The Role of Ras and its Downstream Targets on Cell Cycle

Control

Bryony S. Wiseman

A thesis submitted in partial fulfillment of

the degree of Doctor of Philosophy,

University of London.

March 1999

Growth Control and Development Laboratory

Imperial Cancer Research Fund

44, Lincoln’s Inn Fields

London ProQuest Number: U641977

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.

ProQuest U641977

Published by ProQuest LLC(2015). Copyright of the Dissertation is held by the Author.

All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC.

ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Abstract The oncogene Ras can both stimulate and inhibit cell proliferation depending on the cellular context in which it is activated. Ras is believed to mediate its effects through activation of downstream effector proteins. The best characterised of these is the serine/threonine kinase, Raf. Through conditional activation of Ras or Raf we have shown that depending on the intensity of signal activation, these proteins are able to both stimulate and inhibit proliferation in murine fibroblasts. Strong signals are inhibitory to growth which is shown to be dependent upon an induction of the cell cycle inhibitor p2l‘^‘P ’ which prevents upregulated G1 cyclins from forming active complexes. Weaker signals can induce DNA synthesis in low mitogen conditions since they can upregulate cyclin D1 expression, yet are unable to stimulate p21^^' expression. Thus we demonstrate that Raf controls opposing cellular responses through differential activation of cell cycle regulatory proteins. Ras however demonstrates a greater propensity to stimulate growth than Raf which correlates with an ability to downregulate Raf induction of p21^'P '. The Ras effectors PI 3-kinase and Rif are unable to reproduce this effect and furthermore, RhoA, which has been proposed to downregulate is also unable to attenuate induction of p21^'P ’ by Raf. Indeed we show that RhoA and PI 3-kinase co­ operate with Raf to induce p21^^\ Furthermore Raf and PI 3-kinase co-operate to induce DNA synthesis in the presence of high levels of p21^^\ In addition we investigate the ability of activated Rac, which has been implicated as a downstream target of Ras, to control the cell cycle. It is demonstrated that Rac^'^ is able to stimulate anchorage-independent growth and upregulate cell cycle regulatory proteins, yet is unable to stimulate mitogen-independent growth. Thus cell growth control by Ras depends both on signal strength and a panel of downstream targets. Acknowledgements Firstly, I would like to thank Hucky for giving me the opportunity to work in his laboratory and for his guidance during my time there. I would like to acknowledge the work of Andreas Sewing which is included in this thesis. Furthermore I would like to thank J.Bos, P.Brennan, D.Cantrell, C. Dickson, J.Downward, M.Fried, M.Gossen, T.Jacks, C.Marshall, G.Peters, S.Reeves, A.Ridley, P.Rodriguez-Viciana, R.Treisman and E.Sahai for reagents and/or helpful discussions. The FACS laboratory and the photography department at ICRF have also given invaluable assistance. I would especially like to thank Alan Hall and Fiona Watt for interesting conversations, support and perspective.

In the lab I would like to thank Alison whose irrepressible and unrelenting questioning taught me scientific method but also for support, proof-reading and friendship. Thanks also to Sharon whose sharp wit and words of comfort kept my feet on the ground; Susan, the Bolton boys still remember; David P., for calmness in chaos and for knowing who Little Jimmy was; to Andreas for all his help and much silliness; David S. for his interesting points of view; Liz whose presence continuously reassures me that life can be fun and who has it all to come; Soo for, amongst other things, pointing out that this sentence is too long; Sally for head-banging reminiscences; Betina for vibrancy in a dull place; Laurent for showing me that after it all you can still be chilled; Beatrice who is just wonderful; Nacho, with whom I have been through so many tears, smiles and the odd scowl -thank you for everything and finally Frank-I understand!

Outside of the lab, thank you everyone who has made this time enjoyable, but especially to Nicky for being there through it all ; Jo for trying to make me look good and for being such an understanding friend these past few months; Shugs for supporting me even when my ambitions seemed to come first; to Matt-man for the dog with pants, the dropped pints and for endlessly supporting me down Marlboro Road; Robby for friendship that I can't pin down to anything, but may have something to do with an appreciation of the virtues of shallowness; Ann for helping me split up sentences over the past few months; the Boys for making our house a real-life soap opera and I would like to give a special thank you to Romana and Fiona without whose advice and honesty I may not have got this far.

Finally I would like to thank my family for their help, support and reassurance through out the past few years. This thesis is dedicated to C.H.Peters and T.G.Dupe without whom none of this would have been possible.

'L o n g IS THE WAY AND HARD, THAT OUT OF HELL LEADS UP TO LIGHT.' -John M iltonP a r a d is e L o s t Table Of Contents

Title Page...... 1 Abstract...... 2 Acknowledgements...... 3 Table of Contents...... 4 List of Figures...... 7 List of Tables...... 8 Abbreviations...... 9

1. - INTRODUCTION...... 12

1.1 Cell C ycle Co n t r o l ...... 14 1.1.2 Cell cycle regulatory proteins and tumorigenesis...... 19 1.2 R a s ...... 22 1.2.1 Background...... 22 1.2.2 The Ras Superfamily...... 22 1.2.3 Ras in human tumorigenesis...... 23 1.2.4 Activation of Ras...... 24 1.2.5 Cellular Effects of Ras...... 27 1.2.6 Ras signal transduction through ...... Raf. 29 1.2.7 Activation of MAP kinase cascades...... 33 1.2.8 Alternative Ras effectors...... 37 1.2.9 Ras Effectors...... 39 1.2.10 PI 3-kinase and its role as a Ras effector...... 41 1.2.11 Ral-GEFs and their roles as Ras effectors...... 45 1.3 R a c a n d R ho-fa m ily pr o t e in s ...... 49 1.3.1 Background...... 49 1.3.2 Activation of Rho GTPases...... 49 1.3.3 Upstream activation of Rac and the Rho family...... 53 1.3.4 Rho GTPases in integriri signalling...... 56 1.3.5 Cellular responses to Rac activation...... 56 1.3.6 Cellular Responses specific to effectors of...... Rac 60 1.3.7 Rho Family proteins and tumorigenesis...... 65 2. THE EFFECT OF RAS AND RAF ACTIVATION ON THE CELL CYCLE 6 6

2.1 Introduction ...... 67 2.2 Re s u l t s ...... 68 2.2.1 Regulation of Raf...... 68 2.2.2 Inhibition of cell cycle progression by RafAR...... 69 2.2.3 Stimulation of DNA synthesis by RafAR...... 73 2.2.4 Investigating the generality of the Raf response...... 74 2.2.5 The effect of a different Raf-hormone receptor protein on cell cycle progression...... 74 2.2.6 The effects ofRafCAiAX expression on cell cycle control...... 75 2 .2 .7 Regulation of the Cell Cycle by Ras^^^...... 77 2.2.8 Differential effects of Ras and Raf-1 activation...... 79 2.3 S u m m a r y ...... 81 2.4 F igu res - Chapter Tw o ...... 83 3. THE EFFECTS OF PI 3-KINASE, RLE AND RHOA ON RAF-1 REGULATION OF THE CELL CYCLE...... 112 3.1 Introduction ...... 113 3.2 Re s u l t s ...... 113 3.2.1 Cell Cycle Regulation by Phosphatidylinositol-3' Kinase and Raf-1...... 113 3.2.2 The effect of Raf-1 activation in the presence of RalGEF activity...... 116 3.2.3 Rho signals and Raf upregulation ofp2ff'^'^...... 117 3.3 S u m m a r y ...... 120 3.4 F ig u r es - Chapter Th r e e ...... 121 4. THE EFFECT OF RACl ACTIVATION ON THE CELL CYCLE...... 128

4.1 Introduction ...... 129 4 .2 Re s u l t s ...... 129 4.2.1 Generating cells encoding inducible Racff‘^ ...... 129 4.2.2 Activation of the SRE by Rac...... 131 4.2.3 Activation of JNK/SAPK by Rac ...... 133 4.2.4 Induction of DNA synthesis by Racff^^ ...... 133 4.2.5 The effect o f Rac on the G1 Cyclins...... 137 4.2.6 The role of PI 3-kinase in anchorage-independent DNA synthesis...... 140 4.2.7 The effect o f Raf-1 activation upon the ability o fR a cff’^ to control cell proliferation...... 142 4.2.8 RhoA^'‘^ can support anchorage independent growth...... 144 4.3 S u m m a r y ...... 145 4.5 F ig u res -Chafter Fo u r ...... 146 5. DISCUSSION ...... 167

5.1 Reg ul a t io n o f the cell c ycle b y R as a n d R a f ...... 168 5.1.1 Signal strength determines signal specificity ...... 168 5.1.2 Signal specificity is regulated by differential protein expression ...... 168 5.1.3 R a f induced cell cycle inhibition is mediated by p2ff'’’'^ ...... 169 5.1.4 p 2 ff‘’’'' upregulation by Rafis independent ofp53 ...... 170 5.1.5 Putative mechanisms for p53 independent induction o fp 2 ff'’’'‘ ...... 171 5.1.6 p2ff'’’‘ is not necessary for Ras or Raf-mediated cell cycle arrest of human fibroblasts 172 5.1.7 Utilisation o f a developmental differentiation pathway as a defence against oncogenic activationl73 5.1.8 Physiological relevance of controlling cellular responses by signal strength...... 174 5.1.9 Signal specificity is also affected by the expression of other regulatory proteins...... 175 5.1.10 RafAR-mediated upregulation ofp2ff'^ ' and growth inhibition is not dependent on Cyclin D1175 5.1.11 Activated Ras has greater ability to induce DNA synthesis than activated Raf-1 ...... 175 5.1.12 A Ras-mediated pathway inhibits Raf induction ofp2ff'^'‘ ...... 176 5.1.13 Differential regulation of Rho activity by Ras and Raf...... 177 5.1.14 Co-operative regulation ofp2ff'^ ' induction by Raf-1 and RhoA or PI 3-kinase...... 177 5.1.15 PI 3-kinase is able to positively regulate DNA synthesis ...... 179 5.1.16 Ras controlled pathways can work together to induce DNA synthesis...... 180 5.1.17 Future Directions...... 181 5.2 R ac a n d its effect o n the cell cycle ...... 182 5.2.1 Separation o f Rac- and Rho-mediated anchorage- and mitogen-independent growth ...... 182 5.2.2 Rac may be required for DNA synthesis through its activation o f PAK...... 182 5.2.3 Activation through the SRE is unnecessary for anchorage-independent DNA synthesis 184 5.2.4 Serum-mediated activation ofSRF is independent of Rac ...... 185 5.2.5 Activation of INK is not required for initiation of DNA synthesis ...... 185 5.2.6 Rac induction o f Cyclin D1 may mediate anchorage-independent growth ...... 185 5.2.7 Rac'^'^ induction of mitogen-independent DNA synthesis may be a secondary effect ofactin reorganisation...... 186 5.2.8 Rac^‘^ can assist DNA synthesis induced by additional factors ...... 186 5.2.9 Future directions for investigations into Rac-mediated DNA synthesis ...... 187 6. MATERIALS AND METHODS...... 188

6.1 M a t e r ia l s ...... 189 6.1.1 Equpiment...... 189 6.1.2 Frequently Used Solutions...... 190 6.1.3 Antibodies ...... 191 6.1.4 Plasmids ...... 193 6.1.5 PCR Primers ...... 196 6.1.6 Parental cells-lines...... 196 6.1.7 Generated stable cell-lines...... 196 6.2 M e t h o d s...... 199 6.2.1 Maintenance o f cell stocks...... 199 6.2.2 Growing cells in anchorage independent conditions ...... 201 6.2.3 Transfection...... 203 6.2.4 Retroviral infections ...... 204 6.2.5 Selection of stably transfected or infected cells ...... 204 6.2.6 SDS-polyacrylamide electrophoresis (after Laemmli, 1970)...... 207 6.2.7 Western blotting...... 208 6.2.8 Cell lysate preparation...... 209 6.2.9 Immunoprécipitation...... 210 6.2.10 Kinase assays...... 210 6.2.11 Reporter assays...... 212 6.2.12 Preparation of glutathione-S-transferase (GST)-fusion proteins...... 213 6.2.13 Restriction enzyme digestion ...... 214 6.2.14 Agarose gel electrophoresis ...... 214 6.2.15 Ligation reactions ...... 215 6.2.16 Dephosphorylation of vector DNA...... 215 6.2.17 Phenol-Chloroform extraction of DNA...... 215 6.2.18 Ethanol precipitation of DNA...... 216 6.2.19 Transformation of DH5a E.coli...... 216 6.2.20 Mini-preps by Alkaline Lysis ...... 216 6.2.21 Qiagen Spin-prep Mini-preps ...... 217 6.2.22 Qiagen Maxi-prep ...... 217 6.2.23 Polymerase chain reaction...... 218 7. BIBLIOGRAPHY...... 219 List of Figures

F ig u re 1.1 Gen etic c h a n g e s a sso c ia te d w ith colorectal tumorigenesis ...... 13 F ig u re 1.2 0 1 to S -ph ase T r a n s it io n ...... 15 F igu re 1.3 Sw itch m echa nism o f R a s ...... 2 5 F igure 1.4 A c tiva tio n o f R a s b y grow th facto rs a n d in t eg rin s ...... 26 F igu re 1.5 A ctivation o f R a f - 1 ...... 31 F igu re 1.6 S ig n a l T ransduction th ro ug h M A P k in a se m o d u l e s ...... 36 F igu re 1.7 P u ta t iv e R as effe c t o r s ...... 40 F igure 1.8 U pstream regulation o f the R ho fam ily a n d their effect o n th e cytoskeleton . .. 54 F igure 1.9 M odel for PAK regu la tion o f M E K l...... 62 F igure 2.1 T h e stren gth o f Ra f -1 a ctiv atio n determ ines sig n a l sPEcmciTY ...... 82 F igu re 2.2 LXSN R a f AR ...... 84 F igure 2.3 Ra f c a u se s cell cycle a r re st ...... 86 F igu re 2.4 p21^"" ' is responsiblefor R af -1 -d epen dent inhibition o f 0 1 Cy c l in -a sso c ia t e d k in a se a c t iv it y ...... 88 F igure 2.5 R a f A R induc es transcription from the p21^"’ ' prom oter ...... 88 F igure 2.6 p21^"' ' is responsible for Ra f - d ependent inhibition o f grow th in M EF s ...... 90 F igure 2.7 Ra f AR is a b le to stim u late D N A synth esis in a d o se -d e pe n d e n t m a n n e r ...... 92 F igure 2.8 A ctivation o f AR a f :ER provokes a sim ilar respo nse to R a f AR ...... 94 F igure 2.9 T etracycline repressible retr ovirus , pBPSTRI...... 96 F igure 2.10 R a f C A A X expressio n is ind ucible in STRCX c l o n e s ...... 98 F igure 2.11 R a f C A A X ex pressio n inhibits D N A s y n t h e s is ...... 98 F igure 2.12 Ra f C A A X ind uc tion o f D N A sy nth esis is do se d e p e n d e n t ...... 100 F igure 2.13 Ra s ''*^ e xpressio n is ind uc ible in STR as cl o n es ...... 102 F igure 2.14 R a s ''‘^ ex pressio n inhibits D N A sy n t h e sis ...... 104 F igure 2.15 R a s ''*^ ex pressio n induc es m itogen -independent D N A s y n t h e s is ...... 106 F igure 2.16 Ra s '''^ a n d Ra f C A A X differentially upreg ulate p21^"’ ' ...... 108 F igure 2.17 Ra s ''*^ downregulates p21^"" ' induc tion by AR a f :ER ...... 110 F igure 3.1 A c t iva ted R a f ;ER a n d PI 3 -k in ase induce m itogen independent D N A sy n t h e sis 122 F igure 3.2 RlfC A A X does no t affect regulation of the cell cy cle by R a f ...... 124 F igure 3.3 T he effects of R ho activity on R af -m ediated ef f e c t s ...... 126 F igure 4.1 Ra c I''*^ ex pressio n is regu la ted in STRAC c e l l s ...... 147 F igure 4.2 R a c I^''^ ex pressio n does not induc e SRE a c tiv it y ...... 149 F igure 4.3 T he r espo nse of the SRE to Ra c 1''‘^ differs in different r o d e nt fibroblasts ...... 151 F igure 4.4 JNK is no t a c tiv ated b y ind uc tion of R a c I’^'^...... 153 F igure 4.5 In d uc tio n o f R a c I'''^ allow s co lo ny form ation in so ft a g a r ...... 153 F igure 4.6 RACl^'^ is u n a b l e to in d uc e m itogen -independent g r o w t h ...... 155 F igure 4.7 R a c I'^'^ induc es D N A sy nth esis in a v ariety of a n c h o r a g e -independent c u lt ur e METHODS...... 157 F igure 4.8 T he b a sa l rate o f D N A sy nth esis is compromised in high d e n sit y c o n d it io n s ...... 157 F igure 4.9 Re m o v a l o f ad h e sio n c a uses downregulation o f G1 Cy c l in s ...... 159 F igure 4.10 Re m o v a l of ad h e sio n rapidly downregulates Cyclin D1 transcription 159 Figure 4.11 In d u c tio n of RACl'"^ ind uces S -ph ase a n d upregulates G1 cyclin ex pr e ssio n a n d ACTIVITY...... 161 F igure 4.12 PI 3-k in a se is inhibited b y LY 294002 for at le a st 32 h ...... 163 F igure 4.13 A n c h o r a g e - independent grow th induced b y R a c I'^'^ is n o t d e pe n d e n t o n PI 3- KINASE ACTIVITY...... 163 F igure 4.14 Ra f inhibits the a bility of R a c I'^'^ to induce a n c h o r a g e - independent g ro w th . 165 F igure 4.15 R h o A'^'" in d uc es a n ch o r ag e - independent g r o w t h ...... 165 F igure 5.1 Po ssible m ec hanism for R a c -m ed ia ted ad h esio n sig n a l ...... 183 List of Tables

T a b l e 1 M em bers of the h u m a n Ra s -like GTPa se suferfamily ...... 23 T a b l e 2 R h o GEFs ...... 50 T a b l e 1.3 Rh o GAP s :...... 52 T a b l e 1.4 R ho fa m ily effector p r o t e in s ...... 60 T a b l e 4. 1a Fo rm atio n of colonies in soft a g a r ...... 135 T a b l e 4.2 Co lo n y fo rm ation in soft ag ar b y R a f CAAX ...... 144 T a b l e 6.1 P rim a ry a n tibo dies u se d in this t h e s is ...... 191 T a b l e 6.2 Sec o n d a r y an tibo dies u sed in this t h e s is ...... 192 T a b l e 6.3 Pla sm id s a n d e xpressio n vectors u se d in this t h e s is ...... 193 T a b l e 6.4 P ar en ta l cells a n d cell -lines u se d in this t h e s is ...... 196 T a b l e 6.5 Cell-lin es u sed or g enera ted in this th esis...... 196 Abbreviations

inch (d)NTP (2 ’ -deoxy )ribonuleoside 5 ’ triphosphate aa amino acid residue Anp Ampere AR androgen receptor ATP adenosine 5’triphosphate P-gal P-galactosidase BHI brain heart and lung extract bp base pair BrdU 5-bromo-2’ -deoxyuridine BSA bovine serum albumin CAT chloramphenicol acetyl transferase cDNA complementary deoxyribonucleic acid Ci Curie CIP calf intestinal phosphatase CKI cyclin dependent kinase inhibitor cm centimetre CMV Cytomegalovirus CR conserved region CRD cysteine rich domain distilled water DMEM Dulbecco’s modified Eagles media DMSO dimethylsulphoxide DNA deoxyribonucleic acid Dox doxycycline DTAF dichlorotriazinyl amino fluorescein DTP 1,4-dithiothreitol E.coli. Escherichia coli ECL enhanced chemi-luminescence EDTA ethylene-diamine-tetraacetic acid (disodium salt) HR oestrogen receptor FACS Fluorescence activated cell sorting PBS foetal bovine serum FITC fluoroescein isothiocyanate G418 geneticin g gramme GAP GTPase activating protein GDI guanine dissociation inhibitor GDP guanosine diphosphate GEF guanine exchange factor GST glutathione S-transferase GTP guanosine triphosphate HBD hormone binding domain HCl hydrochloric acid HEPES N-2-hydroxy-ethyl-piperazine-N’-2 ethane sulphonic acid HRP horse radish peroxidase Ig immunoglobulin IP immunoprécipitation IPTG isopropyl beta-D-thiogalactoside kbp kilo base pair kD kilo Dalton

1 litre LB Luria-Bertani broth LTR long terminal repeat li micro m miUi M molar mA milli Ampere MBP myelin basic protein MEF mouse embryo fibroblast mm millimetre MMTV mouse mammary tumour virus Mo-MuLV Moloney murine leukaemia virus mol mole MOPS 3-(N-morpholino) propane sulphonic acid Mr molecular weight mRNA messanger ribonucleic acid n nano NCS new bom calf serum nm nanometre NP40 nonidet P-40 °C degrees centigrade ONPG O-nitrophenyl-p-D-galactopyranoside p pico PAGE poly-acrylamide gel electrophoresis PBS-BT PBSA with 0.5% Tween and 0.05% BSA PB SA phosphate buffered saline A PB ST PBSA with 0.1% Tween 20 PCR polymerase chain reaction PEG poly-ethylene-glycol PI propidium iodide PMSF phenyl-methyl-sulphonyl fluoride PNK poly-nucleotide kinase polyHEMA poly (2-hydroxyethylmethacrylate) RBD Ras binding domain REF rat embryo fibroblast RNA ribonucleic acid ROS reactive oxygen species rpm revolutions per minute RSV Rous sarcoma virus RT room temperature RTK receptor tyrosine kinase SAP shrimp alkaline phosphatase SDS sodium dodecyl sulphate SV40 Simian vims 40 TAE tris-acetate-EDTA buffer TBE tris-borate-EDTA buffer

10 TBS tris buffered saline TEST TBS with 0.1% Tween 20 TE tris EDTA buffer TEMED N,N,N',N',-tetramethylethylenediamine TPA 12-O-tetradecanoyl-phorbol-13-acetate Tris (Trizma base) Tris (hydroxymethyl)aminomethane Tween 20 polyoxyethylenesorbitan monolaurate U unit (of enzyme activity) UV ultra-violet light V volts v/v volume for volume w/v weight for volume WB western blot wt wild type

11 Chapter One - Introduction

1. - Introduction

12 Chapter One - Introduction

Pathological and epidemiological evidence point to tumorigenesis as a multi-step process in which several genetic lesions are required to cause cellular malignancy. Epidemiological investigations have shown that familial cancer generally develops much earlier than an equivalent sporadic tumour which implies that accumulation of genetic lesions promote tumorigenesis. This view is supported by the correlation between cancer and age (Peto et al., 1975). Most tumours also display gross chromosomal defects which indicate that many genetic changes have occurred. A multistep nature for tumour development is implied from investigations into the development of colorectal tumours. These have shown a correlation between the number of genetic lesions and the stage of the tumour. The inheritance of an altered copy of the gene associated with familial adenomatous polyposis (FAP), adenomatous golyposis coli (APC) (a tumour suppressor gene) predisposes patients to the development of colorectal cancer. Analysis of tumours at different stages of progression have led to a model (Figure 1.1) suggesting that colorectal tumours acquire specific mutations in a sequential manner which allow the tumour to progress to a malignant state. The genetic changes associated with colorectal tumorigenesis include activation of Ki-Ras and loss of the p53 tumour supressor gene. The requirement for multiple genetic lesions in cellular transformation is demonstrated by

Figure 1.1 Genetic changes associated with colorectal tumorigenesis

Patients with FAP inherit APC mutations which initiate the neoplastic process. Later they develop numerous dysplastic aberrant crypt foci (ACF), som e of which progress as they acquire the other mutations indicated in the figure. Mis-match repair (MMR) deficiency speeds up this process. K-Ras requires only one genetic event to become activated. Inactivation or p53 function may also only require one genetic even t since its mutant proteins are able to inhibit the function of the wild type protein. The other genes indicated are tumour supressor genes that require two genetic events (one in each allele) for their inactivation. DCC, DPC4 and JVl 8-1 genes are proposed as candidates in colorectal neoplasia from a region on Chromosome 18q21. A variety of other genetic alterations have been described in a small fraction of advanced colorectal cancers.

o th e r K-Ras DCC/DPC4/JV18 p 5 3 APC ch an g es

Early Intermediate L ate A dem ona A denom a Adenom a

MMR deficiency [after\ Kinzler, 1996 #19991.

the response of primary rodent cells to oncogenes in tissue culture. A single oncogene is insufficient to cause malignant cellular transformation of non-established primary fibroblasts, focus formation requires two or more cellular oncogenes (Land et al., 1983; Ruley, 1983) or an oncogene and the loss of a tumour supressor gene (Tanaka et al., 1994). The increased oncogenicity of multiple genetic lesions has been demonstrated in vivo using mouse tumour models. For example, co-expression of v-Ha ras and Chapter One - Introduction constitutive c-myc in the mammary gland of transgenic mice causes much faster and more dramatic tumour formation than the expression of either of these oncogenes alone (Sinn et al.j 1987). Furthermore, expression of activated Ras and c-myc in a reconstituted prostate gland demonstrated that each oncogene makes different contributions to tumour development and that co-expression has additional effects (Thompson et al., 1989). However, it must be noted that rodent cells are much more easily transformed in vitro than human cells. For example, co-expression of oncogenic Ras, the viral oncoproteins

E6 and E7 (that inactivate p53 and pRb) and overexpression of telomerase does not permit human fibroblasts to grow in the absence of adhesion to substratum; a characteristic of transformed cells that correlates most closely with malignancy (Morales et ai, 1999).

