Unraveling the Physiological and Molecular Response of Arabidopsis Thaliana to Narrow-Wavelength Light

Unraveling the physiological and molecular response of Arabidopsis thaliana to narrow-wavelength light

Nafiseh Yavari

A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Doctor of Philosophy May 2020

Department of Bioresource Engineering 21111 Lakeshore Road, Sainte-Anne-de-Bellevue, Quebec H9X 3V9 McGill University, Montreal, Canada

Acknowledgements

First and foremost, I would like to thank my parents, Ehteram and Mohammad, who have provided me with endless love and support during my doctorate. Without their cherished influence on my life and heartfelt support, including my siblings Hesam and Negin, I may not have found myself at McGill University, nor had the courage to see it possible. Thank you for being there during every part of it.

At the very outset, I would like to express my sincere gratitude to my supervisor, Professor Mark G. Lefsrud, for the continuous support of my Ph.D. work and related research, and for his patience, motivation, enthusiasm, and immense knowledge to pursue the project. I thank Dr. Lefsrud for pushing me to strive for higher and better, and for giving me the opportunity to do my thesis away from the school. I am grateful for all I have learned from him.

I would like to thank Professor Valérie Orsat, my co-supervisor, for the scientific support and insightful comments and advice she made throughout my doctorate program.

I would like to extend my heartfelt thanks to Professor Jaswinder Singh, who gave me the opportunity to work with his incredible lab team and have valuable experiences. I also express my deep gratitude to Dr. Rajiv Tripathi, his professionalism and knowledge in supervising and teaching me all about RNA and relevant analyses gave me the opportunity to complete part of my thesis. Warm thanks also go to the amazing people, who are part of Prof. Singh’s lab that brought me a pleasant environment, experience and support to work in, with a special mention to Dr. Rajvinder Kaur and Irfan Iqbal.

I am also thankful for the advice of Professor Ajjamada C. Kushalappa, for his valuable knowledge and great advice in terms of plant science in running the first steps of my doctorate projects and critical review on manuscripts. I do truly appreciate his guidance through conceiving my doctorate project. I would also like to acknowledge and thank Dr. Darwin Lyew for the help and technical support provided for the much needed microbiology and chemistry guidance. Thanks for Mr. Yvan Gariepy during the experimental sessions of the work. I would like to acknowledge

2 support from Professors Don Smith and Jean-Benoit Charron, Department of Plant Science, for their kind assistance with technical support. Finally, thank you to Mr. Guy Rimmer for providing access to the greenhouse facilities.

This work has also benefited from the help and support provided by many friends and colleagues both at and outside of McGill University. Thank you to Dr. Bo-Sen Wu, who assisted me through ordering and testing the customized LED lights, supervising and teaching me all about LI-COR chamber, graphical evaluation rosettes growth, measuring wavelength spectrum and irradiance. Thank you to Dr. Vahid Hajihoseini Gazestani for discussing fruitful ideas through different aspects of the projects. Thank you to Dr. Peter Tikasz, Dr. Lucas McCartney, Mahnaz Mansoori, Sophie Rufyikiri, Dr. Sarah MacPherson and all other colleagues and friends from the Biomass Lab for all support during time in and away from McGill.

3 Contributions of Authors

In accordance with the McGill University “Guidelines for a Manuscript Based Thesis”, the contributions made by the candidate and the co-authors are described here.

Chapters 3, 4, and 5 of this thesis contain materials from manuscripts currently under peer review. Chapter 3 was coauthored by the candidate, Rajiv K. Tripathi, Bo-Sen Wu, Sarah MacPherson, Jaswinder Singh and Mark G. Lefsrud. In Chapter 3, the candidate with Rajiv K. Tripathi planned and designed the experiments. The candidate performed the experiments conducted in the greenhouses of the Plant Science Department and Biomass Lab of the Bioresource Engineering Department. Bo-Sen Wu provided technical assistance in preparing the LEDs and conducting the experiments. The candidate was responsible for analyzing and interpreting the data and writing the manuscript. The coauthor Sarah MacPherson provided critical review of the manuscript. The coauthor Jaswinder Singh served as the Ph.D. co-advisor and provided analytica tools and critical review of the manuscript. The coauthor Mark G. Lefsrud served as the Ph.D. advisor and provided critical review of the manuscript.

Chapter 4 was coauthored by the candidate and Mark G. Lefsrud. In Chapter 4, the candidate was responsible for experimental design, LC/MS/MS calibration and performance, conducted in the Biomass Lab of the Bioresource Engineering Department. The candidate was responsible for data collection, interpretation of data, analysis, and writing of the manuscript. The coauthor Mark G. Lefsrud served as the Ph.D. advisor through designing the experiments and provided critical review of the manuscript.

Chapter 5 was coauthored by the candidate and Mark G. Lefsrud. In Chapter 5, the candidate was responsible for experimental design and sample preparation in the Biomass Lab of the Bioresource Engineering Department. The experimentations were performed by the nano LC-MS/MS/MS on an Orbitrap Fusion Lumos mass spectrometer coupled to an Easy-nLC 1200 UPLC pump from IQ Proteomics company to perform the Tandem Mass Tags (TMT) based proteomics. The candidate was responsible for interpretation of data, analysis, and writing of the manuscript. The coauthor Mark G. Lefsrud served as the Ph.D. advisor and provided critical review of the manuscript.

4 Journal Papers

1. Nafiseh Yavari, Rajiv K. Tripathi, Bo-Sen Wu, Sarah MacPherson, Jaswinder Singh, & Mark G. Lefsrud (2020). The effect of light quality on plant physiology, photosynthetic, and stress response in Arabidopsis thaliana leaves. (under review).

2. Nafiseh Yavari, & Mark G. Lefsrud (2019). Proteomic analysis provides insights into Arabidopsis thaliana response under narrow-wavelength LED of 595 nm light. J Proteomics Bioinform 12:507 doi: 10.35248/0974-276X.19.12.507

3. Nafiseh Yavari, & Mark G. Lefsrud (2020). In-depth proteomic analysis of Arabidopsis thaliana response to narrow-wavelength lights reveals regulation of proteomic profiles controlling biological functions. (submitted).

5 Abstract

This research project aimed to elucidate the physiological and molecular basis of plant growth, photosynthesis and development under narrow-wavelength light of 450nm, 595nm, and 650nm. Arabidopsis accessions Col-0, Est-1 and C24 were treated to assess the mutual as well as specific interaction of light and genotype variations on plant response. The growth variables including leaf growth, biomass, pigments content, and net-photosynthetic-rate, by means of a series of physiological and biochemical experiments were evaluated. 650nm induced a significant increase in leaf growth, biomass and Pn across all accessions. At 450nm, growth and Pn were improved across all accessions, while biomass was reduced. There was a strong reduction in leaf growth and biomass of plants under 595nm, but Pn remained constant. The morphological changes included small-leaves with elongated-petioles. Plants further exhibited a significant upregulation of photosynthetic cyclic-electron-flow and antioxidant activity. Following the knowledge of 595nm influence on plant growth, MudPIT analysis was performed in which results indicated a great potential to mediate metabolic and photoprotective processes.

We sought to study the molecular processes involved in plant growth and development under the narrow-wavelength light. To gain an in-depth, systematic-proteomic view on induced-changes, we leveraged recent labeling-technique with tandem-mass-tags. We were able to quantify 16,707 proteins across the light conditions, representing >23% of the Arabidopsis proteome. This resource enabled us to examine changes in the proteome response of many low-expressed-proteomes with important regulatory roles including transcription-factors and hormone-signaling. Importantly, we found that 18% of Arabidopsis proteome show differential expression patterns in response to narrow-wavelength light. A large proportion, 34% of proteins, showed altered expression under 595nm, which primarily showed a significant stimulation for shade-avoidance-syndrome. Further analysis depicted overexpression of proteins associated with processes involved in cell-wall metabolism, photosystems light-harvesting, and auxin transport. Downstream analysis of 595nm responsive proteins presented important regulatory functions of phytochrome-interacting-factors family. Upon exposure to either 450nm or 650nm, plants showed an induction of proteins associated with salicylic-acid-induced-systemic-acquired-resistance response. This response was accompanied with the overexpression of resistance-related proteins including those involved in programmed-cell-death, senescence, and hypersensitive-response. Besides similar behavior of

6 SAR-like defense response, both wavelengths showed a selective regulation of the implicated mechanisms in their responses; 450nm mediated antioxidant and protective mechanisms linked to retrograde-signaling, resulted in remodeling of the plastid proteome. 650nm regulated a compensatory defense response attributed to an integration of phytohormones and antioxidants. Therefore, this resource provides an unprecedented view of the proteomic landscape of Arabidopsis and serves as a reliable resource for further characterization of light-specific molecular mechanisms in this dominant model organism.

7 Résumé

Ce projet de recherche visait à élucider les bases physiologiques et moléculaires de la croissance, de la photosynthèse et du développement des plantes sous une lumière à longueur d'onde étroite de 450nm, 595nm et 650nm. Les accessions d'Arabidopsis Col-0, Est-1 et C24 ont été traitées pour évaluer l'interaction mutuelle et spécifique des variations de lumière et de génotype sur la réponse des plantes. Les variables de croissance, y compris la croissance des feuilles, la biomasse, la teneur en pigments et le-taux-netde photosynthèse, au moyen d'une série d'expériences physiologiques et biochimiques ont été évaluées. 650nm ont induit une augmentation significative de la croissance foliaire, de la biomasse et du Pn dans toutes les accessions. À 450nm, la croissance et Pn ont été améliorées dans toutes les accessions, tandis que la biomasse a été réduite. Il y a eu une forte réduction de la croissance foliaire et de la biomasse des plantes de 595nm, mais Pn est resté constant. Les changements morphologiques comprenaient de petites feuilles à pétioles allongés. Les plantes présentaient en outre une régulation positive significative du flux cyclique d'électrons photosynthétiques et de l'activité antioxydante. Suite à la connaissance de l'influence de 595nm sur la croissance des plantes, une analyse MudPIT a été réalisée dans laquelle les résultats indiquaient un grand potentiel de médiation des processus métaboliques et photoprotecteurs. Nous avons cherché à étudier les processus moléculaires impliqués dans la croissance et le développement des plantes sous la lumière à longueur d'onde étroite. Pour obtenir une vue approfondie et systématique de la protéomique sur les changements induits, nous avons utilisé la technique d'étiquetage récente avec des étiquettes de masse en tandem. Nous avons pu quantifier 16,707 protéines dans les conditions lumineuses, representant >23% du protéome d'Arabidopsis. Cette ressource nous a permis d'examiner les changements dans la réponse protéomique de nombreux protéomes faiblement exprimés avec des rôles régulateurs importants, y compris les facteurs de transcription et la signalisation hormonale. Surtout, nous avons constaté que 18% du protéome d'Arabidopsis présentent des modèles d'expression différentielle en réponse à la lumière de longueur d'onde étroite. Une grande proportion, 34% des protéines, a montré une expression altérée sous 595nm, ce qui a principalement montré une stimulation significative du syndrome d'évitement de l'ombre. Une analyse plus approfondie a dépeint la surexpression des protéines associées aux processus impliqués dans le métabolisme de la paroi cellulaire, la récolte de lumière des systèmes photoélectriques et le transport de l'auxine. L'analyse en aval de protéines sensibles à 595nm a présenté des fonctions régulatrices importantes de la famille des facteurs d'interaction

8 phytochrome. Lors d'une exposition à 450nm ou 650nm, les plantes ont montré une induction de protéines associées à une réponse de résistance acquise systémique induite par l'acide salicylique. Cette réponse s'est accompagnée de la surexpression des protéines liées à la résistance, y compris celles impliquées dans la mort programmée des cellules, la sénescence et la réponse hypersensible. Outre le comportement similaire de la réponse de défense de type SAR, les deux longueurs d'onde ont montré une régulation sélective des mécanismes impliqués dans leurs réponses; Les mécanismes antioxydants et protecteurs médiés par 450nm liés à la signalisation rétrograde ont entraîné le remodelage du protéome plastidial. 650nm ont régulé une réponse de défense compensatoire attribuée à une intégration de phytohormones et d'antioxydants. Par conséquent, cette ressource offre une vue sans précédent du paysage protéomique d'Arabidopsis et sert de ressource fiable pour une caractérisation plus poussée des mécanismes moléculaires spécifiques de la lumière dans cet organisme modèle dominant.

9 Abbreviations

2-DE two-dimensional gel electrophoresis

3Chl* triplet chlorophyll Arabidopsis Arabidopsis thaliana AAC1 adp/atp carrier protein 1 ABA abscisic acid ABRC arabidopsis biological resource center Ac continuous narrow-wavelength 595 nm ANN1 annexin D1 APX ascorbate peroxidase ARF auxin response factors AsA-GSH ascorbate glutathione ATP adenosine triphosphate

ATPC1 γ-subunit of ATP synthase complex AUX/IAA auxin/ indole-3-acetic acid Bc continuous narrow-wavelength 450 nm bHLH basic helix‐loop‐helix BR brassinosteroid CaM calmodulin CAT catalase CAZy carbohydrate active enzymes CBB-cycle calvin–benson–bassham cycle CBP60g cam-binding protein 60-like G CCT C-terminal cryptochrome C-terminus CET cyclic electron transfer ChIP-Seq chromatin immunoprecipitation followed by deep sequencing Chl chlorophyll Chl a chlorophyll a Chl a:b chlorophyll a: chlorophyll b Chl b chlorophyll b CK cytokinin

10 Cry1 cryptochrome 1 Cry2 cryptochrome 2 CWPs cell wall proteins Cyt b6/f cytochrome b6/f DAPs differentially expressed proteins DIT2-1 dicarboxylate transporter 2.1 DM dry mass ENO2 enolase 2/transcriptional activator ET ethylene FAD flavin adenine dinucleotide FAD6 fatty acid desaturase 6 Fd ferredoxin FDR false discovery rate FKF1 flavin-binding, kelch repeat, f-box1 FL fluorescent FNR fd: NADP+ reductase FQR ferredoxin‐plastoquinone reductase GA gibberellin GABA gamma-aminobutyric acid

GAD2 glutamate decarboxylase 2 GEO NCBI gene expression omnibus GO gene ontology GPX glutathione peroxidase GR glutathione reductase GSEA gene set enrichment analysis GSH glutathione GWAS genome wide association studies HPLC high-performance liquid chromatography HPS high-pressure sodium HY5 long hyphotyl5 IR infra-red

11 JA jasmonic acid KEGG kyoto encyclopedia of genes and genomes LC-MS liquid chromatography–mass spectrometry LEDs light-emitting diodes LET linear electron transfer LHC light harvesting chlorophyll LKP2 LOV kelch protein 2

Mn4CaO5 tetra-manganese calcium penta-oxygenic MudPIT multi-dimensional protein identification technology N:C nitrogen to carbon

NADP+ nicotinamide adenine dinucleotide phosphate NADPH nicotinamide adenine dinucleotide phosphate hydrogen NDH NAD(P)H dehydrogenase NIR1 ferredoxin-nitrite reductase NO nitric oxide NPQ non-photochemical quenching NPR1 non-race-specific disease resistance 1 NSAF normalized spectral abundance factor OEC oxygen-evolving complex PAD4 phytoalexin deficient 4 PAR photosynthetically active radiation PC plastocyanin Pchlide protochlorophyllide PGR5 proton gradient regulation 5 PGRL1 PGR5‐ like photosynthetic phenotype 1 Phot1 phototropin1 Phot2 phototropin2 PhyA phytochrome A PhyB phytochrome B phyE phytochrome E PIFs phytochrome-interacting factors

12 PME3 pectinesterase/pectinesterase inhibitor 3 Pn net photosynthetic rate PPFD photosynthetic photon flux density PPI protein-protein interactions PQ plastoquinone PQH2 plastoquinol PR pathogenesis-related PrxIIE peroxiredoxin-2E PSI photosystem I PSII photosystem II PSM peptide sequence matching R:FR red:far-red RBCS1A ribulose bisphosphate carboxylase small chain RC reaction center Rc continuous narrow-wavelength 650 nm ROS reactive oxygen species Rubisco ribulose‐1, 5‐bisphosphate carboxylase/oxygenase SA salicylic acid SAR systemic acquired resistance SARD1 SAR deficient 1 SAS shade avoidance syndrome SCX strong cation exchange SEPro search engine processor SOD superoxide dismutase TFs transcription factors TMT tandem mass tags TPI triosephosphate isomerase Trx fd-thioredoxin UV ultraviolet VDE violaxanthin de-epoxidase XTHs xyloglucan endotransglucosylase / hydrolases

13 Table of Contents Abstract ...... 6

Résumé ...... 8

Abbreviations ...... 10

1. Chapter 1: General Introduction ...... 23

1.1 Background ...... 23

1.2 Statement of Research Objectives ...... 28

1.3 Choice of Methodology ...... 31

1.4 Organization of Thesis ...... 33

2. Chapter 2: Literature Review ...... 34

2.1 Role of Light throughout the Plant Life ...... 34 2.1.1 Light Wavelengths ...... 34 2.1.1.1 Blue Light ...... 34 2.1.1.2 Amber Light ...... 35 2.1.1.3 Red Light ...... 36

2.2 Chloroplast Structure ...... 43 2.2.1 Thylakoid Membrane ...... 43 2.2.1.1 Stroma ...... 43 2.2.1.2 Lumen ...... 44 2.2.2 Photosynthetic Complexes ...... 44 2.2.2.1 Photosystem II ...... 44 2.2.2.2 Photosystem I ...... 44 2.2.2.3 Cytochrome b6f ...... 45 2.2.2.4 ATP Synthase...... 45

2.3 Plant Light Response ...... 45 2.3.1 Photosynthesis...... 45 2.3.1.1 Photosynthetic Electron Transport ...... 47 2.3.1.1.1 Linear Electron Transport ...... 48

14 2.3.1.1.2 Cyclic Electron Transport ...... 48 2.3.2 Shade Avoidance Response ...... 49 2.3.3 Stress Response ...... 51 2.3.3.1 Photoprotection ...... 51 2.3.3.1.1 ROS Generation and Scavenging...... 52 2.3.3.1.2 Non-photochemical Quenching ...... 52 2.3.3.1.3 PSII Photoinhibition...... 53 2.3.4 Systemic Acquired Resistance ...... 54

2.4 Arabidopsis as a Model Plant ...... 54 2.4.1 Natural Variation as a Key Tool in Plant Light Biology ...... 55

2.5 Plant System Biology ...... 55 2.5.1 From Plant Phenotype, Mass Production and Photosynthesis to Tolerance Responses ...... 56 2.5.1.1 Evaluating Narrow-Wavelengths for Plant Growth and Photosynthetic Performance ...... 56 2.5.1.1.1 Morphology...... 56 2.5.1.1.2 Yield and Photosynthesis ...... 57 2.5.1.1.3 Primary and Secondary Metabolites ...... 58 2.5.1.2 Evaluating Narrow-Wavelengths for Plant Thylakoid Membrane Gene Regulation ...... 58 2.5.1.3 Evaluating Narrow-Wavelengths for Plant Proteins Expression Pattern ...... 59

3. Chapter 3: The effect of light quality on plant physiology, photosynthetic, and stress response in Arabidopsis thaliana leaves ...... 63

3.1 Abstract ...... 63

3.2 Introduction ...... 64

3.3 Materials and methods ...... 66 3.3.1 Plant Materials and Growth Condition ...... 66 3.3.1.1 Lighting Treatment ...... 67 3.3.2 Physical and Biochemical Analyses ...... 67

15 3.3.2.1 Leaf Area Determination ...... 67 3.3.2.2 Biomass Content Determination ...... 68 3.3.2.3 Pigment Content Determination ...... 68 3.3.3 Gas Exchange Determination ...... 68 3.3.4 Photosynthate Content Determination ...... 69 3.3.4.1 Protein ...... 69 3.3.4.2 Starch ...... 70 3.3.4.3 Lipid ...... 70

3.3.5 Antioxidative Enzyme Activity Determination ...... 71 3.3.6 Gene Transcription Analysis...... 71 3.3.6.1 cDNA Synthesis ...... 71 3.3.6.2 Primer Design ...... 72 3.3.6.3 Quantitative Real Time-PCR (qRT-PCR) Analysis ...... 73 3.3.6.4 Data Analysis ...... 73 3.3.6.5 Statistical Analysis ...... 73

3.4 Results ...... 74 3.4.1 Effect of light quality and natural genotype variation on A. thaliana leaf area and biomass accumulation ...... 74 3.4.2 Impact of light quality and natural genotype variation on A. thaliana leaf gas exchange and pigments content ...... 75 3.4.3 Changes in the transcription of marker genes associated with light-responsive photosynthetic process in A. thaliana Col-0 under AL and RL ...... 77 3.4.4. Regulation patterns of PSBA, NPQ1, GSH2 and FAD6 transcripts in A. thaliana Col- 0 under AL and RL ...... 80 3.4.5 Photosynthate contents in A. thaliana Col-0 under AL and RL ...... 80 3.4.6 Antioxidative enzyme activity in A. thaliana Col-0 under AL and RL ...... 81

3.5 Discussion ...... 82 3.5.1. Importance of genotype impact on light quality response of leaf growth and biomass ...... 82 3.5.2. Findings on BL supports its role on activation of protective pigments ...... 82

16 3.5.3. Plants showed high antioxidative and photo-protective under AL ...... 83 3.5.4. RL showed a high regulatory role on plant adaptation and energy assimilation ...... 85

3.6. Conclusion ...... 85

4. Chapter 4: Proteomic analysis provides insights into Arabidopsis thaliana response under narrow-wavelength LED of 595 nm ...... 88

4.1 Abstract ...... 88

4.2 Introduction ...... 88

4.3 Materials and Methods ...... 90 4.3.1 Plant Material and Growth Conditions ...... 90 4.3.1.1 Light Treatments ...... 91 4.3.2 Protein Extraction and Digestion ...... 91 4.3.3 Quantitative Proteomics using LC-MS/MS ...... 92 4.3.3.1 Protein Identification and Quantification...... 93 4.3.4 Function Annotation and Classification of the DAPs ...... 94

4.4 Results ...... 94 4.4.1 Growth Response of Arabidopsis Col-0 to 595 nm ...... 94 4.4.2 The proteomics prospect in Arabidopsis Col-0 response to 595 nm narrow- wavelength ...... 95 4.4.3 Functional Annotation of the DAPs ...... 98 4.4.4 Molecular Network Involved in Arabidopsis Col-0 in Response to 595 nm ...... 99

4.5 Discussion ...... 101 4.5.1 Proteins Involved in Photosynthesis ...... 102 4.5.2 Proteins Involved in Carbohydrate Metabolism ...... 102 4.5.3 Proteins Involved in Amino Acid Metabolism ...... 103 4.5.4 Proteins Involved in Lipid Metabolism and Transport ...... 104 4.5.5 Proteins Involved in Cell Wall Modification ...... 104 4.5.6 Proteins Involved in Protein Synthesis, Folding and Degradation ...... 105 4.5.7 Proteins Involved in ROS Signaling ...... 105 4.5.8 Proteins Involved in Redox Signaling ...... 106

17 4.6 Conclusion ...... 106

5. Chapter 5: In-depth proteomic analysis of Arabidopsis thaliana response to narrow- wavelength lights reveals regulation of proteomic profiles controlling biological functions .... 109

5.1 Abstract ...... 109

5.2 Introduction ...... 109

5.3 Materials and Method ...... 112 5.3.1 Plant Material and Growth Conditions ...... 112 5.3.1.1 Light Treatments ...... 113 5.3.2 Protein Extraction and Digestion ...... 114 5.3.3 TMT Labeling ...... 114 5.3.4 LC-MS/MS/MS...... 115 5.3.5 Quantification of Protein Concentrations using the total Protein Approach ...... 115 5.3.6 Assessment of Coverage for select Biological Pathways and Comparisons with Published Datasets ...... 116 5.3.7 Identification of Differentially Expressed Proteins ...... 117 5.3.8 Cluster Analysis ...... 118 5.3.9 Overlap Analysis ...... 118 5.3.10 Salicylic acid (SA)-induced transcriptome data ...... 118 5.3.11 Gene Ontology (GO)...... 118 5.3.12 Network Analysis...... 118

5.4 Result ...... 119 5.4.1 A. thaliana responses to narrow-wavelengths depict differential morphological appearance...... 119 5.4.2 A. thaliana responses to narrow-wavelengths demonstrate the in-depth proteome remodeling ...... 119 5.4.3 Comparative analysis reveals wavelength-specific proteomic remodeling at large scale ...... 121 5.4.4 Shade Avoidance Syndrome (SAS) is active under A compared to B and R light conditions ...... 126 5.4.5 Systemic Acquired Resistance (SAR) is active under B and R light conditions ...... 130

18 5.4.6 Chloroplast proteome remodeling under B compared to A and R light conditions... 133 5.4.7 High energy provision under R and A compared to B light conditions ...... 134 5.4.8 Stimulation of plant defense response under R compared to A and B light conditions ...... 134

5.5 Discussion ...... 135

5.6 Conclusion ...... 140

6. General Summary ...... 142

6.1 General Conclusion ...... 142

6.2 Contributions to Knowledge ...... 144

6.3 Future Direction ...... 146

7. References ...... 148

8. Appendix A ...... 176

9. Appendix B ...... 181

10. Appendix C ...... 184

11. Appendix D ...... 235

19 List of Figures Figure 2. 1. The active light spectrum and plant photosynthetic action absorption spectra of light- absorbing antennal pigments...... 39

Figure 2. 2. Photoreceptors and their structure in higher plants...... 42

Figure 2. 3. The light reactions of photosynthesis occurring in the chloroplast’s thylakoid membrane...... 47

Figure 2. 4. Simplified scheme of the photosynthetic linear and cyclic electron transfer routes in Arabidopsis thylakoid membranes...... 49

Figure 2. 5. A systematic depiction of general workflow for proteomic analysis...... 61

Figure 3. 1. Flow diagram of study design...... 67

Figure 3. 2. Effect of BL, AL, and RL on the morphology of A. thaliana accessions...... 74

Figure 3. 3. Effect of BL, AL and RL on leaf area, biomass, and Pn of A. thaliana accessions. . 75

Figure 3. 4. A schematic model of light-responsive photosynthetic process and effect of AL and RL on transcription of selected genes in Arabidopsis Col-0...... 78

Figure 3. 5. Proteins involved in ATPsynthase and CET complex of A. thaliana Col-0 are upregulated under AL (595 nm) compared to RL (650 nm)...... 79

Figure 3. 6. Effect of AL and RL on photosynthate accumulation in Arabidopsis Col-0...... 80

Figure 3. 7. Effect of AL and RL on SOD and APX activity in Arabidopsis Col-0...... 81

Figure 4. 1. Growth response and comparative proteomic analysis of Arabidopsis Col-0 to light wavelength 595 nm...... 95

Figure 4. 2. Top enriched GO terms of DAPs in Arabidopsis Col-0 response to 595 nm...... 99

20 Figure 5. 1. MA-plot of the nine samples...... 117

Figure 5. 2. Comparing the proteome coverage of this study with the transcriptome datasets on A. thaliana...... 120

Figure 5. 3. Principal component analysis (PCA) and heatmap of the diﬀerentially expressed proteins in Arabidopsis response to B, A, and R light conditions...... 122

Figure 5. 4. A high coverage map of proteomic response of A. thaliana to 450 nm (B), 595 nm (A), or 650 nm (R) narrow-wavelengths...... 124

Figure 5. 5. Expression patterns of DE proteins reveal the molecular processes induced by specific narrow-wavelengths...... 125

Figure 5. 6. A network map of the significantly enriched GO biological processes in narrow- wavelength responsive protein clusters...... 128

Figure 5. 7. Activity of SAS response under different narrow-wavelength light conditions. .... 130

Figure 5. 8. Network of hub proteins from the five clusters of DE proteins...... 129

Figure 5. 9. SAR show light specific responses in A. thaliana plants...... 132

Figure 5. 10. SAS and SAR demonstrate wavelength specific responses in A. thaliana plants. 135

21 List of Tables Table 3. 1. Origin of the three accessions of Arabidopsis used in this study...... 66

Table 3. 2. List of primers sequences used in qPCR experiments...... 73

Table 3. 3. Effect of BL, AL and RL on pigments content of A. thaliana accessions...... 76

Table 3. 4. Summary of the two-way ANOVA analysis performed on A. thaliana accessions and effects on the determined parameters...... 77

Table 4. 1. The list of DAPs in Arabidopsis Col-0 response to 595 nm...... 96

Table 4. 2. The KEGG pathways enriched by DAPs in Arabidopsis Col-0 response to 595 nm...... 100

Table 4. 3. Protein‑protein interaction (PPI) network of DAPs in Arabidopsis Col-0 response to 595 nm...... 101

Table 5. 1. Coverage comparison of the TMT method in our proteomics dataset to the other published data sets using label-free or labeling methods...... 116

Table 5. 2. KEGG pathway coverage...... 123

22 1. Chapter 1: General Introduction

Chapter 1 provides the background information and the rationale that has led to the development of this research. The hypothesis and the objectives of this research are stated below, while a description of the organization of this thesis can be found at the end of this chapter.

1.1 Background Plant growth and development involves complex signaling networks which are tightly regulated by genetic and environmental factors such as the intensity and quality of irradiance, water, nutrient availability, and temperature. Among these factors, light is an absolute requirement for plant growth and development (Smith 2000). In nature, the light environment of plants is largely determined by the visible region of the sun light’s wavelength range and various amount of photon that each wavelength emits. Green plants convert the sunlight energy into chemical energy via the process of photosynthesis to synthesize carbohydrates (Zhu, Long et al. 2008). The assimilated carbohydrates are subsequently processed further into numerous other biochemical building blocks (Ragauskas, Williams et al. 2006). The energy provided by light is employed to elicit plants' photomorphogenesis, metabolism, genes and proteins expression, and other physiological responses (Dueck, van Ieperen et al. 2016). Significant attention has thus focused on the role of light energy on plant cultivation systems.

Light spectral quality provides rich informational clues about the plant environment that individually and/or in combination can have a remarkable influence on plant from growth to flower formation (Johkan, Shoji et al. 2012). Neighboring plants or changing weather can alter the composition of the natural light wavelengths (Ballaré, Mazza et al. 2012). Plant shading, for example, can result in a lack of blue and red light spectra, two of the most important wavelengths for plant photosynthesis (Niinemets 2010). The opposite effect will occur when shaded leaves are exposed to full sunlight for example after gap formation in a canopy, or for evergreens when neighboring deciduous trees lose their leaves (Fitter and Hay 2012). Photosystem II (PSII) and photosystem I (PSI) have different absorption spectra (Croce and Van Amerongen 2014). Therefore, as spectral properties of the two photosystems differ, exposure of plants to different light wavelengths can induce uneven energy excitation between the two photosystems that needs to adjust to the energy level of photosystems photochemical reactions demand through state

23 transition and stoichiomery adjustment (Ruban 2015). In cases where plants fail to adjust, and the light energy absorbed by leaves pigments exceeds its utilization for photosynthesis reaction, harmful reactive intermediates, mainly reactive oxygen species (ROS) can be generated (Saini, Gani et al. 2018). Generation of ROS will result in oxidative damage, leading to photosystems photoinhibition that can strongly limit plant growth and production (Nishiyama, Allakhverdiev et al. 2011). Understanding the molecular mechanisms underlying how plants maintain balanced growth, photosynthesis and developmental process with changes in light wavelengths are thus of particular interest to agricultural scientists for plant/crop production.

In controlled agriculture, using spectral lighting system has been common practice to ease the negative environmental impacts and/or compensate the daylight fluctuations (Castilla 2013, Hanley, Shogren et al. 2016). A variety of protected cultivation systems such as greenhouses, glasshouses, growth rooms, and chambers are broadly used in modern agriculture and are supplied with electrical light for up to 16–20 h per day and even continuous 24 h lighting (Hanan 2017). Traditional light sources such as high-pressure sodium (HPS) lamps, fluorescent (FL), and incandescent lamps are the usual supplemental light sources used in cultivation (Yeh and Chung 2009). However, the use of conventional lighting systems with a broad spectrum of wavelengths may generate excessive heat and undesirable effects on plant growth and development (Mitchell, Both et al. 2012). The development of light source technologies has opened up new perspectives for highly efficient light sources in the form of light-emitting diodes (LEDs), which are increasingly becoming the light source of choice for controlled plant production systems (Olle and Viršile 2013). LEDs are the next-generation lighting source, because of their significant advantages on energy efficiency, compactness, durability, long lifetime, zero mercury, low CO2 footprint, and low heat emissions (Nelson and Bugbee 2014). LEDs can provide precise delivery of photons in a crop canopy and provide an option for energy efficient sole or supplemental electrical lighting in greenhouses or plant factories (White, Andrade-Sanchez et al. 2012). Agricultural lighting with special consideration of LED lights can be a crucial factor in efficient plant production systems and guarantee the environmental control in plant growth environments.

Technological developments in electrical lighting has enabled the realization of growth environments far beyond what plants would ever experience in their natural environment (Dueck,

24 van Ieperen et al. 2016). In nature the sun-light consists of a broad spectrum, whereas in controlled cultivation, supplementary light is provided by growth-lamps, which differ in the emitting spectra and thus are different than the natural daylight spectra (Hogewoning, Douwstra et al. 2010). Plants have a specialized light-sensing system, the photoreceptors, which posses specific absorption spectrum to stimulate the signaling network and influence plant growth and development (Olle and Viršile 2013). Each of the plant photoreceptors are specialized to absorb a specific range of wavelengths of light. Therefore, as photoreceptors induce a wide-range of changes in molecular processes by modulating signaling pathways, the irradiance emitted from lighting systems can thereby regulate specific biological processes in plant growth and development (Gupta and Pradhan 2017). In spite of the early discovery on the importance of light wavelengths on plant growth and the type of interactions and nature between photoreceptors and plant responses, the effects of many wavelengths on plant are still not yet well understood. Evidence of this can be found in the existing contradictory knowledge of the importance of wavelengths in the range of 500–600 nm on plant growth, photosynthetic performance and development. Lighting wavelength research has resulted in a worldwide interest of plant scientists and horticulturists for more detailed studies to understand the plants physiology, regulatory mechanisms, genes and proteins expression in response to the light wavelengths.

It has been more than 50 years since Arabidopsis thaliana was first introduced as a model organism to understand basic processes in plant biology (Provart, Alonso et al. 2016). Arabidopsis has a relatively small genome size (135 Mbp) with 39,362 loci, including 27,000 protein-coding genes dispersed among five chromosomes and low repetitive content (10%) (Initiative 2000, Cheng, Krishnakumar et al. 2017). Arabidopsis is a flowering plant with a short but complex life cycle. These features make it an ideal organism for laboratory research. Research on Arabidopsis has resulted in numerous fundamental discoveries on plant biology. Arabidopsis has been applied in several of the most comprehensive studies using differential-relative and absolute-quantitative strategies to enhance genome annotation, organelles/sub-cellular proteomes, and investigate developmental processes and responses to biotic and abiotic stresses (Consortium, Doherty et al. 2019). Many findings from Arabidopsis have been successfully replicated in other plants. For example, hormones often function similarly across plant species, and the receptors and signaling pathways of almost all plant hormones have been elucidated in Arabidopsis (Provart, Alonso et al.

25 2016). Research using Arabidopsis has greatly expanded our knowledge about plants, the organisms that provide most human nutrition and revealed key, common processes in diverse organisms beyond plants.

Proteomics, which is defined as the quantitative and exhaustive analysis of proteins expressed in a given organ, tissue, or cell, is becoming a more powerful and indispensable technology in the study of biological systems (Altelaar, Munoz et al. 2013). The availability of the entire genomic sequence of Arabidopsis makes it unique for use in a post-genomic studies such as proteomics in its full capacity (Vaudel, Verheggen et al. 2016). In addition, over the last decade, remarkable technological advances have been achieved due to improvements in mass spectrometry, which have allowed for refining the coverage of total proteomes and sub-proteomes from small amounts of starting material and characterizing post-translational modifications and protein–protein interactions. Proteome analysis has proven to be an effective tool for understanding the physiological processes involving the regulation of expression of many genes from transcription to synthesis of proteins, and consequently the production of metabolites (Voelckel, Gruenheit et al. 2017, Rajjou, Gallardo et al. 2018). Each of these steps is part of the overall mechanisms that are tightly coordinated to allow plants to develop and/or adapt to their environment. Furthermore, quantitative proteomics now provide detailed information on plant- specific molecular mechanisms responding to major signaling and biochemical pathways underlying plant interaction with the environment and stress responses (Patole and Bindschedler 2019, Rey, Valledor et al. 2019). For example, as ROS are highly toxic, reactive, and extremely short-lived, quantifying their activity and accumulation can be done by measuring proteins, as the major target of ROS oxidization, using sensitive, robust, and sophisticated techniques such as proteomics. Proteomic approaches are thus helpful for answering questions on protein function, involved in catalyzing metabolic reactions (Buchanan, Gruissem et al. 2015).

Development of computational tools has further allowed for the management of tremendous amounts of data generated by mass spectrometers to deliver relevant biological information (Smith, Mathis et al. 2014). Major effective and efficient approaches to analyze omics data are pathway analysis and protein interaction networks (Ramanan, Shen et al. 2012, Carter, Hofree et al. 2013). Enrichment analysis approaches combined with pathway analysis make a great contribution to evaluate expression patterns of particular molecular groups related to plant

26 responses (Chen, Huang et al. 2017). The protein network typically represents a physical-, genetic- , and/or functional- interactions among biological and biochemical components (Kanehisa, Sato et al. 2016). Further, interaction-based approaches have key roles to construct and analyze biological networks from omics data (Toubiana, Fernie et al. 2013, Whyburn 2015). Additionally, the network visualization tools can be used to manage and visualize network data corresponding to the type of interaction (Shannon, Markiel et al. 2003, Montojo, Zuberi et al. 2010). Therefore, bioinformatics are powerful tools for analyzing the functions of the plant genes or/and proteins to better understand the various functional aspects in plants responses.

In this research, Arabidopsis was used for biological, biochemical, physiological, and proteomic approaches to gain new insight from a well-annotated model system. To assess whether wavelength-induced changes in plants performance are genotype-specific, the mutual as well as specific effects of lights and genotype variations were assessed on three accessions Col-0, Est-1, and C24, while treated under the three narrow-wavelength LEDs of 450 nm, 595 nm, 650 nm. A strong emphasis was put on the physiological and regulatory processes underlying plant photosynthetic performance because of its complex relationship with plant yield. The activity of antioxidant enzymes involved in chloroplast protective mechanisms, in combination with expression level analysis of genes associated with the photosynthetic light reaction, was carried out to better understand the effect of wavelength on plant responses. Moreover, the two quantitative proteomic methods, including label-free Multi-Dimensional Protein Identification Technology (MudPIT) and isobaric labeling Tandem Mass Tags (TMT), were used to enhance the separation and evaluation of proteins from crude tissue extracts to further analyze the molecular mechanisms underlying plant responses. We used bioinformatics tools to analyze the collected data on differential protein expression to capture the specific responses of plants to light wavelength.

In this dissertation, we investigated the interaction in plant response between incident light and natural variation on growth and photosynthetic performance of Arabidopsis, in terms of leaf area growth, biomass content, pigments content, and net photosynthetic rate (Pn), by means of a series of physiological and biochemical experimental methods. We further demonstrated that the light wavelengths, providing the regulatory mechanisms, contributed to the complex linkage of

27 plant growth and development accompanied with stress response. The diversity and complexity of biological samples required effective techniques to identify the differentially expressed proteins and their roles in the wavelength-specific morphological responses of plants to the incident light. Given enrichment analysis approaches, in combination with pathway analysis that involves the associated biochemical pathway, we investigated the particular molecular processes that are up or down regulated in response to a specific narrow-wavelength light. A series of approaches, including protein network analysis and network visualization tools, were used to elucidate the proteins that play key roles in plant light-specific responses and visualize the underlying molecular network involved in plant response to light wavelength. Throughout the study, we highlighted the importance of narrow wavelengths effects on plant growth and developmental processes integrated with stress tolerance.

1.2 Statement of Research Objectives Plants are a paramount source of food, energy, and valuable compounds. The limitless range of light spectral compositions and changes in spectrum of the agricultural environments make a comprehensive understanding of plant responses to specific spectral lights a challenging task. There is therefore a need to study plants under controlled conditions using recent LED technologies that limit the wavelength to a narrow range. It is important to understand how plant cells, as omplex systems, respond to specific light-wavelengths by identifying the proteins and molecular processes that are involved in this response and their wiring and connections to one another. The developing field of plant systems biology has provided outstanding insights into the mechanisms driven by the cellular systems (Weckwerth 2011). Preliminary investigations indicated that two narrow-wavelengths of 450 nm, and 650 nm can strongly influence plant physiology, and mediate the expression of key regulatory proteins involved in various metabolic pathways associated with plant growth and development including photosynthesis (Demotes- Mainard, Péron et al. 2016, Huché-Thélier, Crespel et al. 2016), stress response (Waszczak, Carmody et al. 2018) and hormone signaling (Chen, Xu et al. 2013, Consentino, Lambert et al. 2015, Ahmad 2016, El-Esawi, Arthaut et al. 2017). Further experiments and analyses showed that these narrow-wavelengths induce stress signals that fuel the reactions of secondary metabolites (Hasan, Bashir et al. 2017). Although changes in plant physiology in response to these two light wavelengths are well documented, the underlying molecular mechanisms remain elusive. This

28 opens questions about the full complexity of the proteome that allow plants to develop appropriate responses. For example, growing research has highlighted the physiological impact of 595 nm on plants growth and photosynthesis (Wang, Gu et al. 2009, Yang, Wang et al. 2012, Wu, Su et al. 2014). 595 nm has shown a high regulatory role on the abundance and activity of key proteins to mediate higher adaptation efficiency and tolerance in plants (Yu, Liu et al. 2017). Thus, 595 nm can regulate an integrated molecular network at multiple levels to bring about tolerance responses. Despite being a probable light source to understand regulatory signals in plant growth and development, the molecular mechanisms underlying the effect of light wavelength 595 nm remains unclear. It is therefore of interest to evaluate the potential of the narrow-wavelengths effects on molecular mechanisms underlying the plant response. It has been hypothesized that various morphological behaviors, accompanied with different adaptation efficiency in terms of light adaptation and tolerance responses, will result from the three narrow-wavelengths 450 nm, 595 nm, and 650 nm. Through the comprehensive measure and evaluation of responsive genes, proteins, and metabolites of plants, the molecular components of their responses could be identified and explained. Proteomic methods would further be a valuable tool to monitor and evaluate how the light wavelengths could affect plant cellular mechanisms and developmental processes to enhance our understanding of plant tolerance. Overall, the subjects covered in this thesis focus on the growth, photosynthetic and developmental biosystems in plants response to the three narrow-wavelengths of 450 nm, 595 nm and 650 nm provided by LEDs.

The objectives of this research are therefore as follows: • Objective 1: Determine the effects of lights and Arabidopsis plant natural variations on modulating plant growth and photosynthetic performance, using the three Arabidopsis laboratory accessions Col-0, Est-1, and C24 that were grown under three narrow-wavelengths of 450 nm, 595 nm and 650 nm provided by LEDs.

• Measure and compare plant growth related parameters (leaf area expansion rate, wet/dry biomass) between the three accessions and under the three narrow-wavelengths.

29 • Perform a series of experiments to test changes in plant photosynthesis as a proxy for its photosynthesis rate inside the growth chamber in response to the three narrow-wavelengths treatments using photosynthesis system (LI-COR).

• Measure and analyze plant leaf pigments, photosynthetic (chlorophyll and carotenoid), and non-photosynthetic pigment (anthocyanin), photosynthates (proteins, starch, lipids) and analyze the findings to assess the plant photosynthetic-generated energy.

• Carry out a series of biochemical measurement of enzymes activity and transcriptional level analyze to determine if the plant photosynthetic performance was affected by the risk of reactive oxygen species (ROS) generation.

• Objective 2: Investigate the changes in expression pattern of proteins corresponding to the underlying growth and developmental processes in Arabidopsis while treated under the narrow-wavelength 595 nm.

• Carry out a shotgun proteomics methodology, known as MudPIT, to detect differentially expressed proteins (DEPs) between the leaves of plants under 595 nm and FL, as the control.

• Perform a functional enrichment analysis of the DEPs to decipher the involved physiological processes in the plant response to 595 nm.

• Construct a protein interaction network from the DEPs to identify the key proteins involved in the plant response under 595 nm.

• Objective 3: Investigate wavelength-specific molecular responses of Arabidopsis and their association with the plant morphology.

30 • Carry out a TMT-based isobaric labeling technique to quantify relative protein expression patterns with the three biologically distinct rosettes samples of plants treated under 595nm, 650nm, and 450nm lights.

• Employ linear regression models to identify differentially expressed proteins (DEPs) at Benjamini-Hochberg corrected p-value <0.1.

• Carry out enrichment analyses of the DEPs to gain a systems level view on the processes that are involved in the wavelength-specific light response.

• Compare and contrast results from the analysis of DEPs with multiple available transcriptome datasets to confirm and expand the systems-level view of involved molecular processes.

• Carry out a series of computational analyses to construct and visualize a functional network underlying the wavelength-specific response of Arabidopsis.

1.3 Choice of Methodology Earlier work has utilized the classical genetic and molecular approaches such as the use of light-signaling deficient mutants, measurement of enzyme activities and enzyme/metabolite levels of certain pathway(s). There have been some studies that focused on the impact of wavelengths on plants. However, they typically used a relatively broad spectrum of light wavelengths in their study and mostly focused only on the changes induced at the plant morphology level. The molecular- based studies have been focused on a small set of pre-selected pathways or employed transcriptomics assay to measure transcripts as a proxy for the changes in the proteins in the cells. The light wavelengths are likely to affect the plant physiology by modulating several metabolic effectors and signaling cascades at almost all levels of cellular hierarchy (Lister, Gregory et al. 2009, Hirayama and Shinozaki 2010). Accordingly, plant biologists in the modern genomic era have adopted the transcriptomics technologies especially in a model plant, Arabidopsis. The genome-wide transcript profiling has been most widely exploited, highlighting several noticeable traits including the massive reprogramming of coordinated transcriptional regulation among

31 several cellular pathways in certain light wavelengths (Liang, Cheng et al. 2016), and critical role of light receptors for the cell stress signals under 450 nm and 650 nm (Chen, Xu et al. 2013) and mediating the regulation of plant development and defense (El-Esawi, Arthaut et al. 2017). However, the proteins rather than the transcripts are the main work force in the cells. Lack of correlation between transcripts and protein concentration in organisms’ cells, due to the different life-times of the molecules (Vogel and Marcotte 2012), stress the importance of understanding the light-mediated signaling mechanisms using large-scale proteomic methods. Therefore, a systematic interrogation of plant proteomic response to specific narrow-wavelength is required to understand how specific lights modulate molecular pathways in the plant cells. Moreover, until recently, nearly all studies have focused on a specific set of pre-selected genes pathways or based on low-coverage microarray chips and proteomics methods. These collective studies highlight the need to develop a more systematic assay for understanding plant light responses. Moreover, although the induced changes at the proteome level have been previously studied using low coverage proteomics assay for both range of 430–450 nm and 640–660 wavelengths, there is currently no knowledge on plant proteomics response treated under the wavelength of 595 nm. Therefore, the resource generated by our work provides an unprecedented view on the wavelength- specific changes in plant cells at the proteome level.

To this end, herein we employ a systems biology approach to characterize molecular processes involved in the wavelength-specific response of Arabidopsis and combine it with the available omics data sets to gain better knowledge on the molecular processes underlying plant growth, photosynthesis and developmental responses into three narrow-wavelengths of light. Given the complex genetic interactions and the evolution of morphological traits such as those underlying the plant’s responses to its environment, the mutual effect of light and natural variation was assessed at first. A set of physical and biochemical analyses have been consequently carried out to monitor plant growth and photosynthetic performance. Transcript analysis of candidate genes involved in photosynthetic light reaction and chloroplast photoprotection was conducted to determine if the plant photosynthetic performance was affected by the risk of reactive oxygen species (ROS) generation. Complexity and high dynamic abundance of proteins samples do not allow the analysis of all proteins, the proteomics techniques including shotgun proteomics and TMT labeling therefore seem appropriate for use in this research project. The fundamental

32 mechanisms underlying the plant response resolved through follow-up computational experiments to evaluate cellular behaviors from a multi-level perspective.

1.4 Organization of Thesis This dissertation consists of seven chapters, references and appendices. Chapter 1, the introduction, provides research background, rationale, the hypothesis and objectives. Chapter 2, the literature review, provides brief discussion on the subject matters involved in this research. Chapters 3, 4 and 5 each present the research and experiments conducted to reach the stated objectives. Between Chapters 3, 4 and 5 connecting texts provide the transition and rationale between each experiment. Appendix A provides the ProLuCID search.xml used to verify the peptide sequence matching (PSM) for Chapter 4. Appendix B provides the workflow of the PatternLab program involved in data analysis for Chapter 4. Appendix C provides the list of proteins and their spectral count across the two top samples in the PatternLab for Proteomics search used for analysis of 595 nm and FL grown plants. Appendix D provides the report of the clustered proteins and GO terms related to the raw data obtained from TMT technology for Chapter 5. Due to the expanded codes, we only report the main lines of the codes.

33 2. Chapter 2: Literature Review

2.1 Role of Light throughout the Plant Life Sunlight is a collection of electromagnetic waves, which are the major energy source for plants. Besides being an energy source, light signals can regulate changes in all features of plants to regulate optimal growth and development. After germination in the soil, etiolated growth enables the germinated seeds to grow toward the soil surface in search of light. Upon exposure to light, the plant undergoes photomorphogenesis characterized by de-etiolation, leaf expansion, shade avoidance limitation, stem elongation avoidance, pigment synthesis and development of chloroplast, all of which enable the plant to establish itself as an independent autotroph (Jiao, Lau et al. 2007, Lau and Deng 2010).

2.1.1 Light Wavelengths Light wavelengths can have a remarkable influence on growth, morphology, and phytochemical composition of plants. In the visible light spectrum (~400–700 nm), the major wavelengths correspond to blue (400–500 nm) and red (600–700 nm) and, to a lesser extent, green (500–600 nm) (Figure 2.1A) (Pocock 2015). The two wavelengths blue and red are absorbed mainly by photosynthetic pigments, chlorophyll a (Chla), chlorophyll b (Chlb) and carotenoids (Lodish, Berk et al. 2000). Chla and Chlb absorb strongly in the red (maximum absorption at 663 and 642 nm, respectively) and blue (maximum absorption at 430 and 453 nm) regions (Guidi, Tattini et al. 2017). Blue and red light thereby play a great role in regulating photosynthesis and developmental processes (Figure 2.1B) (Singh, Basu et al. 2015). There is a misconception that plants do not make use of the spectrum regions (within the spectrum of 500 to 600 nm). However, only around 10–50% of this region is reflected by plant chloroplasts (Terashima, Fujita et al. 2009). Growing research highlights the role of these wavelengths on plant growth and photosynthesis (Folta and Maruhnich 2007, Johkan, Shoji et al. 2012, Wang and Folta 2013, Yoshida, Mogi et al. 2016).

2.1.1.1 Blue Light Blue light is involved in several essential plant functions such as photosynthesis that can be the consequences of specific absorption spectrum of photosynthetic pigments and/or photoreceptors (Kopsell, Sams et al. 2014, O’Carrigan, Hinde et al. 2014). The carotenoid

34 pigments lutein and β-carotene absorb strongly in the blue region, with maximum absorption at 448 and 452 nm, respectively (Wright and Shearer 1984). Among photosynthesis pigments, blue light can increase total leaf carotenoid content (Johkan, Shoji et al. 2010, Wang, Lu et al. 2016). Independent of species, monochromatic blue light tends to increase the chl a:b ratio, which has been suggested as an indicator for relative photosystem stoichiometry (Abidi, Girault et al. 2013). Blue light notably plays a critical role in plant height suppression (Hernández and Kubota 2012) and photomorphogenic responses for light- seeking or -avoidance morphogenesis (Taulavuori, Hyöky et al. 2016). Blue light increases shoot/leaf dry mass, as well as leaf area and thickness (Hogewoning, Trouwborst et al. 2010). Additionally, blue radiation can induce the production of secondary metabolites such as flavonoids, and polyphenols (Shaikhali, de Dios Barajas-Lopéz et al. 2012, Hasan, Bashir et al. 2017).

2.1.1.2 Amber Light Amber light is a narrow-wavelength in the range of ~500-600 nm with a peak at 595 nm. As, the wavelengths within these range are weakly absorbed by photosynthetic pigments (chlorophyll and carotenoids; Figure 2.1B) (Terashima, Fujita et al. 2009), previous studies have reported these wavelengths as less efficient light sources in driving photosynthesis (Wang, Gu et al. 2009, Brazaitytė, Duchovskis et al. 2010, Yan, Wang et al. 2014, Tanaka, Ohno et al. 2016). Growing research has highlighted its physiological impact on plant growth and photosynthesis (Wang, Gu et al. 2009, Wu, Su et al. 2014). For example, the reported consequences of 595 nm are a significant reduce in growth, chlorophyll content, photochemical quenching (qP) and quantum efficiency of PSII photochemistry. Congruently, under 595 nm, the activity of Rubisco was shown decrease due to the slowing of photosynthesis. Further impact is a decrease in CO2 fixation and net photosynthesis (Wang, Gu et al. 2009, Brazaitytė, Duchovskis et al. 2010). Illumination of 595 nm has also resulted in the elongation growth and less leaf area in plants. However, McCree et al. has shown that 595 nm light has some of the highest photosynthetic action spectrum of any of the wavelengths of light tested (McCree 1972). Additionally, 595 nm has shown high regulatory role on abundance and activity of key proteins to mediate higher stress tolerance in plant (Yu, Liu et al. 2017). For instance, 595 nm induced the abundance/activity of antioxidant enzymes such as superoxide-dismutase (SOD), catalase (CAT), and peroxidase (POD) to reduce the accumulation of free radicals. Thus, 595 nm regulates an integrated molecular network at multiple levels to bring

35 about stress tolerance responses. Despite being a probable light source to understand regulatory signals in plant growth and development related to stress signals and tolerance response, the molecular mechanisms and impact on plant growth underlying the effect of light wavelength 595 nm remain unclear.

2.1.1.3 Red Light Red light, influencing growth and photomorphogenic responses in plants, is a fundamental spectral component for photosynthesis and light sensing. Chlorophyll absorption is much higher under blue light than its absorption of red light. It appears that red light can further increase the chlorophyll concentration (Hao, Little et al. 2012). Red light promotes chloroplast development and stomatal maturation (Kang, Lian et al. 2009, Chen, Galvão et al. 2010, Casson and Hetherington 2014). Thylakoid structure and protein composition change in plants’ exposure to red light (Suorsa, Rantala et al. 2015). Further, red light inhibits hypocotyl elongation (Casal 2013) and promotes rapid de-etiolation responses (Franklin and Quail 2009). It promotes leaf expansion area and biomass accumulation in plant/crop (Demotes-Mainard, Péron et al. 2016). Red light alone can activate antioxidant production in numerous species and improve the nutritional value of products (Olle and Viršile 2013). More findings partially revealed the molecular machinery that mediates integration of red light signaling with hormone-induced actions (de Wit and Pierik 2016) and those induced by various biotic and abiotic stresses (Ballare 2014, Cortés, Weldegergis et al. 2016).

2.1.2 Light Signal Perception Virtually all processes within the life cycle of a plant are initiated and/or regulated by light perception either through pigments or photoreceptors and their downstream signaling cascades. This often involves the (de-) activation of transcription factors, which influence the expression of genes e.g., associated with hormone synthesis/transport.

2.1.2.1 Role of Pigments in Light Response Sunlight energy is harvested by light‐harvesting pigment‐protein complex I (LHCI) and II (LHCII) and immediately transferred into excitation energy of the reaction center of photosystem I (PSI) and photosystem II (PSII), where the photochemical reactions take place (Ouyang, Li et al.

36 2011, Blankenship 2014). The pigments consist mainly of chlorophyll, carotenoid and anthocyanin and each pigment absorbs photosynthetically active radiation (PAR) light in different wavelengths (Hogewoning, Wientjes et al. 2012). Red light (600–700 nm) and blue light (400–500 nm) being absorbed more efficiently by chlorophyll than other light wavelengths (McCree 1972) with highly efficient excitation energy transfer (Hogewoning, Wientjes et al. 2012). Carotenoids and non- photosynthetic pigments such as anthocyanins absorb light but do not, or only partially (carotenoids), transfer excitation energy to photosystem reaction centers (Nishio 2000). In a healthy, non-stressed leaf, changes in the light wavelength may result in changes in cell signaling due to changes in the different leaf pigments composition.

2.1.2.1.1 Chlorophylls Chlorophyll is a photosynthetic pigment that is found in two forms in plants, Chl a and Chl b. Chlorophyll’s main function is to absorb light energy and transfer it into the photosynthetic apparatus (Demmig-Adams and Adams III 2000). Chl a absorbs most energy from wavelengths in the violet-blue and orange-red spectrum and is used in oxygenic photosynthesis. It transfers resonance energy in the antenna complex ending in the reaction center, where PSI and PSII primary donors (Chl P700 and Chl P680, respectively) are situated (McDonald 2003). Chl a and b are synthesized at 662 nm and 642 nm respectively, while phototropic processes function between 400 and 700 nm. Chl a absorbs red light with higher light intensities, while Chl b mainly absorbs blue light energy at lower intensity (Huché-Thélier, Crespel et al. 2016).

2.1.2.1.2 Carotenoids Carotenoids are found in the chloroplasts and chromoplasts of plants. Their main roles are to absorb blue light energy for photosynthesis (Armstrong and Hearst 1996). Carotenoids have antioxidant properties, which can protect chlorophyll inside the PSs from photodamage through an energy transfer mechanism (Horton, Wentworth et al. 2005, Xiao, Shen et al. 2011). Carotenoids comprise a group of components such as carotenes, which contribute energy to the photosynthetic system and xanthophylls that are essential for quenching of harmful triplet chlorophyll (3Chl*), and so preventing ROS formation (Jahns and Holzwarth 2012). Compared with blue light, carotenoid levels decreased in red light alone (Kopsell and Sams 2013).

37 2.1.2.1.3 Anthocyanins Light stimulates the production of anthocyanins in leaves. It is known that the red and blue light signaling pathways regulate anthocyanin synthesis and promote significantly increasing amounts of anthocyanin produced in the plants (Ramalho, Marques et al. 2002, Li and Kubota 2009). Anthocyanins are plant pigments of the flavonoid subclass of phenylpropanoids (Falcone Ferreyra, Rius et al. 2012). This group of pigments are commonly induced in plant vegetative tissues in response to a number of different abiotic stresses, especially light induced stress (Kovinich, Kayanja et al. 2014). Anthocyanines have a general role in photoprotection with the proposed roles including quenching of ROS, photoprotection, and stress signaling (Hughes, Carpenter et al. 2014, Nakabayashi, Yonekura‐Sakakibara et al. 2014).

Figure 2. 1. The active light spectrum and plant photosynthetic action absorption spectra. A) individual visible spectrum of light source; (Adapted from http://www.ledflowergrowlights.eu/illuminate.html. B) comparison of the photosynthetically active radiation (PAR) spectrum.

2.1.2.2 Role of Photoreceptors in Light Response Plants are sessile organisms and through molecular genetic approaches have revealed that plants can monitor the light environment and perceive signals through multiple non-photosynthetic photoreceptors, which act as light sensors for perceiving different light wavelengths (Smith 2000). These include red and far-red light (600-750 nm) absorbing phytochromes (phyA to phyE) (Li, Li et al. 2011), blue light (400-500 nm) absorbing cryptochromes (cry1 and cry2), blue and ultraviolet-A radiation (UV-A) light (315-500 nm) absorbing phototropins (phot1 and phot2) (Kharshiing and Sinha 2015) and Zeitlupe (ZTL)/flavin-binding, kelch repeat, F-box (FKF1)/lov klech protein2 (LKP2) (ZTL/FKF1/LKP2) family proteins (Ito et al., 2012), and ultraviolet-B radiation (UV-B) light (280-315 nm) absorbing UV resistance locus 8 (UVR8) (Figure 2.2) (Heijde

39 and Ulm 2012, Jenkins 2014). Each individual photoreceptor, the light-sensing molecules, is encoded by an individual gene and shares a high degree of sequence similarity between the individual photoreceptors of the same family.

Photoreceptors are responsible for initiation of selected physiological responses via specific signaling networks. Manipulation of genes involved in different photoreceptors influences the molecular pathways related to photosynthesis, photorespiration, biotic/abiotic stress, as well as secondary metabolism, such as biosynthesis of phenolics, phenylpropanoids, and flavonoids (Gupta and Pradhan 2017). In green leaves, the absorption of red and blue light is stronger than green light. There are indications of the existence of green light sensory systems which adjust the development and growth of plants in arrangement with red and blue photoreceptors (Folta and Maruhnich 2007, Wang, Jiang et al. 2010). Such simultaneous activation can allow for the study of light wavelengths-mediated physiological responses and developmental processes in plants that eventually affect plant productivity (Wargent and Jordan 2013, Petroutsos, Tokutsu et al. 2016).

2.1.2.2.1 Phytochrome Phytochromes (phy) are red and far-red light photoreceptors that can monitor changes in the red/far-red light ratio and transduce intracellular signals during light-regulated plant development (Jiao, Lau et al. 2007). Nearly all phases of plant development from seed germination to flowering are regulated by phytochromes (Kim, Shin et al. 2011, Wang and Wang 2015). In Arabidopsis, there are five phytochromes ranging from phytochrome A (phyA) to phytochrome E (phyE), with their peak absorption between 665 nm and 730 nm (Li, Li et al. 2011). PhyA is labile in response to light, and phyB-E are light stable phytochromes. Both phyA and phyB are the most prominent phytochromes and they sense far-red and red light, respectively. It should be noted that in addition to red and far-red regions of the spectrum, phytochromes can weakly absorb blue light (Su, Liu et al. 2017).

2.1.2.2.1.1 Phytochrome Interacting Factors Following photoactivation, phytochromes have been shown to translocate to the nucleus to interact with Phytochrome-Interacting Factors (PIFs). In Arabidopsis, PIFs proteins are a small family (7 members) of basic helix‐loop‐helix (bHLH) transcription factors (TFs) that have been

40 reported to interact with phyB (PIF1/PIF3-LIKE 5 [PIL5], PIF3, PIF4, PIF5/PIL6, PIF6/PIL2, PIF7 and PIF8), while two of them (PIF1/PIL5, PIF3) also bind to phyA (Shen, Zhu et al. 2008, de Lucas and Prat 2014). RNA sequencing (RNA-Seq) and chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) analyses showed that PIFs regulate the expression of a large number of target genes related to different developmental processes (Hornitschek, Kohnen et al. 2012, Pfeiffer, Shi et al. 2014). For example, PIFs play a central role in light signaling during Arabidopsis photomorphogenesis (Leivar and Quail 2011), regulating growth and chloroplast differentiation (Stephenson, Fankhauser et al. 2009), phototropic response (Sun, Qi et al. 2013), hormone and temperature signaling pathways (Leivar and Monte 2014), as well as many aspects of the shade-avoidance syndrome (SAS) (Leone, Keller et al. 2014).

2.1.2.2.2 Cryptochrome Cryptochromes (cry) are blue (390 to 500 nm), and UV-A (320 to 390 nm) light absorbing receptors (Yang, Liu et al. 2017). They are flavin adenine dinucleotide (FAD)- and pterin- containing chromoproteins that have a C-terminal cryptochrome C-terminus (CCT) domain (Figure 2.2B), which is necessary for signal transduction (Higuchi and Hisamatsu 2016). In Arabidopsis there are two cryptochrome encoding genes cry1 and cry2 that have major roles in light signaling. Cryptochromes are key regulators of photomorphogenic development, phototropism, de-etiolation, entrainment of the circadian clock, anthocyanins and carotenoids biosynthesis, photoperiodic flowering and stomatal opening in a blue light-induced manner (Kami, Lorrain et al. 2010, Yang, Liu et al. 2017). Cry1 is a light stable protein, while cry2 is a light labile protein. Cry2 undergoes blue-light mediated degradation indicating that it functions preferentially under low light conditions (Casal 2013).

2.1.2.2.3 Phototropins Phototropins (phot) are the principal photoreceptors for blue-light phototropism. In Arabidopsis, there are two phototropins genes (phot1 and phot2) that have roles in mediating the critical adaptive responses such as chloroplast movement, leaf expansion, phototropism, leaf positioning, inhibition of hypocotyl growth, stomatal opening and enhancing the photosynthetic status of plants (Christie, Blackwood et al. 2014, Mawphlang and Kharshiing 2017). Phot1 acts over a wide range of light intensities, whereas phot2 functions predominantly at high light

41 intensities (Christie, Blackwood et al. 2014). Phototropins can promote growth at low intensity of blue light (Takemiya, Inoue et al. 2005).

Figure 2. 2. Photoreceptors and their structure in higher plants. A) Photoreceptors perceiving different light spectrum. B) Photoreceptors’ domain structure and binding chromophores. GAF cGMP-stimulated phosphodiesterase; Anabaena adenylate cyclases and Escherichia coli FhlA; PAS Per (period circadian protein), Arn (Ah receptor nuclear translocator protein) and Sim (single- minded protein); HKRD histidine kinase-related domain; PHR photolyasehomologous region; CCE cry C-terminal extension; LOV light, oxygen and voltage; FAD flavin adenine dinucleotide; FMN flavin mononucleotide.

42 2.1.2.3 Role of Hormones in Light Response Plants have evolved complex methods of sensing, integrating external and internal signals. It is not surprising that a number of regulators of plant photomorphogenesis participate in phytohormone such as gibberellin (GA), auxin (AUX), cytokinin (CK), jasmonates (JA), abscisic acid (ABA), brassinosteroid (BR), salicylic acid (SA), and ethylene (ET) signaling pathways. Increasing studies uncover how light and hormonal pathways interact at the molecular level (Lau and Deng 2010). AUX can modulate photomorphogenesis as well as phototropism by regulating the gene expression of photoreceptors, AUX/indole-3-acetic acid (IAA), and auxin response factors (ARF) (Weijers, Nemhauser et al. 2018). Through modulating multiple PIFs, DELLA proteins have shown a key part in integrating the regulatory effect of light and GA on gene expression and plant development (Feng, Martinez et al. 2008). CK signaling has shown impacts on light responsiveness, through the mechanism that is linked to the regulation of LONG HYPOCOTYL5 (HY5) protein (Argueso, Raines et al. 2010). HY5 has been shown to be involved in mediating ABA signaling (Chen and Xiong 2011). A genomic map of steroid hormone actions in plants revealed a regulatory network that integrates hormonal and light-signaling pathways for plant growth regulation (Sun, Fan et al. 2010). Among the phytohormones, ABA, SA, JA and ET are known to play major roles in regulating plant defense response against abiotic stress (Nakashima and Yamaguchi-Shinozaki 2013, Vishwakarma, Upadhyay et al. 2017). For example, SA regulate plant tolerance to abiotic stress mainly through upregulation of most of the systemic acquired resistance (SAR)-associated genes (Klessig, Choi et al. 2018). SA affects numerous aspects of plant growth and development, including vegetative growth, senescence, photosynthesis (Miura and Tada 2014, Khan, Fatma et al. 2015). Involvement of such regulatory proteins in the transduction of light signals has been an important aspect of investigations.

2.2 Chloroplast Structure

2.2.1 Thylakoid Membrane

2.2.1.1 Stroma Chloroplast has an outer and an inner envelope membrane enclosing the soluble stroma (Figure 2.3), where the carbon fixation process and synthesis of chloroplast-encoded proteins occur (Su, Jacquard et al. 2015). Its pH can reach 8.0 as compared to cytoplasmic pH in the range

43 7.0-7.5 during illumination (Benčina 2013). Stroma contains chloroplast nucleoids, ribosomes, starch and many proteins involved in biosynthetic reactions. The most abundant protein in the chloroplast stroma is Rubisco, an enzyme that assimilates CO2 into carbohydrates, during the Calvin–Benson–Bassham (CBB) cycle (Kumar, Sundaram et al. 2018).

2.2.1.2 Lumen Inside the thylakoid membrane is a soluble space called the thylakoid lumen (Figure 2.3). The thylakoid lumen contains oxygen-evolving complex proteins, the electron carrier PC and photoprotection related violaxanthin de-epoxidase (Kang and Wang 2016). It contains up to 80 proteins that have a role in the regulation of thylakoid biogenesis, activity and turnover of PSII and of NAD(P)H dehydrogenase (NDH)-like complexes (Järvi, Gollan et al. 2013).

2.2.2 Photosynthetic Complexes

2.2.2.1 Photosystem II PSII (also known as Psb, and P680) is considered to be ‘the engine of life on Earth’, due to its ability to utilize water molecules as a source of electrons. It is defined as the minimum set required to oxidize water, and the primary electron donor of PSII. PSII absorbs light up to 680 nm wavelength and contains both Chl a and Chl b. As shown in Figure 2.3, active PSII functions in a dimeric form, where each monomer contains more than 20 protein subunits. In addition to proteins, 35 chlorophylls, 11 β-carotenes, and two plastoquinone (PQ) were found in the latest PSII crystal structure (Umena, Kawakami et al. 2011). PQ is the primary stable electron acceptor of PSII (Vass 2012). Chl P680 is the RC, composed of the core integral subunits D1 and D2, and the inner antenna proteins CP43 and CP47. They are preserved in all oxygenic photosynthetic organisms, and plastid-encoded in plants.

2.2.2.2 Photosystem I PSI (also known as Psa, and P700) absorbs light up to 700 nm wavelength and contains about 100 Chl a and 20 β-carotene molecules (Nymark, Valle et al. 2009). Most of the chlorophyll and carotene molecules (mainly lutein and violaxanthin) are bound to the main subunits PsaA and PsaB. In plants, the PSI complex consists of at least 19 protein subunits, approximately 175 chlorophyll molecules, two phylloquinones and three Fe4S4 clusters (Figure 2.3). PSI mediates

44 light-driven electron transfer from cytochrome b6/f (cyt b6f) via plastocyanin (PC) to the ferredoxin (Fd): Nicotinamide adenine dinucleotide phosphate (NADP+) reductase (FNR).

2.2.2.3 Cytochrome b6f A cyt b6f complex acts as the redox link and proton translocator between the photosynthetic reaction centers of PSII and PSI (Tikhonov 2014). This complex functions as a dimer, with each monomer consisting of nine subunits in plants (Figure 2.3) (Baniulis, Hasan et al. 2013). The large subunits including cytochrome f, cytochrome b6, Rieske iron‐sulfur protein and subunit IV. The small subunits containing PetG, PetL, PetM, and PetN whose functions might have critical roles in assembly and/or stability of the complex. The specific subunit is FNR, with a physiological role to catalyze the final step of photosynthetic electron transport, namely the synthesis of nicotinamide adenine dinucleotide phosphate hydrogen (NADPH) for downstream carbon fixation (Mulo 2011).

2.2.2.4 ATP Synthase The chloroplast adenosine triphosphate (ATP) synthase has two distinct components, CF1 and CF0. CF1 is an extrinsic membrane protein subcomplex that contains the catalytic site(s) for reversible ATP synthesis. CF0 is an integral membrane protein complex, which is responsible for the conversion of an electrochemical proton gradient into rotational motion (Poetsch, Berzborn et al. 2007). CF0 contains four different subunits named I, II, III14 and IV (Figure 2.3). The III14 oligomer forms the proton-driven rotor, and the rotating central stalk in the ATP synthase consists of subunits γ and ε. A second stalk is composed of subunits I, II and δ, which have a role in stabilizing the rotating machinery as a stator (Stewart, Lee et al. 2012).

2.3 Plant Light Response

2.3.1 Photosynthesis

Plants perceive sunlight and produce energy through photosynthesis. Photosynthesis occurs in the chloroplasts, where light energy is captured by photosynthetic pigment molecules (chlorophylls and carotenoids), which are divided over two different pigment-protein complexes of the photosynthetic machinery, PSI and PSII (Blankenship 2002). Chloroplasts’ thylakoid

45 membranes are involved in light harvesting, water oxidation, electron and H+ transfer to form chemical energy (ATP, NADPH). As illustrated in Figure 2.3, at the molecular level, both photosystems are connected to LHCI for PSI and LHCII for PSII (Kargul and Barber 2008). PSII is associated with the oxygen-evolving complex (also known as the water-splitting complex), which donates an electron coming from a water-molecule each time PSII is excited with light (Barber 2009). This is the first section of the light reactions, using the high-energy state of the chlorophyll molecules associated with PSII. This energy then enters an electron transport chain involving PQ, Cyt b6/f, and PC, whereby the high energy molecule ATP is produced that is later needed in the dark reactions of photosynthesis (Flexas, Loreto et al. 2012). The ATP is formed through an ATP synthase as a proton-pump, pumping the H+ coming from the water molecules through the thylakoid membranes resulting in proton motive force (Lane and Martin 2012). At the end of the electron transport chain, the electron has lost its energy, and is donated to PSI. The energized electrons from PSI are then donated to Fd, a soluble protein that facilitates reduction of NADP to NADPH (a reduced form of NADP), a high-energy molecule needed for the dark reactions of photosynthesis, in the chloroplast stroma (Messinger and Shevela 2011). The NADPH and ATP are then used as a source of chemical energy in the plant. The amount of light harvested is affected by the size functionality of the photosystems; and this can be adjusted to suit the environmental conditions (Walters 2005).

Figure 2. 3. The light reactions of photosynthesis occurring in the chloroplast’s thylakoid membrane. It is showing all structural proteins forming PSII, Cyt b6/f, PSI, and the ATP synthase, and their link to the carbon fixing dark reactions through ATP and NADPH energy supply. Organization of photosynthetic complexes simplified linear and cyclic electron transport chains. Dashed red, blue and solid black lines represent the linear, cyclic electron and proton transport, respectively.https://www.kegg.jp/kegg- bin/highlight_pathway?scale=1.0&map=map00195&keyword=photosynthesis.

2.3.1.1 Photosynthetic Electron Transport The photosynthetic apparatus has developed a series of adaptive mechanisms such as linear and cyclic electron transfers which occur through the thylakoid membrane (Johnson 2011, Rochaix 2011).

47 2.3.1.1.1 Linear Electron Transport Linear electron transfer (LET) involves three major complexes, namely PSII, cytb6f and PSI. In PSII, the energy of the harvested photons by chlorophyll is used to excite P680 and to shuttle an electron via PQ molecules (Minagawa and Takahashi 2004). Simultaneously, water splitting occurs at the tetra-manganese calcium penta-oxygenic (Mn4CaO5) cluster on the donor side of PSII (Umena, Kawakami et al. 2011). The protons originating from this reaction are released into the lumen and the electrons reduce oxidized P680. Plastoquinol (PQH2) transfers one electron onto the Rieske iron‐sulfur subunit of Cyt b6/f complex, where it is oxidized. Cyt b6f then regulates electron transfer between the two photosystems via Q‐cycle (Johnson 2011). During the Q‐cycle, protons are translocated from the stroma to the lumen. At PSI, photons excite P700, the primary donor of PSI. P700* transfers an electron onto Fd in the stroma (Iwai, Takizawa et al.

2010). Ultimately, electrons are transferred to NADP+ and form NADPH by FNR. Moreover, as a result of water splitting at PSII and proton pumping from the stroma, the lumen becomes acidified. This proton gradient, ΔpH, is used to synthesize ATP in the stroma (Wang, Yamamoto et al. 2015). This whole electron transport chain from PSII to NADPH is called LET from which the generated products (NADPH and ATP) are used to fuel the carbon fixation by the CBB cycle (Figure 2.4) (Rochaix 2011).

