Oscaf1, a CRM Domain Containing Protein, Influences Chloroplast

International Journal of Molecular Sciences

Article OsCAF1, a CRM Domain Containing Protein, Inﬂuences Chloroplast Development

1, 1, 2 1 1 1 Qiang Zhang † , Lan Shen †, Zhongwei Wang , Guanglian Hu , Deyong Ren , Jiang Hu , Li Zhu 1, Zhenyu Gao 1, Guangheng Zhang 1 , Longbiao Guo 1, Dali Zeng 1 and Qian Qian 1,*

1 State Key Laboratory of Rice Biology/China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou 310006, China 2 Biotechnology Research Center, Chongqing Academy of Agricultural Sciences, Chongqing 401329, China * Correspondence: [email protected]; Tel.: +86-571-63371418 These authors contributed equally to this study. † Received: 6 July 2019; Accepted: 3 September 2019; Published: 6 September 2019

Abstract: The chloroplast RNA splicing and ribosome maturation (CRM) domain proteins are involved in the splicing of chloroplast gene introns. Numerous CRM domain proteins have been reported to play key roles in chloroplast development in several plant species. However, the functions of CRM domain proteins in chloroplast development in rice remain poorly understood. In the study, we generated oscaf1 albino mutants, which eventually died at the seedling stage, through the editing of OsCAF1 with two CRM domains using CRISPR/Cas9 technology. The mesophyll cells in oscaf1 mutant had decreased chloroplast numbers and damaged chloroplast structures. OsCAF1 was located in the chloroplast, and transcripts revealed high levels in green tissues. In addition, the OsCAF1 promoted the splicing of group IIA and group IIB introns, unlike orthologous proteins of AtCAF1 and ZmCAF1, which only aﬀected the splicing of subgroup IIB introns. We also observed that the C-terminal of OsCAF1 interacts with OsCRS2, and OsCAF1–OsCRS2 complex may participate in the splicing of group IIA and group IIB introns in rice chloroplasts. OsCAF1 regulates chloroplast development by inﬂuencing the splicing of group II introns.

Keywords: chloroplast RNA splicing and ribosome maturation (CRM) domain; intron splicing; chloroplast development; rice

1. Introduction Chloroplasts are important organelles in plants. A series of metabolic processes occur in chloroplasts, including photosynthesis and anabolism of compounds such as tetrapyrroles, terpenoids, lipids, amino acids, and hormones [1]. Chloroplasts are considered semi-autonomous organelles because their development is not only influenced by their own genetic material but also by fine regulation by nuclear-encoded genes [2,3]. Studies have shown that by plastid-encoded polymerases (PEPs) and nucleus-encoded polymerases (NEPs) influence the development of chloroplasts [4–6]. Chloroplast genes encode approximately 100 proteins, some of which have one or more introns that cannot be self-spliced, and the primary RNA transcription of such chloroplast genes require splicing by ribozymes potentially via chemical steps similar to spliceosome-mediated splicing in the nucleus [7–9]. In plants, based on the primary sequences, predicted structures, and splicing mechanisms, the introns of the chloroplast are mainly classified into two categories, including group I and group II [10]. Group II introns are mainly divided further into two subgroups, including subgroup IIA introns and subgroup IIB introns [11]. Arabidopsis thaliana, maize, and rice chloroplast genomes all have only 1 group I intron, and 20, 17, and 17 group II introns, respectively [8]. In plant chloroplasts, such introns have lost the

Int. J. Mol. Sci. 2019, 20, 4386; doi:10.3390/ijms20184386 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2019, 20, 4386 2 of 13 capacity to self-splice in vivo and require nuclear gene-encoded proteins as co-factors to participate in splicing [8,12]. Numerous studies have shown that nuclear-encoded pentatricopeptide repeat (PPR) proteins participate in chloroplast RNA editing and splicing, which are critical for chloroplast development and function [8,13]. Currently, the large PPR protein families, including AtOTP51, ZmPPR5, OsPPR6, and OsPPR1, are considered to participate in different chloroplast group II intron splicing activities [14–18]. Previous studies have shown that the disruption of the normal functions of such PPR proteins could lead to abnormal chloroplast development, which would lead to albino seedlings or death of plants [14–18]. In addition to the PPR proteins mentioned above, chloroplast RNA splicing and ribosome maturation (CRM) domain proteins participate in the splicing of chloroplast gene introns [8]. In plants, the splicing of chloroplast introns requires splicing factors encoded by nuclear genes and the abnormal splicing of chloroplast intron will affect the development of chloroplast [14–16]. Several proteins with CRM domains have been identified as splicing co-factors, including CFM2, CFM3, CRS1, CAF1, and CAF2 [8]. Both ZmCFM2 and AtCFM2 have four CRM domains, and they participate in the splicing of ndhA and ycf3-1 subgroup IIB and group I introns. In A. thaliana, AtCFM2 potentially promotes the splicing of clpP introns [19]. CFM3 and CRS1 contain three CRM domains, and AtCRS1 and ZmCRS1 have been associated with the splicing of the atpF intron, which belongs to subgroup IIA introns [20,21]. In addition, CFM3 has been reported to be dual-localized in chloroplasts and mitochondria, and CFM3a is required for the splicing of group II introns, including ndhB, rpl16, rps16, petD, and petB introns in chloroplasts [19]. The CAF1 and CAF2 contain two CRM domains, which are required for the splicing of group IIB introns, including ndhA, ndhB, petB, petD, rpl16, rps16, trnG, and ycf3-1 in maize and A. thaliana [11,21]. In A. thaliana, AtCAF2 potentially promotes the splicing of rpoC1 and ClpP introns that are absent in the maize chloroplast genome [21]. In addition, CAF1 and CAF2 could interact with CRS2, forming the CRS2–CAF1 and CRS2–CAF2 complexes, which participate in the splicing of chloroplast group II introns and the regulation of chloroplast development in maize [22]. Previous studies have shown that there are 14 proteins that contain one or more CRM domains in rice [8]. To date, researchers have only studied the functions of OsCRS1 and OsCFM3, which contain three CRM domains. The studies revealed that oscrs1 mutants exhibited albino leaf phenotypes in rice [23]. In addition, OsCRS1 has been reported to participate in the splicing of ndhA, ndhB, petD, ycf3-1, and trnL introns and it could influence the expression of PEP-dependent genes such as psaA and psbA [23]. Furthermore, oscfm3 T-DNA insertion mutants exhibited albino seedling phenotypes; however, the OsCFM3 participates in the intron splicing of ndhB, petD, rps16, and rpl16 in rice [19]. The functions of other CRM domain proteins have hardly been reported in rice. Previous studies have shown that homologous CAF1 plays important roles in chloroplast development in A. thaliana and Zea mays L. In rice, the function of OsCAF1 remains unknown and investigating its function would enhance our understanding of mechanisms of chloroplast development. In this study, we investigated the function of OsCAF1 in rice chloroplast development, and oscaf1 mutants were obtained using the CRISPR-Cas9 system. The results of our study revealed that oscaf1 mutants exhibited albino seedlings phenotype along with a damaged chloroplast structure. In rice, chloroplast development is regulated by the expression of PEP-dependent genes, which could be affected by OsCAF1. In addition, we observed that the leaves of oscaf1 mutants accumulated higher hydrogen peroxide (H2O2) contents. In addition, OsCAF1 could interact with the OsCRS2 via C-terminal, and then form an OsCAF1–OsCRS2 complex that regulates the splicing of chloroplast gene introns. Chloroplast RNA splicing analysis showed that OsCAF1 influenced the splicing of both chloroplast subgroup IIA and subgroup IIB introns, which is different from the orthologous proteins of AtCAF1 and ZmCAF1, which both influence the splicing of chloroplast subgroup IIB introns. The results of the present study reveal the functions of OsCAF1 in the regulation of rice chloroplast development. Int. J. Mol. Sci. 2019, 20, 4386 3 of 13

