG514622 HG514507 HG514507 HG514507 T. distigma Kiesenwetter, 1851 MNHN-AF94 France- Arthez d'Asson- Aven de Nabails FR733971 GQ293611 HE817936 FR729575 FR729575 FR729575 T. distinctus Fairmaire & Laboulbène, 1854 ZSM-L216 France- Laruns, Col Sobe Ariel - HE817917 HE817933 HE817901 HE817901 HE817901 T. doderoi Jeannel, 1927 ZSM-L306 Italy- Arezzo, Badia Prataglia - Fosso del Macchione HG514747 HG514862 HG514640 HG514521 HG514521 HG514521 T. escalerae Abeille de Perrin, 1903 MNHN-AF104 Spain- Covadonga- Cueva de Porro Covañona GQ293538 GQ293612 FR733912 GQ293731 GQ293793 GQ293839 T. fairmairei Pandellé, 1867 ZSM-L191 France- Sospel- Grotte de Sues HG514721 HG514838 HG514619 HG514504 HG514504 HG514504 T. fairmairei Pandellé, 1867 ZSM-L541 Italy- Montereale Valcellina- Inghiottitoio di Val de Pai HG514813 HG514935 HG514688 HG514576 HG514576 HG514576 T. fulvus Dejean, 1831 MNHN-AF98 Spain- Penilla, Santiurde de Toranzo- Cueva del Pis FR733972 GQ293613 HE817938 GQ293729 - - T. gigoni Casale, 1982 IBE-L35 Morocco- Tabehirt-Semia (Tahla)- Trou de la piste FR733980 FR734000 FR733917 FR729583 FR729583 FR729583 T. glacialis Heer, 1837 ZSM-L419 Germany- Bayer. Alpen, Taubenstein HG514769 HG514887 HG514656 HG514534 HG514534 HG514534 T. gracilitarsis K. Daniel & J. Daniel, 1898 ZSM-L346 Italy- Valdobbiadene, M. Cesen HG514759 HG514873 - HG514990 - - T. grenieri Pandellé, 1867 ZSM-L13 France- Fréchet–Aure- Résurgence de la Hèche HG514715 HE817904 HE817920 HE817887 HE817887 HE817887 T. hampei Ganglbauer, 1891 ZSM-L631 Austria- Göstling/Ybbs- Hochkarschacht HG514823 HG514948 HG514699 HG514589 HG514589 HG514589 T. hummleri Jeannel, 1927 ZSM-L438 Italy- Abruzzo, Rifugio Duca degli Abruzzi, Gran Sasso HG514780 HG514899 - HG514545 HG514545 HG514545 T. jeannei Sciaky, 1998 ZSM–L516 Spain- Saja, Bosque de Saja HG514807 HE817918 HE817903 HE817903 HE817903 T. kahleni Donabauer & Lebenbauer, 2003 ZSM-L289 Italy- Rota d'Imagna- Tomba del Polacco HG514742 HG514857 HG514636 HG514518 HG514518 HG514518 T. karadenizus Pawlowski, 1976 ZSM-L402 Turkey- Rd between Çamlıhemşin and Ayder - HG514884 HG514653 HG514531 HG514531 HG514531 T. lazicus Pawlowski, 1976 ZSM-L397 Turkey- Çifteköprü, rd Borçka-Hopa - HG514883 HG514652 HG514530 HG514530 HG514530 T. lepontinus Ganglbauer, 1891 ZSM-L284 Italy- Biella, Santuario di Oropa HG514738 HG514853 HG514633 HG514977 - - T. liguricus Jeannel, 1921 ZSM-L548 Italy- Valcasotto, Garessio- Tana della Fornace HG514817 HG514940 - HG514582 HG514582 HG514582 T. longobardus Putzeys, 1870 ZSM- L444 Italy- Monte Legnone HG514783 HG514902 - HG514548 HG514548 HG514548 T. melanocephalus Kolenati, 1845 ZSM-L406 Turkey- Erzincan, Sipikor Gecidi - HG514885 HG514654 HG514532 HG514532 HG514532 T. modestus Putzeys, 1874 ZSM-L278 Italy- Biella, Santuario di Oropa HG514736 - HG514631 HG514515 HG514515 HG514515 T. navaricus (Vuillefroy, 1869) MNHN-AF103 France- Sare- Grotte de Sare GQ293539 GQ293603 GQ293687 FR729578 FR729578 FR729578 T. obtusus