2.3.1.1.2 Cyclic Electron Transport Via LET, the four resulting electrons are transferred onto the intersystem PQ pool to reduce two NADP+ and translocate eight protons into the thylakoid lumen (Suorsa, Järvi et al. 2012). In total 12 protons resulting from LET can bind to the CF0 sub‐complex of the ATP synthase. However, LET do not completely rotate the CF0 sub‐complex and only produce 2.57 ATP molecules (Vollmar, Schlieper et al. 2009). To achieve the full count of three ATP, one electron needs to be recycled from PSI to cyt b6f, where two additional protons are pumped into the lumen via type‐I NDH‐ dependent cyclic electron transport (CET) (Peng, Shimizu et al. 2008). In this way, CET acidifies the chloroplast lumen without creating NADPH (Munekage, Hashimoto et al. 2004). NDH is a huge multi-subunit protein complex, which is able to form a super-complex with PSI (Yadav, Semchonok et al. 2017) to subsequently pump protons into the lumen. CET is therefore needed to increase the ΔpH, to derive ATP synthesis (Shikanai and Yamamoto 2017). Two proteins, called Proton Gradient Regulation 5 (PGR5) and PGR5‐ Like Photosynthetic

48 Phenotype 1 (PGRL1) have been proposed to function in CET in Arabidopsis (DalCorso, Pesaresi et al. 2008). PGRL1 is an integral thylakoid protein that interacts with PGR5 to form the elusive ferredoxin‐plastoquinone reductase (FQR) (Hertle et al., 2013), and consequently accept electrons from Fd to reduce PQ (Hertle, Blunder et al. 2013). It is demonstrated that Fd donates electrons to NDH, rendering it a FQR (Peltier, Aro et al. 2016). PGR5 is predicted to be a small extrinsic thylakoid protein that has the main role in the regulation of CET via photosynthetic control at cyt b6f. PGR5 also prevents photodamage of PSI under fluctuating light conditions in Arabidopsis (Suorsa, Jarvi et al. 2012).

Figure 2. 4. Simplified scheme of the photosynthetic linear and cyclic electron transfer routes in Arabidopsis thylakoid membranes. Electron transport pathways are shown by dotted lines with arrows to indicate the direction of electron flow.

2.3.2 Shade Avoidance Response

Plants manifest various shade avoidance responses, collectively called as shade avoidance syndrome (SAS), to reduce the degree of current or future shade. This response involves various mechanisms that are acting together, including the rapid and pronounced increase in elongation growth of hypocotyl, stems and petioles, coupled with leaf movement (hyponasty) (Casal 2013, Martínez-García, Gallemí et al. 2014). SAS may provide plants a survival strategy in rapidly growing populations (Ballare and Pierik 2017).

49 This response involves the modulation of transcriptional and metabolic networks to support shade-mediated growth. The signals from a low irradiance of red light and shaded environment are sensed by phytochromes. Upon activation by light, phytochromes (Phys) migrate from the cytosol to the nucleus where they interact with PIFs (Leivar and Monte 2014). Only three PIF4, PIF5 and PIF7 are unambiguously involved in controlling the plant SAS response (Ballare and Pierik 2017). The network of phys and PIFs have been shown highly interconnected that targets three growth- associated hormones AUX, GA, and ET (Berens, Berry et al. 2017). AUX is now known as the dominant physiological regulator activated by PIFs when they accumulate (Xu, He et al. 2018). Induced-AUX involves PIF-mediated transcription of responsive genes that encode rate-limiting enzymes related to AUX biosynthesis that occurs mostly in the cotyledons (Hornitschek, Kohnen et al. 2012, Procko, Crenshaw et al. 2014). Generated AUX is then transported and localized towards the hypocotyl epidermis by AUX efflux-associated protein PIN3 (Keuskamp, Pollmann et al. 2010). AUX signaling later leads to degradation of AUX/IAA proteins, which in turn relieves repression of ARFs that control transcription of AUX responsive genes, ultimately directing cell expansion (Dünser and Kleine-Vehn 2015). The biosynthesis of GA is stimulated through transcriptional up-regulation of genes encoding the GA biosynthetic enzymes such as GA20ox1 and GA20ox2 (Hedden 2018). Interestingly, DELLAs are direct interactors of PIFs (Pham, Kathare et al. 2018) and their binding to PIFs, controlling the expression of growth-promoting genes. Finally, biosynthesis of the volatile hormone ethylene (ET) is accelerated upon phys interacting (de Wit and Pierik 2016). ET relies on a tight collaboration with auxin biosynthetic, transport, and response proteins to stimulate elongation of shoots via regulating genes encoding cell wall modifying proteins and enzymes (Vandenbussche and Van Der Straeten 2018).

CRYs are also involved in SAS response (Pedmale, Huang et al. 2016, Kong, Stasiak et al. 2018). In Arabidopsis, attenuation and depletion of blue light trigger internode and petiole elongation as well as very strong elongation response of the hypocotyl (Pierik, Djakovic-Petrovic et al. 2009, Keller, Jaillais et al. 2011). The induced signaling recruits partially similar phys- induced physiological regulators to control hypocotyl elongation, including AUX (Keuskamp, Sasidharan et al. 2011). Interestingly, upstream signaling of the crys responsive hormones was further shown to converge in their requirement of PIF4 and PIF5 (Leivar and Monte 2014). Pedmale et al. (2016) showed that crys interact physically with PIF4 and PIF5, thereby modulating

50 their transcriptional output and hence growth, involving xyloglucan endotransglucosylase / hydrolases (XTHs). The elongation response is a result of cell expansion and cell division. There is the family of cell wall modifying proteins XTH, which hydrolyze and weaken the cell wall resulting in expansion of cells (Tenhaken 2015).

2.3.3 Stress Response

The sensing of abiotic stresses initiates several complexes signaling pathways in plants. Plants perceive the stress signals from the environment followed by production of secondary signaling molecules such as ROS, alteration of intracellular Ca2+ concentration, as well as activation of kinase cascades. Perceived signals are transmitted by signaling cascades, which initiate downstream target proteins directly involved in cellular protection, or TFs controlling specific sets of stress-regulated genes and altered physiological responses.

2.3.3.1 Photoprotection Plants have developed intricate internal defense mechanisms known as photoprotection to cope with the ever-changing light energy in the environment that causes photodamage. Two major biochemical signals indicate changes in light energy: 1) A pH-change within the chloroplast membranes associated with lumen acidity (proton gradient dependent regulation), which results from a decrease in the ATPase proton-pump. Chloroplast NDH complex, one of the two CEF routes, probably pumps additional protons per electron transferred and protect the two PSs from photodamage (Yamori and Shikanai 2016). 2) A redox change through the build-up of ROS (redox-dependent regulation) that donate extra electrons from the imbalanced energy excitation to other acceptors in the electron transport chain, such as oxygen and form ROS (de Bianchi, Ballottari et al. 2010). The production of excessive ROS can damage lipids, nucleic acids and proteins including damage to the PSs known as photoinhibition (Li, Aro et al. 2018). Photoprotection is thus executed to either reduce the absorption of light, by dissipating the excess light via non-photochemical quenching (NPQ) or by scavenging the ROS that are eventually produced (Rochaix 2013).

51 2.3.3.1.1 ROS Generation and Scavenging ROS are produced as by-products of many metabolic pathways and can have deleterious effects on many biomolecules within the cell (Baxter, Mittler et al. 2013). ROS act as signaling molecules and secondary messengers which affect the expression of multiple genes in many abiotic and biotic stress pathways (Pospíšil 2016) and function in a variety of cellular processes (Singh, Kumar et al. 2019). The ROS molecules that mediate signaling functions include hydrogen peroxide (H2O2), singlet oxygen (1O2), hydroxyl radical and superoxide anion radicals.

Chloroplasts are a major source of ROS production in plant cells, because it is a site of highly oxidizing metabolic activity and an intense rate of electron flow (Mittler and Blumwald 2015). During photosynthesis, energy from sunlight is captured and transferred to LHCI and

LHCII. Superoxide (O2−), which is produced mainly by electron leakage from Fe-S centers of PSI or reduced Fd to O2 (Mehler reaction), is then converted to H2O2 by SOD (Sgherri, Pinzino et al.

2018). O2− can be produced through the leaking of electrons to O2 from electron transport chains between PSI and PSII (Singh and Thakur 2018). 1O2, another form of ROS, can be formed by energy transfer. Under excess light conditions PSII is able to generate 1O2 by energy transfer from the 3Chl (Dogra, Rochaix et al. 2018).

Scavenging or detoxification of excess ROS is undertaken by an efficient antioxidative system including non-enzymic and enzymic antioxidants (Pinnola and Bassi 2018). The enzymic antioxidants include SOD, catalase (CAT), glutathione peroxidase (GPX), enzymes of the ascorbate glutathione (AsA-GSH) cycle such as APX, and glutathione reductase (GR) (Caverzan, Casassola et al. 2016). Non-enzymic antioxidants include ascorbate (AsA), glutathione (GSH), carotenoids, tocopherols, and phenolics (Sathee, Meena et al. 2019). It has been shown that zeaxanthin and lutein play key roles in inducing ROS scavenging processes (Alboresi, Dall'Osto et al. 2011).

2.3.3.1.2 Non-photochemical Quenching The NPQ mechanism is one of the most efficient photoprotective mechanisms in plants. NPQ dissipate the excitation energy that exceeds the capacity of the photosynthetic electron transfer (PET) chain, as heat, in the LHCII (Bhattacharjee 2019). The process of NPQ can eliminate over 75% of absorbed light energy (Croce and Van Amerongen 2014). This can thus reduce ROS

52 production leading to less damage to PSs. The NPQ mechanism is composed of three components: energy-dependent quenching (qE), state-transition quenching (qT), and photoinhibition quenching (qI) (García-Plazaola, Esteban et al. 2012). The qE is considered to be the most important component of NPQ that is regulated by the ΔpH across the thylakoid membrane (Ruban 2018). ∆pH is produced during the process of LET and the occurrence of CET in chloroplast (Wood, MacGregor-Chatwin et al. 2018). In Arabidopsis, the xanthophyll cycle makes up a large portion of qE (Quaas, Berteotti et al. 2015). A LHC‐family protein, PsbS, is the site of qE which contributes to ∆pH and xanthophyll-dependent excitation quenching (Pinnola and Bassi 2018). PsbS acts as a trigger of the conformational change leading to upregulation of NPQ. Therefore, it can be proposed that PsbS is essential for NPQ mechanism instead of being purely involved in light capturing. The qT is the balancing excitation energy mechanism of PSI and PSII that is mostly involved in regulating plant growth under fluctuating light environment rather than regulating NPQ process (Tikkanen and Aro 2014). Finally, the qI that is associated with the damaging of D1 protein leading to photoinhibition and the long-term down-regulation of PSII, results in decreased photosynthesis (Townsend, Ware et al. 2018).

2.3.3.1.3 PSII Photoinhibition Photoinhibition is a term to describe a decrease in PSII photochemical capacity and an increase in PSII damage (Malnoë 2018). This process can occur through light-dependent destruction of the Mn4CaO5 cluster, light-induced inactivation of PSII reaction center, and inefficiency of electron transport at the PSII acceptor side that causes P680 3Chl* formation, and consequently generation of ROS (Pospíšil 2016). The created ROS then oxidize D1 protein, a core component of PSII reaction center, causing PSII photodamage (Yamori 2016). ROS have been shown to inhibit PSII repair, and increase the extent of photoinhibition (Takahashi and Badger 2011). Plants have developed a rapid and efficient repair system to recover from the damage, PSII repair (Nath, Jajoo et al. 2013). It has been suggested that the rate of D1 degradation is the major rate-limiting step of the PSII repair process (Järvi, Suorsa et al. 2015). There are several proteases involved in the degradation of photodamaged D1 protein, such as FtsH and Degs (Yoshioka- Nishimura 2016). The levels of photoinhibition can vary depending on the rate of repair of damaged PSII and the induction of photoprotective process (Yamori 2016).

53 2.3.4 Systemic Acquired Resistance

Rapid and transient increases in ROS generation could serve as secondary signals for activating biological processes such as defense system responses (Klessig, Choi et al. 2018), which is activated by an endogenously produced small phenolic compound: salicylic acid (SA). SA is a crucial intermediate in local and systemic defense in plants, particularly systemic acquired resistance (SAR) (Fu and Dong 2013). This process is associated with the induction of Pathogenesis-Related (PR) genes in both local and systemic tissues (non-infected tissue) (Ebrahim, Usha et al. 2011). The establishment of the SAR response is accompanied by the constitutive expression of PR genes, which are considered as marker genes for SAR (An and Mou 2011). WRKY TFs have been determined in regulation of PR genes, either indirectly or directly (Jiang, Ma et al. 2017). Many studies have revealed that the positive regulator NPR1 plays a central role in the signaling pathway downstream of SA that leads to the induction of SAR (Pajerowska- Mukhtar, Emerine et al. 2013).

SA is synthesized from chorismate, the final product of the shikimate pathway in the chloroplasts, which is the precursor for the aromatic amino acids in plants (tryptophan, phenylalanine, and tyrosine) (Maeda and Dudareva 2012). Chorismate is converted into SA via two distinct biosynthesis pathways; phenylalanine ammonia lyase and isochorismate synthase (Chen, Xu et al. 2013). SA accumulation is tightly regulated by an intricate genetic modulatory network to balance the regular growth and emergent responses to pathogen attacks. EDS1, as a basal resistance regulator, and Phytoalexin deficient 4 (PAD4) encoding lipase-like proteins, both are involved in the earliest steps of SA accumulation (Stahl, Bellwon et al. 2016). Non-Race- Specific disease resistance 1 (NDR1), encoding a plasma membrane-localized protein is involved in regulating SA content (Rodriguez, El Ghoul et al. 2016). A calmodulin (CaM)-binding TF, involved in Ca2+ signaling, is highly associated with SA accumulation (Cheval, Aldon et al. 2013).

2.4 Arabidopsis as a Model Plant In biological science, models are those organisms with a huge amount of research information that make them attractive to study as examples for other species and/or natural phenomena that are more difficult to study directly. Such models can be used to study different

54 levels of biological systems; from behavior, and physiology, down to the tiny functional scale of proteins (Gosak, Markovič et al. 2018). Arabidopsis is now a well-established, widely studied model system in plant biology for nearly all biological processes (Rajjou, Gallardo et al. 2018). This model plant is widely used in genetic studies because it possesses characteristics, such as a small diploid genome which has already been fully sequenced (Alonso-Blanco, Andrade et al. 2016), more than 2,000 genotypically distinct accessions (Weigel 2012), and a short life cycle (2- 3 months in a greenhouse), that make it well suited for biosystem analysis. This model plant has been used to investigate the molecular networks and genetic factors influencing agronomically important traits including multiple photosynthetic and developmental responses and adaptation mechanisms (Mathan, Bhattacharya et al. 2016, Takou, Wieters et al. 2018, Flood 2019). The general objective of this project was to analyze responses and adaptations of plants to multiple narrow-wavelengths and to identify the level and functions of regulatory networks and expression. The generated dataset has been extensively used in three manuscripts, presented in Chapters 3, 4, and 5.

2.4.1 Natural Variation as a Key Tool in Plant Light Biology

Natural variation is defined as genome-encoded differences that plays a major role in plant acclimation and may cause a range of changes in plant phenotypic variation under different environments. Many traits that are important for plant fitness in agriculture are controlled by the expression of many genes and proteins as well as the effects of environmental factors, and even the interactions between these two. The phenotypic variation contributes to plant traits including growth, morphology, development, defense responses to primary and secondary metabolism and accumulation enabling almost every Arabidopsis accession to be distinguished from accessions collected at different locations (Tohge and Fernie 2017). Studying natural variations under different environments thus tell us about the phenotypic differences related to plant’s adaptation to diverse natural environments (Verhoeven, Vonholdt et al. 2016). In Chapter 3, natural variation in narrow- wavelength response among Arabidopsis ecotypes will be presented.

2.5 Plant System Biology Plants are sessile organisms unable to move to escape changing environmental conditions. As a result, they have developed intricate mechanisms to perceive external signals, allowing for

55 an optimal response to changing conditions. Some responses of the plants to different environmental conditions are very general and provide protection from a variety of stress conditions, whereas others are more specific against a particular factor. The multidimensional level of a network’s crosstalk makes it challenging to recognize which of the observed responses are general and which are more stress specific. Understanding the systems level responses of whole plants to environmental conditions are thus essential if we are to use genetic and molecular approaches to develop broad-spectrum adapted and tolerant crops (Mittler and Blumwald 2010).

In recent years, integrated approaches like systems biology have been evolving as promising tools to investigate plant physiology, ecology, morphology, stress responses and adaptation (Coruzzi, Burga et al. 2018). The molecular components of cellular life forms such as genes, proteins, and metabolites, have largely been studied in isolation or as parts of individual pathways. These components are tied together to form a large, interlinked, complex system in the cell (Yuan, Tiller et al. 2008). The integrative systems approach has been reseached by plant biologists, which focuses on complex interactions among different components in the biological systems (Zhu, Lynch et al. 2016, Coruzzi, Burga et al. 2018, Kiran, Ramasamy et al. 2018). In consecutive Chapters 3, 4, and 5 we illustrate various integrated approaches to understand the diverse range of plant narrow-wavelength response mechanisms.

2.5.1 From Plant Phenotype, Mass Production and Photosynthesis to Tolerance Responses

2.5.1.1 Evaluating Narrow-Wavelengths for Plant Growth and Photosynthetic Performance 2.5.1.1.1 Morphology Light wavelengths have shown profound effects on plant morphology (Folta and Carvalho 2015). Specialized photoreceptors, usually located in plant leaves, mediate these responses. Blue and red photoreceptors PHYs and CRYs have powerful regulatory roles on plant leaf size and thickness (Bugbee 2016, Wu, Gong et al. 2017). Blue light is captured by cryptochrome and regulates morphological responses such as shoot and internode elongation, shoot dry matter, and leaf area expansion (Huché-Thélier, Crespel et al. 2016). Phytochrome exists in two conformations that are implicated in several morphological responses from the time of germination through the flowering. Blue and red lights are generally associated with the production of more compact plants when it is the predominant light wavelength in a spectrum, initiating hypocotyl de-etiolation during

56 plant establishment, and reducing internode lengths and expanding leaf areas throughout vegetative development (Demotes-Mainard, Péron et al. 2016, Huché-Thélier, Crespel et al. 2016, Ganesan, Lee et al. 2017). Depletion and reduction of red and blue wavelengths in light sources have shown to induce SAS in plants, resulting in elongated internodes and petioles, and thinner leaves (de Wit and Pierik 2016, Fraser, Hayes et al. 2016). Blue and red lights have shown to induce high ROS generation and SA accumulation, which cause cell death in leaves of plant (Gallé, Czékus et al. 2018). The influence of light wavelengths on plant growth can be seen throughout the analyses of several specific morphological responses such as germination, stem elongation, fresh mass accumulation rate, organ orientation, and leaf expansion (Fitter and Hay 2012). In Chapters 3, 4, and 5, morphological variations of Arabidopsis responses to narrow- wavelength will be presented.

2.5.1.1.2 Yield and Photosynthesis Light wavelengths directly affect all downstream reactions related to yield in plants (Cardona, Shao et al. 2018, Olle and Alsiņa 2019). In the majority of applications, the dominant consideration for selecting a specific light wavelength is yield of the plant (Olle and Viršile 2013). This is not the explicit objective in all production scenarios, as specific goals, such as increasing production of a certain compound within a plant, can be met through increased overall yields (Hasan, Bashir et al. 2017). Biomass yield is a product of primary metabolism in plants, driven by the light reactions that occur in a series of protein complexes embedded in the membranes of thylakoids, through photosynthesis process.

Amongst the numerous proteins involved in photosynthetic light reactions are two important protein complexes: PSII and PSI, distinct in which wavelengths of light they absorb. These PSs differ in their composition, with PSII being richer in Chlb and PSI being richer in Chla (Caffarri, Tibiletti et al. 2014). Both chlorophyll molecules absorb light across the visible spectrum, though some wavelengths are more strongly absorbed than others such as red and blue. In addition to chlorophyll molecules in the PSs, there are a number of accessory pigments that absorb light energy and pass that energy into photosynthetic reactions (Hogewoning, Wientjes et al. 2012). These can be categorized into a family of compounds called carotenoids and anthocyanins. As will be discussed in Chapter 3, not all of this absorbed light is used solely for photosynthesis, but this

57 can serve as energy to protect plants through photoprotection, while adversely affect plant yield. These generalized interpretations of how plants absorb and utilize photosynthetic light, as presented in Chapter 3, provide insights that inform the design of production light wavelengths favorable for yield.

2.5.1.1.3 Primary and Secondary Metabolites The quality of light has a pronounced effect on the accumulation of primary metabolites, which are essential for plant growth and reproduction and secondary metabolites that are closely associated with biotic and abiotic stress responses (Arbona, Manzi et al. 2013). Increased accumulation of plant metabolites, both primary and secondary (e.g., soluble sugars, starch, soluble protein, and vitamins) was observed in the presence of single-spectral red or blue LEDs when compared with white light (Johkan, Shoji et al. 2010, Li, Xu et al. 2010, Li, Tang et al. 2012). Ambient light supplemented with red or blue elevates the accumulation of organic acids, phenolic compounds, vitamin-C, tocopherol, soluble sugar and nitrate in different crops (Samuolienė, Brazaitytė et al. 2013, Dong, Fu et al. 2014, Choi, Moon et al. 2015, Bantis, Ouzounis et al. 2016). The work described in Chapter 3 is focused on the accumulation of photosynthesis and chloroplast photoprotective mechanisms, while assessing allocation of the generated energy. Two chapters, 4 and 5 present the identification and characterization of proteins involved in plant growth and development responses to narrow-wavelength, which are directly related to the primary processes of photosynthesis (light harvesting and energy conversion), the energy transduction machinery, and metabolic pathways.

2.5.1.2 Evaluating Narrow-Wavelengths for Plant Thylakoid Membrane Gene Regulation Plant responses to light signals are a result of a coordination between chloroplast and nuclear genes and the resultant proteins in the photosynthesis pathway. These organelles are thus the initial site of the response to various environmental conditions such as light signals.

Proteins involved in electron transport play a major role in electron distribution through the chloroplast. Different partial reactions of photosynthetic electron transport chain have led to the identification of light targets like the reaction center of PSII, LHCI, LHCII, the acceptor site of PSII, and the donor site of PSII. Under stress conditions, the activity of thylakoid membrane-

58 associated electron carriers and redox homeostasis are highly important (Suorsa, Jarvi et al. 2012, Yamori and Shikanai 2016). Response to the light signals thus highly needs a rapid responsive regulatory system to balance the photosynthetic light reactions under a fluctuating environment. Therefore, more attention should be paid to the photosynthesis system, when the target is the study of potential light stress signals. The work described in Chapters 3, 4, and 5 is focused on regulation of the thylakoid membrane in plant response to light wavelengths.

2.5.1.3 Evaluating Narrow-Wavelengths for Plant Proteins Expression Pattern Proteins are fundamental macromolecules involved in all aspects of life, from catalyzing metabolic reactions to providing a scaffold for cellular organization to transmitting external environmental changes into the nuclear transcriptional machinery. Improvements in the techniques for plant proteomics based on existing platforms such as two-dimensional gel electrophoresis (2- DE), liquid chromatography–mass spectrometry (LC-MS) and some new techniques such as tandem affinity and protein chips have been broadly used. Moreover, the exponential increase of available sequenced genomes allows access to genome-wide proteomics studies of an increasing number of plant species, such as Arabidopsis since 2000.

Extensive efforts have been invested in the optimization of the preparation of plant protein samples, overcoming mainly: (1) the low protein abundance in plant tissues, (2) the requirement to mechanically break up cell wall matrices to access cellular content and access cell wall proteins, (3) the high-dynamic range of individual protein concentrations, and (4) the abundant presence (relative to proteins) of contaminants, such as polysaccharides, nucleic acids, or polyphenols within the tissues. All of these factors are detrimental to allowing high proteome coverage in mass spectrometry–based proteomics experiments (Gupta, Wang et al. 2015). Therefore, alternative approaches have to be used to prepare plant protein samples compatible for downstream mass spectrometry analyses. The most popular scenarios are summarized in Figure 2.5 (Patole and Bindschedler 2019).

Until recently, nearly all studies have focused on a specific set of pre-selected gene pathways or based on low-coverage microarray chips and proteomics methods. Although limited in coverage, these studies reproducibly have shown that composition of incident light modulates plant

59 growth and development responses (Gupta and Pradhan 2017). The advent of high throughput proteomics using LC-MS/MS further allowed identification of the supporting proteins in the plant wavelengths responses. The most challenging proteomic measurements are small fold changes for lower abundance proteins. This highlights the importance of the proteome quantitation method in estimation and detection differential abundance across all expressed proteins. There exists considerable unexploited potential for TMT in the plant research community, in which this method allows significant increase of detection in the number of total quantified proteins, particularly among less abundant proteins, by higher precision across samples (Patole and Bindschedler 2019). Chapters 4 and 5 present the two most common methods for proteome-wide quantitation, shotgun proteomics and isobaric labeling with TMT to characterize the full spectrum of protein abundances in a proteome of Arabidopsis while they are treated by narrow-wavelengths.

Figure 2. 5. A systematic depiction of general workflow for proteomic analysis.

61 Connecting Text

Chapter 3, The effect of light quality on plant physiology, photosynthetic, and stress response in Arabidopsis thaliana leaves was authored by Nafiseh Yavari, Rajiv K. Tripathi, Bo- Sen Wu, Sarah MacPherson, Jaswinder Singh and Mark G. Lefsrud. Chapter 3 was submitted to the journal Scientific Report on Feb 06, 2020 and is currently under review.

In this chapter, we investigated the effects of light and genotype variations and their potential interaction on modulating plant growth and photosynthetic performance. Specifically, three Arabidopsis accessions Col-0, Est-1, and C24 were treated under three narrow-wavelengths of 450 nm, 595 nm and 650 nm, provided by LEDs. The analysis revealed that these wavelengths significantly impacted leaf growth, biomass, and pigment accumulation (chlorophylls, carotenoid, and anthocyanin). The result from this study further indicates that these wavelengths significantly affected Pn across accessions. This chapter further defines the regulatory effects and the probable induced chloroplast photoprotective mechanisms on photosynthetic light reactions in plants under 595 nm and 650 nm. Obtained results demonstrate that 595 nm signals stimulated the biosynthesis of secondary metabolites at the expense of photosynthate accumulation (proteins and starch). To tightly regulate ROS generation, plants also stimulated the content/activity of antioxidant enzymes. The presented data suggests effect of 595 nm light in regulating processes involved in the resource allocation. Collectively, this chapter provides insights on the complex relationship of narrow- wavelength lights with plant growth, photosynthesis, and stress responses.

62 3. Chapter 3: The effect of light quality on plant physiology, photosynthetic, and stress response in Arabidopsis thaliana leaves

Nafiseh Yavari, Rajiv K. Tripathi, Bo-Sen Wu, Sarah MacPherson, Jaswinder Singh, Mark G. Lefsrud

Additional index words. antioxidants, Arabidopsis thaliana, biomass, light-emitting diodes, photoprotection, photosynthesis, stress response

3.1 Abstract Light quality controls plant physiology, growth and photosynthesis. However, knowledge about the light quality-specific induced mechanisms of plant response is still limited. The aim of this study was to investigate the effects of light quality on leaf area and biomass, pigment content, and net photosynthetic rate (Pn) across three A. thaliana accessions Col-0, Est-1 and C24, compared to fluorescent light (FL), as control. Eleven-leaf stage Arabidopsis thaliana plants were treated with lights of blue (BL; 450 nm), amber (AL; 595 nm), red (RL; 650 nm), and fluorescent (FL), as control, for five days in an environment-controlled growth chamber. Leaf area, biomass content, pigment accumulation, and gas exchange were measured. RL significantly increased leaf area and biomass with promoting the net photosynthetic rate (Pn). RL also increased Chl a: b ratio and the content of determined photosynthate. BL increased leaf area and Pn value, as well as carotenoid and anthocyanin content. AL significantly reduced leaf area and biomass, while Pn remained unaffected and elongation of petiole was observed across accessions. To explore the potential light-induced stress response under AL, expression of the key marker light- responsive photosynthesis genes, enzymatic activity of antioxidants, and photosynthate contents of leaves were analyzed in accession Col-0 under AL, RL (as contrast), and FL (as control). Under RL, expression of ATPC1 and PSBA were increased after 2 to 24 h. AL induced the transcription of GSH2, and PSBA from 2 to 24 h, but downregulated both NPQ1 and FNR2 transcription between 2 to 24 h. Under AL, the activity of superoxide dismutase and ascorbate peroxidase enzymes were also enhanced. These results provide insight into plant growth and photosynthesis response to light qualities, in addition to identifying putative protective mechanisms that may be induced to cope with lighting stress to enhance plant tolerance.

63 3.2 Introduction Among various environmental factors, light is one of the most important variables affecting plant growth, photosynthesis and development (Smith 2000). Plants thus require light as an energy source for growth and photosynthesis and a signal of information to adjust their development to environmental conditions. It is widely understood that light quality can affect physiological and morphological traits and developmental processes in plants (Stenoien, Fenster et al. 2002, Dueck, van Ieperen et al. 2016). The wavelength range 430-500 nm was effective at simulating pigmentation, metabolism of secondary metabolites, photosynthetic function, and development of chloroplasts (Son, Park et al. 2012, Hernández and Kubota 2016, Huché-Thélier, Crespel et al. 2016, Li, Xu et al. 2017). 600-670 nm was found effective to promote an increase in plant biomass such as fresh and dry mass, and leaf area (Johkan, Shoji et al. 2010). It has also shown that it is critically important for the development of the photosynthetic apparatus, net photosynthetic rate (Pn), and primary metabolism (Demotes-Mainard, Péron et al. 2016, Hernández and Kubota 2016). Growing research on the wavelength range 500-600 nm has highlighted its important physiological and morphological effects on elongation growth, chlorophyll content, and photosynthesis function (Wang and Folta 2013, Wu, Su et al. 2014, Ma, Wang et al. 2015, Liu, Fu et al. 2017). In Arabidopsis, the light quality response differs between populations (Botto and Smith 2002).

During photosynthesis, absorbed energy is transferred to the photosynthetic apparatus, which is comprised of two photosystems (Photosystem I (PSI) and Photosystem II (PSII), electron transport carriers (PQ, cytb6f, PC), and ATP synthase (Blankenship 2002). The light-responsive photosynthetic process is driven by electrons released from water-splitting at PSII, followed by the reduction of NADP+ to NADPH, and proton flow into the lumen to generate ATP. Generated NADPH and ATP ultimately serves as an energy source for the consequent carbon fixation (Ceccarelli, Arakaki et al. 2004). Incident light of different quality can result in an imbalanced excitation of either PSII or PSI, affecting energy balance between photosystems and triggering stoichiometric adjustments of photosynthetic complexes (Croce and Van Amerongen 2014, Schottler, Toth et al. 2015). This imbalance between the two photosystems can result in generation of harmful reactive intermediates, mainly reactive oxygen species (ROS) (Tikkanen and Aro 2014, Zavafer, Cheah et al. 2015). Generation of ROS can result in an oxidative damage to chloroplasts,

64 leading to photosystem photo-inhibition that strongly limits plant growth (Barber and Andersson 1992). To maintain steady state photosynthesis efficiency and prevent ROS accumulation, plants activate the buffering mechanisms, including cyclic photosynthetic electron flow (CEF) and non- photochemical quenching (NPQ) (Murchie 2017, Yang, Xu et al. 2018). To scavenge ROS, plant further stimulates antioxidant mechanisms via enhanced activity of enzymes such as glutathione synthetase (GSS), ascorbate peroxidase (APX), superoxide dismutase (SOD) (Sharma 2016). However, the light quality characteristics that can induce such stress responses and their physiological consequence on the plant remains poorly studied.

Light emitting diodes (LEDs) provide an optimal tool to study the effect of light quality on plant development, metabolism, and biochemical responses (D'Souza, Yuk et al. 2015, Ma, Wang et al. 2015, Agarwal and Gupta 2016). To better understand the effect of light quality on plant growth and photosynthetic performance, we studied three LED arrays BL (450 nm), AL (595 nm), RL (650 nm), and compared with FL as the control. We chose the two light qualities BL and RL as leaf pigments have absorption spectrum peaks at these wavelengths (Schwieterman 2018). We also chose the AL since plants show a peak photosynthetic action spectrum under this wavelength, comparable with that of RL, and greater than that of BL (McCree 1971, Inada 1976), while weakly absorbed by the photosynthetic pigments (Terashima, Fujita et al. 2009). Although of high importance, the underlying physiological and molecular processes under AL remain elusive. Furthermore, to assess whether light quality-induced changes in plant growth and photosynthesis are mediated by the genotype, we investigated the light quality response in the three Arabidopsis thaliana accessions Col-0, Est-1, and C24. These accessions show different geographical distributions and hence are adopted to different environments. Congruently, they show a high degree of divergence in their photosynthetic responses to light environment (van Rooijen, Aarts et al. 2015).

To assess the impact of light quality on plant physiology, we designed a series of experiments. First, we investigated the physiological and photosynthesis response of A. thaliana to the three light qualities BL, AL, and RL compared to FL by measuring leaf area, biomass accumulation, gas exchange, and pigments content. Second, we tested whether changes in the plant response to the light quality are genotype specific by conducting the experiments across the three

65 A. thaliana accessions. Third, we investigated the potential induction of stress response under AL condition by testing whether there are light quality-specific changes in the expression of marker genes involved in light-responsive photosynthetic processes and enzymatic activity of antioxidants. Our findings expand the current understanding on how A. thaliana plant respond to different light qualities.

3.3 Materials and methods

3.3.1 Plant Materials and Growth Condition

Seeds from three A. thaliana accessions (Col-0, Est-1, and C24; Table 3.1) were obtained from the Arabidopsis Biological Resource Center (ABRC; Columbus, OH, US). Ninty eight seeds were placed in rockwool cubes (Grodan A/S, DK-2640, Hedehusene, Denmark) and incubated at 4 °C for 2 days. Fluorescent lights (FL; 4200 K, F72T8CW, Osram Sylvania, MA, US) were used as light sources for seed germination and plant growth in an environment-controlled growth chamber (TC30, Conviron, Winnipeg, MB, Canada). Seed density was adjusted to limit treated plants from shadowing each other. FL was placed over the plant-growing surface area (49 cm 

95 cm) at a low photosynthetic photon flux density (PPFD) of 69 to 71 µmol·m-2·sec-1. PPFD was measured at the conjunction of a grid (square area 3 cm2) placed over the growing area. After 21 days, plants formed rosettes with nine (C24) and eleven (Col-0 and Est-1) leaves (Figure 3.2A). To reach the same growth stage as Col-0 and Est-1 plants, C24 plants were allowed to grow for 23 days (Boyes, Zayed et al. 2001). Plants were hydroponically grown and fresh half-strength Hoagland nutrient solution (Hoagland and Arnon 1950) was provided every second day.

Table 3. 1. Origin of the three accessions of Arabidopsis used in this study.

Accession Full name Latitude Longitude Location Country Col-0 Columbia 38.3 -92.3 Columbia USA Est-1 Estland 58.3 25.3 Estland Russia C24 C24 40.2 -8.4 - -

66 3.3.1.1 Lighting Treatment After 21 (Col-0 and Est-1) or 23 (C24) days, twenty five plants were transferred to their respective light treatment for 5 days (before seedlings transformation from growth-developmental stage to floral stage), each with the same environmental conditions: 24 h photoperiod, 23 °C, 50

% relative humidity, and ambient CO2 levels of 407 ppm. 21-day old plants were randomly divided into four experimental groups and received treatment using light emitting diodes (LED) (VanqLED, Shenzhen, China) of BL (peak wavelength: 450 nm), AL (peak wavelength: 595 nm), and RL (peak wavelength: 650 nm). The fourth group was treated with FL (white broad-spectrum light: 400–700 nm) as the control. The light spectra (Figure 3.2B) and PPFD were monitored daily by using a PS-300 spectroradiometer (Apogee, Logan, UT, US). PPFD was maintained at 69 to 71

µmol·m-2·sec-1 throughout the whole plant growth period. Fresh half-strength Hoagland nutrient solution (Hoagland and Arnon 1950) was provided every second day. Biological replicates were grown at different time points under the same environmental settings. The details of the treatments are summarized in Figure 3.1.

Figure 3. 1. Flow diagram of study design. BL; peak wavelength: 450 nm; AL; peak wavelength: 595 nm; RL; peak wavelength: 650 nm; FL; wavelength range: 400-700 nm.

3.3.2 Physical and Biochemical Analyses

3.3.2.1 Leaf Area Determination Three plants per biological replicate were randomly selected for each measurement (four biological and two technical replicates). All leaves from the selected plants were used for the leaf

67 area determination. The leaf area (cm2) of the plants in each treatment group was measured after treatment (5 days). Digital images of leaves were taken with a window size of 640 x 480 pixels and a camera-object distance of approximately 80 cm. The digital images were next used to determine leaf area using Image J software with default settings (Bethesda, MD, US) as described previously (Leister, Varotto et al. 1999).

3.3.2.2 Biomass Content Determination Three plants per biological replicate were randomly selected for each dry mass determination (four biological and two technical replicates). Leaf samples were collected from plants. Dry mass (g) of collected leaves was measured before (0 h) and after light treatments (5 days). Leaves were dried at 80 °C for 2 days until a constant mass was achieved (less than < 5 % mass difference over a 2 h period).

3.3.2.3 Pigment Content Determination Five plants per biological replicate were randomly selected for each assay (four biological and two technical replicates). Leaf samples were collected from plants after treatment (5 days). Methods and equations described by (Porra, Thompson et al. 1989), (Holm 1954), and (Mancinelli,

Yang et al. 1975) were used to estimate pigment content (μg g-1 dry mass) for chlorophyll (Chl a and Chl b), carotenoids, and anthocyanin, respectively. Briefly, chlorophylls and carotenoids were extracted with 5 ml of 80% acetone at 4 °C overnight, before centrifugation at 13,000 g for 5 min. Total anthocyanins were determined by extracting with 5 ml 80% methanol containing 1% HCl solvent at 4 °C overnight, before centrifugation at 13,000 g for 5 min. The absorbance of the extraction solution was determined for Chl a (664 nm), Chl b (647 nm), carotenoids (440 nm), and anthocyanins (530 nm and 657 nm) using a UV–VIS spectrophotometer (UV-180, Shimadzu, Japan).

3.3.3 Gas Exchange Determination

Leaf gas exchange (net photosynthetic rate; Pn; µmol CO2·m-2·sec-1) was monitored before (0 h) and after treatment (5 days) using the LI-6400XT Portable Photosynthesis System (LI-COR Biosciences, Lincoln, NE, US) equipped with a 6400-17 Whole Plant Arabidopsis Chamber (LI- COR Biosciences). To reduce potential measurement errors, three plants were grouped as a single

68 sample for determinations (Pfannschmidt, Schutze et al. 2001). To avoid mismatch between the different light qualities, which were used for the LI-6400XT Portable Photosynthetic System, and the different LED lights, which used for light treatments (Walters 2005), Pn measurements were taken inside the environment-controlled growth chamber, in which whole plants (still embedded in rockwool) were placed and illuminated with used LEDs. As a precaution, parafilm was placed on top of the rockwool cube to maintain moisture within the root zone while measurements were recorded. The environmental conditions of the chamber were set as follows: 400 ppm CO2, 50% relative humidity, 23 °C, and 400 µl min-1 flow rate. Each measurement was taken over 20 min, including 5 min in the dark and 10–15 min under a light treatment at 69–71 µmol·m-2·sec-1. A stable Pn reading was reached 10 min after illumination. Leaf area was determined to normalize Pn per unit leaf area. Measurements for three replicates (three plants per replicate, three replicates per treatment) were performed.

3.3.4 Photosynthate Content Determination

Changes in photosynthate (protein, starch, and lipid) accumulation (mg g-1) were determined in the Arabidopsis accession Col-0 treated for 7 days under AL, RL, and FL. Previous studies reported that the diurnal cycle and developmental stage of plants, along with the stress response can affect the plant metabolism (Watanabe, Balazadeh et al. 2013, Onda, Hashimoto et al. 2015). Thus, a time course assessment prior to treatment (0 h), and after treatment (0, 1, 3, 5, and 7 days) was performed.

3.3.4.1 Protein Five plants per biological replicate were randomly selected for each measurement (four biological and two technical replicates). Leaf samples were collected from plants prior (0 h) and after light treatments (0, 1, 3, 5, and 7 days). Samples were immediately frozen in liquid nitrogen and stored at -80 ∘C, after which they were used for determination. Total protein content was measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA). As a standard, the absorbance of the bovine serum albumin was determined at 562 nm by a UV-VIS spectrophotometer (UV-180, Shimadzu, Japan).

69 3.3.4.2 Starch Five plants per biological replicate were randomly selected for each determination (four biological and two technical replicates). Leaf samples were collected from plants prior to treatment (0 h), and after treatment (0, 3, 5, and 7 days). Samples were immediately frozen in liquid nitrogen and stored at −80 °C, after which they were used for determination. A previously described method (Smith and Zeeman 2006) was used to estimate total starch content. Briefly, samples were homogenized in 0.7 M perchloric acid. The insoluble material was pelleted by centrifugation, washed three times in 80 % (v/v) ethanol, and re-suspended in water. Starch in the insoluble fraction was gelatinized at 95 °C for 15 min, and subsequently digested to glucose at 37 °C using α-amylase and amyloglucosidase (Roche, Diagnostics, Indianapolis, IN, USA). Starch content (in glucose equivalents) was determined by measuring the released glucose with hexokinase/glucose- 6-phosphate dehydrogenase. The absorbance of the extraction solution was determined by a UV- VIS spectrophotometer (UV-180, Shimadzu, Japan).

3.3.4.3 Lipid Twenty plants (five plants per replicate, four replicates per treatment) were randomly selected for each determination (four biological and two technical replicates). Leaf samples were collected from plants prior to treatment (0 h), and after treatment (0, 3, 5, and 7 days). Samples were immediately frozen in liquid nitrogen and stored at −80 °C, after which they were used for determination. A previously described method (Bligh and Dyer 1959, Cheng, Zheng et al. 2011) was used (with minor modifications) to estimate the total lipid content. Briefly, each sample was homogenized with a CHCl3/MeOH solution (1: 2; vol: vol) and centrifuged at 1000 rpm for 5 min. The supernatant was collected in a 15-mL falcon tube and incubated for 30 min at 70 °C in a boiling water bath. Next, 1 ml concentrated sulfuric acid was added in a sealed tube, placed in boiling water bath, and heated for 20 min. After placing on ice for 2 min, 1.5 ml of phosphoric acid reagent was added and incubated for 10 min until a pink color developed. The absorbance of the extraction solution was determined at 540 nm by a UV-VIS spectrophotometer (UV-180, Shimadzu, Japan). The calibration curve was generated using commercial corn oil as a standard.

70 3.3.5 Antioxidative Enzyme Activity Determination Five plants per biological replicate were randomly selected for each measurement (four biological and two technical replicates). Leaf samples were collected from plants after treatment (5 days) and were immediately frozen in liquid nitrogen and stored at -80 °C. Methods described by (McCord and Fridovich 1969) and (Nakano and Asada 1981) were used to monitor the activity of SOD and APX antioxidative enzymes, respectively. Briefly, 500 mg sample was homogenized in an ice bath using 5 mL extraction buffer containing 50 mmol/L potassium phosphate buffer (pH 7.8), 1 mmol/L EDTA (pH 8.0), and 20 μL enzyme extract. A 0.1 mmol/L ascorbic acid solution and a 0.1 mmol/L xanthine solution were used as a substrate for the APX and SOD assays, respectively. The homogenate was next centrifuged at 15,000 g for 15 min at 4 °C. The supernatant was collected and used for determination of SOD and APX enzyme activity (U mg-1 protein-1). One unit of SOD activity was defined as the amount of enzyme required to result in a 50% inhibition of the rate of reduction at 550 nm in 1 min. One unit of APX activity was defined as the amount of enzyme required to oxidize 1 μmol of ascorbate at 290 nm in 1 min. The SOD and

APX enzyme activity were determined as absorbance change at 550 nm and 290 nm (ɛ=2, 8 mM−1 cm−1), respectively. Enzymatic activity was measured for 5 min at room temperature. The protein content in the supernatant was determined by the Pierce™ BCA Protein Assay Kit. The activity of

SOD and APX was expressed as unit min−1 mg−1 protein−1.

3.3.6 Gene Transcription Analysis

3.3.6.1 cDNA Synthesis

Changes in transcription of the interested genes were analyzed in the A. thaliana Col-0 treated for 24 h under AL, RL, and FL. Five plants per replicate, four replicates per treatment, were randomly selected for each determination. Leaf samples were collected prior to treatment (0 h) and after treatment (2 h, 4 h, and 24 h). Total RNA was extracted from 100 mg rosette leaves using the Sigma Spectrum Plant Total RNA Kit (STRN50; Sigma, Seelze, Germany) according to the manufacturer’s protocol. A total of 2 µg RNA per sample was treated with amplification grade DNase I (Invitrogen, Carlsbad, CA, USA) to remove any traces of genomic DNA contamination. RNA concentrations were measured before and after DNase I digestion with a NanoDrop ND- 1000 UV-Vis spectrophotometer (NanoDrop Technologies, Wilmington, Delware, USA).

71 Gene Forward Primer Reverse Primer Accession Name Sequence (5'-3') Sequence (5'-3') number FNR2 TGTGTGGACTCAAGGGAATGGA CTCTGCCTTCTTCAACTGCTTCTTG AT1G20020 PETE1 ACCGTCACCATCCCTTCTTTCA ACTGCGATGACACCGAAATCCTT AT1G76100 PETC GTATTCCAGCAGACAGAGTTCCAGA AGGGACAAGCATGTAGCCAGTA AT4G03280 PGRL1B AGTGTCCTGCTCCCTTTACCCAT TGCTCTCAACTTCTTCCCCACCCA AT4G11960 ATPC1 AGTAGCTCTCGTTGTCGTCACC TCTTGCCCACGCTAATGACTGT AT4G04640 Fd2 TTCATTCATCCGTCGTTCCCCA ACGAGCGGTGCCTGATTTGA AT1G60950 PSBA AGTTTCCGTCTGGGTATGCG TAAAAAGGGAGCCGCCGAAT ATCG00020 RBCS1A TCGGATTCTCAACTGTCTGATG ATTTGTAGCCGCATTGTCCT AT1G67090 FTRB CTCGATGAATCTTCAAGCTGTTTC CAAAGCGGTGCACCATATGAATC AT2G04700 FAD6 ACTCTCGCCTTCCTACCACTTG CTCAAACTCCTCTGGCGGAACT AT4G30950 NPQ1 TGGGAGATCCTCACGTCCTTT CGAGTTTTAGCAACAGCGGAGC AT1G08550 GSH2 TTGCTACCAACTGCATTCCCAGA TGCCATCCAAGCTAACACGATCA AT5G27380 TIP2 CGCCGCTTGTTTCCTCCTTA AAGACGAGAGCGTTTAATGATCCGA AT3G26520 ACT2 CTTGCACCAAGCAGCATGAA CCGATCCAGACACTGTACTTCCTT AT3G18780

Table 3. 2. List of primers sequences used in qPCR experiments.

3.3.6.2 Primer Design Primers for genes of interest (Table 3.2) were designed using IDT software (https://www.idtdna.com/calc/analyzer) with the following criteria: Tm of 58°C –60 °C and PCR amplicon lengths of 70 to 120 bp, yielding primer sequences 20 to 25 nucleotides in length with G-C contents ranging from 40 % to 50 %.

Specificity of the resulting primer pair sequences was examined using the Arabidopsis Information Resource (TAIR) database with BLAST (http://www.arabidopsis.org/Blast/). Specificity of the primer amplicons was further confirmed by melting-curve analysis (30 amplification cycles by PCR and subsequent gel-electrophoretic analysis). Primer amplicons were resolved on 2 % (w/v)

agarose gels run at 110 V in Tris-borate/EDTA buffer, along with a 1 Kb+ DNA-standard ladder (Invitrogen).

72 3.3.6.3 Quantitative Real Time-PCR (qRT-PCR) Analysis Real-time qRT-PCR was performed with a MX3000P qPCR System (Agilent), using three biological and two technical replicates, as described previously (Singh, Tripathi et al. 2017). Relative expression was conducted following the manufacturer’s recommendations with two reference genes (TIP2; AT3g26520 and ACT2; AT3g18780) and the Brilliant III SYBR Green QPCR master mix (Agilent). Amplification was performed in a 20 µL reaction mixture containing 160 nmol each of primer, 1x Brilliant III SYBR Green QPCR master mix, 15µM ROX reference dye, and 0.3 µL cDNA template. Amplification conditions were 95 °C for 10 min (hot start), followed by 40 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. Fluorescence readings were taken at 72 °C, at the end of the elongation cycle.

3.3.6.4 Data Analysis Ct values were calculated with CFX-Manager and MX-3000P software. Relative expression changes (delta-delta Ct) were calculated according to (Pfaffl 2001) using A. thaliana TIP2 (AT3g26520) and ACT2 (AT3g18780) as reference genes. To avoid multiple testing, the p- values were only considered for 0 h with 24 h (a total of 12 genes and two light conditions). A gene was considered differentially expressed if P < 0.05 and the fold change pattern at 24 h was consistent with those observed at 2 h and 4 h.

3.3.6.5 Statistical Analysis Differences between light treatments were tested using the Student’s t-test. A two-way ANOVA was used to assess the effects of accession and different light treatments on leaf area, leaf biomass, Pn, and pigments content. We observed similar patterns using the non-parametric tests of Wilcoxon-Mann-Whitney and Kruskal-Wallis tests (data not shown).

73 3.4 Results

3.4.1 Effect of light quality and natural genotype variation on A. thaliana leaf area and biomass accumulation

To assess the effects of light quality on different accessions, eleven-leaf stage A. thaliana accessions Col-0, Est-1, and C24 were randomly divided into four groups and treated for 5 d under BL, AL, RL, or FL (Figure 3.2B). Compared to FL, the leaf area was significantly increased across accessions under RL. Under AL, leaf area showed a severe reduction in Col-0 and C24, while petiole was noticeably elongated. In contrast, the leaf area showed no change in Est-1 under AL. Under BL, leaf area was significantly increased in C24 and Col-0, but there was no significant leaf area change in Est-1 under BL (P < 0.05; Figure 3.3A).

The leaf mass significantly increased under RL across the three accessions compared to FL (P < 0.05; Figure 3.3B). Under AL, the leaf mass was significantly lower in Col-0 and C24 (P < 0.01; Figure 3.3B), while it showed no change in Est-1 compared to FL (Figure 3.3B). Under BL, the leaf mass was significantly decreased in Est-1 and C24 but increased in Col-0 compared to FL (P < 0.01; Figure 3.3B).

Figure 3. 2. Effect of BL, AL, and RL on the morphology of A. thaliana accessions. A) Eleven- leaves stage A. thaliana accessions (Col-0, Est-1, and C24) grown hydroponically and treated for 5 days under BL, AL, and RL LEDs, as well as FL. B) Light emission spectra of LED light sources and FL.

74 3.4.2 Impact of light quality and natural genotype variation on A. thaliana leaf gas exchange and pigment content

Pn was significantly increased under RL across the accessions compared to FL (Figure 3.3C). In contrast, there was no significant difference in Pn under AL compared to FL (Figure 3.3C). Under BL, the Pn levels of Col-0 and Est-1 were significantly increased (P < 0.05; Figure 3.3C) but remained unchanged in C24 (Figure 3.3C).

In Col-0 and C24, there was no significant difference in contents of chlorophyll b (Chl b) and chlorophyll a (Chl a) under the three light qualities compared to FL (Table 3.3). In contrast, content of Chl a was significantly increased in Est-1 under RL (P < 0.05; Table 3.3). Across accessions, Chl a/b content was significantly increased, remained unchanged, and decreased under RL, BL, and AL, respectively (Table 3.3). Moreover, there was no significant difference in carotenoid and anthocyanin contents across the accessions under AL and RL compared to FL (Table 3.3). Under BL, carotenoid content was significantly increased in Est-1 and Col-0 compared to FL (Table 3.3). Additionally, anthocyanin content was significantly increased in Est-1 and C24 compared to FL (Table 3.3).

FL BL FL BL FL BL (A) AL RL (B) AL RL (C) AL RL 1.2 * * * * n.s. n.s. ) n.s. * n.s. n * ** n.s. * ** P n.s. n.s. ** ** ( 4

* 0.15 )

0.9 ** ** e * *

)

a -

* s **

s s

. 3

e . a 0.10

0.6 r **

)

O r

2 *

g *

(

( 2

** l

a (

e m

0.3 0.05 t

µ (

o 1

B t 0 e 0.00 N 0 Col−0 Est−1 C24 Col−0 Est−1 C24 Col−0 Est−1 C24 Accessions Accessions Accessions

Figure 3. 3. Effect of BL, AL and RL on leaf area, biomass, and Pn of A. thaliana accessions. A) Leaf area was measured in four biological replicates for each light treatment. B) Biomass content (Dry mass). Leaf samples of three plants per biological replicate were collected for determination

75 (four biological replicates for each light treatment). C) Net photosynthetic rate (Pn), measured at

69-71 µmol·m-2·sec-1. Data are expressed as mean values ± SD. Statistical analysis was performed against FL using a Student’s t test (n.s.: not statistically significant; *: P < 0.05; **: P < 0.01).

Table 3. 3. Effect of BL, AL and RL on pigments content of A. thaliana accessions. Leaf samples of five plants per replicate were collected for each determination. Data are expressed as mean values ± SD (μg g-1 dry mass). Statistical analysis was performed against FL using a Student’s t- test (*, P < 0.05 and **, P < 0.01).

Accession Parameters BL AL RL FL Col-0 Chl a 412.3 ± 42.9 314.6 ± 12.7 441.1 ± 27.2 381.9 ± 25.8 Chl b 148.3 ± 13.0 125.0 ± 5.6 132.5 ± 7.9 147.6 ± 4.5

Chl a: b 2.86 2.52* 3.17** 2.78

Anthocyanin 77.8 ± 6.3 71.2 ± 7.7 72.3 ± 5.7 68.9 ± 5.7

Carotenoids 97.8 ± 5.0* 84.7 ± 7.8 67.4 ± 8.0 76.1 ± 5.8 Est-1 Chl a 416.6 ± 34.1 325.7 ± 42.2 478.4 ± 11.2* 417.7± 16.9 Chl b 142.6 ± 12.0 130.1 ± 15.9 149.7 ± 3.2 143.3 ± 10.6

Chl a: b 2.95 2.51** 3.22* 2.91

Anthocyanin 91.9 ± 1.5** 76.4 ± 3.2 75.5 ± 5.5 78.1 ± 0.6

Carotenoids 95.5 ± 1.6* 91.7 ± 3.1 83.2 ± 4.3 80.1 ± 3.8 C24 Chl a 446.6 ± 21.7 359.7 ± 2.9 465.3 ± 9.1 405.4 ± 39.4 Chl b 153.7 ± 9.3 145.7 ± 8.0 132.3 ± 9.8 129.9 ± 10.8

Chl a: b 2.91 2.61** 3.22** 2.87

Anthocyanin 89.7 ± 0.4** 76.5 ± 5.7 81.5 ± 4.2 79.2 ± 0.5

Carotenoids 104.8 ± 8.3 93.0 ± 1.6 83.5± 0.5 87.0 ± 2.1

76 Table 3. 4. Summary of the two-way ANOVA analysis performed on A. thaliana accessions and effects on the determined parameters. Shown are p-values for each set of tests. *, Significant effects (*P < 0.05, ** P < 0.01, *** P < 0.001)

Parameter Light Genotype Interaction

Net photosynthetic rate (Pn) 5.05 x 10-10 *** 0.4096 0.2586

Biomass (dry mass) < 2.20 x 10-16 *** 7.81 x 10-11 *** 2.11 x 10-07 ***

Leaf area (cm2) 1.60 x 10-12 *** 3.27 x 10-14 *** 0.002279 ** Chlorophyll a 0.0002218 *** 0.3171671 0.9187594 Chlorophyll b 0.1194 0.5281 0.2175 Carotenoids 0.0001152*** 0.0232754* 0.7358857 Anthocyanin 0.01634* 0.02138* 0.91437

3.4.3 Changes in the transcription of marker genes associated with light-responsive photosynthetic process in A. thaliana Col-0 under AL and RL

The severe reduction in the leaf area and mass along with unchanged levels of Pn suggested induction of stress signals in photosynthetic response of Col-0 and C24 under AL. To more directly test this hypothesis, we next explored transcriptional changes in marker genes associated with the photosynthetic light reaction under AL (Figure 3.4A; Table 3.2). The accession Col-0 was chosen for the transcription analysis, as it is the most common A. thaliana accession. In addition to AL and FL, the gene transcription levels of plants treated with RL was investigated since plants showed an opposing change in leaf area, leaf biomass and photosynthetic responses under RL compared to AL. Gene expression analyses indicated a significant increase of the ATPC1 (member of ATPsynthase complex) and PGRL1B (member of CET complex) transcripts after 24 h treatment with AL (P < 0.05; Figure 3.4B). ATPC1 transcription was also significantly increased under RL after 24 h (P < 0.05; Figure 3.4B). No significant difference was observed in the transcript levels of the selected markers of the linear photosynthetic electron transfer (i.e., Fd2, PETE1, and PETC genes) under both AL and RL (Figure 3.4B). Transcription of the FNR2 gene was significantly decreased after 24 h treatment with AL, while itremained unchanged under RL (P < 0.05; Figure

77 3.4B). The transcript level of RBCS1A was significantly reduced at 2 h and 4 h under both AL and RL. However, RBCS1A transcript level was recovered after 24 h under RL, while remained downregulated under AL.

To confirm changes in the ATPsynthase and CET complexes under AL, we leveraged available proteomics data where eleven-leaves plants of A. thaliana Col-0 were grown under AL and RL for 5 days (Yavari, Kushalappa et al. Submitted). Consistent with the observed transcriptomic data, a significant increase in the protein abundance levels were observed for both

CET (P < 1.3 x 10-12; Figure 3.5A) and ATPsynthase (P-value < 2 x 10-4; Figure 3.5B) complexes in AL compared to RL.

Figure 3. 4. A schematic model of light-responsive photosynthetic process and effect of AL and RL on transcription of selected genes in Arabidopsis Col-0. A) Genes of interest are highlighted in green. B) Transcription of genes implicated in the light-responsive photosynthetic process that is located within the thylakoid membrane. A time course assessment prior to treatment (0 h), and after treatment (2 h, 4 h, and 24 h) of AL and RL was performed, compared to FL. All data were normalized to the housekeeping genes TIP2 (AT3g26520) and ACT2 (AT3g18780). Red borders represent significant changes in expression (p-value <0.05). Studied genes include: ATP synthase gamma chain 1, ATPC1 (AT4g04640); fatty acid desaturase 6, FAD6 (AT4g30950); ferredoxin-

2, Fd2 (AT1g60950); ferredoxin-NADP+-oxidoreductase, FNR2 (AT1g20020); (Fdx)- thioredoxin (Trx)-reductase, FTRC (AT2g04700); glutathione synthetase, GSH2 (AT5g27380);

PSII non-photochemical quenching, NPQ1 (AT1g08550); cytochrome b6f complex (Cyt b6f),

78 PETC (AT4g03280); plastocyanin, PETE1 (AT1g76100); proton gradient regulation Like 1, PGRL1B (AT4g11960); photosystem II protein D1, PSBA (ATCG00020) and ribulose bisphosphate carboxylase small chain, RBCS1A (AT1g67090).

(A) AL RL (B) PNSL2_ARATH AL RL NDHS_ARATH

NDHT_ARATH ATPD_ARATH PGR5_ARATH

ATPG2_ARATH l

e v

PNSL3_ARATH e l

YMF19_ARATH n

PNSL4_ARATH o

i s

ATPH_ARATH s 1 e

PNSB1_ARATH r p

ATPI_ARATH x e

NDHO_ARATH

d 0 ATPA_ARATH e

NDHN_ARATH z

i l ATPB_ARATH a PNSB3_ARATH m

r −1 o

PNSB5_ARATH ATPE_ARATH N NDHL_ARATH LHCA5_ARATH PNSL5_ARATH PNSB2_ARATH PNSB4_ARATH PGL1A_ARATH PGL1B_ARATH NDHU_ARATH NU1C_ARATH NDHM_ARATH NDHK_ARATH NDHI_ARATH NDHJ_ARATH NDHH_ARATH NU5C_ARATH NU4LC_ARATH NU4C_ARATH FER2_ARATH NU2C1_ARATH PNSL1_ARATH

Figure 3. 5. Proteins involved in ATPsynthase and CET complex of A. thaliana Col-0 are upregulated under AL (595 nm) compared to RL (650 nm). In this experiment, eleven-leaves stage plants were grown under either AL or RL for 5 days (three biological replicates per light condition). A) The expression pattern of protein members involved in Cyclic electron transfer (CET) complex. B) The expression pattern of protein members involved in ATPsynthase complex. Expression levels for each protein is normalized to have mean of zero and standard deviation of one. Yellow or blue color indicates upregulation or downregulation, respectively.

79 3.4.4. Regulation patterns of PSBA, NPQ1, GSH2 and FAD6 transcripts in A. thaliana Col-0 under AL and RL

Transcription of PSBA was significantly upregulated at 4 h and 24 h under RL (P < 0.05; Figure 3.4B). Under AL, PBSA also showed a similar increase after 4 h (P < 0.05; Figure 3.4B); However, its transcription level reduced to a comparable level with FL after 24 h under AL. Transcription of NPQ1 was significantly downregulated after 24 h under AL (P < 0.01; Figure 3.4B), while remained steady under RL (Figure 3.4B). Transcription of GSH2 gradually increased between 2 h and 24 h when treated under AL (P < 0.01; Figure 3.4B). GSH2 transcription showed a similar increasing trend between 2 h and 4 h under RL (P < 0.01) but reduced to a comparable level with FL after 24 h (Figure 3.4B). No significant difference was observed in FAD6 transcription after 24 h of treatment under either AL or RL (Figure 3.4B). Analysis of available proteomic data (Yavari, Kushalappa et al. Submitted) indicated that these genes are significantly differentially expressed between AL and RL at the proteome level after 5 days of light treatment.

3.4.5 Photosynthate contents in A. thaliana Col-0 under AL and RL

We next probed changes in photosynthate accumulation in Col-0 leaves treated under AL, RL, and FL. Lipid, proteins and starch were measured in Col-0 at days 0, 1, 3, 5, and 7 (Figure 3.6). Protein and starch levels in leaves increased under RL, but gradually decreased under AL compared to FL (P < 0.05; Figure 3.6). Total lipid content gradually increased in plants treated under both AL and RL (P < 0.05; Figure 3.6A).

Figure 3. 6. Effect of AL and RL on photosynthate accumulation in Arabidopsis Col-0. A) Lipid; B) Protein; C) Starch. Leaf samples of five plants per replicate were collected for each

80 determination. Data are expressed as mean values ± SD (n = 4). Statistical analysis was performed against FL using a Student’s t-test.

3.4.6 Antioxidative enzyme activity in A. thaliana Col-0 under AL and RL

We examined the antioxidative enzymatic activity of superoxide dismutase (SOD) and ascorbate peroxidase (APX) enzymes in accession Col-0 treated under AL, RL, and FL (Figure 3.7). After 24 h, activity of the both antioxidants were significantly increased under AL (P < 0.05; Figure 3.7), while no significant changes were observed for either of these enzymes when plants were treated with RL.

AL AL RL RL (A) FL (B) FL n.s. n.s. * **

0.100

)

e t

t 0.15

o r

r 0.075

0.10

U (

( 0.050

t c

c 0.05 a

a 0.025

0.00 0.000

Col-0 Col-0

Figure 3. 7. Effect of AL and RL on SOD and APX activity in Arabidopsis Col-0. A) Superoxide dismutase (SOD) activity. One unit of SOD activity was defined as the amount of enzyme required to result in a 50% inhibition of the rate of reduction at 550 nm in 1 min. B) Ascorbate peroxidase (APX) activity. One unit of APX activity was defined as the amount of enzyme required to oxidize 1 μmol of ascorbate at 290 nm in 1 min. Leaf samples of five plants per replicate were collected for each determination. Enzymatic activity was measured for 5 min at room temperature and data are expressed as mean values ± SD (n = 3). Statistical analysis was performed against FL using a Student’s t test (n.s., not statistically significant; *, P < 0.05; **, P < 0.01).

81 3.5 Discussion In this work, we investigated the impact of three light qualities BL, AL, and RL on leaf growth and photosynthesis across three A. thaliana accessions of Col-0, Est-1, and C24. The analysis clearly demonstrated the significant impact of the light quality on leaf area, biomass, and pigments accumulation (chlorophylls, carotenoid, and anthocyanin). Results also indicated that the light quality significantly influences Pn levels across accessions, consistent with the fact that leaf photosynthesis is wavelength-dependent in higher plants (Hoover 1937).

3.5.1. Importance of genotype impact on light quality response of leaf growth and biomass

The selected accessions of Col-0, Est-1, and C24 have different geographic habitats. This has resulted in a high degree of divergence in their photosynthetic responses to light (van Rooijen, Aarts et al. 2015). Consistently, we found that the same light quality could differently impact the leaf area and biomass across the accessions. Importantly, as further elaborated below, the observed genotype specific responses in leaf area and biomass were specific to AL and BL, while the three accessions showed similar patterns of change under RL light conditions. Our findings are consistent with previous reports on different accessions and light quality treatments, and underscores the importance of considering the genotype in characterizing the impact of light quality on the leaf growth (Köhl, Tohge et al. 2017).

3.5.2. Findings on BL supports its role on activation of protective pigments

Under BL, leaf area and biomass changed differently across accessions. Col-0 showed an increase in both leaf area and biomass, while C24 exhibited a reduced leaf biomass and an increased leaf area. The leaf biomass was also reduced in EST-1 under BL. A reduction in leaf biomass with an increase leaf area under BL is also reported on tomato at low light irradiances (Nanya, Ishigami et al. 2012, Hernández and Kubota 2016). This decrease is likely a result of reduced light interception and the possibility of lower light use efficiency in plants under BL.

Our findings demonstrate an increased biosynthesis of carotenoid and anthocyanin under BL, confirming the role of BL in stimulating carotenoid and anthocyanin accumulation in plants (Taulavuori, Hyöky et al. 2016). Plants grown under BL showed no change in Chl a:b ratio across

82 accessions which is similar to a previous report (Hogewoning, Trouwborst et al. 2010). This lack of change in Chl a:b suggests a low adaptation of photosystems under BL (Krupinska, Melonek et al. 2013). However, instead of a possible lower photosynthesis function, all accessions showed significantly increased Pn under BL. We also found an excess production of protective pigments including carotenoids and anthocyanins under BL. Carotenoids and anthocyanins have protective roles for chloroplast membranes against photooxidation, and help plants to maintain their photosynthetic performance (Mawphlang and Kharshiing 2017, Yu, Liu et al. 2017). Therefore, our results confirm that plants activate light protective mechanisms under BL to cope with the induced light stress condition, resulting in an increased photoprotective pigments accumulation in plants under BL. Notably, we find different patterns in accumulation of the carotenoid and anthocyanin pigments in different accessions, suggesting that different accessions employ different protective mechanisms based on their natural adaptations.

3.5.3. Plants showed high antioxidative and photo-protective under AL

Col-0 and C24 plants showed a severe reduction in leaf area and biomass content, while Est-1 were unaffected. Interestingly, the Pn levels were unchanged under AL across accessions. Col-0 and C24 plants have lower acclimation capacity than Est-1 (van Rooijen, Aarts et al. 2015), it could thus be due to the divergence in photosynthetic responses of accessions to light environment. Plants also showed a noticeable elongation of petioles under AL compared to the FL, suggesting the leaf resources are redirected from leaves to petioles. This phenomenon commonly occurs in response to low lighting conditions (Pigliucci and Kolodynska 2002) helping plants to harvest more light photons reaching to the leaf surface.

Our findings suggest induction of stress in plants treated under AL. Leaves treated under AL contained lower photosynthates including protein and starch. A lower accumulation of proteins was previously observed under AL (Wang, Gu et al. 2009) suggesting a positive contribution of downregulated Rubisco genes, as it is the main protein in leaves. Similar downregulation was also observed in transcription of RBCS1A (small subunit of Rubisco) in leaves treated under AL. A lower content of carbohydrates under stress condition has been observed before in A. thaliana (Velez-Ramirez et al., 2011). We also observed a significant downregulation of FNR2 under AL. FNR2 modulates the efficiency of electron distribution between the photosynthetic electron

83 transport flow and the stromal metabolic pathways, especially the Calvin cycle (Hanke and Mulo, 2013; Mulo and Medina, 2017). This observation thus suggests a reduced conversion of light energy into chemical energy during photosynthesis under AL. High capacity for lipid accumulation was observed for plants treated under AL. Lipid accumulation had been previously linked to oxidative stress (Singer et al., 2016), suggesting an increase in lipophilic antioxidants such as tocopherols, which play an important role in scavenging of singlet oxygen (Rastogi et al., 2014). Moreover, we found a significant increase in both expression and enzymatic activity of antioxidants. Antioxidative mechanisms are stimulated to protect the photosynthetic apparatus from incurring damage via ROS detoxification (Selmar and Kleinwachter, 2013; Sharma, 2016). Our results thus suggest that plants grown under AL tried to cope with a potential ROS stress condition.

Corroborating the induction of stress response under AL, we observed a significant upregulation of glutathione biosynthesis, transcription of PGRL1B and ATPC1, markers of ATPsynthase and CET complexes, at the transcript level under AL. Further supporting a potential elevated activity of ATPsynthase and CET complexes under AL, we observed the members of these complexes are significantly upregulated at protein level under AL compared to RL (Yavari, Kushalappa et al. Submitted). It was proposed that CET activates at low light to enhance the ATP synthesis for the fast repair of PSII and to sustain photosynthesis (Huang et al., 2010). During CET, electrons are cycled around PSI, and protons translocated to generate a proton gradient across thylakoid membranes (Shikanai and Yamamoto, 2017). In addition to contributing ATP synthesis, another function of the generated proton gradient is linked to excess energy dissipation as heat from PSII antennae (Takahashi et al., 2009). Upregulation of CET and ATP synthase thus suggests the accelerated rate of PSII repair through elevated ATP synthesis (Yamori et al., 2015; Huang et al., 2017). Overall, our results suggest AL as a potential induced-protective light, which assist plants to cope with the induced-stress condition through activating protection mechanisms, resulting in activated CEF and ATPase complexes and enhanced activity of antioxidative enzymes ASP and APX under AL.

84 3.5.4. RL showed a high regulatory role on plant adaptation and energy assimilation

We found that leaf area was significantly increased under RL across accessions, which in turn enabled a greater light interception by the leaves (Fila and Sartorato 2011). This agrees well with the increased Pn that was observed across accessions. These observations along with a significant increase of biomass suggests proper plant adaptation under RL across accessions. We also found a significant increase in the Chl a:b ratio under RL across accession. Chl a is mainly concentrated around PSI and PSII, whereas Chl b is most abundant in light-harvesting complexes (Venema, Villerius et al. 2000). An increase in Chl a:b ratio can increase the likelihood of an efficient electron transfer system within the chloroplast membrane (Armond, Schreiber et al. 1978). This, in turn, could positively influence the photosynthetic performance in plants under RL. Considering that highly turnover of D1 protein is key to maintain the PSII function and consequently, photosynthetic performance in leaves (Zavafer, Cheah et al. 2015), an increasing trend of PSBA expression was observed in plants exposed to RL. The PSBA is critical for both the de novo synthesis of the D1 protein during the repairs to PSII (Nishiyama, Allakhverdiev et al. 2011, Sugiura and Boussac 2014). Therefore, the transcription of the PSBA gene could play an important role in the process of D1 protein turnover under RL. Plants also showed that leaf photosynthates (starches, lipids, proteins) increased under RL. Overall, our results present RL as a potential induced-protective light, which assists plant with assimilation processes for energy, resulting in an increased efficiency for leaf growth, photosynthesis performance, and photosynthates accumulation in plants under RL.

3.6. Conclusion Our work demonstrates the benefit of LED experimental design on decoding the complex linkage between light quality and leaf growth, photosynthesis, and stress responses in higher plants. The use of RL, even at a low intensity, shows promise as a supplementary light source even for accessions with relatively weak light acclimation capacities including Col-0 and C24. We find exciting interactions between BL and natural genotype variations in plant that could be exploited to investigate the photosynthetic performance and photoprotection response mechanisms. Data further presents AL as a potential light source to investigate plants tolerance, in which light modulates the light-responsive photosynthetic processes. Although our work provides insights on the light quality response of plants, further studies are necessary to fully characterize the observed

85 physiological responses. Such knowledge can ultimately help to improve the yield and quality of plant products through optimization of light quality treatments.

86 Connecting Text Chapter 4, Proteomic analysis provides a brief insight into Arabidopsis thaliana response under narrow spectrum LED of 595 nm light, was authored by Nafiseh Yavari and Mark G. Lefsrud. Chapter 4 was submitted to the Journal of Proteomics on July, 2019 and is published in J Proteomic Bioinform on December, 2019.

In this chapter, we compare the protein content of Arabidopsis Col-0 leaves treated under 595 narrow-wavelengths and those treated under fluorescent to measure changes in the proteins expression levels, we used a shotgun proteomics methodology, known as multidimensional protein identification technology (MudPIT). The detected proteins were analyzed to uncover the underlying molecular mechanism in plants response under 595 nm. Differential expression analysis followed by a functional classification analysis of the identified differentially expressed proteins (DAPs) demonstrated the involvement of physiological processes in plant response to stimulus and stress to 595 nm. Specifically, a constructed protein-protein network from the DAPs depicted the core proteins, participated in plant energy metabolism and stress tolerance under 595 nm. Furthermore, proteomics data presented some of the 595 nm-responsive proteins involved in carbohydrate and amino acid metabolism. Following the knowledgebase developed in Chapter 3, Chapter 4 identifies the proteins that may thus regulate the chloroplast metabolic reactions in optimizing resource allocation that connects plant development and adaptation under 595 nm. This chapter defines the molecular mechanisms underlying plants response to 595 nm and highlights the impact of 595 nm as a potential regulatory signal in plant production associated with targeted lighting. The finding can induce research interests to further expand the biologically relevant contexts where plants are exposed to changing season and/or shaded environment, important to plant adaptation and production. In Appendix A, and B a detailed ProLuCID search.xml used to verify the peptide sequence matching (PSM) obtained from PatternLab program coupled with the PatternLab workflow including the peptide identification, statistically filtering and quantitating PSMs, data analysis and quantification, is presented in text, and figures. Appendix C provides the list of proteins and their spectral count across the two top samples in the PatternLab for Proteomics search used for the analysis of 595 nm and FL grown plants.

87 4. Chapter 4: Proteomic analysis provides insights into Arabidopsis thaliana response under narrow-wavelength LED of 595 nm

Nafiseh Yavari, Mark G. Lefsrud

Additional index words. Arabidopsis thaliana; light wavelength; mass spectrometry; protein- protein interaction; quantitative proteomic; tolerance

4.1 Abstract 595 nm is a narrow-wavelength of light spectrum that regulates a wide range of plant processes, including growth, photosynthesis and tolerance responses. However, molecular mechanisms underlying 595 nm induced signals are not known. The aim of this work was to study the comparative proteome changes in leaves of Arabidopsis thaliana plants. Plants were treated under the narrow-wavelength 595 nm and fluorescent light conditions. The objective was handled using inline three-phasic liquid chromatography coupled to LTQ which resulted in identification of 1538 proteins. Linear regression modeling of protein relative abundance revealed a total 23 differentially abundant proteins (DAPs). Functional analysis of the DAPs demonstrated role of several biological mechanisms in plant response to 595 nm including stress response and metabolic processes. Network level analysis of DAPs demonstrated the importance of energy and redox regulation mechanisms in plant response to 595 nm. Our results determined an important role for proteins associated with glycolysis, ATP synthase complex, stress response, cell wall modification and particularly, those are involved in thylakoid membrane in modulating plant adaptation under 595 nm. Further supporting a role of plant adaptation mechanisms under 595 nm, we found a significant enrichment of DAPs for PSII tolerance capacity and associated Ca2+ and ROS signaling pathways. Collectively, this study provides important insights into potential molecular pathways underpinning plant response to 595 nm.

4.2 Introduction The spectral quality of the radiation adopted in the plant production systems drives the growth and development of the crops (Gupta and Agarwal 2017). Therefore, it is possible to influence plant growth and development through controlling light-signal-response mechanisms to

88 significantly improve production (Pinho and Halonen 2017). For example, a five-fold increase in the annual productivity of cucumber was reported in greenhouses from 50 to 250 kg/m2 by controlling spectral light such as blue and red wavelengths. With the fast growth of the world population and effects of climate change, controlled environment agriculture is expected to become a promising solution (Bisbis, Gruda et al. 2018). Understanding the mechanisms of plant spectral light response and tolerance is extremely important for improving plant agriculture productivity, and global food security.

Plants have developed a sophisticated sensory system to optimally grow and regulate numerous developmental processes to adopt to ambient light quality conditions (Chen, Liu et al. 2014, Higuchi and Hisamatsu 2016). With specific radiation, a variety of receptor molecules, often proteins, have been shown to be involved in monitoring, and consequently transducing the induced signals to trigger a response (Larner, Franklin et al. 2018). The signal-response networks often involve complex interactions between many different processes and signal transduction to regulate gene expression and translational responses throughout the whole plant (Gupta and Pradhan 2017).