Int.2.Results J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 3 of 13

2.1. Knockout Knockout of OsCAF1 Produced the Albino Seedling Phenotype According to a previous study, the orthologortholog of ZmCAF1 inin ricerice waswas Os01g0495900Os01g0495900, which was named OsCAF1, and the function of OsCAF1 has not been determined to date [8]. [8]. We observed that the cDNA cDNA of of OsCAF1OsCAF1 hadhad a a2106-bp 2106-bp nucleotide nucleotide and and encoded encoded 701 701 amino amino acids acids (aa). (aa). To determine To determine the functionthe function of OsCAF1 of OsCAF1 in inrice rice chloroplast chloroplast development, development, oscaf1oscaf1 mutantsmutants were were generated generated using using the CRISPR/Cas9CRISPR/Cas9 system (Figure 11A,B),A,B), andand 2626 transgenictransgenic plantsplants werewere obtainedobtained inin thethe TT0 generation.generation. Sequencing and phenotypic analysis revealed that oscaf1 homozygous mutants exhibited the albino phenotype inin thethe ricerice seedingseeding stage stage (Figure (Figure1C,D), 1C,D), and an thend then died died after after the the three three leaves leaves stage. stage. In bothIn both of of#3 #3 and and #4 mutants,#4 mutants, a premature a premature stop stop codon codon was createdwas created by a frame by a shiftframe in shift the coding in the regioncoding of regionOsCAF1 of. OsCAF1However,. However, the OsCAF1 the/oscaf1 OsCAF1/oscaf1heterozygous heterozygous exhibited exhibited green leaves green (Figure leaves1C,D), (Figure which 1C,D), exhibited which exhibitednormal growth normal and growth phenotypes and underphenotypes chamber under conditions. chamber Because conditions. of oscaf1 /oscaf1Becausehomozygous of oscaf1/oscaf1 lethal homozygousmutants, the heterozygouslethal mutants, lines the were heterozygous used to generate lines were the Tused1 generation. to generate The the diﬀ Terent1 generation. homozygous The differentmutations homozygous in the allele’s mutations of OsCAF1 in inthe T 1allele’sgeneration of OsCAF1 were obtainedin T1 generation from #1 were and #2obtained plants andfrom also #1 andexhibited #2 plants albino and seedling also exhibited phenotypes. albino Theseseedling results phenotypes. indicated These that OsCAF1results indicatedmutations that caused OsCAF1 the mutationsalbino seedling caused phenotype. the albino To seedling study the phen functionotype. ofTo OsCAF1, study theoscaf1 functionmutants of OsCAF1, from T1 generation oscaf1 mutants of #1 plantfrom T were1 generation selected of for #1 further plant were analysis. selected for further analysis.

Figure 1.1. KnockoutKnockout of ofOsCAF1 OsCAF1produces produces the albinothe albino phenotype phenotype in seedlings. in seedlings. (A) Diagram (A) Diagram of CRISPR of/ CRISPR/Cas9Cas9 system for system editing for OsCAF1. editing OsCAF1. (B) Schematic (B) Schematic diagram ofdiagram the targeted of the site targeted in OsCAF1. site in (OsCAF1.C) Mutation (C)

Mutationtypes of four types positive of four plants positive in T0 generation.plants in T0 The generation. targeted sequencesThe targeted are insequences blue letters. are The in blue protospacer letters. Theadjacent protospacer motif (PAM) adjacent sequences motif are(PAM) in red sequences letters. The ar numbere in red ofletters. nucleotides The number at both sidesof nucleotides of the target at bothsequences sides isof 18the bp. target (D) Phenotypessequences is of 18 four bp. positive(D) Phenotypes plants at of seedling four positive stage. Scaleplants bar, at seedling 1 cm. stage. Scale bar, 1 cm. 2.2. The oscaf1 Mutant Exhibited Defects in Chloroplast Development 2.2. TheThe oscaf1oscaf1 Mutantmutant Exhibited exhibited Defects an albino in Chloroplast seedling phenotype Development and eventually died after the three leaves stageThe (Figure oscaf12A). mutant Compared exhibited with thean albino wild type seedling (WT), photosyntheticphenotype and pigmenteventually concentrations died after the showed three leavesthat chlorophyll stage (Figure a (Chla), 2A). chlorophyll Compared b (Chlb), with and the carotenoid wild type (Car) (WT), contents photosynthetic decreased signiﬁcantly pigment oscaf1 concentrationsin mutants showed (Figure that2B). chlorophyll According a to(Chla), the results chlorophyll of chlorophyll b (Chlb), and ﬂuorescence carotenoid measurements, (Car) contents oscaf1 oscaf1 decreasedthe Fv/Fm valuessignificantly of in mutantsoscaf1 mutants were low (Figure (Figure 2B).2C). TheAccording results suggestedto the results that of chlorophyllmutants fluorescencehad impaired measurements, chloroplast development the Fv/Fm and values photosynthesis. of oscaf1 mutants Subsequently, were low we (Figure analyzed 2C). the The expression results oscaf1 suggestedlevels of chloroplast that oscaf1 development mutants andhad photosynthesis-relatedimpaired chloroplast genesdevelopment in WT and and photosynthesis.mutants using Subsequently, we analyzed the expression levels of chloroplast development and photosynthesis-related genes in WT and oscaf1 mutants using qRT-PCR. The results showed that compared with the WT, the transcript levels of HZMA1, PORA, Int. J. Mol. Sci. 2019, 20, 4386 4 of 13

Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 4 of 13 qRT-PCR. The results showed that compared with the WT, the transcript levels of HZMA1, PORA, CAB1, psaA, rbcL, CHLI, CHLH,, ATPa, psbA,, TaX2, ATPB, and ATPE in oscaf1 mutants decreased, while the relativerelative expressionexpression levelslevels ofof YGLIYGLI,, HSA1HSA1,, HSA2HSA2,, RPOBRPOB,, RPOC1RPOC1,, andand RPOC2 increasedincreased (Figure(Figure2 D).2D). Particularly, Particularly, in inoscaf1 oscaf1mutants, mutants, the the expression expression levels levels of HZMA1 of HZMA1, PORA, PORA, CAB1, CAB1, psaA, ,psaArbcL,, CHLH,rbcL, CHLH,and psbA anddecreased psbA decreased signiﬁcantly, significantly, and the expressionand the expression levels of YGLI levels, HSA1 of YGLI, RPOB, HSA1, RPOC1,, RPOBand, RPOC2RPOC1,increased and RPOC2 markedly increased in oscaf1markedlymutants in oscaf1 (Figure mutants2D). Overall, (Figure the2D). results Overall, suggested the results that suggested OsCAF1 inﬂuencesthat OsCAF1 chloroplast influences development chloroplast anddevelopment photosynthesis and photosynthesis in rice. in rice.

Figure 2.2. oscaf1 showed defectsdefects inin chloroplastchloroplast developmentdevelopment andand photosynthesis.photosynthesis. (A) PhenotypePhenotype observations of WT (left) and oscaf1 mutant (right). Scale bar, 1 cm. ( B) Pigment content of WT andand oscaf1 at seedling stage. ( (CC)) Photochemical Photochemical efficiency eﬃciency of of PSII PSII in the light (Fv/Fm) (Fv/Fm) of WT and oscaf1 mutants atat seedling seedling stage. stage. (D) Relative(D) Relative expression expression levels of chloroplastlevels of developmentchloroplast anddevelopment photosynthesis and genesphotosynthesis in WT and genesoscaf1 inmutants. WT and The oscaf1 data representmutants. meanThe dataSE represent from three mean independent ± SE from biological three ± duplicate,independent * and biological ** indicated duplicate,p < 0.05 * and and **p indicated< 0.01, respectively. p < 0.05 and p < 0.01, respectively.

