Pseudanabaenaceae, Cyanobacteria), a New Species at the Nexus of Five Genera

Fottea 11(1): 127–140, 2011 127 Tapinothrix clintonii sp. nov. (Pseudanabaenaceae, Cyanobacteria), a new species at the nexus of five genera Markéta BOHUNICKÁ 1, Jeffrey R. JOHANSEN 2, and Karolina Fu č í k o v á 3 1Faculty of Science, University of South Bohemia, Branišovská 31, České Budějovice, CZ–370 05, Czech Republic; e–mail: [email protected] 2Department of Biology, John Carroll University, University Heights, OH 44118, U.S.A. 3University of Connecticut, Department of Ecology and Evolutionary Biology, 75 North Eagleville Road, Storrs, CT 06269–3043, U.S.A. Abstract: A new species was isolated and characterized from Grand Staircase–Escalante National Monument. This taxon shares morphological characteristics with five different genera, Ammatoidea, Homoeothrix, Leptolyngbya, Phormidiochaete, and Tapinothrix. An argument could be made to place it in any of these genera, however, we consider the most taxonomically correct genus for our pseudanabaenalean species to be Tapinothrix, and we accordingly describe it as T. clintonii sp. nov. Phylogenetically, the taxon is closest to Leptolyngbya sensu stricto, but it has very distinctive morphology and 16S–23S ITS sequence and secondary structure that support our conclusion to recognize Tapinothrix as a genus separate from Leptolyngbya. Key words: Ammatoidea, Homoeothrix, Leptolyngbya, Phormidiochaete, Tapinothrix, Cyanobacteria, taxonomy, 16S rRNA, 16S–23S ITS, rRNA secondary structure 2005). Tapinothrix bornetii was transferred into Introduction Homoeothrix bornetii (Sa u v a g e a u ) ma B i l l e (1954), and Tapinothrix was forgotten for nearly In the course of study of the algal flora of half a century. In the most recent treatment of Grand Staircase–Escalante National Monument the Oscillatoriales, ko m á r e k & an a g n o S t i d i S (kr a u t o v á 2008), we isolated a distinctive non– (2005) recognized that Homoeothrix was likely heterocytous, filamentous strain of cyanobacteria. polyphyletic, with the type species, H. juliana This strain is characterized by having isopolar (BORNE T et Fl a h a u l t ) ki r c h n e r clearly belonging filaments which taper at the apices and fragment in to the Oscillatoriaceae, while the majority the center to form heteropolar tapering trichomes. of described taxa apparently belong in the The resulting “basal” portion of the heteropolar Pseudanabaenaceae. They concluded that these filament forms a mucilage pad, which likely serves pseudanabaenacean species belong in Tapinothrix, to cement the widened trichome end to the substrate. but they did not make any taxonomic transfers. The cell contents are rich in phycoerythrin, giving In looking for species conforming the trichomes a reddish coloration, with mature morphologically to our isolate, the closest species sheaths blackish. Cell organization (thylakoid is actually Phormidiochaete fusca (St a r m a c h ) ko- arrangement and mode of cell division) is typical MÁREK in an a g n o S t i d i S (2001). Phormidiochaete of the Pseudanabaenaceae. was split out of Homoeothrix to accommodate the Within the Pseudanabaenaceae there is species within Homoeothrix that have a mode of a single genus with tapering trichomes whose cell division and thylakoid structure consistent species are attached to the substrate at the base with the Phormidiaceae (an a g n o S t i d i S 2001). The – Tapinothix Sa u v a g e a u . Only two species were type species of Phormidiochaete, P. nordstedtii described in this genus, T. bornetii Sa u v a g e a u (BORNE T et Fl a h a u l t ) ko m á r e k et an a g n o S t i d i S , (1892) and T. mucicola Bo r g e (1923). Another clearly fits into the Phormidiaceae, as does P. tapering genus, Homoeothrix (THURE T ex BORNE T balearica (BORNE T et Fl a h a u l t ) ko m á r e k et et FLAHAUL T ) KIRCHNER (1898) was subsequently an a g n o S t i d i S . This genus is in the subfamily described, and many species were described Ammatoideoideae. However, P. fusca has much within this taxon (ko m á r e k & an a g n o S t i d i S smaller diameter than the vast majority of 128 BOHUNICKÁ et al.: Tapinothrix clintonii sp. nov. Phormidiaceae, and it may have been mistakenly was completed under 16:8 light:dark cycle and placed in this genus. Interestingly, a feature of our corresponding day and night temperatures of 15 °C taxon which separates it from Phormidiochaete and 10 °C. Colonies were picked 4–6 weeks later. The is the common occurrence of isopolar trichomes isolate discussed in this paper was a black cyanobacterial tapering towards both apices that bend acutely in colony, and was isolated