Within the photosynthetically active radiation (PAR) light spectrum (400–700 nm), plant photoreceptors perceive the major wavelengths corresponding to blue (400–500 nm), red (600– 700 nm), and less in green (500-600 nm) (Pocock 2015). While only around 10–50% of these regions are reflected by plant chloroplasts (Terashima, Fujita et al. 2009), there is a misconception that plants do not make use of the green wavelengths regions (500 to 600 nm) (Smith, McAusland et al. 2017). Within this region, there is a narrow-wavelength with a peak at 595 nm, that increasing research has highlighted for its physiological impact on plants growth and photosynthesis (Wang, Gu et al. 2009, Wu, Su et al. 2014). For example, the reported consequences of 595 nm are a significant reduction in growth, chlorophyll content, photochemical quenching (qP) and quantum efficiency of PSII photochemistry. As, this wavelength is shown to be weakly absorbed by photosynthetic pigments (Terashima, Fujita et al. 2009), 595 nm is argued as a less efficient light energy source in driving photosynthesis (Wang, Gu et al. 2009, Brazaitytė, Duchovskis et al. 2010, Yan, Wang et al. 2014, Tanaka, Ohno et al. 2016). Congruently, under 595 nm, the activity of Rubisco was shown to decrease due to the slowing down of photosynthesis. Illumination of 595 nm has resulted in elongation growth and less leaf area in plants. Further

89 impact is a decrease in CO2 fixation and net photosynthesis, leading to reduced growth and yield (Wang, Gu et al. 2009, Brazaitytė, Duchovskis et al. 2010). However, McCree et al. showed that 595 nm light has some of the highest photosynthetic action spectrum of any of the wavelengths of light tested (McCree 1972). Additionally, 595 nm has shown high regulatory role on abundance and activity of key proteins to mediate higher tolerance in plant (Yu, Liu et al. 2017). For instance, 595 nm induced the abundance/activity of antioxidant enzymes such as superoxide-dismutase (SOD), catalase (CAT), and peroxidase (POD) to reduce the accumulation of free radicals. Thus, 595 nm regulates an integrated molecular network at multiple levels to bring about tolerance responses. Despite being a probable light source to understand regulatory signals in plant growth and development related to stress signals and tolerance response, the molecular mechanisms and impact on plant growth underlying the effect of the 595 nm light wavelength remain unclear.

Proteomic techniques have been shown as a powerful means to detect the quantitative variations in relative abundance of proteins, as the fundamental clue in the cellular biological processes under defined environmental conditions (Rajjou, Gallardo et al. 2018). To investigate the molecular mechanism underlying the plant responses to 595 nm light wavelength, a linear ion trap mass spectrometer (LTQ) was applied. As studies demonstrated that the plant growth, photosynthesis and developmental responses to 595 nm are in direct opposition to the normal progression of light-mediated processes, we compared the changes in proteins abundance of the model plant Arabidopsis treated under 595 nm and FL, as the control. The result revealed many differential proteins associated with pathways that were activated/repressed in plants under 595 nm. The differential proteins are enriched in ROS signaling, stress response, photosynthesis and metabolic process. This study highlights light wavelength regulated molecular networks and potential pathway crosstalks in plant growth and stress tolerance under 595 nm.

4.3 Materials and Methods 4.3.1 Plant Material and Growth Conditions Seeds of Arabidopsis accession Col-0 were obtained from the Arabidopsis Biological Resource Center (ABRC; https://www.arabidopsis.org). Hundred seeds were dark-incubated at 4°C. After 2 days, 98 seeds were placed in rockwool cubes (Grodan A/S, DK-2640, Hedehusene,

Denmark) to grow for 21 days at a photosynthetic photon flux density (PPFD) of 69-70 µmol·m-

90 2·sec-1 of fluorescent lamps (FL; 4200 K, F72T8CW, Osram Sylvania, MA, USA) under a photoperiod cycle of 16/8 hr in a growth chamber (TC30, Conviron, Winnipeg, Canada). Seed density was adjusted to not allow 21-day plants’ leaves to shadow each other. Photon flux density was measured over the growing area (49 by 95 cm) using a grid size of 3 cm for each reading to provide a uniform distribution of light over the growing surface. Fresh half-strength Hoagland nutrient solution (Hoagland and Arnon 1950) was provided every other day.

4.3.1.1 Light Treatments A customized LED array with a precisely measured single-emission narrow peak at a wavelength of 595 nm (VanqLED, Shenzhen, China) was used. After 21 days of germination and growth under FL, 100 plants were randomly divided into two groups to treat for 5 days (before seedlings transformation from growth-developmental stage to floral stage) under the 595 nm LED or FL with the following environmental conditions: 23/21 °C (day/night), 50 % relative humidity, and ambient CO2 levels. To avoid hidden developmental response of 26-day old plants as control, FL with a wide spectral emission range of PAR (400-700nm) was used, as a control light source.

The low light PPFD (69-70 µmol·m-2·sec-1) was used to limit light-induced stress response (Brautigam, Dietzel et al. 2009). The wavelength spectra of the LED and FL lights were measured using a PS-300 spectroradiometer (Apogee, Logan, UT, USA). After 5 days, 30 rosettes including both leaf and petiole were randomly harvested as a single sample and immediately frozen in liquid nitrogen and stored at -80 °C for protein extraction. The above-mentioned experiments of plant growth and light treatments were repeated three times to provide three biological replicates.

4.3.2 Protein Extraction and Digestion The frozen samples were ground in liquid nitrogen using a mortar and pestle, right before they were processed according to the previously described protein extraction and digestion method (Huang, Orsat et al. 2012) that was adapted here for Arabidopsis. 100 mg of the ground-tissue was homogenized on ice in 100 μL lysis buffer (Tris/10 mM CaCl2 at pH 7.6 and 6 M guanidine/10 mM DTT) (Sigma-Aldrich Canada, Oakville, ON). The solution was boiled for 5 min and vortexed every 2 min for the first hour before incubation at 37 °C for 12 h. The solubilized mixtures were then sonicated in an ice bath with 40% amplitude for 2 cycles of 60 s each, with a 30 s cool-down period between cycles (Crystal Electronics, Stamina-XP ultrasonicator, Newmarket, ON). The

91 protein extract was boiled for 5 min before centrifugation at 3000 g with 25 °C for 15 min (Beckman Avanti J25-I, Brea, CA). Finally, the protein concentrations in the lysates were quantified using BCA assay (ThermoFisher Scientific, Waltham, MA). Aliquots of 200 μg of the quantified proteins were reduced with 25 mM DTT followed by protein precipitation with trichloroacetic acid. The samples were centrifuged at 4500 g for 10 min before washing with ice- cold acetone to remove lipids and excess SDS. The pellets were re-suspended in 250 ul of 8 M urea, 100 mM Tris-HCl, pH 8.0 using sonic disruption and incubated for 30 min at room temperature. Denatured proteins were reduced with 5 mM DTT. To prevent disulfide linkages reformation, the cysteines were blocked with 20 mM iodoacetamide.

Sequencing grade trypsin (Promega, Madison, WI, USA) was diluted with 50 mM Tris/10 mM CaCl2. The cysteine-blocked protein pellets were suspended in two aliquots of sequencing grade trypsin (1:50 w/w), which were then incubated overnight at 37 °C, followed by the addition of a second aliquot of trypsin and incubation for 4 h, followed by the addition of 1 M DTT to a final concentration of 20 mM. Following digestion, peptide samples were centrifuged for 10 min at 4500 g (VWR Costar model V, Radnor, PA) and the pellets were discarded. The supernatant was added 200 mM NaCl, 0.1% formic acid and filtered through an Ultrafree- MC 45 μm spin filter (Ultrafree-MC UFC30HV00, pore size 0.45 μm, EMD Millipore, Billerica, MA). The peptide concentration was quantified using BCA assay before being stored at - 80 °C until MS analysis.

4.3.3 Quantitative Proteomics using LC-MS/MS Peptide analysis was conducted using an inline three phases (RP-SCX-RP) HPLC coupled to a linear ion trap mass spectrometer (LTQ, ThermoFisher Scientific, San Jose, CA, USA) (Verberkmoes, Russell et al. 2009). 50 µg of peptides were loaded onto an in-house packed 75 μm inner diameter biphasic back column containing ~3-5 cm strong cation exchange resin for charge- based separation of peptides followed by ~3-5 cm C18 RP for online washing and removing residual urea and NaCl (Luna 5 μm 100A and Aqua 5 μm 100A, Phenomenex, Torrance, CA) (McDonald, Ohi et al. 2002). Each loaded column was first washed for 30 min off-line with LC–

MS grade H2O (O.1% F.A) to remove salts before being placed in-line with a front column including a nanospray emitter tip (150μm with 15μm tip; New Objective, Woburn, MA). The front column was packed with ~15-20 cm of C18 RP resin for hydrophobicity-based separation of

92 peptides, adapted from previously described methods (McDonald, Ohi et al. 2002). The analysis was conducted via LC-MS/MS in 12 steps of a 5-30% ACN gradient and 0.125% FA over 180 min at a flow rate of 400 nl/min. Data were acquired in a positive mode by Data-Dependent Acquisition (DDA) operated by the software Xcalibur (v2.0.7) (Thermo Fisher Scientific, CA, USA). Survey scan was followed by the CID MS/MS and high energy collision dissociation MS/MS of the 5 most intense ions in the LTQ for CID at 35 normalized collision energy, 3 m/z isolation width, 10 ms activation time, and previously fragmented ions were dynamically excluded for 30 s.

4.3.3.1 Protein Identification and Quantification For each light condition, three biological replicates were tested. By injecting the same sample two times, as a technical replicate(s), overall either six or five raw files were generated for 595 nm and control samples, respectively. The acquired LC-MS/MS spectra were extracted from Thermo RAW files, corresponding to each biological or technical replicates.

Raw files were converted into MS2 files using RawXtract software and converted into mass lists using the RawExtract1_9_8 program (McDonald, Tabb et al. 2004). The raw data files were processed and quantified using PatternLab for Proteomics software (v4.0.0.62) (available at: http://www.patternlabforproteomics.org/) (Carvalho, Lima et al. 2016). Peptide sequence matching (PSM) was performed using the Comet algorithm (Eng, Jahan et al. 2013) against the UniProt database (http://www.uniprot.org/) with Arabidopsis protein entries downloaded August 2017, containing mitochondria, chloroplast proteins, and common contaminant proteins (i.e. bovine trypsin and human keratin). The search considered semi-tryptic peptide candidates. The oxidation of methionine was considered as variable modifications. The Comet search engine considered a precursor mass tolerance of 450 ppm. Because of the low resolution of LTQ-XL technology, we performed a second round of search to ensure the robustness of the result. To this aim, MS2 files were searched with ProLuCID search engine (Xu, Park et al. 2015) against a sequence database used for PatternLab’s Comet search engine. Parameters used for performing the searches were semi tryptic hydrolysis allowing up to two missed cleavages, for both precursor tolerance and fragment tolerance of 500 ppm. The PSM provided by ProLuCID were subsequently filtered through the PatternLab's Search Engine Processor (SEPro) module (Carvalho, Fischer et

93 al. 2012). The same conclusion was reached using these two search engines (data not shown). The default on SEPro for both data was set on low resolution MS1 and experimented with more than 50k spectra. All identification results are reported with < 1% FDR at the peptide level based on the number of labeled decoys. Spectral counting were applied to compare proteomics datasets, as a proxy for semi-quantitation, according to the normalized spectral abundance factor (NSAF) (Zhang, Wen et al. 2010). The statistical protein variation among the replicates of the two light conditions compared was calculated using the T-Fold option of the PatternLab (Carvalho, Hewel et al. 2008). Parameters for the comparisons were as follows: minimum fold change of 1.5, with a BH q-value of 0.05.

4.3.4 Function Annotation and Classification of the DAPs Protein-protein interaction (PPI) networks were performed for all differentially abundant proteins using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database [42]. The data setting for PPI construction was set as follows; organism: Arabidopsis thaliana, and minimum required interaction score: highest confidence (0.7). The hub node identification was conducted using Cytoscape 3.4.0 (Shannon, Markiel et al. 2003). Enrichment analysis for biological process annotations were performed on DAPs using the BiNGO database databank available as a tool inside Cytoscape (Shannon, Markiel et al. 2003). Enrichment analyses for metabolic pathway annotations were conducted on DAPs using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database as a tool inside STRING.

4.4 Results 4.4.1 Growth Response of Arabidopsis Col-0 to 595 nm The 21-day old FL grown plants of Arabidopsis Col-0 were treated under 595 nm for five days (Figure 4.1A). 26-day old 595 nm grown plants showed morphological changes of a weak light absorption including smaller leaves with longer petioles, compared with the controls, 26-day old FL-grown plants (Figure 4.1B).

94 A B

- Figure 4. 1. Growth response and comparative proteomic analysis of Arabidopsis Col-0 to light wavelength 595 nm. A) Light emission spectra of light source LED 595 nm and FL. B) 21-day old FL-grown plants of Arabidopsis Col-0 grown hydroponically for 5 days under 595 nm and FL (as control). C) represents the proteomic workflow; in-solution digested proteins were identified by on-line liquid chromatography-tandem mass spectrometry (LC-MS/MS) with LTQ- XL.

4.4.2 The proteomics prospect in Arabidopsis Col-0 response to 595 nm narrow-wavelength To investigate the proteomic changes associated with 595 nm effect on leaves of Arabidopsis Col-0 plants, LC-MS/MS analysis was performed between 26-day old 595 nm- and FL- treated plants (Figure 4.1C). LTQ allows certifying the presence of 991 proteins detected with at least two unique peptides across all samples. Of all these identified proteins, a total of 334 proteins were detected repetitively three times from proteomic analysis of the three independent biological replicates of each light condition. Proteins with significant abundance changes (fold change ≥ 1.5 and p-value ≤ 0.05) in 595 nm light condition versus control were listed. A total of 23 unique proteins met the criteria that indicated them as differentially abundant proteins (DAPs). Among these DAPs, 14 proteins were up-regulated while the other 9 proteins were down-regulated when subjected to 595 nm (Table 4.1).

95 Table 4. 1. The list of DAPs in Arabidopsis Col-0 response to 595 nm.

No (a) Protein Protein Protein Description Sub- Fold P- number (b) name (c) localization (d) change value Up (e) Photosynthesis (f) 1 P56778 PSBC PSII CP43 reaction center CY 1.81 0.041 2 Q01908 ATPC1 ATP synthase gamma chain 1 CL 1.57 0.029 Carbon and amino acids metabolisms 3 Q42472 GAD2 Glutamate decarboxylase 2 CY 6.83 0.012 4 P10795 RBCS- Ribulose bisphosphate CL 2.36 0.033 1A carboxylase small chain 1A 5 O50008 MS1 5-methyltetra-hydropteroyl CY 2.16 0.023 triglutamate-homocysteine methyltransferase 1 6 P48491 TPI Triosephosphate isomerase CY 1.93 0.031 7 Q9SRV5 MS2 5-methyltetra-hydropteroyl CY 1.8 0.01 triglutamate-homocysteine methyltransferase 2 8 P25696 ENO2 Bifunctional enolase 2/ N 1.62 0.023 transcriptional activator Cytoskeleton and Cell wall 9 O49006 PME3 Pectinesterase/ CW 2.48 0.008 pectinesterase inhibitor 3 Protein synthesis, folding and Degradation 10 P22953 HSC70-1 Probable mediator of RNA N 5.61 0.034 polymerase II transcription subunit 37e 11 Q94K05 CCT8 T-complex protein 1 subunit CY 3.63 0.043 theta

96 Transportation 12 Q9SJT9 AT2G21 Coatomer subunit alpha-2 CY 2.54 0.047 390 13 P31167 AAC1 ADP, ATP carrier protein 1 M 2.04 0.006 Signaling and defense 14 Q9SYT0 ANN1 Annexin D1 PM 2.98 0.03 Down Photosynthesis 15 Q94BS2 MET1 Protein MET1 CL 0.39 0.036 16 Q9C9I7 PSB33 Rieske (2Fe-2S) domain- CL 0.32 0.033 containing protein Carbon and amino acids metabolisms 17 Q39161 NIR1 Ferredoxin-nitrite reductase CL 0.5 0.038 18 Q9LF98 FBA8 Fructose-bisphosphate CY 0.34 2E-04 aldolase 8 Protein synthesis, folding and Degradation 19 Q9SZD6 EF-Ts Elongation factor Ts M 0.46 0.014 Transportation 20 Q9FMF7 DIT2-1 Dicarboxylate transporter 2.1 CL 0.58 0.044 Signaling and defense 21 Q9ZUC1 AOR Quinone oxidoreductase-like CL 0.55 0.043 protein At1g23740 22 Q9C5R8 AT5G06 2-Cys peroxiredoxin BAS1- CL 0.35 0.03 290 like 23 Q949U7 PRXIIE Peroxiredoxin-2E CL 0.28 0.043

(a) Numerical list of 595 nm responsive proteins. (b) Protein number and the abbreviation commonly used for the protein. (c) Protein name given by Uniprot_Arabidopsis database.

97 (d) Subcellular localization of each protein given by PPDB database. (e) Proteins pattern; Upregulated and Downregulated (f) Functional group. The abbreviations: CL: chloroplast; CW: cell wall; CY: cytoplasm; N: nucleus; PM: plasma membrane; PSII: photosystem II.

4.4.3 Functional Annotation of the DAPs To identify mechanisms involved in plant response to 595 nm, we annotated the DAPs via the GO function and KEGG pathway enrichment analysis using BiNGO and STRING database, respectively. A total of 143 GO terms and 10 KEGG terms were identified with Benjamini- Hochberg corrected FDR < 0.05 (Figure 4.2; Table 4.2). The enriched GO terms were associated with various biological processes, including response to stimulus, response to stress, and small molecule metabolic processes. The over-represented GO cellular component terms included chloroplast, membrane, and cytoplasm. The enriched GO molecular function categories were ion binding and catalytic activity. The major KEGG pathways included metabolic pathways (10 DAPs), biosynthesis of secondary metabolites (6 DAPs), and biosynthesis of amino acids (5 DAPs). The GO and KEGG analysis provide an overarching view on the associated biological processes involved in plants response to 595 nm.

Figure 4. 2. Top enriched GO terms of DAPs in Arabidopsis Col-0 response to 595 nm. Top six GO functional classification of the DAPs. Red, green, and blue boxes represent GO BP, CC, and MF, respectively. The abbreviations: BP: Biological Process; CC: Cell Component; MF: Molecular Function.

4.4.4 Molecular Network Involved in Arabidopsis Col-0 in Response to 595 nm To reveal the interaction networks of the DAPs in Arabidopsis response to 595 nm compared to FL as control, the protein-protein interaction networks were constructed from DAPs using the STRING database (Figure 4.3). This analysis demonstrated that DAPs are highly interconnected. Core central proteins, with high connections in the PPI network, were analyzed using the Cytoscape database. Hub analysis of the network suggested ATPC1, FBA8, and AT5G06290 as central proteins of the networks in plants’ response to 595 nm. These proteins are known to play key roles in energy metabolism and redox regulation processes of plants response. The clustering analysis of the interaction network further showed the two large networks (A and B), consist of 6 DAPs, which are mainly related to energy metabolism and stress tolerance (Figure 4.3). Moreover, result showed a cluster (C), which is not connected to the large clusters and composed of the 3 DAPs involved in amino acids metabolism.

99 Table 4. 2. The KEGG pathways enriched by DAPs in Arabidopsis Col-0 response to 595 nm.

#term ID term description count FDR matching proteins (a) (b) ath01100 Metabolic pathways 10 4.94E-05 MS1, ATPC1, MS2, FBA8, GAD2, ENO2, PME3, PSBC, RBCS-1A, TPI ath01230 Biosynthesis of amino acids 5 4.94E-05 MS1, MS2, FBA8, ENO2, TPI ath00710 Carbon fixation in 3 0.00027 FBA8, RBCS-1A, TPI photosynthetic org. ath01200 Carbon metabolism 4 0.00047 FBA8, ENO2, RBCS-1A, TPI ath00010 Glycolysis/Gluconeogenesis 3 0.00066 FBA8, ENO2, TPI ath00450 Selenocompound metabolism 2 0.00066 MS1, MS2 ath01110 Biosynthesis of secondary 6 0.00087 MS1, MS2, FBA8, GAD2, metabolites ENO2, TPI ath00051 Fructose and mannose 2 0.0046 FBA8, TPI metabolism ath00195 Photosynthesis 2 0.0056 ATPC1, PSBC ath00270 Cysteine and methionine 2 0.011 MS1, MS2 metabolism (a) Pathway ID given by KEGG database. (b) Number of the involved proteins in protein set. The abbreviations: FDR: false discovery rate; Org: organisms.

100

Figure 4. 3. Protein‑protein interaction (PPI) network of DAPs in Arabidopsis Col-0 response to 595 nm. Confidence level of 0.7 was used for analysis parameters. The different line colors represent the types of evidence used in predicting the associations: gene fusion (red), neighbourhood (green), co-occurrence across genomes (blue), co-expression (black), experimental (purple), association in curated databases (light blue) or texting (yellow).

4.5 Discussion Reports on a limited number of transcripts have suggested the potential influence of 595 nm on plant stress tolerance (Wang, Gu et al. 2009, Yu, Liu et al. 2017). Our reseach supported and expanded this notion by showing that 595 nm regulated genes, associated with photosynthetic and antioxidant systems, can be implicated in Arabidopsis response to 595 nm (Yavari et al., submitted). In the present analysis, a number of 595 nm responsive proteins were identified in Arabidopsis Col-0 leaves that implies their important roles in plant stress tolerance response.

101 4.5.1 Proteins Involved in Photosynthesis Photosynthetic machinery reconfigures its components in response to changing light conditions (Rochaix 2013), which is true for photosystem II, and many subunits that are involved in light mediation signals (Järvi, Suorsa et al. 2015). Our proteomic result revealed three responsive photosynthetic related proteins that were regulated by 595 nm in plants chloroplasts. Among them, a significant increase was observed for PSII-associated membrane protein PSII reaction center CP43 (PSBC). This protein plays an important role in stabilization of the manganese cluster which is the primary site of water splitting in the PSII complex (Qian, Chen et al. 2009, Fristedt, Trotta et al. 2017). A significant increase in transcription level of CP43 was observed in a recent study on Arabidopsis treated under 595 nm (Yavari, Tripathi et al. submitted). This increase suggests that plants would have a higher capacity in maintaining the stability of PSII super complex under 595 nm, leads to an enhanced energy transfer from the light harvesting antennae to the photosystems (Zhou, Qiu et al. 2014). Consistent with this possibility, a significant decrease was observed in relative abundance of a PSII-associated protein rieske (2Fe- 2S) domain-containing protein (PSB33) and protein MET1 (MET1). Both proteins are required for PSII assembly in plant response to light stress signals (Bhuiyan, Friso et al. 2015, Fristedt, Trotta et al. 2017). The lack of these two proteins may result in a decreased capacity of PSII for non-photochemical quenching (NPQ) (Fristedt, Herdean et al. 2015, Järvi, Suorsa et al. 2015). Supporting this, we previously found significant down-regulation for the gene of NPQ in Arabidopsis Col-0, under 595 nm (Yavari, Tripathi et al. submitted). At the same time, the corresponding increase of antioxidants capacity could explain further protection via antioxidant systems in plants under 595 nm. Overall, our result suggests a higher stress tolerance capacity for PSII super-complex in plants under 595 nm.

4.5.2 Proteins Involved in Carbohydrate Metabolism Plant energy metabolism and the associated proteins can rearrange to boost plant adaptation to light signaling (Kieffer, Planchon et al. 2008, Jin, Xu et al. 2016). Here, our analysis revealed five carbohydrate metabolism-related proteins that were regulated by 595 nm. Among them, two glycolysis-associated enzymes triosephosphate isomerase (TPI) and enolase 2/transcriptional activator (ENO2) were up-regulated in abundance. These two enzymes are essential for plant efficient energy production (Trujillo, Blumenthal et al. 2014). Recent work demonstrated the

102 interactions of these two enzymes in the glycolysis process, using the yeast two-hybrid experiment as a result, ENO2 was proposed to regulate TPI relative abundance. The alteration in relative abundance of these two proteins has been reported under abiotic/biotic stress conditions (Morris and Djordjevic 2001, Dumont and Rivoal 2019). This result suggests an involvement of these glycolytic enzymes in maintaining and driving carbon metabolism in plants’ response under 595 nm. This result further implies that plants have a higher demand for ATP to maintain metabolic homeostasis under the 595 nm light condition (Wang, Jin et al. 2016). Consistent with this possibility, our results showed an increase in the abundance of the two ATP related proteins; a gamma subunit of the ATP synthase complex (ATPC1), involved in ATP production, and ADP/ATP carrier 1 (AAC1), which mediates the export of ATP generated in the mitochondrion in counter exchange with cytosolic ADP (Haferkamp 2007). In agreement with this result, a significant increase in relative abundance of ATPC1 was recently reported in Col-0 treated under 595 nm (Yavari, Tripathi et al. submitted). It can further be postulated that the highly abundant carrier AAC1 could fulfil the main function in energy transfer of plants mitochondria. A recent study suggested higher chloroplast photoprotection and stress tolerance in leaves of Arabidopsis under 595 nm due to the energy allocation from carbohydrates biosynthesis and accumulation to the production of secondary metabolites (Yavari, Tripathi et al. submitted). The same study further showed a significant down-regulation of the gene fructose-biphosphate aldolase 8 (FBA8) that could further support a restricting flux of generated energy toward the Calvin cycle (Yavari, Tripathi et al. submitted). ATPC1 and FBA8 proteins were shown as core proteins in interaction networks associated with Arabidopsis leaves response to 595 nm. Overall, our result suggests the high tolerance capacity in plants by maintaining and directing allocation of generating energy under 595 nm.

4.5.3 Proteins Involved in Amino Acid Metabolism Biosynthesis of sulfur/nitrogen containing amino acids supports plant energy for growth and development (Ye, She et al. 2012, Shi, Zang et al. 2019). Our results showed a potential impact of 595 nm on DAPs which participate in amino acids metabolism; 5- methyltetrahydropteroyltriglutamate-homocysteine methyltransferase 1 and 2 (MS1 and MS2), involved in methionine metabolism. The proteins dicarboxylate transporter 2.1 (DIT2-1) and ferredoxin-nitrite reductase (NIR1) were down-regulated due to 595 nm light. DIT2-1 is involved

103 in translocating the end product of nitrogen assimilation, glutamate (Renné, Dreßen et al. 2003) and ferredoxin-nitrite reductase (NIR1), and catalyzes the reduction of nitrite to ammonium in the second step of the nitrate-assimilation pathway (Mai and Bauer 2016). This binary pattern suggests that the sulfur uptake ability for plants increased under 595 nm, while the plants requirement to take up nitrate and ammonium decreased (Hoefgen and Nikiforova 2008). This result is consistent with a report on Col-0 treated under 595 nm (Yavari, Tripathi et al. submitted). Sulfur and nitrogen containing amino acids act as key elements for the primary structure of proteins. This result can imply a key role for these amino acids as building blocks for the synthesis of various proteins that are required for plant growth and developmental adjustment under 595 nm. Overall, our results suggest a significant change in amino acid metabolism essential for plants developmental adjustment under 595 nm.

4.5.4 Proteins Involved in Lipid Metabolism and Transport Under high environmental stress, the thylakoid membrane disintegrates the assembled galactolipid, leading to the accumulation of free fatty acids, which are toxic to the cell (Sgherri, Pinzino et al. 2018). Here, the results showed a significant decrease in relative abundance of quinone oxidoreductase-like protein AT1G23740 (AOR) enzyme, involved in detoxification of the stromal lipid-derived reactive carbonyl species (Curien, Giustini et al. 2016). This result suggests a significant decrease in accumulation of oxidative-modified biomolecules in chloroplast of the plants that can support an enhanced tolerance capacity for plants’ chloroplast under 595 nm. Our result suggests a significant increase in adaptation of thylakoid membrane in plants under 595 nm.

4.5.5 Proteins Involved in Cell Wall Modification The enzyme pectinesterase/pectinesterase inhibitor 3 (PME3) was significantly abundant. PME3 functions in the modification of cell walls, could act on cell‐wall plasticity and cell‐to‐cell adhesion (Santi, Molesini et al. 2017). The involvement of PME3 in response to 595 nm signals suggests the promoted growth of the stem to place the leaves at a higher position, with a better chance to capture light energy for photosynthesis. Induction of stem elongation in response to limited light energy has been previously shown (Casal 2012). Our result thus proposes a significant association of PME3 in modulating the cell organization that can highly assist plants adaptation to 595 nm.

104 4.5.6 Proteins Involved in Protein Synthesis, Folding and Degradation The molecular chaperones act to regulate protein quality control in plants (Berner, Reutter et al. 2018). Our results showed that 595 nm significantly induced the relative abundance of two chaperones; a probable mediator of RNA polymerase II transcription subunit 37e (HSC70-1) and T-complex protein 1 subunit theta (CCT8). The heat shock protein HSC70-1 is considered as a crucial protective mechanism, important in re-establishing and maintaining proteins integrity in plant chloroplast (Jarvi, Suorsa et al. 2016). The chaperonin complex, containing CCT8, enables post-translocational refolding of transported and targeted proteins in chloroplast (Horwich, Fenton et al. 2007, Xu, Wang et al. 2011). Overall, results suggest higher adaptation for plant chloroplast via participating in protein folding as well as strengthening protein quality control under 595 nm.

4.5.7 Proteins Involved in ROS Signaling In plant cells, perception of extracellular stimuli is mediated by the plasma membrane receptors (Demidchik, Shabala et al. 2018, Singh, Kumar et al. 2019). In the present study, components in Ca2+ and ROS signaling were regulated under 595 nm. A significant increase was observed in relative abundance of Ca2+-dependent membrane-binding protein annexin 1 (ANN1) where they serve as important components in stress tolerance and maintaining Ca2+ homeostasis in plants (Wang, Li et al. 2012, Singh, Kumar et al. 2015). Ca2+ plays an essential role in plant cells in response to environmental stimuli as a second messenger (Pei and Gilroy 2018). ANN1 has been shown to play a regulatory role in ROS signal transduction in a Ca2+-dependent manner in Arabidopsis (Laohavisit, Richards et al. 2013, Zipfel and Oldroyd 2017). Moreover, our results showed a high relative abundance for glutamate decarboxylase 2 (GAD2), the key enzyme involved in gamma-aminobutyric acid (GABA) biosynthesis (Schousboe 2019). GABA has an important function in the developmental processes and stress responses of plants (Majumdar, Barchi et al. 2016, Ma, Wang et al. 2019). Elevated GABA levels have been reported to be dependent on the calmodulin domain in response to cytosolic Ca2+ oscillations in response to different environmental stresses (Shelp, Bown et al. 2017). Congruent with the potential effect of 595 nm on ROS signaling associated proteins, we observed that 595 nm has a regulatory role on antioxidants activity, leading to higher chloroplast protection under 595 nm (Yavari, Tripathi et al. submitted). Overall, this result suggests that the calcium ion associated signaling pathways have a pivotal role in plant adaptation to 595 nm.

105 4.5.8 Proteins Involved in Redox Signaling Redox regulation is an essential defense response to stress conditions (Sies 2019). Our results showed a significant decrease in the abundance of two antioxidant enzymes of the peroxiredoxin family; peroxiredoxin-2E (PrxIIE) and 2-Cys peroxiredoxin BAS1-like (AT5G06290). Under oxidative stress, PrxIIE plays an important function in the redox- system mechanisms to control H2O2 levels towards preserving the chloroplast integrity (Das, Nutan et al. 2015). The 2-Cys peroxiredoxin BAS1-like protein has shown functions in

H2O2 detoxification (Dietz, Jacob et al. 2006). Lower relative abundance for the two peroxiredoxin enzymes can suggest the sustaining intracellular redox homeostasis, leading to lower requirements for H2O2 scavenging in plants chloroplast under 595 nm (Silva, Vasconcelos et al. 2019). Overall, this result suggests the stable redox homeostasis, resulting to higher adaptation capacity in plants under 595 nm.

4.6 Conclusion The LTQ-XL methodology was applied to Arabidopsis thaliana as a first unbiased proteomic study towards the understanding of the processes associated with a plant’s response to 595 nm. The results identified a number of proteins and highlighted those that could be involved in plant stress tolerance. The proteome coverage obtained here is low, but the result has indicated that a plant significantly modify its proteome upon 595 nm exposure. Proteins involved in carbohydrate and amino acids metabolism are found in larger abundance under 595 nm to efficiently adjust energy generation and protein synthesis under 595 nm. More surprisingly, the molecular chaperones, possessing protein folding, assembly, and degradation function, and PSII- associated membrane proteins were detected with significant changes in abundance. Based on our phenotypic results, it can be hypothesized that 595 nm may drastically affect the cell wall proteome.

106 Connecting Text

Chapter 5, In-depth proteomic analysis of Arabidopsis thaliana response to narrow- wavelength lights reveals regulation of proteomic profiles controlling biological functions was authored by Nafiseh Yavari and Mark G. Lefsrud. Chapter 5 was submitted to the journal Molecular & Cellular Proteomics on July, 2019 and is currently under review.

From the phenotype differences and following the study of plant response to the narrow- wavelengths, it became apparent that narrow-wavelengths provided critical environmental information for the plant’s adaptation and stress-tolerance. Understanding the molecular mechanisms underpinning the response of Arabidopsis thaliana to specific light wavelengths have been hampered by the use of broad wavelength lights, low number of contrasting conditions, or targeted analysis of specific proteins or pathways. Moreover, available knowledge is mostly based on transcriptome data as a proxy of plant proteome response or use of low coverage proteome assays. Like shotgun proteomics, there are a multitude of methodologies used to comprehensively identify and quantify changes in abundance of responsive proteins. A survey of the literature on the study of challenging measurements in mass spectrometry technologies, highlighted the importance of the proteome quantitation method in estimation and detection of differential abundance across all expressed proteins. For an in-depth proteomic analysis, a TMT labeling method was selected for this aim. TMT basically provides the opportunity to simultaneously identify and quantify proteins from multiple (2-11) numbers of samples in a single run, thus reduced run to run variability, and better quantitative accuracy and precision. In this work, we presented a high-resolution resource on proteomic response of Arabidopsis using TMT-based isobaric labeling approach resulted in the identification of 16,707 proteins with 9,120 proteins quantified across 9 samples, covering 23% of the currently annotated proteome of Arabidopsis. This in-depth resource enabled us to examine changes in the proteome response of many low expressed proteomes with important regulatory roles including transcription factors and hormone signaling. Importantly, we found that 18% (1631 proteins) of Arabidopsis proteome show differential expression patterns in response to narrow-wavelength lights that correlated well with the plant morphological responses. To showcase the utility of this resource, we placed our results in the context of +30 available datasets, providing orthogonal validation and insights on deciphered

107 light-specific mechanisms. Therefore, this resource provides an unprecedented view of the proteomic landscape of Arabidopsis and serves as a reliable resource for further characterization of light specific molecular mechanisms in this dominant model organism. The report of clustered proteins and relevant GO terms obtained from TMT technology is provided in Appendix D.

108 5. Chapter 5: In-depth proteomic analysis of Arabidopsis thaliana response to narrow- wavelength lights reveals regulation of proteomic profiles controlling biological functions

Nafiseh Yavari, Mark G. Lefsrud

Additional index words. Arabidopsis thaliana, light proteome profiling, networks, protein-protein interactions, shade-avoidance, systemic acquired resistance, tandem mass spectrometry

5.1 Abstract The wavelength of incident light is viewed as a central modulator of plant growth and developmental processes. However, there are still open questions about the full complexity of the wavelength-specific proteome responses in plants. Here we applied TMT-labeling technology to present an in-depth view on the wavelength-specific proteome changes in Arabidopsis thaliana response to 450 nm, 595 nm, and 650 nm wavelenghts. Using this approach, we identified 16,000 proteins with 9,120 proteins quantified across all three light conditions in three biological replicates. This in-depth resource enabled us to examine changes in the abundance of many low expressed proteins with important regulatory roles including transcription factors and hormone signaling. Importantly, we found that 23% (1631 proteins) of the A. thaliana proteome showed differential expression patterns in response to narrow-wavelength lights. We find that the proteome changes correlate well with the morphological responses in plants. To showcase the usefulness of this resource, we placed our results in the context of more than thirty available datasets, providing orthogonal validation and insights on deciphered light-specific mechanisms. The in-depth, high resolution resource reported herein provides baseline data to define principles and molecular mechanisms controlling fundamental aspects of plant light response with implication in plant development and adaptation.

5.2 Introduction The wavelength composition of incident light provides rich informational clues about the plant environment. Therefore, plants have developed machineries and signaling pathways to accurately sense and respond to the fluctuations in the light composition; and thereby adapting their development (Cerrudo, Keller et al. 2012, de Wit, Spoel et al. 2013). Congruently,

109 accumulating evidence indicates that a range of wavelengths, individually and in combination, influence plant morphology and physiology. Wavelengths in the range of 430–450 nm and 640– 660 nm regulate light-mediated physiological responses in plants (Chaves, Pokorny et al. 2011, Chen and Chory 2011) as both are absorbed, approximately 90%, by the photosynthetic apparatus (Terashima, Hanba et al. 2011). Both wavelengths play critical roles in mediating processes associated with plant growth and development including photosynthesis, stress response, and hormone signaling (Lau and Deng 2010, El-Esawi, Arthaut et al. 2017, Yang, Liu et al. 2017). There is also emerging evidence regarding the role of wavelength range of 500-610 nm in plants photosynthesis, physiological responses, and processes related to a long-term developmental acclimation (Folta and Maruhnich 2007, Johkan, Shoji et al. 2012, Wang and Folta 2013, Yoshida, Mogi et al. 2016, Smith, McAusland et al. 2017). Although changes in plant physiology, in response to fluctuating light wavelength composition, are well documented, the wavelength specific molecular processes that underly photosynthetic and developmental responses are poorly understood. Ultimately, a comprehensive molecular understanding is needed to be able to improve plant adaptation through the distinct light-signal-response mechanisms, especially in the current conditions that demand a controlled-environment agriculture.

Previous transcriptomic and proteomic studies on regulatory effect of light wavelengths on plant growth and development have been mostly focused on a specific set of pre-selected proteins or based on low-coverage proteome assays. A few studies have also used transcriptome data as a proxy of plant proteome response. Although, these studies reproducibly revealed that wavelength composition of incident light modulates major regulatory mechanisms and biological processes; indeed, up to 50% of the Arabidopsis genome is expressed in a light-dependent manner (Ma, Li et al. 2001, Liang, Cheng et al. 2016). Several molecular pathways are implicated in this regulation, including energy metabolism pathways, defense mechanisms and phytohormone regulation (de Wit, Galvao et al. 2016, Demarsy, Goldschmidt-Clermont et al. 2018, Sakuraba and Yanagisawa 2018). An important component of the light-regulatory pathways —the photoreceptors— are known as the primary modulators of these responses. Increasing evidence indicates that photoreceptors have complex synergistic, antagonistic, and redundant associations in regulating plant light responses (Su, Liu et al. 2017, Wang, Liu et al. 2018). Light signaling transcription factors were also characterized as intermediators of the light-regulatory pathways (Leivar and

110 Quail 2011, Paik and Huq 2019). Evidence suggests that light signals trigger both common and wavelength specific biological processes in plants. For example, comparative proteomics analysis of the photoreceptors mutant with wild-type Arabidopsis plants revealed the differential expression of diverse biological processes primarily in photosynthesis, carbohydrate and nitrogen metabolism, redox homeostasis and energy metabolism (Li, Yang et al. 2009, Lopez, Carbone et al. 2012, Fox, Barberini et al. 2015). Further, the overlap and cross-talk of gene regulatory programs, involved in red and blue light responses, suggested a multiple-layer regulation of plant development under those light conditions (Ma, Li et al. 2016, Pedmale, Huang et al. 2016). It is thus required to comprehensively interrogate the plant proteome, because the changes of light quality are likely to affect the plant physiology by modulating the expression of several proteins and signaling cascades at almost all levels of cellular hierarchy.

Although changes in plant physiology, in response to light spectral composition, are well documented, there is limited knowledge on the roles of specific light wavelengths and their impact. Studies that determine plants proteome and their role in inducing the physiological traits have dominated works on wavelength ranges of 430–450 nm and 640–660 nm, and to our knowledge, knowledge of the regulation of proteins as affected by the wavelength range 550-600 nm at the genome level, has been relatively ignored. Within 550-600 nm region, there is a narrow- wavelength with a peak at 595 nm that growing research has highlighted for its physiological impact on plants growth and photosynthesis (Wang, Gu et al. 2009, Wu, Su et al. 2014). Additionally, 595 nm has shown high regulatory role on abundance and activity of key proteins to mediate higher tolerance in plant (Yu, Liu et al. 2017). For instance, 595 nm induced the abundance/activity of antioxidant enzymes such as superoxide-dismutase (SOD), catalase (CAT), and peroxidase (POD) to reduce the accumulation of free radicals. Thus, 595 nm regulates an integrated molecular network at multiple levels to bring about tolerance responses. As being a probable light source to understand regulatory signals in plant growth and development, the molecular mechanisms underlying the effect of light wavelength 595 nm remain elusive. Whether the changes in proteome are correlated with physiological traits of plant response to 595 nm requires testing to understand their tolerance consequences. Moreover, most previous studies have utilized relatively broad wavebands in their experiments. These multi-wavelengths lights function in a complex signaling network, which provide major challenges in inference of wavelength-

111 specific molecular processes that underly the plant response. Besides, most studies have compared the effect of blue and red wavelengths comparing with FL, as control. As FL light consists of the mixed spectra composition of both red and blue as well as numerous other wavelengths, undeniably, comparing results leads to inconsistent and overlapping responses that will hamper effects to elucidate the plant response to specific wavelengths (Ohashi-Kaneko, Takase et al. 2007, van Iersel 2017, Viršilė, Olle et al. 2017). Monitoring plant proteome response to specific wavelengths and further comparing the changes to one another, rather than comparing plants proteome to FL, is thus necessary to gain the clear insights to specific underlying biological pathways and their effect consequences in plant response.

Here we sought to generate a high-resolution proteomic profile of plants, based on exposure to specific narrow-wavelengths. We employed LED lights in our design to eliminate the potential overlap in molecular responses by ensuring non-overlapping wavelengths in the light treatments. We further used TMT-labeling technology to gain a high-resolution view on the associates of proteome changes. This resulted in a significant increase in the number of quantified proteins, by a higher sensitivity. A primary objective of this study was to identify an overall integrative picture of the narrow wavelength regulatory responses and their downstream biological functions affected in plants. To showcase the ability of our resource, we put it in the context of +30 available datasets to identify processes that show differential patterns under specific light wavelengths. Our comparative study also takes advantage of the previously published proteomic and transcriptomic results available in Arabidopsis response to different wavelengths of light. Taken together, this work establishes a baseline of regulatory genes that affect the downstream proteins that control different biological processes of wild-type and mutant Arabidopsis. This knowledgebase can be used in future to explore other plant species grown under a variety of narrow-wavelengths lights.

5.3 Materials and Methods 5.3.1 Plant Material and Growth Conditions Seeds of A. thaliana accession Col-0 were obtained from the Arabidopsis Biological Resource Center (ABRC; https://www.A.thaliana.org; Columbus, OH, US). Ninty eight seeds were placed in rockwool cubes (Grodan A/S, DK-2640, Hedehusene, Denmark) and cold, dark- incubated at 4 °C for 2 days. Fluorescent lights (FL; 4200 K, F72T8CW, Osram Sylvania, MA,

112 US) with 16/8 light/dark cycle were used as light sources for seed germination and growth for 18 days in an environment-controlled growth chamber (TC30, Conviron, Winnipeg, MB, Canada). Density of the seeds was adjusted to limit 18-day plants from shadowing each other. FL was projected over the plant-growing surface area (49 cm  95 cm) at a low-irradiance photosynthetic photon flux density (PPFD) of 80 µmol·m-2·sec-1. PPFD was measured using a grid size of 3 cm for each reading. Seeds were hydroponically grown. Fresh half-strength Hoagland nutrient solution (Hoagland and Arnon 1950) was provided every second day.

5.3.1.1 Light Treatments The experiment was designed as randomized complete blocks, consisting of one genotype (Col 0), three narrow-wavelengths 450 nm (B), 595 nm (A), or 650 nm (R), and three replications over time. At the end of the day, at 18 days, the FL-grown seedlings were randomly divided into three groups and subjected to the responsive LED lights. LED light sources (VanqLED, Shenzhen, China) of blue light (B; peak wavelength: 450 nm), amber light (A; peak wavelength: 595 nm), red light (R; peak wavelength: 650 nm) were used for the light treatments (Figure 3.2B). Seedlings received treatments for 6 days (before seedlings transformation from growth-developmental stage to floral stage) with the following environmental conditions: 23/21 °C (day/night), 16/8 light/dark cycle, 50 % relative humidity, and ambient CO2 levels. Using LEDs avoids the added stress factor of excessive heat produced by commercial lamps, which drastically influences protein expression and development. Low-irradiance of 80 µmol·m-2·sec-1 was used for this study to limit the induction of a stress response, as reported previously (Brautigam, Dietzel et al. 2009). The light spectra and PPFD were monitored daily by a PS-300 spectroradiometer (Apogee, Logan, UT, USA). Plants were hydroponically grown under controlled light conditions. Fresh half-strength Hoagland nutrient solution (Hoagland and Arnon 1950) was provided every second day. The details of the treatments are summarized in Figure 5.4B. After 6 days of light treatments, 24‐day‐ old plants were harvested and immediately frozen in liquid nitrogen to store at -80 °C for quantitative proteome comparison analysis. Full rosettes, treated under the three independent sets of light treatments, were harvested with both leaves and petioles as the experimental units. To reduce plant-to-plant variations, more than 30 rosettes, were combined into a bulk sample for analysis. The plant growth and light treatments were repeated three times to provide three biological replicates.

113

5.3.2 Protein Extraction and Digestion Liquid nitrogen-frozen rosette samples were homogenized in 2% SDS, 150 mM NaCl, 50 mM Tris HCl (pH 8.5) with the addition of Complete Protease inhibitors (Roche, Basel, Switzerland) and heated for 1 hour at 60 °C. Lysates were precleared via centrifugation at 15,000 g for 10min at room temperature. An aliquot of the protein extract (supernatant) was used to determine protein concentrations using the Pierce BCA protein assay (ThermoFisher Scientific, Waltham, MA). Proteins were reduced with 5 mM dithiothreitol (DTT) for 30 minutes at 60 °C. After cooling to room temperature, cysteines were alkylated with 14 mM iodoacetamide, followed by protein precipitation with methanol/chloroform/water (4:1:3 ratio). The protein pellets (~1mg) were resolubilized in 8 M urea, 25 mM HEPES (pH 8.5) further diluted to 4M urea with 25 mM HEPES, pH 8.5 prior to digestion. LysC (Wako Chemicals USA, Richmond, VA) was added at 20 ng/μl (1:50 protease to protein ratio) and the proteins were digested at 25 °C for 12 h. Following the LysC digestion, the urea concentration was diluted to 1 M with 25 mM HEPES (pH 8.5) and trypsin (Promega, Madison, WI) was added at 10 ng/μl (1:35 protease to protein ratio). Trypsin digestion was carried out at 37 °C for 6 h and the reaction was quenched with TFA. Peptides were desalted with a solid phase extraction cartridge (Sep-Pak tC18; Waters, Milford, MA) and dried by centrifugal evaporation. Dried peptides were resuspended in 200 mM EPPS, pH 8.0 and peptide concentrations were quantified using the Pierce colorimetric peptide assay (ThermoFisher Scientific, Waltham, MA).

5.3.3 TMT Labeling The desalted peptides were labelled with nine of the TMT 10-plex reagents at a 2:1 ratio (TMT reagent:peptide), incubating at 25°C for 2h. TMT reactions were quenched with 0.5% hydroxylamine for 15 min, acidified to 2.0% TFA, combined and desalted with a single Sep-Pak. TMT labelled peptides were subjected to orthogonal basic-pH reverse phase fractionation on a 4.6x250 mm column packed with 3 μm ZORBAX Extend C18 material (Agilent, Santa Clara, CA). A 45 min linear gradient was used from 8% buffer A (5% acetonitrile in 10 mM ammonium bicarbonate, pH 8) to 35% buffer B (acetonitrile in 10 mM ammonium bicarbonate, pH 8) at a flow rate of 0.8 ml/min. Ninety-six fractions were consolidated into twenty-four fractions, acidified with formic acid and vacuum dried. The samples were resuspended in 5% formic acid,

114 desalted on StageTips packed with Empore C18 material (3M, Maplewood, MN), and vacuum dried. Peptides were reconstituted in 5% formic acid (FA), 5% acetonitrile for LC-MS/MS/MS analysis.

5.3.4 LC-MS/MS/MS Twelve fractions were analyzed by nano LC-MS/MS/MS on an Orbitrap Fusion Lumos mass spectrometer coupled to an Easy-nLC 1200 UPLC pump. Peptides were separated on an in- house packed 75 μm inner diameter column containing 0.5 cm of Magic C4 resin (5 μm, 100 Å, Michrom Bioresources) followed by 25 cm of GP-C18 resin (1.8 μm, 120 Å, Sepax Technologies). A gradient of 5 to 30% acetonitrile with 0.125% FA was applied over 180 min at a flow rate of 400 nl/min. The mass spectrometer was operated in data-dependent mode. MS1 scans were acquired at a resolution of 120,000. The ten most intense ions were selected for MS/MS. Previously interrogated precursor ions were excluded using a dynamic window of 75 seconds ± 10 ppm. The MS2 precursors were isolated with a quadrupole mass filter set to a width of 0.5 m/z. MS2 scans were acquired in the ion trap using collision induced dissociation at 35% NCE. Ten product ions were isolated using synchronous precursor selection and fragmented using higher energy collisional dissociation of 55% NCE.

5.3.5 Quantification of Protein Concentrations using the total Protein Approach All acquired data were processed via a previously described in-house informatics pipeline (O'Connell, Paulo et al. 2018). Briefly, raw data were converted to mzXML and spectra were identified with SEQUEST utilizing a FASTA formatted database (UniProt A. Thaliana, 2018) with common contaminants and reversed sequences appended. Spectral searches were done with the following parameters: 50 PPM precursor tolerance, fully tryptic peptides only, fragment ion tolerance of 0.9 Da with a static modification of TMT (+229.163 Da) and carbamidomethylation of cysteine (+57.021 Da). Oxidation of methionine (+15.995 Da) was specified as a variable modification. A false discovery rate (FDR) of 1% was obtained via a linear discriminant analysis which utilized several features. Resulting peptides were further filtered to provide a 1% protein FDR. Proteins were collapsed into groups via the rules of parsimony. TMT reporter ion intensities were extracted and divided by reported noise values to derive TMT reporter ion signal / noise ratios.

115 5.3.6 Assessment of Coverage for select Biological Pathways and Comparisons with Published Datasets The proteome coverage of this study was compared with the recent published proteomics datasets on A. thaliana obtained by either label-free (Aryal, McBride et al. 2017, Miller, O'Cualain et al. 2017, Seaton, Graf et al. 2018) or labeling methods; iTRAQ (Wang, Zhou et al. 2018) and TMT (Mostafa, Yoo et al. 2017). All the details of data sets and analysis that were obtained from the studies are listed in Table 5.1. To assess the coverage of our proteomic data, we measured the coverage of main metabolic pathways based on KEGG pathway annotations (Kanehisa, Sato et al. 2016). We also examined the coverage of our proteomic data set for cell wall proteins (CWPs) using the cell wall proteome database WallProtDB (www.polebio.lrsv.ups-tlse.fr/WallProtDB) (San Clemente and Jamet 2015).

Table 5. 1. Coverage comparison of the TMT method in our proteomics dataset to the other published data sets using label-free or labeling methods.

Reference studies WT-accession Organs Method No. of % of proteins genome (39,362) Current study Col-0 R TMT 9,120 23.2 Seaton, Graf et al. 2018 Col-0 R LF 4,344 11.0 Miller, O'Cualain et al. 2017 Ws-4 WS LF 3,514 8.9 Aryal, McBride et al. 2017 Col-0 P LF 1,854 4.5 Mostafa, Yoo et al. 2017 Col-0 L TMT 4,655 11.8 Wang, Zhou et al. 2018 Col-0 and Ler WS iTRAQ 5,106 13.0

The abbreviations: Col-0:Colombia_0; iTRAQ: Isobaric Tags for Relative and Absolute

Quantitation; LF: Label-Free; Ler: Landsberg erecta; No: number; P: plastid; R: rosettes; TMT:

Tandem Mass Tag ; WS: whole plants; Ws-4: Wassilewskija; WT: wild type

116 5.3.7 Identification of Differentially Expressed Proteins Due to the high coverage of our proteomic approach, 9,120 out of 9,551 identified proteins were observed in all nine samples (i.e., three biological replicates across the three light conditions). Raw data were normalized using the quantile normalization method (Wettenhall and Smyth 2004). Significantly differentially expressed (DE) proteins across all light conditions were identified using ANOVA coupled with the Tukey honest significant differences (TukeyHSD) post hoc test (Abdi 2010). Proteins with ANOVA Benjamini-Hochberg adjusted p-value <0.05 were deemed as significantly changed. Pairwise comparisons were conducted to identify light specific responses of DE proteins using F-test with the criteria of Benjamini-Hochberg adjusted p-value < 0.05. MA- plots of protein fold changes in each two combinations of narrow-wavelengths did not show existence of bias in the fold change estimates Figure 5.1.

Figure 5. 1. MA-plot of the nine samples. The purple line in the middle indicates the regression line between mean expression and fold change for all identified proteins. As demonstrated, the mean expression and the fold changes are not correlated overall.

117

5.3.8 Cluster Analysis To identify expression organization in response to narrow-wavelength, a hierarchical clustering was performed on 1631 DE proteins. Expression values for each DE protein was normalized to have mean zero and variance of one across all samples and light conditions. The normalized values were clustered using an average linkage method and Pearson’s correlation coefficient as distance metric. Clustering of proteins were guided by the dendrogram and color coded in the row side bar.

5.3.9 Overlap Analysis The overlap of the proteins in each cluster was determined with multiple published datasets on genes and proteins involved in light and stress responses using two-tailed Fisher test and corrected p-values for multiple testing using Benjamini-Hochberg procedure.

5.3.10 Salicylic acid (SA)-induced transcriptome data Transcriptome data on SA-induced expression were downloaded from NCBI Gene Expression Omnibus (GEO) database with accession number “GSE3984” (Thibaud-Nissen, Wu et al. 2006). After quantile normalization of data, DE genes were identified using limma package (Ritchie, Phipson et al. 2015) with Benjamini-Hochberg corrected p-value <0.05.

5.3.11 Gene Ontology (GO) The ClueGO (v.2.5.1) plugin (Bindea, Mlecnik et al. 2009) from Cytoscape was used for biological process enrichment analysis of the five DE cluster. GO biological process enrichment was assessed using a two-sided hypergeometric test. The multiple testing corrections was performed using the Holm-Bonferroni (Kohnen, Schmid-Siegert et al. 2016). The GO terms with an adjusted p-value < 0.05 and genes number > 5 were considered significantly enriched.

5.3.12 Network Analysis The STRING database (version 8.1) was used to construct a functional network of DE proteins within each cluster (Jensen, Kuhn et al. 2009). A high confidence sub-network was extracted by selecting interaction with confidence score of ≥ 0.7 (the database set threshold). The

118 visualization of networks was performed using Cytoscape (Shannon, Markiel et al. 2003). Hubs were defined as the top 5% of the most interacting proteins within each cluster.

5.4 Result

5.4.1 A. thaliana responses to narrow-wavelengths depict differential morphological appearance

18-day-old plants of FL-grown A. thaliana were treated under narrow-wavelength of 450 nm (B), 595 nm (A), or 650 nm (R) (Figure 5.4A). After 6 days of treatments, plants showed distinct leaf morphologies under the different light conditions. B-plants showed notably expanded leaves with slight leaf cell death. R-plants displayed considerably smaller leaf area with acceleration of yellowing and leaf death. A-plants showed a petiole elongation and upward phyllotaxy (hyponasty) response.

5.4.2 A. thaliana responses to narrow-wavelengths demonstrate the in-depth proteome remodeling

To understand the molecular changes that underly morphological response of plants to the narrow-wavelengths, we performed an in-depth quantitative proteomic analysis of 24-day-old plants treated under B, A, or R light conditions each with three distinct biological replicates. For the proteomics analysis, a TMT-based isobaric labeling technique was applied (Figure 5.4B), in which the 9 samples were labeled and next subjected to 96 offline high-pH RP- HPLC fractions. A total of 125,687 MS2 spectra were matched to tryptic peptides at FDR threshold of 1%, representing 16,707 identified proteins at FDR of 1% with minimum peptide count of 2. After filtering, a total of 9,551 unambiguous protein groups were identified in all nine samples. Unique proteins, remained in each group, totaling 9,120.

The quantified 9,120 proteins represent > 23% of the annotated proteome of A. thaliana. This provided a comprehensive and unbiased view on the narrow-wavelengths of specific proteome changes in A. thaliana plants (Figure 5.4C). While, similar to other proteomic studies,

119 identified proteins were biased towards abundant proteins in the cell, the high coverage of the proteomic assay enabled us to quantify light induced changes in many of the low abundance proteins as well (Figure 5.2A).

Figure 5. 2. Comparing the proteome coverage of this study with the transcriptome datasets on A. thaliana that were extracted from the study by Jiao et al. (Jiao, Ma et al. 2005). A) Identified proteins show bias towards transcripts with higher expression under fluorescent (FL). B) Differentially expressed proteins are upregulated at the transcript under FL compared to the dark condition.

To further examine the coverage of our proteomics dataset, we considered twenty pathways related to metabolism from KEGG database. As illustrated in Figure 5.4C, our dataset shows a coverage of above 50% for many of these pathways including metabolic pathways (1244/1967, 63.24%), secondary metabolism (708/1074, 65.92%), carbon fixation (62/69, 89.85%), and fatty acid biosynthesis (34/41, 82.92%) (Table 5.2). Proteomic studies tend to show over-representation of abundant proteins in the set of quantified proteins. However, many important regulatory proteins tend to have strictly regulated low expression levels including transcription factors and proteins

120 involved in the signaling pathways. Importantly, the employed TMT-labeling approach, in our study, allowed identification and quantification of these groups of proteins including basal transcription factors (23/55, 41.81%) and proteins involved in hormone signaling (50/273, 18.31%). The identified proteins also exhibited a significant coverage for cell wall proteins (CWPs) (517/805, 64.2%). Collectively, these results present our dataset as a comprehensive and unprecedented resource to evaluate and understand the underlying processes in plant response to narrow-wavelengths of light.

5.4.3 Comparative analysis reveals wavelength-specific proteomic remodeling at large scale

ANOVA analysis of samples across light conditions was performed to identify proteins that had differential expression patterns between the light treatments. This analysis identified 1,631 proteins across the three light narrow-wavelengths at FDR <0.05. Clustering was next performed on DE proteins to gain further insights on the expression organization. This analysis demonstrated that biological replicates of the same light condition were clustered together while separated from the other conditions (Figure 5.3A). This analysis further demonstrated that the 1,631 DE proteins are partitioned into five main clusters. The largest cluster (C1, Amber cluster) was composed of proteins that were up-regulated under A relative to R and B light conditions. The second largest cluster (C2, Purple cluster) was composed of proteins that were up-regulated in both R and B compared to A. The third cluster (C3, Blue cluster) was composed of proteins that were up- regulated under B compared to both A and R. The fourth cluster (C4, Orange cluster) was composed of proteins that were up-regulated in both A and R compared to B. The smallest cluster (C5, Red cluster) was composed of proteins that were up-regulated under R compared to the other two light conditions. The clustering results suggested that plants have a more similar proteomics proteins under B and R light conditions compared to seedling grown under A (Figure 5.3B). Congruently, pairwise DE analysis of light conditions demonstrated that the 1,631 DE proteins exhibit the most distinct and most similar expression levels in A-to-B (1,521 DE proteins) and B- to-R (785 DE proteins) light conditions, respectively (Figure 5.5A).

121

Figure 5. 3. Principal component analysis (PCA) and heatmap of the diﬀerentially expressed proteins in Arabidopsis response to B, A, and R light conditions. A) PCA plot of all identified proteins in this study. As illustrated, biological replicates cluster with each other while separate from the other light conditions. This suggests existence of major proteomic remodeling under different light conditions. Node color represents the associated narrow-wavelength light condition. B) Samples are clustered based on the similarity of expression patterns of DE genes. As shown protein responses are more similar to under B and R narrow-wavelength compared to A light.

To validate the observed patterns, protein expression was compared with published transcriptome datasets. The plants molecular response to A has not been characterized systematically before. Therefore, this analysis was limited to the comparison of protein expression patterns between R and B light conditions. Consistent with the previous reports, moderate but statistically significant correlations (Pearson’s correlation: 0.51; p-value: 5.06 x 10-45; Figure 5.5C) were found between fold change patterns of protein expression data with published transcriptome data (Jiao, Ma et al. 2005).

122 Table 5. 2. KEGG pathway coverage. The proportions of proteins in each pathway were quantified in our proteomics dataset.

KEGG Pathway No. in KEGG pathway No. in this study % in this study Metabolic Pathways 1967 1244 63.2 Secondary Metabolism 1074 708 65.9 Amino Acid Metabolism 254 203 79.9 Carbon Metabolism 263 216 82.1 Ribosome 364 225 61.8 Glycolysis 116 94 81.0 Starch Synthesis 180 86 47.7 Carbon Fixation 69 62 89.8 Photosynthesis 99 53 53.5 TCA cycle 63 52 82.5 Peroxisome 87 60 68.9 Proteasome 60 48 80.0 Pentose Phosphate PW 60 53 88.3 Ribosome Biogenesis 101 61 60.4 Fatty Acid Degradation 46 35 76.0 Fatty Acid Biosynthesis 41 34 82.9 Hormone Signaling 273 50 18.3 DNA replication 50 34 68.0 RNA Polymerase 45 24 53.3 Basal Transcription Factors 55 23 41.8 Thiamine Metabolism 20 17 85.0

123

Figure 5. 4. A high coverage map of proteomic response of A. thaliana to 450 nm (B), 595 nm (A), or 650 nm (R) narrow-wavelengths. A) Aerial and side view photographs of plants treated for 6 days with either B, A, or R LED lights. B) Illustration of the workflow applied for the TMT- based isobaric labeling proteomic analysis of A. thaliana rosettes. Three biological replicates were performed. Proteins were extracted from the leaves of treated plants, and subsequently labeled with TMT reagents. The samples were then pooled and fractionated followed by LC-MS/MS analysis. C) Comparing the proteome coverage of this study with the recent published proteomics datasets on A. thaliana. The x-axis demonstrated the number of the identified proteins in each study. D) Coverage of the proteomics dataset for KEGG pathways and cell wall proteins (See Methods for details). Abbreviations: No: number; PW: pathway; TCA: tricarboxylic acid cycle.

124

Figure 5. 5. Expression patterns of DE proteins reveal the molecular processes induced by specific narrow-wavelengths. A) Hierarchical clustering of protein expression patterns for DE proteins. Defined protein clusters are ordered based on their size, and specified with colors on the left. B) Pairwise comparing of the 1,631 DE proteins; A-to-B (1,521 DE proteins), B-to-R (785 DE

125 proteins) and A-to-R (1,119 DE proteins). C) Comparing the B-to-R proteomic responses from this study with a corresponding transcriptomic response (Jiao, Ma et al. 2005). D) An overview of the gene sets from published datasets with significant overlapping with clusters. All five protein clusters were tested for significant overlap for each gene set. The significant overlaps (FDR <0.05) are represented by red color.

5.4.4 Shade Avoidance Syndrome (SAS) is active under A compared to B and R light conditions

Cluster C1 was composed of DE proteins that up-regulated under A compared to B and R. Within this cluster, functional enrichment analysis (Figure 5.6) demonstrated a significant enrichment for the photosynthesis and cell wall organization processes. A significant enrichment of categories related to metabolic processes of carbohydrates and organic acids were also found, suggesting high metabolic activity in providing energy and carbon skeletons for A-plants. Enrichment in the processes related to water movement and osmotic stress was observed. Consistent with the enrichment patterns, we found C1 proteins significantly overlap with genes responsive to heat-, salinity-, and osmotic-stress conditions (Hannah, Caldana et al. 2010, González-Pérez, Gutiérrez et al. 2011, Rasmussen, Barah et al. 2013) (Figure 5.5D).

Network analysis was further performed to identify the proteins that are central to the observed molecular responses under A light condition. This analysis underscores the important role of proteins involved in cell wall modification (ANNAT3, TUB4/6, AGAL2, TLP18) and photosynthesis (LHCB6, NdhN, PSAD1, PnsB5, PSBO1, PSBQ2, PETE1) in plant response to A light (Figure 5.8).

The morphological characteristics of A-plants along with the enrichment analysis of cluster C1 suggest that the canonical SAS response might be activated in plants under A light condition. To directly assess this hypothesis, we tested if the expression levels of SAS-responsive genes (Sellaro, Pacin et al. 2017) show similar alterations at the protein level under A. Supporting the activity of SAS response, a strong and significant positive correlation was uncovered where the up and down regulated genes in response to SAS were also up and down regulated at the protein level under A light condition, respectively (Figure 5.7). Corroborating this finding, we further found a

126 significant overlap between DE proteins in C1 cluster and the SAS-induced genes from other studies (Figure 5.7). As an important negative control, SAS response did not correlate with the fold change patterns between R and B light conditions, suggesting the specificity of the response to A light (Figure 5.9). As phytochrome-interacting factors (PIFs) are major regulators of SAS in A. thaliana (Hornitschek, Lorrain et al. 2009, Leivar, Tepperman et al. 2012, Li, Ljung et al. 2012), we also compared the overlap of C1 cluster with the previously determined regulatory targets of PIF1, PIF3 (Oh, Kang et al. 2009, Chen, Xu et al. 2013, Zhang, Mayba et al. 2013), PIF4, PIF5 (Hornitschek, Kohnen et al. 2012, Oh, Zhu et al. 2012, Leivar and Monte 2014) and PIF7 (Li, Ljung et al. 2012). C1 cluster was significantly enriched for the regulatory targets of all PIFs, except PIF1 (Figure 5.5D). Gene Ontology (GO) enrichment analysis of the PIFs targets that overlapped with C1 cluster demonstrated an over-representation of processes involved in auxin transport, cell wall organization, water transport, and photosynthesis. SAS is also characterized by early flowering. We then examined the enrichment of Arabidopsis flowering genes (Nozue, Tat et al. 2015) and putative flowering regulators (both promoters and repressors) (Navarro, Ribalta et al. 2018, Lorenzo, Alonso Iserte et al. 2019) among C1 proteins. Strikingly, no significant overlap was found, suggesting the higher accumulation of reserves necessary to extend the vegetative phase (Lorenzo, Alonso Iserte et al. 2019). Taken together, these comparative analyses underscore the activity of SAS-induced response under A condition.

127

Figure 5. 6. A network map of the significantly enriched GO biological processes in narrow- wavelength responsive protein clusters. The enrichment analysis was conducted separately for proteins within each cluster. Each node represents a significantly enriched biological process (FDR <0.1). The interactions among terms represent an overlap of their cognate proteins (hypergeometric test) with thicker interactions indicating more significant connections. Node colors represent the associated narrow-wavelength responsive cluster; C1, Amber cluster (amber only); C2, Purple cluster (red and blue, not amber); C3, Blue cluster (blue only); C4, Orange cluster (Amber and blue, not red); C5, Red cluster (only red). Flavonoid metabolism process was enriched in both C2 and C5 clusters. This illustration covers all enriched biological processes with the size of 20 or more proteins.

128

Figure 5. 7. Network of hub proteins from the five clusters of DE proteins. Proteins are represented as nodes using various colors that represent each cluster; C1, Amber cluster (amber only); C2, Purple cluster (red and blue, not amber); C3, Blue cluster (blue only); C4, Orange cluster (Amber and blue, not red); C5, Red cluster (only red).

129 A B 1

1 )

0 ) 0

(

F F

−1 R

g s

s −1

e b

b −2

m A A −2

−3 down up down up Expression pattern Expression pattern SAS response SAS response

C D

1 1

)

(

0 0

R R

−1 −1

down up down up Expression pattern Expression pattern SAS response SAS response

Figure 5. 8. Activity of SAS response under different narrow-wavelength light conditions. A-C) expression patterns of SAS proteins that are identified as DE in our dataset in different light conditions. x-axis represent the transcriptome expression patterns of these SAS proteins under SAS response compared to the control. D) expression patterns of all proteins implicated in SAS response in R vs B narrow-wavelength lights. As shown, while SAS response is active under R and B compared to A light, this response does not show preferential activity between R and B light conditions.

5.4.5 Systemic Acquired Resistance (SAR) is active under B and R light conditions

The C2 cluster was up-regulated in B- and R- plants compared to A-plants. Functional enrichment analysis revealed strong enrichment of processes associated with plant stress and defense responses (Figure 5.7). Many categories associated with oxidative stress were also enriched in this cluster including response to reactive oxygen species (ROS) and endoplasmic

130 reticulum stress. This is in line with the observed acceleration of yellowing leaves and death morphology in plants under R, and to a lesser extent under B (Figure 5.4A). Proteins involved in plant response to salicylic acid (SA) and SA metabolic process were also significantly enriched in C2 cluster, suggesting that R and B light conditions could have SA‐regulatory role in plants. Possible reasons for these effects can be an accumulation of free-radical compounds such as NO and O2 in plants under B and R. Corroborating this hypothesis, targets of free radicals (Parani, Rudrabhatla et al. 2004, Hussain, Mun et al. 2016, Dogra, Duan et al. 2017, Hieno, Naznin et al. 2019) were found significantly enriched in C2 cluster (Figure 5.5D). GO terms analysis of the overlapping targets further showed an enrichment of proteins implicated in plant SA regulation and defense responses. The observed co-enrichment patterns is coincident with the previously reported inter-connection of ROS response and stress responses including high light, desiccation, heat, and biotic stresses (Gururani, Venkatesh et al. 2015, Choudhury, Rivero et al. 2017) (Figure 5.5D).

Network analysis of C2 cluster underscored key enzymes associated with stress response (Hsp70-2, SOBIR1), endoplasmic reticulum (ER) protein-folding machinery (BIP1, PDIL1-2, CRT3), SA‐induced immune responses (EDS1, NPR1, CBP60G), camalexin biosynthetic and metabolic process (PAD4) as central to the network of C2 proteins (Figure 5.8).

A significant enrichment of C2 cluster for free-radicals linked proteins and key enzymes in SA‐induced immune responses can suggest the activation of SA-induced SAR defense signaling under B and R (Zhu, Jeong et al. 2011, Wu, Zhang et al. 2012, Fu and Dong 2013, Wagner, Stuttmann et al. 2013, Cui, Gobbato et al. 2017). To test this hypothesis, we examined the overlaps of C2 cluster with previously reported transcriptomics study on response to SA in A. thaliana leaves (Thibaud-Nissen, Wu et al. 2006). Consistent with the possible activity of SA response under R and B, we found a high correlation between the SA-induced gene expression patterns and protein expression patterns in R-to-A and B-to-A light conditions (Pearson’s correlation: 0.53 and 0.56 for B-to-A and R-to-A; Figure 5.10B). While SAR is active under B and R compared to A light condition, this response does not show preferential activity between R and B light conditions as evidenced by the lack of correlations (Figure 5.10). Further supporting this, C2 cluster was also significantly enriched for the targets of master regulators of SA-mediated SAR reponse including

131 NPR1 and WRKY18 (Wang, Amornsiripanitch et al. 2006) (Figure 5.5D). A significant overlap between C2 proteins and senescence-associated genes (SAGs) (Guo and GAN 2012, Li, Zhao et al. 2017) was also observed (Figure 5.5D), indicating strong involvement of the senescence process as a required resistance signaling, accompanied with SAR response (Somssich 2018). GO terms analysis of the overlapping targets further showed an enrichment of proteins implicated in plant oxidative stress and defense responses. These proteome-level responses are consistent with the observed yellowing and early death of plants’ leaves under R, and to a lesser extent under B. Taken together, this data is suggesting that processes involved in SA and SAR related defense responses are active under R and B light conditions.

Figure 5. 9. SAR show light specific responses in A. thaliana plants. While SAR is active under B and R compared to A light condition, this response does not show preferential activity between R and B light conditions as evidenced by the lack of correlations. The x-axis represents the fold change of DE proteins in B compared to R light condition. The y-axis represents the fold change of genes involved in SAR comparing the transcriptome of SA response induced leaves with the controls. Data were retrieved from Thibaud-Nissen, Wu et al. (2006).

132 5.4.6 Chloroplast proteome remodeling under B compared to A and R light conditions

The C3 cluster was composed of proteins that were up-regulated in B compared to A and R. Functional analysis of C3 proteins (Figure 5.6) demonstrated enrichment of tetrapyrrole, vitamins, and isoprenoid metabolic processes, where all suggest an enhanced tolerance of plants to ROS-associated photo-oxidative damages in chloroplast under B light condition. Congruently, the term “response to oxidative stress” was found among the enriched GO categories for C3 proteins. C3 cluster was also enriched for the protein repair process, including FtsH8 associated with degradation of D1 protein under stress condition. This observation suggests an enhanced stability and activity of photosystem II reaction center (PSII RC) during PSII photoinhibition under B (Rossini, Casazza et al. 2006, Myouga, Takahashi et al. 2018). Moreover, C3 proteins showed a significant enrichment for terms “plastid organization” and “protein localization to chloroplast”. The high regulatory role of B light in mediating chloroplast development, while challenging oxidative stress appears likely the association of B light receptors (CRY1, 2) (Terry and Smith 2013). Relatedly, a significant overlap was observed between C3 proteins and targets genes of both receptors CRY1 and CRY2 (He, Wang et al. 2015) (Figure 5.5D), which are implicated in ROS signaling pathways (Danon, Coll et al. 2006, Consentino, Lambert et al. 2015, El-Esawi, Arthaut et al. 2017). Also, we examined the targets of transcription factor HY5 that acts downstream of CRYs in mediating ROS signaling (Lee, He et al. 2007, Zhang, He et al. 2011). We observed a statistically significant overlap between HY5 targets and C3 proteins (Figure 5.5D). Further, GO terms “response to light stimulus” was found enriched including a R light receptor (PHYB-D), and a B light receptor (SPA4) with known function in photomorphogenesis (Sellaro, Hoecker et al. 2009, Sheerin, Menon et al. 2015).

Network analysis demonstrated the central role of enzymes associated with chloroplast organization and development (EMB2184, SCO1, SVR3, FUG1, SIGF) and several ribosomal proteins (RPL12-A, RPS17) in the network of C3 proteins (Figure 5.8). Overall, our results suggest the regulation of photo-protective mechanisms under B in response to chloroplast membrane oxidative damages.

133 5.4.7 High energy provision under R and A compared to B light conditions

The cluster C4 was composed of proteins that were up-regulated in R and A compared to B. Functional analysis of included proteins indicated a significant enrichment of categories related to metabolic processes of cellular amino acid and sulfur compounds such as glucosinolate as a defense componed (Figure 5.6). Moreover, biosynthetic processes related to monocarboxylic acids, including proteins that have function particularly in jasmonate acid (JA) and auxin biosynthesis, were significantly enriched. C4 cluster also showed an enrichment for term “cofactor metabolic process”, including protochlorophyllide oxidoreductase A-C (PORA-C) proteins that have function in chlorophyll biosynthesis process.

Network analysis of cluster C4 demonstrated a central role of proteins functioning in glucosinolate core skeleton formation (SUR1, CYP83A1, SOT18), starch biosynthesis and homeostasis (AT3G29320), JA biosynthetic process (LOX2), and TCA cycle (BCAT4, MAM1) (Figure 5.8). Overall, our results suggest high energy provision under A and R light conditions.

5.4.8 Stimulation of plant defense response under R compared to A and B light conditions

The cluster C5 was composed of proteins that were up-regulated in R compared to B and A. Functional analysis of included proteins (Figure 5.6) indicated enrichment of a metabolic process for secondary metabolite anthocyanins. In addition, C5 cluster showed an enrichment for plant response to toxic substances such as GSTUs, and TRX5.