To investigateinvestigate chloroplast chloroplast development development in oscaf1 in mutantsoscaf1 mutants further,we further, observed we the observed ultrastructure the ofultrastructure chloroplasts of at chloroplasts the three leavesat the three stages leaves of WT stages and ofoscaf1 WT andmutants oscaf1 using mutants transmission using transmission electron microscopyelectron microscopy (TEM). We(TEM). observed We observed that the that chloroplast the chloroplast number number in the mesophyllin the mesophyll cells of cells the ofoscaf1 the mutantoscaf1 mutant was less was than less in than WT (Figurein WT 3(FigureB). In addition, 3B). In addition, the chloroplasts the chloroplasts in WT mesophyll in WT mesophyll cells were wellcells developed,were well withdeveloped, normal-looking with normal-looking and distinctly and stacked distinctly grana and stacked thylakoids grana (Figure and thylakoids3A,C). Conversely, (Figure the3A,C).oscaf1 Conversely,mutant had the abnormal oscaf1 mutant chloroplast had abnormal architecture chloroplast along with architecture abnormally along structured with abnormally thylakoid andstructured abnormally thylakoid stacked and grana abnormally (Figure3 B,D).stacked The grana results (Figure suggested 3B,D). that The OsCAF1 results plays suggested a key role that in earlyOsCAF1 chloroplast plays a key development role in early in chloroplast rice. development in rice. Int. J. Mol. Sci. 2019, 20, 4386 5 of 13 Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 5 of 13

Figure 3. Chloroplast ultrastructure observation of WT (A,,C)) and oscaf1 mutants (B,D) mesophyll cell at the three leaves stage. cp, chloroplast,chloroplast, gl, grana lamella. Bars = 2.02.0 μµm.m.

2.3. Increased Reactive OxygenOxygen SpeciesSpecies (ROS)(ROS) ContentsContents and and Reduced Reduced ROS-scavenging ROS-scavenging Gene Gene Expression Expression Levels inLevels oscaf1 in Mutantoscaf1 Mutant oscaf1 In plants,plants, thethe overproduction overproduction of of ROS ROS might might cause cause cell cell death death in leavesin leaves [24]. [24]. The The oscaf1mutants mutants died oscaf1 afterdied theafter three the leavesthree leaves stage; stage; therefore, therefore, we tested we thetested ROS the levels ROS in levels leaves in of leaves the WTs of the and WTs andmutants. oscaf1 Themutants.oscaf1 mutantThe oscaf1 leaves displayedmutant leaves a more intensedisplayed brown a colormore following intense 3,3-diaminobenzidine brown color following (DAB) staining, indicating that the levels of H O in oscaf1 mutant leaves were higher than in WT leaves 3,3-diaminobenzidine (DAB) staining, indicating2 2 that the levels of H2O2 in oscaf1 mutant leaves (Figurewere higher4A). In than addition, in WT following leaves (Figure nitroblue 4A). tetrazolium In addition, (NBT) following staining, nitroblueoscaf1 mutanttetrazolium leaves (NBT) had largerstaining, blue oscaf1 leaf areasmutant than leaves WT leaves.had larger The blue results leaf suggested areas than that WT oscaf1 leaves. mutant The results leaves suggested generate more that 2 Ooscaf1− than mutant WT (Figure leaves4B). generate The results more of theO2- experiments than WT (Figure indicated 4B). that The oscaf1 results leaves of accumulated the experiments high ROS levels. Moreover, we measured the H O contents in WT and oscaf1 mutant leaves. The results indicated that oscaf1 leaves accumulated2 hi2 gh ROS levels. Moreover, we measured the H2O2 indicated that the H O content in the mutant was significantly increased compared to that in WT contents in WT and oscaf12 2 mutant leaves. The results indicated that the H2O2 content in the mutant (Figurewas significantly4C). This resultincreased was consistentcompared withto that DAB in staining.WT (Figure Meanwhile, 4C). This theresult ROS-scavenging was consistentgene with expressionDAB staining. levels Meanwhile, were investigated the ROS-scavenging in WT and geneoscaf1 expressionmutants. levels According were toinvestigated the qRT-PCR in WT results, and theoscaf1 expression mutants. levels According of APX1 to, theAPX2 qRT-PCR, SODA1 results,, SODB ,theCatA expression, and CatC levelswere significantlyof APX1, APX2 decreased, SODA1 in, oscaf1SODBmutants, CatA, and compared CatC were to WT significantly (Figure4B). decreased The ROS-scavenging in oscaf1 mutants genes compared reduced expression to WT (Figure in oscaf1 4B). mightThe ROS-scavenging have had feedback genes from reduced lack of OsCAF1.expression Overall, in oscaf1 a decrease mightin have ROS-scavenging had feedback gene from expression lack of levelsOsCAF1. would Overall, impair a thedecrease ROS detoxification in ROS-scavenging system, gene eventually expression leading levels to the would accumulation impair the of ROS,ROS such as H O in oscaf1 mutant leaves. detoxification2 2 system, eventually leading to the accumulation of ROS, such as H2O2 in oscaf1 mutant leaves. Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 6 of 13

Int. J. Mol. Sci. 2019, 20, 4386 6 of 13 Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 6 of 13