The work described in this thesis derives from investigations into the mechanisms of oncogene co-operation. It is now clear that cellular responses to the oncogene Ras are different depending on cell-type, the presence of other oncogenes and cellular environment. Ras can induce a variety of cellular growth responses, such as proliferation, cell cycle arrest and differentiation by differential regulation of the cell cycle. This introduction will begin with an overview of the current understanding of the molecular mechanisms that regulate the cell cycle. Ras and its downstream targets will then be introduced and discussed in the context of their regulation of cell proliferation. Finally the small GTPase Rac and its known role in cell cycle regulation will be discussed. 1.1 Cell Cycle Control

The somatic cell cycle can be divided into the period of DNA replication (S-phase) and the period of chromosome segregation (M-phase), these phases are separated by two gap phases (G1 and G2) in which the cell increases in size and prepares for DNA synthesis or mitosis by accumulating the necessaiy components for the next phase. The cell can also exit the cell cycle to differentiate or it can withdraw from the cell cycle and enter a state referred to as quiescence (or the GO phase). Cells can be induced to enter this phase through starvation. The cell cycle is controlled by multiple mechanisms and tumorigenesis often involves dismption of these controls through interference with pathways that are necessary for cell cycle control. The work in this thesis is mainly concerned with the G1 to S-phase transition (which is summarised in Figure 1.2) and the current understanding of the mechanisms controlling this shall be discussed below.

The proteins that are responsible for directly regulating cell cycle progression are the cyclins and cyclin-dependent kinases (CDKs) (Lees, 1995; Morgan, 1995; Nigg, 1995; Pines, 1994; Sherr, 1993). Cyclin binding to its CDK partner is necessary for CDK activation. Cyclins have specific CDK partners. D-type cyclins form active complexes with CDK4 and CDK 6 (Matsushime et ai, 1992; Meyerson and Harlow, 1994), they can

14 Chapter One - Introduction also form complexes with CDK2, however these complexes are generally not thought to be active (Higashi et al., 1996), although there is a recent report of active Cyclin D2/CDK2 complexes in human breast cells (Sweeney et al., 1997). Cyclin E forms active complexes only with CDK2 (Dulic et al., 1992; Koff et al., 1992). Cyclin A is required for both entry into S-phase and onset of mitosis (Girard et al., 1991; Pagano et al., 1992). It complexes with and activates both CDK2 and CDKl (also known as Cdc2). Cyclin A/CDK2 complexes predominate in late 01 and S-phase whereas Cyclin A/CDKl appear in 02. It is thought that CDK2 containing Cyclin A complexes are most important in 01 to S-phase transition (Pagano etal., 1992).

Figure 1.2 G1 to S- phase Transition I P21 P27 p57 I The D-type cyclins (1, 2 & 3), Cyclin E and Cyclin A r,y ,: 01^ / and their partners CDK2, CDK4 and CDK6 control G1 to S-phase transition. The 1 r- GO CDKs inactivate the u G1 S-phase retinoblastoma gene product, pRb through 1 L phosphorylation. The cyc­ lins are regulated in a cell I p16 p1Sp18p19 I cycle specific manner and bind to CDK partners and direct them to appropriate substrates during particular phases of the cell cycle. Thus determining the time and location of substrate phosphorylation. Hypophosphorylated pRb represses transcription of genes required for G1/S transition, amongst others, the E2F family. This control is relinquished upon gradual hyperphosphorylation. In addition to being regulated by their cyclin partner, CDKs are also controlled in part by activating and inhibitory phosphorylation events. Moreover, CDK activity is controlled by the CDK inhibitors (CKIs). The Cip/Kip family of CKIs contains, p21°P\ p27"^'P^ and pSZ'^'P^, which specifically inhibit G1 cyclin/CDK activity by binding to both sub-units. The family of pi 5, pi 6, pi 8 and pi 9 specifically block CDK4 and CDK6 interaction with their cyclin partner by altering the conformation of the CDK. This is a simplified view of cell cycle control and will be dealt with more thoroughly in the text. ______Another important factor in Cyclin-CDK regulation is the role of the cyclin-dependent kinase inhibitors (CKIs). Currently these proteins fall into two distinct classes. One of these, the specific polypeptide inhibitors of the CDK4 (INK4) family consists of four members: pl5'^^"^® (Hannon and Beach, 1994); p l 6 ^^^^"^ (Serrano et al., 1993) (also called multiple tumour supressor 1 (MTSl)(Kamb et al., 1994)); pig'NK4c p^giNK 4o (Chan et al., 1995; Ouan et al., 1994; Ouan et al., 1996; Hi rai et al., 1995). These proteins bind to CDK4 and CDK 6 and prevent interaction with cyclins. They do not bind other CDKs and thus are specific for inactivation of Cyclin D-associated kinase activity (Brotherton etal., 1998; Hannon and Beach, 1994; Russo et al., 1998; Serrano et al., 1993). Chapter One - Introduction

The Cip/Kip family consists of p21^'p’ (also referred to as W afl, Sdil, CAP20 and mda-

6 ) (el-Deiry et al, 1993; Gu et al., 1993; Harper et at., 1993; Jiang et at., 1995a; Noda et al., 1994; Xiong et al., 1993), p27‘^''’‘ (Polyak et al., 1994a; Polyak et al., 1994b; Toyoshima and Hunter, 1994) and p57*^^^ (Lee et al., 1995; Matsuoka et al., 1995). These proteins bind to both cyclin-CDK subunits and inactivate complexes but have a preference for 01 cyclin complexes over others (Fotedar et al., 1996; Gu et al., 1993; Harper gf a/., 1993; Xiong et al., 1993). p27^'^' has been demonstrated to bind to both subunits of the CDK2/CyclinA complex. It blocks a substrate binding domain of Cyclin A and restructures the upper lobe of the CDK2 sub-unit as well as blocking ATP binding (Morgan, 1996; Russo et al., 1996a). An additional mechanism by which Cip/Kip family members may prevent CDK activation is suggested by experiments in which p21^‘'’‘ has been shown to block de-phosphorylation of the T14 and Y15 residues of CDK2, and a peptide based on a Cdc25-like motif of p21^''’’ is able to compete with Cdc25A for CDK2 binding (Saha et al., 1997). However, although first found to be inhibitory, p21^'^' and p 2 7 Kipi been shown by immunoprécipitation to be present in active CDK2, CDK4 and CDK 6 complexes respectively in most normal diploid cells (Florenes et al., 1996; Harper et al., 1995; LaBaer et al, 1997; Soos et al, 1996; Zhang et al, 1994). Since the addition of extra p 2 1 ^’'’' is able to inhibit p 2 1 ‘^‘‘’' containing complexes, a model has been proposed in which the subunit stoichiometry of the complex determines its activity (Harper e ta l, 1995; Zhang e ta l, 1994). This in turn has led to the proposition that the Cip/Kip family has a role in the assembly of active CyclinD/CDK4 complexes (LaBaer et al, 1997). This ability has been shown to be independent of inhibitory function (Welcker et a l, 1998). However the subunit stoichiometry model does not concur with the structural data which indicates that a single p27*^‘'’' molecule is sufficient to disrupt the kinase activity of the cyclin/CDK complex. Furthermore, recent data have shown that a single molecule of p21^'’’ ' is sufficient to inhibit the kinase activity of cyclin A/cdk2 complexes using recombinant proteins in vitro (Hengst et al, 1998). At present this issue remains unresolved, however these differences may derive from in vitro and in vivo differences, and additional cellular factors may promote the activation of p 2 1 ^'^-containing CDK/cyclin complexes.

Active CDKs exert their regulatory function through phosphorylation of key proteins involved in cell cycle progression. These include the retinoblastoma gene product, pRb and related proteins p i30 and p i07, which constitute a family referred to as the pocket proteins. Active pRb binds to and represses E2F, which itself is bound to E2 elements in promoters of G 1/S regulated genes including Cyclin E and Cyclin A (DeGregori et a l, 1995a; Nevins, 1992; Ohtani et a l, 1995; Schulze et a l, 1995; Weintraub et a l, 1992). Inhibition of E2F directed transcription is thought to involve pRb-mediated histone deacetylation followed by chromatin condensation in the vicinity of the E2F site which

16 Chapter One - Introduction also results in inhibition of other transcription factors on the promoter (Brehm et al., 1998; Luo et al., 1998; Magnaghi-Jaulin et al., 1998; Weintraub et al., 1995). Furthermore, E2F is thought to have an active role in transcriptional repression through its interaction with pRb. The importance of regulated E2F activity is indicated by overexpression studies in which deregulated E2F in mammalian cells or during Drosophila embiyogenesis disrupts normal control of the cell cycle and drives cells into S phase (DeGregori etal., 1995b; Duronio and O'Farrell, 1995; Lukas et al., 1996). E2F proteins are also thought to have an important role in tumour suppression since mice which are null for E2F1 are tumour prone (Field et al., 1996; Yamasaki et al., 1996). This may be related to the ability of E2F to promote apoptosis which can be separated from its ability to induce DNA synthesis (Phillips et al., 1997) or its role as a transcriptional repressor (Helin, 1998). The major role for D-type cyclins in cell cycle progression appears to be the inactivation of pRb through phosphorylation, thus leading to the relief of transcriptional repression. The foundation for this hypothesis comes from several lines of evidence, firstly, RBI-/- fibroblasts or cells expressing either viral oncoproteins that sequester pRb or inactivated pRb, no longer require D-type cyclins for S-phase entry (Lukas eta l, 1995; Lukas et al., 1994a; Lukas et al., 1994b). Secondly, cells expressing a specific inhibitor of D-type cyclin associated activity, p i 6 ^ ’^'^’ arrest in G1 and that arrest depends on the presence of functional pRb (Koh et al., 1995). Thirdly, the theory that the predominant role of Cyclin D1 is to phosphorylate pRb is supported by the observation that unlike Cyclin E, ectopic expression of Cyclin D1 is unable to overcome cell cycle inhibition caused by a constitutively active mutant of pRb that is immune to inactivating phosphorylation (Lukas et al., 1997). Thus it appears that once pRb is inactivated and E2F transcription can ensue, that D-type cyclins are no longer required. In support of this view, ectopic expression of E2F is able to promote S-phase entry even when D-type cyclin activity is suppressed, either by expression of inhibitor proteins specific for CDK4 and CDK 6 , or by microinjection of Cyclin D1 neutralising antibodies (Lukas et al., 1996; Mann and Jones, 1996).

Cyclin E and Cyclin A also have important roles in cell cycle progression, and appear to regulate aspects of cell cycle control different from D-type cyclins. One indication of this is their different expression patterns. Upregulation of Cyclin E protein and associated activity occurs later than D-type cyclins, and peak just prior to S-phase entry. Moreover, E2F-mediated activation of Cyclin E is necessary for S-phase entry once Drosophila embryos have exhausted their maternal supplies (Duronio et al., 1996). Cyclin A was originally thought to have its main role in G2 since that is where its protein level and activity peaks, however, accumulation of Cyclin A occurs prior to S-phase entry (Dulic et al., 1994; Dulic et al., 1992) and it has been shown to promote S-phase entry when ectopically expressed (Resnitzky et al., 1995). Unlike the D-type cyclins, Cyclin E and

17 Chapter One - Introduction

Cyclin A cannot directly bind pRb (Dowdy et al., 1993; Kato et at., 1993), however they do mediate pRb phosphorylation, but on different sites from those phosphorylated by D- type cyclins (Hinds et at., 1992; Zarkowska and Mittnacht, 1997). In support of this, full phosphorylation of mammalian pRb, expressed in yeast requires the expression of multiple cyclins (Hatakeyama et al., 1994). A possible model for G1 cyclin-mediated phosphoiylation of pRb is that D-type cyclins initially partially phosphorylate pRb, inactivating it sufficiently to free enough E2F to transcribe Cychn E, Cyclin E-associated kinase activity then phosphorylates pRb further, leading to complete inactivation, and thus a higher level of E2F activity which is then sufficient for Cyclin A transcription. Cyclin A then maintains this level of pRb phosphorylation beyond G l. Recently, constitutively active pRb has been shown to prevent completion of DNA replication. This can be relieved by ectopic expression of SV40 LT, adenovirus El A or high levels of E2F-1, but not Cyclin A or Cyclin E (Chew et al., 1998; Knudsen et al., 1998). Therefore a component in addition to the cyclins is required for completion of DNA synthesis.

A role for Cyclin E and Cyclin A in mediating Gl/S transition, that is distinct from the requirement to phosphorylate pRb and thus release E2F transcriptional activity, is suggested by several lines of evidence. Firstly, although overexpression of E2F can overcome a plb'^*^"* induced block, it is unable to overcome a block induced by another CKI family, p21^'^‘ or p27'^'‘’' which indicates that cyclin-dependent kinase activities other than those associated with D-type cyclins are required for Gl/S progression (Mann and Jones, 1996). Secondly, SV40 LT is unable to promote S-phase entry in the presence of a dominant negative CDK2, even though pRb is no longer inhibiting E2F (Hofmann and Livingston, 1996). This indicates that sequestration of pRb is insufficient for cell cycle progression. Thirdly, Cyclin E is able to overcome inhibition of S-phase entry caused by an inactivatable mutant pRb, overexpression of pRb or overexpression of p i 6 ^'^'* which inhibits pRb phosphorylation (Alevizopoulos et al., 1997; Knudsen et al., 1998; Lukas et al., 1997). Moreover, although ectopic expression of E2F can overcome p l 6 iNK4 inhibition, this is still dependent on Cyclin E activity since it is inhibited by p27"^'^' (Alevizopoulos et al., 1997). This indicates that Cyclin E has an important role outside pRb phosphorylation and E2F activation. Moreover these data indicate that a possible purpose of pRb phosphorylation in G1 is to initiate Cyclin E transcription, which is then sufficient to drive Gl to S-phase progression.

Cyclins and CDKs are themselves regulated by many different mechanisms. Cyclin A promotes CDK2 activation by inducing two major structural changes in the kinase that are likely to be conserved in other CDK/cyclin pairs (Jeffrey et al., 1995; Russo et a l, 1996b) CDKs also require phosphorylation on Thr 160 or 161 from an activity referred to as CDK activating kinase or CAK (Solomon et al., 1992). There is strong evidence implicating CDK7 in complex with Cyclin H as the prime candidate for CAK (Harper and

18 Chapter One - Introduction

Elledge, 1998). Phosphorylation of CDKs can also lead to inactivation. This occurs specifically on Thr 14 and Tyr 15 within their ATP binding domain (Gu et al., 1992; Sebastian et al., 1993). The importance of these phosphorylation events in normal cell regulation, is demonstrated by the inability of cells to arrest in response to ultraviolet (UV) radiation when expressing a mutant of CDK4 which cannot be phosphorylated on these residues (Terada et al., 1995). The phosphatase implicated in this dephosphorylation is Cdc25A. This is related to the mammalian homologue of yeast cdc25, Cdc25C, which is the phosphatase responsible for de-phosphorylation of T14 and Y15 on cdc2 in yeast. Microinjection of Cdc25A neutralising antibodies leads to Gl arrest (Hoffmann etal., 1994; Jinno etal., 1994).

1.1.1.1 The relationship between and p53 p 2 1 ^'P' is a direct downstream target for the transcription factor p53 which is a tumour supressor gene that is frequently found mutated in human tumours (el-Deiry et al., 1993). p21^‘'’ ' is causally involved in many p53 mediated cellular responses, such as the DNA damage response. null cells have a partial deficiency in Gl cell cycle arrest in response to radiation or nucleotide depletion (Brugarolas et al, 1995; Deng et a l, 1995). DNA damaging agents cause upregulation of p21^'P'^ which enters and inhibits Cyclin E/CDK2 complexes arresting cells in Gl. Induction of p21^‘'’ ' and the ensuing cell cycle arrest in response to DNA damage is dependent on p53 since arrest does not occur in cells containing non-functional p53 (Dulic et a l, 1994; el-Deiry et a l, 1994). p21^'P’ is also involved in mediating growth arrest associated with terminal differentiation (Jiang et a l, 1995a; Liu et a l, 1996; Zhang et a l, 1995b) independently of p53. p 2 l‘^'‘’ ' can be transcriptionally upregulated in the absence of p53 function, either in p53 null cells or cells expressing a dominant negative p53 mutant in response to specific DNA damaging agents (etopiside), growth factor stimulation (PDGF, FGF, EGF and TGFp but not insulin), serum deprivation and differentiation agents in a variety of cell types (Elbendary et al, 1994; Michielieta l, 1994; Sheikheta l, 1994; Steinman et a l, 1994). The mechanisms by which this occurs have not yet been fully elucidated however there is some evidence that p53 independent upregulation of p21^'^'^ involves the transcription factor Spl (Biggs et al, 1996; Nakano e ta l, 1997).

1.1.2 Cell cycle regulatory proteins and tumorigenesis

Many of the genes associated with the cell cycle have been identified as tumour supressor genes or proto-oncogenes.

The oncogenic potential of Cyclin D1 has been demonstrated repeatedly. Identification of the Cyclin D1 gene, CCNDl, occurred through three independent events. It was identified as a gene linked to the parathyroid hormone gene in human parathyroid adenomas containing an inversion of chromosome 11 and designated PRADl (Motokura

19 Chapter One - Introduction et al., 1991). It was separately identified as a gene that could complement a deficiency of the yeast Gl cyclins, Cln 1, 2 and 3 (Xiong et at., 1991). Furthermore, three mouse homologues of CCNDl were identified as cellular genes whose expression was stimulated by the colony stimulating factor 1 in macrophages (Matsushime et aL, 1991). Cyclin D1 has been found overexpressed in many cancers as a result of gene amplification, chromosomal translocations and increased protein stability (Palmero and Peters, 1996; Welcker et al., 1996). A role in tumorigenesis is supported by transgenic studies in which overexpression of Cyclin D1 in the mammary cells of transgenic mice leads to abnormal cell proliferation and mammary adenocarcinomas (Wang et al., 1994). The gene locus for one of Cyclin D's partners, CDK4, is also amplified in some sarcomas and gliomas, however this region also contains other cancer associated genes, including the p53 antagonist, MDM2 (He et al., 1994; Reifenberger et al., 1994).

In addition to D-type cyclins, the other genes involved in the control of pRb phosphorylation appear to have an important role in tumorigenesis. Germ-line mutations in the retinoblastoma tumour supressor gene, RBI, leads to retinoblastoma and osteosarcoma in children (Friend er û/., 1986; Knudson, 1971). However, sporadic non- familial mutations can also cause tumours for example in small cell lung carcinomas

(SCLC). p l 6 '^'^'‘ regulates pRb function through inactivation of D-type cyclin-associated kinase activity. It is a tumour supressor gene and is inactivated in many human tumours for example familial melanoma (Palmero and Peters, 1996). The INK4 locus also encodes another putative tumour suppressor gene ARF, which has been linked to p53 mediated growth arrest. Inactivating mutations in pRb and p i 6 ’^’^'* occur in a mutually exclusive fashion in tumorigenesis which is predicted by their occurrence on the same control pathway. For example, pRb is frequently inactivated in small cell lung carcinomas (SCLC), which usually express wild-type p l6 ^ ^ \ and non-SCLCs which are predominantly wild-type for pRb, have frequently lost plb’^'^'^ function (Palmero and

Peters, 1996). A similar inverse correlation is seen with p l 6 ^ ’^'‘ expression and CDK4 gene amplification, in sarcomas and gliomas. In addition a mutation of CDK4 found in some melanomas retains its ability to bind Cyclin D l, but p l 6 "^‘^'‘ binding is disrupted, and thus acts as a dominant oncogene which disrupts the pRb checkpoint (Wolfel et al., 1995). The tumorigenic potential of Cyclin Dl and CDK4 activation or the loss of Rb and p l 6 ^^"*, which all directly control pRb phosphorylation, emphasises the importance of proper regulation of the pRb checkpoint to prevent uncontrolled cell cycling.

Gene amplification or inactivation of other cell cycle regulators is less common. Even though the human Cyclin A gene was originally identified in a hepatocellular carcinoma, as the integration site of hepatitis B virus (HBV), the evidence for a role of Cyclin A in tumorigenesis is not very strong. In this case the cyclin destruction box of Cyclin A had been replaced with viral sequences, making the protein non-degradable, and therefore

20 Chapter One - Introduction constitutive. However, whether this mutant Cyclin A gene was causally involved in tumour development is not clear (Wang et al., 1990; Wang et at., 1992). Up to now other instances of Cyclin A mutations in human tumours have not been reported. Cyclin A protein has been found upregulated in some tumours, however this could be the result of disruption of events preceding Cyclin A transcription. Transgenic mice ectopically expressing wild type or non-degradable Cyclin A in their mammary glands show some hyperplasia and increased apoptosis, but no tumours (Bortner and Rosenberg, 1995). Since destruction of Cyclin A is required prior to mitosis, this may explain the inability of constitutive Cyclin A to form tumours. This is indicated by reports that NIH 3T3 cells cannot grow with constitutive Cyclin A expression (Guadagno et al, 1993).

Tumour-specific mutations in Cyclin E and p27'^*’*, one its regulators,are rare. However, the levels of these proteins can be altered post-transcriptionally, indicating that mutations in their respective genes may not be required for changes in relative abundance. Indeed, upregulation of Cyclin B or downregulation of protein does occur in several human cancers, including breast cancers, lymphocytes from patients with lymphatic leukaemia and colorectal carcinomas (Catzavelos et al., 1997; Keyomarsi et al., 1994; Loda etal., 1997). Moreover, there are data indicating that the relative protein levels of Cyclin E and p27*^^' can be correlated with the prognosis of breast cancer patients, which suggests that pathways controlled by these elements are important in tumour progression (Porter et ai, 1997; Steeg and Abrams, 1997). In rodents, Cyclin E can be tumorigenic if ectopically expressed in the mammary cells of transgenic mice (Bortner and Rosenberg, 1997) and nullizygous mice are reported to develop pituitary tumours (Eero et al., 1996; Kiyokawa et al., 1996; Nakayama et al., 1996).

Another CKI, p 2 l‘^'’’‘ has been shown to have a very important role in cell cycle regulation. However, analysis into the occurrence of p21^'P ' mutations in human tumours have shown that although polymorphisms occur, in most instances these do not correlate with increased incidence of tumour formation (Chedid et al., 1994; Koopmann et al., 1995; Li et al., 1995b; Mousses et al., 1995; Shioharaet a l, 1994; Wan et al., 1996). However somatic mutation in p21^‘'’ ’ has been described in some primary prostate tumours (Gao et a l, 1995). The absence of p 2 l‘^''’ ’ inactivation in human tumours equates with the lack of disposition to tumour formation observed in p 2 1 ^'P^ null mice. However loss of p21^'‘’’ may have some oncogenic potential. Expression of activated Ras in p21^'^' null kératinocytes causes them to become tumorigenic whereas the same is not true of wild type cells (Missero et al., 1996), thus p21^'P' is able to repress transformation by activated Ras. In addition, inhibition of p21^’’’'' protein expression is required for the full transformation of primary rat Schwann cells by Ras (Lloyd et al., 1997) this will be discussed in further detail later. It is currently not clear whether there is a role for p 2 1 ^’'’ ' in human tumorigenesis.