Network analysis of cluster C5 revealed a central role of proteins associated with anthocyanin biosynthesis (LDOX, GSTF12), kinase activity (AT5G63680), innate immunity (RPN1A), glycolysis process (PFK3), and proteasome-mediated proteolysis (EMB2719) (Figure 5.8). Overall, our results suggest an extreme photodamage reaction under R light condition.

134

Figure 5. 10. SAS and SAR demonstrate wavelength specific responses in A. thaliana plants. A) Figures represent the correlation of transcriptomic (x-axis), and proteomic responses of proteins involved in SAS response. The list of SAS responsive proteins was retrieved from Sellaro, Pacin et al. (2017). B) Significant correlation between protein expression in R- and B- plants and SA- induced expression. Data from Thibaud-Nissen, Wu et al. (2006).

5.5 Discussion Understanding the molecular mechanisms affecting the biological processes underpinning the response of Arabidopsis thaliana to specific light wavelengths have been hampered by use of broad light wavelength lights, low number of contrasting conditions, or targeted analysis of specific proteins or pathways. Moreover, available knowledge is mostly based on transcriptome data as a proxy of plant proteome response or use of low coverage proteome assays. In this work, we presented a high-resolution resource on proteomic response of A. thaliana to narrow- wavelengths 450 nm (B), 595 nm (A), and 650 nm (R) affecting different biological process. Our TMT-based isobaric labeling approach resulted in the identification of 16,000 proteins with 9,120

135 proteins quantified across 9 samples, covering 23% of currently annotated proteome of A. thaliana. This in-depth resource enabled us to examine changes in the proteome response of many low expressed proteomes with important regulatory roles including transcription factors and hormone signaling. Importantly, we found that 18% (1631 proteins) of A. thaliana proteome show differential expression patterns in response to narrow-wavelength lights that correlated well with the plant morphological responses and as well other biological processes. To showcase the utility of this resource, we placed our results in the context of +30 available datasets, providing orthogonal validation and insights on deciphered light-specific proteome and regulatory gene response, affecting biological processes. All the same in-depth analysis of different specific biological processes affected is still needed. Therefore, this resource provides an unprecedented view of the proteomic landscape of A. thaliana, and serves as a reliable resource for further characterization of light specific molecular mechanisms in this dominant model organism.

To our knowledge, we are the first to characterize the molecular response of plant to A light. Our analysis demonstrated a high expression of glycoside hydrolase and carbohydrate esterase under A light condition. Carbohydrate active family of enzymes (CAZY) are known to induce elongation growth in Arabidopsis and to readily adjust cell wall modification and organization (Knoch, Dilokpimol et al. 2014). Our analysis also revealed a higher abundance of several protein families involved in cell wall biosynthesis and differentiation including but not limited to expansin associated proteins, and lipid transfer proteins that have been indicated capable to facilitate the ongoing extension process associated with cell wall division and loosening mechanisms. Co-upregulation of these modifying enzymes has been shown to stimulate cell extension through branching modification of xyloglucan-cellulose-pectin network that maintains cell wall plasticity while facilitating elongating growth (Cosgrove 2005). Furthermore, we observed auxin efflux transfers and water transporters in a smaller subset of enriched proteins with known function in cell expansion/loosening during full auxin-induction of elongating growth (Kozuka, Kobayashi et al. 2010, de Wit, Lorrain et al. 2014, Procko, Burko et al. 2016). These observations are consistent with the current understanding of the molecular signatures of SAS response (de Wit, Kegge et al. 2012, Ballare and Pierik 2017). Interestingly, our results suggested activity of B-light photoreceptors under A light condition. B-light photoreceptors were seen to inversely drive the plants physiology, which agrees with previous observations under shade

136 conditions (Pierik, Djakovic-Petrovic et al. 2009). In comparative studies of induced SAS response and elements of the signal transduction pathways, the observation usually comes with the fact of interaction between photoreceptors and TFs, especially PIFs family (Ma, Li et al. 2016, Pedmale, Huang et al. 2016). This agreed with our own observations that enrichment of the numerous targets of PIFs and B-light photoreceptors lends credence to the idea of a causal relationship between the two factors.

Existing literature determines that besides increased petiole length and plant height, SAS is characterized by early flowering (Galvão, Collani et al. 2015), by which plants ensure the chance of surviving under energy resource‐limited condition. However, genes over-expressed under 595nm light were not significantly enriched for the flowering genes. This is partly in agreement with Lorenzo et al., who found a similar delayed flowering under SAS in alfalfa (Medicago sativa) (Lorenzo, Alonso Iserte et al. 2019), although their observation of the expression pattern of flowering genes does not agree with our results. It is therefore clear that plants would require higher energy and protection for increasing the chance of surviving to the following reproductive event. As with the depletion of R and B irradiance, plants encountered reduced available photoassimilate, it was not surprising to observe the enriched subunits of plastid NDH complex and proteins associated with photosynthetic electron transfer, allowing for higher energy (ATP) production (Rumeau, Peltier et al. 2007). Involvement of photosynthetic apparatus in regulating shade response has been previously reported (Cagnola, Ploschuk et al. 2012, Casal 2012). We also saw strong enrichment for three isoforms PORA/B/C in the same cluster, while no enrichment was observed for genes involved in chlorophyll biosynthesis (Shin, Kim et al. 2009) suggesting their contribution toward plastid photoprotection in plants under A light condition. Moreover, enrichment of proteins participated in jasmonic acid (JA) biosynthesis is an interesting observation to consider, as previous studies showed contribution of JA related-proteins in mediating plant immunity rather than elongating growth (Moreno, Tao et al. 2009, Wasternack and Hause 2013). Choudhury et al. reported a direct regulatory role of NO in glutathione biosynthesis under light stress condition (Choudhury, Devireddy et al. 2018), while we observed no correlation or trend in our data. It is therefore possible that the extensive enrichment of proteins which participated in glucosinolate biosynthesis in A-plants served as reserves, as those contain high levels of nitrogen and sulfur. At the same time, we observed in a smaller subset of proteins of C4 that plants

137 accumulated more proteins involved in the biosynthesis of amino acids, which contain high nitrogen to carbon ratio to serve as reserves for plants. These amino acids are highly scavenging units for free released ammonium from cellular metabolic activity (Law, Chrobok et al. 2018). Indeed, enzymes involved in nitrate and ammonium assimilation are among the significantly depleted proteins in C1. Despite the delay in flowering, it is possible that the energy transmitted by A light is effective for balanced elongating growth and metabolic processes involved in defense mechanisms in plants, which can be interesting in the context of a growth-defense dilemma (Moreno and Ballaré 2014).

In addition to highlighting the wavelength specific responses, our results also underscore the inter-connection of signaling pathways active under different light wavelengths. The distribution of proteins in response to R light appears to partly overlap with those under A and B wavelengths, while a subset exclusively shows higher abundance under R. This suggests a complex regulatory mechanism of R light that impacts plant response in common and distinct ways at the protein level, compared to other light wavelengths. The most significant similarity was observed among C2 proteins, which respond commonly to R and B light conditions. Indeed, previous studies showed that only relatively few genes are specifically regulated by B and R (Ma, Li et al. 2001, Jiao, Ma et al. 2005). Although, most of the proteins that showed altered expression upon exposure to A were found responsive to the absence of R and B light signals. There is a possibility that the shared responsive proteins observed under A and R light conditions are caused by the low light irradiance of the LEDs used for treatments.

Significant past effort has gone into discovering determinants of plant stress response to light. Our observations on the overlap between light responsive proteins and stress signaling proteins bolster many of the previously published observations but also differ in a few key aspects. Our results suggested ROS and SAR associated proteins mediate SAR response in B- and R-plants, which agrees with previous observations (Černý, Habánová et al. 2018, Krasensky-Wrzaczek and

Kangasjärvi 2018). We also observed a significant increase in relative abundance of Ca+2 stimulating TFs among high abundant proteins in B- and R-plants. These TFs contribute to SA biosynthesis and signaling pathways. A link between Ca+2 signaling and SA synthesis has been previously reported (Seyfferth and Tsuda 2014, Herrera-Vasquez, Salinas et al. 2015). Enrichment

138 of R light receptors and SPA4 were also observed in B- and R-plants, corroborating on the importance of these factors in light-induced regulation of SA accumulation (Griebel and Zeier 2008, Roden and Ingle 2009). In comparative studies of plants grown under B vs. R light, this observation usually comes with the conclusion that stress signaling is predominantly mediated by B photoreceptors and less by R light receptors. However, our observation of a strong similar trend within the proteome of B- and R-plants in C2, suggesting a common ROS regulatory role of both photoreceptors. Moreover, a strong enrichment in proteins related to ER stress and the ubiquitin– proteasome system within C2 and C5 suggests extreme resistance in R-plants to eliminate damaged cells (Liu, Burgos et al. 2012). It is further important to note that implicated ROS-mediated defense mechanisms are associated with distinct R and B mediated responses. Under R, plants showed mediation of a robust compensatory defense response that is principally attributed to a proper integration of multiple phytohormones signaling and metabolic pathways. In contrast, under B, a high abundance was observed for the proteins associated with chloroplast membrane antioxidant and photosystems protection. Additionally, proteins with exclusively high expression under B light, showed specific enrichment toward nuclear-chloroplast communication, highlighting the interplay of these organelles that is vital for stress-induced remodeling of plastid proteome in driving stress acclimation (Jarvis 2008, Watson, Sowden et al. 2018).

Our results suggest high protein degradation and synthesis rate under B light that appears to be a protective response to high photo-oxidation rate under this wavelength. Ribosomal proteins, chloroplastic RNA polymerase sigma factors, and RNA processing associated proteins are specifically up-regulated under B wavelength. This observation suggests co-regulation of these proteins as part of RNA stabilizing and processing that play crucial roles in chloroplast development under light conditions (Romani, Tadini et al. 2012, Borner, Aleynikova et al. 2015, Rovira and Smith 2019). Of interest was the enrichment of pentatricopeptide repeat (PPR) family proteins in B-plants suggesting the enhanced stability of PSII and Cyt b6f complex. Furthermore, chloroplast ribonucleoproteins that act as a protector on light reaction proteins (Manavski, Schmid et al. 2018) showed a significant enrichment among proteins of C2. Enrichment of PPRs livelihood the contribution of a precise RNA protection over transcriptional, translational and posttranscriptional modification during stress response under B light condition (Yu, Huang et al. 2014, Watson, Sowden et al. 2018).

139

Another observation was segregation of the core proteins involved in starch and sucrose metabolism pathways and those are associated with photosynthetic carbon assimilation, into different clusters. The major regulatory proteins in starch synthesis and degradation were enriched under A and R light conditions, whereas the core proteins with important functions in Rubisco biogenesis were enriched under B light. It is possible that the high accumulation of starch and sucrose in leaves of A- and R-plants, eliminated the activity of the Rubisco enzyme (Hdider and Desjardins 1994). Indeed, proteins that act as proxy for sucrose levels are among the most statistically significant enriched proteins under A and R light conditions. This observation is partly in agreement with Li et al., who found a negative correlation between rubisco activity and sucrose content of grape plantlets grown in vitro under blue, green, and red light (Li, Xu et al. 2017). However their observations of an up-regulation in translocation and utilization of sucrose under B light showed disagreements with our results. The enrichment of seven members of the serine carboxypeptidase-like protein family in A- and R-plants is expected to have a positive effect on translocation of sucrose (Lehfeldt, Shirley et al. 2000). Furthermore, within C4 proteins, we observed the enrichment of acid beta-fructofuranosidase subunits with known function in sucrose translocation (Roitsch and González 2004). The enrichment of TPS subunits, as the sucrose- sensing proteins and involved in sugar transporting (Lastdrager, Hanson et al. 2014), could further explain this result under A and R light conditions.

5.6 Conclusion The availability of the entire genomic sequence of Arabidopsis and advanced usage of the proteomics techniques such as TMT with significant potential of detecting total quantified proteins, particularly among the less abundant, by higher precision across samples, urged us to systematically analyze the alterations in protein expression under 595 nm, 450 nm, and 650 nm. In the course of this work, proteomics data provides deep insights on understanding proteins and molecular mechanisms involved in light-specific response of plant morphology, physiological processes, and stress responses. The TMT-based isobaric labeling approach resulted in the identification of 16,000 proteins with 9,120 proteins quantified across 9 samples, covering 23% of the currently annotated proteome of A. thaliana. This presented a high-resolution resource on proteomic response of A. thaliana to narrow-wavelengths, affecting different biological processes.

140 Exposure to 595 nm primarily triggered physiological performance associated with shade- avoidance syndrome (SAS), such as enhanced elongation of petioles and leaf hyponasty. I observed an overexpression of processes involved in cell wall metabolic, photosystems light harvesting, and auxin transport. Downstream analysis showed important regulatory functions of the transcription factors phytochrome interacting factors including members of PIF family in plant response to 595 nm. Upon exposure to either 450 nm or 650 nm, seedlings showed an induction of a number of proteins associated with salicylic acid (SA)-induced systemic acquired resistance (SAR) response that correlated with the observed yellowing of leaves. This physiological behavior was accompanied with the overexpression of resistance-related proteins including those involved in programmed cell death, senescence, and hypersensitive response. Transcription factor nonexpressor of pathogenesis-related gene (NPR1), free radicals and antioxidants showed important regulatory functions in promoting 450 nm and 650 nm induced SAR response. Besides similar behavior of SAR-like defense response in 450 nm and 650 nm plants, both lights showed a selective regulation of the implicated mechanisms in their responses; 450 nm mediated antioxidants and protective mechanisms linked to retrograde signaling, resulted in remodeling of the plastid proteome. 650 nm regulated a compensatory defense response attributed to an integration of phytohormones (jasmonic acid (JA), SA, and indole-3-acetic acid (IAA)) and antioxidants (glutathione and anthocyanin). This study provides insights into the underlying mechanism of light wavelength-induced responses, which may have potential implication in plants development and survival. Most studies using LEDs for sole-source lighting demonstrate the need to supplement monochromatic red LEDs or blue light to obtain acceptable growth and development. Therefore, to fully leverage the benefits of lighting systems, studies of targeted lighting, changing spectral composition throughout crop/plant life are needed.

141 6. General Summary

6.1 General Conclusion

The objective of this research was to uncover the molecular basis of plant growth, photosynthesis and development response to different narrow-wavelength light conditions. A survey of current literature clearly shows a major gap in our understanding of the molecular mechanisms of the wavelengths-specific effects of light on plants. It is thus important to systematically develop reproducible and high coverage data resources of plant growth and development responses to light wavelengths.

Natural variation plays a major role in plant phenotype and adaptation under different environments. Moreover, the effect of light wavelengths on plant growth and photosynthesis processes depends on the physiological and molecular state of the plant. As a first step, we investigated the effect of three LED wavelength 450 nm, 595 nm, and 650 nm on leaf growth and photosynthetic performance of three Arabidopsis accessions Col-0, Est-1, and C24 compared with FL, as control. These wavelengths were found to significantly impact plant leaf area, biomass, and pigment accumulation (chlorophylls, carotenoid, and anthocyanin). The data indicated that these wavelengths significantly affected Pn across accessions. In addition, a significant interaction between incident wavelength and genotype impacted plants biomass and leaf growth. Moreover, a significant increase in carotenoids and anthocyanins was observed when plants were treated under 450 nm. The data further demonstrates an impact of 595 nm on the stimulation of antioxidative systems that scavenge generated ROS, as shown by the increased transcription of PSBA and GSH2, along with higher SOD and APX activity in plants. These responses were associated with a decrease in photosynthate (protein and starch) contents under 595 nm.

Additionally, strong reductions in leaf growth, biomass accumulation and photosynthate contents of 595 nm treated-plants were observed, while Pn value remained constant. We thus analyzed the molecular mechanisms of plant response under 595 nm using MudPIT LC-MS/MS technology, as an unbiased proteomic assay towards the understanding of the processes associated with plants’ response to 595 nm. The data identified a number of proteins involved in plant stress

142 tolerance. Although the obtained proteome coverage was low, The result indicated significant rearrangement in plant proteome upon 595 nm exposure. Functional analysis of the differentially expressed proteins (DAPs) demonstrated several biological mechanisms in the plant response to 595 nm including stress response and metabolic processes. Network analysis of DAPs demonstrated the importance of energy and redox regulation mechanisms under 595 nm. Relatedly, proteins involved in carbohydrate and amino acids metabolism are found in larger abundances under 595 nm. This could allow the plant to efficiently adjust energy generation and protein synthesis to increase plant tolerance under 595 nm. More importantly, the associated Ca2+ and ROS signaling molecules and PSII higher tolerance-associated proteins were detected with significant changes in abundance, supporting a role of plant adaptation mechanisms under 595 nm.

The availability of the entire genomic sequence of Arabidopsis and advanced usage of the proteomics techniques such as TMT with significant potential of detecting total quantified proteins, particularly among the less abundant, by higher precision across samples, urged us to systematically analyze the alterations in protein expression under 595 nm, 450 nm, and 650 nm. The TMT-based isobaric labeling approach resulted in the identification of 9,551 proteins with 9,120 proteins quantified across 9 samples, covering 23% of currently annotated proteome of A. thaliana. This presented a high-resolution resource on proteomic response of A. thaliana to narrow-wavelengths, affecting different biological process. Exposure to 595 nm primarily triggered physiological performance associated with shade-avoidance syndrome (SAS), such as enhanced elongation of petioles and leaf hyponasty. I observed an overexpression of processes involved in cell wall metabolic, photosystems light harvesting, and auxin transport. Downstream analysis showed important regulatory functions of the transcription phytochrome interacting factors including members of PIF family in plant response to 595 nm. Upon exposure to either 450 nm or 650 nm, seedlings showed an induction of a numbers of proteins associated with salicylic acid (SA)-induced systemic acquired resistance (SAR) response that correlated with the observed yellowing leaves. This physiological behavior was accompanied with the overexpression of resistance-related proteins including those involved in programmed cell death, senescence, and hypersensitive response. Transcription factor nonexpressor of pathogenesis-related gene (NPR1), free radicals and antioxidants showed important regulatory functions in promoting 450 nm and 650 nm induced SAR response. Besides similar behavior of SAR-like defense response in 450 nm

143 and 650 nm plants, both lights showed a selective regulation of the implicated mechanisms in their responses; 450 nm mediated antioxidants and protective mechanisms linked to retrograde signaling, resulting in remodeling of the plastid proteome. 650 nm regulated a compensatory defense response attributed to an integration of phytohormones (jasmonic acid (JA), SA, and indole-3-acetic acid (IAA)) and antioxidants (glutathione and anthocyanin). This study provides insights into the underlying mechanism of narrow-wavelengths induced responses, which may have potential implications in plant development and survival.

6.2 Contributions to Knowledge

This work generates knowledge and resources imperative for understanding the molecular mechanisms underpinning the plant response to specific narrow-wavelength lights. Further research in this direction would eventually allow improving plant production and protection through optimizing light treatments under controlled agricultural environments. A few of the several notable contributions are as follows:

1- This study provides a comprehensive physiological, biochemical, proteomic, and transcriptomic view on narrow-wavlength light response of A. thaliana model plant. This resourse fills the current critical gap on molecular changes induced by specific light wavelengths and their connection with the plant’s adaptation, growth, and morphology.

2- This study establishes a foundation to proteomics view on wavelength response of A. thaliana to date. Both wavelength specific and common molecular processes underlying plant growth and defense responses under 450nm, 595nm, and 650nm were studied. The generated data serve as a reliable resource for formulating new biological hypotheses and further experimental leads.

144 3- This work identifies that plant leaf area growth and biomass accumulation are regulated by both light wavelengths and genotype, suggesting genotype dependent adaptation of some plant responses to narrow-wavelenghts of light. Given that accessions show specific geographical distributions, this observation suggests that they are evolved under and are adapted to different light environments.

4- This work presents the first thorough examination of plant response under 595 nm including plant proteomic organization. This provides insights on biologically relevant contexts where plants are exposed to changing season and/or shaded environment with related implications on the plant’s adaptation and production.

5- This study discovers a significant accumulation of oxidative-modified biomolecules in chloroplast under 595 nm. The result further showed a higher demand for ATP to maintain metabolic homeostasis in plants under the 595 nm light condition. These observations support an enhanced acclimation capacity for plants under 595 nm.

6- The investigation of plant response to 595 nm discovers a great potential of this narrow- wavelength in modulating chloroplast metabolic reactions involved in the “optimizing resource allocation” process. This has implications in 1) increase reserves and chances of survival to the time of flowering; 2) a high capacity for lipid accumulation, attributed to the synthesis of lipids by degrading assimilated carbon under 595 nm.

7- The results demonstrated the important role for proteins associated with glycolysis, ATP synthase complex, stress response, cell wall modification and particularly, those which are involved in thylakoid membrane in modulating plant adaptation under 595 nm.

8- The network level analysis of DAPs in plants under 595 nm demonstrated the importance of energy and redox regulation mechanisms in plant response. Regulated enzymes suggest the sustaining of intracellular redox homeostasis, leading to lower requirements for energy to scavenge the generated ROS.

145 9- The proteome response to 595 nm shows the most distinguished changes between the three narrow-wavelength light conditions. The functional analysis of DAPs demonstrates the induction of SAS response under 595 nm. This coincides with the hyponasty morphology of the plants under 595 nm.

10- This work demonstrates the induction of salicylic acid (SA)-induced systemic acquired resistance (SAR) response under both 450 nm and 650 nm wavelengths that correlates well with the morphology of the treated plants. This response was accompanied with the overexpression of resistance-related proteins, including those involved in programmed cell death, and senescence.

11- The proteomics data illustrates a selective regulation of the implicated mechanisms in plant responses under 450 nm and 650 nm. A remodeling of the plastid proteome was observed in plants under 450 nm that could be associated with a significant activation of antioxidants and chloroplast associated protective mechanisms that can be related with a high protein biosynthesis/degradation in the chloroplast. A compensatory defense response attributed to an integration of phytohormones and antioxidants was found in plants under 650 nm.

6.3 Future Directions

This study focused on revealing the physiological and molecular basis of plant growth, photosynthesis and development responses to light wavelengths. Three Arabidopsis accessions Col-0, Est-1 and C24, along with three different narrow-wavelengths of light 450 nm, 595 nm, and 650 nm were tested and showed significant outcomes. The two most common methods for proteome-wide quantitation, MudPIT and TMT-based labeling were applied to characterize the full spectrum of protein abundances in a proteome of Arabidopsis while they are treated by narrow- wavelengths. Future studies could provide further insights on the wavelength-specific molecular mechanisms of plant adaptation:

146 1- As photosynthesis was one of the core focuses of this work, chlorophyll fluorescent measurement should be used to complement the current data with the photosynthetic light reaction efficiency and photosynthetic energy conversion underlying the phenotypic diversity and light conditions across the treatments.

2- This work establishes a significant interaction between the genetic and the wavelength response of the plant. Further single or multi-trait genome wide association studies (GWAS) could examine and determine the genetic components underlying the phenotypic diversity across the studied accessions.

3- The generated in-depth proteome resource in this work identifies wavelength-specific proteomic remodeling in the plants. Future studies could investigate the roles that photoreceptors and signaling pathways play in mediating these changes through gene mutation experiments. Analysis of protein phosphorylation changes induced in response to narrow-wavelength response could further help in identifying the induced signaling pathways.

4- Future studies could investigate the relationship between differentially expressed proteins and biosynthesis of associated secondary metabolites. This can be accomplished by growing plants with the same light wavelengths, but at a greater intensity that might induce more specific metabolic stress responses in the plants.

5- The protein expression atlas that was generated in this study can be created on different organelles of A. thaliana to increase proteome coverage and identify protein relocalization events.

147 7. References

Abdi, H. (2010). "Congruence: Congruence coefficient, RV coefficient, and mantel coefficient." Encyclopedia of research design 222: 229. Abidi, F., T. Girault, O. Douillet, G. Guillemain, G. Sintes, M. Laffaire, H. B. Ahmed, S. Smiti, L. Huché‐Thélier and N. Leduc (2013). "Blue light effects on rose photosynthesis and photomorphogenesis." Plant Biology 15(1): 67-74. Agarwal, A. and S. D. Gupta (2016). "Impact of light-emitting diodes (LEDs) and its potential on plant growth and development in controlled-environment plant production system." Current Biotechnology 5(1): 28-43. Ahmad, M. (2016). "Photocycle and signaling mechanisms of plant cryptochromes." Current opinion in plant biology 33: 108-115. Alboresi, A., L. Dall'Osto, A. Aprile, P. Carillo, E. Roncaglia, L. Cattivelli and R. Bassi (2011). "Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein." BMC plant biology 11(1): 62. Alonso-Blanco, C., J. Andrade, C. Becker, F. Bemm, J. Bergelson, K. M. Borgwardt, J. Cao, E. Chae, T. M. Dezwaan and W. Ding (2016). "1,135 genomes reveal the global pattern of polymorphism in Arabidopsis thaliana." Cell 166(2): 481-491. Altelaar, A. M., J. Munoz and A. J. Heck (2013). "Next-generation proteomics: towards an integrative view of proteome dynamics." Nature Reviews Genetics 14(1): 35. An, C. and Z. Mou (2011). "Salicylic acid and its function in plant immunity F." Journal of integrative plant biology 53(6): 412-428. Arbona, V., M. Manzi, C. Ollas and A. Gómez-Cadenas (2013). "Metabolomics as a tool to investigate abiotic stress tolerance in plants." International journal of molecular sciences 14(3): 4885-4911. Argueso, C. T., T. Raines and J. J. Kieber (2010). "Cytokinin signaling and transcriptional networks." Current opinion in plant biology 13(5): 533-539. Armond, P. A., U. Schreiber and O. Björkman (1978). "Photosynthetic acclimation to temperature in the desert shrub, Larrea divaricata: II. Light-harvesting efficiency and electron transport." Plant Physiology 61(3): 411-415. Armstrong, G. and J. Hearst (1996). "Carotenoids 2: Genetics and molecular biology of carotenoid pigment biosynthesis." The FASEB Journal 10(2): 228-237. Aryal, U. K., Z. McBride, D. Chen, J. Xie and D. B. Szymanski (2017). "Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling." J Proteomics 166: 8-18. Ballare, C. L. (2014). "Light regulation of plant defense." Annu Rev Plant Biol 65: 335-363. Ballaré, C. L., C. A. Mazza, A. T. Austin and R. Pierik (2012). "Canopy light and plant health." Plant physiology 160(1): 145-155. Ballare, C. L. and R. Pierik (2017). "The shade-avoidance syndrome: multiple signals and ecological consequences." Plant Cell Environ 40(11): 2530-2543. Baniulis, D., S. S. Hasan, J. T. Stofleth and W. A. Cramer (2013). "Mechanism of enhanced superoxide production in the cytochrome b 6 f complex of oxygenic photosynthesis." Biochemistry 52(50): 8975-8983.

148 Bantis, F., T. Ouzounis and K. Radoglou (2016). "Artificial LED lighting enhances growth characteristics and total phenolic content of Ocimum basilicum, but variably affects transplant success." Scientia Horticulturae 198: 277-283. Barber, J. (2009). "Photosynthetic energy conversion: natural and artificial." Chemical Society Reviews 38(1): 185-196. Barber, J. and B. Andersson (1992). "Too much of a good thing: light can be bad for photosynthesis." Trends in biochemical sciences 17(2): 61-66. Baxter, A., R. Mittler and N. Suzuki (2013). "ROS as key players in plant stress signalling." Journal of experimental botany 65(5): 1229-1240. Benčina, M. (2013). "Illumination of the spatial order of intracellular pH by genetically encoded pH-sensitive sensors." Sensors 13(12): 16736-16758. Berens, M. L., H. M. Berry, A. Mine, C. T. Argueso and K. Tsuda (2017). "Evolution of hormone signaling networks in plant defense." Annual Review of Phytopathology 55: 401-425. Berner, N., K.-R. Reutter and D. H. Wolf (2018). "Protein quality control of the endoplasmic reticulum and ubiquitin–proteasome-triggered degradation of aberrant proteins: Yeast pioneers the path." Annual review of biochemistry 87: 751-782. Bhattacharjee, S. (2019). ROS and Regulation of Photosynthesis. Reactive Oxygen Species in Plant Biology, Springer: 107-125. Bhuiyan, N. H., G. Friso, A. Poliakov, L. Ponnala and K. J. van Wijk (2015). "MET1 is a thylakoid-associated TPR protein involved in photosystem II supercomplex formation and repair in Arabidopsis." The Plant Cell 27(1): 262-285. Bindea, G., B. Mlecnik, H. Hackl, P. Charoentong, M. Tosolini, A. Kirilovsky, W. H. Fridman, F. Pages, Z. Trajanoski and J. Galon (2009). "ClueGO: a Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks." Bioinformatics 25(8): 1091-1093. Bisbis, M. B., N. Gruda and M. Blanke (2018). "Potential impacts of climate change on vegetable production and product quality–A review." Journal of Cleaner Production 170: 1602-1620. Blankenship, R. (2002). Electron transfer pathways and components.[In:] Molecular mechanisms of photosynthesis. Blankenship RE, editor, Oxford: Blackwell Science Ltd. Blankenship, R. E. (2014). Molecular mechanisms of photosynthesis, John Wiley & Sons. Bligh, E. G. and W. J. Dyer (1959). "A rapid method of total lipid extraction and purification." Can J Biochem Physiol 37(8): 911-917. Borner, T., A. Y. Aleynikova, Y. O. Zubo and V. V. Kusnetsov (2015). "Chloroplast RNA polymerases: Role in chloroplast biogenesis." Biochim Biophys Acta 1847(9): 761-769. Botto, J. and H. Smith (2002). "Differential genetic variation in adaptive strategies to a common environmental signal in Arabidopsis accessions: phytochrome‐mediated shade avoidance." Plant, Cell & Environment 25(1): 53-63. Boyes, D. C., A. M. Zayed, R. Ascenzi, A. J. McCaskill, N. E. Hoffman, K. R. Davis and J. Gorlach (2001). "Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants." Plant Cell 13(7): 1499-1510. Brautigam, K., L. Dietzel, T. Kleine, E. Stroher, D. Wormuth, K. J. Dietz, D. Radke, M. Wirtz, R. Hell, P. Dormann, A. Nunes-Nesi, N. Schauer, A. R. Fernie, S. N. Oliver, P. Geigenberger, D. Leister and T. Pfannschmidt (2009). "Dynamic plastid redox signals integrate gene expression and metabolism to induce distinct metabolic states in photosynthetic acclimation in Arabidopsis." Plant Cell 21(9): 2715-2732.

149 Brazaitytė, A., P. Duchovskis, A. Urbonavičiūtė, G. Samuolienė, J. Jankauskienė, J. Sakalauskaitė, G. Šabajevienė, R. Sirtautas and A. Novičkovas (2010). "The effect of light-emitting diodes lighting on the growth of tomato transplants." Zemdirbyste-Agriculture 97(2): 89-98. Buchanan, B. B., W. Gruissem and R. L. Jones (2015). Biochemistry and molecular biology of plants, John Wiley & Sons. Bugbee, B. (2016). Toward an optimal spectral quality for plant growth and development: the importance of radiation capture. VIII International Symposium on Light in Horticulture 1134. Caffarri, S., T. Tibiletti, R. C. Jennings and S. Santabarbara (2014). "A comparison between plant photosystem I and photosystem II architecture and functioning." Curr Protein Pept Sci 15(4): 296- 331. Cagnola, J. I., E. Ploschuk, T. Benech-Arnold, S. A. Finlayson and J. J. Casal (2012). "Stem transcriptome reveals mechanisms to reduce the energetic cost of shade-avoidance responses in tomato." Plant Physiol 160(2): 1110-1119. Cardona, T., S. Shao and P. J. Nixon (2018). "Enhancing photosynthesis in plants: the light reactions." Essays in biochemistry 62(1): 85-94. Carter, H., M. Hofree and T. Ideker (2013). "Genotype to phenotype via network analysis." Current opinion in genetics & development 23(6): 611-621. Carvalho, P. C., J. S. Fischer, T. Xu, D. Cociorva, T. S. Balbuena, R. H. Valente, J. Perales, J. R. Yates III and V. C. Barbosa (2012). "Search engine processor: filtering and organizing peptide spectrum matches." Proteomics 12(7): 944-949. Carvalho, P. C., J. Hewel, V. C. Barbosa and J. R. Yates III (2008). "Identifying differences in protein expression levels by spectral counting and feature selection." Genetics and molecular research: GMR 7(2): 342. Carvalho, P. C., D. B. Lima, F. V. Leprevost, M. D. Santos, J. S. Fischer, P. F. Aquino, J. J. Moresco, J. R. Yates III and V. C. Barbosa (2016). "Integrated analysis of shotgun proteomic data with PatternLab for proteomics 4.0." Nature protocols 11(1): 102. Casal, J. J. (2012). "Shade avoidance." Arabidopsis Book 10: e0157. Casal, J. J. (2013). "Photoreceptor signaling networks in plant responses to shade." Annu Rev Plant Biol 64: 403-427. Casal, J. J. (2013). "Photoreceptor signaling networks in plant responses to shade." Annual review of plant biology 64: 403-427. Casson, S. A. and A. M. Hetherington (2014). "phytochrome B Is required for light-mediated systemic control of stomatal development." Current Biology 24(11): 1216-1221. Castilla, N. (2013). Greenhouse technology and management, Cabi. Caverzan, A., A. Casassola and S. P. Brammer (2016). "Reactive oxygen species and antioxidant enzymes involved in plant tolerance to stress." Abiotic and biotic stress in plants-Recent advances and future perspectives: 463-480. Ceccarelli, E. A., A. K. Arakaki, N. Cortez and N. Carrillo (2004). "Functional plasticity and catalytic efficiency in plant and bacterial ferredoxin-NADP (H) reductases." Biochimica et Biophysica Acta (BBA)-Proteins and Proteomics 1698(2): 155-165. Černý, M., H. Habánová, M. Berka, M. Luklova and B. Brzobohatý (2018). "Hydrogen peroxide: its role in plant biology and crosstalk with signalling networks." International journal of molecular sciences 19(9): 2812. Cerrudo, I., M. M. Keller, M. D. Cargnel, P. V. Demkura, M. de de Wit, M. S. Patitucci, R. Pierik, C. M. Pieterse and C. L. Ballaré (2012). "Low Red: Far-Red ratios reduce Arabidopsis resistance

150 to Botrytis cinerea and jasmonate responses via a COI1-JAZ10-dependent, salicylic acid- independent mechanism." Plant Physiology: pp. 112.193359. Chaves, I., R. Pokorny, M. Byrdin, N. Hoang, T. Ritz, K. Brettel, L.-O. Essen, G. T. van der Horst, A. Batschauer and M. Ahmad (2011). "The cryptochromes: blue light photoreceptors in plants and animals." Annual review of plant biology 62: 335-364. Chen, C., H. Huang and C. H. Wu (2017). Protein bioinformatics databases and resources. Protein Bioinformatics, Springer: 3-39. Chen, D., G. Xu, W. Tang, Y. Jing, Q. Ji, Z. Fei and R. Lin (2013). "Antagonistic basic helix-loop- helix/bZIP transcription factors form transcriptional modules that integrate light and reactive oxygen species signaling in Arabidopsis." The Plant Cell 25(5): 1657-1673. Chen, H. and L. Xiong (2011). "Genetic interaction of two abscisic acid signaling regulators, HY5 and FIERY1, in mediating lateral root formation." Plant signaling & behavior 6(1): 123-125. Chen, M. and J. Chory (2011). "Phytochrome signaling mechanisms and the control of plant development." Trends in cell biology 21(11): 664-671. Chen, M., R. M. Galvão, M. Li, B. Burger, J. Bugea, J. Bolado and J. Chory (2010). "Arabidopsis HEMERA/pTAC12 initiates photomorphogenesis by phytochromes." Cell 141(7): 1230-1240. Chen, X. W., S. Q. Liu, Y. Wang, J. K. Liu and L. Feng (2014). "Effects of different LED light qualities on growth, photosynthetic characteristics and nutritional quality of savoy." Ying Yong Sheng Tai Xue Bao 25(7): 1955-1962. Cheng, C. Y., V. Krishnakumar, A. P. Chan, F. Thibaud‐Nissen, S. Schobel and C. D. Town (2017). "Araport11: a complete reannotation of the Arabidopsis thaliana reference genome." The Plant Journal 89(4): 789-804. Cheng, Y. S., Y. Zheng and J. S. VanderGheynst (2011). "Rapid quantitative analysis of lipids using a colorimetric method in a microplate format." Lipids 46(1): 95-103. Cheval, C., D. Aldon, J.-P. Galaud and B. Ranty (2013). "Calcium/calmodulin-mediated regulation of plant immunity." Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1833(7): 1766-1771. Choi, H. G., B. Y. Moon and N. J. Kang (2015). "Effects of LED light on the production of strawberry during cultivation in a plastic greenhouse and in a growth chamber." Scientia Horticulturae 189: 22-31. Choudhury, F. K., A. R. Devireddy, R. K. Azad, V. Shulaev and R. Mittler (2018). "Rapid accumulation of glutathione during light stress in Arabidopsis." Plant Cell Physiol. Choudhury, F. K., R. M. Rivero, E. Blumwald and R. Mittler (2017). "Reactive oxygen species, abiotic stress and stress combination." The Plant Journal 90(5): 856-867. Christie, J. M., L. Blackwood, J. Petersen and S. Sullivan (2014). "Plant flavoprotein photoreceptors." Plant and Cell Physiology 56(3): 401-413. Consentino, L., S. Lambert, C. Martino, N. Jourdan, P. E. Bouchet, J. Witczak, P. Castello, M. El- Esawi, F. Corbineau, A. d'Harlingue and M. Ahmad (2015). "Blue-light dependent reactive oxygen species formation by Arabidopsis cryptochrome may define a novel evolutionarily conserved signaling mechanism." New Phytol 206(4): 1450-1462. Consortium, I. A. I., C. Doherty, J. Friesner, B. Gregory, A. Loraine, M. Megraw, N. Provart, R. K. Slotkin, C. Town and S. M. Assmann (2019). "Arabidopsis bioinformatics resources: The current state, challenges, and priorities for the future." Plant Direct 3(1): e00109. Cortés, L. E., B. T. Weldegergis, H. E. Boccalandro, M. Dicke and C. L. Ballaré (2016). "Trading direct for indirect defense? Phytochrome B inactivation in tomato attenuates direct anti‐herbivore

151 defenses whilst enhancing volatile‐mediated attraction of predators." New Phytologist 212(4): 1057-1071. Coruzzi, G. M., A. R. Burga, M. S. Katari and R. A. Gutiérrez (2018). "Systems biology: principles and applications in plant research." Annual Plant Reviews online: 3-40. Cosgrove, D. J. (2005). "Growth of the plant cell wall." Nat Rev Mol Cell Biol 6(11): 850-861. Croce, R. and H. Van Amerongen (2014). "Natural strategies for photosynthetic light harvesting." Nature chemical biology 10(7): 492. Cui, H., E. Gobbato, B. Kracher, J. Qiu, J. Bautor and J. E. Parker (2017). "A core function of EDS1 with PAD4 is to protect the salicylic acid defense sector in Arabidopsis immunity." New Phytol 213(4): 1802-1817. Curien, G., C. Giustini, J.-L. Montillet, S. Mas-y-Mas, D. Cobessi, J.-L. Ferrer, M. Matringe, A. Grechkin and N. Rolland (2016). "The chloroplast membrane associated ceQORH putative quinone oxidoreductase reduces long-chain, stress-related oxidized lipids." Phytochemistry 122: 45-55. D'Souza, C., H. G. Yuk, G. H. Khoo and W. Zhou (2015). "Application of Light‐Emitting Diodes in Food Production, Postharvest Preservation, and Microbiological Food Safety." Comprehensive Reviews in Food Science and Food Safety 14(6): 719-740. DalCorso, G., P. Pesaresi, S. Masiero, E. Aseeva, D. Schünemann, G. Finazzi, P. Joliot, R. Barbato and D. Leister (2008). "A complex containing PGRL1 and PGR5 is involved in the switch between linear and cyclic electron flow in Arabidopsis." Cell 132(2): 273-285. Danon, A., N. S. Coll and K. Apel (2006). "Cryptochrome-1-dependent execution of programmed cell death induced by singlet oxygen in Arabidopsis thaliana." Proc Natl Acad Sci U S A 103(45): 17036-17041. Das, P., K. K. Nutan, S. L. Singla-Pareek and A. Pareek (2015). "Oxidative environment and redox homeostasis in plants: dissecting out significant contribution of major cellular organelles." Frontiers in Environmental Science 2: 70. de Bianchi, S., M. Ballottari, L. Dall’Osto and R. Bassi (2010). Regulation of plant light harvesting by thermal dissipation of excess energy, Portland Press Limited. de Lucas, M. and S. Prat (2014). "PIF s get BR right: PHYTOCHROME INTERACTING FACTOR s as integrators of light and hormonal signals." New Phytologist 202(4): 1126-1141. de Wit, M., V. C. Galvao and C. Fankhauser (2016). "Light-mediated hormonal regulation of plant growth and development." Annual review of plant biology 67: 513-537. de Wit, M., W. Kegge, J. B. Evers, M. H. Vergeer-van Eijk, P. Gankema, L. A. Voesenek and R. Pierik (2012). "Plant neighbor detection through touching leaf tips precedes phytochrome signals." Proc Natl Acad Sci U S A 109(36): 14705-14710. de Wit, M., S. Lorrain and C. Fankhauser (2014). "Auxin-mediated plant architectural changes in response to shade and high temperature." Physiol Plant 151(1): 13-24. de Wit, M. and R. Pierik (2016). Photomorphogenesis and photoreceptors. Canopy photosynthesis: from basics to applications, Springer: 171-186. de Wit, M., S. H. Spoel, G. F. Sanchez‐Perez, C. M. Gommers, C. M. Pieterse, L. A. Voesenek and R. Pierik (2013). "Perception of low red: far‐red ratio compromises both salicylic acid‐and jasmonic acid‐dependent pathogen defences in A rabidopsis." The Plant Journal 75(1): 90-103. Demarsy, E., M. Goldschmidt-Clermont and R. Ulm (2018). "Coping with ‘dark sides of the sun’through photoreceptor signaling." Trends in plant science 23(3): 260-271. Demidchik, V., S. Shabala, S. Isayenkov, T. A. Cuin and I. Pottosin (2018). "Calcium transport across plant membranes: mechanisms and functions." New Phytologist 220(1): 49-69.

152 Demmig-Adams, B. and W. W. Adams III (2000). "Photosynthesis: Harvesting sunlight safely." Nature 403(6768): 371. Demotes-Mainard, S., T. Péron, A. Corot, J. Bertheloot, J. Le Gourrierec, S. Pelleschi-Travier, L. Crespel, P. Morel, L. Huché-Thélier and R. Boumaza (2016). "Plant responses to red and far-red lights, applications in horticulture." Environmental and Experimental Botany 121: 4-21. Dietz, K.-J., S. Jacob, M.-L. Oelze, M. Laxa, V. Tognetti, S. M. N. de Miranda, M. Baier and I. Finkemeier (2006). "The function of peroxiredoxins in plant organelle redox metabolism." Journal of experimental botany 57(8): 1697-1709. Dogra, V., J. Duan, K. P. Lee, S. Lv, R. Liu and C. Kim (2017). "FtsH2-Dependent Proteolysis of EXECUTER1 Is Essential in Mediating Singlet Oxygen-Triggered Retrograde Signaling in Arabidopsis thaliana." Front Plant Sci 8: 1145. Dogra, V., J. D. Rochaix and C. Kim (2018). "Singlet oxygen‐triggered chloroplast‐to‐nucleus retrograde signalling pathways: An emerging perspective." Plant, cell & environment 41(8): 1727- 1738. Dong, C., Y. Fu, G. Liu and H. Liu (2014). "Growth, photosynthetic characteristics, antioxidant capacity and biomass yield and quality of wheat (Triticum aestivum L.) exposed to LED light sources with different spectra combinations." Journal of agronomy and crop science 200(3): 219- 230. Dueck, T., W. van Ieperen and K. Taulavuori (2016). "Light perception, signalling and plant responses to spectral quality and photoperiod in natural and horticultural environments." Environmental and Experimental Botany(121): 1-3. Dumont, S. and J. Rivoal (2019). "Consequences of oxidative stress on plant glycolytic and respiratory metabolism." Frontiers in plant science 10. Dünser, K. and J. Kleine-Vehn (2015). "Differential growth regulation in plants—the acid growth balloon theory." Current opinion in plant biology 28: 55-59. Ebrahim, S., K. Usha and B. Singh (2011). "Pathogenesis related (PR) proteins in plant defense mechanism." Sci Against Microb Pathog 2: 1043-1054. El-Esawi, M., L. D. Arthaut, N. Jourdan, A. d'Harlingue, J. Link, C. F. Martino and M. Ahmad (2017). "Blue-light induced biosynthesis of ROS contributes to the signaling mechanism of Arabidopsis cryptochrome." Sci Rep 7(1): 13875. Eng, J. K., T. A. Jahan and M. R. Hoopmann (2013). "Comet: an open‐source MS/MS sequence database search tool." Proteomics 13(1): 22-24. Falcone Ferreyra, M. L., S. Rius and P. Casati (2012). "Flavonoids: biosynthesis, biological functions, and biotechnological applications." Frontiers in plant science 3: 222. Feng, S., C. Martinez, G. Gusmaroli, Y. Wang, J. Zhou, F. Wang, L. Chen, L. Yu, J. M. Iglesias- Pedraz and S. Kircher (2008). "Coordinated regulation of Arabidopsisthaliana development by light and gibberellins." Nature 451(7177): 475. Fila, G. and I. Sartorato (2011). "Using leaf mass per area as predictor of light interception and absorption in crop/weed monoculture or mixed stands." Agricultural and forest meteorology 151(5): 575-584. Fitter, A. H. and R. K. Hay (2012). Environmental physiology of plants, Academic press. Flexas, J., F. Loreto and H. Medrano (2012). Terrestrial photosynthesis in a changing environment: a molecular, physiological, and ecological approach, Cambridge University Press. Flood, P. J. (2019). "Using natural variation to understand the evolutionary pressures on plant photosynthesis." Current opinion in plant biology 49: 68-73.

153 Folta, K. M. and S. D. Carvalho (2015). "Photoreceptors and control of horticultural plant traits." HortScience 50(9): 1274-1280. Folta, K. M. and S. A. Maruhnich (2007). "Green light: a signal to slow down or stop." J Exp Bot 58(12): 3099-3111. Fox, A. R., M. L. Barberini, E. L. Ploschuk, J. P. Muschietti and M. A. Mazzella (2015). "A proteome map of a quadruple photoreceptor mutant sustains its severe photosynthetic deficient phenotype." Journal of plant physiology 185: 13-23. Franklin, K. A. and P. H. Quail (2009). "Phytochrome functions in Arabidopsis development." Journal of experimental botany 61(1): 11-24. Fraser, D. P., S. Hayes and K. A. Franklin (2016). "Photoreceptor crosstalk in shade avoidance." Curr Opin Plant Biol 33: 1-7. Fristedt, R., A. Herdean, C. E. Blaby-Haas, F. Mamedov, S. S. Merchant, R. L. Last and B. Lundin (2015). "PHOTOSYSTEM II PROTEIN33, a protein conserved in the plastid lineage, is associated with the chloroplast thylakoid membrane and provides stability to photosystem II supercomplexes in Arabidopsis." Plant physiology 167(2): 481-492. Fristedt, R., A. Trotta, M. Suorsa, A. K. Nilsson, R. Croce, E.-M. Aro and B. Lundin (2017). "PSB33 sustains photosystem II D1 protein under fluctuating light conditions." Journal of experimental botany 68(15): 4281-4293. Fu, Z. Q. and X. Dong (2013). "Systemic acquired resistance: turning local infection into global defense." Annu Rev Plant Biol 64: 839-863. Fu, Z. Q. and X. Dong (2013). "Systemic acquired resistance: turning local infection into global defense." Annual review of plant biology 64: 839-863. Gallé, Á., Z. Czékus, K. Bela, E. Horváth, A. Ördög, J. Csiszár and P. Poór (2018). "Plant glutathione transferases and light." Frontiers in plant science 9: 1944. Galvão, V. C., S. Collani, D. Horrer and M. Schmid (2015). "Gibberellic acid signaling is required for ambient temperature‐mediated induction of flowering in Arabidopsis thaliana." The Plant Journal 84(5): 949-962. Ganesan, M., H. Y. Lee, J. I. Kim and P. S. Song (2017). "Development of transgenic crops based on photo‐biotechnology." Plant, cell & environment 40(11): 2469-2486. García-Plazaola, J. I., R. Esteban, B. Fernández-Marín, I. Kranner and A. Porcar-Castell (2012). "Thermal energy dissipation and xanthophyll cycles beyond the Arabidopsis model." Photosynthesis Research 113(1-3): 89-103. González-Pérez, S., J. Gutiérrez, F. García-García, D. Osuna, J. Dopazo, Ó. Lorenzo, J. L. Revuelta and J. B. Arellano (2011). "Early transcriptional defense responses in Arabidopsis cell suspension culture under high-light conditions." Plant Physiology 156(3): 1439-1456. Gosak, M., R. Markovič, J. Dolenšek, M. S. Rupnik, M. Marhl, A. Stožer and M. Perc (2018). "Network science of biological systems at different scales: a review." Physics of life reviews 24: 118-135. Griebel, T. and J. Zeier (2008). "Light regulation and daytime dependency of inducible plant defenses in Arabidopsis: phytochrome signaling controls systemic acquired resistance rather than local defense." Plant Physiol 147(2): 790-801. Guidi, L., M. Tattini and M. Landi (2017). "How does chloroplast protect chlorophyll against excessive light." Chlorophyll: 21. Guo, Y. and S. S. GAN (2012). "Convergence and divergence in gene expression profiles induced by leaf senescence and 27 senescence‐promoting hormonal, pathological and environmental stress treatments." Plant, Cell & Environment 35(3): 644-655.

154 Gupta, R., Y. Wang, G. K. Agrawal, R. Rakwal, I. H. Jo, K. H. Bang and S. T. Kim (2015). "Time to dig deep into the plant proteome: a hunt for low-abundance proteins." Frontiers in Plant Science 6: 22. Gupta, S. D. and A. Agarwal (2017). Artificial lighting system for plant growth and development: chronological advancement, working principles, and comparative assessment. Light Emitting Diodes for Agriculture, Springer: 1-25. Gupta, S. D. and S. Pradhan (2017). Regulation of gene expression by LED lighting. Light Emitting Diodes for Agriculture, Springer: 237-258. Gururani, M. A., J. Venkatesh and L. S. Tran (2015). "Regulation of Photosynthesis during Abiotic Stress-Induced Photoinhibition." Mol Plant 8(9): 1304-1320. Haferkamp, I. (2007). "The diverse members of the mitochondrial carrier family in plants." FEBS letters 581(12): 2375-2379. Hanan, J. J. (2017). Greenhouses: Advanced technology for protected horticulture, CRC press. Hanley, N., J. F. Shogren and B. White (2016). Environmental economics: in theory and practice, Macmillan International Higher Education. Hannah, M. A., C. Caldana, D. Steinhauser, I. Balbo, A. R. Fernie and L. Willmitzer (2010). "Combined transcript and metabolite profiling of Arabidopsis grown under widely variant growth conditions facilitates the identification of novel metabolite-mediated regulation of gene expression." Plant physiology 152(4): 2120-2129. Hao, X., C. Little and S. Khosla (2012). LED inter-lighting in year-round greenhouse mini- cucumber production. VII International Symposium on Light in Horticultural Systems 956. Hasan, M., T. Bashir, R. Ghosh, S. K. Lee and H. Bae (2017). "An overview of LEDs’ effects on the production of bioactive compounds and crop quality." Molecules 22(9): 1420. Hdider, C. and Y. Desjardins (1994). "Effects of sucrose on photosynthesis and phosphoenolpyruvate carboxylase activity of in vitro cultured strawberry plantlets." Plant Cell, Tissue and Organ Culture 36(1): 27-33. He, S.-B., W.-X. Wang, J.-Y. Zhang, F. Xu, H.-L. Lian, L. Li and H.-Q. Yang (2015). "The CNT1 domain of Arabidopsis CRY1 alone is sufficient to mediate blue light inhibition of hypocotyl elongation." Molecular plant 8(5): 822-825. Hedden, P. (2018). "Gibberellin biosynthesis in higher plants." Annual Plant Reviews online: 37- 71. Heijde, M. and R. Ulm (2012). "UV-B photoreceptor-mediated signalling in plants." Trends in plant science 17(4): 230-237. Hernández, R. and C. Kubota (2012). Tomato seedling growth and morphological responses to supplemental LED lighting red: blue ratios under varied daily solar light integrals. VII International Symposium on Light in Horticultural Systems 956. Hernández, R. and C. Kubota (2016). "Physiological responses of cucumber seedlings under different blue and red photon flux ratios using LEDs." Environmental and experimental botany 121: 66-74. Herrera-Vasquez, A., P. Salinas and L. Holuigue (2015). "Salicylic acid and reactive oxygen species interplay in the transcriptional control of defense genes expression." Front Plant Sci 6: 171. Hertle, A. P., T. Blunder, T. Wunder, P. Pesaresi, M. Pribil, U. Armbruster and D. Leister (2013). "PGRL1 is the elusive ferredoxin-plastoquinone reductase in photosynthetic cyclic electron flow." Molecular cell 49(3): 511-523. Hieno, A., H. A. Naznin, K. Inaba-Hasegawa, T. Yokogawa, N. Hayami, M. Nomoto, Y. Tada, T. Yokogawa, M. Higuchi-Takeuchi and K. Hanada (2019). "Transcriptome analysis and

155 identification of a transcriptional regulatory network in the response to H2O2." Plant physiology 180(3): 1629-1646. Higuchi, Y. and T. Hisamatsu (2016). Light acts as a signal for regulation of growth and development. LED lighting for urban agriculture, Springer: 57-73. Hirayama, T. and K. Shinozaki (2010). "Research on plant abiotic stress responses in the post‐ genome era: Past, present and future." The Plant Journal 61(6): 1041-1052. Hoagland, D. R. and D. I. Arnon (1950). The water-culture method for growing plants without soil. Berkely,, The College of Agriculture. Hoefgen, R. and V. J. Nikiforova (2008). "Metabolomics integrated with transcriptomics: assessing systems response to sulfur-deficiency stress." Physiol Plant 132(2): 190-198. Hogewoning, S. W., P. Douwstra, G. Trouwborst, W. van Ieperen and J. Harbinson (2010). "An artificial solar spectrum substantially alters plant development compared with usual climate room irradiance spectra." J Exp Bot 61(5): 1267-1276. Hogewoning, S. W., G. Trouwborst, H. Maljaars, H. Poorter, W. van Ieperen and J. Harbinson (2010). "Blue light dose-responses of leaf photosynthesis, morphology, and chemical composition of Cucumis sativus grown under different combinations of red and blue light." J Exp Bot 61(11): 3107-3117. Hogewoning, S. W., E. Wientjes, P. Douwstra, G. Trouwborst, W. van Ieperen, R. Croce and J. Harbinson (2012). "Photosynthetic quantum yield dynamics: from photosystems to leaves." Plant Cell 24(5): 1921-1935. Holm, G. (1954). "Chlorophyll mutations in barley." Acta Agriculturae Scandinavica 4(1): 457- 471. Hoover, W. H. (1937). The dependence of carbon dioxide assimilation in a higher plant on wave length of radiation. City of Washington,, The Smithsonian institution. Hornitschek, P., M. V. Kohnen, S. Lorrain, J. Rougemont, K. Ljung, I. Lopez-Vidriero, J. M. Franco-Zorrilla, R. Solano, M. Trevisan, S. Pradervand, I. Xenarios and C. Fankhauser (2012). "Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling." Plant J 71(5): 699-711. Hornitschek, P., M. V. Kohnen, S. Lorrain, J. Rougemont, K. Ljung, I. López‐Vidriero, J. M. Franco‐Zorrilla, R. Solano, M. Trevisan and S. Pradervand (2012). "Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling." The Plant Journal 71(5): 699-711. Hornitschek, P., S. Lorrain, V. Zoete, O. Michielin and C. Fankhauser (2009). "Inhibition of the shade avoidance response by formation of non-DNA binding bHLH heterodimers." EMBO J 28(24): 3893-3902. Horton, P., M. Wentworth and A. Ruban (2005). "Control of the light harvesting function of chloroplast membranes: The LHCII‐aggregation model for non‐photochemical quenching." Febs Letters 579(20): 4201-4206. Horwich, A. L., W. A. Fenton, E. Chapman and G. W. Farr (2007). "Two families of chaperonin: physiology and mechanism." Annu. Rev. Cell Dev. Biol. 23: 115-145. Huang, E. L., V. Orsat, M. B. Shah, R. L. Hettich, N. C. VerBerkmoes and M. G. Lefsrud (2012). "The temporal analysis of yeast exponential phase using shotgun proteomics as a fermentation monitoring technique." Journal of proteomics 75(17): 5206-5214. Huché-Thélier, L., L. Crespel, J. Le Gourrierec, P. Morel, S. Sakr and N. Leduc (2016). "Light signaling and plant responses to blue and UV radiations—Perspectives for applications in horticulture." Environmental and Experimental Botany 121: 22-38.

156 Hughes, N. M., K. L. Carpenter, T. S. Keidel, C. N. Miller, M. N. Waters and W. K. Smith (2014). "Photosynthetic costs and benefits of abaxial versus adaxial anthocyanins in Colocasia esculenta ‘Mojito’." Planta 240(5): 971-981. Hussain, A., B.-G. Mun, Q. M. Imran, S.-U. Lee, T. A. Adamu, M. Shahid, K.-M. Kim and B.-W. Yun (2016). "Nitric oxide mediated transcriptome profiling reveals activation of multiple regulatory pathways in Arabidopsis thaliana." Frontiers in plant science 7: 975. Inada, K. (1976). "Action spectra for photosynthesis in higher plants." Plant and Cell Physiology 17(2): 355-365. Initiative, A. G. (2000). "Analysis of the genome sequence of the flowering plant Arabidopsis thaliana." nature 408(6814): 796. Iwai, M., K. Takizawa, R. Tokutsu, A. Okamuro, Y. Takahashi and J. Minagawa (2010). "Isolation of the elusive supercomplex that drives cyclic electron flow in photosynthesis." Nature 464(7292): 1210. Jahns, P. and A. R. Holzwarth (2012). "The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1817(1): 182-193. Järvi, S., P. J. Gollan and E.-M. Aro (2013). "Understanding the roles of the thylakoid lumen in photosynthesis regulation." Frontiers in plant science 4: 434. Järvi, S., M. Suorsa and E.-M. Aro (2015). "Photosystem II repair in plant chloroplasts— regulation, assisting proteins and shared components with photosystem II biogenesis." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1847(9): 900-909. Jarvi, S., M. Suorsa, L. Tadini, A. Ivanauskaite, S. Rantala, Y. Allahverdiyeva, D. Leister and E. M. Aro (2016). "Thylakoid-Bound FtsH Proteins Facilitate Proper Biosynthesis of Photosystem I." Plant Physiol 171(2): 1333-1343. Jarvis, P. (2008). "Targeting of nucleus-encoded proteins to chloroplasts in plants." New Phytol 179(2): 257-285. Jenkins, G. I. (2014). "The UV-B photoreceptor UVR8: from structure to physiology." The Plant Cell 26(1): 21-37. Jensen, L. J., M. Kuhn, M. Stark, S. Chaffron, C. Creevey, J. Muller, T. Doerks, P. Julien, A. Roth, M. Simonovic, P. Bork and C. von Mering (2009). "STRING 8--a global view on proteins and their functional interactions in 630 organisms." Nucleic Acids Res 37(Database issue): D412-416. Jiang, J., S. Ma, N. Ye, M. Jiang, J. Cao and J. Zhang (2017). "WRKY transcription factors in plant responses to stresses." Journal of integrative plant biology 59(2): 86-101. Jiao, Y., O. S. Lau and X. W. Deng (2007). "Light-regulated transcriptional networks in higher plants." Nat Rev Genet 8(3): 217-230. Jiao, Y., L. Ma, E. Strickland and X. W. Deng (2005). "Conservation and divergence of light- regulated genome expression patterns during seedling development in rice and Arabidopsis." Plant Cell 17(12): 3239-3256. Jin, H., M. Xu, H. Chen, S. Zhang, X. Han, Z. Tang and R. Sun (2016). "Comparative proteomic analysis of differentially expressed proteins in Amaranthus hybridus L. roots under cadmium stress." Water, Air, & Soil Pollution 227(7): 220. Johkan, M., K. Shoji, F. Goto, S.-n. Hahida and T. Yoshihara (2012). "Effect of green light wavelength and intensity on photomorphogenesis and photosynthesis in Lactuca sativa." Environmental and Experimental Botany 75: 128-133.

157 Johkan, M., K. Shoji, F. Goto, S.-n. Hashida and T. Yoshihara (2010). "Blue light-emitting diode light irradiation of seedlings improves seedling quality and growth after transplanting in red leaf lettuce." HortScience 45(12): 1809-1814. Johnson, G. N. (2011). "Physiology of PSI cyclic electron transport in higher plants." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1807(3): 384-389. Kami, C., S. Lorrain, P. Hornitschek and C. Fankhauser (2010). Light-regulated plant growth and development. Current topics in developmental biology, Elsevier. 91: 29-66. Kanehisa, M., Y. Sato, M. Kawashima, M. Furumichi and M. Tanabe (2016). "KEGG as a reference resource for gene and protein annotation." Nucleic Acids Res 44(D1): D457-462. Kang, C.-Y., H.-L. Lian, F.-F. Wang, J.-R. Huang and H.-Q. Yang (2009). "Cryptochromes, phytochromes, and COP1 regulate light-controlled stomatal development in Arabidopsis." The Plant Cell 21(9): 2624-2641. Kang, Z.-H. and G.-X. Wang (2016). "Redox regulation in the thylakoid lumen." Journal of plant physiology 192: 28-37. Kargul, J. and J. Barber (2008). "Photosynthetic acclimation: Structural reorganisation of light harvesting antenna–role of redox‐dependent phosphorylation of major and minor chlorophyll a/b binding proteins." The FEBS journal 275(6): 1056-1068. Keller, M. M., Y. Jaillais, U. V. Pedmale, J. E. Moreno, J. Chory and C. L. Ballaré (2011). "Cryptochrome 1 and phytochrome B control shade‐avoidance responses in Arabidopsis via partially independent hormonal cascades." The Plant Journal 67(2): 195-207. Keuskamp, D. H., S. Pollmann, L. A. Voesenek, A. J. Peeters and R. Pierik (2010). "Auxin transport through PIN-FORMED 3 (PIN3) controls shade avoidance and fitness during competition." Proc Natl Acad Sci U S A 107(52): 22740-22744. Keuskamp, D. H., R. Sasidharan, I. Vos, A. J. Peeters, L. A. Voesenek and R. Pierik (2011). "Blue- light-mediated shade avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings." Plant J 67(2): 208-217. Khan, M. I. R., M. Fatma, T. S. Per, N. A. Anjum and N. A. Khan (2015). "Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants." Frontiers in Plant Science 6: 462. Kharshiing, E. and S. P. Sinha (2015). "Plant productivity: can photoreceptors light the way?" Journal of Plant Growth Regulation 34(1): 206-214. Kieffer, P., S. Planchon, M. Oufir, J. Ziebel, J. Dommes, L. Hoffmann, J.-F. Hausman and J. Renaut (2008). "Combining proteomics and metabolite analyses to unravel cadmium stress- response in poplar leaves." Journal of proteome research 8(1): 400-417. Kim, K., J. Shin, S.-H. Lee, H.-S. Kweon, J. N. Maloof and G. Choi (2011). "Phytochromes inhibit hypocotyl negative gravitropism by regulating the development of endodermal amyloplasts through phytochrome-interacting factors." Proceedings of the National Academy of Sciences 108(4): 1729-1734. Kiran, G. S., P. Ramasamy, S. Sekar, M. Ramu, S. Hassan, A. Ninawe and J. Selvin (2018). "Synthetic biology approaches: Towards sustainable exploitation of marine bioactive molecules." International journal of biological macromolecules 112: 1278-1288. Klessig, D. F., H. W. Choi and D. A. Dempsey (2018). "Systemic Acquired Resistance and Salicylic Acid: Past, Present, and Future." Mol Plant Microbe Interact 31(9): 871-888. Knoch, E., A. Dilokpimol and N. Geshi (2014). "Arabinogalactan proteins: focus on carbohydrate active enzymes." Frontiers in plant science 5: 198.

158 Köhl, K., T. Tohge and M. A. Schöttler (2017). "Performance of Arabidopsis thaliana under different light qualities: comparison of light-emitting diodes to fluorescent lamp." Functional Plant Biology 44(7): 727-738. Kohnen, M. V., E. Schmid-Siegert, M. Trevisan, L. A. Petrolati, F. Senechal, P. Muller-Moule, J. Maloof, I. Xenarios and C. Fankhauser (2016). "Neighbor Detection Induces Organ-Specific Transcriptomes, Revealing Patterns Underlying Hypocotyl-Specific Growth." Plant Cell 28(12): 2889-2904. Kong, Y., M. Stasiak, M. A. Dixon and Y. Zheng (2018). "Blue light associated with low phytochrome activity can promote elongation growth as shade-avoidance response: A comparison with red light in four bedding plant species." Environmental and experimental botany 155: 345- 359. Kopsell, D. A. and C. E. Sams (2013). "Increases in shoot tissue pigments, glucosinolates, and mineral elements in sprouting broccoli after exposure to short-duration blue light from light emitting diodes." Journal of the American Society for Horticultural Science 138(1): 31-37. Kopsell, D. A., C. E. Sams, T. C. Barickman and R. C. Morrow (2014). "Sprouting broccoli accumulate higher concentrations of nutritionally important metabolites under narrow-band light- emitting diode lighting." Journal of the American Society for Horticultural Science 139(4): 469- 477. Kovinich, N., G. Kayanja, A. Chanoca, K. Riedl, M. S. Otegui and E. Grotewold (2014). "Not all anthocyanins are born equal: distinct patterns induced by stress in Arabidopsis." Planta 240(5): 931-940. Kozuka, T., J. Kobayashi, G. Horiguchi, T. Demura, H. Sakakibara, H. Tsukaya and A. Nagatani (2010). "Involvement of auxin and brassinosteroid in the regulation of petiole elongation under the shade." Plant Physiol 153(4): 1608-1618. Krasensky-Wrzaczek, J. and J. Kangasjärvi (2018). "The role of reactive oxygen species in the integration of temperature and light signals." Journal of experimental botany 69(14): 3347-3358. Krupinska, K., J. Melonek and K. Krause (2013). "New insights into plastid nucleoid structure and functionality." Planta 237(3): 653-664. Kumar, M., S. Sundaram, E. Gnansounou, C. Larroche and I. S. Thakur (2018). "Carbon dioxide capture, storage and production of biofuel and biomaterials by bacteria: A review." Bioresource technology 247: 1059-1068. Lane, N. and W. F. Martin (2012). "The origin of membrane bioenergetics." Cell 151(7): 1406- 1416. Laohavisit, A., S. L. Richards, L. Shabala, C. Chen, R. D. Colaço, S. M. Swarbreck, E. Shaw, A. Dark, S. Shabala and Z. Shang (2013). "Salinity-induced calcium signaling and root adaptation in Arabidopsis require the calcium regulatory protein annexin1." Plant Physiology 163(1): 253-262. Larner, V. S., K. A. Franklin and G. C. Whitelam (2018). "Photoreceptors and light signalling pathways in plants." Annual Plant Reviews online: 107-131. Lastdrager, J., J. Hanson and S. Smeekens (2014). "Sugar signals and the control of plant growth and development." Journal of experimental botany 65(3): 799-807. Lau, O. S. and X. W. Deng (2010). "Plant hormone signaling lightens up: integrators of light and hormones." Current opinion in plant biology 13(5): 571-577. Law, S. R., D. Chrobok, M. Juvany, N. Delhomme, P. Lindén, B. Brouwer, A. Ahad, T. Moritz, S. Jansson and P. Gardestrom (2018). "Darkened leaves use different metabolic strategies for senescence and survival." Plant physiology: pp. 00062.02018.

159 Lee, J., K. He, V. Stolc, H. Lee, P. Figueroa, Y. Gao, W. Tongprasit, H. Zhao, I. Lee and X. W. Deng (2007). "Analysis of transcription factor HY5 genomic binding sites revealed its hierarchical role in light regulation of development." The Plant Cell 19(3): 731-749. Lehfeldt, C., A. M. Shirley, K. Meyer, M. O. Ruegger, J. C. Cusumano, P. V. Viitanen, D. Strack and C. Chapple (2000). "Cloning of the SNG1 gene of Arabidopsis reveals a role for a serine carboxypeptidase-like protein as an acyltransferase in secondary metabolism." The Plant Cell 12(8): 1295-1306. Leister, D., C. Varotto, P. Pesaresi, A. Niwergall and F. Salamini (1999). "Large-scale evaluation of plant growth in Arabidopsis thaliana by non-invasive image analysis." Plant Physiology and Biochemistry 37(9): 671-678. Leivar, P. and E. Monte (2014). "PIFs: systems integrators in plant development." The Plant Cell 26(1): 56-78. Leivar, P. and P. H. Quail (2011). "PIFs: pivotal components in a cellular signaling hub." Trends in plant science 16(1): 19-28. Leivar, P., J. M. Tepperman, M. M. Cohn, E. Monte, B. Al-Sady, E. Erickson and P. H. Quail (2012). "Dynamic antagonism between phytochromes and PIF family basic helix-loop-helix factors induces selective reciprocal responses to light and shade in a rapidly responsive transcriptional network in Arabidopsis." Plant Cell 24(4): 1398-1419. Leone, M., M. M. Keller, I. Cerrudo and C. L. Ballaré (2014). "To grow or defend? Low red: far‐ red ratios reduce jasmonate sensitivity in Arabidopsis seedlings by promoting DELLA degradation and increasing JAZ 10 stability." New Phytologist 204(2): 355-367. Li, C.-X., Z.-G. Xu, R.-Q. Dong, S.-X. Chang, L.-Z. Wang, M. Khalil-Ur-Rehman and J.-M. Tao (2017). "An RNA-seq analysis of grape plantlets grown in vitro reveals different responses to blue, green, red LED light, and white fluorescent light." Frontiers in plant science 8: 78. Li, C. X., Z. G. Xu, R. Q. Dong, S. X. Chang, L. Z. Wang, M. Khalil-Ur-Rehman and J. M. Tao (2017). "An RNA-Seq Analysis of Grape Plantlets Grown in vitro Reveals Different Responses to Blue, Green, Red LED Light, and White Fluorescent Light." Front Plant Sci 8: 78. Li, H., C. Tang, Z. Xu, X. Liu and X. Han (2012). "Effects of different light sources on the growth of non-heading Chinese cabbage (Brassica campestris L.)." Journal of Agricultural Science 4(4): 262. Li, H., Z. Xu and C. Tang (2010). "Effect of light-emitting diodes on growth and morphogenesis of upland cotton (Gossypium hirsutum L.) plantlets in vitro." Plant Cell, Tissue and Organ Culture (PCTOC) 103(2): 155-163. Li, J., G. Li, H. Wang and X. W. Deng (2011). "Phytochrome signaling mechanisms." The Arabidopsis book/American Society of Plant Biologists 9. Li, L., E.-M. Aro and A. H. Millar (2018). "Mechanisms of photodamage and protein turnover in photoinhibition." Trends in plant science 23(8): 667-676. Li, L., K. Ljung, G. Breton, R. J. Schmitz, J. Pruneda-Paz, C. Cowing-Zitron, B. J. Cole, L. J. Ivans, U. V. Pedmale, H. S. Jung, J. R. Ecker, S. A. Kay and J. Chory (2012). "Linking photoreceptor excitation to changes in plant architecture." Genes Dev 26(8): 785-790. Li, Q. and C. Kubota (2009). "Effects of supplemental light quality on growth and phytochemicals of baby leaf lettuce." Environmental and Experimental Botany 67(1): 59-64. Li, X., Y. Yang, Y. Li, J. Wang, X. Xiao, X. Guo, D. Tang and X. Liu (2009). "Protein identification and mRNA analysis of phytochrome-regulated genes in Arabidopsis under red light." Science in China Series C: Life Sciences 52(4): 371-380.

160 Li, Z., Y. Zhao, X. Liu, Z. Jiang, J. Peng, J. Jin, H. Guo and J. Luo (2017). "Construction of the Leaf Senescence Database and Functional Assessment of Senescence-Associated Genes." Methods Mol Biol 1533: 315-333. Liang, C., S. Cheng, Y. Zhang, Y. Sun, A. R. Fernie, K. Kang, G. Panagiotou, C. Lo and B. L. Lim (2016). "Transcriptomic, proteomic and metabolic changes in Arabidopsis thaliana leaves after the onset of illumination." BMC plant biology 16(1): 43. Lister, R., B. D. Gregory and J. R. Ecker (2009). "Next is now: new technologies for sequencing of genomes, transcriptomes, and beyond." Current opinion in plant biology 12(2): 107-118. Liu, H., Y. Fu and M. Wang (2017). "Green light enhances growth, photosynthetic pigments and CO 2 assimilation efficiency of lettuce as revealed by ‘knock out’of the 480–560 nm spectral waveband." Photosynthetica 55(1): 144-152. Liu, Y., J. S. Burgos, Y. Deng, R. Srivastava, S. H. Howell and D. C. Bassham (2012). "Degradation of the endoplasmic reticulum by autophagy during endoplasmic reticulum stress in Arabidopsis." The plant cell 24(11): 4635-4651. Lodish, H., A. Berk, S. L. Zipursky, P. Matsudaira, D. Baltimore and J. Darnell (2000). Photosynthetic stages and light-absorbing pigments. Molecular Cell Biology. 4th edition, WH Freeman. Lopez, L., F. Carbone, L. Bianco, G. Giuliano, P. Facella and G. Perrotta (2012). "Tomato plants overexpressing cryptochrome 2 reveal altered expression of energy and stress‐related gene products in response to diurnal cues." Plant, cell & environment 35(5): 994-1012. Lorenzo, C. D., J. Alonso Iserte, M. Sanchez Lamas, M. S. Antonietti, P. Garcia Gagliardi, C. E. Hernando, C. A. A. Dezar, M. Vazquez, J. J. Casal and M. J. Yanovsky (2019). "Shade delays flowering in Medicago sativa." The Plant Journal. Ma, D., X. Li, Y. Guo, J. Chu, S. Fang, C. Yan, J. P. Noel and H. Liu (2016). "Cryptochrome 1 interacts with PIF4 to regulate high temperature-mediated hypocotyl elongation in response to blue light." Proceedings of the National Academy of Sciences 113(1): 224-229. Ma, L., J. Li, L. Qu, J. Hager, Z. Chen, H. Zhao and X. W. Deng (2001). "Light control of Arabidopsis development entails coordinated regulation of genome expression and cellular pathways." Plant Cell 13(12): 2589-2607. Ma, X., Y. Wang, M. Liu, J. Xu and Z. Xu (2015). "Effects of green and red lights on the growth and morphogenesis of potato (Solanum tuberosum L.) plantlets in vitro." Scientia Horticulturae 190: 104-109. Ma, Y., P. Wang, M. Wang, M. Sun, Z. Gu and R. Yang (2019). "GABA mediates phenolic compounds accumulation and the antioxidant system enhancement in germinated hulless barley under NaCl stress." Food chemistry 270: 593-601. Maeda, H. and N. Dudareva (2012). "The shikimate pathway and aromatic amino Acid biosynthesis in plants." Annu Rev Plant Biol 63: 73-105. Mai, H.-J. and P. Bauer (2016). "From the proteomic point of view: Integration of adaptive changes to iron deficiency in plants." Current Plant Biology 5: 45-56. Majumdar, R., B. Barchi, S. A. Turlapati, M. Gagne, R. Minocha, S. Long and S. C. Minocha (2016). "Glutamate, ornithine, arginine, proline, and polyamine metabolic interactions: the pathway is regulated at the post-transcriptional level." Frontiers in plant science 7: 78. Malnoë, A. (2018). "Photoinhibition or photoprotection of photosynthesis? Update on the (newly termed) sustained quenching component qH." Environmental and experimental botany 154: 123- 133.