Erichson, 1837 IBE–AF2 Portugal- Madeira, Estrada de Nicho FR733976 FR733997 HE817937 FR729579 FR729579 FR729579 T. ovatus Putzeys, 1846 ZSM-L630 Austria- Göstling/Ybbs- Hochkar HG514822 HG514947 HG514698 HG514588 HG514588 HG514588 T. piazzolii Focarile, 1950 IBE-L221 Switzerland- Guriner Furka HG514727 HG514842 HG514623 - - - T. pilisensis Csiki, 1918 cf ZSM-L478 Austria- Göstling/Ybbs- Hochkar HG514798 HG514919 HG514678 HG514563 HG514563 HG514563 T. pochoni Jeannel, 1939 ZSM-L747 Switzerland- Tessin, Frasco, Lago d´Efra - HG514968 HG514711 HG514610 HG514610 HG514610 T. pulchellus Putzeys, 1846 ZSM-L491 Romania- Albia, Bucium Sasa Detunata HG514803 HG514925 - HG514568 HG514568 HG514568 T. putzeysi Pandellé, 1867 ZSM-L276 Italy- Limonetto - Galleria di Napoleone HG514735 HG514851 - HG514976 - - T. quadristriatus (Schrank, 1781) MNHN-AF96 Spain- Egea, Collau de la Plana del Turbón GQ293534 GQ293619 FR733908 GQ293743 GQ293745 GQ293841 T. quadristriatus (Schrank, 1781) IBE-L39 Greece- Kastania HG514768 HG514881 HG514650 HG514528 HG514528 HG514528 T. rubens Fabricius, 1792 ZSM-L782 Austria-Tirol, östtirol, Villgratental Sillian - HG514972 HG514713 HG514614 HG514614 HG514614 T. saxicola Putzeys, 1870 MNHN- AF100 Spain- Braña Caballo - Piedrafita FR733974 GQ293614 HE817935 FR729577 FR729577 FR729577 T. schaufussi ssp. comasi Hernando, 2002 MNHN- AF127 Spain- Barindano- Cueva Basaula FR733977 GQ293617 HE817940 FR729580 FR729580 FR729580 T. aff. schaufussi Putzeys, 1870 MNHN-AF101 Spain- Ciudad Real-Navas de Estena-"El Boqueron" GQ293532 GQ293620 FR733910 GQ293737 GQ293788 GQ293820 T. schwienbacheri Donabauer & Lebenbauer 2003 ZSM-L344 Italy- Marmentino, Piani di Vagezza HG514757 - - HG514988 - - T. straneoi montismaiellettae Ghidini, 1932 ZSM-L439 Italy- Monte Majelletta HG514781 HG514900 - HG514546 HG514546 HG514546 T. strasseri Ganglbauer, 1891 ZSM-L748 Switzerland- Tessin, Frasco, Lago d´Efra - HG514969 - HG514611 HG514611 HG514611 T. sylvicola K. Daniel & J. Daniel, 1898 IBE-L195 Italy- Bosco Chiesanueva HG514723 HG514840 HG514621 HG514506 HG514506 HG514506 T. tenuilimbatus K. Daniel & J. Daniel, 1898 ZSM-L749 Switzerland- Kt. Graubünden, Soglio, Passo da la Prasgnola - HG514970 - HG514612 HG514612 HG514612 T. tyrrhenicus Jeannel, 1927 IBE-L229 Italy- Sardinia, Perdasdefogu- Grotta Is Ingurtidorgius HG514728 HG514843 HG514624 HG514508 HG514508 HG514508 T. uhagoni uhagoni Crotch, 1869 MNHN-AF102 Spain- Alsasúa- Cueva de Orobe GQ293540 GQ293616 FR733911 GQ293730 - - Trechus sp. ZSM-L744 Greece- SW Skiathos Isl. Koukounaries env. - HG514965 HG514710 HG514607 HG514607 HG514607 Trechus sp. ZSM-L375 Italy- Gavardo, Selva Piana HG514767 HG514880 HG514649 HG514527 HG514527 HG514527 Trechus sp. IBE-L167 Turkey- Kastamonu HG514717 HG514835 HG514616 HG514501 HG514501 HG514501 ss. g. Epaphius Leach, 1819 T. secalis (Paykull, 1790) ZSM-L254 France- Rupt / Moselle- Tourbière de la Charme HG514730 HG514846 HG514628 HG514511 HG514511 HG514511