Figure 4. DAB, NBT staining, H2O2 contents and gene expression level analysis in WT and oscaf1 mutants. (A) DAB staining of leaves from WT (left) and oscaf1 mutants (right). Scale bar, 1 cm. (B) FigureFigure 4. DAB, 4. DAB, NBT NBT staining, staining, H 2HO22Ocontents2 contents andand genegene expression expression level level analysis analysis in WT in WT and andoscaf1oscaf1 mutants.NBT stainingmutants. (A) DAB of(A leaves) DAB staining stainingfrom of WT leaves of (left) leaves from and from WT oscaf1 WT (left) (left)mutants and an oscaf1d oscaf1(right). mutants mutants Scale (right). bar, (right). 1 cm. Scale Scale (C bar,) bar,Measurement 1 1 cm. cm. (B(B)) NBT of H2O2 content in WT and oscaf1 mutant (C) Relative expression levels of genes involved in stainingNBT of staining leaves fromof leaves WT from (left) WT and (left) oscaf1 and mutantsoscaf1 mutants (right). (right). Scale Scale bar, 1bar, cm. 1 cm. (C) ( MeasurementC) Measurement of of H 2O2 contentROS-scavenging.H2O in2 WTcontent and The oscaf1in dataWTmutant andrepresent oscaf1 (D) mean Relativemutant ± SE expression(C from) Relative three levels expressionindependent of genes levels involvedbiological of genes in duplicate, ROS-scavenging.involved * inand ** Theindicated dataROS-scavenging.represent p < 0.05 and mean The p < data0.01,SE represent fromrespectively. three mean independent ± SE from three biological independent duplicate, biological * and duplicate, ** indicated * andp **< 0.05 ± and pindicated< 0.01, respectively. p < 0.05 and p < 0.01, respectively. 2.4. OsCAF1 Involved in Splicing of Multiple Chloroplast Group II Introns 2.4. OsCAF12.4. OsCAF1 Involved Involved in Splicing in Splicing of Multipleof Multiple Chloroplast Chloroplast Group II II Introns Introns Previous studies have shown that ZmCAF1 and AtCAF1 participate in intron splicing in the Previous studies have shown that ZmCAF1 and AtCAF1 participate in intron splicing in the chloroplastPrevious [21]. studies To test have whether shown OsCAF1 that ZmCAF1 was involvandedAtCAF1 in the RNAparticipate splicing inof intronchloroplast splicing genes, in thewe chloroplast [21]. To test whether OsCAF1 was involved in the RNA splicing of chloroplast genes, we chloroplast [21]. To test whether OsCAF1 was involved in the RNA splicing of chloroplast genes, we amplifiedamplified the chloroplast the chloroplast genes genes that that contained contained at at least least one intronintron in in WT WT and and oscaf1 oscaf1 mutants mutants using using the the oscaf1 amplifiedRT-PCRRT-PCR method. the method. chloroplast We Weobserved genesobserved thatthat that contained the the introns introns at least ofof chloroplast one intron atpF inatpF WT, rpl2, rpl2 and, and, and rps12 rps12mutants could could not using benot thebe RT-PCRspliced,spliced, method.whereas whereas Wethe observedtheintron intron splicing thatsplicing the efficiency efficiency introns ofof of chloroplast ndhAndhA, ndhB,atpF ,and and, ycf3rpl2 ycf3 ,decreased anddecreasedrps12 incould groupin group not II intronsbe II spliced,introns whereasin oscaf1in oscaf1 themutants intron mutants (Figure splicing (Figure 5). e 5).ffiInciency Inoscaf1 oscaf1, of the, thendhA splicing splicing, ndhB efficiencyefficiency, and ycf3 ofofdecreased group group I intronsI inintrons group (trnL (trnL II) intronswas) was normal. innormal.oscaf1 mutantsThe resultsThe (Figureresults indicated indicated5). In thatoscaf1 that OsCAF1, OsCAF1 the splicing might might eparticipateffi participateciency of in group the splicingsplicing I introns of of multiple ( trnLmultiple) was chloroplast chloroplast normal. group The group resultsII II indicatedintrons.introns. that OsCAF1 might participate in the splicing of multiple chloroplast group II introns.

Figure 5. Splicing analysis of chloroplast gene transcripts in WT and oscaf1 mutants. U, unspliced transcripts; S, spliced transcripts. Figure 5. Splicing analysis of chloroplastchloroplast gene transcripts in WTWT andand oscaf1oscaf1 mutants.mutants. U, unspliced transcripts; S, spliced transcripts. Int.Int. J.J. Mol.Mol. Sci.Sci. 20192019,, 2020,, 4386x FOR PEER REVIEW 77 of 13 13

2.5. Subcellular Localization and Expression Patterns of OsCAF1 2.5. Subcellular Localization and Expression Patterns of OsCAF1 OsCAF1 was localized in the chloroplasts, which was predicted using the TargetP website (http://www.cbs.dtu.dk/services/TargetP/).OsCAF1 was localized in the chloroplasts, To determine which was the predicted actual subcellular using the TargetP localization website of (OsCAF1,http://www.cbs.dtu.dk we fused the/services OsCAF1/TargetP full-length/). To cDNA determine with the GFP actual driven subcellular by the 2× localization CaMV 35S of promoter OsCAF1, weand fused transiently the OsCAF1 transfected full-length in rice cDNA protoplasts. with GFP Th drivene results by theshowed 2 CaMV that the 35S green promoter fluorescent and transiently signals × transfectedof OsCAF1–GFP in rice protoplasts.co-localized Thewith results chloroplast showed autofluorescence that the green fluorescent in transformed signals ofrice OsCAF1–GFP protoplasts co-localized(Figure 6A). with The chloroplastassays indicated autofluorescence that OsCAF1 in was transformed localized ricein the protoplasts rice chloroplast. (Figure6 A). The assays indicatedThe qRT-PCR that OsCAF1 assays was were localized used in to the investigate rice chloroplast. the expression patterns of OsCAF1 in different tissuesThe at qRT-PCR the three assays leaves werestage. used According to investigate to our results, the expression OsCAF1 patterns was highly of OsCAF1 expressed in diinff erentgreen tissuestissue, atparticularly the three leaves in the stage. leaves, According suggesting to our that results, the OsCAF1 OsCAF1 was mainly highly functions expressed in in green tissue,tissue particularly(Figure 6B). in the leaves, suggesting that the OsCAF1 mainly functions in green tissue (Figure6B).

FigureFigure 6.6. Subcellular localization and and expression expression patterns patterns of of OsCAF1. OsCAF1. (A (A) Subcellular) Subcellular localization localization of ofOsCAF1 OsCAF1 in inrice rice protoplasts. protoplasts. (B ()B )Expression Expression analysis analysis of of OsCAF1 OsCAF1 in in didifferentfferent tissues.tissues. TheThe tissuestissues includeinclude rootsroots (R),(R), stems stems (S), (S), and and leaves leaves (L). (L). The The values values in in the the figures figures represent represent the the means means ±SE SE ( n(n= =3). 3). ± **** indicate indicatep p< < 0.01.0.01.

2.6.2.6. OsCAF1OsCAF1 throughthrough C-terminalC-terminal InteractsInteracts withwith OsCRS2OsCRS2 InIn maize,maize, CRS2CRS2 couldcould interactinteract withwith CAF1CAF1 andand formform aa CRS2–CAF1CRS2–CAF1 complexcomplex inin chloroplastschloroplasts [[22].22]. Therefore,Therefore, we we investigated investigated whether whether OsCAF1 OsCAF1 interacted interacted with OsCRS2with OsCRS2 and formed and formed an OsCRS2–OsCAF1 an OsCRS2– complexOsCAF1 incomplex rice. We in obtained rice. We riceobtainedOsCRS2 rice( Os01g0132800OsCRS2 (Os01g0132800) by homologous) by homologous alignment alignment with ZmCRS2 with andZmCRS2 observed and thatobservedOsCRS2 thatwas OsCRS2 also expressed was also highly expressed in green highly tissue in (Supplementarygreen tissue (Supplementary Figure S1A). TheFigure results S1A). of The the yeastresults two-hybrid of the yeast (Y2H) two-hybrid experiment (Y2H) revealed experiment that OsCAF1revealed interactedthat OsCAF1 with interacted OsCRS2 andwith formed OsCRS2 an OsCRS2–OsCAF1and formed an OsCRS2–OsCAF1 complex in rice (Figure comple7A).x in To rice determine (Figure which 7A). OsCAF1To determine section which was essentialOsCAF1 forsection interactions was essential with OsCRS2, for interactions we ﬁrst generated with OsCRS2, three truncated we first forms generated of OsCAF1, three includingtruncated OsCAF1-N,forms of OsCAF1, OsCAF1-M, including which containsOsCAF1-N, two OsCAF1-M, CRM domains, which and contains OsCAF1-C two (Figure CRM7 B).domains, The results and showedOsCAF1-C that (Figure only OsCAF1-C 7B). The results could interactshowed with that OsCRS2,only OsCAF1-C while OsCAF1-N could interact and OsCAF1-Mwith OsCRS2, failed while to interactOsCAF1-N with and OsCRS2 OsCAF1-M (Figure 7failedC). The to resultinteract indicated with Os thatCRS2 the (Figure C-terminal 7C). ofThe OsCAF1 result indicated was essential that forthe interactionsC-terminal of with OsCAF1 OsCRS2. was To essential further for explore interactions the function with ofOsCRS2. the of OsCAF1To further C-terminal, explore the we function analyzed of thethe alignmentof OsCAF1 of C-terminal, the C-terminals we analyzed of OsCAF1 the residues alignment 387–701 of the aa C-terminals in Oryza sativa of OsCAF1with diﬀ residueserent species, 387– including701 aa inZ. Oryza mays, A.sativa thaliana with, Panicum different hallii species,, Brachypodium including distachyon Z. mays, Sorghum, A. thaliana bicolor, Panicum, Setaria italicahallii,, TriticumBrachypodium aestivum distachyon, Elaeis guineensis, Sorghum, and bicolorPhoenix, Setaria dactylifera italica. The, Triticum sequence aestivum alignment, Elaeis results guineensis showed, thatand thePhoenix OsCAF1 dactylifera C-terminal. The residuessequence of alignment 585–598 aa results and 685–701 showed aa th wereat the highly OsCAF1 conserved C-terminal (Supplementary residues of Figure585–598 S2). aa and To test 685–701 the functional aa were highly regions conserved of the OsCAF1 (Supplementary in C-terminal, Figure we S2). divided To test the the C-terminal functional containingregions of OsCAF1the OsCAF1 residues in C-terminal, C1 (387–584 we aa), divided C2 (585–598 the C-terminal aa), C3 (599–684 containing aa), OsCAF1 and C4 (685–701residues aa)C1 (Figure(387–5847B) aa), for C2 further (585–598 study. aa), The C3 results(599–684 of theaa), Y2Hand C4 experiment (685–701 showedaa) (Figure that 7B OsCAF1-C1) for further could study. bind The OsCRS2results of (Figure the Y2H7C). experiment The results indicatedshowed that that OsCAF1 the C1-terminal-C1 could of OsCAF1bind OsCRS2 was required (Figure for7C). interactions The results withindicated OsCRS2 that in the rice; C1-terminal however, the of two OsCAF1 highly conservedwas required regions for ofinteractions the C-terminal with ofOsCRS2 OsCAF1 in could rice; nothowever, interact the with two OsCRS2. highly conserved regions of the C-terminal of OsCAF1 could not interact with OsCRS2. Int. J. Mol. Sci. 2019, 20, 4386 8 of 13 Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 8 of 13