161 Manavski, N., L.-M. Schmid and J. Meurer (2018). "RNA-stabilization factors in chloroplasts of vascular plants." Essays in biochemistry 62(1): 51-64. Mancinelli, A. L., C. P. Yang, P. Lindquist, O. R. Anderson and I. Rabino (1975). "Photocontrol of Anthocyanin Synthesis: III. The Action of Streptomycin on the Synthesis of Chlorophyll and Anthocyanin." Plant Physiol 55(2): 251-257. Martínez-García, J. F., M. Gallemí, M. J. Molina-Contreras, B. Llorente, M. R. Bevilaqua and P. H. Quail (2014). "The shade avoidance syndrome in Arabidopsis: the antagonistic role of phytochrome A and B differentiates vegetation proximity and canopy shade." PloS one 9(10): e109275. Mathan, J., J. Bhattacharya and A. Ranjan (2016). "Enhancing crop yield by optimizing plant developmental features." Development 143(18): 3283-3294. Mawphlang, O. I. and E. V. Kharshiing (2017). "Photoreceptor mediated plant growth responses: Implications for photoreceptor engineering toward improved performance in crops." Frontiers in plant science 8: 1181. Mawphlang, O. I. L. and E. V. Kharshiing (2017). "Photoreceptor Mediated Plant Growth Responses: Implications for Photoreceptor Engineering toward Improved Performance in Crops." Front Plant Sci 8: 1181. McCord, J. M. and I. Fridovich (1969). "Superoxide dismutase an enzymic function for erythrocuprein (hemocuprein)." Journal of Biological chemistry 244(22): 6049-6055. McCree, K. J. (1971). "The action spectrum, absorptance and quantum yield of photosynthesis in crop plants." Agricultural Meteorology 9: 191-216. McCree, K. J. (1972). "Significance of enhancement for calculations based on the action spectrum for photosynthesis." Plant Physiol 49(5): 704-706. McDonald, M. S. (2003). Photobiology of higher plants, John Wiley & Sons. McDonald, W. H., R. Ohi, D. T. Miyamoto, T. J. Mitchison and J. R. Yates III (2002). "Comparison of three directly coupled HPLC MS/MS strategies for identification of proteins from complex mixtures: single-dimension LC-MS/MS, 2-phase MudPIT, and 3-phase MudPIT." International Journal of Mass Spectrometry 219(1): 245-251. McDonald, W. H., D. L. Tabb, R. G. Sadygov, M. J. MacCoss, J. Venable, J. Graumann, J. R. Johnson, D. Cociorva and J. R. Yates III (2004). "MS1, MS2, and SQT—three unified, compact, and easily parsed file formats for the storage of shotgun proteomic spectra and identifications." Rapid Communications in Mass Spectrometry 18(18): 2162-2168. Messinger, J. and D. Shevela (2011). "Principles of photosynthesis." Fundamentals of materials for Energy and Environmental Sustainability (Ginley DS, Cahen D, eds): 302-314. Miller, M. A. E., R. O'Cualain, J. Selley, D. Knight, M. F. Karim, S. J. Hubbard and G. N. Johnson (2017). "Dynamic Acclimation to High Light in Arabidopsis thaliana Involves Widespread Reengineering of the Leaf Proteome." Front Plant Sci 8: 1239. Minagawa, J. and Y. Takahashi (2004). "Structure, function and assembly of Photosystem II and its light-harvesting proteins." Photosynthesis research 82(3): 241-263. Mitchell, C. A., A.-J. Both, C. Bourget, J. Burr, C. Kubota, R. Lopez, R. Morrow and E. Runkle (2012). "LEDs: The future of greenhouse lighting!" Chronica Horticulturae 52(1): 6-12. Mittler, R. and E. Blumwald (2010). "Genetic engineering for modern agriculture: challenges and perspectives." Annu Rev Plant Biol 61: 443-462. Mittler, R. and E. Blumwald (2015). "The roles of ROS and ABA in systemic acquired acclimation." The Plant Cell 27(1): 64-70.

162 Miura, K. and Y. Tada (2014). "Regulation of water, salinity, and cold stress responses by salicylic acid." Frontiers in plant science 5: 4. Montojo, J., K. Zuberi, H. Rodriguez, F. Kazi, G. Wright, S. L. Donaldson, Q. Morris and G. D. Bader (2010). "GeneMANIA Cytoscape plugin: fast gene function predictions on the desktop." Bioinformatics 26(22): 2927-2928. Moreno, J. E. and C. L. Ballaré (2014). "Phytochrome regulation of plant immunity in vegetation canopies." Journal of chemical ecology 40(7): 848-857. Moreno, J. E., Y. Tao, J. Chory and C. L. Ballaré (2009). "Ecological modulation of plant defense via phytochrome control of jasmonate sensitivity." Proceedings of the National Academy of Sciences 106(12): 4935-4940. Morris, A. C. and M. A. Djordjevic (2001). "Proteome analysis of cultivar‐specific interactions between Rhizobium leguminosarum biovar trifolii and subterranean clover cultivar Woogenellup." Electrophoresis 22(3): 586-598. Mostafa, I., M. J. Yoo, N. Zhu, S. Geng, C. Dufresne, M. Abou-Hashem, M. El-Domiaty and S. Chen (2017). "Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29." Front Plant Sci 8: 534. Mulo, P. (2011). "Chloroplast-targeted ferredoxin-NADP+ oxidoreductase (FNR): structure, function and location." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1807(8): 927-934. Munekage, Y., M. Hashimoto, C. Miyake, K.-I. Tomizawa, T. Endo, M. Tasaka and T. Shikanai (2004). "Cyclic electron flow around photosystem I is essential for photosynthesis." Nature 429(6991): 579. Murchie, E. H. (2017). "Safety conscious or living dangerously: what is the 'right' level of plant photoprotection for fitness and productivity?" Plant Cell Environ 40(8): 1239-1242. Myouga, F., K. Takahashi, R. Tanaka, N. Nagata, A. Z. Kiss, C. Funk, Y. Nomura, H. Nakagami, S. Jansson and K. Shinozaki (2018). "Stable Accumulation of Photosystem II Requires ONE- HELIX PROTEIN1 (OHP1) of the Light Harvesting-Like Family." Plant Physiol 176(3): 2277- 2291. Nakabayashi, R., K. Yonekura‐Sakakibara, K. Urano, M. Suzuki, Y. Yamada, T. Nishizawa, F. Matsuda, M. Kojima, H. Sakakibara and K. Shinozaki (2014). "Enhancement of oxidative and drought tolerance in Arabidopsis by overaccumulation of antioxidant flavonoids." The Plant Journal 77(3): 367-379. Nakano, Y. and K. Asada (1981). "Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts." Plant and cell physiology 22(5): 867-880. Nakashima, K. and K. Yamaguchi-Shinozaki (2013). "ABA signaling in stress-response and seed development." Plant cell reports 32(7): 959-970. Nanya, K., Y. Ishigami, S. Hikosaka and E. Goto (2012). Effects of blue and red light on stem elongation and flowering of tomato seedlings. VII International Symposium on Light in Horticultural Systems 956. Nath, K., A. Jajoo, R. S. Poudyal, R. Timilsina, Y. S. Park, E.-M. Aro, H. G. Nam and C.-H. Lee (2013). "Towards a critical understanding of the photosystem II repair mechanism and its regulation during stress conditions." FEBS letters 587(21): 3372-3381. Navarro, M. P., F. M. Ribalta, B. Hurgobin, J. S. Croser and P. Kaur (2018). "Gene networks underlying faster flowering induction in response to far-red light." bioRxiv: 234161. Nelson, J. A. and B. Bugbee (2014). "Economic analysis of greenhouse lighting: light emitting diodes vs. high intensity discharge fixtures." PloS one 9(6): e99010.

163 Niinemets, Ü. (2010). "A review of light interception in plant stands from leaf to canopy in different plant functional types and in species with varying shade tolerance." Ecological Research 25(4): 693-714. Nishio, J. (2000). "Why are higher plants green? Evolution of the higher plant photosynthetic pigment complement." Plant, Cell & Environment 23(6): 539-548. Nishiyama, Y., S. I. Allakhverdiev and N. Murata (2011). "Protein synthesis is the primary target of reactive oxygen species in the photoinhibition of photosystem II." Physiologia Plantarum 142(1): 35-46. Nozue, K., A. V. Tat, U. Kumar Devisetty, M. Robinson, M. R. Mumbach, Y. Ichihashi, S. Lekkala and J. N. Maloof (2015). "Shade avoidance components and pathways in adult plants revealed by phenotypic profiling." PLoS Genet 11(4): e1004953. Nymark, M., K. C. Valle, T. Brembu, K. Hancke, P. Winge, K. Andresen, G. Johnsen and A. M. Bones (2009). "An integrated analysis of molecular acclimation to high light in the marine diatom Phaeodactylum tricornutum." PloS one 4(11): e7743. O'Connell, J. D., J. A. Paulo, J. J. O'Brien and S. P. Gygi (2018). "Proteome-Wide Evaluation of Two Common Protein Quantification Methods." J Proteome Res 17(5): 1934-1942. O’Carrigan, A., E. Hinde, N. Lu, X.-Q. Xu, H. Duan, G. Huang, M. Mak, B. Bellotti and Z.-H. Chen (2014). "Effects of light irradiance on stomatal regulation and growth of tomato." Environmental and Experimental Botany 98: 65-73. Oh, E., H. Kang, S. Yamaguchi, J. Park, D. Lee, Y. Kamiya and G. Choi (2009). "Genome-wide analysis of genes targeted by PHYTOCHROME INTERACTING FACTOR 3-LIKE5 during seed germination in Arabidopsis." The Plant Cell 21(2): 403-419. Oh, E., J.-Y. Zhu and Z.-Y. Wang (2012). "Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses." Nature cell biology 14(8): 802. Ohashi-Kaneko, K., M. Takase, N. Kon, K. Fujiwara and K. Kurata (2007). "Effect of light quality on growth and vegetable quality in leaf lettuce, spinach and komatsuna." Environmental Control in Biology 45(3): 189-198. Olle, M. and I. Alsiņa (2019). Influence of Wavelength of Light on Growth, Yield and Nutritional Quality of Greenhouse Vegetables. Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences., Sciendo. Olle, M. and A. Viršile (2013). "The effects of light-emitting diode lighting on greenhouse plant growth and quality." Agricultural and food science 22(2): 223-234. Onda, Y., K. Hashimoto, T. Yoshida, T. Sakurai, Y. Sawada, M. Y. Hirai, K. Toyooka, K. Mochida and K. Shinozaki (2015). "Determination of growth stages and metabolic profiles in Brachypodium distachyon for comparison of developmental context with Triticeae crops." Proc Biol Sci 282(1811). Ouyang, M., X. Li, J. Ma, W. Chi, J. Xiao, M. Zou, F. Chen, C. Lu and L. Zhang (2011). "LTD is a protein required for sorting light-harvesting chlorophyll-binding proteins to the chloroplast SRP pathway." Nature communications 2: 277. Paik, I. and E. Huq (2019). Plant photoreceptors: Multi-functional sensory proteins and their signaling networks. Seminars in Cell & Developmental Biology, Elsevier. Pajerowska-Mukhtar, K. M., D. K. Emerine and M. S. Mukhtar (2013). "Tell me more: roles of NPRs in plant immunity." Trends in plant science 18(7): 402-411. Parani, M., S. Rudrabhatla, R. Myers, H. Weirich, B. Smith, D. W. Leaman and S. L. Goldman (2004). "Microarray analysis of nitric oxide responsive transcripts in Arabidopsis." Plant Biotechnol J 2(4): 359-366.

164 Patole, C. and L. V. Bindschedler (2019). Plant proteomics: A guide to improve the proteome coverage. Advances in Biological Science Research, Elsevier: 45-67. Pedmale, U. V., S. C. Huang, M. Zander, B. J. Cole, J. Hetzel, K. Ljung, P. A. B. Reis, P. Sridevi, K. Nito, J. R. Nery, J. R. Ecker and J. Chory (2016). "Cryptochromes Interact Directly with PIFs to Control Plant Growth in Limiting Blue Light." Cell 164(1-2): 233-245. Pei, Z. M. and S. Gilroy (2018). "Calcium signals and their regulation." Annual Plant Reviews online: 137-162. Peltier, G., E.-M. Aro and T. Shikanai (2016). "NDH-1 and NDH-2 plastoquinone reductases in oxygenic photosynthesis." Annual review of plant biology 67: 55-80. Peng, L., H. Shimizu and T. Shikanai (2008). "The chloroplast NAD (P) H dehydrogenase complex interacts with photosystem I in Arabidopsis." Journal of Biological Chemistry 283(50): 34873- 34879. Petroutsos, D., R. Tokutsu, S. Maruyama, S. Flori, A. Greiner, L. Magneschi, L. Cusant, T. Kottke, M. Mittag and P. Hegemann (2016). "A blue-light photoreceptor mediates the feedback regulation of photosynthesis." Nature 537(7621): 563. Pfaffl, M. W. (2001). "A new mathematical model for relative quantification in real-time RT- PCR." Nucleic Acids Res 29(9): e45. Pfannschmidt, T., K. Schutze, M. Brost and R. Oelmuller (2001). "A novel mechanism of nuclear photosynthesis gene regulation by redox signals from the chloroplast during photosystem stoichiometry adjustment." J Biol Chem 276(39): 36125-36130. Pfeiffer, A., H. Shi, J. M. Tepperman, Y. Zhang and P. H. Quail (2014). "Combinatorial complexity in a transcriptionally centered signaling hub in Arabidopsis." Molecular plant 7(11): 1598-1618. Pham, V. N., P. K. Kathare and E. Huq (2018). "Phytochromes and phytochrome interacting factors." Plant Physiology 176(2): 1025-1038. Pierik, R., T. Djakovic-Petrovic, D. H. Keuskamp, M. de Wit and L. A. Voesenek (2009). "Auxin and ethylene regulate elongation responses to neighbor proximity signals independent of gibberellin and DELLA proteins in Arabidopsis." Plant Physiology 149(4): 1701-1712. Pigliucci, M. and A. Kolodynska (2002). "Phenotypic plasticity to light intensity in Arabidopsis thaliana: invariance of reaction norms and phenotypic integration." Evolutionary Ecology 16(1): 27-47. Pinho, P. and L. Halonen (2017). "Agricultural and horticultural lighting." Handbook of Advanced Lighting Technology: 703-720. Pinnola, A. and R. Bassi (2018). "Molecular mechanisms involved in plant photoprotection." Biochemical Society Transactions 46(2): 467-482. Pocock, T. (2015). "Light-emitting diodes and the modulation of specialty crops: Light sensing and signaling networks in plants." HortScience 50(9): 1281-1284. Poetsch, A., R. J. Berzborn, J. Heberle, T. A. Link, N. A. Dencher and H. Seelert (2007). "Biophysics and bioinformatics reveal structural differences of the two peripheral stalk subunits in chloroplast ATP synthase." The Journal of Biochemistry 141(3): 411-420. Porra, R., W. Thompson and P. Kriedemann (1989). "Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy." Biochimica et Biophysica Acta (BBA)-Bioenergetics 975(3): 384-394. Pospíšil, P. (2016). "Production of reactive oxygen species by photosystem II as a response to light and temperature stress." Frontiers in plant science 7: 1950.

165 Procko, C., Y. Burko, Y. Jaillais, K. Ljung, J. A. Long and J. Chory (2016). "The epidermis coordinates auxin-induced stem growth in response to shade." Genes Dev 30(13): 1529-1541. Procko, C., C. M. Crenshaw, K. Ljung, J. P. Noel and J. Chory (2014). "Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in Brassica rapa." Plant Physiol 165(3): 1285-1301. Provart, N. J., J. Alonso, S. M. Assmann, D. Bergmann, S. M. Brady, J. Brkljacic, J. Browse, C. Chapple, V. Colot and S. Cutler (2016). "50 years of Arabidopsis research: highlights and future directions." New Phytologist 209(3): 921-944. Qian, H., W. Chen, J. Li, J. Wang, Z. Zhou, W. Liu and Z. Fu (2009). "The effect of exogenous nitric oxide on alleviating herbicide damage in Chlorella vulgaris." Aquatic Toxicology 92(4): 250-257. Quaas, T., S. Berteotti, M. Ballottari, K. Flieger, R. Bassi, C. Wilhelm and R. Goss (2015). "Non- photochemical quenching and xanthophyll cycle activities in six green algal species suggest mechanistic differences in the process of excess energy dissipation." Journal of plant physiology 172: 92-103. Ragauskas, A. J., C. K. Williams, B. H. Davison, G. Britovsek, J. Cairney, C. A. Eckert, W. J. Frederick, Jr., J. P. Hallett, D. J. Leak, C. L. Liotta, J. R. Mielenz, R. Murphy, R. Templer and T. Tschaplinski (2006). "The path forward for biofuels and biomaterials." Science 311(5760): 484- 489. Rajjou, L., K. Gallardo, C. Job and D. Job (2018). "Proteome analysis for the study of developmental processes in plants." Annual Plant Reviews online: 151-184. Ramalho, J., N. Marques, J. Semedo, M. Matos and V. Quartin (2002). "Photosynthetic performance and pigment composition of leaves from two tropical species is determined by light quality." Plant Biology 4(01): 112-120. Ramanan, V. K., L. Shen, J. H. Moore and A. J. Saykin (2012). "Pathway analysis of genomic data: concepts, methods, and prospects for future development." TRENDS in Genetics 28(7): 323- 332. Rasmussen, S., P. Barah, M. C. Suarez-Rodriguez, S. Bressendorff, P. Friis, P. Costantino, A. M. Bones, H. B. Nielsen and J. Mundy (2013). "Transcriptome responses to combinations of stresses in Arabidopsis." Plant physiology 161(4): 1783-1794. Renné, P., U. Dreßen, U. Hebbeker, D. Hille, U. I. Flügge, P. Westhoff and A. P. Weber (2003). "The Arabidopsis mutant dct is deficient in the plastidic glutamate/malate translocator DiT2." The Plant Journal 35(3): 316-331. Rey, M.-D., L. Valledor, M. Á. Castillejo, R. Sánchez-Lucas, C. López-Hidalgo, V. M. Guerrero- Sanchez, F. J. Colina, M. Escandón, A. M. Maldonado-Alconada and J. V. Jorrín-Novo (2019). "Recent Advances in MS-Based Plant Proteomics: Proteomics Data Validation Through Integration with Other Classic and-Omics Approaches." Ritchie, M. E., B. Phipson, D. Wu, Y. Hu, C. W. Law, W. Shi and G. K. Smyth (2015). "limma powers differential expression analyses for RNA-sequencing and microarray studies." Nucleic acids research 43(7): e47-e47. Rochaix, J.-D. (2011). "Regulation of photosynthetic electron transport." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1807(3): 375-383. Rochaix, J. D. (2013). "Plant science. Fine-tuning photosynthesis." Science 342(6154): 50-51. Roden, L. C. and R. A. Ingle (2009). "Lights, rhythms, infection: the role of light and the circadian clock in determining the outcome of plant-pathogen interactions." Plant Cell 21(9): 2546-2552.

166 Rodriguez, E., H. El Ghoul, J. Mundy and M. Petersen (2016). "Making sense of plant autoimmunity and ‘negative regulators’." The FEBS journal 283(8): 1385-1391. Roitsch, T. and M.-C. González (2004). "Function and regulation of plant invertases: sweet sensations." Trends in plant science 9(12): 606-613. Romani, I., L. Tadini, F. Rossi, S. Masiero, M. Pribil, P. Jahns, M. Kater, D. Leister and P. Pesaresi (2012). "Versatile roles of Arabidopsis plastid ribosomal proteins in plant growth and development." The Plant Journal 72(6): 922-934. Rossini, S., A. P. Casazza, E. C. Engelmann, M. Havaux, R. C. Jennings and C. Soave (2006). "Suppression of both ELIP1 and ELIP2 in Arabidopsis does not affect tolerance to photoinhibition and photooxidative stress." Plant Physiology 141(4): 1264-1273. Rovira, A. G. and A. G. Smith (2019). "PPR proteins–orchestrators of organelle RNA metabolism." Physiologia plantarum 166(1): 451-459. Ruban, A. V. (2015). "Evolution under the sun: optimizing light harvesting in photosynthesis." J Exp Bot 66(1): 7-23. Ruban, A. V. (2018). "Light harvesting control in plants." FEBS letters 592(18): 3030-3039. Rumeau, D., G. Peltier and L. Cournac (2007). "Chlororespiration and cyclic electron flow around PSI during photosynthesis and plant stress response." Plant, cell & environment 30(9): 1041-1051. Saini, P., M. Gani, J. J. Kaur, L. C. Godara, C. Singh, S. Chauhan, R. M. Francies, A. Bhardwaj, N. B. Kumar and M. Ghosh (2018). Reactive oxygen species (ROS): a way to stress survival in plants. Abiotic Stress-Mediated Sensing and Signaling in Plants: An Omics Perspective, Springer: 127-153. Sakuraba, Y. and S. Yanagisawa (2018). "Light signalling-induced regulation of nutrient acquisition and utilisation in plants." Semin Cell Dev Biol 83: 123-132. Samuolienė, G., A. Brazaitytė, R. Sirtautas, A. Viršilė, J. Sakalauskaitė, S. Sakalauskienė and P. Duchovskis (2013). "LED illumination affects bioactive compounds in romaine baby leaf lettuce." Journal of the Science of Food and Agriculture 93(13): 3286-3291. San Clemente, H. and E. Jamet (2015). "WallProtDB, a database resource for plant cell wall proteomics." Plant Methods 11(1): 2. Santi, C., B. Molesini, F. Guzzo, Y. Pii, N. Vitulo and T. Pandolfini (2017). "Genome-Wide Transcriptional Changes and Lipid Profile Modifications Induced by Medicago truncatula N5 Overexpression at an Early Stage of the Symbiotic Interaction with Sinorhizobium meliloti." Genes 8(12): 396. Sathee, L., H. S. Meena, S. B. Adavi and S. K. Jha (2019). Cross Talk of Nitric Oxide and Reactive Oxygen Species in Various Processes of Plant Development: Past and Present. Plant Abiotic Stress Tolerance, Springer: 381-408. Schottler, M. A., S. Z. Toth, A. Boulouis and S. Kahlau (2015). "Photosynthetic complex stoichiometry dynamics in higher plants: biogenesis, function, and turnover of ATP synthase and the cytochrome b6f complex." J Exp Bot 66(9): 2373-2400. Schousboe, A. (2019). "Metabolic signaling in the brain and the role of astrocytes in control of glutamate and GABA neurotransmission." Neuroscience letters 689: 11-13. Schwieterman, E. W. (2018). "Surface and temporal biosignatures." arXiv preprint arXiv:1803.05065. Seaton, D. D., A. Graf, K. Baerenfaller, M. Stitt, A. J. Millar and W. Gruissem (2018). "Photoperiodic control of the Arabidopsis proteome reveals a translational coincidence mechanism." Mol Syst Biol 14(3): e7962.

167 Sellaro, R., U. Hoecker, M. Yanovsky, J. Chory and J. J. Casal (2009). "Synergism of red and blue light in the control of Arabidopsis gene expression and development." Current Biology 19(14): 1216-1220. Sellaro, R., M. Pacin and J. J. Casal (2017). "Meta-Analysis of the Transcriptome Reveals a Core Set of Shade-Avoidance Genes in Arabidopsis." Photochem Photobiol 93(3): 692-702. Seyfferth, C. and K. Tsuda (2014). "Salicylic acid signal transduction: the initiation of biosynthesis, perception and transcriptional reprogramming." Front Plant Sci 5: 697. Sgherri, C., C. Pinzino and M. F. Quartacci (2018). Reactive oxygen species and photosynthetic functioning: past and present. Reactive Oxygen Species in Plants: Boon or Bane–Revisiting the Role of ROS, J. Wiley & Sons, Ltd, Chichester, UK: 137-155. Shaikhali, J., J. de Dios Barajas-Lopéz, K. Ötvös, D. Kremnev, A. S. Garcia, V. Srivastava, G. Wingsle, L. Bako and Å. Strand (2012). "The CRYPTOCHROME1-dependent response to excess light is mediated through the transcriptional activators ZINC FINGER PROTEIN EXPRESSED IN INFLORESCENCE MERISTEM LIKE1 and ZML2 in Arabidopsis." The Plant Cell 24(7): 3009-3025. Shannon, P., A. Markiel, O. Ozier, N. S. Baliga, J. T. Wang, D. Ramage, N. Amin, B. Schwikowski and T. Ideker (2003). "Cytoscape: a software environment for integrated models of biomolecular interaction networks." Genome Res 13(11): 2498-2504. Sharma, N. Y. S. (2016). "Reactive Oxygen Species, Oxidative stress and ROS scavenging system in plants." Journal of Chemical and Pharmaceutical Research 8(5): 595-604. Sheerin, D. J., C. Menon, S. zur Oven-Krockhaus, B. Enderle, L. Zhu, P. Johnen, F. Schleifenbaum, Y.-D. Stierhof, E. Huq and A. Hiltbrunner (2015). "Light-activated phytochrome A and B interact with members of the SPA family to promote photomorphogenesis in Arabidopsis by reorganizing the COP1/SPA complex." The Plant Cell 27(1): 189-201. Shelp, B. J., A. W. Bown and A. Zarei (2017). "4-Aminobutyrate (GABA): a metabolite and signal with practical significance." Botany 95(11): 1015-1032. Shen, H., L. Zhu, A. Castillon, M. Majee, B. Downie and E. Huq (2008). "Light-induced phosphorylation and degradation of the negative regulator PHYTOCHROME-INTERACTING FACTOR1 from Arabidopsis depend upon its direct physical interactions with photoactivated phytochromes." The Plant Cell 20(6): 1586-1602. Shi, J., X. Zang, X. Cong, L. Hou, B. He, Y. Ding, M. Dong, D. Sun, Y. Guo and F. Zhang (2019). "Cloning of nitrite reductase gene from Haematococcus pluvialis and transcription and enzymatic activity analysis at different nitrate and phosphorus concentration." Gene. Shikanai, T. and H. Yamamoto (2017). "Contribution of cyclic and pseudo-cyclic electron transport to the formation of proton motive force in chloroplasts." Molecular plant 10(1): 20-29. Shin, J., K. Kim, H. Kang, I. S. Zulfugarov, G. Bae, C. H. Lee, D. Lee and G. Choi (2009). "Phytochromes promote seedling light responses by inhibiting four negatively-acting phytochrome-interacting factors." Proc Natl Acad Sci U S A 106(18): 7660-7665. Sies, H. (2019). Oxidative Stress: Eustress and Distress in Redox Homeostasis. Stress: Physiology, Biochemistry, and Pathology, Elsevier: 153-163. Silva, F. D., I. M. Vasconcelos, K. D. Saraiva, J. H. Costa, C. F. Fernandes and J. T. Oliveira (2019). "The expression of the genes involved in redox metabolism and hydrogen peroxide balance is associated with the resistance of cowpea [Vigna unguiculata (L.) Walp.] to the hemibiotrophic fungus Colletotrichum gloeosporioides." Journal of plant physiology 233: 73-83. Singh, A., A. Kumar, S. Yadav and I. K. Singh (2019). "Reactive oxygen species-mediated signaling during abiotic stress." Plant Gene: 100173.

168 Singh, A. K., R. Kumar, A. K. Tripathi, B. K. Gupta, A. Pareek and S. L. Singla-Pareek (2015). "Genome-wide investigation and expression analysis of Sodium/Calcium exchanger gene family in rice and Arabidopsis." Rice 8(1): 21. Singh, D., C. Basu, M. Meinhardt-Wollweber and B. Roth (2015). "LEDs for energy efficient greenhouse lighting." Renewable and Sustainable Energy Reviews 49: 139-147. Singh, J. and J. K. Thakur (2018). Photosynthesis and abiotic stress in plants. Biotic and abiotic stress tolerance in plants, Springer: 27-46. Singh, S., R. K. Tripathi, P. G. Lemaux, B. B. Buchanan and J. Singh (2017). "Redox-dependent interaction between thaumatin-like protein and beta-glucan influences malting quality of barley." Proc Natl Acad Sci U S A 114(29): 7725-7730. Smith, A. M. and S. C. Zeeman (2006). "Quantification of starch in plant tissues." Nat Protoc 1(3): 1342-1345. Smith, H. (2000). "Phytochromes and light signal perception by plants--an emerging synthesis." Nature 407(6804): 585-591. Smith, H. (2000). "Phytochromes and light signal perception by plants—an emerging synthesis." Nature 407(6804): 585. Smith, H. L., L. McAusland and E. H. Murchie (2017). "Don’t ignore the green light: exploring diverse roles in plant processes." Journal of experimental botany 68(9): 2099-2110. Smith, R., A. D. Mathis, D. Ventura and J. T. Prince (2014). "Proteomics, lipidomics, metabolomics: a mass spectrometry tutorial from a computer scientist's point of view." BMC bioinformatics 15(7): S9. Somssich, I. E. (2018). "Networks of transcriptional regulation underlying plant defense responses toward phytopathogens." Annual Plant Reviews online: 266-284. Son, K.-H., J.-H. Park, D. Kim and M.-M. Oh (2012). "Leaf shape index, growth, and phytochemicals in two leaf lettuce cultivars grown under monochromatic light-emitting diodes." Korean Journal of Horticultural Science and Technology 30(6): 664-672. Stahl, E., P. Bellwon, S. Huber, K. Schlaeppi, F. Bernsdorff, A. Vallat-Michel, F. Mauch and J. Zeier (2016). "Regulatory and functional aspects of indolic metabolism in plant systemic acquired resistance." Molecular plant 9(5): 662-681. Stenoien, H. K., C. B. Fenster, H. Kuittinen and O. Savolainen (2002). "Quantifying latitudinal clines to light responses in natural populations of Arabidopsis thaliana (Brassicaceae)." Am J Bot 89(10): 1604-1608. Stephenson, P. G., C. Fankhauser and M. J. Terry (2009). "PIF3 is a repressor of chloroplast development." Proceedings of the National Academy of Sciences 106(18): 7654-7659. Stewart, A. G., L. K. Lee, M. Donohoe, J. J. Chaston and D. Stock (2012). "The dynamic stator stalk of rotary ATPases." Nature communications 3: 687. Su, F., C. Jacquard, S. Villaume, J. Michel, F. Rabenoelina, C. Clément, E. A. Barka, S. Dhondt- Cordelier and N. Vaillant-Gaveau (2015). "Burkholderia phytofirmans PsJN reduces impact of freezing temperatures on photosynthesis in Arabidopsis thaliana." Frontiers in plant science 6: 810. Su, J., B. Liu, J. Liao, Z. Yang, C. Lin and Y. Oka (2017). "Coordination of cryptochrome and phytochrome signals in the regulation of plant light responses." Agronomy 7(1): 25. Sugiura, M. and A. Boussac (2014). "Some Photosystem II properties depending on the D1 protein variants in Thermosynechococcus elongatus." Biochimica et Biophysica Acta (BBA)- Bioenergetics 1837(9): 1427-1434. Sun, J., L. Qi, Y. Li, Q. Zhai and C. Li (2013). "PIF4 and PIF5 transcription factors link blue light and auxin to regulate the phototropic response in Arabidopsis." The Plant Cell 25(6): 2102-2114.

169 Sun, Y., X.-Y. Fan, D.-M. Cao, W. Tang, K. He, J.-Y. Zhu, J.-X. He, M.-Y. Bai, S. Zhu and E. Oh (2010). "Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis." Developmental cell 19(5): 765-777. Suorsa, M., S. Järvi, M. Grieco, M. Nurmi, M. Pietrzykowska, M. Rantala, S. Kangasjärvi, V. Paakkarinen, M. Tikkanen and S. Jansson (2012). "PROTON GRADIENT REGULATION5 is essential for proper acclimation of Arabidopsis photosystem I to naturally and artificially fluctuating light conditions." The Plant Cell 24(7): 2934-2948. Suorsa, M., S. Jarvi, M. Grieco, M. Nurmi, M. Pietrzykowska, M. Rantala, S. Kangasjarvi, V. Paakkarinen, M. Tikkanen, S. Jansson and E. M. Aro (2012). "PROTON GRADIENT REGULATION5 is essential for proper acclimation of Arabidopsis photosystem I to naturally and artificially fluctuating light conditions." Plant Cell 24(7): 2934-2948. Suorsa, M., M. Rantala, F. Mamedov, M. Lespinasse, A. Trotta, M. Grieco, E. Vuorio, M. Tikkanen, S. Järvi and E. M. Aro (2015). "Light acclimation involves dynamic re‐organization of the pigment–protein megacomplexes in non‐appressed thylakoid domains." The Plant Journal 84(2): 360-373. Takahashi, S. and M. R. Badger (2011). "Photoprotection in plants: a new light on photosystem II damage." Trends in plant science 16(1): 53-60. Takemiya, A., S.-i. Inoue, M. Doi, T. Kinoshita and K.-i. Shimazaki (2005). "Phototropins promote plant growth in response to blue light in low light environments." The Plant Cell 17(4): 1120-1127. Takou, M., B. Wieters, S. Kopriva, G. Coupland, A. Linstädter and J. De Meaux (2018). "Linking genes with ecological strategies in Arabidopsis thaliana." Journal of experimental botany 70(4): 1141-1151. Tanaka, A., N. Ohno, K. Nakajima and Y. Matsuda (2016). "Light and CO2/cAMP signal cross talk on the promoter elements of chloroplastic β-carbonic anhydrase genes in the marine diatom Phaeodactylum tricornutum." Plant physiology 170(2): 1105-1116. Taulavuori, K., V. Hyöky, J. Oksanen, E. Taulavuori and R. Julkunen-Tiitto (2016). "Species- specific differences in synthesis of flavonoids and phenolic acids under increasing periods of enhanced blue light." Environmental and experimental botany 121: 145-150. Tenhaken, R. (2015). "Cell wall remodeling under abiotic stress." Frontiers in plant science 5: 771. Terashima, I., T. Fujita, T. Inoue, W. S. Chow and R. Oguchi (2009). "Green light drives leaf photosynthesis more efficiently than red light in strong white light: revisiting the enigmatic question of why leaves are green." Plant Cell Physiol 50(4): 684-697. Terashima, I., Y. T. Hanba, D. Tholen and Ü. Niinemets (2011). "Leaf functional anatomy in relation to photosynthesis." Plant Physiology 155(1): 108-116. Terry, M. J. and A. G. Smith (2013). "A model for tetrapyrrole synthesis as the primary mechanism for plastid-to-nucleus signaling during chloroplast biogenesis." Front Plant Sci 4: 14. Thibaud-Nissen, F., H. Wu, T. Richmond, J. C. Redman, C. Johnson, R. Green, J. Arias and C. D. Town (2006). "Development of Arabidopsis whole-genome microarrays and their application to the discovery of binding sites for the TGA2 transcription factor in salicylic acid-treated plants." Plant J 47(1): 152-162. Tikhonov, A. N. (2014). "The cytochrome b6f complex at the crossroad of photosynthetic electron transport pathways." Plant Physiology and Biochemistry 81: 163-183. Tikkanen, M. and E. M. Aro (2014). "Integrative regulatory network of plant thylakoid energy transduction." Trends Plant Sci 19(1): 10-17.

170 Tohge, T. and A. R. Fernie (2017). "Leveraging natural variance towards enhanced understanding of phytochemical sunscreens." Trends in plant science 22(4): 308-315. Toubiana, D., A. R. Fernie, Z. Nikoloski and A. Fait (2013). "Network analysis: tackling complex data to study plant metabolism." Trends in biotechnology 31(1): 29-36. Townsend, A. J., M. A. Ware and A. V. Ruban (2018). "Dynamic interplay between photodamage and photoprotection in photosystem II." Plant, cell & environment 41(5): 1098-1112. Trujillo, C., A. Blumenthal, J. Marrero, K. Y. Rhee, D. Schnappinger and S. Ehrt (2014). "Triosephosphate isomerase is dispensable in vitro yet essential for Mycobacterium tuberculosis to establish infection." MBio 5(2): e00085-00014. Umena, Y., K. Kawakami, J.-R. Shen and N. Kamiya (2011). "Crystal structure of oxygen- evolving photosystem II at a resolution of 1.9 Å." Nature 473(7345): 55. van Iersel, M. W. (2017). Optimizing LED Lighting in Controlled Environment Agriculture. Light Emitting Diodes for Agriculture, Springer: 59-80. van Rooijen, R., M. G. Aarts and J. Harbinson (2015). "Natural genetic variation for acclimation of photosynthetic light use efficiency to growth irradiance in Arabidopsis." Plant Physiol 167(4): 1412-1429. Vandenbussche, F. and D. Van Der Straeten (2018). "The role of ethylene in plant growth and development." Annual Plant Reviews online: 219-241. Vass, I. (2012). "Molecular mechanisms of photodamage in the Photosystem II complex." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1817(1): 209-217. Vaudel, M., K. Verheggen, A. Csordas, H. Ræder, F. S. Berven, L. Martens, J. A. Vizcaíno and H. Barsnes (2016). "Exploring the potential of public proteomics data." Proteomics 16(2): 214- 225. Venema, J. H., L. Villerius and P. R. van Hasselt (2000). "Effect of acclimation to suboptimal temperature on chilling-induced photodamage: comparison between a domestic and a high-altitude wild Lycopersicon species." Plant Science 152(2): 153-163. Verberkmoes, N. C., A. L. Russell, M. Shah, A. Godzik, M. Rosenquist, J. Halfvarson, M. G. Lefsrud, J. Apajalahti, C. Tysk, R. L. Hettich and J. K. Jansson (2009). "Shotgun metaproteomics of the human distal gut microbiota." ISME J 3(2): 179-189. Verhoeven, K. J., B. M. Vonholdt and V. L. Sork (2016). "Epigenetics in ecology and evolution: what we know and what we need to know." Molecular Ecology 25(8): 1631-1638. Viršilė, A., M. Olle and P. Duchovskis (2017). LED Lighting in Horticulture. Light Emitting Diodes for Agriculture, Springer: 113-147. Vishwakarma, K., N. Upadhyay, N. Kumar, G. Yadav, J. Singh, R. K. Mishra, V. Kumar, R. Verma, R. Upadhyay and M. Pandey (2017). "Abscisic acid signaling and abiotic stress tolerance in plants: a review on current knowledge and future prospects." Frontiers in plant science 8: 161. Voelckel, C., N. Gruenheit and P. Lockhart (2017). "Evolutionary transcriptomics and proteomics: insight into plant adaptation." Trends in plant science 22(6): 462-471. Vogel, C. and E. M. Marcotte (2012). "Insights into the regulation of protein abundance from proteomic and transcriptomic analyses." Nature reviews genetics 13(4): 227. Vollmar, M., D. Schlieper, M. Winn, C. Büchner and G. Groth (2009). "Structure of the c14 rotor ring of the proton translocating chloroplast ATP synthase." Journal of Biological Chemistry 284(27): 18228-18235. Wagner, S., J. Stuttmann, S. Rietz, R. Guerois, E. Brunstein, J. Bautor, K. Niefind and J. E. Parker (2013). "Structural basis for signaling by exclusive EDS1 heteromeric complexes with SAG101 or PAD4 in plant innate immunity." Cell Host Microbe 14(6): 619-630.

171 Walters, R. G. (2005). "Towards an understanding of photosynthetic acclimation." J Exp Bot 56(411): 435-447. Wang, C., H. Yamamoto and T. Shikanai (2015). "Role of cyclic electron transport around photosystem I in regulating proton motive force." Biochimica et Biophysica Acta (BBA)- Bioenergetics 1847(9): 931-938. Wang, D., N. Amornsiripanitch and X. Dong (2006). "A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants." PLoS Pathog 2(11): e123. Wang, H., M. Gu, J. Cui, K. Shi, Y. Zhou and J. Yu (2009). "Effects of light quality on CO2 assimilation, chlorophyll-fluorescence quenching, expression of Calvin cycle genes and carbohydrate accumulation in Cucumis sativus." Journal of Photochemistry and Photobiology B: Biology 96(1): 30-37. Wang, H., M. Gu, J. Cui, K. Shi, Y. Zhou and J. Yu (2009). "Effects of light quality on CO2 assimilation, chlorophyll-fluorescence quenching, expression of Calvin cycle genes and carbohydrate accumulation in Cucumis sativus." J Photochem Photobiol B 96(1): 30-37. Wang, H., Y. P. Jiang, H. J. Yu, X. J. Xia, K. Shi, Y. H. Zhou and J. Q. Yu (2010). "Light quality affects incidence of powdery mildew, expression of defence-related genes and associated metabolism in cucumber plants." European journal of plant pathology 127(1): 125-135. Wang, H. and H. Wang (2015). "Phytochrome signaling: time to tighten up the loose ends." Molecular Plant 8(4): 540-551. Wang, J., W. Lu, Y. Tong and Q. Yang (2016). "Leaf morphology, photosynthetic performance, chlorophyll fluorescence, stomatal development of lettuce (Lactuca sativa L.) exposed to different ratios of red light to blue light." Frontiers in plant science 7: 250. Wang, L., X. Jin, Q. Li, X. Wang, Z. Li and X. Wu (2016). "Comparative proteomics reveals that phosphorylation of β carbonic anhydrase 1 might be important for adaptation to drought stress in brassica napus." Scientific reports 6: 39024. Wang, P., Z. Li, J. Wei, Z. Zhao, D. Sun and S. Cui (2012). "A Na+/Ca2+ exchanger-like protein (AtNCL) involved in salt stress in Arabidopsis." Journal of Biological Chemistry 287(53): 44062- 44070. Wang, Q., Q. Liu, X. Wang, Z. Zuo, Y. Oka and C. Lin (2018). "New insights into the mechanisms of phytochrome–cryptochrome coaction." new phytologist 217(2): 547-551. Wang, Y. and K. M. Folta (2013). "Contributions of green light to plant growth and development." Am J Bot 100(1): 70-78. Wang, Z. Q., X. Zhou, L. Dong, J. Guo, Y. Chen, Y. Zhang, L. Wu and M. Xu (2018). "iTRAQ- based analysis of the Arabidopsis proteome reveals insights into the potential mechanisms of anthocyanin accumulation regulation in response to phosphate deficiency." J Proteomics 184: 39- 53. Wargent, J. J. and B. R. Jordan (2013). "From ozone depletion to agriculture: understanding the role of UV radiation in sustainable crop production." New Phytologist 197(4): 1058-1076. Wasternack, C. and B. Hause (2013). "Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany." Annals of botany 111(6): 1021-1058. Waszczak, C., M. Carmody and J. Kangasjärvi (2018). "Reactive oxygen species in plant signaling." Annual review of plant biology 69: 209-236. Watanabe, M., S. Balazadeh, T. Tohge, A. Erban, P. Giavalisco, J. Kopka, B. Mueller-Roeber, A. R. Fernie and R. Hoefgen (2013). "Comprehensive dissection of spatiotemporal metabolic shifts

172 in primary, secondary, and lipid metabolism during developmental senescence in Arabidopsis." Plant Physiol 162(3): 1290-1310. Watson, S. J., R. G. Sowden and P. Jarvis (2018). "Abiotic stress-induced chloroplast proteome remodelling: a mechanistic overview." J Exp Bot 69(11): 2773-2781. Weckwerth, W. (2011). "Green systems biology—from single genomes, proteomes and metabolomes to ecosystems research and biotechnology." Journal of proteomics 75(1): 284-305. Weigel, D. (2012). "Natural variation in Arabidopsis: from molecular genetics to ecological genomics." Plant physiology 158(1): 2-22. Weijers, D., J. Nemhauser and Z. Yang (2018). Auxin: small molecule, big impact, Oxford University Press UK. Wettenhall, J. M. and G. K. Smyth (2004). "limmaGUI: a graphical user interface for linear modeling of microarray data." Bioinformatics 20(18): 3705-3706. White, J. W., P. Andrade-Sanchez, M. A. Gore, K. F. Bronson, T. A. Coffelt, M. M. Conley, K. A. Feldmann, A. N. French, J. T. Heun and D. J. Hunsaker (2012). "Field-based phenomics for plant genetics research." Field Crops Research 133: 101-112. Whyburn, G. T. (2015). Topological analysis, Princeton University Press. Wood, W. H., C. MacGregor-Chatwin, S. F. Barnett, G. E. Mayneord, X. Huang, J. K. Hobbs, C. N. Hunter and M. P. Johnson (2018). "Dynamic thylakoid stacking regulates the balance between linear and cyclic photosynthetic electron transfer." Nature plants 4(2): 116. Wright, S. W. and J. D. Shearer (1984). "Rapid extraction and high-performance liquid chromatography of chlorophylls and carotenoids from marine phytoplankton." Journal of Chromatography A 294: 281-295. Wu, Q., N. Su, W. Shen and J. Cui (2014). "Analyzing photosynthetic activity and growth of Solanum lycopersicum seedlings exposed to different light qualities." Acta physiologiae plantarum 36(6): 1411-1420. Wu, Y., W. Gong and W. Yang (2017). "Shade inhibits leaf size by controlling cell proliferation and enlargement in soybean." Scientific reports 7(1): 9259. Wu, Y., D. Zhang, J. Y. Chu, P. Boyle, Y. Wang, I. D. Brindle, V. De Luca and C. Despres (2012). "The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid." Cell Rep 1(6): 639-647. Xiao, F.-G., L. Shen and H.-F. Ji (2011). "On photoprotective mechanisms of carotenoids in light harvesting complex." Biochemical and biophysical research communications 414(1): 1-4. Xu, F., S. He, J. Zhang, Z. Mao, W. Wang, T. Li, J. Hua, S. Du, P. Xu and L. Li (2018). "Photoactivated CRY1 and phyB interact directly with AUX/IAA proteins to inhibit auxin signaling in Arabidopsis." Molecular plant 11(4): 523-541. Xu, T., S. Park, J. Venable, J. Wohlschlegel, J. Diedrich, D. Cociorva, B. Lu, L. Liao, J. Hewel and X. Han (2015). "ProLuCID: An improved SEQUEST-like algorithm with enhanced sensitivity and specificity." Journal of proteomics 129: 16-24. Xu, X. M., J. Wang, Z. Xuan, A. Goldshmidt, P. G. Borrill, N. Hariharan, J. Y. Kim and D. Jackson (2011). "Chaperonins facilitate KNOTTED1 cell-to-cell trafficking and stem cell function." Science 333(6046): 1141-1144. Yadav, K. S., D. A. Semchonok, L. Nosek, R. Kouřil, G. Fucile, E. J. Boekema and L. A. Eichacker (2017). "Supercomplexes of plant photosystem I with cytochrome b6f, light-harvesting complex II and NDH." Biochimica et Biophysica Acta (BBA)-Bioenergetics 1858(1): 12-20. Yamori, W. (2016). "Photosynthetic response to fluctuating environments and photoprotective strategies under abiotic stress." Journal of plant research 129(3): 379-395.

173 Yamori, W. and T. Shikanai (2016). "Physiological Functions of Cyclic Electron Transport Around Photosystem I in Sustaining Photosynthesis and Plant Growth." Annu Rev Plant Biol 67: 81-106. Yan, M., M. Wang, H. Wang, Y. Wang and C. Zhao (2014). "Effects of light quality on photosynthetic pigment contents and photosynthetic characteristics of peanut seedling leaves." Ying yong sheng tai xue bao= The journal of applied ecology 25(2): 483-487. Yang, X., X. Wang, L. Wang and M. Wei (2012). "Control of light environment: A key technique for high-yield and high-quality vegetable production in protected farmland." Agricultural Sciences 3(07): 923. Yang, X., H. Xu, L. Shao, T. Li, Y. Wang and R. Wang (2018). "Response of photosynthetic capacity of tomato leaves to different LED light wavelength." Environmental and Experimental Botany 150: 161-171. Yang, Z., B. Liu, J. Su, J. Liao, C. Lin and Y. Oka (2017). "Cryptochromes orchestrate transcription regulation of diverse blue light responses in plants." Photochemistry and photobiology 93(1): 112-127. Yavari, N., A. Kushalappa and M. G. Lefsrud (Submitted). "In-depth comparative proteomic analysis of Arabidopsis thaliana response to narrow-wavelength lights reveals regulation of proteome profiles controlling biological functions." Yavari, N., R. K. Tripathi, B. Wu, S. MacPherson, J. Singh and M. G. Lefsrud (submitted). Photosynthetic performance of Arabidopsis thaliana accessions to different light wavelengths. Ye, X., M. She, K. Wang and H. Xu (2012). "Identification, cloning, and potential application of genes related to somatic embryogenesis in plant tissue culture." Acta Agronomica Sinica 38(2): 191-201. Yeh, N. and J.-P. Chung (2009). "High-brightness LEDs—Energy efficient lighting sources and their potential in indoor plant cultivation." Renewable and Sustainable Energy Reviews 13(8): 2175-2180. Yoshida, Y., Y. Mogi, A. D. TerBush and K. W. Osteryoung (2016). "Chloroplast FtsZ assembles into a contractible ring via tubulin-like heteropolymerization." Nature plants 2(7): 16095. Yoshioka-Nishimura, M. (2016). "Close relationships between the PSII repair cycle and thylakoid membrane dynamics." Plant and Cell Physiology 57(6): 1115-1122. Yu, Q. B., C. Huang and Z. N. Yang (2014). "Nuclear-encoded factors associated with the chloroplast transcription machinery of higher plants." Front Plant Sci 5: 316. Yu, W., Y. Liu, L. Song, D. F. Jacobs, X. Du, Y. Ying, Q. Shao and J. Wu (2017). "Effect of differential light quality on morphology, photosynthesis, and antioxidant enzyme activity in Camptotheca acuminata seedlings." Journal of Plant Growth Regulation 36(1): 148-160. Yuan, J. S., K. H. Tiller, H. Al-Ahmad, N. R. Stewart and C. N. Stewart Jr (2008). "Plants to power: bioenergy to fuel the future." Trends in plant science 13(8): 421-429. Zavafer, A., M. H. Cheah, W. Hillier, W. S. Chow and S. Takahashi (2015). "Photodamage to the oxygen evolving complex of photosystem II by visible light." Sci Rep 5: 16363. Zhang, H., H. He, X. Wang, X. Wang, X. Yang, L. Li and X. W. Deng (2011). "Genome‐wide mapping of the HY5‐mediated genenetworks in Arabidopsis that involve both transcriptional and post‐transcriptional regulation." The Plant Journal 65(3): 346-358. Zhang, Y., O. Mayba, A. Pfeiffer, H. Shi, J. M. Tepperman, T. P. Speed and P. H. Quail (2013). "A quartet of PIF bHLH factors provides a transcriptionally centered signaling hub that regulates seedling morphogenesis through differential expression-patterning of shared target genes in Arabidopsis." PLoS genetics 9(1): e1003244.

174 Zhang, Y., Z. Wen, M. P. Washburn and L. Florens (2010). "Refinements to label free proteome quantitation: how to deal with peptides shared by multiple proteins." Analytical chemistry 82(6): 2272-2281. Zhou, F., N. Qiu, Z. Gu, B. Zhang and C. Hua (2014). "Thermal stability studies of photosystem II complexes reconstituted into phosphatidylcholine liposomes." Russian journal of plant physiology 61(1): 26-32. Zhu, S., R. D. Jeong, S. C. Venugopal, L. Lapchyk, D. Navarre, A. Kachroo and P. Kachroo (2011). "SAG101 forms a ternary complex with EDS1 and PAD4 and is required for resistance signaling against turnip crinkle virus." PLoS Pathog 7(11): e1002318. Zhu, X.-G., S. P. Long and D. R. Ort (2008). "What is the maximum efficiency with which photosynthesis can convert solar energy into biomass?" Current opinion in biotechnology 19(2): 153-159. Zhu, X. G., J. P. Lynch, D. S. LeBauer, A. J. Millar, M. Stitt and S. P. Long (2016). "Plants in silico: why, why now and what?—an integrative platform for plant systems biology research." Plant, Cell & Environment 39(5): 1049-1057. Zipfel, C. and G. E. Oldroyd (2017). "Plant signalling in symbiosis and immunity." Nature 543(7645): 328.

175 8. Appendix A

The ProLuCID search.xml used to verify the PSM obtained from PatternLab program for Chapter 4.

Main Script:

D:/17PM_pombe030305.fasta false 1

200 500

176

mono mono 0

4500 4500 100 400

177 700.00 16000.00 7 15 5000 4 * 0 false x 0 false

178 C 57.02146

# 0 T S 0 trypsin true R K

179

180 9. Appendix B

The PatternLab for Proteomics software (v4.0.62) (http://www.patternlabforproteomics.org/) used for analysis of the obtained data from our lab shotgun proteomics methodology in chapter 3. The workflow is separated into three main modules: peptide identification, statistically filtering and quantitating PSMs, data analysis and quantification

Figure A-1. Search engine for PSMs

181

Figure A-2. Search comet

182

Figure A-3. Spectral counting and Tfold analysis of DAPs

183 10. Appendix C

The list of proteins and their spectral count across the two top samples in the PatternLab for Proteomics search used for analysis of the obtained data from our lab shotgun proteomics methodology in chapter 3.

Table 1.C. List of proteins and their spectral count in the 595 nm samples.

Protein ID # Unique Total # of Total Total NSAF peptides peptides spectral count (%)

O03042 70 73 4520 0.10208335 Q9ZNZ7 0 35 191 0.0012739 Q8RWV0 0 31 632 0.00922679 P19366 25 29 631 0.0137073 P10896 2 26 325 0.00741749 O50008 17 26 333 0.00470907 P10896-2 1 25 314 0.00761635 Q0WNJ6 7 24 55 0.00034897 P22953 7 24 112 0.00186118 O65719 7 24 89 0.00148353 Q9LTX9 7 23 221 0.00332981 Q8H0T4 23 23 23 6.80E-05 Q0WLB5 6 23 53 0.00033668 Q9FI56 22 22 85 0.00098982 Q94B78 12 22 159 0.00165871 Q944G9 9 22 457 0.01242182 P56777 22 22 453 0.00964687 Q9STW6 5 21 237 0.00357089 Q9SJU4 6 21 468 0.01268893 Q39043 13 21 99 0.00160328

184 P56757 21 21 718 0.01532034 P25856 4 21 529 0.01445148 P21240 5 21 327 0.00589588 Q9S841 10 20 303 0.009903 Q9LPW0 0 20 441 0.01195687 Q56WK6 19 20 74 0.00139711 P55737 2 20 88 0.00136194 P38418 20 20 89 0.00107457 P25857 12 20 512 0.01239123 P21238 20 20 138 0.00254761 O81283 19 20 23 0.00016555 F4JKH6 20 20 30 0.00017842 C0Z361 7 20 270 0.00489262 Q9SZD6 19 19 49 0.00055623 Q9LV03 19 19 23 0.00011269 Q9FX54 2 19 252 0.00806558 P56767 17 19 165 0.00243187 P51818 0 19 90 0.00139289 P25858 2 19 245 0.00784154 P23321 9 19 349 0.01137206 O80988 10 19 102 0.00105694 B3H5S2 0 19 1277 0.07427282 Q9SRV5 10 18 180 0.00254544 Q5GM68 10 18 99 0.00111214 P10795 6 18 1157 0.0695365 Q9XIE2 17 17 19 0.00013992 Q9M5K3 9 17 38 0.00081083 Q9LW52 17 17 22 0.00052655 Q9ASR1 16 17 105 0.00134745 P56778 17 17 503 0.01150426 P31414 17 17 47 0.00066033

185 F4KHD5 17 17 17 6.37E-05 F4IW47 8 17 257 0.00375204 Q9SIB9 10 16 29 0.00031689 Q9SAC6 16 16 23 0.00017785 Q9S7H1 6 16 159 0.00826962 Q9FIH8 16 16 16 0.00013683 Q56ZI2 15 16 26 0.00041182 P20649 7 16 33 0.00037618 O49006 16 16 67 0.00122435 Q9LJE4 1 15 271 0.00491898 Q9LD57 12 15 105 0.00236154 Q9FH02 14 15 25 0.00038417 Q94A28 8 15 16 0.00017396 Q8H1E2 2 15 43 0.00105007 O23255 4 15 152 0.00339042 F4JVN6 15 15 27 0.00021166 Q9SZJ5 14 14 153 0.0032015 Q9SI75 14 14 17 0.00023488 Q9SA56 4 14 129 0.00684087 Q9LVL7 1 14 37 0.00090559 Q9LK36 3 14 107 0.00238668 Q9LJX0 14 14 14 0.00012097 Q9LJL3 0 14 32 0.00032054 Q9FKW6 13 14 98 0.00294493 Q42601 14 14 19 0.00017316 Q42547 1 14 254 0.00558497 Q39142 2 14 406 0.01651187 Q39141 0 14 410 0.01673748 Q38970 14 14 25 0.00011999 P56766 13 14 444 0.00640433 P30184 9 14 25 0.0005201

186 P25696 12 14 53 0.00129135 O81645 13 14 38 0.000426 Q9XF88 7 13 41 0.00154545 Q9STX5 0 13 30 0.00039434 Q9STF2 13 13 44 0.00093333 Q9STE8 13 13 21 0.00027773 Q9SJQ9 4 13 68 0.00205484 Q9SCN8 4 13 22 0.00029202 Q9M5K2 5 13 51 0.00108821 Q9LZF6 3 13 20 0.00026711 Q9LF98 6 13 80 0.00241746 Q8VXX0 1 13 18 0.00025224 Q8H0U5 13 13 22 0.00037129 Q07473 7 13 96 0.00358117 P19456 0 13 30 0.00034235 F4JPJ7 0 13 30 0.00033083 B9DG18 0 13 239 0.00533099 Q9XES1 2 12 15 0.00015294 Q9LYA9 12 12 56 0.00149216 Q9LTT8 1 12 21 0.00016903 Q9LR30 1 12 107 0.00240653 Q9C5A9 3 12 39 0.00075475 Q94A41 12 12 14 0.00017075 Q8VZG7-2 1 12 24 0.00025783 Q8S944 1 12 14 0.00018744 Q0WW26 12 12 18 0.00021978 P56771 12 12 84 0.00283976 P54609 4 12 16 0.00021396 P17094 12 12 40 0.0011124 O80860 9 12 18 0.00028018 O65902 12 12 19 0.00043182

187 F4IXW2 12 12 14 8.71E-05 F4IWV2 12 12 20 0.00021275 Q9ZU52 6 11 64 0.00177074 Q9XI01 0 11 24 0.00051823 Q9T0P4 9 11 21 0.00013946 Q9SFU0 11 11 11 0.00011464 Q9SF85 3 11 38 0.00119503 Q9SA52 9 11 42 0.00120201 Q9MAH0 2 11 63 0.0007048 Q9LZG0 3 11 38 0.00119156 Q9LZ66 11 11 16 0.00026961 Q9LR30-2 0 11 106 0.00260027 Q9LFA3 0 11 68 0.00169501 Q9FVQ1 10 11 17 0.00033018 Q8W4E2 1 11 59 0.00131061 Q8RXD9 11 11 13 0.00014726 Q8LPR9 11 11 12 0.00012777 Q43127 10 11 160 0.00402535 P36428 1 11 18 0.00019414 O65396 11 11 62 0.00164393 O65351 10 11 24 0.00034298 O65282 11 11 46 0.00196693 O49485 11 11 26 0.00046645 O48844 11 11 11 0.00011853 O23627 0 11 19 0.00028195 O22173 11 11 11 0.00017976 O04316 3 11 32 0.00055926 F4K180 1 11 16 0.00026426 F4JFV6 0 11 82 0.00237825 Q9SUS3 1 10 12 0.00014521 Q9SPK5 10 10 20 0.00034127

188 Q9SJT9 10 10 12 0.00010658 Q9SJL8 3 10 70 0.00194171 Q9SGR6 7 10 21 0.00041993 Q9MAQ0 10 10 12 0.00021282 Q9M9P3 10 10 25 0.00057666 Q9M1H3 10 10 11 0.00016459 Q9LUT2 3 10 25 0.00068818 Q9LMQ2 10 10 81 0.00339639 Q9LKA3 0 10 25 0.00079312 Q9FMU6 9 10 13 0.00037503 Q93Z18 9 10 14 0.00036495 Q8W112 10 10 14 0.00024271 Q8VZ10 10 10 12 0.00012305 Q8RXA7 1 10 11 0.00010025 Q43727 10 10 15 0.00028172 Q43316 10 10 63 0.00178414 Q42522 5 10 47 0.00107723 Q42029 1 10 76 0.00312615 Q39161 10 10 18 0.0003323 Q01908 10 10 77 0.00223323 P92549 0 10 73 0.00155764 P56785 10 10 11 6.66E-05 P53496 2 10 62 0.00177911 P46283 10 10 62 0.00170668 P42731 10 10 17 0.00029238 P29197 5 10 29 0.00054372 P25851 10 10 73 0.00189382 P25819 1 10 192 0.00422171 O04487 8 10 17 0.00044422 F4JAF3 0 10 46 0.00137089 F4IX26 1 10 86 0.00297239

189 F4IMB5 0 10 73 0.00101637 Q9ZT91 5 9 33 0.00078634 Q9ZP06 2 9 24 0.00076139 Q9XF89 9 9 91 0.00351589 Q9SRZ6 9 9 36 0.00094988 Q9SK50 9 9 12 0.00024085 Q9SD76 8 9 15 0.00019295 Q9SCW1 8 9 9 0.00011495 Q9S791 9 9 10 0.00017735 Q9M8D3 9 9 9 6.92E-05 Q9LXC9 9 9 15 0.00054091 Q9LV35 9 9 23 0.00040857 Q9LIB2 8 9 13 0.00014619 Q9LDZ0 8 9 14 0.00022207 Q9FN05 9 9 9 0.00010571 Q9FMM3 9 9 9 5.68E-05 Q9FLQ4 6 9 11 0.00025646 Q9FLG1 9 9 13 0.00017938 Q9CA67 9 9 17 0.00039381 Q96533 1 9 37 0.00105612 Q96293 1 9 74 0.00212345 Q94KE3 9 9 37 0.00075953 Q93ZT6-2 0 9 16 0.00022305 Q93ZT6 0 9 16 0.00022191 Q8VYK6 0 9 31 0.00128001 Q8RWN9 9 9 16 0.00032113 Q8L611 0 9 19 0.00018618 Q84VW9 1 9 61 0.00068172 Q42560 1 9 21 0.00025299 Q42472 9 9 28 0.00061317 Q42029-2 0 9 30 0.00148193

190 Q05758 9 9 11 0.00020135 Q04836 1 9 51 0.00167697 P53494 1 9 61 0.00175041 P53492 2 9 69 0.00197998 P43286 8 9 51 0.00192238 P42799 4 9 56 0.00127809 P34791 0 9 85 0.00353669 P17745 5 9 96 0.00218181 O82491 9 9 10 0.00010073 O81742 4 9 10 0.00012114 O65581 5 9 36 0.00108786 O23654 9 9 40 0.00069458 O22263 1 9 26 0.00077914 O04499 8 9 28 0.00054382 F4KG14 9 9 12 0.00011998 F4K4Y5 9 9 10 0.00013905 F4JXW9 9 9 15 0.00016525 F4JLP5 9 9 13 0.00024803 F4J110 0 9 19 0.00018788 Q9ZVD5 8 8 8 9.37E-05 Q9ZVA4 8 8 9 0.00022078 Q9ZUY6 3 8 13 0.00036153 Q9ZUC1 8 8 18 0.00050447 Q9ZU23 8 8 13 0.00019265 Q9SYT0 8 8 21 0.00071666 Q9SRH5 8 8 11 0.00043116 Q9SIV2 8 8 11 0.00013356 Q9SIV0 2 8 8 0.00018733 Q9SIU0 8 8 10 0.00017365 Q9SFH9 8 8 19 0.00047801 Q9SDM9 0 8 26 0.00059845

191 Q9S7Y7 8 8 14 0.00016552 Q9MB58 7 8 8 0.00011632 Q9M9K1 7 8 15 0.00028977 Q9M1R2 8 8 16 0.00032658 Q9LZQ4 8 8 10 8.82E-05 Q9LVJ1 7 8 14 0.00019492 Q9LQQ3 8 8 13 0.00039504 Q9LIK9 8 8 15 0.00035048 Q9LF37 8 8 9 0.00010058 Q9LD55 8 8 9 9.86E-05 Q9FZ76 5 8 29 0.00134646 Q9FVT2 6 8 15 0.00039291 Q9FKA5 8 8 13 0.00036912 Q9C8P0 8 8 22 0.00051183 Q9C5X9 8 8 14 8.92E-05 Q96528 3 8 150 0.00329821 Q96242 7 8 19 0.0003968 Q94BT0 6 8 15 0.00015558 Q944K2 8 8 15 0.00037133 Q0WM29 1 8 10 0.00017822 Q04836-2 0 8 50 0.00171716 P93819 8 8 86 0.00280229 P55229 7 8 14 0.00029014 P55228 7 8 53 0.00110262 O82662 7 8 12 0.00030836 O82462 8 8 10 0.00015046 O24653 4 8 10 0.00024365 O24456 1 8 22 0.00072782 F4JPD8 2 8 8 0.00018532 F4IX28 0 8 43 0.00179606 F4IL52 1 8 26 0.00087081

192 F4IAH9 2 8 26 0.00087351 F4I3R0 0 8 9 9.86E-05 F4I2F8 1 8 10 0.00027113 F4I116 8 8 13 0.00012891 B9DFG0 1 8 9 0.00015857 B3H6B0 1 8 13 0.00030441 Q9ZUU4 4 7 32 0.00119785 Q9ZU25 1 7 18 0.00038713 Q9ZP05 0 7 12 0.00036672 Q9XF91 6 7 20 0.00081646 Q9SRG3 4 7 11 0.00023425 Q9SIP7 1 7 27 0.00116836 Q9SHI1 6 7 8 8.44E-05 Q9SHE8 7 7 130 0.0063636 Q9SFB1 1 7 21 0.00062241 Q9SEI2 7 7 9 0.00022963 Q9SAU2 7 7 15 0.00057748 Q9SAJ4 5 7 32 0.00086329 Q9S762 7 7 8 0.00021057 Q9M339 2 7 27 0.00117305 Q9M2F9 6 7 17 0.00028469 Q9M0S5 7 7 9 0.00012744 Q9LYE7 7 7 11 0.00032513 Q9LXG1 1 7 49 0.00267721 Q9LW57 7 7 26 0.00099039 Q9LST0 7 7 8 0.00018144 Q9LPG6 5 7 7 0.00011353 Q9LJE5 0 7 8 0.00012975 Q9LIA8 1 7 9 0.00020284 Q9LH76 5 7 12 0.00019551 Q9FXA2 7 7 8 0.00012898

193 Q9FN48 7 7 19 0.00053112 Q9FM01 3 7 10 0.00022538 Q9FJZ7 7 7 10 0.00014348 Q9FJA6 1 7 27 0.00117778 Q9FDZ9 1 7 35 0.00230875 Q96291 4 7 104 0.00422964 Q94JQ4 7 7 8 0.00046281 Q94EJ6 7 7 7 0.00012194 Q94AR8 7 7 13 0.0002763 Q944P7 3 7 13 0.00024123 Q93YU5 7 7 9 9.25E-05 Q8W585 4 7 12 0.00018951 Q8S9L5 7 7 10 0.00019777 Q8GUM2 6 7 11 0.00017449 Q8GUK4 7 7 8 0.00011298 Q84WV1 7 7 9 0.00017543 Q5S1W2 7 7 7 0.00012923 Q43291 1 7 34 0.00224278 Q41932 6 7 46 0.00216362 Q38933 3 7 8 0.00017274 P92948 7 7 8 0.00010254 P56774 7 7 13 0.00087897 P56761 7 7 314 0.00962292 P51430 1 7 25 0.00108616 P48491 7 7 15 0.00063887 P46644 7 7 10 0.00024094 P33207 7 7 12 0.00040695 P31167 7 7 31 0.00088021 P29513 3 7 30 0.00072281 P24636 4 7 34 0.00082841 P21218 7 7 19 0.00051258

194 P16127 7 7 18 0.00045926 O82660 7 7 30 0.00080532 O81644 6 7 17 0.00018843 O49203 6 7 7 0.00031818 O49160 7 7 7 8.41E-05 O48963 6 7 8 8.69E-05 O48741 0 7 9 0.0002428 O22785 0 7 11 0.00022667 O04603 7 7 13 0.00053678 O04309 2 7 17 0.00040778 F4JDC3 0 7 8 0.00012995 F4J5F4 6 7 7 0.00014848 F4IKG5 7 7 8 0.00011791 F4IFG2 1 7 9 0.00012035 F4IFG1 1 7 9 0.00012482 B3H5Y0 0 7 19 0.00025855 A8MS49 1 7 17 0.0002048 Q9XGM1 6 6 6 0.00024869 Q9XF87 1 6 297 0.01207888 Q9SZX9 1 6 45 0.00250936 Q9SY97-2 1 6 15 0.00074437 Q9SMT7 6 6 7 0.00014733 Q9SHR7 1 6 297 0.01212446 Q9SE60 6 6 26 0.00047512 Q9S831 5 6 23 0.00173998 Q9S714 5 6 18 0.00134294 Q9LZ82 0 6 11 0.00038019 Q9LXZ4 6 6 7 0.00021761 Q9LV21 6 6 7 0.00014128 Q9LR75 6 6 56 0.00156947 Q9LQK7 6 6 8 0.0001822

195 Q9LNU4 6 6 8 0.00017735 Q9LFD5-3 1 6 6 0.00025256 Q9LF33 1 6 8 0.0001803 Q9LEX1 6 6 8 0.0001697 Q9FYA6 3 6 10 0.00026068 Q9FNF2 6 6 7 0.00011615 Q9FMF7 6 6 26 0.00049959 Q9FM97 6 6 11 0.00023895 Q9FI53-2 1 6 12 0.00025454 Q9C9I7 6 6 14 0.00052771 Q9C827 0 6 6 7.01E-05 Q94AW8 1 6 21 0.00054091 Q944I4 0 6 10 0.00023724 Q940I2 6 6 10 0.00031912 Q93Z70 6 6 12 0.00032373 Q93W02 6 6 7 0.00014535 Q93VG5 6 6 18 0.00087715 Q8LA13 4 6 10 0.00017677 Q8L7K9 6 6 6 0.00010693 Q8L7B5 0 6 25 0.00046231 Q8L636 6 6 7 0.00012945 Q8H112 6 6 6 0.00020034 Q8GWP4 6 6 11 0.00056937 Q84W89 4 6 10 0.0001709 Q56YA5 6 6 26 0.00070142 Q42533 0 6 13 0.00050227 Q42479 6 6 10 0.0002045 Q42262 6 6 34 0.00140388 Q39085 6 6 9 0.00017355 Q39054 6 6 8 0.00012917 Q1WIQ6 0 6 25 0.00054527

196 Q08682 1 6 20 0.00072605 Q01525 2 6 50 0.00208844 P93306 6 6 6 0.00016474 P93025 0 6 16 0.00018917 P93014 6 6 6 0.00021422 P60040 6 6 21 0.00093876 P55826-2 0 6 21 0.00044897 P55826 0 6 21 0.00042306 P51414 6 6 15 0.00111145 P49209 1 6 45 0.00250936 P49107 1 6 61 0.0038591 P47998 6 6 7 0.00023518 P43297 5 6 39 0.00091322 P42734-2 1 6 7 0.00024349 P42699 6 6 57 0.00369241 P42643 0 6 55 0.00222845 P37107 6 6 8 0.00015345 P34795 6 6 15 0.00028977 P0DKC4 1 6 29 0.00086665 O82533 6 6 11 0.00024895 O24457 6 6 8 0.00020221 O23593 6 6 8 0.0002404 O22203 6 6 14 0.00029814 F4K5B9 6 6 8 0.00019021 F4K0E8 0 6 7 0.0001022 F4JYE1 1 6 10 0.0002168 F4J1E5 0 6 6 6.98E-05 F4IY44 3 6 10 0.00021988 F4I7I0 6 6 10 0.00019923 F4HQD5 1 6 18 0.00023433 B9DFF8 1 6 61 0.00154545

197 B3H725 0 6 7 0.00010562 B3H658 1 6 10 0.00026321 Q9ZVS5 5 5 9 0.00022434 Q9ZVL6 5 5 14 0.00053142 Q9ZPI6 5 5 7 0.00010503 Q9XI22 3 5 5 0.00016243 Q9SYP2 4 5 8 0.00014095 Q9SYM5 2 5 10 0.00016171 Q9SUI4 5 5 154 0.00760727 Q9STT3 5 5 5 0.00015109 Q9STS7 5 5 10 0.00030646 Q9SSS7 3 5 5 0.0001577 Q9SJE1 5 5 11 0.00015658 Q9SIZ2 4 5 9 0.00028303 Q9SGE0 1 5 6 0.00016686 Q9SEU8 1 5 11 0.00063978 Q9SCY2 5 5 10 0.0005201 Q9S7Z8 5 5 6 0.00010142 Q9S7J7 0 5 296 0.01208364 Q9S7B5 5 5 6 0.0001234 Q9S757 5 5 18 0.00052915 Q9M356 5 5 6 0.00013439 Q9M336 1 5 7 0.00025583 Q9M2U7 5 5 10 0.00025454 Q9M1S4 0 5 5 6.83E-05 Q9LZH9 1 5 6 0.00025355 Q9LVT8 1 5 9 0.00027273 Q9LV33 4 5 6 0.00012677 Q9LQ04 4 5 11 0.00039535 Q9LFX8 5 5 6 0.00015454 Q9LF41 5 5 6 6.25E-05

198 Q9FZE1 3 5 7 0.00015744 Q9FXI5 5 5 5 6.81E-05 Q9FWA3 5 5 8 0.00017808 Q9FVR6 5 5 5 0.00018274 Q9FND0 1 5 7 0.00016828 Q9FJF1 1 5 9 0.00045076 Q9FGY1 5 5 5 6.99E-05 Q9FFN4 5 5 5 7.53E-05 Q9FFJ2 5 5 8 0.00031935 Q9FFE0 2 5 7 0.00045619 Q9FE65 1 5 10 0.00090909 Q9C9C6 0 5 28 0.00130003 Q9C9C5 0 5 28 0.00130003 Q9C4Z6 2 5 5 0.00016592 Q9ASS2 5 5 5 9.00E-05 Q96327-3 0 5 6 0.00016187 Q96327 0 5 6 0.00016558 Q94K71 5 5 16 0.0005426 Q94C48 1 5 10 0.00024755 Q94BS2 5 5 5 0.00016146 Q940P8 5 5 5 0.00010264 Q940B0 1 5 14 0.00080991 Q93Y40 5 5 7 0.0001657 Q93VT9-2 1 5 11 0.00073006 Q93VT9 0 5 11 0.00054091 Q8W4M5 5 5 9 0.00017202 Q8VYM4 5 5 10 0.00042759 Q8L7C9 5 5 22 0.00109677 Q8GXR9 2 5 5 0.00010422 Q8GSJ1 5 5 5 0.00013097 Q84XU2 2 5 6 0.00012065

199 Q56Z59 5 5 6 0.00013247 Q42545 5 5 9 0.00022486 P83755 5 5 347 0.01063425 P82281 5 5 6 0.00018598 P62090 5 5 15 0.00200336 P56798 5 5 22 0.00109174 P56795 5 5 12 0.00081136 P49692 1 5 9 0.00037884 P48641 5 5 12 0.00026016 P42791 1 5 14 0.00080991 P42734 0 5 6 0.0001803 P41917 1 5 13 0.00063636 P41916 1 5 13 0.00063636 P38666 5 5 16 0.0010619 P32961 5 5 25 0.00078166 P29514 1 5 29 0.00069872 P25697 5 5 16 0.0004382 O82299 5 5 11 0.00038636 O82261 0 5 9 0.0001604 O80977 2 5 5 8.61E-05 O80934 5 5 9 0.00029958 O49299 5 5 16 0.0002969 O48549 2 5 19 0.00082218 O23715 5 5 10 0.00043446 O23144 5 5 7 0.00012374 O22607 5 5 5 0.00010669 O04983 1 5 11 0.0002216 F4K7E0 1 5 7 0.00019367 F4K2Y3 5 5 5 7.41E-05 F4JL11 5 5 5 0.0001011 F4JJ94 0 5 54 0.00183704

200 F4JIF9 1 5 42 0.00211331 F4J462 1 5 6 8.21E-05 F4II29 5 5 5 6.78E-05 F4I9X6 0 5 51 0.00172954 F4HQD4 0 5 17 0.00022131 B3H5L3 1 5 6 0.00013411 A8MS75 0 5 18 0.00091421 A8MRX4 1 5 9 0.00031922 Q9ZV36 2 4 6 0.00018924 Q9XJ36 4 4 6 0.00023265 Q9XFT3-2 3 4 27 0.00130982 Q9SW96 4 4 4 7.57E-05 Q9SW18 0 4 31 0.00107488 Q9SKI0 4 4 12 0.00044611 Q9SIH0 1 4 15 0.00108181 Q9SGS4 4 4 16 0.00057315 Q9SEU6 4 4 14 0.00078473 Q9S7Z3 4 4 6 0.00013383 Q9S7T8 4 4 5 0.00013834 Q9MA79 4 4 7 0.00022207 Q9M895 3 4 4 6.96E-05 Q9M591 2 4 19 0.00050255 Q9M0A7 3 4 13 0.00056254 Q9LYM8 1 4 6 0.00023689 Q9LX13 4 4 4 0.00019759 Q9LV77-2 0 4 9 0.00016816 Q9LV28 2 4 4 0.00013274 Q9LUG1 0 4 5 7.07E-05 Q9LP45 4 4 4 0.00010328 Q9LJG3 4 4 17 0.00046915 Q9LI77 4 4 8 0.00016116