26 Trichaphaenops Jeannel,1916 T. gounellei (Bedel, 1879) MNCN-AF6 France- Vassieux-en-Vercors- Baume Cervière FR733985 FR734006 FR733924 FR729590 FR729590 FR729590

27 Thalassophilus Wollaston, 1854 T. longicornis (Sturm, 1825) IBE-AF7 France- Beost - FR734008 FR733929 - - -

28 Typhlotrechus (J. Müller, 1913) T. bilimeki bilimeki (Sturm, 1847) ZSM_L318 Slovenia- Videm, Grosuplje- Podpeška jama HG514751 HG514865 HG514643 HG514523 HG514523 HG514523 T. bilimeki hacquetii (Sturm, 1853) ZSM_L322b Slovenia- Mt Krim- Velika Pasica jama - HG514868 HG514644 HG514985 - -

Outgroups 29 Penetretus Motschulsky, 1865 P. temporalis Bedel, 1909 IBE-AF8 Morocco- Taza- Ifri Ouled-Ayach FR733989 FR734010 - FR729595 FR729595 FR729595

30 Philochthus Stephens, 1828 P. lunulatus (Fourcroy, 1795) MNHN-AF118 Spain- Guadalajara- El Pobo de Dueñas GQ293505 FR734009 GQ293686 GQ293690 GQ293797 GQ293801

31 Typhlocharis Dieck, 1869 Typhlocharis sp. MNHN-AF119 Spain- Santa Almagrera GQ293502 GQ293624 GQ293633 FR729594 FR729594 FR729594 Additional file 6: Table S3. Primers used in the amplification.

Gene Name Sense Sequence Ref. cox1 Jerry (M202) F CAACATTTATTTTGATTTTTTGG [1] Pat (M70) R TCCA(A)TGCACTAATCTGCCATATTA [1] Chy F T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT [2] Tom R AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A [2] Ron F GGATCACCTGATATAGCATTCCC [1] rrnL-nad1 16saR (M14) F CGCCTGTTTA(A/T)CAAAAACAT [1] ND1A (M223) R GGTCCCTTACGAATTTGAATATATCCT [1] SSU 5’ F GACAACCTGGTTGATCCTGCCAGT [3] b5.0 R TAACCGCAACAACTTTAAT [3] LSU D1 F GGGAGGAAAAGAAACTAAC [4] D3 R GCATAGTTCACCATCTTTC [4]

References

1. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P: Evolution, weighting, and phylogenetic utility of mitochondrial gene-sequences and a compilation of conserved polymerase chain-reaction primers. Ann Entomol Soc Am 1994, 87, 651-701. 2. Ribera I, Fresneda J, Bucur R, Izquierdo A, Vogler AP, Salgado JM, Cieslak A: Ancient origin of a Western Mediterranean radiation of subterranean beetles. BMC Evol Biol 2010, 10(29): 1-14. doi:10.1186/1471-2148-10-29 3. Shull VL, Vogler AP, Baker MD, Maddison DR, Hammond PM: Sequence alignment of 18S ribosomal RNA and the basal relationships of adephagan beetles: evidence for monophyly of aquatic families and the placement of Trachypachidae. Systematic Biology 2001, 50: 945-969. 4. Ober KA: Phylogenetic relationships of the carabid subfamily Harpalinae (Coleoptera) based on molecular sequence data. Mol Phylogenet Evol 2002, 24: 228- 248.