21 Chapter One - Introduction

1.2 Ras

1.2.1 Background

Ras genes were first identified as the transforming principle of the Harvey and Kirsten strains of rat sarcoma viruses (Harvey, 1964; Kirsten and Mayer, 1967). These are viral homologues of cellular genes that have been constitutively activated by point mutation (DeFeo etal., 1981; Ellis etal., 1981; Parada et al., 1982; Santos et al., 1982) (Balmain and Pragnell, 1983; Der et al., 1982; Eva and Aaronson, 1983; Guerrero et al., 1984; Reddy et al., 1982; Shimizu et al., 1983b; Sukumar et al., 1983; Tabin et al., 1982; Taparowsky etal., 1982; Yuasa etal., 1983). Three human Ras genes have so far been identified; Ha-ra 5 (Paradaef a/., 1982; Santos etal., 1982), Ki-ras (Der et al., 1982) and N-ra^ (Hall et al., 1983; Shimizu et al., 1983b). These genes and the pathways they regulate are very well conserved in eukaryotes. Ras has been demonstrated to have a role in multiple aspects of mammalian cell growth and development, including; cell proliferation; apoptosis; differentiation and senescence. It has also been demonstrated to be essential for development of the eye and vulva in Drosophila and C.elegans respectively.

1.2.2 The Ras Superfamily

Ras proteins are members of a much larger Ras-like GTPase superfamily that are separated into sub-groups determined by structure and function. These proteins are listed in their family groups in Table 1.

Families other than Ras, in the Ras subfamily also appear to have roles in regulating cell growth and development. Rapl was identified as a supressor of Ras transformation (Noda, 1993), and may function by sequestering RasGEFs. Activated R-Ras, TC21 and R-Ras3 are able to transform rodent fibroblasts and R-Ras is able to bind the apoptosis regulator, Bcl-2 at its C-terminus (Chan et al., 1994; Cox et al., 1994; Graham et al., 1994; Kimmelman etal., 1997; Saez etal., 1994). In a similar manner to Rapl, Rheb is able to antagonise Ras transformation and signalling, this may be linked to an interaction between Raf-1 and Rheb, which is potentiated with phosphorylation of Raf-1 on serine 43 by protein kinase A, an event which decreases H-Ras interaction (Clark et al., 1997b; Yee and Worley, 1997). The specific functions of other Ras subfamily members are only just beginning to emerge (Bos, 1997). A major function of the Rho family is actin cytoskeleton organisation, however it also has many other functions which will be discussed in more detail later. The Rab sub-family are involved in the secretory and endocytic pathways (Schimmoller et al., 1998), and comprises the largest family of GTPases. ADP-ribosylation factors (ARFs) are critical for several vesicular trafficking

22 Chapter One - Introduction pathways (Moss and Vaughan, 1998) and for efficient ADP-ribosylation of by cholera toxin (Bobak et al., 1989; Sewell and Kahn, 1988). The Ran (Ras-related nuclear protein) sub-family is involved in trafficking proteins and RNA in and out of the nucleus, and unlike most other Ras superfamily members which exist in the cytoplasm, they are found in the nucleus (Mattaj and Englmeier, 1998). Rad proteins are believed to have a role in calcium signalhng since they bind Calmodulin (Fischer et al., 1996; Moyers et al., 1997). Table 1 Members of the human Ras-like GTPase superfamily Ras-like Family/ Members Review/ References Subfamily Class Ras Ras Ha-Ras, Ki-Ras, N- (Bos, 1997) Ras Rap lA, IB, 2A, 2B Ral A,B R-Ras R-Ras, TC21 (R- Ras2), R-Ras3 Rheb Rheb Rho Rho A,B, C (Hotchin and Hall, 1996; Van Aelst, 1997) Rac 1,2,3 TCIO TCIO Cdc42 Cdc42, G25K, RhoG RhoG RhoE RhoE. Rho8/Rnd3, Rndl/Rho 6 , Rnd2/Rho7 RhoD RhoD TTF TTF Rab Rab Over 40 members in (Novick and Zerial, 1997) mammahan family AD? Ribosylation Class I ARF 1, 2, 3 (Moss and Vaughan, 1998) Factor (ARF) Class II ARF 4, 5

Class III ARF 6 Ran Ran Ran (Mattaj and Englmeier, 1998; Rush et al., 1996) Rad Rad Rad, Gem, Kir, (Cohen et al., 1994; Finlin and Rem Andres, 1997; Maguire etal., 1994; Reynet and Kahn, 1993) Rin Rin Rin, Rit (Lee et al, 1996; Wes et al., 1996) 1.2.3 Ras in human tumorigenesis

Mutations in the ras genes are commonly found in human tumours. Their overall incidence is around 10-15%, however this varies strongly amongst tumour types. For example, over 90% of tumours of the pancreas and half of colonic cancers contain

23 Chapter One - Introduction activating ras mutations (Bos, 1989). Individual ras genes are commonly associated with specific tumours; Yà-ras mutations are predominantly found in adeno-carcinoma of the lung and pancreatic and colorectal cancers; N-ras is predominantly found in a subset of acute leukemias and in myelodysplastic syndromes; mutations in Ha-mj are quite rare, although Yià-ras was originally identified in human bladder carcinomas (Bos, 1989; Rodenhuis, 1992). It is clear that activation of Ras is advantageous for tumour formation. However, although the reason for this is not yet known the ability of activated Ras to act as an independent mitogen may be relevant. Furthermore, many components involved in Ras activation are also found mutated in human tumours. For example inactivation of the neurofibromatosis type I gene (NF-1), a Ras GTPase activating protein (RasGAP) is implicated in neurofibromatosis (Ballester et al., 1990; Martin et al., 1990; Xu et al., 1990a; Xu et al., 1990b). In addition the epidermal growth factor receptor (EGFR) has been found overexpressed in many human tumours (Hesketh, 1997). Therefore although these tumours do not contain Ras mutations, they still contain a constitutively activated Ras pathway.

1.2.4 Activation of Ras

The three humanras genes encode four 188-189 amino acid proteins of 21 kDa in size (H-Ras, N-Ras, K-Ras4A and K-Ras4B). The K-Ras proteins use different exons to encode the last 25 amino acids in their carboxy termini (Capon et al., 1983; McGrath et al., 1983; Shimizu etal., 1983a). Ras proteins localise and become active at the plasma membrane due to post-translational modifications to their carboxy termini via their CAAX motif. Prénylation is the first modification that occurs to Ras proteins, which Ae* become famysylated or geranylgeranylated by famesyl transferase or geranylgeranyl transferase type I respectively. After prénylation Ras proteins undergo carboxy-terminal cleavage, carboxymethylation and palmitoylation (Lowy and Willumsen, 1993). However only farnesylation is necessary for the oncogenicity of Ras (Kato et al., 1992) which has made it a major target for drug therapy (Kohl et al, 1995).

Ras proteins are similar to the two other families of GTP binding proteins, the heterotrimeric G proteins and the elongation and initiation factors of protein synthesis. All act as molecular switches whose signalling ability is activated upon association with guanosine triphosphate (GTP). The GTP is then hydrolysed into guanosine diphosphate (GDP), by intrinsic GTPase activity and the protein becomes inactivated (Bourne et a l, 1990). Two regions of Ras change conformation upon GTP hydrolysis. Switch I and Switch II, which comprise amino acids 30-37 and 59-76 respectively. These regions contain amino acid residues that interact with the y-phosphate of GTP (Wittinghofer and Nassar, 1996).

24 Chapter One - Introduction

The intrinsic GTPase activity and Figure 1 .3 Switch mechanism of Ras GDP exchange rate of Ras is quite low and therefore two types of regulatory proteins assist Ras RasCihh GTP/GDP cycling, this is depicted in figure 1.3. GTPase activating proteins (GAPs) are negative RAS I GTP RASIgdp regulators of Ras signalling (Trahey and McCormick, 1987). They accelerate the intrinsic RasCiA!^ GTPase activity of Ras, possibly by stabilising the transition state ACTIVE INACTIVE for GTP hydrolysis (Prive et ai, RAS RAS 1992; Scheffzek et al., 1997). Two GAPs which show catalytic activity towards Ras are p i20°^^ (Adari et al., 1988; Trahey and McCormick, 1987; Vogel etal., 1988) and NFl (Ballester a/., 1990; Martin et al., 1990; Xu et al., 1990a). G.uanosine nucleotide exchange factors (GEFs) (also called GDP dissociation stimulators (GDSs) and guanine nucleotide releasing proteins (GNRPs)) promote exchange of GDP for GTP and thus activate Ras signalling (Quilliam etal., 1995). The major mammalian GEFs in Ras signal transduction are thought to be Sos 1 and 2, (Bowtell et al., 1992; Chardin et al., 1993) which are mammalian homologues of the Drosophila melanogaster GEF, ^on Qf ^evenless (Simon et al., 1991). Additional mammalian RasGEFs are Cdc25'^"’/RasGRFl and RasGRF2 (Fam et al., 1997; Farnsworth et al., 1995). The role of other putative Ras GEFs is more controversial. It has been suggested that Vav, a GEF with sequence homology to Dbl, acts as a RasGEF (Gulbins et al., 1993; Gulbins et al., 1994), however other groups disagree and believe it is a GEF for the Rho family (Bustelo et al., 1994; Khosravi-Far et al., 1994). Smg-GDS is able to act as a GEF for K-Ras4B and other members of the Ras superfamily, but not for the other Ras proteins (Mizuno et al., 1991; Takai et al., 1993). Mutants that act in a dominant negative fashion towards Ras family members such as Ras"^^^ have a very low affinity for guanosine nucleotides and may act by sequestering RasGEFs and preventing normal Ras molecules from utilising GEF exchange activity (van den Berghe gf a/., 1997). Chapter One - Introduction

Activation of normal Ras occurs in response to a wide variety of stimuli, such as growth factors, cytokines, hormones, and neurotransmitters. These stimuli signal to transmembrane receptors such as receptor tyrosine kinases (RTKs), non-receptor tyrosine kinase-associated receptors and G-protein coupled receptors. The best characterised Ras- mediated signal transduction pathway is Figure 1.4 Activation of Ras by growth the activation of the epidermal growth factors and integrins factor receptor. This is depicted in A. This RTK undergoes auto­ phosphorylation on cytoplasmic tyrosine EGFR residues in response to epidermal growth factor (EOF) stimulation. These mSOS phosphorylated residues then provide binding sites for the ^rc-homology 2 B (SH2) domains of growth factor receptor- bound protein 2 (Grb2) (Lowenstein et al., 1992; Matuoka et al., 1992). Grb2 consists almost entirely of one SH2 domain and two proline binding SH3 domains (Clark et al., 1992). The SH3 domains bind to the proline rich carboxy terminus of Sos which is in complex with Ras at the plasma membrane (Buday and Downward, 1993; Chardin et al., 1993; Egan et al., 1993; Gale et al., 1993; Li et al., 1993; Rozakis-Adcock et al., 1993). This proposed mechanism derives from several observations including the potentiation of EGFR activation of Ras upon over expression of Grb2, and also the activation of Ras by an artificially membrane localised Sos (Aronheim et al., 1994; Gale et al., 1993; Quilliam et al., 1994). Other growth factor receptors use similar mechanisms, for example the Sos-Grb 2 complex binds to the insulin receptor via another adaptor protein, She and the insulin receptor substrate (lRS-1) (Skolnik etal., 1993). A similar, though more complex mechanism is used by integrins for Ras activation of the mitogen activated protein (MAP) kinase pathway in kératinocytes (see B). Caveolin has been shown to recruit the tyrosine kinase Fyn to the a integrin which binds She. She then binds Grb2 and Sos complexes and this ultimately leads to Ras activation (Wary etal., 1996; Wary et al., 1998). Increase in GEF activity may just be one mechanism by which Ras is activated. Phorbol ester treatment in T cells which leads to Ras activation, occurs with no change in guanine nucleotide exchange activity and instead coincides with downregulation of RasGAP activity (Downward et al., 1990). Chapter One - Introduction

Furthermore, Ras activity is regulated by PI 3-kinase-mediated inhibition of GAP activity in adipocytes (DePaolo etal., 1996).

Ras genes are proto-oncogenes and become constitutively activated when point mutated in specific amino acid residues. The most common mutations in human tumours are 12, 13 and 61 (Lowy and Willumsen, 1993). Ras proteins activated by these mutation become immune to the effects of GAPs since they have lost their intrinsic GTPase activity and so become GTP bound (Adari etal., 1988; Scheffzek et al., 1997; Trahey and McCormick, 1987; Vogel et al., 1988). Expression of these mutants in rodent fibroblasts leads to cellular transformation and constitutive upregulation of Ras targets (Chang et al., 1982; Parada etal., 1982; Shih and Weinberg, 1982; Stacey and Kung, 1984).

1.2.5 Cellular Effects of Ras

Ras is involved in many cellular processes and inappropriate activation of Ras signals can stimulate a variety of responses including changes in growth control, morphological and structural changes to cells and alterations in gene expression.

Ras was initially isolated because of its ability to overcome contact inhibition in rodent fibroblast cell-lines and the subsequent ability of those cells to promote tumour formation in nude mice (Chang et ai, 1982; Shih and Weinberg, 1982). Microinjection experiments then demonstrated that oncogenic Ras increased the proliferation and induced DNA synthesis of serum-deprived cells (Feramisco et al, 1984; Stacey and Kung, 1984). Ras was found to be an essential component of growth factor signalling because Ras inhibitory antibodies or dominant negative, Ras*^’’ prevented induction of DNA synthesis by serum and growth factors (Cai et a l, 1990; Feig and Cooper, 1988). Ras activation by growth factors is required at multiple points during transition from quiescence through G1 and is no longer necessary after the cells have initiated DNA synthesis (Dobrowolski eta l, 1994; Mulcahye ta l, 1985). Ras is able to induce Cyclin D1 expression (Aktas et a l, 1997), and as discussed earlier, in some cells ectopic expression of Cyclin D1 is sufficient to induce cell cycle progression. Moreover, the resulting effect of Cyclin Dl/Cdk4/6 activation is the phosphorylation of pRb. Inactivation of Ras, by dominant negative mutants or inhibitory antibodies has less inhibitory effect on mitogen stimulated proliferation in Rb null cells, than Rb positive cells (Mittnacht et al., 1997; Peeper et a l, 1997). This work shows Ras partly stimulates DNA synthesis by promoting hyperphosphorylation of pRb, but that it also has other functions.

Oncogenic Ras also relieves the requirement for cells to be adhered to a substratum when cultured in vitro. This is a characteristic of most neoplastic cells, in contrast to non­ transformed cells which require specific signals from their adhesion receptors to

27 Chapter One - Introduction proliferate (Giancotti and Mainiero, 1994). For example, F2408 rat fibroblasts require adhesion to substratum for 4-8 h after serum stimulation to progress into S-phase (Inoue et a l, 1996), however on expression of viral oncogenes, cells no longer require adhesion signals to be stimulated by mitogens. As described earlier, pi integrins and also a4p6 integrins are able to directly activate Ras and the Extracellular regulated kinase (ERK) MAP kinase pathway, via the adaptor molecule She (Mainiero et al., 1997; Wary et at., 1996; Wary et at., 1998). Moreover only integrin signalling mediated through She can co-operate with mitogens to stimulate cell cycle progression (Wary et at., 1996). Adhesion and mitogenic signals have been shown to synergise in their activation of the Ras-ERK MAP kinase pathway. This is demonstrated by the synergistic upregulation of ERK activity in human fibroblasts by the addition of EOF, PDGF or bFGF coupled with integrin receptor occupation, by fibronectin-coated beads or an RGD peptide (Miyamoto et al., 1996). However, this is not always the case, attachment to fibronectin-coated dishes did not alter the abihty of PDGF to activate ERK in fibroblasts maintained in suspension (Hotchin and Hall, 1995; Zhu and Assoian, 1995). In contrast to this another group has reported that serum is unable to stimulate ERK activity in suspended Swiss 3T3 cells (Inoue et al., 1996). It has however been demonstrated that constitutive activation of MEKl appears to be sufficient for both mitogen and anchorage independent growth, since fibroblasts expressing constitutive MEKl are able to form colonies in soft agar, and proliferate in the absence of mitogens (Cowley et al., 1994; Mansour et al., 1994). Thus integrin-mediated and growth factor-mediated proliferative signals may converge on the ERK MAP kinase pathway, possibly through activation of Ras.

Oncogenic Ras also enables cells to overcome the constraints of growth inhibition by cell­ cell contact. This is demonstrated by the occurrence of foci of transformed Ras^'^ transfected cells on an untransfected monolayer. is induced in fibroblasts upon cell-cell contact and downregulates Cyclin E-associated kinase activity (Polyak et al., 1994a). However p27'^‘‘’' null MEFs are still contact-inhibited (Nakayama et al., 1996). Alternatively, in epithelial cells Ras has been shown to downregulate the expression of cadherins which mediate cell-cell interactions and are also important signalling molecules (Ben Ze'ev, 1997).

Although Ras was originally discovered as a transforming and growth promoting oncogene, these properties only arise in established cell-lines or in co-operation with another oncogene in primary cells. It is assumed that established cell-lines have acquired genetic lesions as part of the immortalisation process. Indeed immortalised mouse embryo fibroblasts have lost function of either of the tumour supressor genes p 5 3 or

PI 9 ARF (2indy et al., 1998). Activated Ras is unable to transform cells of primary origin. It requires the presence of a second co-operating oncogene to achieve full transformation. Indeed Ras actively inhibits proliferation of some cell types. For example, v-Ha ras or

28 Chapter One - Introduction activated Raf was shown to directly inhibit cell proliferation in primary rat Schwann cells, although full transformation could be acheived if co-expressed with a viral oncogene, simian virus 40 large T antigen (SV40 LT) (Lloyd et al, 1997; Ridley et al, 1988). This arrest occurs in the G1 phase of the cell cycle and is associated with a p53-dependent upregulation of the cell cycle inhibitor, pll^'^"'(Lloyd et a l, 1997). In addition, Ras is able to mimic the effects of nerve growth factor (NGF) on a rat phaeochromocytoma cell- line, PCI2, and induce cessation of cell growth and neurite outgrowth, a differentiated phenotype (Noda et al, 1985). More recently, it has been shown that primary human and rodent fibroblasts respond to activated Ras with a growth arrest. This arrest is associated with the upregulation of the CKIs and the cells exhibit characteristics associated with senescence such as changes in morphology and expression of senescence markers (Serrano eta l, 1997).

Therefore it appears that the default response to activated Ras signalling is to stop growing and this must be overcome in order for Ras to stimulate mitogenesis. The mechanisms by which this is achieved are starting to be understood. For example, the G1 arrest caused by activation of the Ras/Raf/ERK pathway in primary rat Schwann cells can be prevented by interfering with p53-dependent upregulation of p21^‘‘’'' using a dominant negatively acting p53 mutant, antisense RNA to block p21^'P ' translation, or SV40 LT which sequesters p53 (Lloyd et a l, 1997). In a similar manner, Ras is tumorigenic in p21^'P ' null kératinocytes, but not in wild type cells (Missero et a l, 1996). Likewise, pj^iNK4A MEFs no longer exhibit growth arrest in response to Ras (Serrano et a l, 1997). However this may also involve the tumour supressor gene, p i9^’^*', which is also affected in this knock out. Thus it appears that in order for Ras to be growth stimulatory or tumorigenic, cell cycle inhibitory proteins must first be inactivated.

1.2.6 Ras signal transduction through Raf

1.2.6.1 Raf as a Ras effector

Upon activation, Ras relays its signals through its downstream targets. The most established of these is Raf-1. Raf-1 is a serine threonine protein kinase, and is part of a family also containing A-Raf and B-Raf (Bonner et al, 1984; Huleihel et a l, 1986; Ikawa et a l, 1988). Raf was originally placed downstream of Ras because genetic evidence from Drosophila and C.elegans showed that it is essential for Ras signalling in eye and vulval development, respectively (Dickson et a l, 1992; Han et a l, 1993). Raf is also necessary for Ras signalling in mammalian cells since dominant negative Raf molecules block Ras-induced gene transcription (Bruder et al, 1992) and proliferation (Kolch et a l, 1991). Moreover, Raf can reproduce many of the cellular responses of Ras in mammalian cells. For example, both Ras and Raf can activate ERK, and dominant negative versions of both can block growth factor induced ERK activation (de Vries-

29 Chapter One - Introduction

Smits et al., 1992; Schaapet a i, 1993). Direct binding of Raf to Ras was demonstrated using yeast two hybrid analysis and direct in vitro binding assays. Specifically, the N- terminal portion of Raf-1 binds directly to the effector domain of Ras-GTP (Moodie et at., 1993; Van Aelst et ai, 1993; Vojtek et ai, 1993; Wame et al., 1993; Zhang et al., 1993). Furthermore, the Ras^'^°^^ effector domain mutant which can no longer bind to Raf-1 is defective in ERK activation and this impairment can be complemented by mutations in Raf-1 which restore an interaction with Ras^'^^^^ (White et al., 1995). These observations and similar ones (reviewed in Katz and McCormick, 1997; Marshall, 1996; Marshall, 1993) provide strong evidence that Raf-1 is a genuine effector of Ras signalling responsible for the activation of the ERK MAP kinase pathway.

1.2.6.2 Raf activation

Although Raf-1 has been established as an effector of Ras, purified recombinant Ras is not sufficient to activate Raf-1 in vitro (Traverse et al, 1993; Zhang et al., 1993). Raf-1 activation appears to be a complex, multi-step process involving many components. A current model of Raf activation is depicted in Figure 1.5. Raf-1 is composed of two functional domains, the amino terminal regulatory domain (conserved regions, CRl (aa 62-194) and CR2 (aa 254-269)) and the carboxy terminal kinase domain (CR3 (aa 330- 627)) which interacts with downstream targets of Raf-1. The amino terminal domain suppresses Raf-1 catalytic activity and deletion of part of its regulatory amino-terminal domain results in a constitutively activated Raf-1 mutant (Beck et a l, 1987; Heidecker et a l, 1990; Ikawa et al, 1988; Stanton and Cooper, 1987; Stanton e ta l, 1989).

All the components necessary for Raf-1 activation are located at the plasma membrane. Raf-1, purified from an insect expression system can be activated by the addition of plasma membranes from Ras^'^ transformed cells (Dent and Sturgill, 1994). Moreover, when plasma membranes which have been treated to remove integral proteins were mixed with recombinant and post-translationally modified Ki-Ras it was sufficient to activate Raf-1 added as a component of cytosol, but not purified recombinant Raf-1 protein. This did not occur in the absence of membranes (Stokoe and McCormick, 1997). Ras is known to translocate Raf-1 from the cytoplasm to the plasma membrane (Traverse et a l, 1993). Membrane localisation of Ras can be prevented by blocking its post-translational modification using peptide inhibitors. Unmodified Ras is still able to complex with Raf- 1, but these cytosolic complexes are inactive (Kikuchi and Williams, 1994; Lemer et a l, 1995; Okada et a l, 1996). Raf-1 can be constitutively activated by fusion of the membrane localisation sequence of Ki-Ras to its carboxy terminus which permits membrane binding and activation of Raf-1 independently of Ras (Leevers et a l, 1994; Stokoe et al, 1994).

30 Chapter One - Introduction

Two separate domains of Raf-1, the Ras binding domain (RED) a a 2-140 and the Cysteine rich domain (CRD), a a 139-186, have been found to bind to Ras in its switch 1 and switch 11 regions, respectively. Concurrent binding of both domains is required for Raf-1 activation. Mutation of Ras in either its Switch 1 or 11 region which can disrupt binding of polypeptides encoding the CRD or the RED can prevent Raf-1 activation in vitro (Ertva et al., 1995; Drugan et al., 1996; Hu et al., 1995a). Furthermore, Raf-1 fragments corresponding to the CRD are able to inhibit the transforming ability of activated Ras, indicating that this association is important in Ras transformation (Ertva et al., 1995). This implies that Ras has additional functions important in activation of Raf- l,in addition to translocation. Ras mutants that are defective in binding the RED of Raf-1 are unable to bind full length Raf-1 indicating that RED binding is required prior to CRD binding. The CRD is possibly unmasked by a conformational change in Raf-1 upon RED binding, since removal of CR3 or mutations in CR2 of Raf-1 allow CRD binding in the absence of prior RED binding (Drugan gr a/., 1996).