201 Q9LHL7 1 4 8 0.0002404 Q9LFW1 2 4 5 0.00015025 Q9FJH0 4 4 6 0.00029912 Q9FH98 4 4 5 0.00012074 Q9FG67 4 4 6 0.00012828 Q9CAX6 1 4 18 0.00129817 Q9C5R8 1 4 59 0.00233798 Q9C5M0 4 4 11 0.00039933 Q9C524 4 4 6 0.00016903 Q93Z10 4 4 4 7.83E-05 Q93Y22 4 4 7 0.00014369 Q93VR3 4 4 6 0.00017217 Q93VP3-2 1 4 13 0.0010191 Q8W4E6 4 4 5 0.00014779 Q8W471 4 4 6 8.93E-05 Q8LDU4 4 4 10 0.00033913 Q8L831 4 4 7 9.81E-05 Q8H156 0 4 12 0.00058741 Q66GJ0 4 4 5 0.00010323 Q42524-2 1 4 4 8.83E-05 Q42351 0 4 9 0.00081136 Q42112 0 4 14 0.00047329 Q39258 4 4 26 0.00122292 Q39231 4 4 4 8.45E-05 Q39061 4 4 9 0.00029594 Q38799 4 4 10 0.00029802 Q08298 4 4 7 0.00019318 Q03250 0 4 64 0.00393386 Q02971 1 4 7 0.00021212 P93004 3 4 28 0.00108181 P82658 4 4 5 0.0002362

202 P56799 4 4 6 0.00032293 P56791 4 4 9 0.00035534 P56773 4 4 6 0.0003019 P56759 4 4 32 0.00188141 P55034 4 4 8 0.00022421 P49206 1 4 9 0.00074323 P47999 4 4 14 0.00038636 P46416 4 4 4 8.03E-05 P46248 0 4 5 0.00011941 P29402 4 4 8 0.00016329 P28493 4 4 5 0.00022632 P27521 4 4 7 0.0003017 O78310 4 4 4 0.00020034 O24633 0 4 41 0.00222886 O23254 4 4 9 0.00020672 F4JWF6 1 4 9 0.00020034 F4JBC9 1 4 7 0.00034897 F4J9U9 4 4 4 6.78E-05 F4IFC5 4 4 6 9.99E-05 F4I7X1 3 4 11 0.00021956 F4I1C1 0 4 6 0.0002586 A8MQR4 0 4 14 0.00052771 Q9SRT9 1 3 4 0.00012121 Q9SRI1 3 3 4 0.00014329 Q9SLA8 3 3 4 0.00011096 Q9SKU1 3 3 3 9.60E-05 Q9SJ66 3 3 4 0.00010254 Q9SID0 1 3 7 0.00023301 Q9SFF1 1 3 3 6.03E-05 Q9SF40 0 3 3 7.99E-05 Q9SF20 1 3 5 0.00035353

203 Q9SE45 3 3 3 0.0001011 Q9S7W4 3 3 4 0.00013153 Q9M8M7 3 3 13 0.00030774 Q9LYR4 3 3 4 9.88E-05 Q9LYK9 0 3 8 0.00066573 Q9LX65 3 3 8 0.00019625 Q9LVM5-2 3 3 3 0.00010435 Q9LV66 3 3 3 0.00019551 Q9LT08 0 3 3 0.00010537 Q9LNE4 0 3 7 0.0002195 Q9LNE3 0 3 7 0.00023017 Q9LIH9 3 3 3 5.71E-05 Q9LFH5 0 3 13 0.0008472 Q9FV52 3 3 6 0.0001759 Q9FPJ4 3 3 3 0.00016067 Q9FLW9 3 3 5 9.34E-05 Q9FJ95 3 3 4 0.00011888 Q9FGS0 3 3 5 0.00018716 Q9FF52 0 3 13 0.0008472 Q9FE78 2 3 4 0.00012579 Q9FE58 3 3 7 0.0006107 Q9C5C2 0 3 26 0.00051421 Q94K30 2 3 4 0.00014669 Q949U7 3 3 7 0.00032362 Q93ZN9 3 3 6 0.0001408 Q93VP3 0 3 12 0.00081646 Q8VZK6 3 3 3 7.94E-05 Q8VYF1 0 3 23 0.00121969 Q8RXN0 3 3 3 4.62E-05 Q8RXF8 3 3 3 5.01E-05 Q8RW90 3 3 5 0.00012848

204 Q8LPJ7 0 3 8 0.00065071 Q8LF99 2 3 4 0.00014819 Q8LDQ8 3 3 4 0.00057697 Q7Y1W1 3 3 3 6.16E-05 Q6TBX7 3 3 3 6.02E-05 Q6GKU7 3 3 3 6.30E-05 Q56WH4 1 3 6 0.00021212 Q42523 3 3 3 4.42E-05 Q39099 3 3 8 0.00029238 Q39048 3 3 3 7.71E-05 Q2HIR7 1 3 4 0.0001513 Q0WVJ0 3 3 11 0.00016976 P94072 3 3 10 0.00051271 P62126 3 3 4 0.00035181 P59259 3 3 3 0.00031509 P56753 3 3 8 0.00022022 P54150 3 3 10 0.00041931 P51418 3 3 10 0.00060776 P51413 3 3 6 0.00037091 P51412 3 3 22 0.00108181 P49200 3 3 48 0.00418766 P42804 3 3 3 5.98E-05 P42795 0 3 31 0.00184265 P31265 3 3 6 0.00038636 P26569 3 3 4 0.00015851 P24704 3 3 32 0.0022775 P09468 3 3 3 0.00024587 O49344 1 3 5 0.00043272 O48737 2 3 5 0.00030218 O23714 1 3 40 0.0021212 O04209 3 3 5 0.00020965

205 O04204 1 3 13 0.00044365 F4KIB2 3 3 4 6.68E-05 F4KBK9 1 3 4 0.0001004 F4JTH0 0 3 4 9.66E-05 F4JD57 1 3 3 7.76E-05 F4J9K9 3 3 4 6.43E-05 F4J8X6 2 3 3 5.53E-05 F4J8L7 0 3 7 0.00023591 F4ISP6 1 3 6 0.00016391 Q9ZSR7 0 2 4 0.00010554 Q9ZQ24 2 2 3 0.00017735 Q9XIB5 2 2 2 9.57E-05 Q9XI93 2 2 4 0.00027918 Q9XFM6 2 2 2 9.83E-05 Q9SQT8 2 2 5 8.97E-05 Q9SMX3 2 2 4 0.00015793 Q9SK22 0 2 4 0.00029639 Q9SF53 0 2 4 0.00035181 Q9SDS7 2 2 2 5.77E-05 Q9SCX3 2 2 20 0.0009659 Q9S7N7 2 2 3 0.00020284 Q9LXQ2 2 2 5 0.00035586 Q9LT39 2 2 18 0.0005335 Q9LK96 2 2 3 8.87E-05 Q9LFS3 2 2 3 0.0001211 Q9FMT1 0 2 2 5.29E-05 Q9FGT8 2 2 6 0.00034897 Q96255 2 2 3 7.55E-05 Q94A94 1 2 4 8.85E-05 Q949X7 1 2 4 8.94E-05 Q941D3 0 2 2 9.05E-05

206 Q8VYJ4 1 2 2 4.43E-05 Q8LER3 1 2 3 0.00011077 Q8GYN9 2 2 4 0.00012841 Q6DYE4 2 2 2 4.76E-05 Q56XG6-2 1 2 7 0.00036407 Q56WH4-2 0 2 5 0.00017735 Q42589 2 2 8 0.00073343 Q42586 2 2 3 6.82E-05 Q3E902 0 2 5 0.00065964 Q39249 2 2 2 4.68E-05 Q39242 2 2 2 5.65E-05 Q39041 2 2 7 0.00011405 P92963 2 2 2 0.00010254 P92959 2 2 6 0.00032782 P82715 2 2 6 0.00021855 P56802 2 2 16 0.00125428 P49693 2 2 3 0.00015603 P46421 2 2 2 9.66E-05 P43333 2 2 2 8.69E-05 P42763 2 2 5 0.00029238 P42733 1 2 7 0.00047627 P39207 2 2 16 0.00116168 P38605 2 2 4 5.70E-05 P31169 2 2 4 0.00065564 P16181 1 2 9 0.00060852 P16180 2 2 5 0.00036302 O80840 2 2 6 0.00026386 O80526 2 2 6 0.00015309 O80448 2 2 11 0.00038511 O65660 2 2 3 0.00017931 O48593 2 2 3 5.72E-05

207 O23647 2 2 2 2.52E-05 F4JY76 2 2 2 4.21E-05 F4I615 0 2 5 0.00033389 A8MR47 0 2 2 7.67E-05

208 Table 2.C. List of proteins and their spectral count of the FL samples.

Protein ID # Unique Total # of Total Total NSAF peptides peptides spectral count (%)

O03042 71 74 6486 0.15061313 Q9ZNZ7 0 36 137 0.000939488 Q9STW6 14 35 225 0.003485615 Q9LTX9 11 31 212 0.003284224 P25857 21 30 489 0.012168099 P10896 4 29 337 0.007908115 Q8RWV0 0 28 612 0.009186596 P21240 7 28 263 0.004875576 P10896-2 5 27 207 0.003863185 Q944G9 10 27 404 0.011290669 Q9LJE4 2 27 335 0.008354709 P19366 24 25 499 0.010947476 P56757 24 25 579 0.012932147 O50008 9 24 131 0.001568473 Q9FI56 11 24 308 0.004478274 Q56WK6 20 23 89 0.001727654 P38418 23 23 139 0.001725553 Q9SJU4 3 22 352 0.00981276 P22953 7 21 128 0.002131351 Q39043 3 21 312 0.010267372 P25858 7 21 176 0.003007136 O81283 21 21 25 0.000185013 O65719 20 20 91 0.001062111 P25856 5 20 428 0.012021813 Q9SZD6 6 20 146 0.002502243

209 P23321 0 19 300 0.009872473 P51818 17 19 550 0.008156857 Q9FX54 1 19 98 0.001559446 P56766 0 19 99 0.001575359 P55737 6 19 343 0.011491519 C0Z361 3 19 182 0.003390927 P21238 5 18 201 0.00292251 Q9SRV5 9 18 46 0.001275954 Q94B78 5 18 296 0.00994684 Q9LPW0 17 18 20 0.000100752 Q9SAJ4 0 18 346 0.009645497 Q9LV03 10 18 139 0.001490931 O80860 18 18 84 0.001594421 Q9S841 12 18 53 0.000848228 P56778 16 17 42 0.000333928 Q5GM68 15 17 43 0.000496665 Q9SAC6 14 17 41 0.000667705 Q56ZI2 17 17 507 0.011922524 Q9LF98 8 16 120 0.003413704 Q9LD57 13 16 47 0.000716137 P50318 16 16 31 0.000234726 P56777 7 16 107 0.003324468 P20649 5 16 123 0.00284434 Q42547 1 16 111 0.002509454 F4JKH6 16 16 442 0.009677874 Q9XIE2 2 16 111 0.002582953 Q9ZU23 16 16 46 0.00066449 P31414 5 16 31 0.000363343 Q9ZU52 15 16 39 0.000238481 O80988 2 15 63 0.001614627 Q0WLB5 2 15 37 0.000241662

210 Q9LFA3 3 15 24 0.000281595 F4JAF3 7 15 97 0.001033458 P19456 0 15 123 0.003768946 Q9SJQ9 3 14 82 0.002547723 Q9S7H1 5 14 142 0.007593577 Q0WNJ6 14 14 20 0.00030769 Q9FKW6 14 14 140 0.006035729 Q43127 11 14 93 0.002873438 B3H5S2 14 14 338 0.008743185 B9DG18 14 14 21 0.00010363 P10795 1 14 33 0.000215284 Q9LMQ2 14 14 49 0.001149845 P42799 5 14 803 0.049620878 Q38970 0 14 107 0.002453937 Q9M1H3 0 14 967 0.057827568 Q8LPR9 13 13 80 0.001721158 Q9SZJ5 13 13 59 0.000778477 Q9ASR1 12 13 20 0.0002508 O23255 7 13 18 0.000292283 O65282 13 13 24 0.000262748 F4IMB5 13 13 19 0.000329699 P92549 12 13 19 0.000251292 F4JVN6 2 13 105 0.002303577 Q94A41 13 13 43 0.001890468 F4IXW2 13 13 38 0.000700951 O49485 13 13 121 0.002775013 Q8W585 13 13 34 0.000274045 F4HS98 13 13 15 9.59E-05 Q8H0U5 3 13 144 0.002161552 Q0WUY5 1 13 104 0.001488791 F4IW47 1 13 18 0.000112039

211 Q9STF2 12 12 29 0.000632484 Q9SI75 12 12 20 0.000284112 P46283 5 12 46 0.001009186 P25819 12 12 129 0.003534151 Q9LYA9 12 12 28 0.000288374 Q8VZ10 9 12 16 0.00026095 Q9M5K3 0 12 24 0.000265096 Q8VZG7-2 12 12 14 0.000147604 P34791 12 12 47 0.002066326 F4IX26 3 12 153 0.004514103 P53492 12 12 61 0.001726469 Q8VYM4 0 12 124 0.005304809 Q9LDZ0 0 12 130 0.002939 Q9LJL3 0 12 124 0.00440655 Q9LR30 5 11 89 0.003425418 Q9LR30-2 11 11 16 0.000280706 Q8VZF3 2 11 120 0.006542933 P56767 1 11 13 0.000182574 O65581 11 11 12 0.000108782 Q944P7 2 11 32 0.000439427 Q9SPK5 0 11 14 0.000115864 P25696 0 11 53 0.001336776 P54609 0 11 53 0.00122561 F4IX28 11 11 21 0.000236659 P42731 9 11 18 0.000298381 Q9LZF6 11 11 11 7.14E-05 Q96293 3 11 24 0.000704358 Q9ZUU4 0 11 169 0.004986166 O82660 5 11 20 0.000381578 Q96533 0 11 13 0.000150624 Q9LZQ4 11 11 12 0.000144768

212 P53494 10 11 128 0.001939703 P36428 2 11 20 0.000274981 Q9FXA2 1 11 150 0.004425591 Q9LD55 9 11 19 0.000335988 Q9SA56 0 11 16 0.000177435 Q9LTT8 11 11 43 0.001077226 O81645 11 11 68 0.001876831 F4KHD5 6 11 30 0.000345792 Q9M1S4 6 11 60 0.001864188 F4J9K9 11 11 14 5.39E-05 Q8GZQ3 11 11 13 0.000214857 Q9FMM3 1 11 64 0.002748537 F4HQD4 9 10 12 0.000294 F4HQD5 9 10 108 0.004290295 Q9C5A9 3 10 31 0.000680104 Q9XF89 10 10 21 0.00050125 P32961 7 10 16 0.000193443 Q9FH02 5 10 125 0.003366521 P17094 10 10 14 0.0001231 Q9LQ55 10 10 41 0.000647788 Q9M158 1 10 39 0.000776022 P53496 10 10 15 0.000158447 O49006 5 10 13 0.000332411 Q9ZT91 2 10 20 0.000380273 Q9FVT2 7 10 15 0.00024464 Q42262 1 10 23 0.000976445 Q9M5K2 0 10 149 0.004396087 Q9FIH8 10 10 21 0.000675095 Q8GUM2 10 10 54 0.001544065 P16127 10 10 49 0.001285439 Q93YU5 9 10 57 0.001070963

213 Q93WJ8 0 10 21 0.000281086 Q8L7B5 0 10 21 0.000281086 Q43316 1 9 23 0.000510636 Q07473 1 9 26 0.000351394 P30184 9 9 13 0.000190262 O04603 7 9 15 0.000485014 P83755 8 9 12 0.000130093 P25851 9 9 24 0.000493441 Q9SHI1 9 9 47 0.001383017 O65396 0 9 24 0.000461056 Q9SA52 2 9 13 0.00021679 Q9SJE1 8 9 10 9.16E-05 Q93ZN9 1 9 22 0.000933991 P17745 9 9 29 0.000699711 Q9STX5 8 9 10 0.000183245 Q8L7K9 9 9 11 0.00020915 P54888 0 9 15 0.000151128 O24456 9 9 78 0.002271186 Q05758 7 9 197 0.00755596 O04487 9 9 43 0.000809287 Q9LV77-2 1 9 14 0.000170188 F4J110 9 9 290 0.009137864 Q8L611 2 9 17 0.000260456 Q9CAV0 8 9 35 0.001356462 Q9XI01 3 9 17 0.000363636 Q8L636 9 9 131 0.003494271 Q9SGR6 8 9 178 0.004159436 Q9SIZ2 6 9 27 0.000307706 P93025 9 9 47 0.001281324 Q9LJE5 9 9 9 0.000133298 O81644 0 9 46 0.001564701

214 P43286 9 9 13 0.000236273 O22607 9 9 10 0.000219388 O23144 9 9 45 0.001910437 O48802 4 9 35 0.000940349 Q9LD60 0 9 15 0.000152509 Q39141 8 8 12 0.000345792 P56771 8 8 10 9.32E-05 Q39142 4 8 24 0.000163875 O23654 8 8 13 0.000250605 Q9SR13 4 8 14 0.000189673 Q9LX99 1 8 11 0.000120189 B9DFG0 0 8 190 0.007974971 Q9SHR7 8 8 19 0.000339224 Q9T0P4 8 8 18 0.000357525 Q01908 2 8 17 0.000548089 Q9LW57 1 8 12 0.000104851 P42644 8 8 40 0.001566618 Q93VB8 1 8 26 0.000654293 O22263 8 8 61 0.001757778 F4I3R0 8 8 8 8.73E-05 Q8RWN9 8 8 14 0.000336332 Q9LR75 7 8 21 0.000414889 Q94BS2 1 8 10 0.000156222 Q8H1E2 0 8 16 0.000104872 Q9LVL7 8 8 14 0.0003178 Q9ZUC1 8 8 25 0.000536824 P29402 8 8 9 0.000298826 Q9C5Z1 6 8 15 0.000137208 Q96242 1 8 11 0.00043082 Q9LZG0 8 8 11 0.000227 F4I116 1 8 28 0.000703033

215 F4IDH2 0 8 194 0.008112253 Q9C5X9 0 8 196 0.008226812 Q9ZTZ7 8 8 15 0.000508673 Q96529 0 8 94 0.00331924 Q9M9K1 0 8 94 0.003177996 Q9SCY0 8 8 39 0.001162993 Q04836 8 8 77 0.002676469 Q04836-2 1 8 30 0.001308587 Q9FMF7 8 8 11 0.000230854 F4JDC3 8 8 28 0.000499909 Q38884 2 8 26 0.000801102 Q9LIK9 8 8 13 0.000255024 F4JLP5 1 8 12 0.000200414 F4I420 8 8 11 5.69E-05 Q9SJF0 0 8 16 0.000102222 F4IIM1 7 8 9 7.74E-05 Q9SJT7 1 8 13 0.000146503 Q94A40 8 8 9 9.18E-05 Q9LM78 0 8 16 0.00028985 Q9SRZ6 7 7 28 0.000619172 Q9M9P3 5 7 10 0.000419735 Q42029 1 7 189 0.007903174 F4K0E8 7 7 51 0.001383591 P55228 7 7 7 0.000216883 Q9S7J7 2 7 55 0.001568626 Q9XF87 0 7 33 0.001468234 Q9SD76 7 7 17 0.000518057 P49688 1 7 16 0.000517348 Q9LX99-2 7 7 15 0.000198389 Q9S757 0 7 189 0.007932998 Q9S714 7 7 12 0.000253756

216 Q9FLT0 7 7 9 0.00027203 Q8L8Y0 5 7 24 0.001841046 Q9C4Z6 4 7 16 0.000379462 Q9LF33 0 7 33 0.001474131 Q9LEX1 7 7 49 0.001028352 P52901 0 7 11 9.60E-05 P42795 7 7 8 0.000122567 Q9LKA3 6 7 19 0.000271991 Q96528 5 7 11 0.000200908 Q9M1R2 2 7 8 0.000288909 Q9SF85 0 7 29 0.000945943 P62090 7 7 12 0.000278075 Q9XF91 7 7 9 0.000196288 P34795 3 7 19 0.000509245 Q9SJL8 3 7 16 0.000180678 Q9LVJ1 0 7 13 0.001215116 Q9C8P0 7 7 30 0.000717612 A8MS49 3 7 8 0.000146355 O04316 2 7 12 0.000409435 Q9ZU25 2 7 51 0.001152992 Q9M339 1 7 10 0.000254531 Q9C522 1 7 19 0.000272341 Q9SFB1 1 7 19 0.000270945 Q93ZT6 3 7 11 0.000149029 Q93ZT6-2 7 7 27 0.000341662 Q39085 0 7 10 0.000391654 Q9FE65 7 7 7 0.000150021 Q9SIP7 7 7 12 0.000148637 Q9SKK4 1 7 19 0.000965008 Q42560 1 7 197 0.008331667 P17562 7 7 10 0.000198271

217 Q9LW85 7 7 29 0.003982304 O22993 6 7 23 0.000491978 Q42029-2 5 7 12 0.000343126 F4IFM7 2 7 26 0.001014729 Q9S7B5 6 7 9 0.000222955 Q9LT08 1 7 24 0.001466767 Q8VZH2 7 7 10 0.000198625 Q94C48 2 7 54 0.001528349 Q9LV35 6 7 10 0.000117579 Q9FYA6 7 7 12 0.000183094 F4JFN3 1 7 16 0.000287509 Q8W4S4 0 7 18 0.000270194 O22899 4 7 24 0.000334107 Q8GXR9 0 7 9 0.00017718 P46644 1 7 12 0.000148637 F4JFV6 6 6 15 0.00112733 Q8W4E2 4 6 16 0.000457501 A8MQR4 0 6 15 0.000471313 Q39161 6 6 6 0.000100207 P93819 1 6 17 0.00058542 Q9CA67 1 6 15 0.000534759 Q9SW18 1 6 6 0.000102832 F4IS91 6 6 10 0.000135978 P21218 5 6 11 0.000240852 B3H725 4 6 10 9.13E-05 Q9LZ66 6 6 6 9.27E-05 Q9SE83 0 6 11 0.000593946 Q41932 0 6 7 0.000183634 Q42472 3 6 12 0.000146035 O22609 0 6 15 0.000354989 O23553 6 6 21 0.00104278

218 Q9STE8 6 6 9 0.000131202 F4IL52 6 6 8 0.000145875 Q9LXG1 6 6 15 0.000299005 Q9ZUY6 6 6 7 0.000121279 Q9LYG3 6 6 22 0.000416166 Q9FNB0 0 6 53 0.002977365 Q38854 1 6 11 0.000375315 O48741 1 6 60 0.001698166 Q9SJT9 6 6 7 0.000127432 Q9LUT2 1 6 7 0.000149445 P47999 2 6 6 6.54E-05 Q9SFU1 0 6 12 0.000296613 B9DFF8 3 6 7 5.64E-05 Q9FJA6 6 6 10 0.000141875 Q9FFJ2 0 6 32 0.001435224 O65572 3 6 7 0.000114839 Q93VG5 6 6 41 0.000589202 Q9ZP05 2 6 7 0.000128061 Q944I4 6 6 22 0.000902973 Q39258 6 6 30 0.000714539 O82261 6 6 6 7.96E-05 Q9SXS7 2 6 6 9.12E-05 Q39061 1 6 9 0.000219533 P31167 6 6 17 0.00055779 Q9SDM9 6 6 12 0.000253275 Q9FLG1 6 6 25 0.001252589 Q42351 0 6 29 0.000662354 Q9LT75 6 6 14 0.000240311 Q03250 1 6 13 0.000271802 Q8L835 1 6 6 5.99E-05 Q9FVP6 1 6 32 0.000720517

219 O22173 0 6 12 0.001112299 Q9LV28 5 6 30 0.001450824 O49160 6 6 23 0.001112299 O04019 6 6 25 0.00047453 Q9ZV24 6 14 0.000473 0.0881 Q9SEI2 6 7 0.000116 0.0358 Q94BZ7 6 6 9.31E-05 0.0321 Q9M084 6 39 0.002465 0.1705 Q84WU2 6 140 0.00469 0.1295 B3H658 6 10 0.000275 0.0322 Q9SCX3 6 13 0.000369 0.051 Q8RXF8 6 18 0.000525 0.042 Q9SRG3 6 15 0.000416 0.0973 F4K7E0 6 8 0.000147 0.056 Q9FND0 6 18 0.000372 0.026 Q9FGX1 6 7 8.65E-05 0.0356 Q9FGY1 6 31 0.00086 0.0499 F4JRX3 6 22 0.000447 0.0237 Q39054 6 25 0.000633 0.0888 Q9S791 6 13 0.000218 0.0211 Q93Y22 6 7 0.000184 0.0284 Q9SU25 6 6 5.58E-05 0.0134 F4KDH9 6 12 0.000341 0.0691 Q9SJD4 6 7 6.06E-05 0.0156 Q9SAB1 6 10 9.82E-05 0.0115 Q9ASZ4 6 38 0.001133 0.0777 F4J8L3 6 6 6.92E-05 0.0145 Q9FQ03 6 9 7.47E-05 0.0097 Q9FIB4 6 24 0.000826 0.13 P49243 6 50 0.001302 0.1194 Q940I2 6 17 0.000264 0.0488

220 F4JHQ0 6 18 0.000487 0.0706 Q9T0A0 6 7 0.000271 0.0697 Q96291 5 15 0.000385 0.0185 O04983 5 8 0.000118 0.0199 Q42112 5 15 0.000407 0.0341 P49107 5 27 0.000881 0.085 Q9XF88 5 9 0.000359 0.0394 Q9C5R8 5 34 0.001318 0.1115 Q9SFH9 5 30 0.002735 0.1967 O80585 5 7 0.000282 0.0507 Q9M8M7 5 6 0.00013 0.0447 O22886 5 9 0.000344 0.079 Q9SHE8 5 12 0.00015 0.0404 P56759 5 10 0.000742 0.18 P25697 5 22 0.001107 0.1131 O82299 5 13 0.000479 0.1358 Q8VYK6 5 8 0.000207 0.0372 F4K3R8 5 10 0.000576 0.0622 O80934 5 16 0.000301 0.0541 Q9ZSR7 5 32 0.002489 0.1818 Q38799 5 5 0.000155 0.0391 Q9C5C2 5 5 8.69E-05 0.0234 Q949U7 5 11 0.000378 0.037 F4IWV2 5 6 0.000106 0.0271 Q9STY6 5 5 0.000122 0.035 P50546 5 10 0.000208 0.043 Q9ZP06 5 5 0.000115 0.0414 P51430 5 17 0.00063 0.0733 Q8S9L5 5 14 0.000436 0.0504 Q9LV21 5 11 0.000228 0.0466 Q94AW8 5 6 8.72E-05 0.0248

221 Q9S831 5 17 0.000422 0.0268 Q9ZUF6 5 7 0.000113 0.0145 F4K409 5 6 7.81E-05 0.0175 F4K410 5 6 0.000103 0.0201 Q9FZ76 5 15 0.00028 0.052 P51413 5 7 0.000135 0.026 O48549 5 5 5.36E-05 0.0145 P56798 5 27 0.001289 0.0944 Q9LXC9 5 5 0.000118 0.0254 Q9LVT8 5 14 0.00028 0.0646 O24457 5 12 0.00089 0.18 Q94K71 5 20 0.000815 0.1538 Q02971 5 10 0.000203 0.0494 F4J3M2 5 28 0.001171 0.2256 Q93VI3 5 25 0.000528 0.0664 Q9SGS4 5 7 0.000244 0.0596 Q43291 5 5 0.000185 0.0498 Q8L7C9 5 12 0.000318 0.0952 Q9SKI0 5 42 0.001996 0.1581 Q9SIH0 5 5 0.000185 0.0867 O48844 5 12 0.000839 0.1195 Q94KE3 5 17 0.001074 0.1591 Q9SMT7 5 20 0.000274 0.0123 O49299 5 21 0.000892 0.1527 P82869 5 5 7.20E-05 0.0246 F4J9G2 5 18 0.000366 0.0731 P29513 5 6 8.77E-05 0.0263 Q9FVQ1 5 6 0.00011 0.0298 Q9XJ36 5 8 0.000382 0.0858 Q9SE60 5 5 6.31E-05 0.0125 Q9SIV2 5 9 0.000461 0.0553

222 Q8H103 5 8 0.000145 0.0359 Q8LPJ4 5 18 0.001221 0.1524 Q8VXX0 5 15 0.000596 0.1143 Q9SRH5 5 7 0.000106 0.0177 F4JYE1 5 6 0.000209 0.0625 Q9CAX6 5 10 0.000306 0.0606 Q8LD27 5 5 5.11E-05 0.0092 F4J1E5 5 8 0.000227 0.051 Q9M888 5 8 0.000249 0.0644 Q9LIK0 5 8 0.000422 0.0521 Q9S7Z8 5 5 0.000119 0.03 O24633 5 12 0.000884 0.2252 P05466 5 8 0.000443 0.1095 Q9SEU6 5 15 0.000765 0.1101 Q9M8T0 5 20 0.001209 0.163 P94072 5 26 0.001161 0.1888 P51414 5 13 0.00099 0.1644 P59223 5 21 0.001335 0.16 O23714 5 10 0.000104 0.0215 P56799 5 31 0.002016 0.1345 O04209 5 34 0.000842 0.0869 Q9LF41 5 33 0.000929 0.0759 F4JXW9 5 5 0.000107 0.0346 Q08298 5 11 0.000397 0.1201 Q93XM7 5 5 6.23E-05 0.0112 Q42533 5 9 0.000308 0.0985 F4IAX0 5 15 0.000281 0.0556 F4KGY8 5 21 0.000401 0.0686 O04309 5 5 5.54E-05 0.0149 Q8L7U5 5 36 0.001602 0.192 Q9M356 5 7 0.000391 0.0955

223 Q93VP3 5 6 0.000156 0.0607 Q9ZVS4 5 7 0.000382 0.0931 Q9S818 5 10 0.000282 0.0609 Q8LPT3 5 14 0.00029 0.0354 Q0WLC6 5 5 7.89E-05 0.017 Q9LJK5 5 12 0.000296 0.0687 Q8VZM7 5 6 0.000259 0.0581 F4J5T2 5 14 0.000399 0.1333 Q9LS42 5 10 0.000165 0.0133 Q9LFU1 5 14 0.00023 0.0133 Q9S6Z7 5 9 0.00033 0.033 B5X582 5 13 0.00029 0.0381 Q9LU10 5 6 6.80E-05 0.0112 Q9FZ33 5 7 0.000137 0.0316 Q94C69 5 6 9.73E-05 0.019 Q9LUG1 5 5 8.15E-05 0.0279 Q42523 5 24 0.000374 0.0182 F4JGR5 5 8 9.78E-05 0.0154 Q9LK35 5 8 9.57E-05 0.0215 O81742 5 8 8.75E-05 0.0226 O04310 5 18 0.000296 0.0295 F4J8L1 5 5 7.84E-05 0.0197 Q9SYI0 4 6 0.000259 0.0426 P57751 4 4 7.25E-05 0.0244 P56761 4 12 0.000131 0.0264 P43297 4 4 4.98E-05 0.0112 Q9M591 4 5 9.22E-05 0.0498 Q94AM1 4 7 0.000193 0.0769 P24636 4 5 0.000129 0.0301 Q9SGE0 4 5 0.00012 0.0541 Q42586 4 4 8.51E-05 0.044

224 Q9FZ47 4 8 0.00017 0.0211 P46645 4 12 0.000343 0.0977 Q9CAI7 4 13 0.000515 0.1495 F4I2F8 4 9 0.00019 0.0227 Q1WIQ6 4 9 0.000254 0.0406 O80448 4 7 0.000493 0.0696 Q9SAU2 4 9 0.000294 0.085 Q9MA79 4 14 0.000381 0.0587 P49200 4 4 0.000105 0.0235 Q9SN86 4 4 0.000128 0.0575 Q940B0 4 5 8.04E-05 0.0145 P42791 4 5 0.000161 0.0435 Q9C5M0 4 9 0.000834 0.1667 O23049 4 5 5.78E-05 0.0281 Q9SYP2 4 10 0.000168 0.0196 Q93Z70 4 7 0.000291 0.0448 Q43727 4 14 0.000537 0.0414 P59224 4 7 0.000263 0.0473 P54150 4 5 8.53E-05 0.0445 Q8H156 4 4 5.55E-05 0.0112 P41917 4 5 0.00011 0.0296 P41916 4 13 0.000416 0.0345 Q9FNF2 4 12 0.000193 0.0275 F4J8L7 4 49 0.001316 0.0966 O82291 4 4 7.21E-05 0.0243 Q9SGT7 4 11 0.000426 0.1394 Q9SA73 4 7 8.41E-05 0.0216 P33207 4 12 0.000448 0.0503 Q8W112 4 7 0.000106 0.0123 Q8W4M5 4 4 7.16E-05 0.0177 Q9FIG9 4 13 0.000139 0.0259

225 Q9C9I7 4 11 0.000155 0.0228 Q944K2 4 13 0.000331 0.0366 Q8LA13 4 11 0.000654 0.1283 Q9LV93 4 4 0.000111 0.0848 Q9SJ62 4 4 0.000107 0.0458 Q42545 4 6 0.000205 0.0736 O23653 4 7 0.000149 0.0614 P93014 4 13 0.000887 0.0613 Q93VR4 4 13 0.000657 0.0455 P38666 4 5 0.000359 0.0774 Q9LNE4 4 11 0.000887 0.1377 A8MQD9 4 10 0.000197 0.0565 Q9FG67 4 7 0.000125 0.0609 Q8LBP4 4 4 7.39E-05 0.0266 F4JIF9 4 5 0.000101 0.0164 O22203 4 6 0.000144 0.0238 Q93VT9 4 20 0.000363 0.0507 Q9C827 4 8 0.000226 0.0433 Q39099 4 4 0.000101 0.0362 Q9LFS3 4 16 0.000805 0.086 P92959 4 10 0.000343 0.1327 P28493 4 4 8.44E-05 0.0247 Q9FVR6 4 5 0.000108 0.0272 Q8H112 4 14 0.00027 0.066 Q93VT9-2 4 5 0.000585 0.1895 Q93W02 4 16 0.000374 0.0252 Q9S829 4 6 0.000154 0.0323 Q9SQT8 4 5 0.000112 0.0323 Q8H1Y0 4 4 0.000218 0.1176 Q9M2U7 4 8 0.000141 0.065 Q9LIB2 4 6 0.000225 0.1014

226 Q9LJW6 4 4 7.13E-05 0.0385 Q94EJ6 4 6 0.000135 0.0242 Q93XW5 4 4 0.000109 0.0367 F4JMJ1 4 24 0.000419 0.0204 Q9SIV0 4 4 4.67E-05 0.0189 O49629 4 5 0.000184 0.0627 O22785 4 14 0.000786 0.0606 Q93VP3-2 4 4 7.20E-05 0.034 O82762 4 10 0.000737 0.2252 Q9SAK4 4 13 0.000308 0.1106 Q9C9K3 4 299 0.009421 0.0907 Q94BT0 4 7 0.000149 0.0441 Q9LH76 4 12 0.000517 0.1279 Q9CAP8 4 36 0.003229 0.1935 Q9ZUC2 4 9 0.000247 0.0889 Q93Z18 4 10 0.000241 0.0346 Q9SUS3 4 11 0.000654 0.1283 Q43292 4 16 0.000805 0.086 Q39002 4 16 0.000805 0.086 Q9FFD2 4 40 0.00273 0.1718 Q9SIK1 4 6 0.000209 0.0502 P55231 4 5 0.000233 0.1255 F4JQE2 4 31 0.000777 0.0608 Q94KI8 4 6 0.000106 0.0206 Q8H1E3 4 8 0.000237 0.0293 F4J462 4 4 0.000144 0.0421 F4JD57 4 4 0.000144 0.0484 Q9LXZ4 4 5 0.000238 0.0769 Q0WQF7 4 4 8.18E-05 0.046 O48529 4 14 0.000698 0.0942 Q0WMY5 4 4 8.47E-05 0.04

227 P92935 4 10 0.000219 0.0197 Q1EBV7 4 4 8.92E-05 0.022 Q41188-2 4 12 0.000413 0.0372 O05000 4 5 7.87E-05 0.0339 Q7Y1W1 4 5 6.41E-05 0.0127 Q39256 4 4 6.26E-05 0.0352 F4K5T2 4 6 0.00031 0.0884 Q6GKU7 4 4 0.000106 0.0455 Q42525 4 9 0.000312 0.0872 Q8W033 4 5 7.03E-05 0.024 Q8W0Z9 4 29 0.000808 0.0501 F4JMF4 4 5 0.000214 0.0538 A8MS75 3 14 0.000359 0.0184 Q96327-3 3 3 5.64E-05 0.022 Q96327 3 6 0.000431 0.3871 Q9ZVS5 3 29 0.001446 0.157 Q9M292 3 3 8.38E-05 0.0302 Q56YA5 3 6 0.000211 0.0505 Q08682 3 8 0.000133 0.0194 Q94K05 3 6 0.000102 0.023 P48491 3 15 0.000742 0.0578 Q9XFT3-2 3 3 7.80E-05 0.0631 P42699 3 6 0.000221 0.1093 O23593 3 5 0.000172 0.0432 P49209 3 6 0.00021 0.0283 O82533 3 4 0.000132 0.0947 P49692 3 8 0.000609 0.1164 Q38814 3 10 0.000598 0.086 Q9SYT0 3 3 0.000129 0.0502 P42734-2 3 9 0.000247 0.0395 Q9FF52 3 3 6.88E-05 0.0454

228 P42734 3 17 0.001182 0.0688 Q03251 3 5 7.02E-05 0.0164 Q9C9P3 3 3 5.91E-05 0.046 Q9LFH5 3 4 0.000112 0.0476 Q9LT39 3 5 0.000256 0.0645 Q9S7N7 3 15 0.000533 0.0447 Q9LZX1 3 11 0.000335 0.0767 P56774 3 4 0.000176 0.0949 Q39041 3 6 0.0001 0.0195 Q9LHL7 3 12 0.000274 0.0574 P93031 3 4 0.000135 0.0456 F4I1C1 3 8 0.000247 0.0778 Q9FKA5 3 19 0.001273 0.1687 Q8W4D6 3 3 6.21E-05 0.0223 P93004 3 6 0.000181 0.0217 P56802 3 4 0.000119 0.0613 P56788 3 5 9.61E-05 0.0207 Q8GYC7 3 9 0.000263 0.0866 Q56WH4-2 3 10 0.000515 0.0556 Q56WH4 3 4 0.000239 0.0968 Q9FMU6 3 19 0.001273 0.1687 Q9SYM5 3 3 9.70E-05 0.0349 Q9SAB3 3 4 0.000107 0.053 Q9LZ82 3 11 0.000319 0.0495 O22229 3 8 0.000222 0.0424 Q93VR3 3 8 0.000227 0.0434 O48737 3 4 0.000151 0.0475 P0DKC4 3 10 0.000203 0.0364 Q94A68 3 3 7.58E-05 0.0568 Q9S7Z3 3 7 0.000207 0.0292 P39207 3 10 0.000159 0.0285

229 Q9XI93 3 3 7.11E-05 0.0256 Q8LBI1 3 7 0.000207 0.0637 Q9FJF1 3 5 9.30E-05 0.0284 Q9SMN0 3 8 0.000122 0.0399 Q9M1G8 3 3 6.84E-05 0.0369 Q9FGT8 3 4 4.39E-05 0.0227 P82658 3 52 0.001922 0.0532 Q94F09 3 6 0.000262 0.0471 Q9SEU8 3 5 0.000194 0.0906 P51418 3 3 3.78E-05 0.0204 Q9LNE3 3 3 0.000107 0.0543 Q94K30 3 4 0.000627 0.2254 Q9SK22 3 3 7.11E-05 0.0299 Q9LNU4 3 4 0.000103 0.0278 Q9SKU1 3 24 0.000666 0.0474 Q9SE96 3 10 0.000365 0.0328 Q949P2 3 10 0.000363 0.0327 Q9ZPS7 3 4 6.70E-05 0.0241 O24466 3 44 0.001402 0.0372 Q6ICX4 3 3 0.000136 0.0571 P56753 3 9 0.000336 0.0705 Q8LAD0 3 22 0.001448 0.1243 Q8LAA6 3 5 0.000267 0.0769 Q9SW33 3 4 0.000119 0.0509 Q9SRI1 3 5 0.000199 0.0679 Q9LPG6 3 4 0.000194 0.0568 Q8W471 3 5 0.000403 0.1087 O04090 3 14 0.000846 0.0924 Q9FYC2 3 8 0.000556 0.0625 Q8GXU7 3 11 0.000311 0.056 Q84JG2 3 16 0.001 0.1067

230 Q9C524 3 8 0.000346 0.0778 Q8VYJ4 3 11 0.000631 0.1289 Q9MAC8 3 10 0.000438 0.1575 Q9LS02 3 10 0.000358 0.0643 F4I6V2 3 10 0.000309 0.0556 O23166 3 4 0.000266 0.1437 P94040 3 22 0.001642 0.1946 F4IFC5 3 3 2.81E-05 0.0126 Q9SL96 3 8 0.000246 0.0497 P38420 3 10 0.000233 0.0523 Q2HIW6 3 5 7.62E-05 0.0137 Q940Z5 3 9 0.000559 0.1229 Q9SYI5 3 6 0.000309 0.0741 Q9FLW9 3 6 0.000185 0.05 Q9FE78 3 3 0.000128 0.0421 Q8LPL6-2 3 3 6.31E-05 0.0246 Q8L735 3 60 0.004509 0.0676 O64760 3 3 5.68E-05 0.0307 F4J8X6 3 4 6.84E-05 0.0262 Q9T090 3 10 0.000187 0.0168 A8MQW3 3 3 0.000133 0.0677 Q9FV52 3 7 0.000366 0.061 Q9SVM9 3 4 0.000131 0.0324 P46248 2 10 0.00039 0.0596 Q93VC7 2 2 5.04E-05 0.0567 Q9SK50 2 2 7.92E-05 0.0391 P82538 2 2 6.68E-05 0.039 Q9SEI3 2 6 0.000276 0.062 Q9ZVL6 2 3 0.000249 0.097 Q9MAK9 2 3 7.83E-05 0.0587 Q84MD7 2 5 0.000103 0.0427

231 F4JWF6 2 2 5.90E-05 0.0292 P49693 2 2 5.45E-05 0.0294 F4JVC0 2 2 5.58E-05 0.0301 Q941D3 2 3 0.000154 0.0599 Q9C5N2 2 3 8.36E-05 0.0301 Q9FN91 2 2 0.000179 0.0968 P56797 2 3 0.000127 0.0646 Q9LK47 2 2 0.000105 0.1462 P24704 2 2 2.91E-05 0.0209 P62126 2 2 5.08E-05 0.0297 P42770 2 2 5.13E-05 0.0253 F4JY76 2 2 7.15E-05 0.0675 Q9LI88 2 2 4.40E-05 0.0336 P56808 2 5 5.63E-05 0.0132 Q56XG6-2 2 2 5.67E-05 0.0255 Q9FR37 2 3 0.000182 0.1202 Q9LER7 2 2 0.00015 0.1216 Q9SCY3 2 2 5.23E-05 0.0376 Q9SSB5 2 2 3.51E-05 0.041 P56791 2 2 5.06E-05 0.0318 B3H6B0 2 3 8.16E-05 0.0293 P56795 2 2 2.76E-05 0.0149 Q9XI22 2 2 5.14E-05 0.0277 A8MR47 2 2 3.68E-05 0.0231 Q9M9S3 2 2 0.000134 0.0542 Q39172 2 3 0.000201 0.1084 Q9M0S5 2 3 0.00023 0.0828 Q9SZB2-2 2 3 5.18E-05 0.0233 Q9ZVA4 2 6 0.000264 0.0474 Q8VYF1 2 2 9.31E-05 0.0669 F4JBC9 2 2 7.00E-05 0.044

232 Q9M9W1 2 3 0.000211 0.0633 Q94EG6 2 2 3.26E-05 0.0205 Q9ZNT1 2 6 0.000198 0.0386 Q3E902 2 2 5.35E-05 0.0553 O04486 2 2 5.32E-05 0.0478 Q9FMT1 2 31 0.00169 0.1176 Q9FFC0 2 2 2.75E-05 0.0161 Q9SV91 2 2 2.36E-05 0.0128 Q9LNC5 2 3 0.000114 0.0375 F4KJA1 2 3 8.67E-05 0.0494 Q93YP0 2 2 5.39E-05 0.0242 Q93XY1 2 5 0.000267 0.0481 Q8RY16 2 12 0.001628 0.1341 Q0WM29 2 2 6.45E-05 0.0319 F4JWP9 2 2 3.66E-05 0.028 A8MS46 2 2 3.57E-05 0.0369 Q9SEI4 2 2 4.34E-05 0.0273 Q9LPL6 2 5 0.000242 0.0957 Q9M2D8 2 2 0.000181 0.0894 Q9FIM2 2 2 0.000242 0.1196 Q6NPN5 2 6 0.000283 0.0636 O23715 2 20 0.00139 0.0688 Q9LVM5-2 2 24 0.000974 0.0949 Q9FFE0 2 2 0.000107 0.101 Q8LER3 2 3 7.37E-05 0.0331 P93026 2 11 0.000217 0.0265 F4ISP6 2 31 0.002269 0.1513 P92958 2 4 0.000179 0.0803 Q940G5 2 2 5.25E-05 0.0354 Q93W28 2 3 0.000154 0.0507 Q93VB4 2 4 8.19E-05 0.0221

233 Q9FH13 2 13 0.000281 0.0136 O22467 2 5 5.72E-05 0.0134 Q9FI78 2 6 0.000137 0.0206 Q9FN03 2 21 0.002539 0.2283 Q9LXZ7 2 19 0.000974 0.1106 Q9SHB0 2 9 0.000253 0.0303 Q8S944 2 6 0.000109 0.0147 F4I0K2 2 4 9.63E-05 0.0238 Q9FH46 2 2 0.000147 0.0861 Q9LYR4 2 2 7.89E-05 0.0355

234 11. Appendix D

The report of R program used to analyze the raw data obtained from TMT technology for Chapter 5. Due to the expanded codes, we only brought the main lines of the codes.

235 C)

236 Figure D-1. GO enrichment analysis of the clusters

Table D.1. Comparison of the coverage of Cell Wall Proteins (CWPs) in our proteomics dataset (517), compared to A. thalian CWPs data set (805) obtained from (Jamet, E., et al. 2006). Data showed 64.2% coverage supporting the depth of our proteomic data set.

Gene name, Description TAIR ID glycoside hydrolase family 1 - GH1 (beta-glucosidase) (AtBGLU44) AT3G18080 glycoside hydrolase family 3 - GH3 (beta xylosidase 1) (AtBXL1) AT5G49360 glycoside hydrolase family 3 - GH3 (beta-xylosidase) (AtBXL4) AT5G64570 glycoside hydrolase family 3 - GH3 (beta-xylosidase) (AtBXL7) AT1G78060 glycoside hydrolase family 3 - GH3 AT5G20950 glycoside hydrolase family 3 - GH3 AT5G10560 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (At-XTH4) AT2G06850 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (At-XTH6) AT5G65730 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (At-XTH7) AT4G37800 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) (BG2) (PR2) AT3G57260 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT1G11820 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT1G64760 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT1G66250 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT2G01630 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT3G07320 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT3G13560 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT3G55430 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT4G16260 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT4G31140 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT5G42100 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT5G56590 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT5G58090 expressed protein (X8 domain that may be involved in carbohydrate binding) AT5G61130 glycoside hydrolase family 18 - GH18 AT4G19810

237 glycoside hydrolase family 19 - GH19 AT1G02360 glycoside hydrolase family 19 - GH19 AT2G43570 glycoside hydrolase family 19 - GH19 AT2G43610 glycoside hydrolase family 19 - GH19 AT2G43620 glycoside hydrolase family 19 - GH19 AT4G01700 glycoside hydrolase family 20 - GH20 (N-acetyl-beta-glucosaminidase) AT1G65590 glycoside hydrolase family 20 - GH20 (N-acetyl-beta-glucosaminidase) AT3G55260 glycoside hydrolase family 27 - GH27 (alpha-galactosidase/melibiase) AT5G08370 glycoside hydrolase family 27 - GH27 (alpha-galactosidase/melibiase) AT5G08380 glycoside hydrolase family 27 - GH27 (alpha-galactosidase/melibiase) AT3G56310 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT1G80170 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT3G06770 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT3G16850 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT4G23500 glycoside hydrolase family 29 - GH29 (alpha-L-fucosidase) AT2G28100 glycoside hydrolase family 31 - GH31 (alpha-xylosidase) (XYL1) AT1G68560 glycoside hydrolase family 31 - GH31 (alpha-glucosidase) (AGLU1) AT5G11720 glycoside hydrolase family 32 - GH32 (fructosidase/invertase) (AtcwINV3, AT1G55120 FRUCT5) glycoside hydrolase family 32 - GH32 (fructosidase/invertase) (AtcwINV1) AT3G13790 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL9) AT2G32810 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL6) AT5G63800 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL10) AT5G63810 glycoside hydrolase family 38 - GH38 (alpha-mannosidase) AT3G26720 glycoside hydrolase family 38 - GH38 (alpha-mannosidase) AT5G13980 glycoside hydrolase family 1 - (thioglucoside hydrolase 2) (TGG2) (AtBGLU37) AT5G25980 glycoside hydrolase family 1 - GH1 (thioglucoside hydrolase 1) (TGG1) AT5G26000 (AtBGLU38) glycoside hydrolase family 3 - GH3 (beta-xylosidase) (AtBXL5) AT3G19620 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (meri-5) (At- AT4G30270 XTH24)

238 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) (BG3) (PR3) AT3G57240 glycoside hydrolase family 19 - GH19 AT3G54420 glycoside hydrolase family 27 - GH27 (alpha-galactosidase/melibiase) AT3G26380 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT3G61490 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL2) AT3G52840 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL8) AT2G28470 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL1) AT3G13750 glycoside hydrolase family 3 - GH3 (beta xylosidase 2) (AtBXL2) AT1G02640 glycoside hydrolase family 3 - GH3 AT5G04885 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (At-XTH23) AT4G25810 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT5G41870 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (At-XTH31) AT3G44990 glycoside hydrolase family 16 - GH16 (endoxyloglucan transferase) (At-XTH32) AT2G36870 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT1G19170 glycoside hydrolase family 51 - GH51 (alpha-arabinofuranosidase) AT3G10740 glycoside hydrolase family 79 - GH79 (endo-beta-glucuronidase/heparanase) AT5G34940 glycoside hydrolase family 79 - GH79 (endo-beta-glucuronidase/heparanase) AT5G07830 polysaccharide lyase family 1 - PL1 (pectate lyase) (AtPLL19) AT4G24780 polysaccharide lyase family 1 - PL1 (pectate lyase) (AtPLL21) AT5G48900 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME18) AT1G11580 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME3) AT3G14310 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME32) AT3G43270 carbohydrate esterase family 13 - CE13 (pectin acylesterase - PAE) (AtPAE7) AT4G19410 carbohydrate esterase family 13 - CE13 (pectin acylesterase - PAE) (AtPAE11) AT5G45280 alpha-expansin (ATHEXP ALPHA 1.8) (AtEXPA6) AT2G28950 alpha-expansin (ATHEXP ALPHA 1.14) (AtEXPA11) AT1G20190 expansin-like A (ATHEXP BETA 2.1) (AtEXLA1) AT3G45970 peroxidase (AtPrx12) AT1G71695 peroxidase (AtPrx15) AT2G18150 peroxidase (AtPrx17) AT2G22420 peroxidase (AtPrx22) (ATPEA) AT2G38380

239 peroxidase (AtPrx30) (ATP7a) AT3G21770 peroxidase (AtPrx31) AT3G28200 peroxidase (AtPrx32) (ATP16A) AT3G32980 peroxidase (AtPrx33) AT3G49110 peroxidase (AtPrx34) AT3G49120 peroxidase (AtPrx37) (ATP38) AT4G08770 peroxidase (AtPrx49) (ATP31) AT4G36430 peroxidase (AtPrx51) AT4G37530 peroxidase (AtPrx71) (ATP15a) AT5G64120 multicopper oxidase (AtSKS1, homologous to SKU5) AT4G25240 multicopper oxidase (AtSKS4, homologous to SKU5) AT4G22010 multicopper oxidase (AtSKS5, homologous to SKU5) AT1G76160 multicopper oxidase (AtSKS6, homologous to SKU5) AT1G41830 multicopper oxidase (AtSKS17, homologous to SKU5) AT5G66920 multicopper oxidase (AtSKU5, SKEWED 5) AT4G12420 multicopper oxidase (LPR2, LOW PHOSPHATE ROOT 2) AT1G71040 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT4G20830 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT4G20860 plantacyanin (blue copper binding protein) (AtPNC) AT2G02850 uclacyanin II (blue copper binding protein) (AtUCC2) AT2G44790 early nodulin AtEN7 homologous to blue copper binding protein AT2G25060 early nodulin AtEN20 homologous to blue copper binding protein AT4G12880 early nodulin AtEN22 homologous to blue copper binding protein AT5G15350 Ser protease (subtilisin) (AtSBT1.6) (Peptidase family S08.A39, MEROPS) AT4G34980 Ser protease (subtilisin) (AtSBT4.14, XSP1, XYLEM SERINE PROTEINASE 1) AT4G00230 (Peptidase family S08.A14, MEROPS) Ser protease (subtilisin) (AtSBT1.8, AF70) (Peptidase family S08.A24, AT2G05920 MEROPS) Ser protease (subtilisin) (AtSBT1.7, ARA12) (Peptidase family S08.112, AT5G67360 MEROPS) COBRA-like (AtCOBL5) AT5G60950

240 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME44) AT4G33220 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME61) AT5G53370 alpha-expansin (ATHEXP ALPHA 1.2) (AtEXPA1) AT1G69530 homologous to expansin (EXR3) AT2G18660 multicopper oxidase (AtSKS9, homologous to SKU5) AT4G38420 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT2G34790 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT5G44400 early nodulin AtEN6 homologous to blue copper binding protein AT5G25090 early nodulin AtEN12 homologous to blue copper binding protein AT4G27520 Ser protease (subtilisin) (AtSBT1.1) (Peptidase family S08.112, MEROPS) AT1G01900 Ser protease (subtilisin) (AtSBT4.1) (Peptidase family S08.A46, MEROPS) AT2G39850 Ser protease (subtilisin) (AtSBT3.5) (Peptidase family S08.A36, MEROPS) AT1G32940 Ser protease (subtilisin) (AtSBT3.13) (Peptidase family S08.A48, MEROPS) AT4G21650 Ser protease (subtilisin) (AtSBT1.2, SDD1, STOMATAL DISTRIBUTION AND AT1G04110 DENSITY 1) (Peptidase family S08.084, MEROPS) Ser protease (subtilisin) (AtSBT5.2) (Peptidase family S08.104, MEROPS) AT1G20160 L-ascorbate oxidase AT4G21100 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT5G44390 Ser protease (subtilisin) (AtSBT3.3) (Peptidase family S08.A35, MEROPS) AT1G32960 glycosyl transferase family 48 - GT48 (callose synthase) (AtCalS1) AT1G05570 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT5G44410 expressed protein (oxido-reductase domain) AT5G22140 Ser protease (subtilisin) (AtSBT5.3, AIR3) (Peptidase family S08.119, MEROPS) AT2G04160 Ser protease (subtilisin) (AtSBT1.4) (Peptidase family S08.A28, MEROPS) AT3G14067 Asp protease (pepsin family) (Peptidase family A01.A05, MEROPS) AT1G01300 Asp protease (pepsin family) (Peptidase family A01.A36, MEROPS) AT1G09750 Asp protease (pepsin family) (Peptidase family A01.A11, MEROPS) AT3G25700 Asp protease (pepsin family) (Peptidase family A01.A47, MEROPS) AT3G52500 Asp protease (pepsin family) (Peptidase family A01.A48, MEROPS) AT3G54400 Asp protease (pepsin family) (Peptidase family A01.A13, MEROPS) AT3G61820 Asp protease (pepsin family) (Peptidase family A01.A54, MEROPS) AT5G07030

241 Asp protease (pepsin family) (Peptidase family A01.A15, MEROPS) AT5G10770 Cys protease (cathepsin B family) (Peptidase family C01.144, MEROPS) AT4G01610 Cys protease (papain family) (Peptidase family C01.064) (RD21A) AT1G47128 Cys protease (papain family) (Peptidase family C01.A12) (RD21B) AT5G43060 Cys protease (papain family) (Peptidase family C01.163 MEROPS) AT5G60360 Cys protease (cathepsin family) (XCP2, XYLEM CYSTEINE PEPTIDASE 2) AT1G20850 (Peptidase family C01.121, MEROPS) Ser carboxypeptidase (SCPL11) (Peptidase family S10.A08, MEROPS) AT2G22970 Ser carboxypeptidase (AtSCPL34) (Peptidase family S10.A39, MEROPS) AT5G23210 Ser carboxypeptidase (AtSCPL25) (Peptidase family S10.A40, MEROPS) AT3G02110 Ser carboxypeptidase (AtSCPL42) (Peptidase family S10.A21, MEROPS) AT5G42240 Ser carboxypeptidase (AtSCPL45) (Peptidase family S10.A24, MEROPS) AT1G28110 Ser carboxypeptidase (AtSCPL50) (Peptidase family S10 unassigned peptidases, AT1G15000 MEROPS) Ser carboxypeptidase (AtSCPL24, BRS1, Brassinosteroid-Insensitive BRI AT4G30610 suppressor 1) (Peptidase family S10.015, MEROPS) lectin (curculin-like) AT1G78830 lectin (curculin-like) AT1G78850 lectin (curculin-like) AT1G78860 lectin (curculin-like) AT5G18470 lectin (legume lectin domain) AT1G53070 lectin (legume lectin domain) AT3G15356 expressed protein (Barwin domain, defense protein) AT3G04720 expressed protein (LRR domains) AT1G33590 expressed protein (LRR domains) AT3G20820 expressed protein (LRR domains) AT5G23400 Asp protease (pepsin family) (Peptidase family A01.A07, MEROPS) AT1G79720 Ser carboxypeptidase (AtSCPL46) (Peptidase family, S10.A42, MEROPS) AT2G33530 germin (subfamily 3 member 1, GLP1) AT1G72610 lectin (curculin-like) AT1G78820 lectin (legume lectin domain) AT3G16530

242 lectin (legume lectin domain) AT5G03350 expressed protein (LRR domains) AT1G33600 expressed protein (LRR domains) AT2G34930 expressed protein (LRR domains) AT2G42800 PGIP1 (LRR domains) AT5G06860 Ser carboxypeptidase (SCPL20) (Peptidase family S10.A11, MEROPS) AT4G12910 PGIP2 (LRR domains) AT5G06870 Asp protease (pepsin family) (Peptidase family A01.A23, MEROPS) AT3G02740 expressed protein (LRR domains) AT5G12940 Asp protease (pepsin family) (Peptidase family A1, subfamily A1B, non-peptidase AT1G03220 homologues, MEROPS) (homologous to carrot EDGP and tomato XEGIP) Asp protease (pepsin family) (Peptidase family A1, subfamily A1B, non-peptidase AT1G03230 homologues, MEROPS) (homologous to carrot EDGP and tomato XEGIP) Asp protease (pepsin family) (Peptidase family A1, subfamily A1B, non-peptidase AT5G19110 homologues, MEROPS) (homologous to carrot EDGP and tomato XEGIP) plant invertase/pectin methylesterase inhibitor (PMEI) (AtPMEI7) AT4G25260 inhibitor family I3 (Kunitz-P family) (subfamily I3A unassigned peptidase AT1G73260 inhibitor homologues, MEROPS) inhibitor family I3 (Kunitz trypsin inibitor family) (subfamily I03.030, MEROPS) AT1G17860 inhibitor family I18 (family I18 unassigned peptidase inhibitor homologues, AT2G43535 MEROPS) (ATTI4) proteinase inhibitor family I25 (phytostatin) (cystatin family, I25.033, MEROPS) AT4G16500 (AtCYS-4) expressed protein (LysM domain) AT2G17120 fasciclin-like arabinogalactan protein (FLA1) AT5G55730 fasciclin-like arabinogalactan protein (FLA7) AT2G04780 fasciclin-like arabinogalactan protein (FLA8) AT2G45470 leucine-rich repeat receptor protein kinase (LRR III subfamily) AT3G02880 AGP/proline-rich protein (AtAGP31) AT1G28290 gibberellic acid-stimulated Arabidopsis (AtGASA14) protein AT5G14920 LRR-extensin (AtLRX3) AT4G13340

243 LRR-extensin (AtLRX5) AT4G18670 lipase acylhydrolase (GDSL family) AT1G29670 lipase acylhydrolase (GDSL family) AT1G54000 lipase acylhydrolase (GDSL family) AT1G54010 lipase acylhydrolase (GDSL family) AT1G54030 glycerophosphoryl diester phosphodiesterase (GDPDL4, GPDL1) AT5G55480 glycerophosphoryl diester phosphodiesterase (GDPDL3, GDPL2) (MRH5/SHV3, AT4G26690 MORPHOGENESIS OF ROOT HAIR 5) non-specific lipid-transfer protein (AtLTP5) AT3G51600 non-specific lipid transfer protein (AtLTP1.6, AtLTP6) AT3G08770 non-specific lipid transfer protein (AtLTPd2) AT5G48490 expressed protein (MD-2-related lipid-recognition (ML) domain) AT5G23820 expressed protein (MD-2-related lipid-recognition (ML) domain) AT3G44100 pathogenesis-related protein (PR) 1 / Cys-rich secretory protein (SCP) AT2G14610 pathogenesis-related protein (PR) 1 / Cys-rich secretory protein (SCP) AT5G66590 thaumatin (PR5) AT2G28790 plant invertase/pectin methylesterase inhibitor (PMEI) (INH) AT1G47960 plant invertase/pectin methylesterase inhibitor (PMEI) (INH) AT5G64620 proteinase inhibitor family I25 (phytostatin) (cystatin family, I25.014, MEROPS) AT2G40880 (AtCYS-3) proteinase inhibitor family I25 (phytostatin) (cystatin family, I25.033, MEROPS) AT5G47550 (AtCYS-5) expressed protein (LysM domain) AT1G21880 fasciclin-like arabinogalactan protein (FLA10) AT3G60900 fasciclin-like arabinogalactan protein (FLA13) AT5G44130 leucine-rich repeat receptor protein kinase (LRR III subfamily) AT3G08680 LRR-extensin (AtLRX4) AT3G24480 lipase acylhydrolase (GDSL family) AT1G28600 lipase acylhydrolase (GDSL family) AT1G67830 lipase acylhydrolase (GDSL family) AT3G48460 non-specific lipid transfer protein (AtLTP1.4, AtLTP2) AT2G38530

244 non-specific lipid transfer protein (AtLTP1.12, AtLTP3) AT5G59320 non-specific lipid transfer protein (AtLTPg4, LTPG1) AT1G27950 transducin family protein/WD-40 repeat family protein AT5G08390 COBRA-like (AtCOBL7) AT4G16120 leucine-rich repeat receptor protein kinase (LRR IX subfamily) AT2G01820 leucine-rich repeat receptor protein kinase (LRR III subfamily) AT3G51740 leucine-rich repeat receptor protein kinase (LRR III subfamily) AT5G16590 lipase acylhydrolase (GDSL family) AT5G14450 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT1G32860 serpin (serine protease inhibitor) AT1G47710 ceramidase AT2G38010 thaumatin (PR5) AT1G75040 thaumatin (PR5) AT1G73620 Low-molecular-weight Cysteine-Rich protein 69 (LCR69)/Defensin-like protein AT2G02100 2 expressed protein (lipase/lipooxygenase domain, PLAT/LH2) AT2G22170 aldose-1-epimerase AT4G25900 aldose-1-epimerase AT3G47800 purple acid phosphatase (AtPAP12) AT2G27190 purple acid phosphatase (AtPAP15) AT3G07130 purple acid phosphatase (AtPAP26) AT5G34850 acid phosphatase (class B) AT4G29270 phosphate-induced (phi) protein 1 AT4G08950 phosphate-induced (phi) protein 1 AT5G09440 phosphate-induced (phi) protein 1 AT5G51550 phosphate-induced (phi) protein 1 AT5G64260 gibberellic acid-stimulated Arabidopsis (AtGASA4) protein AT5G15230 gibberellic acid-stimulated Arabidopsis (AtGASA1) protein AT1G75750 glucose/sorbosone dehydrogenase (weakly hedgehog interacting protein HIPL1) AT1G74790 glucose/sorbosone dehydrogenase (weakly hedgehog interacting protein HIPL2) AT5G62630 germin (subfamily 2 member 2) AT1G02335

245 germin (subfamily 2 member 1, GLP5) AT1G09560 germin (subfamily 2 member 4, GLP10) AT3G62020 purple acid phosphatase (AtPAP1) AT1G13750 expressed protein (WD40-like beta propeller domain) AT1G21680 Peptide-N4-(N-acetyl-beta-glucosaminyl) asparagine amidase A AT3G14920 expressed protein AT3G15950 expressed protein AT5G18860 expressed protein (Gnk2-homologous domain, antifungal protein of Ginkgo seeds) AT3G22060 expressed protein (DUF538) AT3G07470 expressed protein (DUF642) AT3G08030 expressed protein (DUF642) AT4G32460 expressed protein (DUF642) AT5G11420 expressed protein (DUF642) AT5G25460 expressed protein (human brain CREG protein domain) AT2G04690 peroxidase (AtPrx03) AT1G05260 peroxidase (AtPrx39) AT4G11290 early nodulin AtEN14 homologous to blue copper binding protein AT3G20570 thiol reductase (GILT family) AT1G07080 Cys protease (cathepsin family) (Peptidase family C01.162 MEROPS) AT3G45310 expressed protein (LRR domains) AT1G33610 fasciclin-like arabinogalactan protein (FLA2) AT4G12730 ribonuclease T2 AT2G39780 ribonuclease T2 AT1G14210 purple acid phosphatase (AtPAP4) AT1G25230 dirigent protein (AtDIR21) AT1G65870 purple acid phosphatase (AtPAP10) AT2G16430 phosphate-induced (phi) protein 1 AT1G35140 germin (AtGER3, GLP2, GLP3) AT5G20630 expressed protein (WD40-like beta propeller domain) AT1G21670 expressed protein (thioredoxin fold) AT1G76020 expressed protein (DUF288) AT3G57420

246 expressed protein (DUF642) AT2G34510 alpha-expansin (ATHEXP ALPHA 1.9) (AtEXPA3) AT2G37640 early nodulin AtEN13 homologous to blue copper binding protein AT4G31840 plant invertase/pectin methylesterase inhibitor (PMEI) (AtPMEI3) AT5G20740 expressed protein AT1G61900 expressed protein (auxin-responsive protein AIR12) (DUF568) AT3G07390 expressed protein (DUF1680) AT5G12950 strictosidine synthase AT3G57030 expressed protein AT3G62360 expressed protein (cyclase domain) AT4G34180 expressed protein AT5G19250 expressed protein AT5G24460 expressed protein (DUF246) AT1G51630 expressed protein (DUF248) AT4G18030 expressed protein (DUF248) AT5G14430 expressed protein (SPFH domain / Band 7 family) AT3G27280 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (BGAL4) AT5G56870 myo-inositol monophosphatase AT3G02870 expressed protein AT3G56750 expressed protein (DUF248) AT1G26850 alpha-expansin (ATHEXP ALPHA 1.11) (AtEXPA8) AT2G40610 expressed protein AT4G28100 expressed protein (Gnk2-homologous domain, antifungal protein of Ginkgo seeds) AT5G48540 glycoside hydrolase family 1 - GH1 (beta-glucosidase) AT3G09260 dirigent protein (AtDIR7) AT3G13650 dirigent protein (AtDIR13) AT4G11190 purple acid phosphatase (AtPAP2) AT1G13900 purple acid phosphatase (AtPAP27) AT5G50400 purple acid phosphatase (AtPAP29) AT5G63140 thaumatin (PR5) AT5G40020 acid phosphatase (class B) AT5G44020

247 dirigent protein (AtDIR20) AT1G55210 Germin AT3G05950 Germin AT5G39110 germin (subfamily 1 member 18, GLP2a) AT5G39160 germin (GLP9) AT4G14630 phosphodiesterase AT4G29700 strictosidine synthase AT1G74020 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT1G26380 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT1G30700 expressed protein (FAD binding domain) AT4G29740 expressed protein (FAD binding domain) AT5G11540 peroxidase (AtPrx21) AT2G37130 peroxidase (AtPrx42) AT4G21960 peroxidase (AtPrx47) AT4G33420 peroxidase (AtPrx50) AT4G37520 peroxidase (AtPrx59) AT5G19890 copper amine oxidase AT1G62810 expressed protein (thioredoxin fold) AT1G20225 expressed protein (GMC oxido-reductase domain) AT3G56060 Asp protease (pepsin family) (Peptidase family A01.A03, MEROPS) AT4G04460 Asp protease (subfamily S9B unassigned peptidases, MEROPS) AT1G11910 Asp protease (pepsin family) (Peptidase family A01.A09, MEROPS) (ASPG1, AT3G18490 ASPARTIC PROTEASE IN GUARD CELL 1) Asp protease (pepsin family) (Peptidase family A01.A43, MEROPS) AT3G51330 Cys protease (cathepsin B family) (Peptidase family C01.049, MEROPS) AT1G02305 Cys protease (cathepsin family) AT4G35350 Cys protease (cathepsin family) AT4G39090 peptidase C13 (legumain family) (peptidase family C13.006, MEROPS) AT4G32940 peptidase C26 (peptidase family C26.003, MEROPS)(GGH2) AT1G78680 peptidase M28 (peptidase family M28.A02, MEROPS) AT5G19740 Ser carboxypeptidase (AtSCPL26) (Peptidase family S10.A43, MEROPS) AT2G35780

248 Ser carboxypeptidase (AtSCPL27) (Peptidase family S10.A23, MEROPS) AT3G07990 Ser carboxypeptidase (AtSCPL29) (Peptidase family S10.A32, MEROPS) AT4G30810 Ser carboxypeptidase (AtSCPL48) (Peptidase family S10.A46, MEROPS) AT3G45010 Ser carboxypeptidase (AtSCPL49) (Peptidase family S10.A45, MEROPS) AT3G10410 Ser carboxypeptidase (AtSCPL51) (Peptidase family S10.017, MEROPS) AT2G27920 Ser carboxypeptidase (AtSCPL8) (Peptidase family S10.A10, MEROPS) AT2G22990 Pro-Xaa carboxypeptidase (Peptidase family S28.A02, MEROPS) AT5G65760 Pro-Xaa carboxypeptidase (Peptidase family S28.A26, MEROPS) AT4G36195 Ser protease (subtilisin) (AtSBT2.5) (Peptidase family S8.A02, MEROPS) AT2G19170 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME17) AT2G45220 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME25) AT3G10720 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT3G62110 glycoside hydrolase family 32 - GH32 (fructosidase/invertase) (AtcwINV6) AT5G11920 homologous to Arabidopsis PMR5 (Powdery Mildew Resistant) (carbohydrate AT2G31110 acylation) homologous to Arabidopsis PMR5 (Powdery Mildew Resistant) (carbohydrate AT2G42570 acylation) carbohydrate esterase family 13 - CE13 (pectin acylesterase - PAE) (AtPAE2) AT1G57590 carbohydrate esterase family 13 - CE13 (pectin acylesterase - PAE) (AtPAE12) AT3G05910 carbohydrate esterase family 13 - CE13 (pectin acylesterase - PAE) (AtPAE5) AT3G09410 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME8) AT1G05310 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME41) AT4G02330 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME51) AT5G09760 beta-expansin (AtEXPB3) AT4G28250 glycoside hydrolase family 1 - GH1 (beta-glucosidase) AT3G03640 glycoside hydrolase family 1 - GH1 (beta-glucosidase) AT3G60130 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT4G29360 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT5G42720 glycoside hydrolase family 19 - GH19 AT2G43590 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT3G57790 glycoside hydrolase family 9 - GH9 (endo-1,3(4)-beta-glucanase) AT4G02290

249 polysaccharide lyase family 1 - PL1 (pectate lyase) (AtPLL20) AT3G07010 polysaccharide lyase family 1 - PL1 (pectate lyase) (AtPLL26) AT1G04680 lipase acylhydrolase (GDSL family) AT1G09390 lipase acylhydrolase (GDSL family) AT1G28580 lipase acylhydrolase (AtCDEF1, CUTICLE DESTRUCTING FACTOR 1) AT4G30140 lipase acylhydrolase (GDSL family) AT5G03610 non-specific lipid transfer protein (AtLTPd8) AT5G05960 expressed protein (lipase/lipooxygenase domain, PLAT/LH2) (ATS3 embryo- AT2G41475 specific protein 3) expressed protein (MD-2-related lipid-recognition (ML) domain) AT3G11780 expressed protein (phospholipase C, phosphatidylinositol-specific, X domain) AT4G36945 expressed protein (saposin domains) AT3G51730 expressed protein (saposin domains) AT5G01800 glycerophosphoryl diester phosphodiesterase (GDPD5) AT1G74210 expressed protein (LRR domains) AT4G06744 plant invertase/pectin methylesterase inhibitor (PMEI-like) AT4G12390 plant invertase/pectin methylesterase inhibitor (PMEI-like) AT5G62350 leucine-rich repeat receptor protein kinase AT3G17840 leucine-rich repeat receptor protein kinase AT3G28450 leucine-rich repeat receptor protein kinase (LRR I sub-family) AT1G51890 expressed protein AT3G11800 expressed protein AT5G50200 expressed protein (amidohydrolase domain) AT5G12200 expressed protein (cyclase domain) AT4G35220 expressed protein (DUF538) AT1G02816 expressed protein (DUF538) AT3G07460 expressed protein (DUF538) AT4G02370 expressed protein (DUF538) AT5G19860 expressed protein (MATH domain) AT1G58270 expressed protein (Xylose isomerase-like TIM barrel) AT5G57655 ribonuclease III AT1G24450

250 leucine-rich repeat receptor protein kinase (LRR VIII sub-family) AT5G49760 peptidase C26 (peptidase family C26.A01, MEROPS)(GGH3) AT1G78670 DUF26 receptor protein kinase AT1G70520 expressed protein (saposin domain) AT4G29520 fasciclin-like arabinogalactan protein (FLA15) AT3G52370 fasciclin-like arabinogalactan protein (FLA16) AT2G35860 proline-rich protein (AtPRP4) AT4G38770 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT1G23460 non-specific lipid transfer protein (AtLTP2.9) AT3G18280 expressed protein AT5G39570 multicopper oxidase AT5G21105 leucine-rich repeat receptor protein kinase AT2G26730 homologous to PGIP1 (LRR protein FLR1) AT3G12145 expressed protein (DUF3456) AT1G42480 expressed protein AT3G23450 expressed protein (phospholipase C, phosphatidylinositol-specific, X domain) AT5G67130 lipase acylhydrolase (GDSL family) AT1G31550 glycoside hydrolase family 35 - GH35 (beta-galactosidase) (AtBGAL5) AT1G45130 glycoside hydrolase family 3 - GH3 AT5G09730 glycoside hydrolase family 14 - GH14 AT4G15210 glycoside hydrolase family 1 - GH1 (beta-glucosidase) (AtBGLU8) AT3G62750 Ser protease (subtilisin) (AtSBT2.2) (Peptidase family S08.A01, MEROPS) AT4G20430 multicopper oxidase (AtSKS11, homologous to SKU5) AT3G13990 uclacyanin AtUCC8 (blue copper binding protein) AT1G72230 gamma glutamyltranpeptidase (GGT2) AT4G39640 acid phosphatase (class B) AT5G24780 expressed protein (X8 domain that may be involved in carbohydrate binding) AT5G08000 non-specific lipid transfer protein (AtLTPg11) AT2G13820 expressed protein (DUF1138) AT4G00860 non-specific lipid-transfer protein (AtLTPg6) AT1G55260 polysaccharide lyase family 1 - PL1 (pectate lyase) (AtPLL15) AT5G63180

251 leucine-rich repeat receptor protein kinase AT2G27060 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT4G20840 copper amine oxidase AT1G31690 Asp protease (pepsin family) (Peptidase family A1, A01.A14, MEROPS) AT5G10760 carbohydrate esterase family 13 - CE13 (pectin acylesterase - PAE) (AtPAE3) AT2G46930 lipase acylhydrolase (GDSL family) AT4G01130 lipase acylhydrolase (GDSL family) AT3G05180 lipase acylhydrolase (GDSL family) AT3G14210 lipase acylhydrolase (GDSL family) AT1G29660 lipase acylhydrolase (GDSL family) AT3G16370 non-specific lipid-transfer protein (AtLTP1.5, AtLTP1) AT2G38540 homologous to non-specific lipid transfer protein AT2G10940 glycerophosphoryl diester phosphodiesterase (GDPDL1, GDPL3) AT1G66970 expressed protein (phospholipase C, phosphatidylinositol-specific, X domain) AT1G49740 expressed protein (LRR domains) AT1G49750 expressed protein (Gnk2-homologous domain, antifungal protein of Ginkgo seeds) AT4G23170 gibberellic acid-stimulated Arabidopsis (AtGASA6) protein AT1G74670 gibberellic acid-stimulated Arabidopsis (AtGASA7) protein AT2G14900 carbonic anhydrase AT3G52720 inhibitor family I18 (family I18 unassigned peptidase inhibitor homologues, AT2G43510 MEROPS) (ATTI1) inhibitor family I18 (family I18 unassigned peptidase inhibitor homologues, AT2G43530 MEROPS) (ATTI3) inhibitor family I18 (family I18 unassigned peptidase inhibitor homologues, AT2G43550 MEROPS) (ATTI6) phosphorylase AT4G24350 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT1G26390 berberine-bridge enzyme (S)-reticulin:oxygen oxido-reductase AT2G34810 multicopper oxidase AT5G21100 peroxidase (AtPrx67) AT5G58390 thiol reductase (GILT family) AT4G12900

252 Asp protease (pepsin family) (Peptidase family A01.A26, MEROPS) AT1G77480 Asp protease (pepsin family) (Peptidase family A01.A30, MEROPS) AT3G12700 Cys protease (papain family) (Peptidase family C01.117 MEROPS) (SAG12) AT5G45890 Ser carboxypeptidase (AtSCPL35) (Peptidase family, S10.A34, MEROPS) AT5G08260 Ser protease (subtilisin) (AtSBT1.3) (Peptidase family S08.A25, MEROPS) AT5G51750 Ser protease (subtilisin) (AtSBT5.6) AT5G45650 carbohydrate esterase family 8 - CE8 (pectin methylesterase - PME) (AtPME35) AT3G59010 alpha-expansin (AtEXPA13) AT3G03220 beta-expansin (AtEXPB1) AT2G20750 glycoside hydrolase family 1 - GH1 (beta-glucosidase)(AtBG1) (AtBGLU18) AT1G52400 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT5G58480 glycoside hydrolase family 2 - GH2 AT1G09010 glycoside hydrolase family 28 - GH28 (polygalacturonase) AT4G23820 glycoside hydrolase family 31 - GH31 (alpha-glucosidase) AT3G45940 lipase acylhydrolase (GDSL family) AT1G33811 lipase acylhydrolase (GDSL family) AT2G03980 lipase acylhydrolase (GDSL family) AT3G04290 lipase acylhydrolase (GDSL family) AT5G45950 homologous to non-specific lipid transfer protein AT2G45180 homologous to non-specific lipid transfer protein AT3G22120 homologous to non-specific lipid transfer protein AT4G00165 homologous to non-specific lipid transfer protein AT4G22490 non-specific lipid transfer protein (AtLTP1.11, AtLTP4) AT5G59310 non-specific lipid transfer protein (AtLTP7) AT2G15050 non-specific lipid-transfer protein (AtLTPg13) AT2G44290 expressed protein (LRR domains) AT2G15320 expressed protein (LRR domains) AT4G18760 inhibitor family I9 (unassigned peptidase inhibitors, MEROPS) AT1G71950 plant invertase/ pectin methylesterase inhibitor (PMEI) AT3G62820 expressed protein AT1G52410 expressed protein AT1G65900

253 expressed protein AT2G25510 expressed protein AT3G05730 expressed protein AT3G06035 expressed protein AT3G18050 expressed protein AT4G21620 expressed protein AT5G19240 expressed protein AT5G38980 expressed protein (BURP domain) AT5G25610 expressed protein (calcium binding domain) AT3G52850 expressed protein (DUF538) AT1G55265 expressed protein (MATH domain) AT3G28220 expressed protein (Ole e1 allergen domain) AT1G78040 expressed protein (Ole e1 allergen domain) AT5G13140 expressed protein (Ole e1 allergen domain) AT5G41050 expressed protein (SOUL heme-binding domain) AT1G17100 cysteine-rich receptor protein kinase (CRK22) AT4G23300 expressed protein (LRR domains) AT4G29240 non-specific lipid-transfer protein (AtLTP2.4) AT1G48750 homologous to Arabidopsis PMR5 (Powdery Mildew Resistant) (carbohydrate AT1G29050 acylation) Ser carboxypeptidase (AtSCPL7) (Peptidase family S10.A15, MEROPS) AT3G10450 expressed protein (GMC oxido-reductase domain) AT1G12570 fasciclin-like arabinogalactan protein (FLA9) AT1G03870 glycoside hydrolase family 17 - GH17 (beta-1,3-glucosidase) AT2G27500 expressed protein (LysM domain) AT1G77630

254 Table D.2. The differentially expressed proteins grouped in clusters of A. thaliana response to the narrow-wavelength lights.