Figure 7. 7. C-terminalC-terminal of ofOsCAF1 OsCAF1 interacts interacts with with OsCRS2. OsCRS2. (A) (OsCAF1A) OsCAF1 interacts interacts with withOsCRS2. OsCRS2. The full-lengthThe full-length CDS CDS sequences sequences of OsCAF1 of OsCAF1 and and OsCRS2 OsCRS2 were were cloned cloned into into PGBKT7 PGBKT7 (BD) (BD) and and PGADT7 PGADT7 (AD) vector, respectively,respectively, toto generategenerate BD-OsCAF1BD-OsCAF1 andand AD-OsCRS2AD-OsCRS2 constructs.constructs. The successfully cloned two constructs were thenthen co-transformedco-transformed intointo yeastyeast AH109AH109 cells.cells. ADAD++ BD-OsCAF1 and BD+AD-OsCRS2BD+AD-OsCRS2 constructs constructs we werere used used as as control. control. (B ()B The) The protein protein structure structure of ofOsCAF1. OsCAF1. Diagram Diagram of OsCAF1of OsCAF1 protein protein structure structure and and different diﬀerent struct structuralural domains domains of of OsCAF1, OsCAF1, OsCAF1-N OsCAF1-N (1-184), (1-184), OsCAF1-M (185-386),(185-386), OsCAF1-C OsCAF1-C (387-701), (387-701), OsCAF1-C1 OsCAF1-C1 (387-584), (387-584), OsCAF1-C2 OsCAF1-C2 (585-598), OsCAF1-C3(585-598), OsCAF1-C3(599-684), and (599-684), OsCAF1-C4 and (685-701).OsCAF1-C4 (C (685-701).) Yeast two-hybrid (C) Yeast resultstwo-hybrid of the results interaction of the of interaction OsCRS2 and of OsCRS2OsCAF1. and Truncated OsCAF1. versions Truncated of OsCAF1 versions were of OsCAF1 cloning into were BD cloning vector into and toBD generate vector and BD-OsCAF1-N, to generate BD-OsCAF1-N,BD-OsCAF1-M, BD-OsCAF1-C,BD-OsCAF1-M, BD-OsCAF1-C1, BD-OsCAF1-C, BD-OsCAF1-C2, BD-OsCAF1-C1, BD-OsCAF1-C3 BD-OsCAF1-C2, and BD-OsCAF1-C3 BD-OsCAF1-C4 andvectors. BD-OsCAF1-C4 These vectors vectors. were co-transferredThese vectors to we AH109re co-transferred yeast cells with to AD-OsCRS2,AH109 yeast respectively.cells with AD-OsCRS2,Yeast cells were respectively. selected on Yeast synthetic cells were dextrose selected medium on synthetic lacking Leudextrose and Trpmedium (SD/-Trp-Leu) lacking Leu and and the 1 Trpmedium (SD/-Trp-Leu) lacking Leu, and Trp, the His, medium and Ade lacking (SD/-Trp-Leu-His-Ade) Leu, Trp, His, and with Ade di ﬀ(SD/erent-Trp-Leu-His-Ade) dilution series (1, with 10− , 2 differentand 10− ).dilution series (1, 10−1, and 10−2).