Figure 1.5 Activation of Raf-1

RASCgdp k in a s f: PAK S338.P

KINASE

14-3-3

INACTIVE RAF A C T IV E RAF

The CRD may be involved in binding other molecules such as 14-3-3 proteins (Michaud et al., 1995). 14-3-3 proteins are thought to have a regulatory role in Raf-1 activation (Fantl et a/., 1994; Fu era/., 1994), however the details of this remain unclear. Raf-1 has three putative 14-3-3 binding sites; RxSxS*xP (single letter code for amino acids where x represents any amino acid and S* represents phosphorylated serine) (Morrison and Cutler, 1997). 14-3-3 proteins may be involved in the masking of the amino terminal CRD of Raf-1, regulating its activation since disruption of 14-3-3 binding by mutation of a 14-3-3 binding site within the CRD of Raf-1 increases the transforming potential of Raf- 1 (Clark et al., 1997a; Rommel et al., 1997). Ras also interferes with the interaction between amino terminal of Raf-1 and 14-3-3 (Rommel et al., 1996). 14-3-3 proteins binding to the carboxy terminal kinase domain of Raf-1 may be required to stabilise an active conformation of Raf produced during activation, since inhibition of 14-3-3 binding Chapter One - Introduction can deactivate Raf-1 in vitro and dimerised 14-3-3 proteins can reactivate Raf-1 (Tzivion et al., 1998). 14-3-3 interaction with Raf-1 can also protect Raf-1 from phosphatases (Dent et at., 1995).

A role for phospholipids in Raf-1 regulation has also been demonstrated. The CRD of Raf-1 binds to phosphatidyl serine (PS) (Ghosh et at., 1994) and addition of PS or reconstituted plasma membranes can enhance activation of Raf-1 by Ras in vitro (Kuroda etal., 1996b; Stokoe and McCormick, 1997). Ceramide, which acts as a lipid co-factor induced by interleukin ip, has also been demonstrated to bind and activate Raf-1 (Huwiler et ai, 1996). However, ceramides activated by TNF, have been shown to bind Raf-1 and increase its association with Ras but do not increase Raf-1 kinase activity and actually downregulate activation of Raf-1 by EOF and v-Src (Muller et al., 1998). These different effects may be due to cell type specific differences, however, they may well be propagated by kinase supressor of Ras (Ksr).

There also appears to be a role for Ksr in Raf-1 regulation downstream of Ras (Therrien etal., 1996). Loss of function ksr alleles act as dominant suppressors to the rough eye phenotype caused by activated Ras in Drosophila (Therrien et al., 1995) indicating a requirement for Ksr in Ras signal transduction. Ksr had been previously identified as ceramide activated protein (CAP) kinase (Zhang et al, 1997). It appears to have a role in facilitating signalling via the MAP kinase cascade. Several groups suggest it interacts (possibly via 14-3-3 proteins) with and activates Raf-1 in a membrane bound multi­ protein signalling complex (Michaud eta l, 1997; Xing et al., 1997; Zhang et al., 1997). However other groups show that it does not interact with Raf-1, but does interact with Mitogen/Extracellular regulated kinase kinase (MEK) and ERK in yeast two hybrid screens and immunoprécipitation of endogenous proteins from PCI2 cells (Denouel-Galy et a l, 1998; Yu et a l, 1998). A novel gene, connector enhancer of ksr (cnk) is also required for efficient signal transmission within the Ras/ERK cascade and was found as a mutation that modified a dominant negative ksr and activated Ras dependent phenotype in Drosophila. CNK is a possible target of tyrosine phosphorylation and physically interacts with D-Raf (Therriene ta l, 1998). There are also indications that Ksr is a substrate for ERK which may be an event connected to a regulatory feedback loop (Cacace et a l, 1999).

Other Raf-1 binding proteins such as the molecular chaperone heat shock proteins, HSP 90 and HSP 50, may have a role in maintaining Raf-1 protein stability and its proper localisation. Their binding to Raf-1 is irrespective of its activation state (Schulte et a l, 1995; Schultee ta l, 1996).

Raf-1 is also regulated through tyrosine phosphorylation at residues Y340 and Y341. This is dependent upon Ras activity in mammalian cells and is performed by tyrosine

32 Chapter One - Introduction kinases such as the Src family or the Janus activated kinases (JAKs). The presence of v- Src synergistically increases Ras activation of Raf-1 indicating the importance of tyrosine phosphorylation in Raf activation (Fabian et al., 1994; Marais et al., 1995; Xia et al., 1996).

Serine/threonine phosphorylation may also have a role in Raf-1 regulation. The p21 activated protein kinase, PAK3, has been demonstrated to directly phosphorylate serine 338 of Raf-1. Phosphorylation of this site is necessary for Ras activation of ERK, via Raf-1 (King et al., 1998). (This will be discussed in more detail later). In addition, 14-3- 3 binding requires a phosphorylated serine residue.

The cyclic AMP dependent kinase (PKA), is able to inhibit Raf-1 activity (Cook and McCormick, 1993). PKA phosphorylates Raf-1 at Ser43, and this phosphorylation inhibits Ras-Raf interaction (Wu et a l, 1993a). Furthermore, PKA has an ability to directly inhibit Raf-1 kinase activity that is distinct from its ability to interfere with Ras- Raf interaction, since it is able to inhibit the kinase activity of a tmncated Raf-1 mutant, missing its Ras binding domains, or v-Raf which is independent of Ras. This ability may involve phosphorylation of residues within Raf s kinase domain (Hafner et al., 1994).

Finally, forced dimérisation of Raf proteins has been demonstrated by two groups to activate Raf signalling, however one group demonstrates this in the absence of membrane components , i.e. independently of Ras (Farrar gf a/., 1996), while the other study found that the Ras-Raf interaction was still required (Luo et al., 1996). This may indicate an alternative mechanism for Raf activation, which may be independent of Ras.

1.2.7 Activation of MAP kinase cascades

Raf controls a cascade of dual specifieity kinases, in which a MAP kinase kinase kinase, such as Raf-1, phosphorylates and activates a MAP kinase kinase, such as MEKl, which then phosphorylates and activates a MAP kinase, which then goes on to phosphorylate specific targets (see Figure 1.6). This sequence of events is generally termed a MAP kinase cascade. MEK (also called MKKl and MAPKKl) and ERK are activated upon mitogen stimulation or in the presence of oncogenic Ras or Raf-1. Bacterially expressed oncogenic Raf-1, or wild type Raf-1 immunoprecipitated from insect or mammalian cells that co-express v-Src or v-Ras, is able to directly phosphorylate and activate MEKl, that has been previously subjected to dephosphorylation by phosphatase 2A (Dent et al., 1992; Howe et ai, 1992; Kyriakis et a l, 1992; Macdonald et al., 1993). Activated MEK can phosphorylate and activate p44^*"' and p42 (also referred to as p42 and p44 MAP kinases (or MAPKs)) in an in vitro reconstitution assay (Crews et al., 1992; Wu et a i, 1992) and when over expressed in Cos cells (Wu et al., 1993b). ERKs are activated by phosphorylation on both threonine and tyrosine residues (Boulton et a l, 1991; Payne et a l, 1991). Removal of either of these phosphorylations through the action of specific

33 Chapter One - Introduction phosphatases or site-directed mutagenesis leads to inactivation (Anderson et al., 1990; Cowley era/., 1994).

Other MAP kinase cascades occur in mammalian cells in addition to the Raf-MEK-ERK cascade. These are depicted in Figure 1.1. The JNK and p38 pathways are activated by inflammatory cytokines, TNFa, ILip and cellular stresses such as UV light, anisomysin, heat shock, sodium arsenite and y-irradiation (Kyriakis and Avruch, 1996). They can also be activated by Ras, independently of Raf (Minden et at., 1994). These pathways are also targets of the Rho family of GTPases and will be discussed in more detail later. Similar MAP kinase cascades have been identified in yeast, C.elegans and Drosophila.

Different MAP kinase modules in yeast share components and specificity of signalling in response to stimuli is thought to be achieved by the use of scaffold or adaptor proteins. Such an example is Ste5 in S.cerevisiae, which form multi-protein complexes with specific MAP kinase modules. Recently, two non-enzymatic proteins with similar functions have been identified in mammalian cells, JNK-interacting protein-1 (JlP-1) and MEK partner 1 (MPI) . JlP-1 is thought to channel signals through a specific set of kinases that activate JNK. It specifically binds the MAP kinase kinases, MLK3 and DLK, the MAP kinase, MKK7 and the MAP kinases, JNKl and JNK2 (Whitmarsh et al., 1998). MPI does not appear to route an entire pathway, but specifically stabilises MEKl and p44^^"^' interaction such that overexpression of MPI is able to increase the ability of MEKl and p44^^^^' to co- activate Elk-1-mediated transcription (Schaeffer et al., 1998). It is probable that more proteins with similar functions will be found in mammalian cells, and that such proteins will provide a mechanism for retaining that specificity of MAP kinase modules in response to specific signals, even when the components are shared between pathways. Abuse of scaffolding proteins may account for inappropriate activation of MAP kinase cascades upon overexpression of specific module components. For example, overexpression of MEKKl has been shown to activate MEKl (Lange-Carter et al, 1993; Yan et al., 1994).

1.2. 7.1 ERK targets

ERKs are activated in the cytoplasm and directly or indirectly activate transcription. MAP kinases can translocate into the nucleus and phosphorylate nuclear transcription factors including those in the Ets family and bZlP and MADS box containing transcriptional regulators. For example, Elkl; Ets transrepressors e.g. ERF; ATFs; c-fos; c-myc and the oestrogen receptor (Lewis et a l, 1998). In addition, ERKs can activate protein kinases referred to as MAPK activated protein kinases (MAPKAPK) 1, 2 and 3 and Mnks 1 and 2 (MAPKAPKla and P were first identified as p90’^*'"' and p i90^'"^). Some MAPKAPK 1 substrates are involved in transcription and include cAMP response-element binding protein (CREB), CREB binding protein (CBP), c-fos, Nurr 77 and serum response factor

34 Chapter One - Introduction

(SRF) (Chen et al., 1996c; Nakajima et at., 1996; Tan et al., 1996; Xing et al., 1996). MAPKAPK2 and MAPKAPK3 phosphorylate HSP27 which is believed to be an actin capping protein (Clifton et al., 1996; Engel et al., 1995; McLaughlin et al., 1996; Stokoe et al., 1992). Mnkl and 2 phosphorylate Elongation Initiation Factor 4E (eif4E), implying that they have a role in translational control (Waskiewicz et al., 1997). ERKs also activate phospholipase A2 which suggests a role for ERKs in agonist stimulated arachidonic acid release (Lin etal., 1993; Nemenoff etal., 1993).

A mechanism for activation of MAP kinase directed transcription has recently been proposed in S. cerevisiae which also contain MAP kinase cascades. The MAP kinase homologue Kssl, when unphosphorylated, directly binds to and represses the transcription factor Stel2 which prevents invasive growth. This was demonstrated by the inability of Kssl mutants that are specifically defective in Stel2 binding (but are able to bind other regulatory molecules, including Ste7) to inhibit invasive growth. Phosphorylation of Kssl by Ste7, a MEK homologue, weakens the Kssl-Stel2 interaction and thereby relieves Kssl induced transcriptional repression. Kssl is then thought to further activate Stel2 by phosphorylation (Bardwell et al., 1998). It remains to be seen whether this mechanism in which MAP kinases have both a repressive and activating role in gene transcription will be found in mammalian MAP kinase cascades.

1,2. 7.2 ERK inactivation

Inactivation of MAP kinases in mammalian cells occurs by dephosphorylation involving phosphatases of two different families. Dual specificity phosphatases such as the MAP kinase phosphatases (MKP) 1-4 are able to remove serine, threonine and tyrosine phosphorylation concomitantly in vitro, (Alessi etal., 1993; Charlesetal., 1993) and also inactivate ERKs in vivo (Duff et a i, 1995; Sun et al., 1993). Serine/threonine protein phosphatases, such as PPl and PP2A also inactivate ERKs as well as MAP kinase kinases. Treatment of cells with okadaic acid (which is inhibitory for PPl and PP2A) activates ERK activity, which implies a role for these phosphatases in ERK regulation.(Casillas etal., 1993; Gotoh etal., 1990; Haystead etal., 1990).

35 Stress signais Growth TNFa Growth Stimulus Pheromones Factors Proinfiammatory cytokines Factors? i Growth Factors Small! Cdc42 Sc Rasi Ras Rac, Cdc42 GTPase

MAPKKKK STE20 PAK GCK GCK.HPKl HPK1

MAPKKK STEl 1 Byr2 Raf TAK1.TA0

MAPKK STE7 Byrl MEKl,2 MKK7 MEK4 MEK3 MEK6 MEK5

MAPK Kssl SPK1 ERK1.2 JNKl,2,3 p38,p38p ERK6, ERKS FUS3 SAPK4

Substrate STE12, Ets, Elkl, ATF2, Jun, ATF2,CREB, MCEF2C FAR1 MAPKAP-Ks Elkl MAPKAP-Ks m ating, m uscle m eiosis differentiation?

S.cerevisiae S.pombe Mammalian cascades

Figure 1.6 Signal transduction through MAP kinase modules MAP kinase cascades in mammalian cells and yeast are depicted. Multiple MAP kinase modules exist in yeast and only one is shown. Examples of substrates for the MAPKs are shown, but many more substrates have been identified and the specificity of each MAPK for its substrates has not yet been properly defined. As described in the text, additional interactions between members of cascades occur and are not shown here. Chapter One - Introduction

1.2, 7.3 Additional regulation of MAP kinase cascades

Each member of MAP kinase cascade also has additional upstream activators and downstream targets. Thus what were once considered linear signalling pathways are now considered part of a much larger signalling network. For example the novel protein kinase C, PKCÔ, is able to activate ERK in the presence of a dominant negative Ras molecule (Ueda et at., 1996). The same is true of an integrin dependent pathway stimulated by fibronectin binding (Chen et at., 1996b) indicating independence of ERK activation from Ras signalling. The use of specific chemical inhibitors has indicated that p4 4 Erki activation by PDGF has both a MEKl dependent and a MEKl independent step that are tempororally distinct. Both phosphatidylinositol 3 kinases (PI 3-kinase) and conventional PKCs are implicated in the MEKl independent step (Grammer and Blenis, 1997). In addition regulatable oncogenic Raf (and constitutively activated MEKl) has been demonstrated to rapidly activate p70^^ in the presence of the MAP kinase phosphatase, MKP-1 and therefore independently of ERK activity (Lenormand et al., 1996). Positive feedback loops also occur within the cascade. For instance ERKs can phosphorylate MEKl (Gotoh et al., 1994; Zheng and Guan, 1993), Raf-1 (Anderson et a l, 1991; Kyriakis eta l, 1993; Lee eta l, 1991) and Ksr, and MEKl can phosphorylate Raf-1 through an ERK dependent pathway (Zimmermann et al., 1997). However, caution must be used when interpreting this data. For example, MEK was proposed as a target for an alternative MAP kinase kinase kinase MEKKl because MEKKl can induce MEKl activation in vitro and when over expressed in Cos cells (Lange-Carter et a i, 1993; Yan et al., 1994). However, lower levels of MEKKl expression were unable to activate MEKl, but could activate the jun N-terminal kinases or stress activated protein kinases (JNKs or SAPKs). These are now considered to be the genuine physiological targets for MEKKl (Minden eta l, 1994; Yan etal., 1994).

1.2.8 Alternative Ras effectors

A large body of evidence derived from cellular responses to Ras in different organisms suggests that Raf is not the sole effector of Ras. Firstly, adenyl cyclase can be activated in vitro by Ras-GTP and has been demonstrated to be a direct effector of RAS in S.cerevisiae (Toda et al., 1985). However, deletion of the gene does not cause the lethality associated with RAS deletion (Marcus et al., 1993) indicating that Ras controls additional pathways. Secondly, in S.pombe, Byr2 which is similar in structure to Raf-1 and activates a MAP kinase cascade, rescues the sporulation defect but not the conjugation or morphological defects of Rasl null cells (Wang et al, 1991). Thirdly, Raf is unable to reproduce all the effects of Ras in mammalian cells. For example activated Raf only activates a subset of the genes activated by constitutive Ras in PC 12 cells (D'Arcangelo

37 Chapter One - Introduction and Halegoua, 1993). Similarly activated Raf is able to reproduce MAP kinase activation and gene transcription induced by oncogenic Ras in cardiac myoblasts, but is unable to reproduce the Ras induced changes to the cytoskeleton (Thorbum et al., 1994). Furthermore JNK and p38 MAP kinase pathways can be stimulated by activated Ras, but not directly by activated Raf (Minden et al., 1994) and although activated Ras is able to promote complete transformation of a rat intestinal cell-line (RIE-1), activated Raf is unable to fully reproduce this. These data indicate that Ras must activate additional targets and pathways in addition to Raf to achieve its reported effects.

1.2.8,1 Effector domain mutants of Ras

Some mutations within the effector domain of Ras disrupt Ras signalling but do not compromise GTP binding. This domain comprises amino acids 32-40 and includes part of the Switch I domain. Ras proteins containing these mutations are termed Ras effector domain mutants and each one displays differential abilities to stimulate Ras-mediated effects. These correlate with their abilities to bind or activate specific target or effector proteins. These mutants have been invaluable in identifying the role of specific Ras effectors in Ras-mediated cellular responses. A yeast two hybrid screen designed to identify Ha-Ras mutants which bind Ha-Ras targets differentially led to the isolation of two mutants, Ras^^^ and Ras°^^. Ras^^^ can bind Raf-1 and the S.cerevisiae RasGEF, CDC25, but is unable to bind Byr2 or adenyl cyclase. Ras^^’ binds Byr2 and adenyl cyclase, but not CDC25 or Raf-1. In mammalian cells , Ras^'^^^^ (an activated version of the mutant) was shown to activate signalling from the serum response element (SRE) of the c-fos promoter and had weak focus forming ability when transfected into NIH 3T3 cells, while Ras^^'“^^^ was unable to activate SRE signalling nor form foci. However co­ expression of Ras'^'^^^^ and Ras'^’^^^^ caused a synergistic increase in focus formation (Whiteet al, 1995). This implied that at least two downstream pathways from Ras were required for full transformation. SRE activation by Ras^'^^^^ did not increase upon co­ expression of Ras^'^"^^^, indicating that Ras-mediated effects can be specific to certain effector pathways. Another effector domain mutant, Ras^'^^'*°, is able to activate membrane ruffling (another property of Ras^'^), but cannot activate ERK. Ras^'^^^^ has reciprocal properties to Ras^'^^"^°, however neither is able to induce DNA synthesis. Microinjection of both of these mutants does stimulate DNA synthesis, indicating that Ras needs to activate multiple downstream pathways to induce DNA synthesis (Joneson et al., 1996b). In vitro binding assays showed that Ras^^^ binds Raf with the greatest efficiency, Ras^"^° binds the pi 10 subunit of PI 3-kinase and Ras^^^ binds Ral-GDS, however interaction with other Ras effectors may also occur. Moreover Ras proteins with these mutations in combination with the V12 mutation co-operate with activated versions of other proposed Ras downstream targets to form foci in NIH 3T3 cells. Specifically

38 Chapter One - Introduction

RagVi 2 S3 5 co-operates with activated Racl, RhoA and pi 10, but not Raf-1. Ras'^‘^^'‘° co­ operates with activated Raf-1 and RhoA, but not Racl or pi 10; and Ras^'^°^^ co-operates with activated Raf-1 and RhoA and to a lesser extent with pi 10 and Rac-1. These mutants can also co-operate with each other (Rodriguez-Viciana et al., 1997). However, caution must be used when interpreting the data generated from studies utilising effector domain mutants since these interactions could not be seen in all experimental systems suggesting that effector function may vary between cell types (Stang et at., 1997). Furthermore, the intensity of signals generated by these mutants is much less than activated Ras. We demonstrate later that Ras signal strength is an important factor in Ras- induced cellular responses. However these data add weight to other evidence supporting a role for multiple Ras activated pathways in many Ras-mediated effects.

1.2.9 Ras Effectors

There are a multitude of putative Ras effectors that bind Ras in a GTP-dependent manner, which have been isolated by yeast two hybrid screens, yeast functional screening and biochemical methods (Campbell eta l, 1998; Va was eta l, 1998). Current candidate Ras effectors are included in Figure 1.7. Two main criteria define true Ras effectors. Genuine effectors of Ras should be able to mimic certain Ras responses upon activation. Furthermore, Ras-induced effects should be inhibited by interference with the function of these effectors. So far, only three of these putative effectors as yet meet these criteria; the Raf family, the phosphatidylinositol 3-OH kinase (PI 3-kinase) family and the Ral- guanine nucleotide exchange factor (Ral-GEF) family.

39 Ras-GTP

PI 3- IF! GAP PKCî;Rinl 1 20GAP)(RalGEF Raf kinase MEKKl £ano^ ^ ^

PIP3 Ral

MEK4.MKK7 MEKl,2

PDK1 RalBPI

JNK, p38 ERK1,2

AKT/PKB Cdc42/Rac

PAK

Figure 1.7 Putative Ras effectors Proteins that have been found to bind to Ras in a GTP-dependent fashion. Rinl was identified as a gene that interfered with Ras function in yeast. AF- 6 (Rbsl) is homologous to the Drosophila protein Canoe. Rinl, Norel, AF- 6 and Canoe have been shown to bind Ras in a yeast two-hybrid system or inin vitro assays, in a GTP-dependent manner and Rinl, AF- 6 and Canoecan compete with Raf-1 for Ras binding (Campbelle t a!., 1998; Vavvuse t al .,1 9 9 8 ). Their functions have not yet been elucidated, however Rinl may be involved in linking Abl tyrosine kinase to Ras signalling, since they interactin vitro and Rinl is a substrate for Abl. PKC^ has been shown to be necessary for serum-stimulated mitogenic signalling and forms com plexes with Ras invivo in response to PDGF stimulation. It can bind Ras in a GTP- dependent manner and dominant negative Ras mutants prevent its activation by PDGF. The main function of NFl is probably as a RasGAP, however it may also have a limited function downstream. MEKKl has been shown to bind Ras in a GTP-dependent manner and is activated in response to activated Ras, however it is not clear whether it has a role as a Ras effector. The other effectors, highlighted in bold, are discussed in the text. Chapter One - Introduction

1.2.10 PI 3-kinase and its role as a Ras effector

PI 3-kinase was first discovered as an activity associated with the viral oncoproteins, v- Src and polyoma middle T antigen. They comprise a family of related proteins and are thought to be important in a wide range of biological activities, including control of proliferation (Vanhaesebroeck et al., 1996). This may involve PI 3-kinase activation of p-yQseidnasc (^hung ct üL, 1994; Monfar et al., 1995). PI 3-kinases have also been demonstrated to cause cytoskeletal organisation through activation of the Rho family of GTPases (Kotani e ta l, 1994; Rodriguez-Viciana et al., 1997; Wennstrom et al., 1994a; Wennstrom et al., 1994b). PI 3-kinase is also involved in the prevention of cell death by apoptosis by the activation of AKT/PKB, which directly phosphorylates the pro-apoptotic Bcl-2 family member. Bad, and therefore couples this signalling pathway to the death machinery (Dattaeta l, 1997; Dudek etal., 1997; Franke et al., 1997; Kauffmann-Zeh et al, 1997; Yao and Cooper, 1995; Yao and Cooper, 1996). In addition PI 3 kinase has been demonstrated to have a role in endocytosis and vesicular trafficking (Joly et al., 1995; Joly et al., 1994; Li et al., 1995a; Martys et al., 1996; Shpetner et al., 1996), neurite outgrowth (Kimura et al., 1994) and insulin stimulated glucose transport (Cheathamet al., 1994; Kara et al., 1994; Okada et al., 1994). Mutations within PI 3- kinase have also been shown to increase lifespan in C.elegans (Morris et al., 1996). Furthermore, a PI 3 kinase has recently been shown to be a retrovirally-encoded oncogene in avian sarcoma virus 16 (Chang et al., 1997) and an activated form of PI 3- kinase has been cloned from an induced murine lymphoma (Jimenez et al., 1998).