onto a Z8 slant. Morphological variability of the culture was determined by examining the center. Such isopolar forms are placed in the the culture as it aged from exponential growth phase genus Ammatoidea WES T et g.S. We S t (1897), through senescence (a period of about three months). which includes mostly species with typical Characterization was completed using an OLYMPUS phormidiacean features as well as the apparently BMAX 60 microscope with high resolution Nomarski pseudanabaenacean marine species A. murmanica DIC optics, equipped with a Spot digital camera. The Pe t r o v (1961). cell dimensions were repeatedly measured using an Finally, we must mention the genus ocular micrometer. Leptolyngbya. This genus has become the home for a plethora of pseudanabaenacean species Molecular characterization. Tapinothrix was scraped transferred from Lyngbya, Plectonema, and from slants, and genomic DNA isolation was performed Phormidium because of their narrow, untapered using the UltraClean Microbial DNA Isolation Kit from trichomes forming simple sheaths. This genus MO BIO (Carlsbad, CA, USA). DNA was eluted and stored at –20 °C. has been said to be a polyphyletic assemblage A PCR product of 1600 bps containing the 16S– (AL B ER T ANO & ko v á č i k 1994; TURNER 1997; 23S ITS was generated using primers 1 and 2 (BOYER WILMO tt E et al. 1997; CAS T ENHOLZ 2001; et al. 2002). Fifty microliter reactions were performed Wi l m o t t e & he r d m a n 2001; TA T ON et al. 2003; in a Bio–Rad DNA Engine PTC200 (Hercules, CA, CASAMA tt A et al. 2005; ko m á r e k & an a g n o S t i d i S USA). Final concentrations of reagents in the reactions 2005; JOHANSEN et al. 2008), but no revisionary were 1X Taq polymerase buffer (USB, OH, USA), work recognizing the separate clades as separate 1.5 mM MgCl2, 2.5 pmol per μl of each primer, 1 μl genera has been completed. of template DNA (100–200 ng total), 0.2 mM dNTPs Our isolate is at the nexus of these five (USB), and 1.25 units Taq polymerase (USB).Cycling genera. It fits no described species in any genus, conditions were 35 cycles of 94 °C for 45 sec, 57 °C for 45 sec, and 72 °C for 135 sec. A 5 min extension and some justification could be given to place it at 72 °C was performed, and the reactions were held in any of the five genera discussed above. The at 4°C indefinitely. All PCR products were analyzed intent of this paper is to describe our isolate as on 1% agarose gels before being TA–cloned into the a new species in the genus which we consider pSC–amp/kan plasmid of the Stratagene Cloning Kit to be most correct (Tapinothrix), determine the (La Jolla, CA, USA). Putative clones were isolated phylogenetic position of the isolate, and discuss using QIAprep Spin kits (Qiagen, Carlsbad, CA, USA) the systematic and taxonomic ramifications of with elution in 50 μl of sterile water. The presence of the discovery and characterization of this species, an insert was confirmed byEco R I digestion. including reassignment of problematic species to Four 16S rRNA and 16S–23S ITS plasmids what we consider to be the correct genera. While were sequenced by Functional Biosciences, Inc. (Madison, WI, USA) using the M13 forward and this may seem like an unusual case, it is likely M13 reverse primers. Additionally, the 16S–23S representative of many similar stories that will be ITS–containing plasmids were sequenced with internal told as the revisionary process of the cyanobacteria primers 5 (5’–TGTACACACCGCCCGTC–3’) continues. and 8 (5’–AAGGAGGTGATCCAGCCACA–3’) (FLECH T NER et al. 2002). Sequences were aligned and proofread using Sequencher software (version 4.8, Materials and Methods Ann Arbor, MI, USA). Only one 16S–23S ITS operon was identified, the one that encodes both tRNAIle and Isolation and cultivation. A sample was collected tRNAAla. Subsequently, the folded secondary structures in August 2006 from a sandstone seep wall adjacent were determined using Mfold version 3.2; the default to the cascade at Lower Calf Creek Falls in the Great conditions were used in this analysis except for draw Staircase–Escalante National Monument, Utah, mode: untangle with loop fix. Conserved domains USA (37°49’44.77” N, 111°25’12.58” W) and kept within the 16S–23S ITS were identified through refrigerated until further processing in laboratory. employment of comparative analysis with the ITS of A small, unmeasured portion of the sample other Pseudanabaenales, particularly with respect to was dilution plated onto agar–solidified Z8 universal the basal portions of each helix. Structures were drawn algal culture medium (KO T AI 1972). Enrichment in Adobe Illustrator CS4 prior to publication.

Load more