The oscaf1oscaf1 mutantmutant exhibited exhibited albinism albinism and and survived survived for foronly only approximately approximately three three weeks. weeks. The chloroplastThe chloroplast numbers numbers in oscaf1 in oscaf1 mutantsmutants decreased, decreased, accompanied accompanied by by abnormal abnormal chloroplast development (Supplementary(Supplementary Figure Figure S3 S3)) and and damaged damaged thylakoid thylakoid membranes membranes compared compared with with the the WT, WT, which ledled toto a a decrease decrease in chlorophyllin chlorophyll contents contents in oscaf1 in oscaf1mutants. mutants. Similar Similar phenotypes phenotypes of CRM of domain CRM domainproteins proteins have been have reported been reported in rice, such in rice, as oscfm3 such andas oscfm3oscrs1 and[19, oscrs123]. OsCAF1 [19,23]. might OsCAF1 play might an important play an importantrole in chloroplast role development.in chloroplast Among developme the alterednt. chloroplastAmong the and photosynthesis-relatedaltered chloroplast geneand photosynthesis-relatedexpressions in oscaf1 mutants, gene expressions PEP-dependent in oscaf1 genes, mutants, including PEP-dependentPsaA, PsbA, and genes,RbcL including, and encoding PsaA, PsbAphotosynthesis-associated, and RbcL, and encoding proteins photosynthes significantlyis-associated decreased in proteinsoscaf1 mutants, significantly although decreased NEP-dependent in oscaf1 mutants,genes, RpoC1 althoughand RpoC2 NEP-dependent, markedly genes, increased RpoC1 in oscaf1 and RpoC2mutants., markedly In addition, increased the expression in oscaf1 mutants. levels of InAtpB addition,and AtpE the, transcribedexpression bylevels both of NEP AtpB and and PEP, AtpE significantly, transcribed decreased by both inNEoscaf1P andmutants. PEP, significantly Therefore, decreasedOsCAF1 might in oscaf1 regulate mutants. chloroplast Therefore, development OsCAF1 by influencingmight regulate PEP activities.chloroplast development by influencingThe ROS PEP contents activities. such as H2O2 increased in the three leaves stage leaves of oscaf1 mutants, compared with the WT. In addition, the expression levels of ROS-scavenging related genes decreased The ROS contents such as H2O2 increased in the three leaves stage leaves of oscaf1 mutants, comparedin oscaf1 mutant with leaves.the WT. Considering In addition, the the results expres of asion previous levels study of ROS-sc [19], theavenging functional related obstruction genes decreasedof OsCAF1 in couldoscaf1 leadmutant to abnormalleaves. Considering chloroplast the development, results of a previous ROS over-accumulation study [19], the functional in leaves, obstructionand eventually of OsCAF1 the death could of rice lead seedlings to abnormal after thechloroplast three leaves development, stage. ROS over-accumulation in leaves,Numerous and eventually leaf-color the associated death of rice mutants seedlings have after been identifiedthe three leaves and cloned stage. in different plants [25–27]. AbnormalNumerous splicing leaf-color of chloroplast associated gene mutants introns couldhave b causeeen identified chlorophyll and deficiency, cloned in which different then plants leads [25–27].to visible Abnormal losses in splicing green color of chloroplast in leaves or gene death introns of plants could [25 cause–27]. chlorophyll In rice, wsl4 deficiency,exhibit bleached which thenappearances leads to beforevisible the losses four in leaves green stage, color and in leaves after the or five death leaves of plants stage, [25–27]. all leaves In turned rice, wsl4 to a normalexhibit bleachedcolor similar appearances to WT under before normal the four growth leaves environments. stage, and after The bleachedthe five leaves appearance stage, phenomenon all leaves turned in wsl4 to awas normal caused color by defective similar intronto WT splicing under ofnormal chloroplast growth genes, environments. including atpF The, rpl2 bleached, ndhA, and appearancerps12 [26]. phenomenonThe results of in such wsl4 studies was caused indicate by thatdefective the abnormal intron splicing splicing of ofchloroplast the fourintrons genes, doesincluding not causeatpF, rpl2, ndhA, and rps12 [26]. The results of such studies indicate that the abnormal splicing of the four introns does not cause lethal phenotypes at seedling stages. In the present study, the splicing of ndhB Int. J. Mol. Sci. 2019, 20, 4386 9 of 13 lethal phenotypes at seedling stages. In the present study, the splicing of ndhB and ycf3 introns was also affected. The ndhB protein was an NADPH dehydrogenase and bound to the thylakoid membrane, influenced NDH activity, and regulated cyclic electron transport around photosystem I (PS I) and respiratory electron transport [28]. In tobacco, the ndhB mutant exhibited abnormal 4 intron splicing of only chloroplast ndhB, and the ndhB mutant could grow normally under normal 4 conditions [28]. In addition, both crr2-1 and crr2-2, with impaired intron splicing of ndhB in Arabidopsis, could grow normally under normal conditions [29]. In the present study, NDH activity or electron transfer efficiency of PS I may be affected in oscaf1 mutants; however, the impairing of the ndhB intron was not the key factor influencing seedling death after the three leaves stage. Another intron splicing impaired gene, ycf3, the chloroplast-encoded Ycf3 protein, was responsible for the stability of the PS I protein complex [16]. Previous studies have shown that numerous mutants, such as otp51, osppr6, and tha8, have albino seedling lethal phenotypes similar to the one in the oscaf1 mutant, and all the mutants have similar genetic defects including reduced intron splicing efficiency of ycf3, similar to the results in the present study [14,16,27]. Therefore, the Ycf3 protein could be required for early chloroplast development. In oscaf1 mutants, the reduced splicing efficiency of ycf3 was responsible for mutant deaths after the three leaves stages. In Arabidopsis, AtCAF1 is required for the splicing of group IIB introns, including ndhA, petD, rpl16, rps16, trnG, ycf3, rpoC1, and ClpP [21]. ZmCAF1 in maize is also required for the splicing of group IIB introns, almost similar to A. thaliana, excluding rpoC1 and ClpP [11]. Previous results have shown that CAF1 is not required for group IIA intron splicing in maize and A. thaliana [11,21]. Notably, our results indicated that the efficiency of intron splicing of group IIA introns, including atpF, rpl2, and rps12, and group IIB introns, including ndhB, ycf3, and ndhA, were affected. Particularly, the group IIA introns were not spliced in oscaf1 mutants completely. The results indicated that OsCAF1 could play a key role in the regulation of intron splicing in group IIA and group IIB introns in rice, which was different from maize and A. thaliana. Previous study showed that OsCRS1 not only participated in the splicing of atpF introns but also promoted the splicing of other introns, including trnL, rpl2, ndhA, ndhB, petD, and ycf3 [22]. Therefore, the functions of OsCRS1 and OsCAF1 could partially overlap but are not redundant in rice. In addition, the intron splicing of subgroup IIB introns, including petD, rpl16, rps16, and trG does not require OsCAF1 in rice, while the splicing of the subgroup IIB introns requires ZmCAF1 and AtCAF1 in maize and A. thaliana [11,21]. Moreover, in rice, there are three additional proteins containing two CRM domains, and the functions of the proteins may be different from OsCAF1. Intron splicing of subgroup IIA and subgroup IIB introns was regulated by OsCAF1, which, in turn, influenced chloroplast development in rice. Nuclear-encoded protein ZmCRS2 could interact with ZmCAF1 to form the CRS2–CAF1 complex, which regulates the splicing of group IIB introns in maize chloroplasts [22]. In addition, our study demonstrated that OsCAF1 could interact with OsCRS2 through the C-terminal region, suggesting that the interaction mechanism of CAF1 and CRS2 might be conserved in maize and rice. The homologous alignment analysis results of the C-terminal region of CAF1 among various plants suggested high conservation at C-terminal positions 585–598 aa and 685–701 aa. However, the results of our study showed that the C1 region of OsCAF1, 387–584 aa, was essential for interactions with OsCRS2 rather than the conserved regions of the C2 and C4 regions. The C2 and C4 conserved regions of OsCAF1 could interact with other proteins, which requires further investigations. In addition, the OsCRS2 expression levels decreased significantly in oscaf1 (Supplementary Figure S2B), suggesting the mutation of OsCAF1 also influenced OsCRS2 expression. Based on the above findings, the C1 region of OsCAF1 interacts with OsCRS2, and the generated complex, OsCRS2–OsCAF1, could participate in the splicing of subgroup IIA and subgroup IIB introns in rice chloroplast. OsCAF1, which has two CRM domains, is an RNA intron-splicing factor in rice. OsCAF1 influences the expression of chloroplast-associated genes, affects the accumulation of H2O2 in rice leaves, and plays a key role in early chloroplast development in rice. We demonstrated that OsCAF1 is potentially involved in the splicing of both group IIA and group IIB introns of chloroplast transcripts in rice. Int. J. Mol. Sci. 2019, 20, 4386 10 of 13

In addition, the C1-terminal region of OsCAF1 could interact with OsCRS2 and the OsCRS2–OsCAF1 complex could participate in the splicing of group II introns.

3. Materials and Methods

3.1. Plant Materials and Growth Conditions The oscaf1 mutants were obtained using the CRISPR-Cas9 gene editing system in the japonica rice variety, Nipponbare, which was used as the WT. For chlorophyll content measurement and genetic material and RNA extraction, the WT and oscaf1 plants were grown in growth chambers under a 16 h light and 8 h of a dark cycle at a constant temperature of 30 ◦C.

3.2. Knockout of OsCAF1 Using the CRISPR/Cas9 System The rice genome editing strategy was based on the CRISPR/Cas9 system according to a previous study [30]. Two gRNA target sequences (AAGCCCAGTACCCCATCTCACGG, CCGAGGTACCA AGCGGCGTCCAG) were designed from exon 1 to construct the intermediate vector (Figure1B) namely SK-gRNA- gOsCAF1-g1 and SK-gRNA- gOsCAF1-g2. The binary expression vector transferred into Agrobacterium tumefaciens strain EHA105 was constructed using the isocaudamer ligation method; the intermediate vectors were digested with Kpn I/Xho I, Sal I/Bgl II, and then assembled into the pC1300-Cas9 binary vector (digested with Kpn I/BamH I). The schematic for the development of the plant expression vector is illustrated in Figure1A,B. The intermediate vector SK-gRNA and the expression vector pC1300-Cas9 were provided by Kejian Wang and were kept in our laboratory. All of the primers are listed in Supplementary Table S1.