The PI 3-kinase family is divided into classes; the most studied, and the one discussed here is Class lA (Fruman et al., 1998). Class lA PI 3-kinases phosphorylate phosphoinositide phospholipids on the free 3-position, and can phosphorylate, Ptdlns, Ptdlns 4-P, Ptdlns 4,5-P^ and Ptdlns 5-P in vitro . Activation of PI 3-kinases in vivo however appears to mainly produce Ptdlns 3,4-Pj and Ptdlns 3,4,5-P^ (Fruman et al., 1998; Stephens et al., 1991). These proteins comprise of a catalytic subunit of 110-120 kDa and a regulatory subunit. The three mammalian catalytic subunits in this class are referred to as pi 10a, pllOp and pi 108. They interact with their regulatory subunits through their amino-terminal domains and have a carboxy-terminal catalytic domain. The regulatory subunits are called p85a, p85p, p55a, p55y and p50a (the final three proteins are splice variants of p85a) and are generally termed the p85 subunit. p85a and p85f contain an SH3 domain in their amino terminus, then a proline rich region and a region of homology to Rho-GAPs . The carboxy terminus contains the pi 10 binding region (referred to as the inter-SH2 domain) flanked by two SH2 domains. The splice variants still contain the carboxy-terminal domain but are lacking the amino-terminal domains including the Rho-GAP-like domain (Fruman etal., 1998).

41 Chapter One - Introduction

1.2.10.1 Activation of PI 3~kinase

PI 3-kinase activity is regulated by several mechanisms. Direct phosphorylation of the catalytic pllO subunit is necessary for its kinase activity and serine phosphorylation of p85 causes inhibition of PI 3-kinase activity, and tyrosine phosphorylation of p85 also occurs (Carpenter et ai, 1993; Dhand et aL, 1994; Kavanaugh et al., 1994). Activation is also mediated through interaction with a variety of signalling proteins. For example many growth factor receptors activate PI 3-kinase directly. Growth factors stimulate autophosphorylation of tyrosine residues within the intracellular domain of their receptors which create a specific binding site recognised by the SH2 domains of the p85 subunit. Binding of PI 3-kinase to the receptor causes an increase in PI 3-kinase activity probably because it is brought into the vicinity of its lipid substrates. This can be blocked by mutation of these phosphotyrosines (Vanhaesebroeck et al., 1996). PI 3-kinase is also regulated by and associated with non-receptor tyrosine kinases, v-src, v-abl, Ick, fyn and lyn in response to cellular activators that stimulate these enzymes. They are thought to bind the proline rich region of p85 through their SH3 domains (Kapeller and Cantley, 1994). PI 3-kinase activity is also activated by cell attachment to extracellular matrix (ECM) which may be an important survival signal. Adhesion-mediated activation of PI 3- kinase is thought to be via integrin activation of focal adhesion kinase (FAK). Autophosphoiylated FAK has been shown to bind the p85 subunit of PI 3-kinase and activate PI 3-kinase activity (Chen etal., 1996a). p85a also binds to Cdc42 and Racl in vitro and exogenous Rac and Cdc42 can increase PI 3-kinase activity in vitro (Zheng et al., 1994). However, in contrast, another group has demonstrated that Rac and Cdc42 are unable to stimulate PI 3-kinase activity, while Ras is able (Rodriguez-Viciana et al., 1994). In addition, PI 3-kinase has been shown to be activated by direct interaction of the pi 10 subunit with GTP bound Ras which also locates it to the plasma membrane (Rodriguez-Viciana et al., 1994).

1.2.10.2 PI 3-kinase, a Ras effector

Several lines of evidence support the case for PI 3-kinase as an effector of Ras. Firstly, the pi 10 subunit of PI 3-kinase interacts directly with the effector domain of Ras-GTP in vitro and in vivo. (Rodriguez-Viciana et al., 1994). Secondly, transfection of Ras, but not activated Raf, upregulates the cellular levels of 3' phosphorylated phosphatidylinositols (the products of PI 3-kinase phosphorylation) and co-transfection of the pi 10 and p85 subunits of PI 3-kinase with Ras increases 3' phosphorylated phosphatidylinositol production above that with Ras alone. Moreover, a dominant negative Ras mutant is able to attenuate the production of 3' phosphorylated phosphatidylinositols in response to growth factors (Rodriguez-Viciana et al., 1994). This implies that Ras is important for growth factor stimulation of PI 3-kinase activity.

42 Chapter One - Introduction

The remaining ability of growth factors to stimulate PI 3-kinase activity in the presence of RasNlT indicates that there are alternative pathways for activation. Thirdly, prenylated Ras has been shown to directly induce PI 3-kinase activity in an in vitro liposome reconstitution system (Rodriguez-Viciana etal., 1996). This implies that the role of Ras in PI 3-kinase activation may be to localise PI 3-kinase to the plasma membrane and bring it in contact with its lipid substrate.

Finally, several experiments have shown that PI 3-kinase is an important component of Ras transformation. Firstly, a mutant of the p85 subunit that acts in a dominant negative manner, suppresses the ability of Ras^'\ but not v-Src, to form foci and colonies in soft agar (Rodriguez-Viciana et al., 1997). Secondly, PI 3-kinase has been shown to co­ operate with activated Raf to cause focus formation. Thirdly, co-expression of H- Ras^'^^"*°, which is able to bind PI 3-kinase, but not Raf-1, and H-Ras^'^^^\ which has the reciprocal binding properties, results in synergistic focus formation. The same is true when one Ras effector mutant is co-expressed with the reciprocal effector (Rodriguez- Viciana et al., 1997).

1.2.10.3 PI 3-kinase regulation of the cell cycle

A requirement for PI 3-kinase activity for stimulation of DNA synthesis by serum and specific mitogens has been suggested by a variety of experiments. Firstly, platelet derived growth factor (PDGF) stimulated DNA synthesis is reported to be dependent on PI 3-kinase because PDGF receptor mutants that no longer bind PI 3-kinase are unable to respond mitogenically to PDGF in human hepatoma and canine kidney epithelial cells (Valius and Kazlauskas, 1993). However it should be borne in mind that these sites may be used by other signalling molecules. Secondly, microinjected antibodies specific for pi 10a and inhibitory to PI 3-kinase function, prevent PDGF and epidermal growth factor (EGF) stimulation of DNA synthesis in 3T3 fibroblasts. However this is not true for all growth factors, since colony stimulating factor- 1 , bombesin and lysophosphatidic acid are able to stimulate DNA synthesis in a PI 3-kinase independent manner (Roche et a l, 1994). Thirdly, insulin stimulated DNA synthesis is inhibited by microinjection of the SH2 domain of the p85 subunit of PI 3-kinase, which acts in a dominant negative fashion (Jhun et al., 1994). Finally, a specific inhibitor of PI 3-kinase, LY 294002 inhibits serum stimulation of DNA synthesis in 3T3-L1 adipocytes (Cheatham et a l, 1994).

PI 3-kinase activity is also able to stimulate DNA synthesis. For example constitutively activated PI 3-kinase in 3T3-L1 adipocytes stimulates mitogen independent DNA synthesis (Frevert and Kahn, 1997). Also microinjection of a PI 3-kinase activating antibody stimulates DNA synthesis in quiescent Chinese hamster ovary cells, however this activation appears to be dependent on Ras since it is partly inhibited by anti-Ras

43 Chapter One - Introduction antibodies (McHroy et al, 1997). Thus PI 3-kinase is a strong candidate as a Ras effector and appears to have an important role in cell cycle progression.

1,2.10.4 Downstream targets of PI 3-kinase

1.2.10.4.1 Akt/PKB and its role in cell survival

PI 3-kinase has been shown to be necessary and sufficient for activation of Akt/PKB (also occasionally referred to as RAC, related to A and Ç kinases) by growth factors. Akt/PKB has been demonstrated to have an important role in cell survival, through direct interaction with and subsequent inhibition of Bad, a protein that inhibits activation of the survival factor Bcl-2 (Datta et a l, 1997; del Peso et a l, 1997; Downward, 1998). Akt/PKB is thought to be activated by PDKl which has been shown to phosphorylate its activation loop. PDK-1 is activated by a lipid product of PI 3-kinase activity, PI(3,4,5)Pj (Alessi and Cohen, 1998). Thus PI 3-kinase activation can directly influence and promote cell survival. The significance of AKT in the regulation of cell growth and survival is emphasised by the amplification of Akt2/PKBp in 12% of ovarian carcinomas, 3% of breast carcinomas and 10% of pancreatic carcinomas (Downward, 1998). Akt/PKB can also be activated in responses to cellular stresses of the type that activate the JNK and p38 MAP kinase cascades by a wortmannin insensitive pathway which implies that activation is independent of PI 3-kinase . The mechanism by which this occurs is unknown.

Other functions of Akt/PKB include the induction of protein synthesis through activation of p70S6kinase; the activation of glycogen synthesis through inactivation of glycogen synthase kinase-3 (GSK-3) which is also implicated in a variety of other intracellular signalling pathways including control of API and Creb transcription factors and regulation of APC; the induction of glycolysis through 6-phosphofructo-2-kinase (PFK-

2 ) and finally transducing the metabolic effects of insulin such as stimulation of glucose uptake and GLUT4 translocation.

1.2.10.4.2 Other downstream targets

PI 3-kinase activity is also required upstream of the Rho family small GTPase, Rac to promote Rac-mediated membrane ruffling, by growth factors or activated Ras, since it can be inhibited by specific inhibitors or dominant negative mutants of PI 3-kinase (Wennstrom gr a l, 1994a; Rodriguez-Viciana et a l, 1997). However, the role of PI 3- kinase in Rac activation is not clear since a constitutively activated PI 3-kinase mutant was only able to reproduce the effects on the cytoskeleton, but not Rac and Rho-regulated gene transcription from the serum response element (SRE) or the transcription factors Elkl and AP-1 (Reif et al, 1996). This may mean that PI 3-kinase is required to mediate downstream effects of Rac, but is not involved in direct activation of Rac itself.

44 Chapter One - Introduction

In addition to being implicated as a Ras effector, PI 3-kinase may also have a function upstream of Ras. A constitutively active pi 10 subunit was able to stimulate transcription from the c-fos promoter which was sensitive to inhibition by a dominant negative Ras mutant and furthermore increased the levels of Ras-GTP and Raf activation when expressed in Xenopus oocytes, as well as stimulating oocyte maturation (Hu et al., 1995b). Furthermore, antibodies that specifically activate PI 3-kinase activity and stimulate DNA synthesis can be blocked by dominant negative Ras mutants (McHroy et a l, 1997).

PI 3-kinase also activates . The ability of the PI 3-kinase antibodies described above to induce DNA synthesis is also blocked by anti-p70^^‘“"“® antibodies or rapamycin (McDroy et a l, 1997). Both Akt/PKB and Rac have demonstrated ability to activate p'7 QS6 kinase (jownstream of PI 3-kinase (Welch et a l, 1998). is thought to have an important role in progression through the G 1 phase of the cell cycle, because inhibition of the protein with rapamycin, causes cells to accumulate in G1 (Grammer et a l, 1996). pYQSôkinase ^ctivation can also be mediated by PKCs independently of PI 3-kinase (Chung e ta l, 1994).

PI 3-kinase also appears to mediate growth factor activation of PKCX and PKCe, possibly through 3 'phosphoinositol dependent kinase (PDK) 1, since their activation by EGF or platelet-derived growth factor (PDGF) is inhibited by wortmannin and a dominant negative PI 3-kinase mutant (Akimoto et al, 1996; Moriya et al, 1996).

1.2.11 Ral-GEFs and their roles as Ras effectors

The Ral-GEF family currently consists of five members, Ral-GDP dissociation stimulator (Ral-GDS), Ral-GDS like factor (Rif), Ral-GDS-like (RGL), RGL2 and Ral-GDS related (Rgr) (Albright eta l, 1993; DAdamo e ta l, 1997; Kikuchi et a l, 1994; Peterson eta l, 1996; Wolthuis eta l, 1996). These proteins act as nucleotide exchange factors for the Ras related, Ral family of small GTPases. Ral proteins, like Ras, are found exclusively in the membrane fraction of cells and are found mostly in endocytic and exocytic vesicles (Bielinski et al, 1993; Volknandt et al, 1993).

Ral-GDS, Rif and RGL2 have been shown to interact with Ras in a GTP-dependent fashion both in vitro and in vivo (Hofer et al, 1994; Kikuchiet al, 1994; Peterson et al, 1996; Spaargaren and Bischoff, 1994; Wolthuis et a l, 1996). Ral-GDS, Rif and RGL increase the amount of Ral-GTP in cells by stimulating Ral GDP/GTP exchange activity. This exchange activity is upregulated by co-transfection of activated Ras implying that Ras has a role in Ral-GEF activation (Murai et a l, 1997; Urano et a l, 1996). This is further evident because dominant negative Ras mutants inhibit Ral activation by growth factors (Wolthuis et a l, 1997). Rif availability appears to be rate limiting for Ras

45 Chapter One - Introduction activation of the c-fos promoter upon transient transfection since Rif is unable to activate it alone, but increases c-fos promoter activity induced by Ras"^*^. A role for both Ral-GEFs and Raf downstream of Ras in c-fos promoter activation is supported by two observations. Firstly, a dominant negative mutant of Ral (which is believed to compete out Ral-GEFs) or the MEK inhibitor PD 98059, partially inhibit Ras activation of the c- fos promoter. (Wolthuis et al., 1997). Secondly, in co-transfection experiments RGL and RafCAAX co-operate to activate the c-fos promoter to a similar degree to Ras^^^ while they have a meagre effect when transfected individually (Murai et al., 1997). It also appears that Ral-GEFs have a role in Ras transforming potential. A dominant negative mutant of Ral inhibits the focus forming ability of Ras^’^ (Urano et al., 1996). Furthermore expression of RalGDS, activated Ral or a Ras effector mutant (Ras^*^^^’) that specifically interacts with Ral-GDS, is able to enhance the focus forming abihty of v- Raf and Ras^'^ (Urano et al., 1996; Whiteet al., 1996). Thus there is a convincing case for Ral-GEFs as necessary Ras effectors.

Rif has also been implicated in mitogenesis because an activated form of Rif, Rif CAAX, is able to stimulate colony formation in low mitogen conditions in NIH 3T3 cells (Wolthuis et al., 1997). It is thought that Ral may be the mediator of Ral-GEF signalling, however this is not yet thoroughly established. The function of Ral proteins is largely unknown. Putative downstream targets of Ral are Phospholipase D which been shown to bind Ral via its amino-terminus (Jiang et al., 1995b) and Ral interacting protein 1 (RLIP76) (also known as Ral interacting protein 1 (RIP) and Ral binding protein l(RalBPl)) which is believed to act as a GAP to the Rho family GTPases, Cdc42 and Rac (Cantor et al., 1995; Jullien-Flores et al., 1995; Park and Weinberg, 1995). This interaction could potentially link the Ras and Rho family mediated pathways.

1 ,2 .1 1 .1 as a Ras effector

The RasGAP, p i20^^^ was the first candidate Ras effector identified. It was shown to bind to the Ras effector domain in a GTP-dependent manner of both wild type and oncogenic Ras. Mutations in the effector domain also inhibited binding (Adari et al., 1988; Cales, 1988). p i20^^^ became implicated as a Ras effector because it was able to reproduce the effects of Ras in inhibiting muscarinic potassium channel currents in an in vitro system. This was dependent on its amino-terminal SH2 and SH3 domains which were sufficient for these effects, in the absence of the Ras binding domain (Martin et al., 1992). Furthermore, an amino-terminal fragment of pl20^'^^ was also shown to stimulate transcription from the c-fos promoter, however, this effect was dependent on Ras function, suggesting that it co-operated with other Ras effectors to stimulate this effect, however whether Ras activation, or an alternative activator of p i20°^’’ is required for activation of c-fos promoter transcription is not clear (Medema et al., 1992). In contrast,

46 Chapter One - Introduction

overexpression of an amino terminal fragment of p i 2 0 °'^'’, has also been shown to interfere with Ras effects in mammalian cells. For example, it inhibited the transforming activity of oncogenic Ras, but not Raf (Clark et al., 1993); it blocked Ras activation of JNK, but not ERKs (Clark et al., 1997c), and it also interfered with cytoskeletal organisation (McGlade et al., 1993). Thus possibly the amino terminus of p i20°^^ mediates multiple functions which are differentially affected by overexpression of this fragment. Furthermore, certain Ras-mediated effects in Xenopus have been reported to be dependent on p i20^^^. The use of blocking peptides has demonstrated that the SH3 domain of p i20°^^ was essential for Ras-mediated germinal vesicle breakdown (GVBD) (Duchesne et al., 1993). Moreover, inhibition of the SH3 domain of pl20'^'^^ with a monoclonal antibody prevented Ras activation of Cdc2 and expression of c-mos, but not ERK (Pomerance et al., 1996). However, certain mutations in the effector domain of Ras were found that impaired p i20°^'' binding but did not reduce Ras focus forming ability. This indicated that p i20°'^’’ signalling was not necessary for Ras transforming activity (Marshall and Hettich, 1993). Thus p i20^'^’’ may be required for some Ras-mediated effects. However the mechanism by which it exerts these effects is not yet clear. This may involve p i90'^^°^^'’ or another phosphoprotein that interacts with the amino terminus, p62. Furthermore, the function of pl20^^'' downstream signalling in mammalian cells is not known.

1.2.11.2 Mediation of Ras effects by Ras effector pathways

Activation of Ras affects many cellular processes, many of which have been discussed above. Some of these processes can be induced by one Ras effector-mediated pathway and others require collaboration between two or more. The need for multiple Ras effector pathways to induce cellular transformation has been discussed above (Joneson et a l, 1996b; Whiteet al., 1995). Effector pathways from Ras have contrasting roles in their response to c-myc induced apoptosis in Rati fibroblasts. Ras^'^ enhances c-myc induced apoptosis. Ras effector domain mutants, and activated Raf mutants demonstrated that this is caused by the Raf activated effector pathway. In contrast, activation of a constitutively activated pi 10 subunit of PI 3-kinase, or the Ras'^'^^'^° effector domain mutant that activates PI 3-kinase activity provides protection from c-myc induced apoptosis (Kauffmann-Zeh etal., 1997), Thus cellular responses to Ras effector pathways can be very different and in order to see the protective effect of Ras in these cells it was necessary to prevent activation of Raf. This raises the question, can the cell preferentially activate one Ras effector pathway over another? One group has demonstrated a mechanism by which this may occur. Endothelin-1 (ET-1) induces Ras activation in rat glomerular mesangial cells through activation of a G-protein coupled receptor and subsequent coupling of She and Grb2 to the RasGEF, Sos. Addition of ET-1 to these

47 Chapter One - Introduction cells induces two separate peaks of Ras activation. The first peak begins 2 min after ET-1 addition and drops to background levels after 15 min because of a negative feedback mechanism in which ERK phosphorylates Sos. The first Ras peak directly correlates with stimulation of ERK activity and relatively weak PI 3-kinase activity, both of which drop to back background levels. The second peak occurs at around 30 min, when Sos has reverted to a non-phosphorylated form. This induces a high level of PI 3-kinase activity, but no ERK activation. The reason for the inactivity of ERK is thought to be due to the upregulation of the ERK phosphatase, MKPl, which begins 30 min after ET-1 stimulation (Foschi et al., 1997). Thus differential activation of Ras effector pathways can be achieved and one mechanism by which this occurs is by the induction of regulatory proteins that are specific to a single pathway.

Another mechanism that may be used to differentiate between Ras effectors is through one effector having preferential binding affinity for Ras over another. This has been shown to occur between Raf and Ral-GDS. PKA phosphorylates both proteins, however, PKA phosphorylation of Raf, reduces its affinity for Ras, but does not affect the affinity of Ral-GDS. Furthermore, the addition of forskolin to cells (which upregulates PKA activity and downregulates Raf activity), increases ectopic Ral-GDS association with endogenous Ras in response to Ras activation by EGF, suggesting that Ral-GDS is preferentially binding Ras over Raf (Kikuchi and Williams, 1996).

Therefore it appears that another level of control of Ras-mediated effects derives from factors which do not directly influence Ras activation, but affect the availability of its downstream targets thus influencing the specificity of Ras signalling.

48 Chapter One - Introduction

1.3 Rac and Rho~family proteins

1.3.1 Background

Rac is a member of the Ras superfamily of small GTPases. Specifically it is a member of the Rho (Ras homologous) subfamily which have around 55% amino acid identity to each other. Three Rac proteins have so far been identified, Racl, 2 and 3 (see Table 1). This overview will concentrate on Racl, however other Rho family GTPases, especially RhoA and Cdc42, are also relevant to Rac function and so will also be discussed.

After identification as homologues of Ras, the Rho family of GTPases were found to be involved in cytoskeletal reorganisation, through control of actin. Activation of Rho family members can cause profound changes to the actin cytoskeleton in certain cell- types. The cytoskeletal changes are different for Racl, RhoA and Cdc42 and have contributed to the growing understanding of the upstream activation and downstream targets of the Rho family. Activation of Rac causes formation of lamellipodia. Lamellipodia are actin sheets that protrude from the edges of cultured fibroblasts and many motile cells. When lamellipodia fold back on themselves they form membrane ruffles. Inhibition of growth factor signalling using dominant negative Racl mutants prevents lamellipodia formation (Ridley et al., 1992). Activation of Cdc42 forms filopodia. These are protruding spikes formed by the extension of a tight bundle of actin filaments in the direction of the protrusion. Activation of RhoA causes actin stress fibre formation. Stress fibres are bundles of actin filaments that traverse the cell and terminate in focal adhesions that are complexes which adhere to the extracellular matrix (ECM). Racl and Cdc42 also stimulate production of distinct integrin-containing complexes, however these are morphologically distinct from focal adhesions formed by RhoA and are termed focal complexes (Hotchin and Hall, 1996).

Rho GTPases also have roles in transcriptional regulation, cell growth control, membrane trafficking and development (Van Aelst, 1997).

1.3.2 Activation of Rho GTPases

Like Ras, Rho family proteins act as molecular switches. They are active when in a GTP bound conformation, and inactivated after GTP hydrolysis. This reaction is regulated by RhoGEFs, RhoGAPs and RhoGDIs (GDP dissociation inhibitors).

1.3.2.1 RhoGEFs

Multiple proteins have been found to act as exchange factors that activate Rho GTPases by exchanging GDP for GTP. Table 2 lists the known RhoGEFs. Most RhoGEFs are

49 Chapter One - Introduction oncogenic and they share two features. Firstly they have a Dbl homology (DH) domain. Deletion analysis has shown that this region is necessary and sufficient for exchange activity in vitro(Hait et aL, 1991a; Ron et al., 1991). It is also necessary for the oncogenicity of RhoGEFs in vivo (Hart et al., 1994). Secondly, in each RhoGEF, the DH domain is followed by a pleckstrin homology (PH) domain. This region has been shown to be necessary for subcellular localisation of GEFs in vivo (Zheng et at., 1996b).

The guanosine exchange activity of Vav is activated by tyrosine phosphorylation, probably by the Src family tyrosine kinase, Lck. It is unclear however, whether this is a general mechanism of activation for RhoGEFs (Crespo et al, 1997; Han et al., 1997).