Cluster Description Gene Name TAIR ID C1 (Amber) (3R)-hydroxymyristoyl-[acyl carrier protein] AT5G10160 AT5G10160 dehydratase-like protein C1 (Amber) 1-phosphatidylinositol-3-phosphate 5-kinase FAB1B FAB1B AT3G14270 C1 (Amber) 15-cis-phytoene desaturase, PDS AT4G14210 chloroplastic/chromoplastic C1 (Amber) 2-dehydro-3-deoxyphosphooctonate aldolase 1 KDSA1 AT1G79500 C1 (Amber) 21.7 kDa class VI heat shock protein HSP21.7 AT5G54660 C1 (Amber) 3-ketoacyl-acyl carrier protein synthase I KASI AT5G46290 C1 (Amber) 3-methyl-2-oxobutanoate hydroxymethyltransferase 1, KPHMT1 AT2G46110 mitochondrial C1 (Amber) 30S ribosomal protein AT5G24490 AT5G24490 C1 (Amber) 5'-nucleotidases;magnesium ion binding protein AT2G38680 AT2G38680 C1 (Amber) 65-kDa microtubule-associated protein 6 MAP65-6 AT2G01910 C1 (Amber) AACT1 AT5G47720 AT5G47720 C1 (Amber) ABC transporter B family member 19 ABCB19 AT3G28860 C1 (Amber) ABC transporter G family member 22 ABCG22 AT5G06530 C1 (Amber) ABC transporter I family member 11, chloroplastic ABCI11 AT5G14100 C1 (Amber) ACBP6 ACBP6 AT1G31812 C1 (Amber) Acid beta-fructofuranosidase 3, vacuolar BFRUCT3 AT1G62660 C1 (Amber) Acid beta-fructofuranosidase 4, vacuolar BFRUCT4 AT1G12240 C1 (Amber) Acyl-acyl carrier protein thioesterase ATL3, ALT3 AT1G68260 chloroplastic C1 (Amber) Adenine nucleotide alpha hydrolases-like superfamily AT5G14680 AT5G14680 protein C1 (Amber) Adenylate kinase 3 ADK2 AT5G50370 C1 (Amber) Aldolase superfamily protein AT1G12230 AT1G12230 C1 (Amber) Alkaline-phosphatase-like family protein AT4G29700 AT4G29700

255 C1 (Amber) Allantoinase ALN AT4G04955 C1 (Amber) Allene oxide synthase, chloroplastic CYP74A AT5G42650 C1 (Amber) Alpha carbonic anhydrase 1, chloroplastic ACA1 AT3G52720 C1 (Amber) Alpha-galactosidase 2 AGAL2 AT5G08370 C1 (Amber) Alpha-L-arabinofuranosidase 1 ASD1 AT3G10740 C1 (Amber) Alpha-mannosidase At3g26720 AT3G26720 AT3G26720 C1 (Amber) Alpha-N-acetylglucosaminidase NAGLU AT5G13690 C1 (Amber) Alpha-xylosidase 1 XYL1 AT1G68560 C1 (Amber) alpha/beta-Hydrolases superfamily protein AT1G29840 AT1G29840 C1 (Amber) Alpha/beta-Hydrolases superfamily protein AT1G35420 AT1G35420 C1 (Amber) Alpha/beta-Hydrolases superfamily protein AT2G19550 AT2G19550 C1 (Amber) Alpha/beta-Hydrolases superfamily protein AT3G47590 AT3G47590 C1 (Amber) Alpha/beta-Hydrolases superfamily protein AT5G22460 AT5G22460 C1 (Amber) Alpha/beta-Hydrolases superfamily protein AT5G38220 AT5G38220 C1 (Amber) alpha/beta-Hydrolases superfamily protein MNA5.13 AT5G65400 C1 (Amber) Amidase 1 AMI1 AT1G08980 C1 (Amber) Amino acid transporter AVT3C AVT3C AT4G38250 C1 (Amber) Amino acid transporter AVT6D AVT6D AT2G40420 C1 (Amber) Aminopeptidase (DUF3754) AT3G19340 AT3G19340 C1 (Amber) AmmeMemoRadiSam system protein B AT2G25280 AT2G25280 C1 (Amber) Ankyrin repeat family protein AT5G04680 AT5G04680 C1 (Amber) Annexin ANN3 AT2G38760 C1 (Amber) Annexin D4 ANN4 AT2G38750 C1 (Amber) Aquaporin PIP2-3 PIP2-3 AT2G37180 C1 (Amber) Aquaporin TIP1-2 TIP1-2 AT3G26520 C1 (Amber) Arginine biosynthesis bifunctional protein ArgJ, AT2G37500 AT2G37500 chloroplastic C1 (Amber) Ascorbate oxidase-like protein AT5G21100 AT5G21100 C1 (Amber) ASG5 PBL21 AT1G20650 C1 (Amber) asparagine synthetase 2 ASN2 AT5G65010 C1 (Amber) Aspartate aminotransferase ASP4 AT1G62800

256 C1 (Amber) Aspartate-glutamate racemase family AT1G15410 AT1G15410 C1 (Amber) Aspartyl protease AED3 AED3 AT1G09750 C1 (Amber) At1g04800 AT1G04800 AT1G04800 C1 (Amber) At1g07750/F24B9_13 AT1G07750 AT1G07750 C1 (Amber) AT1G11360 protein AT1G11360 AT1G11360 C1 (Amber) At1g14380 IQD28 AT1G14380 C1 (Amber) At1g16880 AT1G16850 AT1G16850 C1 (Amber) At1g18840 IQD30 AT1G18840 C1 (Amber) At1g21440 AT1G21440 AT1G21440 C1 (Amber) AT1g27100/T7N9_16 AT5G54855 AT5G54855 C1 (Amber) At1g43790 TED6 AT1G43790 C1 (Amber) At1g51400/F5D21_10 AT1G51400 AT1G51400 C1 (Amber) At1g55570/T5A14_1 sks12 AT1G55570 C1 (Amber) At1g56720 AT1G56720 AT1G56720 C1 (Amber) At1g58270/F19C14_8 ZW9 AT1G58270 C1 (Amber) At1g64330 AT1G64330 AT1G64330 C1 (Amber) At1g65900/F12P19_7 AT1G65900 AT1G65900 C1 (Amber) At1g67862/At1g67862 AT1G67865 AT1G67865 C1 (Amber) At1g78995 AT1G78995 AT1G78995 C1 (Amber) At2g05540/T20G20.11 AT2G05540 AT2G05540 C1 (Amber) At2g22230/T26C19.11 AT2G22230 AT2G22230 C1 (Amber) At2g27140 AT2G27140 AT2G27140 C1 (Amber) AT2G44210 protein AT2G44210 AT2G44210 C1 (Amber) At2g46220/T3F17.13 AT2G46220 AT2G46220 C1 (Amber) At3g09740 SYP71 AT3G09740 C1 (Amber) AT3G11560 protein AT3G11560 AT3G11560 C1 (Amber) At3g20570 ENODL9 AT3G20570 C1 (Amber) At3g27230 AT3G27230 AT3G27230 C1 (Amber) AT3g27760/MGF10_16 AT3G27770 AT3G27770 C1 (Amber) AT3g28220/T19D11_3 AT3G28220 AT3G28220 C1 (Amber) At3g52500 AT3G52500 AT3G52500

257 C1 (Amber) AT3g54400/T12E18_90 AT3G54400 AT3G54400 C1 (Amber) AT3g56060/F18O21_20 AT3G56060 AT3G56060 C1 (Amber) At3g59370 AT3G59370 AT3G59370 C1 (Amber) At3g61050 NTMC2TYP AT3G61050 E4 C1 (Amber) AT3g62110 AT3G62110 AT3G62110 C1 (Amber) AT4G03560 protein TPC1 AT4G03560 C1 (Amber) At4g10300 AT4G10300 AT4G10300 C1 (Amber) At4g12880 ENODL19 AT4G12880 C1 (Amber) AT4G23670 protein AT4G23670 AT4G23670 C1 (Amber) At4g25660 AT4G25660 AT4G25660 C1 (Amber) At4g33625 AT4G33625 AT4G33625 C1 (Amber) At4g35020 ARAC3 AT4G35020 C1 (Amber) AT5g02160 AT5G02160 AT5G02160 C1 (Amber) AT5g05480/MOP10_2 AT5G05480 AT5G05480 C1 (Amber) AT5g12260/MXC9_22 AT5G12260 AT5G12260 C1 (Amber) At5g25460 AT5G25460 AT5G25460 C1 (Amber) AT5g37360/MNJ8_150 AT5G37360 AT5G37360 C1 (Amber) At5g40020 AT5G40020 AT5G40020 C1 (Amber) AT5g48790/K24G6_12 AT5G48790 AT5G48790 C1 (Amber) AT5G50950 protein FUM2 AT5G50950 C1 (Amber) At5g57040 AT5G57040 AT5G57040 C1 (Amber) At5g65760 AT5G65760 AT5G65760 C1 (Amber) At5g66005 AT5G66005 AT5G66005 C1 (Amber) AT5G66420 protein AT5G66420 AT5G66420 C1 (Amber) ATMRK1 ATMRK1 AT3G63260 C1 (Amber) ATP-dependent caseinolytic (Clp) protease/crotonase AT3G60510 AT3G60510 family protein C1 (Amber) ATPase 11, plasma membrane-type AHA11 AT5G62670 C1 (Amber) Auxin efflux carrier component PIN4 AT2G01420 C1 (Amber) Auxin efflux carrier component 3 PIN3 AT1G70940

258 C1 (Amber) Auxin efflux carrier component 7 PIN7 AT1G23080 C1 (Amber) B-box zinc finger protein 32 BBX32 AT3G21150 C1 (Amber) Berberine bridge enzyme-like 21 AT4G20840 AT4G20840 C1 (Amber) beta carbonic anhydrase 5 ATBCA5 AT4G33580 C1 (Amber) Beta glucosidase 8 BGLU8 AT3G62750 C1 (Amber) Beta-D-xylosidase 1 BXL1 AT5G49360 C1 (Amber) Beta-D-xylosidase 3 BXL3 AT5G09730 C1 (Amber) Beta-galactosidase BGAL2 AT3G52840 C1 (Amber) Beta-galactosidase 1 BGAL1 AT3G13750 C1 (Amber) Beta-galactosidase 6 BGAL6 AT5G63800 C1 (Amber) Beta-galactosidase 8 BGAL8 AT2G28470 C1 (Amber) Beta-glucosidase 33 BGLU33 AT2G32860 C1 (Amber) Beta-glucosidase 44 BGLU44 AT3G18080 C1 (Amber) Beta-hexosaminidase 3 HEXO3 AT1G65590 C1 (Amber) Bifunctional inhibitor/lipid-transfer protein/seed AT3G22142 AT3G22142 storage 2S albumin superfamily protein C1 (Amber) Bifunctional L-3-cyanoalanine synthase/cysteine CYSD1 AT3G04940 synthase D1 C1 (Amber) Bifunctional L-3-cyanoalanine synthase/cysteine CYSD2 AT5G28020 synthase D2 C1 (Amber) BNR/Asp-box repeat family protein AT5G57700 AT5G57700 C1 (Amber) Branched-chain amino acid aminotransferase 5 / ATBCAT-5 AT5G65780 branched-chain amino acid transaminase 5 (BCAT5) C1 (Amber) Branched-chain amino acid aminotransferase like DAAT AT5G57850 protein C1 (Amber) BTB/POZ domain-containing protein At1g30440 AT1G30440 AT1G30440 C1 (Amber) Calcineurin-like metallo-phosphoesterase superfamily AT1G25230 AT1G25230 protein C1 (Amber) Calcium-dependent protein kinase 21 CPK21 AT4G04720 C1 (Amber) Carbamoyl-phosphate synthase large chain, CARB AT1G29900 chloroplastic

259 C1 (Amber) Carbamoyl-phosphate synthase small chain, CARA AT3G27740 chloroplastic C1 (Amber) Carboxyl-terminal-processing peptidase 2, CTPA2 AT4G17740 chloroplastic C1 (Amber) Carboxypeptidase SCPL26 AT2G35780 C1 (Amber) Carboxypeptidase SCPL27 AT3G07990 C1 (Amber) Cardiomyopathy-associated protein AT5G17910 AT5G17910 C1 (Amber) Catalytic/ hydrolase AT2G35450 AT2G35450 C1 (Amber) CBS domain-containing protein CBSX6 CBSX6 AT1G65320 C1 (Amber) CBSX3 CBSX3 AT5G10860 C1 (Amber) Cell division protein FtsZ homolog 2-1, chloroplastic FTSZ2-1 AT2G36250 C1 (Amber) Chaperone protein dnaJ-like protein AT2G38000 AT2G38000 C1 (Amber) Chloride channel protein CLC-a CLC-A AT5G40890 C1 (Amber) Chlorophyll a-b binding protein 1, chloroplastic LHCB1.3 AT1G29930 C1 (Amber) Chlorophyll a-b binding protein 3, chloroplastic LHCB3 AT5G54270 C1 (Amber) Chlorophyll a-b binding protein CP29.2, chloroplastic LHCB4.2 AT3G08940 C1 (Amber) Chlorophyll a-b binding protein, chloroplastic LHCB6 AT1G15820 C1 (Amber) Chlorophyll a-b binding protein, chloroplastic LHCA3 AT1G61520 C1 (Amber) Chlorophyll a-b binding protein, chloroplastic LHB1B1 AT2G34430 C1 (Amber) Chlorophyll a-b binding protein, chloroplastic LHCA4 AT3G47470 C1 (Amber) Chlorophyll a-b binding protein, chloroplastic LHCB5 AT4G10340 C1 (Amber) Chlorophyll(ide) b reductase NOL, chloroplastic NOL AT5G04900 C1 (Amber) Cinnamyl alcohol dehydrogenase 4CL2 AT3G21240 C1 (Amber) Clathrin light chain CLC2 AT2G40060 C1 (Amber) COP1-interacting protein 7 CIP7 AT4G27430 C1 (Amber) Cryptochrome-1 CRY1 AT4G08920 C1 (Amber) CURT1C CURT1C AT1G52220 C1 (Amber) CYP706A5 CYP706A5 AT4G12310 C1 (Amber) Cysteine proteinase inhibitor CYS3 AT2G40880 C1 (Amber) Cysteine synthase OASB AT2G43750 C1 (Amber) Cytidine deaminase 6 CDA6 AT4G29610

260 C1 (Amber) Cytochrome b561 and DOMON domain-containing AT4G12980 AT4G12980 protein At4g12980 C1 (Amber) Cytochrome P450 71B2 CYP71B2 AT1G13080 C1 (Amber) Cytochrome P450 71B34 CYP71B34 AT3G26300 C1 (Amber) Cytochrome P450 71B5 CYP71B5 AT3G53280 C1 (Amber) Cytokinin dehydrogenase 4 CKX4 AT4G29740 C1 (Amber) Dehydrin ERD10 ERD10 AT1G20450 C1 (Amber) Dehydrin ERD14 ERD14 AT1G76180 C1 (Amber) Delta-1-pyrroline-5-carboxylate synthase A P5CSA AT2G39800 C1 (Amber) Dihydrolipoyllysine-residue acetyltransferase EMB3003 AT1G34430 component 5 of pyruvate dehydrogenase complex, chloroplastic C1 (Amber) Dihydropterin pyrophosphokinase / Dihydropteroate AT4G30000 AT4G30000 synthase C1 (Amber) DJ-1 protein homolog F DJ1F AT3G54600 C1 (Amber) DMP2 DMP2 AT3G21550 C1 (Amber) double-stranded DNA-binding family protein AT1G29850 AT1G29850 C1 (Amber) DRT100 DRT100 AT3G12610 C1 (Amber) E3 ubiquitin-protein ligase RGLG1 RGLG1 AT3G01650 C1 (Amber) Early nodulin-like protein 2 ENODL2 AT4G27520 C1 (Amber) ECIP1 AT4G24800 AT4G24800 C1 (Amber) ELI3-1 CAD7 AT4G37980 C1 (Amber) Emb Emb AT5G59080 C1 (Amber) EMB3117 DEGP2 AT2G47940 C1 (Amber) Endoglucanase 10 AtGH9B7 AT1G75680 C1 (Amber) endonuclease 4 ENDO4 AT4G21585 C1 (Amber) Enolase (DUF1399) AT1G56230 AT1G56230 C1 (Amber) Enoyl- MOD1 AT2G05990 C1 (Amber) Ent-kaurene oxidase, chloroplastic KO AT5G25900 C1 (Amber) ERH1 IPCS2 AT2G37940 C1 (Amber) Expansin-A11 EXPA11 AT1G20190

261 C1 (Amber) Expansin-A8 EXPA8 AT2G40610 C1 (Amber) Expansin-B1 EXPB1 AT2G20750 C1 (Amber) Expressed protein AT2G05310 AT2G05310 C1 (Amber) Expressed protein AT2G30930 AT2G30930 C1 (Amber) Extradiol ring-cleavage dioxygenase LIGB AT4G15093 C1 (Amber) F11F12.1 protein AT1G50670 AT1G50670 C1 (Amber) F17L21.9 AT1G27300 AT1G27300 C1 (Amber) F3I6.9 protein AT1G24160 AT1G24160 C1 (Amber) FAD-binding Berberine family protein AT5G44440 AT5G44440 C1 (Amber) FAD/NAD(P)-binding oxidoreductase family protein AT3G09580 AT3G09580 C1 (Amber) Fasciclin-like arabinogalactan protein 1 FLA1 AT5G55730 C1 (Amber) FASCICLIN-like arabinogalactan protein 15 FLA15 AT3G52370 C1 (Amber) Fasciclin-like arabinogalactan protein 2 FLA2 AT4G12730 C1 (Amber) Fasciclin-like arabinogalactan protein 7 FLA7 AT2G04780 C1 (Amber) Fasciclin-like arabinogalactan protein 8 FLA8 AT2G45470 C1 (Amber) Fatty-acid-binding protein 1 FAP1 AT3G63170 C1 (Amber) FLA16 FLA16 AT2G35860 C1 (Amber) Flavin containing amine oxidoreductase family HEMG2 AT5G14220 C1 (Amber) Flavin-containing monooxygenase FMO GS-OX1 FMOGS-OX1 AT1G65860 C1 (Amber) Formate dehydrogenase, mitochondrial FDH1 AT5G14780 C1 (Amber) Fumarylacetoacetase FAH AT1G12050 C1 (Amber) G-type lectin S-receptor-like serine/threonine-protein SD113 AT1G11350 kinase SD1-13 C1 (Amber) gamma-soluble NSF attachment protein GSNAP AT4G20410 C1 (Amber) GDSL esterase/lipase APG APG AT3G16370 C1 (Amber) GDSL esterase/lipase At1g28660 AT1G28660 AT1G28660 C1 (Amber) GDSL esterase/lipase At1g28670 ARAB-1 AT1G28670 C1 (Amber) GDSL esterase/lipase At1g33811 AT1G33811 AT1G33811 C1 (Amber) GDSL esterase/lipase At4g01130 AT4G01130 AT4G01130 C1 (Amber) GDSL esterase/lipase At5g14450 AT5G14450 AT5G14450 C1 (Amber) GDSL-like Lipase/Acylhydrolase superfamily protein AT1G29670 AT1G29670

262 C1 (Amber) general regulatory factor 11 GRF11 AT1G34760 C1 (Amber) Gibberellin-regulated protein 14 GASA14 AT5G14920 C1 (Amber) Glucan endo-1,3-beta-glucosidase 5 AT4G31140 AT4G31140 C1 (Amber) Glucan endo-1,3-beta-glucosidase 6 AT5G58090 AT5G58090 C1 (Amber) Glucose-6-phosphate 1-dehydrogenase 1, G6PD1 AT5G35790 chloroplastic C1 (Amber) Glutamate decarboxylase 2 GAD2 AT1G65960 C1 (Amber) Glutamate synthase 1 GLT1 AT5G53460 C1 (Amber) Glutamate--cysteine ligase, chloroplastic GSH1 AT4G23100 C1 (Amber) Glutathione hydrolase 1 GGT1 AT4G39640 C1 (Amber) Glycerol-3-phosphate dehydrogenase SDP6, SDP6 AT3G10370 mitochondrial C1 (Amber) Glycerophosphodiester phosphodiesterase GDPDL3 GDPDL3 AT4G26690 C1 (Amber) Glycerophosphodiester phosphodiesterase GDPDL4 GDPDL4 AT5G55480 C1 (Amber) Glycoside hydrolase family 2 protein AT3G54440 AT3G54440 C1 (Amber) Glycosyltransferase (Fragment) UGT73B1 AT4G34138 C1 (Amber) Glycosyltransferase (Fragment) UGT76C2 AT5G05860 C1 (Amber) Glycosyltransferase (Fragment) UGT76C5 AT5G05890 C1 (Amber) GPAT4 GPAT4 AT1G01610 C1 (Amber) GPI-anchored protein AT3G18050 AT3G18050 C1 (Amber) Guanosine nucleotide diphosphate dissociation GDI2 AT3G59920 inhibitor C1 (Amber) Haloacid dehalogenase-like hydrolase (HAD) AT1G79790 AT1G79790 superfamily protein C1 (Amber) HAOX2 GLO3 AT3G14150 C1 (Amber) Heavy metal transport/detoxification superfamily AT1G01490 AT1G01490 protein C1 (Amber) Heavy metal-associated isoprenylated plant protein 5 HIPP05 AT2G36950 C1 (Amber) Heteroglycan glucosidase 1 HGL1 AT3G23640 C1 (Amber) Hexosyltransferase GAUT6 AT1G06780 C1 (Amber) HIPP25 HIPP25 AT4G35060

263 C1 (Amber) HIPP26 HIPP26 AT4G38580 C1 (Amber) Homoserine kinase HSK AT2G17265 C1 (Amber) HSP20-like chaperones superfamily protein AT5G20970 AT5G20970 C1 (Amber) HVA22-like protein f HVA22F AT2G42820 C1 (Amber) Importin subunit alpha-9 IMPA9 AT5G03070 C1 (Amber) Integrin-linked protein kinase family AT3G58760 AT3G58760 C1 (Amber) Inter-alpha-trypsin inhibitor heavy chain-like protein AT1G19110 AT1G19110 C1 (Amber) Unknown protein AT5G42765 AT5G42765 C1 (Amber) IQ-domain 11 IQD11 AT5G13460 C1 (Amber) IQ-domain 9 iqd9 AT2G33990 C1 (Amber) ISA1 ISA1 AT2G39930 C1 (Amber) ISA2 ISA2 AT1G03310 C1 (Amber) Jacalin-related lectin 5 JAL5 AT1G52000 C1 (Amber) KAI2 KAI2 AT4G37470 C1 (Amber) KIN2 KIN2 AT5G15970 C1 (Amber) Kinesin-like protein KIN-14U KIN14U AT5G27950 C1 (Amber) Kinesin-like protein KIN-4A KIN4A AT5G47820 C1 (Amber) Kinesin-like protein KIN-7C, mitochondrial KIN7C AT1G21730 C1 (Amber) KS1 GA2 AT1G79460 C1 (Amber) Lactoylglutathione lyase AT1G08110 AT1G08110 C1 (Amber) Leucine-rich repeat (LRR) family protein AT3G15410 AT3G15410 C1 (Amber) Leucine-rich repeat (LRR) family protein AT3G20820 AT3G20820 C1 (Amber) Leucine-rich repeat extensin-like protein 5 LRX5 AT4G18670 C1 (Amber) Leucine-rich repeat protein kinase family protein AT1G10850 AT1G10850 C1 (Amber) Leucine-rich repeat protein kinase family protein AT2G27060 AT2G27060 C1 (Amber) Unknown protein AT1G22060 AT1G22060 C1 (Amber) Low-temperature-induced 78 kDa protein RD29A AT5G52310 C1 (Amber) LQY1 LQY1 AT1G75690 C1 (Amber) Lupeol synthase 1 LUP1 AT1G78970 C1 (Amber) Lycopene epsilon cyclase, chloroplastic LUT2 AT5G57030 C1 (Amber) LYP2 LYM1 AT1G21880

264 C1 (Amber) magnesium-protoporphyrin IX methyltransferase CHLM AT4G25080 C1 (Amber) Major latex protein, putative AT3G26450 AT3G26450 C1 (Amber) Mannan endo-1,4-beta-mannosidase 6 MAN6 AT5G01930 C1 (Amber) Mannose-binding lectin superfamily protein RTM1 AT1G05760 C1 (Amber) Membrane-associated protein VIPP1, chloroplastic VIPP1 AT1G65260 C1 (Amber) Methylcrotonoyl-CoA carboxylase subunit alpha, MCCA AT1G03090 mitochondrial C1 (Amber) Methylesterase 10 MES10 AT3G50440 C1 (Amber) Mitochondrial outer membrane protein porin 4 VDAC4 AT5G57490 C1 (Amber) Mitochondrial substrate carrier family protein AT5G07320 AT5G07320 C1 (Amber) MLP-like protein 28 MLP28 AT1G70830 C1 (Amber) MLP-like protein 43 MLP43 AT1G70890 C1 (Amber) Monocopper oxidase-like protein SKU5 SKU5 AT4G12420 C1 (Amber) Monooxygenase 2 MO2 AT4G38540 C1 (Amber) myo-inositol monophosphatase like 2 IMPL2 AT4G39120 C1 (Amber) Myosin heavy chain-related protein AT5G41140 AT5G41140 C1 (Amber) Myrosinase 2 TGG2 AT5G25980 C1 (Amber) N-(5'-phosphoribosyl)anthranilate isomerase 1, PAI1 AT1G07780 chloroplastic C1 (Amber) NAD(P)-binding Rossmann-fold superfamily protein AT3G55290 AT3G55290 C1 (Amber) NAD(P)H-quinone oxidoreductase subunit M, NDHM AT4G37925 chloroplastic C1 (Amber) NAD(P)H-quinone oxidoreductase subunit S, ndhS AT4G23890 chloroplastic C1 (Amber) NADPH-dependent alkenal/one oxidoreductase, AOR AT1G23740 chloroplastic C1 (Amber) NdhN ndhN AT5G58260 C1 (Amber) NdhU ndhU AT5G21430 C1 (Amber) Neurofilament protein-like protein AT3G05900 AT3G05900 C1 (Amber) Non-specific lipid transfer protein GPI-anchored 1 LTPG1 AT1G27950 C1 (Amber) Non-specific lipid-transfer protein 3 LTP3 AT5G59320

265 C1 (Amber) Non-specific lipid-transfer protein-like protein MHJ24.6 AT5G64080 At5g64080 C1 (Amber) Novel plant SNARE 12 NPSN12 AT1G48240 C1 (Amber) Nucleobase-ascorbate transporter 6 NAT6 AT5G62890 C1 (Amber) O-fucosyltransferase 36 OFUT36 AT5G50420 C1 (Amber) O-fucosyltransferase family protein AT1G53770 AT1G53770 C1 (Amber) O-Glycosyl hydrolases family 17 protein AT5G20870 AT5G20870 C1 (Amber) Outer arm dynein light chain 1 protein AIR9 AT2G34680 C1 (Amber) Oxygen-evolving enhancer protein 1-1, chloroplastic PSBO1 AT5G66570 C1 (Amber) Oxygen-evolving enhancer protein 2-1, chloroplastic PSBP1 AT1G06680 C1 (Amber) Oxygen-evolving enhancer protein 3-2, chloroplastic PSBQ2 AT4G05180 C1 (Amber) P-loop containing nucleoside triphosphate hydrolases AT4G28000 AT4G28000 superfamily protein C1 (Amber) Patched family protein AT1G42470 AT1G42470 C1 (Amber) Patched family protein AT4G38350 AT4G38350 C1 (Amber) Patellin-1 PATL1 AT1G72150 C1 (Amber) Patellin-2 PATL2 AT1G22530 C1 (Amber) Patellin-3 PATL3 AT1G72160 C1 (Amber) Patellin-4 PATL4 AT1G30690 C1 (Amber) Pectate lyase AT1G04680 AT1G04680 C1 (Amber) Pectate lyase AT3G09540 AT3G09540 C1 (Amber) Pectin acetylesterase 11 PAE11 AT5G45280 C1 (Amber) Pectin acetylesterase 12 PAE12 AT3G05910 C1 (Amber) Pectin acetylesterase 3 PAE3 AT2G46930 C1 (Amber) Pectin lyase-like superfamily protein AT1G23460 AT1G23460 C1 (Amber) Pectin lyase-like superfamily protein AT5G49215 AT5G49215 C1 (Amber) Pectinesterase PME1 AT1G53840 C1 (Amber) Pectinesterase PME35 AT3G59010 C1 (Amber) Pentatricopeptide repeat-containing protein AT5G02860 AT5G02860 At5g02860 C1 (Amber) Peptide methionine sulfoxide reductase B5 MSRB5 AT4G04830

266 C1 (Amber) Peptidyl-prolyl cis-trans isomerase CYP19-4 CYP19-4 AT2G29960 C1 (Amber) Peptidyl-prolyl cis-trans isomerase CYP37, CYP37 AT3G15520 chloroplastic C1 (Amber) Peptidyl-prolyl cis-trans isomerase FKBP16-1, FKBP16-1 AT4G26555 chloroplastic C1 (Amber) Peroxidase PER12 AT1G71695 C1 (Amber) Peroxidase 31 PER31 AT3G28200 C1 (Amber) Peroxidase 42 PER42 AT4G21960 C1 (Amber) PGR5-like protein 1B, chloroplastic PGRL1B AT4G11960 C1 (Amber) PGS1 PGPS1 AT2G39290 C1 (Amber) Phenazine biosynthesis PhzC/PhzF protein AT4G02860 AT4G02860 C1 (Amber) Phosphoinositide phospholipase C PLC2 AT3G08510 C1 (Amber) Phospholipase D delta PLDDELTA AT4G35790 C1 (Amber) Phospholipid scramblase AT2G04940 AT2G04940 C1 (Amber) Phosphoserine phosphatase, chloroplastic PSP AT1G18640 C1 (Amber) Phosphotransferase HXK2 AT2G19860 C1 (Amber) Photosynthetic NDH subunit of subcomplex B 1, PNSB1 AT1G15980 chloroplastic C1 (Amber) Photosynthetic NDH subunit of subcomplex B 3, PNSB3 AT3G16250 chloroplastic C1 (Amber) Photosynthetic NDH subunit of subcomplex B 4, PNSB4 AT1G18730 chloroplastic C1 (Amber) Photosystem I P700 chlorophyll a apoprotein A2 PSAB NA C1 (Amber) Photosystem I reaction center subunit II-1, PSAD1 AT4G02770 chloroplastic C1 (Amber) Photosystem I reaction center subunit IV B, PSAE2 AT2G20260 chloroplastic C1 (Amber) Photosystem I reaction center subunit PSI-N, PSAN AT5G64040 chloroplast, putative / PSI-N, putative (PSAN) C1 (Amber) Photosystem II CP43 reaction center protein PSBC NA C1 (Amber) Photosystem II CP47 reaction center protein PSBB NA

267 C1 (Amber) Photosystem II D2 protein PSBD NA C1 (Amber) photosystem II light harvesting complex gene 2.1 LHCB2.1 AT2G05100 C1 (Amber) Phototropin-2 PHOT2 AT5G58140 C1 (Amber) PIP1D PIP1-5 AT4G23400 C1 (Amber) PIP2A PIP2-1 AT3G53420 C1 (Amber) Plant intracellular Ras-group-related LRR protein 4 PIRL4 AT4G35470 C1 (Amber) Plant L-ascorbate oxidase AT5G21105 AT5G21105 C1 (Amber) Plant UBX domain-containing protein 7 PUX7 AT1G14570 C1 (Amber) Plasma membrane fusion protein AT2G12400 AT2G12400 C1 (Amber) Plasma membrane intrinsic protein 1B PIP1B AT2G45960 C1 (Amber) plasma membrane intrinsic protein 2 PIP2B AT2G37170 C1 (Amber) plasma-membrane associated cation-binding protein 1 PCAP1 AT4G20260 C1 (Amber) Plastidic glucose transporter 4 GLT1 AT5G16150 C1 (Amber) plastocyanin 1 PETE1 AT1G76100 C1 (Amber) Plastocyanin major isoform, chloroplastic DRT112 AT1G20340 C1 (Amber) PLAT domain-containing protein 2 PLAT2 AT2G22170 C1 (Amber) PnsB5 PNSB5 AT5G43750 C1 (Amber) Potassium transporter 10 POT10 AT1G31120 C1 (Amber) Probable acyl-activating enzyme 1, peroxisomal AAE1 AT1G20560 C1 (Amber) Probable aldo-keto reductase 4 ATB2 AT1G60710 C1 (Amber) Probable aquaporin PIP2-6 PIP2-6 AT2G39010 C1 (Amber) Probable beta-D-xylosidase 5 BXL5 AT3G19620 C1 (Amber) Probable beta-D-xylosidase 7 BXL7 AT1G78060 C1 (Amber) Probable calcium-binding protein CML14 CML14 AT1G62820 C1 (Amber) Probable calcium-binding protein CML26 CML26 AT1G73630 C1 (Amber) Probable carboxylesterase 5 CXE5 AT1G49660 C1 (Amber) Probable carboxylesterase SOBER1-like SOBER1 AT4G22300 C1 (Amber) Probable cinnamyl alcohol dehydrogenase 9 CAD9 AT4G39330 C1 (Amber) Probable cysteine protease RDL2 RDL2 AT3G19400 C1 (Amber) Probable ethanolamine kinase EMB1187 AT2G26830 C1 (Amber) Probable F-actin-capping protein subunit beta AT1G71790 AT1G71790

268 C1 (Amber) Probable gamma-glutamyl hydrolase 3 GGH3 AT1G78670 C1 (Amber) Probable inactive purple acid phosphatase 2 PAP2 AT1G13900 C1 (Amber) Probable inactive receptor kinase At3g02880 AT3G02880 AT3G02880 C1 (Amber) Probable inactive receptor kinase At5g10020 AT5G10020 AT5G10020 C1 (Amber) Probable inactive receptor kinase At5g16590 LRR1 AT5G16590 C1 (Amber) Probable metal-nicotianamine transporter YSL6 YSL6 AT3G27020 C1 (Amber) Probable methyltransferase PMT22 AT3G56080 AT3G56080 C1 (Amber) Probable methyltransferase PMT28 AT1G19430 AT1G19430 C1 (Amber) Probable methyltransferase PMT8 AT1G04430 AT1G04430 C1 (Amber) Probable pectate lyase 18 AT4G24780 AT4G24780 C1 (Amber) Probable pectate lyase 20 AT5G48900 AT5G48900 C1 (Amber) Probable pectate lyase 22 AT5G63180 AT5G63180 C1 (Amber) Probable pectate lyase 8 AT3G07010 AT3G07010 C1 (Amber) Probable pectin methyltransferase QUA2 QUA2 AT1G78240 C1 (Amber) Probable pectinesterase/pectinesterase inhibitor 64 PME64 AT5G64640 C1 (Amber) Probable peroxygenase 4 PXG4 AT1G70670 C1 (Amber) Probable protein phosphatase 2C 26 AT2G30170 AT2G30170 C1 (Amber) Probable protein phosphatase 2C 76 AT5G53140 AT5G53140 C1 (Amber) Probable purine permease 23 PUP23 AT1G57980 C1 (Amber) Probable receptor-like protein kinase At1g30570 HERK2 AT1G30570 C1 (Amber) Probable xyloglucan endotransglucosylase/hydrolase XTH7 AT4G37800 protein 7 C1 (Amber) Proline-tRNA ligase (DUF1680) AT5G12950 AT5G12950 C1 (Amber) Protein CELLULOSE SYNTHASE INTERACTIVE 3 CSI3 AT1G77460 C1 (Amber) Protein COFACTOR ASSEMBLY OF COMPLEX C CCB2 AT5G52110 SUBUNIT B CCB2, chloroplastic C1 (Amber) Protein COFACTOR ASSEMBLY OF COMPLEX C CCB4 AT1G59840 SUBUNIT B CCB4, chloroplastic C1 (Amber) Protein CURVATURE THYLAKOID 1A, CURT1A AT4G01150 chloroplastic C1 (Amber) Protein ECERIFERUM 26-like CER26L AT3G23840

269 C1 (Amber) Protein IQ-DOMAIN 31 IQD31 AT1G74690 C1 (Amber) Protein kinase superfamily protein AT1G79640 AT1G79640 C1 (Amber) Protein kinase superfamily protein AT3G26700 AT3G26700 C1 (Amber) protein kinase-related AT1G66940 AT1G66940 C1 (Amber) Protein KINESIN LIGHT CHAIN-RELATED 1 KLCR1 AT4G10840 C1 (Amber) Protein KINKY POLLEN KIP AT5G49680 C1 (Amber) Protein NRT1/ PTR FAMILY 1.2 NPF1.2 AT1G52190 C1 (Amber) Protein NRT1/ PTR FAMILY 6.4 NPF6.4 AT3G21670 C1 (Amber) Protein NRT1/ PTR FAMILY 8.1 NPF8.1 AT3G54140 C1 (Amber) Protein NRT1/ PTR FAMILY 8.2 NPF8.2 AT5G01180 C1 (Amber) Protein of unknown function (DUF1336) AT5G35180 AT5G35180 C1 (Amber) Protein of unknown function, DUF538 AT3G07460 AT3G07460 C1 (Amber) Protein OSCA1 OSCA1 AT4G04340 C1 (Amber) Protein PLASTID MOVEMENT IMPAIRED 1 PMI1 AT1G42550 C1 (Amber) Protein PLASTID TRANSCRIPTIONALLY ACTIVE PTAC16 AT3G46780 16, chloroplastic C1 (Amber) Protein RETICULATA-RELATED 2, chloroplastic RER2 AT3G08630 C1 (Amber) Protein RNA-directed DNA methylation 3 RDM3 AT5G04290 C1 (Amber) Protein STICHEL-like 3 AT4G18820 AT4G18820 C1 (Amber) Protein STRICTOSIDINE SYNTHASE-LIKE 1 SSL1 AT2G41300 C1 (Amber) Protein TONNEAU 1b TON1B AT3G55005 C1 (Amber) Protein TRANSPARENT TESTA 9 TT9 AT3G28430 C1 (Amber) Protein trichome birefringence-like 38 TBL38 AT1G29050 C1 (Amber) Protein WVD2-like 4 WDL4 AT2G35880 C1 (Amber) PsbP domain-containing protein 4, chloroplastic PPD4 AT1G77090 C1 (Amber) Pumilio homolog 23 APUM23 AT1G72320 C1 (Amber) Putative extensin AT2G46630 AT2G46630 C1 (Amber) Putative pectinesterase sks9 AT4G38420 C1 (Amber) Putative RNA methyltransferase At5g10620 AT5G10620 AT5G10620 C1 (Amber) Putative uncharacterized protein AT3g24100 AT3G24100 AT3G24100

270 C1 (Amber) Putative WEB family protein At1g65010, AT1G65010 AT1G65010 chloroplastic C1 (Amber) Pyridoxal phosphate (PLP)-dependent transferases AT2G23520 AT2G23520 superfamily protein C1 (Amber) RAB7A RABG2 AT2G21880 C1 (Amber) RABB1C RABB1C AT4G17170 C1 (Amber) Ran-binding protein 1 homolog b RANBP1B AT2G30060 C1 (Amber) Ras-related protein RABA1f RABA1F AT5G60860 C1 (Amber) Ras-related protein RABG3b RABG3B AT1G22740 C1 (Amber) RD17 COR47 AT1G20440 C1 (Amber) Receptor protein kinase TMK1 TMK1 AT1G66150 C1 (Amber) Receptor-like kinase TMK4 TMK4 AT3G23750 C1 (Amber) Receptor-like protein 51 RLP51 AT4G18760 C1 (Amber) Remorin DBP AT2G45820 C1 (Amber) Remorin 4.2 REM4.2 AT2G41870 C1 (Amber) Remorin family protein AT5G23750 AT5G23750 C1 (Amber) Reticulon family protein AT3G10260 AT3G10260 C1 (Amber) Rhodanese/Cell cycle control phosphatase superfamily AT3G59780 AT3G59780 protein C1 (Amber) RNA-binding (RRM/RBD/RNP motifs) family protein AT1G76460 AT1G76460 C1 (Amber) RNA-directed DNA methylation 4 RDM4 AT2G30280 C1 (Amber) Root phototropism protein 3 RPT3 AT5G64330 C1 (Amber) RPT1 PHOT1 AT3G45780 C1 (Amber) S-adenosyl-L-methionine-dependent AT3G05100 AT3G05100 methyltransferases superfamily protein C1 (Amber) S-adenosyl-L-methionine-dependent AT3G21950 AT3G21950 methyltransferases superfamily protein C1 (Amber) SBE2.1 SBE2.1 AT2G36390 C1 (Amber) Selenium-binding protein 1 SBP1 AT4G14030 C1 (Amber) SEOR1 SEOB AT3G01680 C1 (Amber) Serine carboxypeptidase-like 11 SCPL11 AT2G22970

271 C1 (Amber) Serine carboxypeptidase-like 13 SCPL13 AT2G22980 C1 (Amber) Serine carboxypeptidase-like 25 SCPL25 AT3G02110 C1 (Amber) Serine carboxypeptidase-like 34 SCPL34 AT5G23210 C1 (Amber) Serine carboxypeptidase-like 50 SCPL50 AT1G15000 C1 (Amber) Serine racemase SR AT4G11640 C1 (Amber) Serine/threonine-protein kinase WNK1 WNK1 AT3G04910 C1 (Amber) SH3 domain-containing protein 3 SH3P3 AT4G18060 C1 (Amber) Shikimate O-hydroxycinnamoyltransferase HST AT5G48930 C1 (Amber) Sialyltransferase-like protein 1 SIA1 AT1G08660 C1 (Amber) Sialyltransferase-like protein 2 SIA2 AT3G48820 C1 (Amber) Sieve element occlusion protein AT3G01670 AT3G01670 C1 (Amber) Signal recognition particle 43 kDa protein, CAO AT2G47450 chloroplastic C1 (Amber) SKP1-like protein 1B SKP1B AT5G42190 C1 (Amber) Sks17 sks17 AT5G66920 C1 (Amber) Sks5 sks5 AT1G76160 C1 (Amber) SKS6 SKS6 AT1G41830 C1 (Amber) SNF1-related protein kinase regulatory subunit KING1 AT3G48530 gamma-1 C1 (Amber) Spermidine synthase 2 SPDSYN2 AT1G70310 C1 (Amber) SRK2G SRK2G AT5G08590 C1 (Amber) Sterol 3-beta-glucosyltransferase UGT80A2 UGT80A2 AT3G07020 C1 (Amber) STRUBBELIG-receptor family 6 SRF6 AT1G53730 C1 (Amber) SUB1 SUB1 AT4G08810 C1 (Amber) Subtilisin-like protease SBT1.4 SBT1.4 AT3G14067 C1 (Amber) Subtilisin-like protease SBT1.7 SBT1.7 AT5G67360 C1 (Amber) Subtilisin-like protease SBT3.13 SBT3.13 AT4G21650 C1 (Amber) Subtilisin-like protease SBT4.1 SBT4.1 AT2G39850 C1 (Amber) Subtilisin-like protease SBT4.14 SBT4.14 AT4G00230 C1 (Amber) Sugar transporter ERD6-like 1 SUGTL4 AT1G08890 C1 (Amber) Sulfoquinovosyl transferase SQD2 SQD2 AT5G01220

272 C1 (Amber) Sulfotransferase SOT11 AT2G03750 C1 (Amber) Synaptotagmin-5 SYT5 AT1G05500 C1 (Amber) SYNC2_ARATH SYNC2 AT3G07420 C1 (Amber) Syntaxin of plants 132 SYP132 AT5G08080 C1 (Amber) T31J12.3 protein AT1G09310 AT1G09310 C1 (Amber) T7N9.21 AT1G27150 AT1G27150 C1 (Amber) TBL24 TBL24 AT4G23790 C1 (Amber) Tetraspanin-18 TOM2AH2 AT2G20230 C1 (Amber) Tetraspanin-2 TET2 AT2G19580 C1 (Amber) Tetraspanin-3 TET3 AT3G45600 C1 (Amber) Tetratricopeptide repeat (TPR)-like superfamily AT5G53490 AT5G53490 protein C1 (Amber) TGG1 TGG1 AT5G26000 C1 (Amber) Thioredoxin H3 TRX3 AT5G42980 C1 (Amber) Thioredoxin superfamily protein AT5G65840 AT5G65840 C1 (Amber) Thioredoxin-like protein CXXS1 CXXS1 AT1G11530 C1 (Amber) Thiosulfate sulfurtransferase 16, chloroplastic STR16 AT5G66040 C1 (Amber) Threonine synthase 2, chloroplastic TS2 AT1G72810 C1 (Amber) TLDc domain protein AT1G32520 AT1G32520 C1 (Amber) TLP18.3 TLP18.3 AT1G54780 C1 (Amber) TMP-B PIP1-3 AT1G01620 C1 (Amber) Tobamovirus multiplication protein 2A TOM2A AT1G32400 C1 (Amber) Transcription factor bHLH122 BHLH122 AT1G51140 C1 (Amber) Translation initiation factor IF3-4, chloroplastic IF3-4 AT4G30690 C1 (Amber) Transmembrane protein AT5G52420 AT5G52420 C1 (Amber) triacylglycerol lipase-like 1 ATTLL1 AT1G45201 C1 (Amber) Tubulin alpha-2 chain TUBA4 AT1G04820 C1 (Amber) Tubulin beta chain TUBB6 AT5G12250 C1 (Amber) Tubulin beta-4 chain TUBB4 AT5G44340 C1 (Amber) UBDK GAMMA 7 PI4KG7 AT2G03890 C1 (Amber) Ubiquitin carboxyl-terminal hydrolase 26 UBP26 AT3G49600

273 C1 (Amber) Ubiquitin receptor RAD23c RAD23C AT3G02540 C1 (Amber) UDP-glycosyltransferase 72D1 UGT72D1 AT2G18570 C1 (Amber) UDP-glycosyltransferase 76C1 UGT76C1 AT5G05870 C1 (Amber) UDP-glycosyltransferase 88A1 UGT88A1 AT3G16520 C1 (Amber) Uncharacterized protein At3g55240 AT3G55240 AT3G55240 C1 (Amber) Uncharacterized protein At3g61260 AT3G61260 AT3G61260 C1 (Amber) Uncharacterized protein At5g11420 AT5G11420 AT5G11420 C1 (Amber) Uncharacterized TPR repeat-containing protein AT1G05150 AT1G05150 At1g05150 C1 (Amber) unknown protein AT1G70100 AT1G70100 C1 (Amber) unknown protein AT5G40450 AT5G40450 C1 (Amber) unknown protein AT5G59960 AT5G59960 C1 (Amber) unknown protein AT2G04039 AT2G04039 C1 (Amber) unknown protein AT4G33640 AT4G33640 C1 (Amber) Ureidoglycolate hydrolase UAH AT5G43600 C1 (Amber) Vacuolar cation/proton exchanger CAX1 AT2G38170 C1 (Amber) VAM3 SYP22 AT5G46860 C1 (Amber) VC2 CER2 AT4G24510 C1 (Amber) vesicle-associated membrane protein 713 ATVAMP713 AT5G11150 C1 (Amber) Vesicle-associated protein 4-3 PVA43 AT4G05060 C1 (Amber) Villin-3 VLN3 AT3G57410 C1 (Amber) VLN2 VLN2 AT2G41740 C1 (Amber) Voltage-dependent L-type calcium channel subunit AT5G16550 AT5G16550 C1 (Amber) Wall-associated receptor kinase carboxy-terminal AT3G17350 AT3G17350 protein C1 (Amber) WCRKC thioredoxin 1 WCRKC1 AT5G06690 C1 (Amber) WEB family protein At5g16730, chloroplastic AT5G16730 AT5G16730 C1 (Amber) WLIM2a WLIN2A AT2G39900 C1 (Amber) Xyloglucan endotransglucosylase/hydrolase protein 4 XTH4 AT2G06850 C2 (Red-Blue) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase AT3G19010 AT3G19010 superfamily protein

274 C2 (Red-Blue) 26S proteasome regulatory particle chain RPT6-like AT5G53540 AT5G53540 protein C2 (Red-Blue) 60S ribosomal protein L18a-1 RPL18AA AT1G29965 C2 (Red-Blue) A_TM021B04.14 protein AT5G27280 AT5G27280 C2 (Red-Blue) AAA-ATPase At1g43910 AT1G43910 AT1G43910 C2 (Red-Blue) AAA-ATPase At3g28510 AT3G28510 AT3G28510 C2 (Red-Blue) AAA-ATPase At3g28540 AT3G28540 AT3G28540 C2 (Red-Blue) AAA-ATPase At3g28580 AT3G28580 AT3G28580 C2 (Red-Blue) AAA-ATPase At5g17760 AT5G17760 AT5G17760 C2 (Red-Blue) ABC transporter B family member 27 ABCB27 AT5G39040 C2 (Red-Blue) ABC transporter C family member 1 ABCC1 AT1G30400 C2 (Red-Blue) ABC transporter C family member 11 ABCC11 AT1G30420 C2 (Red-Blue) ABC transporter C family member 4 ABCC4 AT2G47800 C2 (Red-Blue) ABC transporter I family member 19 ABCI19 AT1G03905 C2 (Red-Blue) ACA2 ACA2 AT4G37640 C2 (Red-Blue) acireductone dioxygenase 3 ARD AT2G26400 C2 (Red-Blue) Actin cross-linking protein (DUF569) AT1G59710 AT1G59710 C2 (Red-Blue) Acyl-CoA N-acyltransferases (NAT) superfamily AT2G32030 AT2G32030 protein C2 (Red-Blue) Acyl-coenzyme A oxidase ACX2 AT5G65110 C2 (Red-Blue) Adenylate kinase 1, chloroplastic ADK AT2G37250 C2 (Red-Blue) ADP,ATP carrier protein 1, chloroplastic AATP1 AT1G80300 C2 (Red-Blue) Agmatine deiminase AIH AT5G08170 C2 (Red-Blue) AL3 AL3 AT3G42790 C2 (Red-Blue) alanine aminotransferase 2 ALAAT2 AT1G72330 C2 (Red-Blue) Alpha-1,6-mannosyl-glycoprotein 2-beta-N- GNT2 AT2G05320 acetylglucosaminyltransferase C2 (Red-Blue) Alpha-glucan water dikinase 1, chloroplastic GWD1 AT1G10760 C2 (Red-Blue) Alpha/beta-Hydrolases superfamily protein AT1G74300 AT1G74300 C2 (Red-Blue) alpha/beta-Hydrolases superfamily protein AT5G11910 AT5G11910 C2 (Red-Blue) Alpha/beta-Hydrolases superfamily protein AT5G24210 AT5G24210

275 C2 (Red-Blue) Amine oxidase AT4G12290 AT4G12290 C2 (Red-Blue) Ammonium transporter AMT1-1 AT4G13510 C2 (Red-Blue) Ankyrin repeat family protein AT4G03450 AT4G03450 C2 (Red-Blue) Ankyrin repeat family protein AT5G54720 AT5G54720 C2 (Red-Blue) Ankyrin repeat-containing protein BDA1 BAD1 AT5G54610 C2 (Red-Blue) Ankyrin repeat-containing protein ITN1 ITN1 AT3G12360 C2 (Red-Blue) Appr-1-p processing enzyme family protein AT2G40600 AT2G40600 C2 (Red-Blue) ARM repeat superfamily protein AT1G51350 AT1G51350 C2 (Red-Blue) Aspartyl protease AED1 AED1 AT5G10760 C2 (Red-Blue) At1g05270 AT1G05270 AT1G05270 C2 (Red-Blue) At1g14000 VIK AT1G14000 C2 (Red-Blue) AT1G14820 protein AT1G14820 AT1G14820 C2 (Red-Blue) At1g25420/F2J7_16 AT1G25420 AT1G25420 C2 (Red-Blue) At1g36320/F7F23_4 AT1G36320 AT1G36320 C2 (Red-Blue) At1g55530/T5A14_7 AT1G55530 AT1G55530 C2 (Red-Blue) At1g70000 AT1G70000 AT1G70000 C2 (Red-Blue) At2g29070 AT2G29070 AT2G29070 C2 (Red-Blue) At2g37110 AT2G37110 AT2G37110 C2 (Red-Blue) At2g46420/F11C10.11 AT2G46420 AT2G46420 C2 (Red-Blue) AT3G03890 protein AT3G03890 AT3G03890 C2 (Red-Blue) At3g04210/T6K12_17 AT3G04210 AT3G04210 C2 (Red-Blue) AT3g05760/F10A16_5 AT3G05760 AT3G05760 C2 (Red-Blue) At3g09490 AT3G09490 AT3G09490 C2 (Red-Blue) AT3g14620/MIE1_12 CYP72A8 AT3G14620 C2 (Red-Blue) AT3g18370/MYF24_8 SYTF AT3G18370 C2 (Red-Blue) AT3g29240/MXO21_9 AT3G29240 AT3G29240 C2 (Red-Blue) At3g55470 AT3G55470 AT3G55470 C2 (Red-Blue) At3g60420 Q9M217 At3g60420 C2 (Red-Blue) At3g62810 AT3G62810 AT3G62810 C2 (Red-Blue) At4g03260 AT4G03260 AT4G03260 C2 (Red-Blue) AT4G10590 protein UBP9 AT4G10590

276 C2 (Red-Blue) AT4g17070/dl4565c AT4G17070 AT4G17070 C2 (Red-Blue) At4g24330 AT4G24330 AT4G24330 C2 (Red-Blue) AT4g26130/F20B18_240 AT4G26130 AT4G26130 C2 (Red-Blue) At4g32870 AT4G32870 AT4G32870 C2 (Red-Blue) AT4g34150/F28A23_90 AT4G34150 AT4G34150 C2 (Red-Blue) At4g39830 AT4G39830 AT4G39830 C2 (Red-Blue) AT5g08500/MAH20_6 AT5G23575 AT5G23575 C2 (Red-Blue) At5g22060 ATJ2 AT5G22060 C2 (Red-Blue) At5g44820 AT5G44820 AT5G44820 C2 (Red-Blue) At5g46230 AT5G46230 AT5G46230 C2 (Red-Blue) At5g55460 AT5G55460 AT5G55460 C2 (Red-Blue) AT5g58110/k21l19_90 AT5G58110 AT5G58110 C2 (Red-Blue) ATP-dependent zinc metalloprotease FTSH 10, FTSH10 AT1G07510 mitochondrial C2 (Red-Blue) ATP-dependent zinc metalloprotease FTSH 11, FTSH11 AT5G53170 chloroplastic/mitochondrial C2 (Red-Blue) ATP-dependent zinc metalloprotease FTSH 3, FTSH3 AT2G29080 mitochondrial C2 (Red-Blue) ATP-dependent zinc metalloprotease FTSH 4, FTSH4 AT2G26140 mitochondrial C2 (Red-Blue) Autophagy protein 5 ATG5 AT5G17290 C2 (Red-Blue) Autophagy-related protein ATG8D AT2G05630 C2 (Red-Blue) Autophagy-related protein ATG8I AT3G15580 C2 (Red-Blue) Basic leucine zipper 25 BZIP25 AT3G54620 C2 (Red-Blue) Bax inhibitor 1 BI-1 AT5G47120 C2 (Red-Blue) Beta-1,3-glucanase 2 BGL2 AT3G57260 C2 (Red-Blue) Beta-fructofuranosidase, insoluble isoenzyme CWINV6 AT5G11920 CWINV6 C2 (Red-Blue) C2 calcium/lipid-binding plant AT4G00700 AT4G00700 phosphoribosyltransferase family protein C2 (Red-Blue) CAD1 CAD1 AT1G72680

277 C2 (Red-Blue) Calcineurin-like metallo-phosphoesterase superfamily AT3G09970 AT3G09970 protein C2 (Red-Blue) calcium-binding EF hand family protein AT5G28830 AT5G28830 C2 (Red-Blue) Calcium-dependent protein kinase 10 CPK10 AT1G18890 C2 (Red-Blue) Calcium-dependent protein kinase 28 CPK28 AT5G66210 C2 (Red-Blue) Calcium-dependent protein kinase 4 CPK4 AT4G09570 C2 (Red-Blue) Calcium-transporting ATPase ACA1 AT1G27770 C2 (Red-Blue) Calcium-transporting ATPase 10, plasma membrane- ACA10 AT4G29900 type C2 (Red-Blue) Calmodulin-binding protein 60 B CBP60B AT5G57580 C2 (Red-Blue) Calmodulin-binding protein 60 G CBP60G AT5G26920 C2 (Red-Blue) Calmodulin-binding receptor-like cytoplasmic kinase CRCK3 AT2G11520 3 C2 (Red-Blue) Calmodulin-binding transcription activator 3 CAMTA3 AT2G22300 C2 (Red-Blue) Calmodulin-like protein 12 CML12 AT2G41100 C2 (Red-Blue) Calreticulin-2 CRT2 AT1G09210 C2 (Red-Blue) Calreticulin-3 CRT3 AT1G08450 C2 (Red-Blue) CAN1 CAN1 AT3G56170 C2 (Red-Blue) CBS domain-containing protein CBSCBSPB3 CBSCBSPB3 AT3G52950 C2 (Red-Blue) Cell division control protein 48 homolog D CDC48D AT3G53230 C2 (Red-Blue) Cell division control protein 48 homolog E CDC48E AT5G03340 C2 (Red-Blue) Chalcone synthase family protein CHS AT5G13930 C2 (Red-Blue) CHI CHI AT2G43570 C2 (Red-Blue) Chlorophyll a-b binding protein, chloroplastic LHCB4.3 AT2G40100 C2 (Red-Blue) CHR20 ATRX AT1G08600 C2 (Red-Blue) Cinnamoyl-CoA reductase 1 CCR1 AT1G15950 C2 (Red-Blue) Clathrin light chain 3 AT3G51890 AT3G51890 C2 (Red-Blue) Copine (Calcium-dependent phospholipid-binding AT1G67800 AT1G67800 protein) family C2 (Red-Blue) Copper-transporting ATPase RAN1 RAN1 AT5G44790 C2 (Red-Blue) CPK3 CPK3 AT4G23650

278 C2 (Red-Blue) Crooked neck protein, putative / cell cycle protein AT5G41770 AT5G41770 C2 (Red-Blue) CTC-interacting domain 11 CID11 AT1G32790 C2 (Red-Blue) Curculin-like (Mannose-binding) lectin family protein AT5G18470 AT5G18470 C2 (Red-Blue) Cysteine--tRNA ligase 2, cytoplasmic AT5G38830 AT5G38830 C2 (Red-Blue) Cysteine-rich receptor-like protein kinase 14 CRK14 AT4G23220 C2 (Red-Blue) Cysteine-rich receptor-like protein kinase 7 CRK7 AT4G23150 C2 (Red-Blue) cysteine-rich RLK (RECEPTOR-like protein kinase) 6 CRK6 AT4G23140 C2 (Red-Blue) Cysteine/Histidine-rich C1 domain family protein AT2G27660 AT2G27660 C2 (Red-Blue) Cytochrome P450 71B20 CYP71B20 AT3G26180 C2 (Red-Blue) Cytochrome P450 71B23 CYP71B23 AT3G26210 C2 (Red-Blue) Cytochrome P450 71B24 CYP71B24 AT3G26230 C2 (Red-Blue) Cytochrome P450 71B3 CYP71B3 AT3G26220 C2 (Red-Blue) Cytochrome P450 71B6 CYP71B6 AT2G24180 C2 (Red-Blue) Cytochrome P450, family 89, subfamily A, CYP89A5 AT1G64950 polypeptide 5 C2 (Red-Blue) DCD (Development and Cell Death) domain protein BON1 AT5G61910 C2 (Red-Blue) DEAD-box ATP-dependent RNA helicase 14 RH14 AT3G01540 C2 (Red-Blue) DEAD-box ATP-dependent RNA helicase 24 RH24 AT2G47330 C2 (Red-Blue) DEAD-box ATP-dependent RNA helicase 53, RH53 AT3G22330 mitochondrial C2 (Red-Blue) Decapping nuclease DXO homolog, chloroplastic AT4G17620 AT4G17620 C2 (Red-Blue) Dentin sialophosphoprotein-like protein AT5G52530 AT5G52530 C2 (Red-Blue) DHNAT1 DHNAT1 AT1G48320 C2 (Red-Blue) Disease resistance protein (TIR-NBS class) AT1G66090 AT1G66090 C2 (Red-Blue) Disease resistance protein (TIR-NBS-LRR class) AT1G69550 AT1G69550 C2 (Red-Blue) Disease resistance protein (TIR-NBS-LRR class) AT4G19510 AT4G19510 C2 (Red-Blue) Disease resistance protein (TIR-NBS-LRR class) AT1G31540 AT1G31540 family C2 (Red-Blue) Disease resistance protein (TIR-NBS-LRR class) AT1G56520 AT1G56520 family

279 C2 (Red-Blue) Disease resistance protein (TIR-NBS-LRR class) AT5G41750 AT5G41750 family C2 (Red-Blue) Disease resistance protein (TIR-NBS-LRR class) AT5G46450 AT5G46450 family C2 (Red-Blue) Disease resistance protein RPP5 RPP5 AT4G16950 C2 (Red-Blue) Disease resistance-like protein CSA1 CSA1 AT5G17880 C2 (Red-Blue) DJ-1 protein homolog E DJ1E AT2G38860 C2 (Red-Blue) DNAJ heat shock N-terminal domain-containing AT1G21080 AT1G21080 protein C2 (Red-Blue) DnaJ protein homolog atj3 ATJ3 AT3G44110 C2 (Red-Blue) DnaJ protein P58IPK homolog P58IPK AT5G03160 C2 (Red-Blue) Dynamin-related protein 1E DRP1E AT3G60190 C2 (Red-Blue) E3 ubiquitin-protein ligase ATL31 ATL31 AT5G27420 C2 (Red-Blue) E3 ubiquitin-protein ligase UPL6 UPL6 AT3G17205 C2 (Red-Blue) ECT2 ECT2 AT3G13460 C2 (Red-Blue) EG45-like domain containing protein 2 EGC2 AT2G18660 C2 (Red-Blue) ELIP1 ELIP1 AT3G22840 C2 (Red-Blue) Elongation factor family protein AT2G31060 AT2G31060 C2 (Red-Blue) Elongation factor G-2, mitochondrial MEFG2 AT2G45030 C2 (Red-Blue) Endonuclease/exonuclease/phosphatase family protein AT5PTASE1 AT1G05630 3 C2 (Red-Blue) Endoplasmin homolog HSP90-7 AT4G24190 C2 (Red-Blue) Endoribonuclease AT3G04480 AT3G04480 C2 (Red-Blue) EP3 EP3 AT3G54420 C2 (Red-Blue) ER membrane protein complex subunit 7 homolog AT4G32130 AT4G32130 C2 (Red-Blue) ERAD-associated E3 ubiquitin-protein ligase HRD3A AT1G18260 component HRD3A C2 (Red-Blue) Eukaryotic aspartyl protease family protein AT3G51330 AT3G51330 C2 (Red-Blue) Eukaryotic aspartyl protease family protein AT5G43100 AT5G43100 C2 (Red-Blue) Eukaryotic translation initiation factor NCBP NCBP AT5G18110 C2 (Red-Blue) EX2 EX2 AT1G27510

280 C2 (Red-Blue) Exocyst subunit Exo70 family protein ATEXO70E1 AT3G29400 C2 (Red-Blue) Expressed protein AT2G03510 AT2G03510 C2 (Red-Blue) Expressed protein AT2G18690 AT2G18690 C2 (Red-Blue) Expressed protein AT2G27285 AT2G27285 C2 (Red-Blue) F10K1.7 protein AT1G07220 AT1G07220 C2 (Red-Blue) F20D23.9 protein ATILP1 AT1G17210 C2 (Red-Blue) F25P12.91 protein AT1G56660 AT1G56660 C2 (Red-Blue) F28K20.6 protein AT1G31130 AT1G31130 C2 (Red-Blue) F9L1.42 protein AT1G15470 AT1G15470 C2 (Red-Blue) FAD/NAD(P)-binding oxidoreductase family protein CTF2B AT2G29720 C2 (Red-Blue) Farnesoic acid carboxyl-O-methyltransferase FAMT AT3G44860 C2 (Red-Blue) Feruloyl CoA ortho-hydroxylase 1 F6'H1 AT3G13610 C2 (Red-Blue) Fes1A Fes1A AT3G09350 C2 (Red-Blue) Flavin-containing monooxygenase FMO GS-OX-like AT1G62600 AT1G62600 4 C2 (Red-Blue) Flotillin-like protein 1 FLOT1 AT5G25250 C2 (Red-Blue) Flotillin-like protein 2 FLOT2 AT5G25260 C2 (Red-Blue) GATA transcription factor 26 GATA26 AT4G17570 C2 (Red-Blue) GBF-interacting protein 1-like GIP1L AT1G55820 C2 (Red-Blue) GDP-L-fucose synthase 1 GER1 AT1G73250 C2 (Red-Blue) GDSL esterase/lipase At1g28610 AT1G28610 AT1G28610 C2 (Red-Blue) GFAT AT3G24090 AT3G24090 C2 (Red-Blue) Glutamate receptor 1.4 GLR1.4 AT3G07520 C2 (Red-Blue) Glutamate receptor 2.7 GLR2.7 AT2G29120 C2 (Red-Blue) Glutamine synthetase GLN1-4 AT5G16570 C2 (Red-Blue) Glycosyl hydrolase family 81 protein AT5G15870 AT5G15870 C2 (Red-Blue) Glycosyltransferase AT3G61280 AT3G61280 C2 (Red-Blue) Glycosyltransferase (Fragment) UGT89C1 AT1G06000 C2 (Red-Blue) GTP-binding protein At3g49725, chloroplastic AT3G49725 AT3G49725 C2 (Red-Blue) GYF domain-containing protein AT5G42950 AT5G42950

281 C2 (Red-Blue) Haloacid dehalogenase-like hydrolase domain- SGPP AT2G38740 containing protein Sgpp C2 (Red-Blue) Heat shock protein 70 (Hsp 70) family protein BIP AT5G42020 C2 (Red-Blue) Heat shock protein 81-2 HSP81-2 AT5G56030 C2 (Red-Blue) Heat shock protein 90-3 HSP90-3 AT5G56010 C2 (Red-Blue) Heavy metal-associated isoprenylated plant protein 14 HIPP14 AT5G52760 C2 (Red-Blue) Helicase-like transcription factor CHR28 CHR28 AT1G50410 C2 (Red-Blue) High-affinity nitrate transporter 3.1 NRT3.1 AT5G50200 C2 (Red-Blue) HIR2 HIR3 AT3G01290 C2 (Red-Blue) Hsp81.4 HSP90-4 AT5G56000 C2 (Red-Blue) HXXXD-type acyl-transferase family protein AT5G42830 AT5G42830 C2 (Red-Blue) Hypersensitive-induced response protein 4 HIR4 AT5G51570 C2 (Red-Blue) Importin beta-like SAD2 homolog AT3G59020 AT3G59020 C2 (Red-Blue) Inactive receptor-like serine/threonine-protein kinase AT2G40270 AT2G40270 At2g40270 C2 (Red-Blue) Indole glucosinolate O-methyltransferase 4 IGMT4 AT1G21130 C2 (Red-Blue) Indole-3-glycerol phosphate synthase, chloroplastic IGPS AT2G04400 C2 (Red-Blue) Internal alternative NAD(P)H-ubiquinone NDA2 AT2G29990 oxidoreductase A2, mitochondrial C2 (Red-Blue) IQ domain-containing protein IQM4 IQM4 AT2G26190 C2 (Red-Blue) Iron-sulfur assembly protein IscA-like 2, AT5G03905 AT5G03905 mitochondrial C2 (Red-Blue) Isoleucine--tRNA ligase, cytoplasmic AT4G10320 AT4G10320 C2 (Red-Blue) Isoprenylcysteine alpha-carbonyl methylesterase ICME AT5G15860 ICME C2 (Red-Blue) KU70 KU70 AT1G16970 C2 (Red-Blue) L-ascorbate peroxidase 3 APX3 AT4G35000 C2 (Red-Blue) L-type lectin-domain containing receptor kinase I.8 LECRK18 AT5G60280 C2 (Red-Blue) L-type lectin-domain containing receptor kinase VI.2 LECRK62 AT5G01540 C2 (Red-Blue) La-related protein 6B LARP6B AT2G43970 C2 (Red-Blue) LETM1-like protein AT3G59820 AT3G59820

282 C2 (Red-Blue) Leucine-rich repeat protein kinase family protein AT1G51890 AT1G51890 C2 (Red-Blue) Leucine-rich repeat receptor-like SOBIR1 AT2G31880 serine/threonine/tyrosine-protein kinase SOBIR1 C2 (Red-Blue) Leucine-rich repeat transmembrane protein kinase AT1G56120 AT1G56120 C2 (Red-Blue) Like disulfide bond formation protein AERO1 AT1G72280 C2 (Red-Blue) Lipase-like PAD4 PAD4 AT3G52430 C2 (Red-Blue) lon protease 1 LON_ARA_ AT5G26860 ARA C2 (Red-Blue) Lon protease homolog 2, peroxisomal LON2 AT5G47040 C2 (Red-Blue) Long chain acyl-CoA synthetase 4 LACS4 AT4G23850 C2 (Red-Blue) LRR receptor-like serine/threonine-protein kinase IOS1 AT1G51800 IOS1 C2 (Red-Blue) LS1-like protein AT3G51660 AT3G51660 C2 (Red-Blue) Lysine histidine transporter 1 LHT1 AT5G40780 C2 (Red-Blue) Mediator of RNA polymerase II transcription subunit MED37A AT5G28540 37a C2 (Red-Blue) MEE62 MEE62 AT5G45800 C2 (Red-Blue) Metal-dependent protein hydrolase AT3G49320 AT3G49320 C2 (Red-Blue) Metalloendoproteinase 3-MMP 3MMP AT1G24140 C2 (Red-Blue) Methionine aminopeptidase 2A MAP2A AT2G44180 C2 (Red-Blue) Mitochondrial fission 1 protein FIS1B AT5G12390 C2 (Red-Blue) Mitogen-activated protein kinase 11 MPK11 AT1G01560 C2 (Red-Blue) Mitogen-activated protein kinase 4 MPK4 AT4G01370 C2 (Red-Blue) Mitogen-activated protein kinase kinase kinase 3 MAPKKK10 AT4G08470 C2 (Red-Blue) MKK4 MKK4 AT1G51660 C2 (Red-Blue) Monodehydroascorbate reductase 3 MDAR3 AT3G09940 C2 (Red-Blue) MPK12 ATMPK12 AT2G46070 C2 (Red-Blue) MPK3 MPK3 AT3G45640 C2 (Red-Blue) MRP3 ABCC3 AT3G13080 C2 (Red-Blue) MutT/nudix family protein AtNUDT7 AT4G12720 C2 (Red-Blue) Myosin 2 MYA2 AT5G43900