3.3. Transmission Electron Microscopy (TEM) The WT and oscaf1 seedlings were grown in growth chambers, as above. The transmission electron microscopy (TEM) analysis was performed according to a previous study [23]. Briefly, the third leaves from WT and oscaf1 were collected and cut into approximately 0.5 cm2 pieces. Leaf samples were fixed using 2.5% glutaraldehyde and 1% OsO4, dehydrated using an ethanol series, and embedded in resin. The samples were stained again with uranyl acetate and alkaline lead citrate and finally observed under a HitachiH-7500 TEM (Tokyo, Japan).

3.4. RNA Extraction and Quantitative Real-time PCR (qRT-PCR) Assay Total rice RNA from leaves of oscaf1 and WT plants was extracted using an RNA extraction Kit (TaKaRa, Japan). First-strand cDNA was synthesized using a ReverTra Ace qPCR RT Kit (TOYOBO, Japan). The qRT-PCR was conducted using a SYBR green real-time PCR master mix (TOYOBO, Japan) on a Bio-Rad CFX96 system according to the manufacturer’s instructions. The qRT-PCR procedure was as follows: 5 min at 95 ◦C followed by 40 cycles of 95 ◦C for 10 s and 58 ◦C for 1 min. OsActin1 were used as internal controls. The fluorescence data were analysis by Lin-RegPCR program [31,32] to calculate primer efficiency and obtain Ct values. The genes relative expression levels were calculated according to previous study [33]. All qRT-PCR primers are listed in Supplementary Table S1. For date statistical significance was analyzed using ANOVA with Tukey post hoc pairwise comparisons. * and ** indicate p < 0.05 and p < 0.01, respectively.

3.5. Chloroplast RNA Splicing Analysis The cDNA of WT and oscaf1 plants seeding leaves were obtained according to the procedures above. The RT-PCR procedure was as follows: 95 ◦C for 5 min, followed by 32 cycles of 95 ◦C for 30 s, 60 ◦C for 30 s, 72 ◦C for 1 min, and a ﬁnal elongation step at 72 ◦C for 8 min. The corresponding RT-PCR primers were used for chloroplast RNA splicing analysis according to previous studies [18,26]. Int. J. Mol. Sci. 2019, 20, 4386 11 of 13

3.6. Chlorophyll Concentration and Fv/Fm Measurement Total chlorophyll content in the plants was determined spectrophotometrically. In brief, we obtained 0.1 g leaf samples at the three leaves stage, cut them into pieces, and immersed them into 15 mL 95% ethanol for 48 h in darkness at 4 ◦C. The chlorophyll concentrations were measured using a UV-1800PC (Mapada, China) spectrophotometer at 665 nm, 649 nm, and 470 nm. According to the method of Lichtenthaler [34], we calculated Chla, Chlb, and Car content pigment concentrations. In three leaves stage, WT and oscaf1 mutants were treated with darkness for 30 min, and Fv/Fm was measured using a handheld fluorometer according to the manufacturer’s instructions. There were 5 WT and mutant plants used for analysis, respectively. The values in the figures represent the means SE. Statistical significance was analyzed using Student’s t-test * and ** indicate p < 0.05 and ± p < 0.01, respectively.

3.7. Subcellular Localization of OsCAF1 We cloned the coding sequence of OsCAF1, and the PCR product was fused to the N-terminus of the green ﬂuorescent protein (GFP) in the pAN580 vector. Both the OsCAF1–GFP fusion construct and the empty GFP vector were transformed into rice protoplasts as previously described [35]. Protoplasts with GFP signals were observed under a laser scanning confocal microscope (Zeiss LSM700, Germany). The PCR ampliﬁcation primers are listed in Supplementary Table S1.

3.8. Yeast Two-hybrid Analysis The coding sequences of OsCAF1 and OsCRS2 (Os01g0132800) were ampliﬁed using gene-speciﬁc primers. Full-length OsCAF1 and partial-length OsCAF1 were cloned into pGBKT7 (BD) to generate the BD-OsCAF1, BD-OsCAF1-N, BD-OsCAF1-M, BD-OsCAF1-C, BD-OsCAF1-C1, BD-OsCAF1-C2, BD-OsCAF1-C3, and BD-OsCAF1-C4 plasmids. In addition, full-length OsCRS2 was cloned into pGADT7 (AD) to generate the AD-OsCRS2 plasmid. The pairwise plasmid was co-transformed into the AH109 yeast strain and growth on SD-T/L in a 28 ◦C incubator. Next, the co-transformed yeast strains were transferred to SD-T/L/H/A for interaction analysis.

3.9. Measurement of H2O2 Content

The H2O2 was extracted using 3-amino-1,2,4-triazole, and according to the method of Brennan and Frenkel [36]. In brief, we obtained 0.1-g leaf samples at the three leaves stage. The samples were homogenized in 3 mL of 3-amino-1,2,4-triazole (10 mM) and centrifugation for 20 min under 6000 g. × Next, 1 mL (0.1% titanium tetrachloride to 20% H2SO4) was added to 1.5 mL supernatant. Centrifuge the reaction solution to remove insoluble materials and measured absorbance at 410 nm against a blank. The standard curve was used to calculate the content of H2O2.

Supplementary Materials: Supplementary materials can be found at http://www.mdpi.com/1422-0067/20/18/ 4386/s1. Author Contributions: Formal analysis, Q.Z., Z.W., G.H., J.H., Z.G. and L.G.; Funding acquisition, L.S., D.R., L.Z., G.Z., D.Z., Project administration Q.Q.; Writing—original draft, Q.Z. and L.S. Funding: This research was supported by the National Natural Science Foundation of China (31801333), the ’Collaborative Innovation Project’ of the Chinese Academy of Agricultural Sciences, the Zhejiang Provincial ‘Ten Thousand Talent Program’ Project (2018R52025), and the Central Public-interest Scientific Institution Basal Research Fund of China National Rice Research Institute (2017RG001-4). Conflicts of Interest: The authors declare no conflict of interest.

References

1. Li, Y.; Zhang, J.; Li., L.; Gao, L.; Xu, J.; Yang, M. Structural and comparative analysis of the complete chloroplast genome of pyrus hopeiensis-"wild plants with a tiny population"-and three other pyrus species. Int. J. Mol. Sci. 2018, 19, 3262. [CrossRef] Int. J. Mol. Sci. 2019, 20, 4386 12 of 13