In addition to these shared domains, RhoGEFs also contain other regulatory domains, such as catalytic, protein-protein interaction, and protein-lipid interaction domains, these may mediate upstream or downstream regulatory mechanisms. Of note is that Sos, which was originally identified as a RasGEF, has a DH domain distinct from its RasGEF domain, which specifically displays GEF activity towards Racl. This may provide a hnk between Ras and Rac signalling pathways (Nimnual et al., 1998). The substrate specificity of RhoGEFs varies between family members. For example Vav has exchange activity towards RhoA, Racl and Cdc42, whereas Tiaml is specific for Racl (Crespo et al., 1997; Habets et al., 1994; Han et al., 1997). The specificity of cellular responses may be regulated by differential activation of RhoGEFs leading to distinct patterns of activation of Rho family members. Table 2 RhoGEFs Rho Substrate Biological properties Reference GEF specificity Dbl Cdc42, RhoA oncogenic, implicated in (Hart et al., 1991b) Ewings sarcoma Lbc RhoA oncogenic (Zheng et al., 1995) Lfc RhoA oncogenic (Glaven et al., 1996) GEF-Hl Racl, RhoA co-localises with (Ren et al., 1998) microtubules Lsc RhoA oncogenic (Glaven etal., 1996) Tiaml Racl metastatic and oncogenic (Habets etal., 1994) Vav Racl, RhoA, oncogenic, implicated in (Crespo et al., 1997; Han Cdc42 lymphocytic proliferation et al., 1997) and lymphopenia FGDl Cdc42 implicated in faciogenital (Olson etal., 1996; dysplasia Zheng et al., 1996a) Trio Racl, RhoA cell migration ? (Debant et al., 1996) Ost RhoA, Cdc42 oncogenic (Horii etal., 1994) (binds to GTP-

50 Chapter One - Introduction

Racl) Bcr Racl, RhoA, implicated in leukaemia (Chuang etal., 1995) Cdc42 (GAP for Racl) Abr Racl, RhoA, 7 (Chuang et a l, 1995) Cdc42 (GAP for Racl and Cdc42) Sos Racl oncogenic, RasGEF (Nimnual et al., 1998) pllSRhoGEF RhoA oncogenic, also GAP for (Hart et al., 1998; Hart et small G proteins: G„12 al., 1996; Kozasa etal., and G„13 1998) PIX Racl? binds to PAK (Manser et al., 1998) Dbs Cdc42, RhoA (Whitehead e/a/., 1997) mNETl RhoA oncogenic (Alberts and Treisman, 1998)

1,3.2.2 RhoGAPs

The Rho family is negatively regulated by GTPase activating proteins (GAPs). The RhoGAP domain bears no similarity to the RasGAP domain. Proteins that contain a RhoGAP domain are listed in Table 1.3. Substrate specificity of RhoGAPs is also variable; the GAP domain of Bcr is able to increase GTPase activity of Racl, but not RhoA in vitro, and if microinjected into cells can prevent Racl-mediated membrane ruffling, but not RhoA-mediated stress fibre formation. Alternatively, p i90^^^ preferentially stimulates GTP hydrolysis on RhoA and RhoA-mediated stress fibre formation (Ridley et ai, 1993). Interestingly, p i90^^’’ is found complexed with the RasGAP, p i20^^^, in Src transformed or growth factor stimulated cells (Settleman et a i, 1992). This may formulate another link between Ras and Rho pathways since the interaction makes the SH3 domain of p i20'^'^*’ more accessible to interacting proteins (Hu and Settleman, 1997). In addition, the Ral target, RalBPl, which acts as a GAP towards Cdc42 and Rac, may be regulated by Ras, through RalGEF activity (Wolthuis et al., 1998).

It is also likely that some RacGAPs act as Rac effector proteins. For example, N- and p- chimerin act as GAPs specific for Rac and microinjection of their GAP domains inhibits Racl-mediated lamellipodia formation (Diekmann et a i, 1991; Leung et al., 1993). However, microinjection of the full length N-chimerin induces lamellipodia and filopodia formation in fibroblasts and neuroblastoma cells. This is dependent on N-chimerin's ability to bind Racl and Cdc42, but not on GAP activity. Such actin reorganisation is inhibited by dominant negative mutants of Racl and Cdc42 (Kozma et al., 1996), which implies that N-chimerin is involved in mediating Rac and Cdc42 downstream signals.

51 Chapter One - Introduction

Table 1.3 RhoGAPs

R hoG A P s Target Specificity References p^QRhoGAP preferentially Cdc42, but also (Barfod et al., 1993; RhoA and Racl Lancaster et al., 1994) Bcr preferentially Racl, but also (Diekmann etal., 1991) Cdc42 Abr Racl, Cdc42 (Tan etal., 1993) N-Chimerin Racl (Diekmann eta l, 1991) p-Chimerin Racl (Leung etal., 1993) pl90°A'' preferentially RhoA, but also (Settleman ef a/., 1992) Racl, Cdc42 p l 2 2 RhoA (Homma and Emori, 1995) Myr5 preferentially RhoA, but also (Reinhard f f a/., 1995) Cdc42 RalBPl/RLIP76/RIPl preferentially Cdc42, but also (Cantor et al., 1995; Jullien- Racl Flores et a l, 1995; Park and Weinberg, 1995) Graf RhoA, Cdc42 (Hildebrand et al., 1996) 3BP-1 Racl, Cdc42 (Cicchetti etal., 1995)

1.3.2.3 RhoGDIs

The Rho family has an additional family of negative regulators, that Ras proteins do not have. These are termed Rho GDP dissociation inhibitors (RhoGDIs) and comprise RhoGDI, D4-GDI (LY-GDI) and RhoGDIy. In vivo, microinjection of RhoGDI is able to inhibit Racl and RhoA-mediated, insulin- and hepatocyte growth factor (HGF)- induced membrane ruffling (Nishiyama et al., 1994).

These proteins preferentially bind to the GDP-bound form of the Rho protein and prevent dissociation with the GDP, thus preventing reactivation of the protein (Abo et a l, 1991; Adra et at., 1997; Fukumoto et al., 1990; Delias et al., 1993; Leonard et al., 1992; Scherleet al., 1993; Ueda et al., 1990). RhoGDIs are located in the cytoplasm and are able to relocate Rho proteins from the plasma membrane into the cytoplasm, possibly by binding their carboxy terminal isoprene (Gosser et al, 1997). RhoGDIs also bind GTP- bound Rho proteins and inhibit GAP-mediated and intrinsic GTP hydrolysis keeping them inactive, probably by preventing them from forming their active transition state. This is especially important in the case of Racl which has an intrinsic GTPase activity fifty times that of RhoA or Ras (Chuang et al., 1993b; Hancock and Hall, 1993; Hart et al., 1992).

A region of Rho family proteins is not found in other Ras-like proteins and is termed the Rho insert region. In Cdc42, deletion analysis has shown that this region is dispensable

52 Chapter One - Introduction for RhoGEF and RhoGAP activity and for RhoGDI binding and relocalisation, however it is necessary for the GDI to inhibit GTP hydrolysis and GDP dissociation (Wu et al., 1997).

1,3.2.4 Indirect regulators of Rho GTPases

Another family of proteins which may regulate Rho family activation, is the ERM (ezrin, radixin, moesin) family. Although RhoGEFs can activate Rho GTPases, they are unable to disrupt Rho-RhoGDI complexes. This implies that another factor is involved in Rho activation. Radixin (and other members of the ERM family) has been shown to interact separately with both the RhoGEF, Dbl and RhoGDI. It has been shown to reduce the inhibitory activity of RhoGDI (Takahashi et at., 1998; Takahashiet al, 1997). Thus, the ERM family may regulate Rho proteins by recmiting other regulatory proteins to Rho. Furthermore, ERM proteins were identified as the cytosolic activity that permitted activated RhoA to form stress fibres in permeabilised and extracted Swiss 3T3 cells (Mackay et al, 1997). In addition, the proposed role of ERM proteins in Rho regulation is substantiated by the observation that ERM proteins also bind actin (Martin et at., 1995b).

Biologically active lipids, such as arachidonic acid, phosphatidic acid and phosphatidylinositols, have also been shown to dissociate Rac-RhoGDI complexes, with GTP-Rac-RhoGDI being more sensitive to disruption (Chuang et al., 1993a). This suggests a further level of Rac regulation since the production of lipid second messengers can be mediated by many factors (Carpenter et al., 1991).

1.3.3 Upstream activation of Rac and the Rho family

Rho family proteins can be activated by many upstream elements, although how these signals are relayed to the Rho proteins remains unclear at present. Signals activating Rho family GTPases can be transmitted through seven transmembrane receptors, RTKs and integrin receptors. Figure 1.8 gives a summary of upstream activators and downstream effects. Insulin, PDGF, bombesin and phorbol ester (phorbol 12-myristate 13-acetate (PMA)) are able to induce lamellipodia formation. This is inhibited by a dominant negative Racl mutant, indicating that these compounds signal to the actin cytoskeleton through Rac (Ridley et al., 1992). The same is true of activated Ras which is also dependent on Rac to trigger lamellipodia formation (Ridley et ai, 1992).

53 PDGF (insulin Bradykinin bombesin LPA (CSF)I PMA) Fibronectin (bombesin) SR Ir™ IR

Gal 3 ( R a s V ^ “ ► ? ! 3-kinase

P I P 2 *

Tyrosine kinase

Vav RacGAP? pll5Rho6EF

C d c42 ► (R h o A leukotrienes? I I T V T Filopodia Lamellipodia Stress fibres focal complexes membrane ruffles Focal contacts focal complexes

Figure 1.8 Upstream signalling to Rho family members and their effect on the cytoskeleton The signalling pathways are activated by ligand-stimulated G-protein coupled receptors (SR), receptor tyrosine kinases (RTK) and integrin receptors (IR). GEFs are shown in green, kinases are shown in red and GTPases in yellow. Direct interactions are shown as unbroken arrows and indirect activation as dashed arrows. Shown as a blue arrow is phosphorylation of phosphatidylinositol 4,5 biphosphate (PIP2 ) by PI 3-kinase to PI

(3,4,5)Pg (PIP3 ). Interaction of Gal 3 and pi 1 SR^ogef has recently been shown to stimu­ late its GEF activity towards RhoA. Furthermore, activation of stress fibres by LPA is sensitive to inhibitors of tyrosine phosphorylation, eg tyrophostin. Other interactions are described in the text. Chapter One - Introduction

The ability of mitogens and Ras to activate Rac appears to be partly mediated by PI 3- kinase. PDGF activates Racl by Wortmannin sensitive and insensitive mechanisms. The PDGF-induced increase in the amount of Rac-GTP is blocked by the PI 3-kinase inhibitor wortmannin, whereas the decrease in GTPase activity is independent of PI 3-kinase inhibition (Hawkins eta l, 1995). Nevertheless, the effects on the actin cytoskeleton by PDGF, IGF-1 and insulin, (but not bombesin, EGF and PMA), are inhibited by Wortmannin (Kotani et al., 1994; Nobes et a l, 1995; Wennstrom et al., 1994a). Furthermore, dominant negative forms of PI 3-kinase completely inhibit R as^'\ PDGF, IGF-1 and insulin stimulated membrane ruffling (Hawkins et a l, 1995; Kotani et a l, 1994; Rodriguez-Viciana et al., 1997). These data indicate that PI 3-kinase has a vital role in mediating activation of Racl and Rac-induced lamellipodia formation by RTKs and Ras, but that Rac activation can also occur by mechanisms independent of PI 3-kinase. Regulation of Rac by PI 3-kinase appears to be mediated by its lipid targets. A PI 3- kinase substrate, PI(4,5)P2, has been shown to inhibit the activity of the RhoGEF, Vav, by inhibiting its activation by the Src family tyrosine kinase, Lck. Conversely, a lipid product of PI 3-kinase activity, PI(3,4,5)P3, upregulates Vav phosphorylation and activation by Lck (Han et al., 1998). Moreover the RasGEF, Sos, has RacGEF activity which is enhanced by the presence of Ras^'^ and Ras^'^^"^*^ (the effector domain mutant that binds PI 3-kinase, but not RalGEFs or Raf), but not Ras^'^^^^ (which does not bind PI 3-kinase). This suggests that Ras may regulate Sos activation of Racl and that this may involve PI 3-kinase (Nimnual et al, 1998). However, Ras has been demonstrated to stimulate Rac-mediated transcriptional activation independently of the PI 3-kinase inhibitor LY 294002 in T lymphocytes, indicating that activation of Rac by Ras can occur independently of PI 3-kinase activity (Genot et al., 1996; Genot et al., 1998). Wortmannin does not prevent filopodia formation by Cdc42, nor stress fibre formation by RhoA (Nobes and Hall, 1995; Nobes et al, 1995) indicating that the involvement of PI 3- kinase may be distinct to Rac activation.

In addition to external stimuli, Cdc42 is able to activate Racl, and Racl is able to activate RhoA. Stimulation of Cdc42 signalling, using Bradykinin or Cdc42^^^, leads firstly to filopodia formation, and subsequently to lamellipodia formation. The formation of lamellipodia is prevented by the expression of a dominant negative Rac mutant (Nobes and Hall, 1995). Activation of Rho by Rac, may involve Rac-mediated induction of aracadonic acid and its metabolites, leukotrienes, since these are required for Rac- mediated EGF induction of Rho dependent stress fibres (Peppelenbosch et al., 1995). This cascade of activation of the Rho GTPases does not activate all Rho GTPase effects. For example, transcriptional activation from the SRE by Rac and Cdc42 is independent of Rho (Hill eta l, 1995).

55 Chapter One - Introduction

Thus Rho GTPases appear to be a point of convergence for many distinct upstream signals.

1.3.4 Rho GTPases in integrin signalling

Racl, RhoA and Cdc42 also regulate the assembly of integrin-containing complexes at the plasma membrane, which link the actin cytoskeleton to the ECM. In addition to containing proteins with structural functions, the adhesion complexes also contain putative signalling proteins such as Src and focal adhesion kinase (FAK). Integrin ligation to ECM proteins is essential for cell cycle progression (Giancotti, 1997). Integrins are known to signal to the Raf-MEKl-ERK pathway, and Rho GTPases appear to be involved in mediating this link. For example, ERK becomes activated when NIH 3T3 cells are plated on fibronectin, an integrin ligand. This is mediated by Rho since activation of ERK is sensitive to a specific inhibitor of Rho, C3 transferase, or dominant negative Rho mutants, and can be partially stimulated by activated mutants of Rho or the RhoGEF, lbc (Renshaw et al., 1996). Fibronectin-mediated activation of Raf-1, MEKl and ERK is also blocked by a dominant negative p85 subunit and the chemical inhibitors, wortmannin and LY294002, demonstrating a dependence on PI 3-kinase function which may implicate Rac-mediated activation of PAK (see Figure 1.9) (King et at., 1997). Furthermore, two RhoGEFs, lbc and dbl, have been demonstrated to relieve the anchorage-dependence but not the requirement for mitogens of murine 3T3 fibroblasts, further implicating Rho as a mediator of integrin signalling (Schwartz et al., 1996). Rac and Cdc42 have also been shown to be necessary for integrin-mediated invasion by mammary epithelial cells and collagenase expression in synovial fibroblasts (Keely et al., 1997; Kheradmand et al., 1998).

1.3.5 Cellular responses to Rac activation

1,3,5.1 Activation of MAP kinase cascades

INK and p38 appear to be major targets for Rho proteins. However, the properties of specific Rho family members vary between cell types. Racl, Rac2 and Cdc42, but not Rho, are able to regulate the activation of INK and p38, but not ERK in Hela, NIH 3T3 and Cos cells. In addition, the oncogenic RhoGEFs, Dbl and Ost, are also able to stimulate JNK activation (Coso et al., 1995; Minden et al., 1995; Olson et al., 1995; Zhang et al., 1995a). Furthermore, dominant interfering mutants of Racl are able to interfere with JNK activation in response to v-Src and EGF in Hela and NIH 3T3 cells respectively (Minden et al., 1995). In Cos cells, interleukin-1 activation of JNK is inhibited by a dominant interfering Cdc42 allele (Bagrodia et al., 1995b). However in human kidney 293T cells, Ras and Rac are unable to activate JNK, but RhoA, B and C and Cdc42 can (Teramoto et al., 1996b).

56 Chapter One - Introduction

1,3.5.2 Rac involvement in ROS-mediated signalling

GTP bound Racl, Rac 2 and Ras have all been demonstrated to increase the cellular levels of reactive oxygen species (ROS) (Finkel, 1998). Racl or Rac2 is required as a component of NADPH oxidase which regulates the oxidative killing mechanisms in human phagocytic neutophils. Racl, in combination with p47’’”°^, p67™°^ and cytochrome b^^g is able to generate super oxide in in vitro recombination assays (Bokoch, 1994).

Furthermore, stimulation of mitogen independent DNA synthesis by activated Ras but not activated Raf, was partially inhibited by a scavenger of oxygen free radicals, N-aceyl-L- cysteine (NAG), indicating ROS are required for DNA synthesis and that generation of ROS by Ras is independent of Raf (Irani et al., 1997). Rac may be the downstream mediator from Ras involved in this response because superoxide production correlates with the ability of Rac to induce DNA synthesis in cell-lines expressing Rac effector domain mutants, whereas it is independent of JNK activation and actin reorganisation. Moreover, inhibition of superoxide with chemical inhibitors inhibits the mitogenic effects of Racl (Joneson and Bar-Sagi, 1998).

1.3.5.3 Transcriptional activation

Rho, Rac and Cdc42 have also been implicated in transcriptional regulation. Rho is required for transcriptional activation by the serum response factor, SRF, in response to LPA, serum and AIF/. Rac and Cdc42 are also able to potentiate SRF-induced transcription in the presence of the Rho inhibitor transferase (Hill and Treisman, 1995). This indicates that, different from regulation of the actin cytoskeleton, Rac and Cdc42 induce SRF-mediated transcription independently of Rho.

In cardiac muscle cells, Rho activity, in addition to ERK and JNK signals, is required for regulation of MEKKl or phenylephrine stimulated transcription from an atrial natriuretic factor (ANF) promoter reporter construct (Thorbum et al, 1997).

Racl, RhoA and Cdc42 are all able to induce NFkB transcriptional activity. NFkB is a nuclear transcription factor which is regulated by being retained in a complex with an inhibitor, IkB, in the cytoplasm. It is released from this complex by phosphorylation of IkB. Activation of NFkB transcriptional activity by TNFa in Cos cells, is dependent on Cdc42 and RhoA. However, it is not inhibited by dominant negative mutants of Rac (Perona et at., 1997). In contrast, in Hela cells, activated Rac and IL-1(3 can induce NFkB activity and Rac^'^ can inhibit the latter. Furthermore, induction of ROS by Rac is necessary for NFkB mediated transcription since it is inhibited by treatment of the cells with antioxidants (Sulciner et al., 1996). In contrast, activation of NFKB-mediated

57 Chapter One - Introduction transcription by UV light is independent of Rho GTPases (Perona et a l, 1997).

Rac mediates changes in cell shape in rabbit synovial fibroblasts. This is stimulated by integrin cx5 and occurs through induction of collagenase-1 gene expression. Stimulation of collagense-1 transcription by Racl is dependent on NFicB-mediated transcription of

IL-1 , which is also sensitive to inhibition by antioxidants (Kheradmand et al.^ 1998).

1.3.5.4 Rac involvement in invasion

The RacGEF, Tiaml, was initially identified as an oncogenic factor that stimulated T lymphoma cells to become invasive in an insertional mutagenesis screen. Transfection of Tiaml mutants induced an invasive phenotype in non-invasive T-lymphomas (Habets et al., 1994). Tiaml also induces membrane ruffling which is inhibited by dominant negative Racl^'^ whereas ruffling is not inhibited by the Rho specific inhibitor, C3 transferase. R acl^'\ but not RhoA^'\ is also able to confer an invasive phenotype on non-invasive T lymphoma cells indicating that these functions of Tiaml are Rac-mediated (Michielset al., 1995). NIH 3T3 cells expressing a deletion mutant of Tiaml encoding the DH/PH domain can stimulate tumours in nude mice, however this region is not sufficient to induce membrane ruffling. Moreover, full length Tiaml is able to induce membrane ruffling, but is unable to stimulate tumour formation (Leeuwen et al., 1997). This indicates that these two properties of Tiaml are independent of each other, but may still function through Rac. In contrast to the observations above, expression of Rac^'^ or Tiaml in MDCK epithelial cells suppresses the invasive phenotype stimulated by Ras^'^, by restoring E-cadherin-mediated cell-cell adhesion (Hordijk et al., 1997). Although this may seem contradictory to the effect of Rac^’^ and Tiaml in T lymphoma cells, in each case, Rac^'^ and Tiaml alter the adhesive properties of the cells, in the former case, by increasing cell-ECM binding and in the latter, by increasing cell-cell interaction.

Ectopic Racl and Cdc42 have also been shown to transform differentiated mammary epithelial cells which demonstrated integrin-dependent polarisation in a three dimensional collagen matrix, into motile and invasive cells (Keely et al., 1997). The use of Rac effector domain mutants, dominant negative SEK/MEK4 mutants and specific chemical inhibitors, indicated that this Rac-mediated increase in motility and invasion is not dependent on the proposed Rac targets, PAK, JNK, PORI, and leukotrienes. However, activated PI 3-kinase was able to reproduce the effects of Rac and Rac-induced invasion is inhibited by the PI 3-kinase inhibitors, wortmannin and LY 294002 (Keely et a l, 1997).

1.3.5.5 Rac involvement in transformation and growth control

The expression of some Rho family members have been shown to be upregulated in response to mitogenic signals. For example, the expression a Rac2 isoform specific to

58 Chapter One - Introduction haemopoietic cells is upregulated in response to T cell activation by phytohaemagglutinin (Reibel et al., 1991). Furthermore, RhoB was identified as an immediate early gene induced by the PDGF and EGF receptors, and the non-RTKs, v-Src and Fps (Jahner and Hunter, 1991). More recently, specific growth enhancing properties have been directly attributed to Rho family members. Rho function was shown to be necessary for serum induced G1 to S-phase transition in Swiss 3T3 cells by the use of the Rho specific inhibitor, C3 transferase (Yamamoto et al., 1993). Similarly, Racl and Cdc42 function were shown to be necessary for serum-induced cell cycle progression from quiescence in Swiss 3T3 cells (Lamarcheeta l, 1996; Olson et al., 1995). Furthermore, Racl, Cdc42 and RhoA and B have been shown to be necessary for transformation by activated Ras. Dominant negative mutants of the Rho family are able to block morphological transformation, focus forming ability and soft agar colony formation by oncogenic mutants of Ras in fibroblast cell-lines. In addition, co-transfection of activated RhoA or B or Racl can synergistically increase focus formation induced by activated Raf, when Raf is expressed at such levels that its transforming ability is weak (Khosravi-Far et al., 1995; Prendergast et al., 1995; Qiu et al., 1997; Qiu et a l, 1995a; Qiu et al., 1995b). This implies that Rac and Rho are activating a pathway parallel to Raf downstream of Ras that is essential for cell proliferation and transformation. The effects on growth and transformation of activated Rho family members alone on cells is not yet clear. Full malignant transformation by activated Rac and Rho has been reported (Perona et al., 1993; Qiu gf al., 1995a), however, other groups observe much lesser effects. This will be discussed later in the context of this thesis.

1.3.5, 6 Membrane Trafficking

Rac and Rho are thought to be involved in cellular processes such as secretion, endocytosis, phagocytosis and antigen presentation. These processes may involve the transport of vesicles that may accompany actin remodelling. For example, dominant negative mutants of Rac can inhibit the formation of clathrin coated pits, which are important in endocytosis (Lamaze et al., 1996). Furthermore, Rac is able to stimulate pinocytosis in Swiss 3T3 cells (Ridley et al., 1992). However, this does not occur in baby hamster kidney cells. In this case, dominant negative Rac mutants are unable to inhibit Ras^'^ stimulation of pinocytosis. An alternative GTPase, Rab5, appears to be the mediator (Li et al., 1997). Thus pinocytosis appears to occur through a variety of regulators in different cell types. In addition, activated Rac and Rho also stimulate exocytosis of secretory vesicles in mast cells. GTP-y-S induced exocytosis can be inhibited by dominant negative mutants of Rac and Rho. This may be linked to the ability of Rac and Rho to stimulate actin reorganisation in these cells (Norman et ai, 1996).

59 Chapter One - Introduction

1.3.6 Cellular Responses specific to effectors of Rac

In a similar manner to Ras, Racl and other Rho family members have many putative effectors. These are listed in Table 1.4. Racl and Cdc42 have many effectors in common, but RhoA effectors are mostly distinct. A sixteen amino acid sequence that is common to Rac and Cdc42 effector proteins, but not Rho effectors, has been designated Cdc42/Rac interactive binding, CRIB, and has aided identification of some putative Rac and Rho effectors (Burbelo et ai, 1995). Although some Rac and Cdc42 effectors do not contain this motif, e.g. p85" and IQGAPs. Some cellular responses to Rac have been attributed to specific effectors through the use of activated and dominant negative mutants (Van Aelst, 1997). In addition, the participation of certain candidate effectors in Rac-mediated responses has been dismissed since Rac effector domain mutants have been identified that induce the response but no longer bind the effector (Joneson et al., 1996a; Lamarcheet al., 1996; West wick et al., 1997).