283 C2 (Red-Blue) NA NA AT3G55270 C2 (Red-Blue) NAD(P)-binding Rossmann-fold superfamily protein AT4G09750 AT4G09750 C2 (Red-Blue) NAD(P)-binding Rossmann-fold superfamily protein AT4G11410 AT4G11410 C2 (Red-Blue) NAD(P)-binding Rossmann-fold superfamily protein FLDH AT4G33360 C2 (Red-Blue) Naringenin,2-oxoglutarate 3-dioxygenase F3H AT3G51240 C2 (Red-Blue) NEFA-interacting nuclear protein AT3G62140 AT3G62140 C2 (Red-Blue) Nicotinamide adenine dinucleotide transporter 1, NDT1 AT2G47490 chloroplastic C2 (Red-Blue) Non-specific serine/threonine protein kinase KIN11 AT3G29160 C2 (Red-Blue) NSL1 NSL1 AT1G28380 C2 (Red-Blue) Nuclear transport factor 2 (NTF2) family protein AT5G04830 AT5G04830 C2 (Red-Blue) Nucleophosmin AT4G29520 AT4G29520 C2 (Red-Blue) Nudix hydrolase 5 NUDT5 AT2G04430 C2 (Red-Blue) Nudix hydrolase 6 NUDT6 AT2G04450 C2 (Red-Blue) O-methyltransferase family protein AT1G21120 AT1G21120 C2 (Red-Blue) Oxoglutarate/iron-dependent oxygenase AT3G28480 AT3G28480 C2 (Red-Blue) P-loop containing nucleoside triphosphate hydrolases AIG1 AT1G33960 superfamily protein C2 (Red-Blue) p-loop containing nucleoside triphosphate hydrolases AT1G50140 AT1G50140 superfamily protein C2 (Red-Blue) PA200 PA200 AT3G13330 C2 (Red-Blue) Patatin-like protein 2 PLP2 AT2G26560 C2 (Red-Blue) Pathogenesis-related protein 1 PR1 AT2G14610 C2 (Red-Blue) Pathogenesis-related protein 5 PR5 AT1G75040 C2 (Red-Blue) PCS1 PCS1 AT5G44070 C2 (Red-Blue) PDIL1-3 PDIL1-3 AT3G54960 C2 (Red-Blue) pectin methylesterase PCR fragment F ATPMEPCRF AT5G53370 C2 (Red-Blue) Pentatricopeptide repeat-containing protein PCMP-E77 AT2G17210 At2g17210 C2 (Red-Blue) Pentatricopeptide repeat-containing protein AT5G09450 AT5G09450 At5g09450, mitochondrial

284 C2 (Red-Blue) Peptide methionine sulfoxide reductase B7 MSRB7 AT4G21830 C2 (Red-Blue) Peptidyl serine alpha-galactosyltransferase SERGT1 AT3G01720 C2 (Red-Blue) Peptidylprolyl isomerase FKBP42 AT3G21640 C2 (Red-Blue) PfkB-like carbohydrate kinase family protein AT5G43910 AT5G43910 C2 (Red-Blue) phosphatase-related SGT1A AT4G23570 C2 (Red-Blue) Phosphatidate phosphatase PAH1 PAH1 AT3G09560 C2 (Red-Blue) Phosphatidylserine decarboxylase proenzyme 1, PSD1 AT4G16700 mitochondrial C2 (Red-Blue) Phospho-2-dehydro-3-deoxyheptonate aldolase AT1G22410 AT1G22410 C2 (Red-Blue) Phosphoglycerate mutase family protein AT1G09932 AT1G09932 C2 (Red-Blue) Phospholipase PLDP1 AT3G16785 C2 (Red-Blue) Phospholipase A(1) LCAT3 LCAT3 AT3G03310 C2 (Red-Blue) Phospholipase D gamma 3 PLDGAMMA AT4G11840 3 C2 (Red-Blue) Phospholipid-transporting ATPase ALA1 AT5G04930 C2 (Red-Blue) Phospholipid-transporting ATPase 10 ALA10 AT3G25610 C2 (Red-Blue) Photosystem II CP43 reaction center protein PSBC NA C2 (Red-Blue) PKT2 KAT5 AT5G48880 C2 (Red-Blue) PLAC8 family protein AT4G23470 AT4G23470 C2 (Red-Blue) Plant UBX domain-containing protein 2 PUX2 AT2G01650 C2 (Red-Blue) Plant UBX domain-containing protein 8 PUX8 AT4G11740 C2 (Red-Blue) poly(ADP-ribose) glycohydrolase 2 PARG2 AT2G31865 C2 (Red-Blue) Polynucleotide 5'-hydroxyl-kinase NOL9 AT5G11010 AT5G11010 C2 (Red-Blue) Pre-mRNA-processing protein 40C MED35C AT3G19840 C2 (Red-Blue) Probable 1-acyl-sn-glycerol-3-phosphate LPAT4 AT1G75020 acyltransferase 4 C2 (Red-Blue) Probable aminotransferase TAT3 TAT3 AT2G24850 C2 (Red-Blue) Probable calcium-binding protein CML40 CML40 AT3G01830 C2 (Red-Blue) Probable cyclic nucleotide-gated ion channel 10 CNGC10 AT1G01340 C2 (Red-Blue) Probable cyclic nucleotide-gated ion channel 20, CNGC20 AT3G17700 chloroplastic

285 C2 (Red-Blue) Probable disease resistance protein At5g66910 DRL43 AT5G66910 C2 (Red-Blue) Probable folate-biopterin transporter 4 AT5G54860 AT5G54860 C2 (Red-Blue) Probable galactinol--sucrose galactosyltransferase 2 RFS2 AT3G57520 C2 (Red-Blue) Probable glucan endo-1,3-beta-glucosidase BG3 BG3 AT3G57240 C2 (Red-Blue) Probable inactive beta-glucosidase 25 BGLU25 AT3G03640 C2 (Red-Blue) Probable leucine-rich repeat receptor-like protein AT1G35710 AT1G35710 kinase At1g35710 C2 (Red-Blue) Probable leucine-rich repeat receptor-like LRR-RLK AT3G14840 serine/threonine-protein kinase At3g14840 C2 (Red-Blue) Probable mediator of RNA polymerase II transcription MED37B AT1G09080 subunit 37b C2 (Red-Blue) Probable mediator of RNA polymerase II transcription MED37D AT5G02490 subunit 37c C2 (Red-Blue) Probable pectinesterase/pectinesterase inhibitor 12 PME12 AT2G26440 C2 (Red-Blue) Probable RNA methyltransferase At5g51130 AT5G51130 AT5G51130 C2 (Red-Blue) Probable serine/threonine-protein kinase PBL17 PBL17 AT2G07180 C2 (Red-Blue) Probable serine/threonine-protein kinase WNK4 WNK4 AT5G58350 C2 (Red-Blue) Probable sucrose-phosphate synthase 3 SPS3 AT1G04920 C2 (Red-Blue) Probable transcriptional regulator SLK1 SLK1 AT4G25520 C2 (Red-Blue) Probably inactive leucine-rich repeat receptor-like BIR1 AT5G48380 protein kinase At5g48380 C2 (Red-Blue) Prolyl oligopeptidase family protein AT2G47390 AT2G47390 C2 (Red-Blue) Protease Do-like 7 DEGP7 AT3G03380 C2 (Red-Blue) Protein ABC transporter 1, mitochondrial ABC1 AT4G01660 C2 (Red-Blue) Protein ACCUMULATION AND REPLICATION ARC3 AT1G75010 OF CHLOROPLASTS 3 C2 (Red-Blue) Protein C2-DOMAIN ABA-RELATED 10 CAR10 AT2G01540 C2 (Red-Blue) Protein C2-DOMAIN ABA-RELATED 7 CAR7 AT1G70810 C2 (Red-Blue) Protein DETOXIFICATION DTX21 AT1G33110 C2 (Red-Blue) Protein disulfide isomerase-like 1-2 PDIL1-2 AT1G77510 C2 (Red-Blue) Protein disulfide-isomerase like 2-2 PDIL2-2 AT1G04980

286 C2 (Red-Blue) Protein DMR6-LIKE OXYGENASE 1 DLO1 AT4G10500 C2 (Red-Blue) Protein DOWNY MILDEW RESISTANCE 6 DMR6 AT5G24530 C2 (Red-Blue) Protein EDS1 EDS1 AT3G48090 C2 (Red-Blue) Protein EDS1B EDS1B AT3G48080 C2 (Red-Blue) Protein EXECUTER 1, chloroplastic EX1 AT4G33630 C2 (Red-Blue) Protein HEAT-INDUCED TAS1 TARGET 2 HTT2 AT5G18040 C2 (Red-Blue) Protein HESO1 HESO1 AT2G39740 C2 (Red-Blue) Protein HYPER-SENSITIVITY-RELATED 4 HSR4 AT3G50930 C2 (Red-Blue) protein kinase family protein AT1G51870 AT1G51870 C2 (Red-Blue) Protein kinase family protein AT5G38210 AT5G38210 C2 (Red-Blue) Protein kinase superfamily protein AT1G66880 AT1G66880 C2 (Red-Blue) Protein kinase superfamily protein AT1G66880 AT1G66880 C2 (Red-Blue) Protein kinase superfamily protein AT3G07700 AT3G07700 C2 (Red-Blue) Protein kinase superfamily protein AT3G09010 AT3G09010 C2 (Red-Blue) Protein kinase superfamily protein AT4G11890 AT4G11890 C2 (Red-Blue) Protein kinase superfamily protein AT5G25440 AT5G25440 C2 (Red-Blue) Protein LYK5 LYK5 AT2G33580 C2 (Red-Blue) Protein MEI2-like 1 ML1 AT5G61960 C2 (Red-Blue) Protein NBR1 homolog NBR1 AT4G24690 C2 (Red-Blue) Protein of unknown function (DUF1262) AT1G13470 AT1G13470 C2 (Red-Blue) Protein of unknown function (DUF726) AT4G36210 AT4G36210 C2 (Red-Blue) Protein PIN-LIKES 4 PILS4 AT1G76530 C2 (Red-Blue) Protein PLANT CADMIUM RESISTANCE 1 PCR1 AT1G14880 C2 (Red-Blue) Protein SAR DEFICIENT 4 SARD4 AT5G52810 C2 (Red-Blue) Protein SHORT ROOT IN SALT MEDIUM 1 emb1579 AT2G03150 C2 (Red-Blue) Protein STRICTOSIDINE SYNTHASE-LIKE 6 SSL6 AT3G51440 C2 (Red-Blue) Protein TIC 56, chloroplastic TIC56 AT5G01590 C2 (Red-Blue) Protein TRANSPARENT TESTA GLABRA 1 TTG1 AT5G24520 C2 (Red-Blue) Protein transport protein SEC16A homolog MAG5 AT5G47480 C2 (Red-Blue) Protein YLS3 YLS3 AT2G44290 C2 (Red-Blue) Proton pump-interactor 1 PPI1 AT4G27500

287 C2 (Red-Blue) Putative calcium-transporting ATPase 13, plasma ACA13 AT3G22910 membrane-type C2 (Red-Blue) Putative glycerol-3-phosphate transporter 1 ATPS3 AT3G47420 C2 (Red-Blue) Putative RRM-containing protein AT4G17720 AT4G17720 C2 (Red-Blue) Putative uncharacterized protein AT1G58602 AT1G58602 C2 (Red-Blue) Putative zinc finger protein AT4G02220 AT4G02220 C2 (Red-Blue) RBR-type E3 ubiquitin transferase NHL8 AT1G32340 C2 (Red-Blue) RBR1 RBR1 AT3G12280 C2 (Red-Blue) Receptor like protein 23 AtRLP23 AT2G32680 C2 (Red-Blue) Receptor-like protein 34 AtRLP34 AT3G11010 C2 (Red-Blue) Receptor-like protein 37 AtRLP37 AT3G23110 C2 (Red-Blue) Receptor-like protein 38 AtRLP38 AT3G23120 C2 (Red-Blue) Receptor-like protein 43 AtRLP43 AT3G28890 C2 (Red-Blue) Receptor-like protein 47 RLP47 AT4G13810 C2 (Red-Blue) Receptor-like protein 48 AtRLP48 AT4G13880 C2 (Red-Blue) Receptor-like serine/threonine-protein kinase SD1-6 SD16 AT1G65800 C2 (Red-Blue) REF/SRPP-like protein At3g05500 AT3G05500 AT3G05500 C2 (Red-Blue) Regulatory protein NPR1 NPR1 AT1G64280 C2 (Red-Blue) Reticulon-like protein B5 RTNLB5 AT2G46170 C2 (Red-Blue) Ribonuclease E inhibitor RraA/Dimethylmenaquinone AT5G56260 AT5G56260 methyltransferase C2 (Red-Blue) RNI-like superfamily protein AT5G45500 AT5G45500 C2 (Red-Blue) S-adenosyl-L-methionine-dependent tRNA 4- TYW1 AT1G75200 demethylwyosine synthase C2 (Red-Blue) SAC3 family protein A SAC3A AT2G39340 C2 (Red-Blue) SAL2 phosphatase SAL2 AT5G64000 C2 (Red-Blue) Sec14p-like phosphatidylinositol transfer family AT1G75170 AT1G75170 protein C2 (Red-Blue) Senescence-induced receptor-like serine/threonine- SIRK AT2G19190 protein kinase C2 (Red-Blue) Serine carboxypeptidase-like 45 SCPL45 AT1G28110

288 C2 (Red-Blue) Serine carboxypeptidase-like 51 SCPL51 AT2G27920 C2 (Red-Blue) Serine/threonine-protein kinase VPS15 VPS15 AT4G29380 C2 (Red-Blue) Serine/threonine-protein phosphatase TOPP4 AT2G39840 C2 (Red-Blue) Short-chain dehydrogenase reductase 3a SDR3A AT2G47130 C2 (Red-Blue) Short-chain dehydrogenase reductase 4 SDR4 AT3G29250 C2 (Red-Blue) Signal peptide peptidase SPP AT2G03120 C2 (Red-Blue) SMP2 SMP2 AT4G37120 C2 (Red-Blue) SNARE associated Golgi protein family AT4G17790 AT4G17790 C2 (Red-Blue) SNP33 SNAP33 AT5G61210 C2 (Red-Blue) Solanesyl diphosphate synthase 3, SPS3 AT2G34630 chloroplastic/mitochondrial C2 (Red-Blue) Staphylococcal-like nuclease CAN2 CAN2 AT2G40410 C2 (Red-Blue) STP13 STP13 AT5G26340 C2 (Red-Blue) Stromal cell-derived factor 2-like protein SDF2 AT2G25110 C2 (Red-Blue) Structural maintenance of chromosomes protein 1 SMC1 AT3G54670 C2 (Red-Blue) Succinate dehydrogenase assembly factor AT5G51040 AT5G51040 C2 (Red-Blue) Syntaxin-122 SYP122 AT3G52400 C2 (Red-Blue) T6D22.13 AT1G08050 AT1G08050 C2 (Red-Blue) Tetratricopeptide repeat (TPR)-like superfamily AT5G02590 AT5G02590 protein C2 (Red-Blue) THO complex subunit 1 THO1 AT5G09860 C2 (Red-Blue) TMS1 ERDJ3A AT3G08970 C2 (Red-Blue) TOM1-like protein 4 TOL4 AT1G76970 C2 (Red-Blue) Transcription elongation factor (TFIIS) family protein AT4G24200 AT4G24200 C2 (Red-Blue) Transcription factor bHLH3 BHLH3 AT4G16430 C2 (Red-Blue) Transducin/WD40 repeat-like superfamily protein AT3G45620 AT3G45620 C2 (Red-Blue) Transglutaminase PNG1 AT5G49570 C2 (Red-Blue) Transmembrane emp24 domain-containing protein AT1G21900 AT1G21900 p24delta5 C2 (Red-Blue) Transmembrane emp24 domain-containing protein AT1G14010 AT1G14010 p24delta7

289 C2 (Red-Blue) Transmembrane emp24 domain-containing protein AT1G26690 AT1G26690 p24delta9 C2 (Red-Blue) Transmembrane protein AT2G41610 AT2G41610 C2 (Red-Blue) Transmembrane protein, putative (DUF247) AT3G47250 AT3G47250 C2 (Red-Blue) Transmembrane protein, putative (DUF707) AT1G13000 AT1G13000 C2 (Red-Blue) Triacylglycerol lipase 1 LIP1 AT2G15230 C2 (Red-Blue) Trifunctional UDP-glucose 4,6-dehydratase/UDP-4- RHM1 AT1G78570 keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto- L-rhamnose-reductase RHM1 C2 (Red-Blue) Tripeptidyl-peptidase 2 TPP2 AT4G20850 C2 (Red-Blue) tRNase Z TRZ3, mitochondrial TRZ3 AT1G52160 C2 (Red-Blue) Tunicamycin induced protein TIN1 AT5G64510 C2 (Red-Blue) U-box domain-containing protein 2 PUB2 AT5G67340 C2 (Red-Blue) Ubiquinol oxidase 1a, mitochondrial AOX1A AT3G22370 C2 (Red-Blue) UDP-galactose/UDP-glucose transporter 1 UTR1 AT2G02810 C2 (Red-Blue) UDP-glucosyl transferase 73B2 UGT73B2 AT4G34135 C2 (Red-Blue) UDP-glycosyltransferase 73C3 UGT73C3 AT2G36780 C2 (Red-Blue) UDP-glycosyltransferase 85A1 UGT85A1 AT1G22400 C2 (Red-Blue) UDP-glycosyltransferase 87A2 UGT87A2 AT2G30140 C2 (Red-Blue) UGT84A2 UGT84A2 AT3G21560 C2 (Red-Blue) Uncharacterized protein At3g12790 SDRB AT3G12800 C2 (Red-Blue) Uncharacterized protein At4g12070/F16J13_140 AT4G12070 AT4G12070 C2 (Red-Blue) unknown protein AT3G03560 AT3G03560 C2 (Red-Blue) Vacuolar protein sorting-associated protein 2 homolog VPS2.3 AT1G03950 3 C2 (Red-Blue) Vacuolar-sorting receptor 6 VSR6 AT1G30900 C2 (Red-Blue) Wall-associated receptor kinase 1 WAK1 AT1G21250 C2 (Red-Blue) Wall-associated receptor kinase 2 WAK2 AT1G21270 C2 (Red-Blue) Wall-associated receptor kinase 3 WAK3 AT1G21240 C2 (Red-Blue) Wall-associated receptor kinase-like 9 WAKL9 AT1G69730 C2 (Red-Blue) XLG2 XLG2 AT4G34390

290 C2 (Red-Blue) YTH domain-containing protein ECT1 ECT1 AT3G03950 C2 (Red-Blue) Zinc finger AN1 and C2H2 domain-containing stress- SAP13 AT3G57480 associated protein 13 C2 (Red-Blue) Zinc finger CCCH domain-containing protein 3 AT1G04990 AT1G04990 C2 (Red-Blue) Zinc finger CCCH domain-containing protein 66 MZN1.16 AT5G58620 C2 (Red-Blue) zinc finger nuclease 2 ZFN2 AT2G32930 C3 (Blue) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase AT1G03400 AT1G03400 superfamily protein C3 (Blue) 24-methylenesterol C-methyltransferase 3 SMT3 AT1G76090 C3 (Blue) 30S ribosomal protein S1, chloroplastic RPS1 AT5G30510 C3 (Blue) 30S ribosomal protein S17, chloroplastic RPS17 AT1G79850 C3 (Blue) 30S ribosomal protein S2, chloroplastic RR2 NA C3 (Blue) 4-coumarate--CoA ligase 3 4CL3 AT1G65060 C3 (Blue) 4-hydroxyphenylpyruvate dioxygenase HPD AT1G06570 C3 (Blue) 50S ribosomal protein L1, chloroplastic RPL1 AT3G63490 C3 (Blue) 50S ribosomal protein L11, chloroplastic RPL11 AT1G32990 C3 (Blue) 50S ribosomal protein L15, chloroplastic RPL15 AT3G25920 C3 (Blue) 50S ribosomal protein L19-1, chloroplastic AT4G17560 AT4G17560 C3 (Blue) 50S ribosomal protein L31, chloroplastic RPL31 AT1G75350 C3 (Blue) 50S ribosomal protein L32, chloroplastic RK32 NA C3 (Blue) 50S ribosomal protein L5, chloroplastic RPL5 AT4G01310 C3 (Blue) ABC transporter C family member 2 ABCC2 AT2G34660 C3 (Blue) ABC transporter I family member 21 ABCI21 AT5G44110 C3 (Blue) ABC1K3 ABC1K3 AT1G79600 C3 (Blue) Acclimation of photosynthesis to environment APE1 AT5G38660 C3 (Blue) Acyltransferase-like protein At1g54570, chloroplastic AT1G54570 AT1G54570 C3 (Blue) AFG1-like ATPase family protein AT2G25530 AT2G25530 C3 (Blue) Alcohol dehydrogenase-like 7 AT5G42250 AT5G42250 C3 (Blue) Aldehyde dehydrogenase ALDH3I1 AT4G34240 C3 (Blue) Alkaline/neutral invertase E, chloroplastic INVE AT5G22510 C3 (Blue) Alpha/beta-Hydrolases superfamily protein AT1G74640 AT1G74640

291 C3 (Blue) Alpha/beta-Hydrolases superfamily protein AT4G36530 AT4G36530 C3 (Blue) Alpha/beta-Hydrolases superfamily protein AT5G19850 AT5G19850 C3 (Blue) Antitermination NusB domain-containing protein AT4G26370 AT4G26370 C3 (Blue) ARM repeat superfamily protein AT3G62530 AT3G62530 C3 (Blue) AT hook motif-containing protein AT5G54930 AT5G54930 C3 (Blue) AT-hook motif nuclear-localized protein 9 AHL9 AT2G45850 C3 (Blue) At1g09500/F14J9_16 AT1G09500 AT1G09500 C3 (Blue) At2g21860/F7D8.18 AT2G21860 AT2G21860 C3 (Blue) AT2G32160 protein AT2G32160 AT2G32160 C3 (Blue) At2g32500 AT2G32500 AT2G32500 C3 (Blue) At2g44240/F4I1.5 AT2G44240 AT2G44240 C3 (Blue) AT3g04650/F7O18_13 AT3G04650 AT3G04650 C3 (Blue) At3g10405 AT3G10405 AT3G10405 C3 (Blue) AT3G20230 protein AT3G20230 AT3G20230 C3 (Blue) At3g22210 AT3G22210 AT3G22210 C3 (Blue) AT3g23700/MYM9_3 AT3G23700 AT3G23700 C3 (Blue) AT3G27110 protein AT3G27110 AT3G27110 C3 (Blue) AT4g27020/F10M23_360 AT4G27020 AT4G27020 C3 (Blue) At4g39040 AT4G39040 AT4G39040 C3 (Blue) AT4g39960/T5J17_130 AT4G39960 AT4G39960 C3 (Blue) At5g54100 AT5G54100 AT5G54100 C3 (Blue) AT5g67220/K21H1_18 AT5G67220 AT5G67220 C3 (Blue) AtACDO1 ABC1K1 AT4G31390 C3 (Blue) ATP-dependent Clp protease adapter protein CLPS1, CPLS1 AT1G68660 chloroplastic C3 (Blue) ATP-dependent zinc metalloprotease FTSH 8, FTSH8 AT1G06430 chloroplastic C3 (Blue) Beta carbonic anhydrase 1, chloroplastic BCA1 AT3G01500 C3 (Blue) Beta-amylase BAM1 AT3G23920 C3 (Blue) Bifunctional monothiol glutaredoxin-S16, GRXS16 AT2G38270 chloroplastic

292 C3 (Blue) Bifunctional nitrilase/nitrile hydratase NIT4 NIT4 AT5G22300 C3 (Blue) CAF2 CAF2 AT1G23400 C3 (Blue) Calcium-dependent protein kinase 27 CPK27 AT4G04700 C3 (Blue) Chaperone protein ClpC1, chloroplastic CLPC1 AT5G50920 C3 (Blue) Chaperone protein ClpC2, chloroplastic CLPC2 AT3G48870 C3 (Blue) Chaperone protein dnaJ A6, chloroplastic DJA6 AT2G22360 C3 (Blue) Chaperone protein dnaJ C76, chloroplastic DJC76 AT5G23240 C3 (Blue) Chaperonin 60 subunit alpha 2, chloroplastic CPN60A2 AT5G18820 C3 (Blue) Chaperonin-like RBCX protein 1, chloroplastic RBCX1 AT4G04330 C3 (Blue) Chloroplast RNA-binding protein 29 CP29 AT3G53460 C3 (Blue) Chorismate mutase 1, chloroplastic CM1 AT3G29200 C3 (Blue) Cinnamyl alcohol dehydrogenase 4 CAD4 AT3G19450 C3 (Blue) Class I peptide chain release factor AT1G62850 AT1G62850 C3 (Blue) CRS1 / YhbY (CRM) domain-containing protein EMB1865 AT3G18390 C3 (Blue) Cryptochrome DASH, chloroplastic/mitochondrial CRYD AT5G24850 C3 (Blue) CYP76C1 CYP76C1 AT2G45560 C3 (Blue) Cytochrome P450, family 71, subfamily B, CYP71B26 AT3G26290 polypeptide 26 C3 (Blue) Cytochrome P450, family 72, subfamily A, CYP72A15 AT3G14690 polypeptide 15 C3 (Blue) DAR GTPase 3, chloroplastic DGP3 AT4G02790 C3 (Blue) DEA(D/H)-box RNA helicase family protein AT1G48650 AT1G48650 C3 (Blue) DEAD-box ATP-dependent RNA helicase 22 RH22 AT1G59990 C3 (Blue) DEAD-box ATP-dependent RNA helicase 47, RH47 AT1G12770 mitochondrial C3 (Blue) Dehydrodolichyl diphosphate synthase 2 MZN1.21 AT5G58770 C3 (Blue) Dihydrolipoyl dehydrogenase 2, chloroplastic LPD2 AT4G16155 C3 (Blue) DNA gyrase subunit B GYRB1 AT3G10270 C3 (Blue) DNA photolyase AT4G25290 AT4G25290 C3 (Blue) DNA topoisomerase, type IA, core AT4G31210 AT4G31210 C3 (Blue) Elongation factor family protein AT5G13650 AT5G13650

293 C3 (Blue) Elongation factor G, chloroplastic CPEFG AT1G62750 C3 (Blue) Elongation factor P (EF-P) family protein AT3G08740 AT3G08740 C3 (Blue) Emb1629 APO2 AT5G57930 C3 (Blue) Emb2738 emb2738 AT3G12080 C3 (Blue) Eukaryotic translation initiation factor 5A ELF5A-1 AT1G13950 C3 (Blue) Exonuclease V, chloroplastic MUF9.2 AT5G60370 C3 (Blue) Expressed protein AT2G21960 AT2G21960 C3 (Blue) Expressed protein AT2G34310 AT2G34310 C3 (Blue) Expressed protein AT2G36885 AT2G36885 C3 (Blue) F17F16.6 protein UP6 AT1G16730 C3 (Blue) F3H9.20 protein AT1G28140 AT1G28140 C3 (Blue) FAD/NAD(P)-binding oxidoreductase family protein AT1G57770 AT1G57770 C3 (Blue) Ferredoxin--NADP reductase, leaf isozyme 2, LFNR2 AT1G20020 chloroplastic C3 (Blue) ferredoxin/thioredoxin reductase subunit A (variable FTRA2 AT5G08410 subunit) 2 C3 (Blue) Ferric reduction oxidase 7, chloroplastic FRO7 AT5G49740 C3 (Blue) Flavonol synthase/flavanone 3-hydroxylase FLS1 AT5G08640 C3 (Blue) Fructose-bisphosphate aldolase FBA5 AT4G26530 C3 (Blue) FtsH extracellular protease family VAR2 AT2G30950 C3 (Blue) Ftsh9 FTSH9 AT5G58870 C3 (Blue) Unknown protein AT1G69070 AT1G69070 C3 (Blue) Unknown protein AT4G28740 AT4G28740 C3 (Blue) Unknown protein AT1G19140 AT1G19140 C3 (Blue) GCN5 ABCF5 AT5G64840 C3 (Blue) glutamate synthase 1 GLU1 AT5G04140 C3 (Blue) Glutathione S-transferase L2, chloroplastic GSTL2 AT3G55040 C3 (Blue) Glycosyltransferase (Fragment) UGT73C5 AT2G36800 C3 (Blue) Glycosyltransferase (Fragment) UGT78D2 AT5G17050 C3 (Blue) HCF244 AT4G35250 AT4G35250 C3 (Blue) Heat shock 70 kDa protein 7, chloroplastic HSP70-7 AT5G49910

294 C3 (Blue) high chlorophyll fluorescence phenotype 173 HCF173 AT1G16720 C3 (Blue) HSP90.5 HSP90-5 AT2G04030 C3 (Blue) K(+) efflux antiporter 3, chloroplastic KEA3 AT4G04850 C3 (Blue) Kinesin-like protein AT4G24175 AT4G24175 C3 (Blue) LETM1-like protein AT5G06220 AT5G06220 C3 (Blue) Lysine-tRNA ligase AT3G01060 AT3G01060 C3 (Blue) Methionine aminopeptidase 1B, chloroplastic MAP1B AT1G13270 C3 (Blue) Mitochondrial substrate carrier family protein AT2G46320 AT2G46320 C3 (Blue) Mitogen-activated protein kinase 8 MPK8 AT1G18150 C3 (Blue) MSRB6 MSRB6 AT4G04840 C3 (Blue) NAD kinase 2 NADK2 AT1G21640 C3 (Blue) NAD(P)-binding Rossmann-fold superfamily protein AT3G61220 AT3G61220 C3 (Blue) Nematode resistance protein-like HSPRO2 HSPRO2 AT2G40000 C3 (Blue) NITI NIT1 AT3G44310 C3 (Blue) Nitrate reductase NIA1 AT1G77760 C3 (Blue) Non-intrinsic ABC protein 9 ATNAP9 AT5G02270 C3 (Blue) Non-specific serine/threonine protein kinase CIPK26 AT5G21326 C3 (Blue) Nuclear protein AT1G16080 AT1G16080 C3 (Blue) OCP3 OCP3 AT5G11270 C3 (Blue) OHP2 OHP2 AT1G34000 C3 (Blue) Organellar single-stranded DNA binding protein 3 OSB3 AT5G44785 C3 (Blue) Organelle RRM domain-containing protein 6, ORRM6 AT1G73530 chloroplastic C3 (Blue) P-loop containing nucleoside triphosphate hydrolases PDE318 AT1G80770 superfamily protein C3 (Blue) P-loop containing nucleoside triphosphate hydrolases ATNOS1 AT3G47450 superfamily protein C3 (Blue) P-loop containing nucleoside triphosphate hydrolases AT5G35970 AT5G35970 superfamily protein C3 (Blue) PDE340 RH26 AT5G08610 C3 (Blue) PDX2 PDX2 AT5G60540

295 C3 (Blue) Pentatricopeptide repeat (PPR) superfamily protein AT3G46870 AT3G46870 C3 (Blue) Pentatricopeptide repeat-containing protein AT1G01970 AT1G01970 At1g01970 C3 (Blue) Pentatricopeptide repeat-containing protein AT2G17033 AT2G17033 At2g17033 C3 (Blue) Pentatricopeptide repeat-containing protein GUN1 AT2G31400 At2g31400, chloroplastic C3 (Blue) Pentatricopeptide repeat-containing protein P67 AT4G16390 At4g16390, chloroplastic C3 (Blue) Pentatricopeptide repeat-containing protein AT5G02830 AT5G02830 At5g02830, chloroplastic C3 (Blue) Pentatricopeptide repeat-containing protein PPR4 AT5G04810 At5g04810, chloroplastic C3 (Blue) Pentatricopeptide repeat-containing protein AT5G46580 AT5G46580 At5g46580, chloroplastic C3 (Blue) Pentatricopeptide repeat-containing protein MRL1, MRL1 AT4G34830 chloroplastic C3 (Blue) Peptide methionine sulfoxide reductase B1, MSRB1 AT1G53670 chloroplastic C3 (Blue) Peptidylprolyl isomerase FKBP20-1 AT3G55520 C3 (Blue) Phenylalanine ammonia-lyase 1 PAL1 AT2G37040 C3 (Blue) Phenylalanine ammonia-lyase 2 PAL2 AT3G53260 C3 (Blue) Phospho-2-dehydro-3-deoxyheptonate aldolase DHS2 AT4G33510 C3 (Blue) Phospholipid hydroperoxide glutathione peroxidase 1, GPX1 AT2G25080 chloroplastic C3 (Blue) Phytochrome PHYB AT2G18790 C3 (Blue) Phytochrome C PHYC AT5G35840 C3 (Blue) Phytochrome D PHYD AT4G16250 C3 (Blue) Plastidial pyruvate kinase 3, chloroplastic PKP3 AT1G32440 C3 (Blue) Polyadenylate-binding protein RBP47C RBP47C AT1G47490 C3 (Blue) Polyadenylate-binding protein-interacting protein 7 CID7 AT2G26280

296 C3 (Blue) Post-illumination chlorophyll fluorescence increase PIFI AT3G15840 C3 (Blue) Potassium transporter AT3G56290 AT3G56290 C3 (Blue) PPD6 PPD6 AT3G56650 C3 (Blue) Presequence protease 1, chloroplastic/mitochondrial PREP1 AT3G19170 C3 (Blue) Presequence protease 2, chloroplastic/mitochondrial PREP2 AT1G49630 C3 (Blue) Probable aminotransferase TAT2 AT5G53970 AT5G53970 C3 (Blue) Probable carotenoid cleavage dioxygenase 4, CCD4 AT4G19170 chloroplastic C3 (Blue) Probable envelope ADP,ATP carrier protein, EAAC AT3G51870 chloroplastic C3 (Blue) Probable glutathione peroxidase 2 GPX2 AT2G31570 C3 (Blue) Probable pheophorbidase PPD AT4G16690 C3 (Blue) Probable ribosome-binding factor A, chloroplastic AT4G34730 AT4G34730 C3 (Blue) Probable starch synthase 4, chloroplastic/amyloplastic SS4 AT4G18240 C3 (Blue) Protein BIC2 BIC2 AT3G44450 C3 (Blue) Protein CONSERVED ONLY IN THE GREEN CGL160 AT2G31040 LINEAGE 160, chloroplastic C3 (Blue) Protein DJ-1 homolog D DJ1D AT3G02720 C3 (Blue) Protein LURP-one-related 12 AT3G15810 AT3G15810 C3 (Blue) Protein MET1, chloroplastic ZKT AT1G55480 C3 (Blue) Protein of unknown function (DUF1295) AT1G18180 AT1G18180 C3 (Blue) Protein PEP-RELATED DEVELOPMENT PRDA1 AT5G48470 ARRESTED 1, chloroplastic C3 (Blue) Protein PHOTOSYSTEM I ASSEMBLY 2, PSA2 AT2G34860 chloroplastic C3 (Blue) Protein RETICULATA-RELATED 5, chloroplastic RER5 AT2G40400 C3 (Blue) Protein STRICTOSIDINE SYNTHASE-LIKE 9 SSL9 AT3G57020 C3 (Blue) Protein TIC 55, chloroplastic TIC55 AT2G24820 C3 (Blue) Protochlorophyllide-dependent translocon component PTC52 AT4G25650 52, chloroplastic C3 (Blue) PRPS20 RPS20 AT3G15190

297 C3 (Blue) Putative glutathione peroxidase 7, chloroplastic GPX7 AT4G31870 C3 (Blue) Putative ribosomal large subunit pseudouridine SVR1 AT2G39140 synthase SVR1, chloroplastic C3 (Blue) Pyridoxal 5'-phosphate synthase subunit PDX1.1 PDX11 AT2G38230 C3 (Blue) Pyridoxal 5'-phosphate synthase subunit PDX1.3 PDX13 AT5G01410 C3 (Blue) Radical SAM superfamily protein AT2G39670 AT2G39670 C3 (Blue) RbcX2 RBCX2 AT5G19855 C3 (Blue) Receptor-like protein kinase At5g59670 MTH12.12 AT5G59670 C3 (Blue) RH3 RH3 AT5G26742 C3 (Blue) RH39 RH39 AT4G09730 C3 (Blue) RIBA1 RIBA1 AT5G64300 C3 (Blue) Ribonuclease III domain-containing protein RNC1, RNC1 AT4G37510 chloroplastic C3 (Blue) Ribonucleoside-diphosphate reductase small chain A RNR2A AT3G23580 C3 (Blue) RING-H2 zinc finger protein AT5G24460 AT5G24460 C3 (Blue) RNA polymerase sigma factor sigB SIGB AT1G08540 C3 (Blue) RNA polymerase sigma factor sigF, chloroplastic SIGF AT2G36990 C3 (Blue) RNA-binding protein CP29B, chloroplastic CP29B AT2G37220 C3 (Blue) Root phototropism protein 2 RPT2 AT2G30520 C3 (Blue) RPE RPE AT5G61410 C3 (Blue) RPL12-A RPL12A AT3G27830 C3 (Blue) Rubisco accumulation factor 1.1, chloroplastic RAF1.1 AT5G28500 C3 (Blue) Rubisco accumulation factor 1.2, chloroplastic RAF1.2 AT3G04550 C3 (Blue) S-adenosyl-L-methionine-dependent AT4G29590 AT4G29590 methyltransferases superfamily protein C3 (Blue) Senescence-associated protein AAF, chlorolplastic AAF AT1G66330 C3 (Blue) Serine carboxypeptidase-like 46 SCPL46 AT2G33530 C3 (Blue) Serine carboxypeptidase-like 48 SCPL48 AT3G45010 C3 (Blue) Serine hydroxymethyltransferase 5 SHM5 AT4G13890 C3 (Blue) Serine protease SPPA, chloroplastic SPPA AT1G73990 C3 (Blue) sirtuin 2 SRT2 AT5G09230

298 C3 (Blue) Solanesyl diphosphate synthase 1 SPS1 AT1G78510 C3 (Blue) SPA4 SPA4 AT1G53090 C3 (Blue) SPS2 SPS2 AT1G17050 C3 (Blue) Squalene epoxidase 3 SQE3 AT4G37760 C3 (Blue) SRFR1 SRFR1 AT4G37460 C3 (Blue) Stromal processing peptidase, chloroplastic SPP AT5G42390 C3 (Blue) Tetratricopeptide repeat (TPR)-like superfamily AT1G01320 AT1G01320 protein C3 (Blue) Tetratricopeptide repeat (TPR)-like superfamily TPR4 AT1G04530 protein C3 (Blue) Thermosome subunit gamma AT5G19540 AT5G19540 C3 (Blue) Thioredoxin-like protein HCF164, chloroplastic HCF164 AT4G37200 C3 (Blue) Tocopherol cyclase, chloroplastic VTE1 AT4G32770 C3 (Blue) Transcription termination factor MTERF4, MTERF4 AT4G02990 chloroplastic C3 (Blue) Transducin family protein / WD-40 repeat family AT1G71840 AT1G71840 protein C3 (Blue) Translation initiation factor IF-2, chloroplastic FUG1 AT1G17220 C3 (Blue) Translocase of chloroplast 159, chloroplastic TOC159 AT4G02510 C3 (Blue) tRNA (guanine(37)-N1)-methyltransferase 2 AT4G27340 AT4G27340 C3 (Blue) tRNA pseudouridine synthase AT5G35400 AT5G35400 C3 (Blue) tRNase Z TRZ2, chloroplastic TRZ2 AT2G04530 C3 (Blue) UDP-glycosyltransferase 84A3 UGT84A3 AT4G15490 C3 (Blue) UDP-Glycosyltransferase superfamily protein AT1G01390 AT1G01390 C3 (Blue) Uncharacterized oxidoreductase At1g06690, AT1G06690 AT1G06690 chloroplastic C3 (Blue) Uncharacterized protein At1g32220, chloroplastic AT1G32220 AT1G32220 C3 (Blue) Uncharacterized protein At5g50100, chloroplastic AT5G50100 AT5G50100 C3 (Blue) Unknown protein AT2G38780 AT2G38780 C3 (Blue) VAR1 FTSH5 AT5G42270 C3 (Blue) YlmG homolog protein 1-1, chloroplastic YLMG1-1 AT3G07430

299 C3 (Blue) Zeaxanthin epoxidase, chloroplastic ZEP AT5G67030 C3 (Blue) Zinc finger (C3HC4-type RING finger) family protein AT1G18660 AT1G18660 C4 (Amber-Red) 1-phosphatidylinositol-3-phosphate 5-kinase FAB1A FAB1A AT4G33240 C4 (Amber-Red) 12-oxophytodienoate reductase 3 OPR3 AT2G06050 C4 (Amber-Red) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase AT3G19000 AT3G19000 superfamily protein C4 (Amber-Red) 24 kDa vacuolar protein-like AT5G20660 AT5G20660 C4 (Amber-Red) 4-coumarate--CoA ligase 1 4CL1 AT1G51680 C4 (Amber-Red) ACR12 ACR12 AT5G04740 C4 (Amber-Red) Acyl-CoA thioesterase II AT1G01710 AT1G01710 C4 (Amber-Red) Adenine nucleotide transporter 1 ADNT1 AT4G01100 C4 (Amber-Red) Adenylosuccinate lyase AT4G18440 AT4G18440 C4 (Amber-Red) ADP-ribosylation factor GTPase-activating protein AGD7 AT2G37550 AGD7 C4 (Amber-Red) Aha1 domain-containing protein AT3G12050 AT3G12050 C4 (Amber-Red) Alcohol dehydrogenase transcription factor AT2G44730 AT2G44730 Myb/SANT-like family protein C4 (Amber-Red) Aldolase superfamily protein ATKDSA2 AT1G16340 C4 (Amber-Red) Allene oxide cyclase 3, chloroplastic AOC3 AT3G25780 C4 (Amber-Red) Alpha-1,3-mannosyl-glycoprotein 2-beta-N- GNTI AT4G38240 acetylglucosaminyltransferase C4 (Amber-Red) Alpha-glucan phosphorylase 1 PHS1 AT3G29320 C4 (Amber-Red) Alpha,alpha-trehalose-phosphate synthase TPS5 AT4G17770 C4 (Amber-Red) Aluminum-activated malate transporter 5 ALMT5 AT1G68600 C4 (Amber-Red) Amine oxidase AT1G31690 AT1G31690 C4 (Amber-Red) Anthranilate N-hydroxycinnamoyl/benzoyltransferase- AT5G67150 AT5G67150 like protein C4 (Amber-Red) AP-1 complex subunit gamma AT1G60070 AT1G60070 C4 (Amber-Red) Argininosuccinate synthase, chloroplastic AT4G24830 AT4G24830 C4 (Amber-Red) Asparagine--tRNA ligase, cytoplasmic 3 SYNC3 AT1G70980 C4 (Amber-Red) Aspartate carbamoyltransferase, chloroplastic PYRB AT3G20330

300 C4 (Amber-Red) Aspartokinase 3, chloroplastic AK3 AT3G02020 C4 (Amber-Red) At1g56700 AT1G56700 AT1G56700 C4 (Amber-Red) At1g62305 AT1G62305 AT1G62305 C4 (Amber-Red) At2g25950 AT2G25950 AT2G25950 C4 (Amber-Red) At2g30720 AT2G30720 AT2G30720 C4 (Amber-Red) AT3g15940/MVC8_7 AT3G15940 AT3G15940 C4 (Amber-Red) AT3g17020/K14A17_14 AT3G17020 AT3G17020 C4 (Amber-Red) At3g25760 AOC1 AT3G25760 C4 (Amber-Red) AT4g29480/F17A13_300 AT4G29480 AT4G29480 C4 (Amber-Red) AT5g01210/F7J8_190 AT5G01210 AT5G01210 C4 (Amber-Red) AT5g01800/T20L15_70 AT5G01800 AT5G01800 C4 (Amber-Red) At5g05960 AT5G05960 AT5G05960 C4 (Amber-Red) AT5g13970/MAC12_6 AT5G13970 AT5G13970 C4 (Amber-Red) AT5g16210/T21H19_130 AT5G16210 AT5G16210 C4 (Amber-Red) At5g55530 AT5G55530 AT5G55530 C4 (Amber-Red) At5g64090 AT5G64090 AT5G64090 C4 (Amber-Red) Berberine bridge enzyme-like 26 AT5G44400 AT5G44400 C4 (Amber-Red) Beta-amylase 5 BAM5 AT4G15210 C4 (Amber-Red) Beta-glucosidase 16 BGLU16 AT3G60130 C4 (Amber-Red) Bifunctional aspartokinase/homoserine dehydrogenase AKHSDH1 AT1G31230 1, chloroplastic C4 (Amber-Red) Bifunctional D-cysteine desulfhydrase/1- DCD AT1G48420 aminocyclopropane-1-carboxylate deaminase, mitochondrial C4 (Amber-Red) binding AT1G58230 AT1G58230 C4 (Amber-Red) Calcium-binding EF hand family protein AT1G21630 AT1G21630 C4 (Amber-Red) Calcium-transporting ATPase 2, endoplasmic ECA2 AT4G00900 reticulum-type C4 (Amber-Red) catalase 3 CAT3 AT1G20620 C4 (Amber-Red) CBL-interacting serine/threonine-protein kinase 12 CIPK12 AT4G18700

301 C4 (Amber-Red) Cell wall integrity/stress response component-like AT4G39840 AT4G39840 protein C4 (Amber-Red) Cofactor-independent phosphoglycerate mutase AT3G30841 AT3G30841 C4 (Amber-Red) Conserved oligomeric Golgi complex subunit 4 COG4 NA C4 (Amber-Red) COP1-interacting protein-like protein AT5G43310 AT5G43310 C4 (Amber-Red) Copper transporter 5 COPT5 AT5G20650 C4 (Amber-Red) Cryptochrome-2 CRY2 AT1G04400 C4 (Amber-Red) Cystathionine beta-lyase, chloroplastic CBL AT3G57050 C4 (Amber-Red) Cysteine protease XCP2 XCP2 AT1G20850 C4 (Amber-Red) Cystine lyase CORI3 CORI3 AT4G23600 C4 (Amber-Red) Cytochrome P450 83A1 CYP83A1 AT4G13770 C4 (Amber-Red) Cytochrome P450, family 706, subfamily A, CYP706A4 AT4G12300 polypeptide 4 C4 (Amber-Red) D-aminoacid aminotransferase-like PLP-dependent AT5G27410 AT5G27410 enzymes superfamily protein C4 (Amber-Red) Dihomomethionine N-hydroxylase CYP79F1 AT1G16410 C4 (Amber-Red) Diphosphomevalonate decarboxylase MVD1 AT2G38700 C4 (Amber-Red) Diphosphomevalonate decarboxylase MVD2, MVD2 AT3G54250 peroxisomal C4 (Amber-Red) DOF2 DOF3.1 AT3G21270 C4 (Amber-Red) DPP6 amino-terminal domain protein AT1G21670 AT1G21670 C4 (Amber-Red) E3 ubiquitin-protein ligase UPL2 UPL2 AT1G70320 C4 (Amber-Red) electron transfer flavoprotein beta ETFBETA AT5G43430 C4 (Amber-Red) EP1-like glycoprotein 3 AT1G78850 AT1G78850 C4 (Amber-Red) ER membrane protein complex subunit-like protein AT2G25310 AT2G25310 (DUF2012) C4 (Amber-Red) Exocyst complex component 84B EXO84B AT5G49830 C4 (Amber-Red) Expansin-like protein EXLB1 AT4G17030 C4 (Amber-Red) Expressed protein AT2G46900 AT2G46900 C4 (Amber-Red) External alternative NAD(P)H-ubiquinone NDB1 AT4G28220 oxidoreductase B1, mitochondrial

302 C4 (Amber-Red) Fe(3+)-Zn(2+) purple acid phosphatase 12 PAP12 AT2G27190 C4 (Amber-Red) Ferredoxin--NADP reductase, root isozyme 1, RFNR1 AT4G05390 chloroplastic C4 (Amber-Red) Filaggrin-like protein AT1G64370 AT1G64370 C4 (Amber-Red) Flavin-containing monooxygenase FMO GS-OX3 FMOGS-OX3 AT1G62560 C4 (Amber-Red) Flavonol 3-O-glucosyltransferase UGT89B1 UGT89B1 AT1G73880 C4 (Amber-Red) Folylpolyglutamate synthase FPGS1 AT5G05980 C4 (Amber-Red) Formate--tetrahydrofolate ligase THFS AT1G50480 C4 (Amber-Red) Gamma-glutamyl hydrolase 2 GGH2 AT1G78680 C4 (Amber-Red) GDSL esterase/lipase ESM1 ESM1 AT3G14210 C4 (Amber-Red) Geranylgeranyl transferase type-2 subunit alpha 1 RGTA1 AT4G24490 C4 (Amber-Red) Glucose-1-phosphate adenylyltransferase APL3 AT4G39210 C4 (Amber-Red) Glutathione S-transferase DHAR1, mitochondrial DHAR1 AT1G19570 C4 (Amber-Red) Glutathione S-transferase U20 GSTU20 AT1G78370 C4 (Amber-Red) Glutathione S-transferase U7 GSTU7 AT2G29420 C4 (Amber-Red) Glycolipid transfer protein 1 GLTP1 AT2G33470 C4 (Amber-Red) Glycosyltransferase UGT74B1 AT1G24100 C4 (Amber-Red) Glycosyltransferase UGT73B5 AT2G15480 C4 (Amber-Red) Glycosyltransferase (DUF604) AT4G15240 AT4G15240 C4 (Amber-Red) Glycosyltransferase (Fragment) CSLC4 AT3G28180 C4 (Amber-Red) GPT1 GPT1 AT5G54800 C4 (Amber-Red) GRF10 GRF10 AT1G22300 C4 (Amber-Red) GSTU19 GSTU19 AT1G78380 C4 (Amber-Red) Heptahelical transmembrane protein 3 HHP3 AT2G24150 C4 (Amber-Red) Hexosyltransferase GAUT9 AT3G02350 C4 (Amber-Red) Hexosyltransferase (Fragment) GAUT4 AT5G47780 C4 (Amber-Red) Inactive TPR repeat-containing thioredoxin TTL3 TTL3 AT2G42580 C4 (Amber-Red) Inner membrane localized protein AT1G42960 AT1G42960 C4 (Amber-Red) Inositol-phosphate phosphatase VTC4 AT3G02870 C4 (Amber-Red) IQD5 IQD5 AT3G22190 C4 (Amber-Red) Isoamylase 3, chloroplastic ISA3 AT4G09020

303 C4 (Amber-Red) jacalin-related lectin 23 JAL23 AT2G39330 C4 (Amber-Red) L-tryptophan--pyruvate aminotransferase 1 TAA1 AT1G70560 C4 (Amber-Red) Lactoylglutathione lyase GLX1 ATGLX1 AT1G11840 C4 (Amber-Red) Lipoxygenase 2, chloroplastic LOX2 AT3G45140 C4 (Amber-Red) LOS2 ENO2 AT2G36530 C4 (Amber-Red) Major Facilitator Superfamily with SPX AT1G63010 AT1G63010 (SYG1/Pho81/XPR1) domain-containing protein C4 (Amber-Red) MDAR6 MDAR5 AT1G63940 C4 (Amber-Red) Mechanosensitive ion channel protein 6 MSL6 AT1G78610 C4 (Amber-Red) Methionine aminotransferase BCAT4 BCAT4 AT3G19710 C4 (Amber-Red) methylthioalkylmalate synthase 1 MAM1 AT5G23010 C4 (Amber-Red) Methylthioalkylmalate synthase 3, chloroplastic MAM3 AT5G23020 C4 (Amber-Red) Mitochondrial phosphate carrier protein 3, MPT3 AT5G14040 mitochondrial C4 (Amber-Red) Mitochondrial substrate carrier family protein AT5G51050 AT5G51050 C4 (Amber-Red) Mitogen-activated protein kinase MPK2 AT1G59580 C4 (Amber-Red) Molybdenum cofactor sulfurase family protein AT5G44720 AT5G44720 C4 (Amber-Red) NAD(P)-binding Rossmann-fold superfamily protein AT3G20790 AT3G20790 C4 (Amber-Red) NAD(P)-linked oxidoreductase superfamily protein AT1G59960 AT1G59960 C4 (Amber-Red) NADPH-protochlorophyllide oxidoreductase PORA AT5G54190 C4 (Amber-Red) NET2D NET2D AT2G22560 C4 (Amber-Red) NHL domain-containing protein AT1G70280 AT1G70280 C4 (Amber-Red) NPL4-like protein 1 NPL41 AT3G63000 C4 (Amber-Red) nuclear matrix constituent protein-related LINC2 AT1G13220 C4 (Amber-Red) NUDT3 NUDT3 AT1G79690 C4 (Amber-Red) Outer envelope pore protein 16-1, chloroplastic OEP161 AT2G28900 C4 (Amber-Red) Pectin acetylesterase 5 PAE5 AT3G09410 C4 (Amber-Red) Peptidyl-prolyl cis-trans isomerase CYP23 CYP23 AT1G26940 C4 (Amber-Red) Phenylalanine ammonia-lyase PAL3 AT5G04230 C4 (Amber-Red) Phosphoinositide phosphatase SAC8 SAC8 AT3G51830 C4 (Amber-Red) Phosphoinositide phospholipase C 1 PLC1 AT5G58670

304 C4 (Amber-Red) Phosphoserine aminotransferase 2, chloroplastic PSAT2 AT2G17630 C4 (Amber-Red) Phosphotransferase ATHXK4 AT3G20040 C4 (Amber-Red) Plant intracellular Ras-group-related LRR protein 1 PIRL1 AT5G05850 C4 (Amber-Red) PMSR2 MRSA2 AT5G07460 C4 (Amber-Red) Probable 2-oxoglutarate-dependent dioxygenase AOP1 AT4G03070 AOP1 C4 (Amber-Red) Probable acyl-activating enzyme 17, peroxisomal AAE17 AT5G23050 C4 (Amber-Red) Probable glucose-1-phosphate adenylyltransferase APL4 AT2G21590 large subunit, chloroplastic C4 (Amber-Red) Probable inositol 3-phosphate synthase isozyme 3 IPS3 AT5G10170 C4 (Amber-Red) Probable methyltransferase PMT21 ERD3 AT4G19120 C4 (Amber-Red) Probable mitochondrial saccharopine dehydrogenase- AT5G39410 AT5G39410 like oxidoreductase At5g39410 C4 (Amber-Red) Probable pinoresinol-lariciresinol reductase 3 PLR3 AT4G34540 C4 (Amber-Red) Probable plastid-lipid-associated protein 8, PAP8 AT5G19940 chloroplastic C4 (Amber-Red) Probable serine/threonine protein kinase IREH1 IREH1 AT3G17850 C4 (Amber-Red) Probable UMP-CMP kinase 1 UMK1 AT3G60180 C4 (Amber-Red) Probable uridine nucleosidase 2 URH2 AT1G05620 C4 (Amber-Red) Proteasome subunit alpha type-1-B PAF2 AT1G47250 C4 (Amber-Red) Protein CLT3, chloroplastic CLT3 AT5G12170 C4 (Amber-Red) Protein FAR-RED IMPAIRED RESPONSE 1 FAR1 AT4G15090 C4 (Amber-Red) Protein LIKE COV 1 LCV1 AT2G20130 C4 (Amber-Red) Protein NETWORKED 4B NET4B AT2G30500 C4 (Amber-Red) Protein phosphatase 2C family protein AT3G02750 AT3G02750 C4 (Amber-Red) Protein transport protein Sec61 subunit beta MUF9.9 AT5G60460 C4 (Amber-Red) Protochlorophyllide reductase B, chloroplastic PORB AT4G27440 C4 (Amber-Red) Protochlorophyllide reductase C, chloroplastic PORC AT1G03630 C4 (Amber-Red) Putative aluminum-activated malate transporter 3 ALMT3 AT1G18420 C4 (Amber-Red) Pyridoxal phosphate (PLP)-dependent transferases POP2 AT3G22200 superfamily protein

305 C4 (Amber-Red) Pyridoxamine 5'-phosphate oxidase family protein AT1G51560 AT1G51560 C4 (Amber-Red) RAD23A RAD23A AT1G16190 C4 (Amber-Red) Regulator of chromosome condensation (RCC1) AT3G02510 AT3G02510 family protein C4 (Amber-Red) Rhomboid-like protein RBL3 AT5G07250 C4 (Amber-Red) RuvB-like protein 1 RIN1 AT5G22330 C4 (Amber-Red) S-alkyl-thiohydroximate lyase SUR1 SUR1 AT2G20610 C4 (Amber-Red) SAL1 phosphatase SAL1 AT5G63980 C4 (Amber-Red) Selenium-binding protein 2 SBP2 AT4G14040 C4 (Amber-Red) Serine acetyltransferase 5 SAT5 AT5G56760 C4 (Amber-Red) Serine protease inhibitor (SERPIN) family protein AT1G47710 AT1G47710 C4 (Amber-Red) SEX4 DSP4 AT3G52180 C4 (Amber-Red) SNF1-related protein kinase catalytic subunit alpha KIN10 AT3G01090 KIN10 C4 (Amber-Red) SNF7 family protein AT3G62080 AT3G62080 C4 (Amber-Red) SOT17 SOT17 AT1G18590 C4 (Amber-Red) Squalene epoxidase 6 SQE6 AT5G24160 C4 (Amber-Red) Sugar transporter, putative (DUF1195) AT5G65650 AT5G65650 C4 (Amber-Red) Sulfhydryl oxidase 2 QSOX2 AT2G01270 C4 (Amber-Red) Sulfotransferase SOT18 AT1G74090 C4 (Amber-Red) T14P8.17 AT4G02360 AT4G02360 C4 (Amber-Red) TPS1 TPS1 AT1G78580 C4 (Amber-Red) TRAF-like family protein AT4G00780 AT4G00780 C4 (Amber-Red) Trafficking protein particle complex II-specific TRS130 AT5G54440 subunit 130 homolog C4 (Amber-Red) transcription activators PIR AT5G18410 C4 (Amber-Red) Transducin/WD40 repeat-like superfamily protein AT3G50590 AT3G50590 C4 (Amber-Red) Transducin/WD40 repeat-like superfamily protein AT5G24710 AT5G24710 C4 (Amber-Red) Transmembrane 9 superfamily member TMN7 AT3G13772 C4 (Amber-Red) Triosephosphate isomerase, cytosolic CTIMC AT3G55440 C4 (Amber-Red) Tryptophan synthase alpha chain TRPA1 AT4G02610

306 C4 (Amber-Red) TSK-associating protein 1 TSA1 AT1G52410 C4 (Amber-Red) UCP1 PUMP1 AT3G54110 C4 (Amber-Red) UDP-glucose 4-epimerase 4 UGE4 AT1G64440 C4 (Amber-Red) UDP-glucose 6-dehydrogenase 4 UGD4 AT5G39320 C4 (Amber-Red) UDP-glycosyltransferase 90A1 UGT90A1 AT2G16890 C4 (Amber-Red) UEV1A UEV1A AT1G23260 C4 (Amber-Red) unknown protein AT5G08270 AT5G08270 C4 (Amber-Red) Vacuolar protein sorting-associated protein 35C VPS35C AT3G51310 C4 (Amber-Red) VHA-A VHA-A AT1G78900 C4 (Amber-Red) VOZ2 VOZ2 AT2G42400 C4 (Amber-Red) WD repeat-containing protein 26 homolog WDR26 AT5G08560 C4 (Amber-Red) WD repeat-containing protein DWA2 DWA2 AT1G76260 C5 (Red) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase AT1G78550 AT1G78550 superfamily protein C5 (Red) 26S proteasome non-ATPase regulatory subunit 1 RPN2B AT1G04810 homolog C5 (Red) 26S proteasome non-ATPase regulatory subunit 2 RPN1A AT2G20580 homolog C5 (Red) 26S proteasome non-ATPase regulatory subunit 3 RPN3A AT1G20200 homolog A C5 (Red) 6-phosphogluconate dehydrogenase, decarboxylating PGD2 AT3G02360 C5 (Red) 60S ribosomal protein L19-3 RPL19C AT4G02230 C5 (Red) 60S ribosomal protein L26-2 RPL26B AT5G67510 C5 (Red) AAA-ATPase At5g57480 AT5G57480 AT5G57480 C5 (Red) AAA-type ATPase family protein AT4G02480 AT4G02480 C5 (Red) ABC transporter F family member 1 ABCF1 AT5G60790 C5 (Red) ABC transporter G family member 40 ABCG40 AT1G15520 C5 (Red) ALA-interacting subunit 3 ALIS3 AT1G54320 C5 (Red) Alpha/beta-Hydrolases superfamily protein AT2G39420 AT2G39420 C5 (Red) Alpha/beta-Hydrolases superfamily protein AT3G09690 AT3G09690

307 C5 (Red) Anthranilate N-hydroxycinnamoyl/benzoyltransferase, AT1G28680 AT1G28680 putative C5 (Red) AOC2 AOC2 AT3G25770 C5 (Red) Aspartate aminotransferase 3, chloroplastic ASP3 AT5G11520 C5 (Red) At1g33030/F9L11_18 AT1G33030 AT1G33030 C5 (Red) At1g55840/F14J16_2 AT1G55840 AT1G55840 C5 (Red) At1g67350 AT1G67350 AT1G67350 C5 (Red) At2g16595 AT2G16595 AT2G16595 C5 (Red) AT2G31490 protein AT2G31490 AT2G31490 C5 (Red) At2g41380 AT2G41380 AT2G41380 C5 (Red) AT3g22600/F16J14_17 AT3G22600 AT3G22600 C5 (Red) At4g01700 AT4G01700 AT4G01700 C5 (Red) AT4g17010/dl4535w AT4G17010 AT4G17010 C5 (Red) AT4g21110/F7J7_50 AT4G21110 AT4G21110 C5 (Red) AT4G22880 protein LDOX AT4G22880 C5 (Red) At4g23885 AT4G23885 AT4G23885 C5 (Red) At4g36090 AT4G36090 AT4G36090 C5 (Red) At5g23850 AT5G23850 AT5G23850 C5 (Red) At5g26610 AT5G26610 AT5G26610 C5 (Red) At5g43670 AT5G43670 AT5G43670 C5 (Red) At5g61510 AT5G61510 AT5G61510 C5 (Red) ATP-dependent 6-phosphofructokinase 3 PFK3 AT4G26270 C5 (Red) ATP-dependent 6-phosphofructokinase 7 PFK7 AT5G56630 C5 (Red) ATP-dependent DNA helicase 2 subunit KU80 KU80 AT1G48050 C5 (Red) ATP-dependent zinc metalloprotease FTSH 7, FTSH7 AT3G47060 chloroplastic C5 (Red) B-cell receptor-associated protein 31-like protein AT1G11905 AT1G11905 C5 (Red) Basic-leucine zipper (BZIP) transcription factor AT1G58110 AT1G58110 family protein C5 (Red) Berberine bridge enzyme-like 3 FOX1 AT1G26380 C5 (Red) Berberine bridge enzyme-like 4 FOX2 AT1G26390

308 C5 (Red) Berberine bridge enzyme-like 7 FOX5 AT1G26420 C5 (Red) Bifunctional dihydrocamalexate synthase/camalexin CYP71B15 AT3G26830 synthase C5 (Red) CAAX prenyl protease 1 homolog FACE1 AT4G01320 C5 (Red) Carboxyl-terminal domain (Ctd) phosphatase-like 2 CPL2 AT5G01270 C5 (Red) Cathepsin B-like protease 3 CATHB3 AT4G01610 C5 (Red) Cation-chloride cotransporter 1 CCC1 AT1G30450 C5 (Red) Class V chitinase ChiC AT4G19810 C5 (Red) Cleavage stimulating factor 64 CSTF64 AT1G71800 C5 (Red) CONTAINS InterPro DOMAIN/s: Vacuolar AT2G37680 AT2G37680 import/degradation protein Vid24 (InterPro:IPR018618); Ha. C5 (Red) Contains similarity to O-linked GlcNAc transferases AT3G04830 AT3G04830 C5 (Red) Coumaroyl-CoA:anthocyanidin 3-O-glucoside-6''-O- 3AT1 AT1G03940 coumaroyltransferase 1 C5 (Red) Cytochrome c oxidase subunit 5b-2, mitochondrial COX5B-2 AT1G80230 C5 (Red) Cytochrome P450 709B3 CYP709B3 AT4G27710 C5 (Red) cytochrome P450, family 79, subfamily B, CYP79B2 AT4G39950 polypeptide 2 C5 (Red) Cytochrome P450, family 81, subfamily D, CYP81D8 AT4G37370 polypeptide 8 C5 (Red) D-3-phosphoglycerate dehydrogenase PGDH AT1G17745 C5 (Red) DEAD-box ATP-dependent RNA helicase 30 RH30 AT5G63120 C5 (Red) Deoxyhypusine hydroxylase AT3G58180 AT3G58180 C5 (Red) DExH-box ATP-dependent RNA helicase DExH18, AT5G39840 AT5G39840 mitochondrial C5 (Red) Dihydroflavonol reductase DFRA AT5G42800 C5 (Red) Dirigent protein 20 DIR20 AT1G55210 C5 (Red) DNA repair REX1-B protein AT5G04910 AT5G04910 C5 (Red) E3 ubiquitin-protein ligase listerin AT5G58410 AT5G58410 C5 (Red) Elongation factor G-1, mitochondrial MEFG1 AT1G45332

309 C5 (Red) Embryonic abundant protein-like AT3G54150 AT3G54150 C5 (Red) Endoplasmic reticulum oxidoreductins 2 ERO2 AT2G38960 C5 (Red) Endoplasmic reticulum vesicle transporter protein AT1G22200 AT1G22200 C5 (Red) ERF1-1 ERF1-1 AT5G47880 C5 (Red) Evolutionarily conserved C-terminal region 10 ECT10 AT5G58190 C5 (Red) Expressed protein AT2G16900 AT2G16900 C5 (Red) Expressed protein AT2G35790 AT2G35790 C5 (Red) F-box protein At1g78280 AT1G78280 AT1G78280 C5 (Red) F16L1.9 protein AT1G22180 AT1G22180 C5 (Red) F7A19.25 protein AT1G14170 AT1G14170 C5 (Red) F8M12.2 protein AT4G10860 AT4G10860 C5 (Red) Ferrochelatase-1, chloroplastic/mitochondrial FC1 AT5G26030 C5 (Red) Unknown protein AT1G50120 AT1G50120 C5 (Red) FUT12 FUT12 AT1G49710 C5 (Red) GDSL esterase/lipase At5g03610 AT5G03610 AT5G03610 C5 (Red) GGP3 GGP3 AT4G30550 C5 (Red) Gls protein (DUF810) AT2G20010 AT2G20010 C5 (Red) Glutathione S-transferase F12 GSTF12 AT5G17220 C5 (Red) Glutathione S-transferase F6 GSTF6 AT1G02930 C5 (Red) Glutathione S-transferase F7 GSTF7 AT1G02920 C5 (Red) Glutathione S-transferase L1 GSTL1 AT5G02780 C5 (Red) Glutathione S-transferase U10 GSTU10 AT1G74590 C5 (Red) Glutathione S-transferase U4 GSTU4 AT2G29460 C5 (Red) Glutathione S-transferase U8 GSTU8 AT3G09270 C5 (Red) Glycosyltransferase (Fragment) A3G2XYLT AT5G54060 C5 (Red) Hypoxia-responsive family protein AT5G27760 AT5G27760 C5 (Red) IAA-amino acid hydrolase ILR1-like 3 ILL3 AT5G54140 C5 (Red) Immune-associated nucleotide-binding protein 7 IAN7 AT1G33950 C5 (Red) Indoleacetaldoxime dehydratase CYP71A13 AT2G30770 C5 (Red) IPGAM2 AT3G08590 AT3G08590 C5 (Red) Long chain acyl-CoA synthetase 6, peroxisomal LACS6 AT3G05970

310 C5 (Red) LPPgamma LPPG AT5G03080 C5 (Red) MA3 domain-containing protein AT1G22730 AT1G22730 C5 (Red) Microsomal signal peptidase 25 kDa subunit (SPC25) AT4G04200 AT4G04200 C5 (Red) Mitochondrial phosphate carrier protein 2, MPT2 AT3G48850 mitochondrial C5 (Red) Mitochondrial ribosomal protein L51/S25/CI-B8 AT3G59650 AT3G59650 family protein C5 (Red) Mitochondrial uncoupling protein 5 PUMP5 AT2G22500 C5 (Red) modifier of snc1 MOS1 AT4G24680 C5 (Red) NAD(P)H dehydrogenase B2 NDB2 AT4G05020 C5 (Red) NDR1/HIN1-like protein 6 NHL6 AT1G65690 C5 (Red) NifU-like protein 5, mitochondrial NIFU5 AT1G51390 C5 (Red) Non-specific serine/threonine protein kinase AT5G09890 AT5G09890 C5 (Red) O-fucosyltransferase 35 OFUT35 AT5G35570 C5 (Red) Outer envelope protein 64, mitochondrial OM64 AT5G09420 C5 (Red) P-loop containing nucleoside triphosphate hydrolases MCI2.1 AT5G61450 superfamily protein C5 (Red) Peptidase C78, ubiquitin fold modifier-specific AT3G48380 AT3G48380 peptidase 1/ 2 C5 (Red) Peptide methionine sulfoxide reductase B3 MSRB3 AT4G04800 C5 (Red) Peptidyl-prolyl cis-trans isomerase CYP65 CYP65 AT5G67530 C5 (Red) Peroxidase 51 PER51 AT4G37530 C5 (Red) Peroxidase 58 PER58 AT5G19880 C5 (Red) Peroxisome biogenesis protein 1 PEX1 AT5G08470 C5 (Red) Phosphoenolpyruvate carboxylase 1 PPC1 AT1G53310 C5 (Red) Phox (PX) domain-containing protein AT1G15240 AT1G15240 C5 (Red) PHT1 PHT1-4 AT2G38940 C5 (Red) PMT5 PLT5 AT3G18830 C5 (Red) Probable 2-oxoglutarate-dependent dioxygenase AT5G05600 AT5G05600 At5g05600 C5 (Red) Probable acyl-CoA dehydrogenase IBR3 IBR3 AT3G06810

311 C5 (Red) Probable calcium-binding protein CML35 CML35 AT2G41410 C5 (Red) Probable carboxylesterase 6 CXE6 AT1G68620 C5 (Red) Probable fructokinase-7 AT5G51830 AT5G51830 C5 (Red) Probable mediator of RNA polymerase II transcription MED26C AT5G09850 subunit 26c C5 (Red) Probable pectinesterase/pectinesterase inhibitor 17 PME17 AT2G45220 C5 (Red) Probable pre-mRNA-splicing factor ATP-dependent AT1G27900 AT1G27900 RNA helicase DEAH4 C5 (Red) Probable serine/threonine-protein kinase PBL19 PBL19 AT5G47070 C5 (Red) Probable ubiquitin conjugation factor E4 PUB1 AT5G15400 C5 (Red) Probable xyloglucan endotransglucosylase/hydrolase XTH23 AT4G25810 protein 23 C5 (Red) Prolyl 4-hydroxylase 5 P4H5 AT2G17720 C5 (Red) Protein DETOXIFICATION 47, chloroplastic DTX47 AT4G39030 C5 (Red) Protein kinase superfamily protein AT2G32850 AT2G32850 C5 (Red) Protein NRT1/ PTR FAMILY 2.13 NPF2.13 AT1G69870 C5 (Red) Protein OBERON 4 OBE4 AT3G63500 C5 (Red) Protein PGR PGR AT5G19930 C5 (Red) Protein PHOSPHATE STARVATION RESPONSE 1 PHR1 AT4G28610 C5 (Red) Protein SPIRRIG SPI AT1G03060 C5 (Red) Protein STRICTOSIDINE SYNTHASE-LIKE 7 SSL7 AT3G51450 C5 (Red) Pseudouridine synthase family protein AT3G04820 AT3G04820 C5 (Red) Putative UDP-N-acetylglucosamine--N- AT1G73740 AT1G73740 acetylmuramyl-(Pentapeptide)-pyrophosphoryl- undecaprenol N-acetylglucosamine transferase; 62395-63952 C5 (Red) PX domain-containing protein EREX EREX AT3G15920 C5 (Red) Pyruvate kinase AT2G36580 AT2G36580 C5 (Red) Pyruvate kinase AT5G63680 AT5G63680 C5 (Red) RABA1d RABA1D AT4G18800 C5 (Red) Regulator of nonsense transcripts 1 homolog UPF1 AT5G47010

312 C5 (Red) RNA demethylase ALKBH10B ALKBH10B AT4G02940 C5 (Red) RNA polymerase II C-terminal domain phosphatase- CPL3 AT2G33540 like 3 C5 (Red) S1P SBT6.1 AT5G19660 C5 (Red) SacI homology domain-containing protein / WW SAC9 AT3G59770 domain-containing protein C5 (Red) SAG13 SAG13 AT2G29350 C5 (Red) SEC12-like protein 1 PHF1 AT3G52190 C5 (Red) SEC22 SEC22 AT1G11890 C5 (Red) senescence-associated gene 21 SAG21 AT4G02380 C5 (Red) Signal recognition particle 54 kDa protein 3 SRP-54C AT1G48900 C5 (Red) SIN3-like 3 SNL3 AT1G24190 C5 (Red) Single-stranded nucleic acid binding R3H protein AT5G05100 AT5G05100 C5 (Red) SMG1 RABA4C AT5G47960 C5 (Red) Sphingosine-1-phosphate lyase DPL1 AT1G27980 C5 (Red) SPX domain-containing protein 2 SPX2 AT2G26660 C5 (Red) Stearoyl- S-ACP-DES3 AT5G16230 C5 (Red) Subtilisin-like protease SBT3.3 SBT3.3 AT1G32960 C5 (Red) Subtilisin-like protease SBT3.5 SBT3.5 AT1G32940 C5 (Red) SUMO-activating enzyme subunit 1A SAE1A AT4G24940 C5 (Red) SUMO-activating enzyme subunit 2 SAE2 AT2G21470 C5 (Red) Tesmin/TSO1-like CXC domain-containing protein AT2G20110 AT2G20110 C5 (Red) Thioredoxin H5 TRX5 AT1G45145 C5 (Red) Thioredoxin superfamily protein AT5G38900 AT5G38900 C5 (Red) THO complex subunit 1 THO1 AT5G09860 C5 (Red) Thylakoid ADP,ATP carrier protein, chloroplastic TAAC AT5G01500 C5 (Red) TI1 ATTI1 AT2G43510 C5 (Red) Time for coffee TIC AT3G22380 C5 (Red) tolB protein-related AT4G01870 AT4G01870 C5 (Red) Transcriptional repressor ILP1 ILP1 AT5G08550 C5 (Red) Translocon-associated protein subunit beta AT5G14030 AT5G14030

313 C5 (Red) Transmembrane protein AT4G29960 AT4G29960 C5 (Red) Ubiquitin carboxyl-terminal hydrolase 10 UBP10 AT4G10570 C5 (Red) Ubiquitin carboxyl-terminal hydrolase 6 UBP6 AT1G51710 C5 (Red) Ubiquitin domain-containing protein DSK2b DSK2B AT2G17200 C5 (Red) Ubiquitin system component Cue protein AT1G27752 AT1G27752 C5 (Red) UBP5 UBP5 AT2G40930 C5 (Red) UDP-glucose:glycoprotein EBS1 AT1G71220 glucosyltransferases;transferases, transferring hexosyl groups;transferases, transferring glycosyl groups C5 (Red) UDP-glycosyltransferase 75C1 UGT75C1 AT4G14090 C5 (Red) UDP-glycosyltransferase 76B1 UGT76B1 AT3G11340 C5 (Red) UDP-sulfoquinovose synthase, chloroplastic SQD1 AT4G33030 C5 (Red) Unknown protein AT2G15860 AT2G15860 C5 (Red) Unknown protein AT3G50370 AT3G50370 C5 (Red) Unknown protein AT1G73350 AT1G73350 C5 (Red) Uric acid degradation bifunctional protein TTL TTL AT5G58220 C5 (Red) UXE1 MUR4 AT1G30620 C5 (Red) Vacuolar sorting protein 39 VPS3 AT1G22860 C5 (Red) VACUOLAR SORTING RECEPTOR 7 VSR7 AT4G20110 C5 (Red) Varicose-related protein VCR AT3G13290 C5 (Red) VPS9A VPS9A AT3G19770 C5 (Red) Zinc finger CCCH domain-containing protein 30 AT2G41900 AT2G41900 C5 (Red) Zinc finger CCCH domain-containing protein 56 AT5G12850 AT5G12850

314