2. Bobik, K.; Burch-Smith, T.M. Chloroplast signaling within, between and beyond cells. Front. Plant Sci. 2015, 6, 781. [CrossRef] 3. Zerges, W. Translation in chloroplasts. Biochimie 2000, 82, 583–601. [CrossRef] 4. Hedtke, B.; Börner, T.; Weihe, A. Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis. Science 1997, 277, 809–811. [CrossRef] 5. Pogson, B.J.; Albrecht, V. Genetic dissection of chloroplast biogenesis and development: An overview. Plant Physiol. 2011, 155, 1545–1551. [CrossRef] 6. Yua, Q.B.; Ma, Q.; Kong, M.M.; Zhao, T.T.; Zhang, X.L.; Zhou, Q.; Huang, C.; Chong, K.; Yang, Z.N. AtECB1/MRL7, a thioredoxin-like fold protein with disulfide reductase activity, regulates chloroplast gene expression and chloroplast biogenesis in Arabidopsis thaliana. Mol. Plant 2014, 7, 206–217. [CrossRef] 7. Nakai, M. New perspectives on chloroplast protein import. Plant Cell Physiol. 2018, 59, 1111–1119. [CrossRef] 8. de Longevialle, A.F.; Small, I.D.; Lurin, C. Nuclearly encoded splicing factors implicated in RNA splicing in higher plant organelles. Mol. Plant 2010, 3, 691–705. [CrossRef] 9. Börner, T.; Aleynikova, A.Y.; Zubo, Y.O.; Kusnetsov, V.V. Chloroplast RNA polymerases: role in chloroplast biogenesis. Biochim. Biophys. Acta 2015, 1847, 761–769. [CrossRef] 10. Saldanha, R.; Mohr, G.; Belfort, M.; Lambowitz, A.M. Group I and group II introns. FASEB J. 1993, 7, 15–24. [CrossRef] 11. Ostheimer, G.J.; Williams-Carrier, R.; Belcher, S.; Osborne, E.; Gierke, J.; Barkan, A. Group II intron splicing factors derived by diversification of an ancient RNA-binding domain. EMBO J. 2003, 22, 3919–3929. [CrossRef] 12. Bonen, L.; Vogel, J. The ins and outs of group II introns. Trends Genet. 2001, 17, 322–331. [CrossRef] 13. Barkan, A.; Small, I. Pentatricopeptide repeat proteins in plants. Annu. Rev. Plant. Biol. 2014, 65, 415–442. [CrossRef] 14. de Longevialle, A.F.; Hendrickson, L.; Taylor, N.L.; Delannoy, E.; Lurin, C.; Badger, M.; Millar, A.H.; Small, I. The pentatricopeptide repeat gene OTP51 with two LAGLIDADG motifs is required for the cis-splicing of plastid ycf3 intron 2 in Arabidopsis thaliana. Plant J. 2008, 56, 157–168. [CrossRef] 15. Beick, S.; Schmitz-Linneweber, C.; Williams-Carrier, R.; Jensen, B.; Barkan, A. The pentatricopeptide repeat protein PPR5 stabilizes a specific tRNA precursor in maize chloroplasts. Mol. Cell Biol. 2008, 28, 5337–5347. [CrossRef] 16. Tang, J.; Zhang, W.; Wen, K.; Chen, G.; Sun, J.; Tian, Y.; Tang, W.; Yu, J.; An, H.; Wu, T.; et al. OsPPR6, a pentatricopeptide repeat protein involved in editing and splicing chloroplast RNA, is required for chloroplast biogenesis in rice. Plant Mol. Biol. 2017, 95, 345–357. [CrossRef] 17. Gothandam, K.M.; Kim, E.S.; Cho, H.; Chung, Y.Y. OsPPR1, a pentatricopeptide repeat protein of rice is essential for the chloroplast biogenesis. Plant Mol. Biol. 2005, 58, 421–433. [CrossRef] 18. Tan, J.; Tan, Z.; Wu, F.; Sheng, P.; Heng, Y.; Wang, X.; Ren, Y.; Wang, J.; Guo, X.; Zhang, X.; et al. A novel chloroplast-localized pentatricopeptide repeat protein involved in splicing affects chloroplast development and abiotic stress response in rice. Mol. Plant 2014, 7, 1329–1349. [CrossRef] 19. Asakura, Y.; Bayraktar, O.A.; Barkan, A. Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts. RNA 2008, 14, 2319–2332. [CrossRef] 20. Keren, I.; Klipcan, L.; Bezawork-Geleta, A.; Kolton, M.; Shaya, F.; Ostersetzer-Biran, O. Characterization of the molecular basis of group II intron RNA recognition by CRS1-CRM domains. J. Biol. Chem. 2008, 283, 23333–23342. [CrossRef] 21. Asakura, Y.; Barkan, A. Arabidopsis orthologs of maize chloroplast splicing factors promote splicing of orthologous and species-specific group II introns. Plant Physiol. 2006, 142, 1656–1663. [CrossRef] 22. Ostheimer, G.J.; Rojas, M.; Hadjivassiliou, H.; Barkan, A. Formation of the CRS2-CAF2 group II intron splicing complex is mediated by a 22-amino acid motif in the COOH-terminal region of CAF2. J. Biol. Chem. 2006, 281, 4732–4738. [CrossRef] 23. Liu, C.; Zhu, H.; Xing, Y.; Tan, J.; Chen, X.; Zhang, J.; Peng, H.; Xie, Q.; Zhang, Z. Albino leaf 2 is involved in the splicing of chloroplast group I and II introns in rice. J. Exp. Bot. 2016, 67, 5339–5347. [CrossRef] 24. Noctor, G.; Reichheld, J.P.; Foyer, C.H. ROS-related redox regulation and signaling in plants. Semin. Cell Dev. Biol. 2018, 80, 3–12. [CrossRef] 25. Huang, W.; Zhu, Y.; Wu, W.; Li, X.; Zhang, D.; Yin, P.; Huang, J. The Pentatricopeptide repeat protein SOT5/ EMB2279 is required for plastid rpl2 and trnK intron splicing. Plant Physiol. 2018, 177, 684–697. [CrossRef] Int. J. Mol. Sci. 2019, 20, 4386 13 of 13

26. Wang, Y.; Ren, Y.; Zhou, K.; Liu, L.; Wang, J.; Xu, Y.; Zhang, H.; Zhang, L.; Feng, Z.; Wang, L.; et al. White stripe leaf4 encodes a novel P-type PPR protein required for chloroplast biogenesis during early leaf development. Front. Plant Sci. 2017, 8, 1116. [CrossRef] 27. Khrouchtchova, A.; Monde, R.A.; Barkan, A. A short PPR protein required for the splicing of specific group II introns in angiosperm chloroplasts. RNA 2012, 18, 1197–1209. [CrossRef] 28. Endo, T.; Shikanai, T.; Takabayashi, A.; Asada, K.; Sato, F. The role of chloroplastic NAD(P)H dehydrogenase in photoprotection. FEBS Lett. 1999, 457, 5–8. [CrossRef] 29. Hashimoto, M.; Endo, T.; Peltier, G.; Tasaka, M.; Shikanai, T. A nucleus-encoded factor, CRR2, is essential for the expression of chloroplast ndhB in Arabidopsis. Plant J. 2003, 36, 541–549. [CrossRef] 30. Shen, L.; Wang, C.; Fu, Y.; Wang, J.; Liu, Q.; Zhang, X.; Yan, C.; Qian, Q.; Wang, K. QTL editing confers opposing yield performance in different rice varieties. J. Integr. Plant Biol. 2018, 60, 89–93. [CrossRef] 31. Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) date. Neurosci. Lett. 2003, 339, 62–66. [CrossRef] 32. Ruijter, J.M.; Ramaker, C.; Hoogaars, W.M.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.; Moorman, A.F. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [CrossRef] 33. Pfaffl, M.W.; Horgan, G.M.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [CrossRef] 34. Lichtenthaler, H.K. Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. 35. Zhang, Y.; Su, J.; Duan, S.; Ao, Y.; Dai, J.; Liu, J.; Wang, P.; Li, Y.; Liu, B.; Feng, D.; et al. A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast-related processes. Plant Methods 2011, 7, 30. [CrossRef] 36. Brennan, T.; Frenkel, C. Involvement of hydrogen peroxide in the regulation of senescence in pear. Plant Physiol. 1977, 59, 411–416. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).