Table 1.4 Rho family effector proteins Effector Interact Function Reference ing GTPase hPAK-l*(rat Racl, serine/threonine kinase, JNK (Bagrodia et al, aPAK), hPAK-2* Cdc42 activation, actin 1995b; Manser (p62^^^^), mouse depolymerisation and focal etal., 1995; rnPAKS* (rat adhesion disassembly Manser et al., p65P'’^'^) 1994; Martin et al., 1995a; Teo et al., 1995) MLK2*, MLK3* Racl, MAPK kinase kinase, JNK (Teramoto et al., Cdc42 activation 1996a) MEKKl, MEKK4* Racl, MAPK kinase kinase, JNK and (Fanger et al., (MTKl) Cdc42 p38 activation 1997; Gerwins etal., 1997) p-yQSôkinaseD Racl, kinase for ribosomal subunit, (Chou and Cdc42 required in growth factor Blenis, 1996) stimulated DNA synthesis IQGAP1°, Racl, putative RasGAP, possibly (Brill et al., IQGAP2° Cdc42 involved in cytoskeletal 1996; Kuroda et organisation a l, 1996a) p85 subunit of PI 3- Racl, membrane ruffling (Zheng et al., kinase° Cdc42 1994) MSE55* Cdc42, ? (Burbelo et al., Rac 1995) PI 5-kinase Racl, possibly generating PI(4,5)P^ (Ren et al., RhoA which enhances actin 1996) polymerisation PORI, POR2 Racl membrane ruffling (Van Aelst et al., 1996)

60 Chapter One - Introduction p67PHOXD Racl NADPH oxidase complex (Diekmann et aL, 1994) POSH Racl JNK activation, NFk B (Tapon et al., activation, scaffold protein 1998) N-Chimerin ? Racl membrane ruffling (Kozma et at., 1996) a and p tubulin Racl possibly cellular translocation of (Best et at., Racl via microtubule network 1996) p35/cdk5 Racl regulation of neurite outgrowth, (Nikolic et al., down regulation of PAKl 1998) MRCK (myotonic Cdc42 Filopodia formation, myosin (Leung et al., dystrophy kinase- light chain phosphorylation 1998) related Cdc42 binding kinase) WASP*, N-WASP* Cdc42 Actin organisation, implicated in (Miki et al., Wiskott-Aldrich syndrome. N- 1998; Symons et WASP required for filopodia al., 1996) formation and actin de- polymerisation pl2QACK*^ ACK-2* Cdc42 non receptor tyrosine kinase (Manser et al., 1993; Yang and Cerione, 1997) CIP4 Cdc42 actin organisation (Aspenstrom, 1997) pl60ROCK#D/ RhoA, Stress fibre formation, focal (Fujisawa et al., kinase/ ROKa*/ (Racl*) adhesions 1996; Ishizaki et ROKp/ ROCKII al., 1996; Leung etal., 1995; Matsui et al., 1996) PKN/PRK2 RhoA Endocytosis? (Quilliam et al., 1996; Watanabe etal., 1996) citron*, CRIK, RhoA, cytokinesis (Di Cunto et al, CRIK-SK Racl* 1998; Madaule et al., 1995) MBS (myosin- RhoA muscle contraction, actin and (Kimura et al., binding subunit of myosin binding 1996) MLC phosphatase) pl40'^‘VmDia2/ RhoA actin polymerisation, (Lynchet al., DFNA cytokinesis? Implicated in 1997; Watanabe deafness and Madaule, 1997) Rhophilin RhoA related to PRKl (Watanabe et al., 1996) Rhothekin RhoA 7 (Reid et al, 1996)

61 Chapter One - Introduction

kinectin RhoA Kinesin binding, vesicle (Alberts etal, transport 1998; Hotta et a/., 1996) * -indicates CRIB motif; ° -indicates does not contain CRIB motif; * -indicates also binds Racl in a GTP dependent manner

1,3.6.1 PAKs

The Rac and Cdc42 effector proteins, jp.21 GTPase activated protein kinases, PAKs, are serine/threonine kinases that were initially found as proteins in brain cytosol that bound GTP-Rac and Cdc42, but not Rho. They antagonise intrinsic GTPase and GAP activity on Rac and Cdc42. Upon incubation with GTP-Rac or GTP-Cdc42 they become activated and exhibit autophosphorylation (Manser et al., 1994; Martin et al., 1995a).

PAKs have striking similarity to the S.cerevisiae gene Ste20. This is implicated in G protein signalling to a MAP kinase cascade. Mammalian PAKs have also been implicated in Rac signalling to the JNK and p38 MAP kinase pathways. Activated PAKs have been demonstrated to induce JNK activity (Bagrodia et al., 1995a; Teramoto et al., 1996b). Furthermore, activation of p38 by Rac and Cdc42 in Cos and Hela cells is inhibited by a kinase inactive mutant of PAKl (Zhang et al., 1995a). JNK activation by Ras or Rac can also be inhibited by a kinase inactive mutant, PAKl*^"^^ in Rati cells (Tang et al., 1997). An amino terminal fragment of PAK that binds Rac-GTP is also able to block Rac and Cdc42-mediated activation of JNK (Minden et al., 1995; Teramoto et al., 1996b). However it is not clear whether these PAK mutants work by are blocking interaction of Rac and Cdc42 with other effectors in addition to PAK especially since inhibition by PAKl^-^^ is prevented by mutations which interfere with Rac and Cdc42 binding (Tang et al., 1997).

There is accumulating evidence that Rho GTPases may also have a role in regulating Raf- MEKl-ERK activation. Co-expression of activated Rho GTPases and wild type (wt) Raf-1, are able to synergistically activate MEKl, while neither is able to activate MEKl alone. This ability of the Rho GTPases may be Figure 1.9 Model for mediated by PAKl since a kinase inactive mutant of PAK regulation of MEKl PAKl or a dominant negative mutant of Rac can inhibit Ras^’“ activation of MEKl. Furthermore, xPl3-K ? PAKl has recently been shown to phosphorylate a VRac ? serine residue (S298) of MEKl which is important PAK for Raf-1-MEKl interaction (Frost et al., 1997; Frost etal., 1996). Moreover, PAK3 was recently identified as a kinase activity that phosphorylated a serine residue (S338) on Raf-1. This site regulates Chapter One - Introduction

Raf-1 activation by Ras, Src and EGF. This group also showed that signal transduction through Raf-1 was dependent on activation of both the Ras and PAK pathways (King et al., 1998). Furthermore, the kinase inactive PAKl^^’^ is able to inhibit transformation of Rati cells by Ras, but not by v-Raf, presumably because v-Raf does not require PAKl for activation (Tang etal., 1997). In addition a PAK mutant that lacks the kinase domain but retains the motif, can also block transformation by Rac^'^ and Ras^^^ in rat 3Y1 cells (Osada et al., 1997). Interestingly, PAKl^^^^ does not prevent Ras transformation in NIH 3T3 cells indicating a cell type specificity in terms of PAK function (Tang et al., 1997). Since PAKl and PAK3 have been shown to be necessary for Ras activation of MEKl and for transformation, this suggests that Raf is directly activated by Ras, but also requires PAK for activation which is indirectly activated by Ras, possibly through PI 3- kinase and Rac, see Figure 1.9.

There does not appear to be a role for PAK in Rac and Cdc42-mediated membrane ruffling since effector domain mutants that are unable to bind PAK are still able to induce lamellipodia. However, there is still a possibility that PAK does have an alternative role in actin organisation because Drosophila Pakl is required for dorsal closure in Drosophila embryos which involves actin reorganisation (Harden et al., 1996). Moreover, expression of an activated PAK1/Cdc42 chimera or an activated PAKl can mediate actin reorganisation and disassembly at the plasma membrane (Manser etal., 1997; Sells et al., 1997). Experiments with Rac effector domain mutants have shown that PAK binding to Rac may be required for induction of Cyclin Dl transcription of by Rac, but that it is not required for Rac stimulation of: transformation; G1 cell cycle progression; membrane ruffling; transcription from the SRE; or activation of JNK or p38 (Joneson et al., 1996a; Lamarcheet al., 1996; Westwick et al., 1997). However, data using PAK mutants has suggested a requirement for PAK in Ras and Rac-mediated transformation. In one set of experiments, a PAKl mutant lacking the kinase domain, but retaining the CRIB motif, blocked transformation and transcriptional activation of the TPA responsive element, by both Racl^'^ and Ras^'^ in rat 3Y1 cells (Osada et al., 1997). Alternatively, kinase inactive PAK^^^^ is able to block Ras, but not v-Raf mediated transformation in Rati fibroblasts, but not NIH 3T3 cells. Further mutations that prevented interaction of the mutant PAK*^^^^ with Rac and Cdc42 did not inhibit its ability to block transformation of Rati cells, or to block activation of ERK by Ras, indicating that for these effects it was not just blocking alternative Rac and Cdc42 effectors. However, Rac binding was necessary for inhibition of JNK activity, which indicates that JNK activity does not relieve the block on transformation (Tang et al., 1997).

63 Chapter One - Introduction

1.3.6.2 PORI

The Rac effector, PORI, has been shown to induce membrane ruffling. The binding of PORI to Rac effector domain mutants also correlates well with their ability to stimulate membrane ruffling (Van Aelst et al., 1996). PORI is also able to co-operate with activated Ras to induce membrane ruffles, and a truncated PORI mutant is able to inhibit Racl^'^ induced membrane ruffles. Furthermore, ARF6, the Ras effector, also interacts with PORI and induces alterations to the cytoskeleton which are sensitive to inhibition by a dominant negative PORI, but not Racl^*^ (D'Souza-Schorey et at., 1997). Thus Ras may influence cytoskeleton stmcturing through activation of different effector proteins using the same mediator.

1 .3 .6 .3

Inhibition of with rapamycin or inhibitory antibodies inhibits G1 cell cycle progression indicating the importance of this protein to cell proliferation (Grammer et a i, 1996). has been shown to interact with Rac and Cdc42 in vitro in a GTP dependent manner, and activated versions stimulate p^o^eidnase vivo. Cdc42 is unable to activate in vitro; a similar situation to Ras-mediated activation of Raf. Moreover, dominant negative mutants of Rac and Cdc42 are able to inhibit EGF and PDGF induction of p^o^^wnase activation (Chou and Blenis, 1996). Thus it appears that pYQSôkinase jg cffcctor of Rac and Cdc42. However, it is also regulated by PKC, AKT/PKB, and TOR, which may all play necessary roles in p^Q^^kinase regulation.

1.3, 6. 4 Rock and ROK plbo^ocK ROKa interact with Racl and Cdc42 as well as with RhoA (Ishizaki et al., 1996; Joneson et al., 1996a; Lamarcheet al., 1996). A Rac effector domain mutant that is deficient in its binding of p i60’^°^'^ was unable to induce G1 progression or lamellipodia formation, thus it may have a role in these processes (Lamarche et al, 1996).

1.3, 6,5 MEKK4

Rac and Cdc42 activation of JNK in Cos cells may also be mediated by a putative Rac and Cdc42 effector, MEKK4 (a MAP kinase kinase kinase). One group reports that MEKK4 is able to activate JNK, and not p38 or ERK, and that a kinase inactive mutant of MEKK4 is able to block JNK activation by Rac and Cdc42 (Gerwins et al., 1997). However, another group identified MEKK4 as a potent activator of p38 and as a secondary activator of JNK in Cos and Hela cells. This group showed that activation of p38 by environmental stresses (UV light, anisomysin and osmotic shock) was sensitive to inhibition by a kinase inactive version of MEKK4, whereas TNFa activation of p38 was not inhibited (Takekawa et al., 1997). Importantly, it has also been demonstrated that activation of JNK activity by anisomycin, is not inhibited by dominant negative mutants

64 Chapter One - Introduction of Racl. Indicating that this is a Rac independent mechanism for JNK activation. Furthermore JNK activation by EGF is more sensitive to dominant negative mutant of Ras than Rac (Coso et al, 1995; Minden et al., 1995).

1,3,6.6 MLK

Mxed-hneage kinase-3 (MLK-3), is able to bind Rac and Cdc42 in a GTP dependent manner. This protein has also been proposed as the main activator of JNK by Rac and Cdc42 in Cos cells since it was demonstrated that this kinase (and not PAKl) can activate JNK (Teramoto etal., 1996a).

1.3.7 Rho Family proteins and tumorigenesis

Unlike Ras, members of the Rho subfamily have not yet been found mutated in human tumours (Moscow etal., 1994). However, many proteins that have since been found to be exchange factors for the Rho family were first identified in NIH 3T3 cell transformation assays as oncogenes, for example, Dbl and Vav (see Table 2). In addition, Dbl is found expressed in the childhood tumour, Ewings sarcoma (Vecchio et al., 1989), and appears to affect DNA damage repair. Vav, is located on a region of chromosome 19 that is involved in karyotypic abnormalities in a variety of malignancies including melanomas and leukaemias (Martinerie etal., 1990). In addition, Bcr acts both as a RhoGEF and a RacGAP. Over 90% of all chronic myeloid leukaemia (CML) and 10-20% of acute lymphoblastic leukaemia involve the formation of the Philadelphia chromosome, which results in the generation of a BCR/ABL chimeric gene. Antisense oligonucleotides directed to the BCR/ABL junction are able to suppress the hyperproliferative growth of leukaemia cells from CML patients (Szczylik et al., 1991). This difference between the occurrence j of i Rho GTPases and their activators could derive from the ability of RhoGEFs to activate multiple Rho family members and that activation of more than one Rho family member is required for tumour promotion.

65 Chapter Two - Ras and Raf and the Cell Cycle

2. The Effect of Ras and Raf activation on the Cell Cycle

66 Chapter Two - Ras and Raf and the Cell Cycle

2.1 Introduction

Ras is found activated in 10-15% of all human tumours and this figure is much higher in specific types of tumour (Barbacid, 1987). This implies that it is an important growth regulatory gene and this has been borne out in studies investigating its ability to control cell cycle progression. Raf is a direct effector of Ras (Koide et al., 1993; Moodie et al., 1993; Van Aelst e ta l, 1993; Vojtek eta l, 1993; Wame et a l, 1993; Zhang et a l, 1993) and can also be oncogenic, although it has only been found activated and/or upregulated in a very small number of human tumours (Chenevix-Trench et al., 1987; Graziano et al., 1987; Hajj et al, 1990; Riva et al, 1995; Sithanandam et al, 1989). The role of Ras and Raf in regulating cell cycle progression has been shown to be complex and their modes of action are not fully understood. Early experiments showed that introduction of activated Ras and Raf could fully transform established cell-lines. They allowed cells to grow in reduced mitogen conditions, overcome contact inhibition, grow in the absence of anchorage and form tumours when injected into nude mice (Feramisco et a l, 1984; Pritchard et a l, 1995; Rapp et a l, 1983; Smith et a l, 1990; Stacey and Kung, 1984). A requirement for Ras and Raf in growth factor stimulated DNA synthesis has also been demonstrated in NIH 3T3 cells (Feig and Cooper, 1988; Howe et al, 1992; Kolch et al, 1991; Mulcahyet a l, 1985; Schaap et a l, 1993; Stacey et al, 1991). However Ras and Raf have been shown to control multiple aspects of cell growth and development in addition to mitogen-stimulated proliferation. Aberrant activation of Ras or Raf often causes cell cycle arrest, especially in primary cells. For example, oncogenic Ras and Raf cause a p53-dependent cell cycle arrest in Schwann cells which requires induction of the cyclin-dependent kinase inhibitor, p21^'P ' (Lloyd et a l, 1997; Ridley et a l, 1988). However the specificity of the Ras or Raf signal can be changed by the presence of an additional oncogenic lesion which can prevent p21^‘^ ' upregulation and allow mitogenic stimulation. For example, SV40 Large T antigen, which sequesters p53 or the loss of p53 is able to revert the growth inhibitory phenotype of activated Ras or Raf in Schwann cells (Lloyd et al, 1997; Ridley et al, 1988). In addition to promoting cell cycle inhibition, Ras has also been shown to change cell fate. Expression of activated Ras in human or murine fibroblasts causes a phenotype that resembles premature senescence (Serrano et a l, 1997). This may be a protective mechanism utilised by the cell to prevent constitutive activation of a mitogenic signal transduction pathway by oncogenes. Furthermore, Ras and Raf have also been demonstrated to promote differentiation when overexpressed in cells in tissue culture (Noda et a l, 1985; Wood et a l, 1993). More importantly, overexpression of activated Ras and Raf in transgenic animals has also been shown to promote differentiation

67 Chapter Two - Ras and Raf and the Cell Cycle

(Bailleul et al., 1990; O'Sheaet al., 1996). Thus aberrant activation of Ras or Raf has physiological consequences which match those observed in vitro. Although many consequences of Ras and Raf activation have been observed, the molecular mechanisms by which Ras and Raf specify these different responses remains unresolved. Studies of oncogene co-operation in primary cells have shown that viral oncogenes can alter the response of cells to Ras or Raf by differential regulation of cell cycle inhibitor proteins (Lloyd et al., 1997; Serrano et al., 1997). Interestingly, Raf activation has been reported to both initiate and inhibit DNA synthesis in NIH 3T3 fibroblasts (Pritchard et al., 1995; Samuels and McMahon, 1994). This indicates that these cells have the potential to reveal how cells are able to respond to the same signal in different ways. Thus we have used NIH 3T3 cells to investigate how Ras and Raf signal specificity is regulated The work in this chapter was performed in collaboration with Andreas Sewing and his work is acknowledged in the figure legends.

2.2 Results

2.2.1 Regulation of Raf To investigate the effects of Raf on the cell cycle we generated a cell-line in which Raf activation could be induced when required. Catalytic proteins have previously been made regulatable by the addition of the hormone binding domain (HBD) of a steroid hormone receptor (Godowski et al., 1988; Samuels et al., 1993). The presence of the HBD inactivates these proteins, but addition of the relevant hormone releases the inhibition and causes rapid activation. This principle was used to generate an androgen receptor-Raf fusion protein. The carboxy terminus of RafCAAX (wild type Raf-1 fused to the membrane localisation signal of K-Ras (Leevers etal., 1994)) was amplified by PGR and digested with Hindlll and EcoRI and cloned into pBluescript. This fragment was ligated to the HBD of the androgen receptor (AR) which had also been amplified by PGR and digested with BamHI and Hindlll. The Raf-AR fragment was sub-cloned in frame into the replication defective, neomycin resistant retroviral vector, pLXSN3 with a Myc tag that is specifically recognised by the 9B10 monoclonal antibody (Evan et al., 1985). This retroviral vector is depicted in Figure 2.2a and is referred to as pLXSN RafAR (Sewing et al., 1997). The retroviral producer cell-line GP+E was stably transfected with pLXSN RafAR and selected for resistance to G418 in media containing 10% charcoal and dextran stripped PBS and without phenol red. Phenol red and hormones in serum are able to activate steroid hormone receptors. A G418-resistant population of cells was obtained from which supernatant containing replication-defective retroviruses was collected. GP-kE cells

68 Chapter Two - Ras and Raf and the Cell Cycle that produced the empty virus, LXSN, were also made. NIH 3T3 cells were infected with either virus and selected for G418 resistance. These cells were consistently cultured in media without phenol red and stripped NCS. Polyclonal populations were obtained and are referred to as RafAR and LXSN cells. To confirm that RafAR was expressed, cell lysates from RafAR or LXSN cells were separated by SDS-PAGE and analysed for RafAR expression by Western blotting using the 9E10 antibody. A protein of the expected size was expressed in RafAR cells and not in the empty vector cells (Figure 2.2b). To confirm that RafAR can be activated by the addition of androgens we looked at the ability of RafAR to activate the ERK MAP kinase pathway. The testosterone derivative, R1881 or the equivalent volume of ethanol (the solvent used to dissolve R1881) was added to quiescent RafAR or LXSN cells for 30 minutes. p42^^^^^ was immunoprecipitated from cell lysates and its ability to phosphorylate myelin basic protein (MBP) was measured. R1881 stimulated a large increase in the level of ERK kinase activity indicating that RafAR had been activated (Figure 2.2c). This increase in ERK kinase activity did not occur upon addition of ethanol to either cell-line or upon addition of R 1881 to LXSN cells.

2.2.2 Inhibition of cell cycle progression by RafAR Raf has been implicated in both stimulation and inhibition of DNA synthesis in NIH 3T3 cells. We wished to determine whether the growth of NIH 3T3 cells could be inhibited by activation of RafAR. Tritiated thymidine incorporation analysis, which measures the DNA synthesis index of the cells, was performed on asynchronously growing RafAR cells after stimulation with R1881 or ethanol. DNA synthesis of RafAR cells dramatically decreased 18 h after treatment with R1881 to 20% of the thymidine incorporation of RafAR cells that had been treated with ethanol. This inhibition of growth is specific to RafAR since the growth of LXSN cells was unaffected by the addition of R1881 (Figure 2.3a). To analyse the nature of the arrest, the DNA profile of the RafAR cell populations were examined by staining their DNA with propidium iodide (PI) and quantifying the total DNA content of each cell using fluorescent activated cytometry (FACS). RafAR cells treated with R1881 accumulated in the G1 phase of the cell cycle and 88% of the cells had a 2N DNA content. Only 68% of RafAR cells treated with ethanol were in G1 which is normal for an asynchronously growing population of cells (Figure 2.3b). To examine the percentage of cells transiting from G1 to S-phase, RafAR cells were pulse labelled with a DNA analogue, Bromodeoxyuridine (BrdU) for 2 h, after treatment with R1881 or ethanol for 16 h. The degree of BrdU incorporation compared with the total DNA content for each population was analysed by FACS. Activation of RafAR with R1881 caused a dramatic reduction in the number of cells entering S-phase. Only 1% of cells in the presence of R1881 entered S-phase compared to 25% of cells treated with ethanol (Figure

69 Chapter Two - Ras and Raf and the Cell Cycle

2.3b). Thus activation of RafAR in NIH 3T3 cells caused a cell cycle arrest in G l. This was very similar to the effect of ARafiER that had been observed in primary rat Schwann cells where Raf-1 activation caused a p53-dependent induction of p21^'^' which resulted in a Gl arrest. In Schwann cells expression of Cyclins D l, A and to a small extent, E became upregulated and yet were inactive due to the concomitant upregulation of the cell cycle inhibitor, (Lloyd et al., 1997). To determine whether this growth inhibition by RafAR in NIH 3T3 cells was similar to that observed in Schwann cells, we examined the effect of activation of RafAR on a panel of cell cycle regulatory proteins. The expression levels of Gl cyclins, CDKs and CKIs were compared from subconfluent RafAR cells in the presence of 10% NCS after stimulation with R1881 or ethanol. Immunoblotting analysis following SDS-PAGE revealed that Cyclin Dl, Cyclin E and p21^'^'' expression were upregulated, while the levels of CDK4, CDK6 and p27^^* remained unchanged (Figure 2.3c). This profile of protein expression was similar to that observed upon Raf activation in Schwann cells, implying that growth arrest in NIH 3T3 cells may be through a similar mechanism. pRb has an important role in Gl to S-phase progression and is a substrate for active D- type cyclin and Cyclin E complexes. Phosphorylation and subsequent inactivation of pRb is a necessary requirement for cells to transit from Gl to S-phase upon stimulation with mitogens (Mittnacht, 1998). The phosphorylation state of pRb was examined by looking at its mobility shift upon SDS-PAGE. In the presence of R1881, pRb was hypophosphorylated compared with unstimulated cells, indicating that pRb was active (Figure 2.3c). We have shown that activation of RafAR in asynchronously growing cells induces expression of G 1 cyclins which are usually growth promoting and yet RafAR activation causes in cell cycle arrest. This indicates that they may not be active and that concurrent upregulation of p 2 1 ^ r' may be responsible for their inactivation. The kinase activities of the Gl cyclin complexes were assessed. Asynchronously growing RafAR cells were stimulated with R1881 or ethanol. Cyclins Dl, E and H were immunoprecipitated and the ability of the cyclin associated complex to phosphorylate a specific substrate was determined. The associated kinase activities of Cyclin Dl and Cyclin E decreased by 3-5 fold upon activation of RafAR (Figure 2.3d). The kinase activity of Cyclin H, which is unable to bind p21^'^^ (Harper et al., 1995), remained unchanged. Stimulation of RafAR must therefore induce an activity inhibitory to the Gl cyclins. Since p21^'^ ' was upregulated by RafAR activation and had already been implicated as the responsible factor in the Raf-1-induced Schwann cell growth arrest (Lloyd et al., 1997) it was an obvious candidate. p21^'P ' binds cyclin-CDK complexes and inhibits their activation (el-Deiry etal., 1993; Harper eta l, 1993; Noda et al., 1994; Xiong et al..

70 Chapter Two - Ras and Raf and the Cell Cycle

1993). Therefore we assessed whether the increased expression of may be responsible for downregulation of Cyclin Dl- and E-associated kinase activity. To determine whether the level of p21^'‘’ ' present in the Gl cyclin/CDK complexes increased upon RafAR activation, CDK2 and CDK4 complexes were immunoprecipitated from R1881 treated and untreated cells. Immunoprecipitates were separated by SDS- PAGE and examined by Western blot for p21^‘P * and CDK protein levels. Stimulation of

RafAR activity increased the amount of p 2 1 °^i complexing with both CDK4 and CDK2, although total CDK levels remained constant (Figure 2.4a). The presence of extra p21^'P * in CDKs complexes upon RafAR activation suggested that the increased level of p21‘^''^* stimulated by RafAR may be sufficient to inhibit the Gl cyclin complexes . To determine whether there was an excess of an inhibitory activity in cells which contained activated RafAR, we tested the ability of R1881-treated RafAR cell lysates to inhibit a target of exogenous active Cyclin E complex. In addition, to determine whether p21^'^^ was responsible for the inhibitory activity, lysates of cells that had been treated with R1881 for 16 h were immunodepleted with an anti-p21^'^'' antibody (or immunoglobulins as a control) to remove p21^'^ ' protein (Figure 2.4c). Exogenous active cyclin E target complexes were provided by a Rat-1 cell hne that expressed human Cyclin E (E6 cells) (Perez-Roger et al., 1997)) that could be distinguished from murine Cyclin E by a monoclonal antibody. Target extracts from E6 cells were mixed either with lysates (immunodepleted or normal) from RafAR cells that had been treated with R1881 or ethanol, or with a mock extract (lysis buffer). Human Cyclin E complexes were then immunoprecipitated from the lysate mixtures and their ability to phosphorylate histone H 1 was determined. RafAR cell lysates treated with R1881 and mock-immunodepleted with immunoglobulins, were able to inhibit the Cyclin E-associated kinase activity of the E6 cells. However, p21^'’’ ' immunodepleted lysates from R1881 treated cells could not (Figure 2.4b). Lysates from RafAR cells treated with ethanol were unable to inhibit Cyclin E-associated kinase activity. This indicates that cells stimulated with R1881 contain active p21^^' which is responsible for the inhibition. Gl cyclin-associated kinase activity is necessary for mitogen stimulation of DNA synthesis. We have shown that in NIH 3T3 cells activation of RafAR downregulates Cyclin Dl - and Cyclin E-associated kinase activities by inducing p21^'^'' which binds to CDK2 and CDK4 complexes and that p21^''"'' is necessary for inhibition of cyclin- associated kinase activity. Therefore p21^'^'' is necessary for the Gl specific arrest we observe in R1881 stimulated RafAR cells. To determine if Raf-1 was able to transcriptionally upregulate p21^'^'' we examined the ability of RafAR to induce expression from a luciferase reporter construct under the control of the full length human p21^'P ' promoter (pCip-l-Luc) (a kind gift from X.Lu). RafAR cells were transiently transfected with pCip-l-Luc and a control lacZ reporter

71 Chapter Two - Ras and Raf and the Cell Cycle

construct. Addition of R1881 for 24 h induced p21^'‘’ ’ promoter activity to 3 fold above background levels Figure 2.5. This indicates that RafAR activity was able to stimulate p2 ic.p-i transcription. To confirm that p21^'^'' was responsible for the Raf-induced arrest we decided to obtain direct genetic evidence using mouse embryo fibroblasts (MEFs) from transgenic mice. We determined whether activation of RafAR would inhibit the growth of wild type (wt) MEFs. To this end RafAR was subcloned into pLXPB, a derivative of pLXSN3 that contains a puromycin resistance gene in place of the neomycin resistance gene. This was necessary because MEFs from transgenic mice are already neomycin resistant. This plasmid was transiently transfected into a viral producer cell-line, Bose 23 cells and viral supernatant was collected 48 h later. wtMEFs were infected with LXP3 RafAR viral supernatant and selected for resistance to puromycin, a polyclonal population was obtained. Asynchronously growing RafAR wtMEFs were stimulated with R1881 or ethanol and a tritiated thymidine incorporation assay was performed. Activation of RafAR for 16 h inhibited cellular DNA synthesis by over 50% (Figure 2.6a). This indicated that wtMEFs responded to RafAR activation in a similar manner to NIH 3T3 cells. We primarily wished to determine whether p21^'^'' was necessary for RafAR- induced growth inhibition. Therefore, RafAR expressing MEFs from null mice were generated in the same manner as the wt MEFs and their DNA synthesis in response to RafAR activation was measured. Activation of RafAR for 16 h in these cells did not cause any growth inhibition (Figure 2.6a). This proved that p21^'^ ' was necessary for RafAR-induced growth inhibition in MEFs. p53 is a direct regulator of p21^'P ’ (el-Deiry et a l, 1994; el-Deiry et al., 1993) and has been shown to be necessary for Ras and Raf inhibition of primary cells (Lloyd et al., 1997; Serrano et al., 1997). To determine if the p21^’'’ '-mediated arrest we observe is dependent on p53,p5i null MEFs were analysed for their response to RafAR activation. p53 null MEFs were infected with LXP3 RafAR virus in the manner described above. Activation of RafAR in these cells caused inhibition of growth and an upregulation of p2 icip-i (pigm*e 2.6). This indicated that growth inhibition and p21^''''' upregulation by Raf activity was not dependent on p53. As shown earlier, Cyclin Dl is upregulated by RafAR activation. Cyclin Dl overexpression is able to stimulate proliferation (Lovec et al, 1994; Resnitzky, 1997; Zhu et a l, 1996b) but has also been implicated in cell cycle inhibition (Del Sal et a l, 1996) and senescence (Dulic et a l, 1993; Lucibello et al., 1993). We wished to determine whether it had a role in RafAR-mediated growth inhibition. Thus Cyclin D l null MEFs were infected with LXP3 RafAR retrovirus. Upon RafAR activation in asynchronously growing cells, their rate of DNA synthesis was reduced (Figure 2.6a), indicating that Cyclin Dl was not necessary for growth inhibition by RafAR. In addition p21^''’ ’ was

72 Chapter Two - Ras and Raf and the Cell Cycle

also induced suggesting that Cyclin Dl also had no role in ' induction (Figure 2.6b) Thus we have shown that stimulation of RafAR activity is able to inhibit cell cycle progression from Gl to S-phase in asynchronously growing murine fibroblasts. Furthermore, it has been shown biochemically and genetically that this arrest is dependent on upregulation the cell cycle inhibitor, p21^‘P ' which occurs transcriptionally and is independent of p53 and Cyclin Dl function.

2.2.3 Stimulation of DNA synthesis by RafAR We have established that activation of RafAR is able to induce a Gl specific growth arrest in fibroblasts. However activated Raf has also been shown to act as a mitogen in NIH 3T3 cells (Fukui et al., 1985; Pritchard et al., 1995; Rapp et al., 1983; Smith et al., 1990). We were interested to find an explanation for these apparently contrasting effects. The different mitogenic properties of Raf family members provided clues as to how this apparent contradiction could be rationalised. An oncogenic form of A-Raf was shown to stimulate DNA synthesis in NIH 3T3 cells, whereas similarly activated forms of Raf-1 and B-Raf could not (Pritchard et al., 1995). These Raf mutants also activated the ERK MAP kinase pathway to different extents. A-Raf stimulated the least ERK activity while B-Raf induced the most. Therefore the ability of A-Raf to stimulate DNA synthesis may have been related to its lesser ability to activate ERK activity implying that the strength of Raf signal generated may be a factor in determining their mitogenic ability. To determine if the degree of Raf-1 activation was able to determine proliferative responses of cells, we tested whether it was possible to regulate the strength of the RafAR signal by analysing its ability to stimulate ERK activity. We treated quiescent, confluent, serum-deprived cultures of RafAR cells with the indicated concentrations of testosterone for 30 minutes and measured p42^'‘'^ kinase activity. The degree of ERK kinase activity increased proportionally with greater concentrations of testosterone (Figure 2.7a), This demonstrated that RafAR could be activated to different signal strengths depending on the concentration of hormone. Thus we investigated whether the induction of different levels of Raf-1 activity could stimulate Gl to S-phase progression with different efficiencies in quiescent cells. Confluent, serum-deprived cultures of RafAR cells were treated with the indicated concentrations of testosterone for 16 h. Their DNA synthesis was then analysed by tritiated thymidine incorporation. Activation of RafAR with gradually increasing concentrations of testosterone increased cellular DNA synthesis to a maximum of 4 fold above basal rates at 10 nM testosterone. Higher concentrations of testosterone failed to induce this mitogenic response and at the highest concentrations thymidine incorporation rates were reduced to below background levels (Figure 2.7b). In parallel to the thymidine incorporation assay, cell lysates were also taken for analysis by Western blot and

73 Chapter Two - Ras and Raf and the Cell Cycle assessed for Cyclin Dl and p21‘^'‘’ ‘ expression. Cyclin Dl expression levels became elevated in response to 10 nM testosterone and remained high in the presence of 100 nM testosterone. In contrast p2l‘^‘P'* was induced only by 100 nM testosterone. Thus different strengths of RafAR activation were able to differentially upregulate Cyclin Dl and p21^'’^‘. Induction of Cyclin Dl correlated with induction of DNA synthesis, while induction of p21^'^'^ correlated with a Gl arrest and we demonstrated earlier that p21^'P ‘ is responsible for RafAR-mediated inhibition of DNA synthesis. Thus RafAR is able to both stimulate and inhibit DNA synthesis by differentially regulating expression of cell cycle regulatory proteins depending on its strength of activation.

2.2.4 Investigating the generality of the Raf response

To confirm that this dual regulation by RafAR is a general response to Raf-1 activation we investigated the ability of other activated Raf-1 mutants to inhibit cell cycle progression. An alternative Raf-steroid receptor fusion protein which-fead been caused Raf-1-induced cell cycle arrest in Schwann cells was tested. To confirm that the steroid hormone binding domains had no role in the Raf-1 mediated arrest we also tested the ability of RafCAAX to cause growth inhibition by inducing its expression using a tetracycline repressible promoter. RafCAAX is wild type Raf-1 fused to a membrane localisation sequence which makes it constitutively active (Leevers et a l, 1994; Stokoe et al., 1994). In addition we wished to determine whether Ras, which directly activates Raf in vivo, could elicit similar cellular responses.

2.2.5 The effect of a different Raf-hormone receptor protein on cell cycle progression

ARafiER has the CR3 domain of human Raf-1 at its amino terminus which is fused to the hormone binding domain of the human oestrogen receptor at its carboxy terminus (Samuels et a i, 1993) (Figure 2.8a). This protein is activated by oestrogens and its antagonists, for example, P-oestradiol and 4-OH tamoxifen (4-OHT) respectively. ARafiER induces p21^'P ’-dependent growth arrest in Schwann cells (Lloyd et al., 1997) and can prevent growth factor stimulated DNA synthesis in NIH 3T3 cells (Pritchard et al., 1995; Samuels and McMahon, 1994). NIH 3T3 cells infected with pLXSN ARafiER were a kind gift from A.Lloyd and are referred to as ARER cells. The abihty of ARafiER to stimulate dose-dependent stimulation and inhibition of DNA synthesis was tested. To determine whether the activity of ARafiER could be induced to different strengths, confluent serum-deprived cultures of ARER cells were stimulated with the indicated concentrations of p-oestradiol, ethanol or 10% NCS for 30 min. The degree of ARafiER activity was gauged by its ability to induce ERK phosphorylation which can be observed as a mobility shift when proteins are separated on a MAP kinase shift gel and

74 Chapter Two - Ras and Raf and the Cell Cycle immunoblotted for p42^'^ expression. The phosphorylated form of increased proportionally with the concentration of p-oestradiol in the media (Figure 2.8b). Ethanol- treated ARER cells demonstrated no ERK phosphorylation shift indicating that ARafrER is inactive in unstimulated cells. IN addition, the blot was stripped and reprobed with antibodies specific for tyrosine 204 and threonine 202 dual phosphorylated p42/44 ERKl/2 . Phosphorylation of these residues is essential for ERK activity (Boulton et al., 1991; Payne et at., 1991). The shifted band of the MAP kinase shift blot correlated precisely in position and intensity with that recognised by anti-phospho-ERK antibody (Figure 2.8b). Thus ARafiER signal strength could be regulated. The ability of ARafiER to stimulate DNA synthesis in quiescent NIH 3T3 cells was then investigated. Confluent, serum-deprived, quiescent cultures of ARER cells were stimulated with the indicated concentrations of p-oestradiol or 10% NCS for 25 h and a tritiated thymidine incorporation assay was performed. DNA synthesis gradually increased with increasing hormone concentration to a maximum of two fold above basal levels in the presence of 1.5 nM P-oestradiol. As we had observed with RafAR, higher concentrations of p-oestradiol were less able to initiate DNA synthesis in the cells and no induction of DNA synthesis was observed at the maximal concentration of hormone (Figure 2.8c). The addition of serum to the cells was much more mitogenic than ARafiER activation, it induced thymidine incorporation 5 fold above background levels. Thus similarly to RafAR, ARafiER has a narrow window in which it is able to stimulate DNA synthesis. The ability of ARafiER activation to inhibit mitogen-stimulated growth in a dose dependent manner was tested. ARER cells, exponentially growing in 10% NCS, were stimulated with 4-OH tamoxifen at the indicated concentrations for 18 h. DNA synthesis was measured by tritiated thymidine incorporation. DNA synthesis was reduced in proportion to the concentration of hormone added to the cells (Figure 2.8d). This indicates that like RafAR, ARafiER is able to inhibit DNA synthesis in the presence of mitogens. Furthermore, we have shown that Raf-1-mediated inhibition is sensitive to the strength of the Raf-1 signal. We can conclude that dose-dependent regulation of the cell cycle is a common property of Raf-steroid hormone receptor fusion proteins.

2.2.6 The effects of RafCAAX expression on cell cycle control It was necessary to establish that RafAR and ARafiER-mediated growth arrest was a genuine property of Raf-1 and that the different cellular responses to Raf-1 signals of varying strengths were a general phenomenon and not specific to Raf-steroid hormone receptor fusion proteins. Therefore we utilised a tetracycline regulatable promoter to regulate expression of RafCAAX (Leevers et al., 1994). Transcription of RafCAAX is driven by a

75 Chapter Two - Ras and Raf and the Cell Cycle

Cytomegalovirus (CMV) promoter. This is inhibited in the presence of tetracycline due to tet O sequences within the promoter that bind tetracycline and repress transcription. Removal of tetracycline from the growth media allows transcription to occur (Gossen and Bujard, 1992). This method of regulation was developed as a two plasmid system by Gossen and Bujard (1992) and was then assimilated into a retroviral vector containing a puromycin resistance gene, based on pBabePuro (Morgenstem and Land, 1990a) and called pBPSTRl (Paulus et al., 1996). This is depicted in Figure 2.9. Doxycycline, a derivative of tetracycline, has a higher binding affinity for tet O sequences than tetracycline, is soluble in dH20 and is commonly used in place of tetracycline (M. Gossen personal communication). RafCAAX was subcloned as a blunt fragment into the Pmel site of pBPSTRl to form pBPSTRl RafCAAX. The amino terminus of RafCAAX had been tagged with a peptide derived from human c-myc which is specifically recognised by the 9E10 antibody (Evan et ai, 1985) to distinguish this mutant from endogenous Raf-1. Cell-lines were generated in which RafCAAX expression could be regulated. pBPSTRl and pBPSTRl RafCAAX were transiently transfected into Bose 23 viral producer cells in the presence of doxycycline, supernatant was collected and used to infect NIH 3T3 cells. Infected NIH 3T3 cells were selected for puromycin resistance in the presence of 100 ng/ml of doxycycline and clonal populations were derived by ring cloning and are referred to as ST and STRCX cells. STRCX clones were then tested for their ability to induce RafCAAX expression. Two dishes of each clone were grown in DMEM with 10% NCS in the presence or absence of doxycycline for 48 h. Cell lysates were then separated by SDS-PAGE and analysed for RafCAAX expression by Western blot. Out of 16 STRCX clones tested, 4 had a significant induction of RafCAAX expression upon removal of doxycycline. Most of the clones did not express RafCAAX and one did not respond to doxycycline (Figure 2.10). The ability of RafCAAX to inhibit mitogen-induced DNA synthesis was then analysed. Subconfluent cultures of four regulatable STRCX clones and a polyclonal population of ST cells maintained in DMEM with 10% NCS in the presence or absence of doxycycline for 48 h. DNA synthesis was measured by tritiated thymidine incorporation analysis. Removal of doxycycline from each STRCX clone caused some inhibition of DNA synthesis. Clones STRCX6 and 15 were inhibited to the greatest extent, to a half and a quarter of their normal growth rates respectively (Figure 2.11). Thus activation of Raf-1 signals by three different mechanisms can inhibit serum-stimulated DNA synthesis indicating that this is a genuine property of Raf-1. The ability of RafCAAX to induce cell cycle progression was also investigated. Initially we tested whether RafCAAX expression levels could be differentially regulated by varying the concentration of doxycycline added to the growth media. Confluent, serum-

76 Chapter T w o-Ras and Raf and the Cell Cycle deprived, quiescent cultures of STRCX 6 cells were incubated in the indicated levels for 25 h. STRCX6 cells became gradually more morphologically transformed in response to higher levels of RafCAAX expression (Figure 2.12a). Cell lysates were separated by SDS-PAGE and analysed for RafCAAX expression by Western blot. Induction of RafCAAX expression was stimulated when doxycycline concentrations were lowered to 1 ng/ml and increased upon further reductions in doxycycline concentration. Maximal RafCAAX expression occurred on complete removal of doxycycline (Figure 2.12a). The levels of endogenous Raf-1 were analysed by stripping antibodies from the blot and re­ probing with an anti-Raf-1 antibody. Raf-1 levels remained constant, indicating that expression of RafCAAX did not affect the expression of endogenous Raf-1 protein (Figure 2.12b). We proceeded to test whether RafCAAX could initiate DNA synthesis and whether different expression levels of RafCAAX would affect this. Confluent, serum-deprived quiescent cultures of STRCX6 cells were incubated in the indicated levels of doxycycline for 25 h and DNA synthesis was measured by tritiated thymidine incorporation analysis. DNA synthesis increased to a maximum of two fold above basal levels in 0.5ng/ml doxycycline (Figure 2.12). However as doxycycline concentrations were reduced beyond 0.5 ng/ml DNA synthesis was reduced. At maximal RafCAAX expression, in the absence of doxycycline, DNA synthesis levels were higher than basal levels but lower than maximal rates (Figure 2.12). This indicated that the same effects on cell cycle control occurred with RafCAAX as with the Raf-hormone receptor fusions. I.E. that Raf-1 activation to a low level is stimulatory and yet higher levels of induction become inhibitory.

2.2.7 Regulation of the Cell Cycle by Ras^'^ Ras is able to directly activate Raf (Moodie et aL, 1993; Van Aelst et aL, 1993; Vojtek et ai, 1993; Zhang et aL, 1993). Therefore we were interested to know whether activated Ras was also able to provoke similar cellular responses to activated Raf-1. Importantly, Ras, but not Raf, is frequently found activated in human tumours (Barbacid, 1987). This heightens the importance of understanding the molecular mechanisms behind its regulation of cell growth. As discussed earlier activated Ras acts mitogenically in cell- lines such as NIH 3T3 fibroblasts and yet has also been shown to inhibit the growth of primary cells (Ridley etal., 1988; Serrano eta l, 1997). Thus we investigated the abihty of Ras to regulate cell cycle progression in NIH 3T3 cells. Induction of Ras^'^ expression was achieved by using the tetracycline repressible pBPSTRl vector described above (Figure 2.9). Ras^'^ was subcloned as a BamHI fragment into pBPSTRl to make pBPSTRl Ras^'^. pBPSTRl and pBPSTRl Ras^^^ were stably transfected into a viral producer cell-line, GP+E cells. Viral supernatants were collected from these pooled cells and used to infect NIH 3T3 fibroblasts. Infected

77 Chapter Two - Ras and Raf and the Cell Cycle cells were selected for puromycin resistance in the presence of doxycycline to obtain clones which were tested for regulatability in the same manner as STRCX cells. Cells infected with virus derived from pBPSTRl Ras^'^ were referred to as STRas cells. Lysates from STRas or ST cells cultured in the presence or absence of doxycycline were analysed for expression of Ras^'^ by SDS-PAGE and Western blotting. The antibodies used to detect Ras^'^ are also able to pick up endogenous Ras protein, however Ras expression was almost undetectable in ST cells indicating that the Ras expression we detected was probably Ras^'^. Sixteen STRas clones were tested and Ras^'^ was significantly induced in ten clones. Three clones did not express observable levels of Ras^'^ and three clones had a high background of Ras^'^ expression (Figure 2.13). Clone number 18 was chosen for further investigation and is referred to as STRas c l8. The effect of Ras^'^ expression on the DNA synthesis of asynchronously growing cells was investigated. Subconfluent STRas cl8 cells in DMEM with 10% NCS were cultured in the indicated concentrations of doxycycline for 65 h. DNA synthesis was measured by a tritiated thymidine incorporation assay. In addition, lysates were taken and separated by SDS-PAGE and analysed by Western blot for Ras^'^ and p21^^' expression. Titration of doxycycline induced Ras^'^ and p21^‘'’ ' expression in a dose-dependent manner (Figure 2.14b). Induction of Ras^'^ inhibited DNA synthesis in a dose dependent manner to a quarter of their DNA synthesis levels in the absence of Ras^'^ (Figure 2.14). The DNA profile of the cells was also analysed by propidium iodide staining using FACS. This revealed that upon Ras^'^ expression cells accumulated in the G1 phase of the cell cycle in a dose-dependent fashion from 64% in the presence of 100 ng/ml of doxycycline to 75% in its absence. Therefore Ras'^’^ was able to inhibit cell cycle progression at high expression levels which correlated with p21^'^'' expression. This response is very similar to the effect of activated Raf-1, indicating that inhibition of proliferation is a general response to hyperactivation of the Ras-Raf signalling pathway. Activated Ras has been shown multiple times to induce DNA synthesis in NIH 3T3 cells (Feramisco eta l, 1984; Stacey and Kung, 1984). In addition, it has been reported that although Ras^'^ is able to morphologically transform cells in the complete absence of mitogens (Lloyd et aL, 1989), Ras^'^ needs to synergise with other mitogenic factors, such as insulin to induce DNA synthesis (Morris et aL, 1989). We analysed the Ras^'L induced entry into S-phase and also whether Ras^'^ could initiate DNA synthesis in the complete absence of mitogens. To determine when Ras^'^ expression occurs a time course of Ras^^^ expression was performed on synchronouosly growing STRas cl8 cells which had had doxycycline removed at the indicated time points. Ras^'^ expression was induced 8-10 hours after doxycycline removal. Expression levels continued to rise until the final 24 h time-point of this experiment (Figure 2.15a). To determine when Ras^'^ expression reached a

78 Chapter Two - Ras and Raf and the Cell Cycle consistent level the experiment was repeated with longer time points. The levels of Ras^'^ induction reached a steady state between 24 and 36 h (Figure 2.15b). Ras^^^ has a very long half-life, 42 h, while normal wild-type Ras, has a half-life of 20 h. This may account for the long period of protein accumulation (Ulsh and Shih, 1984). To determine when Ras^'^ induction elicited a cellular response a time course of ERK activation was performed. Confluent serum-deprived, quiescent cultures of STRas clS cells were harvested at the indicated time points after doxycycline removal and assayed for p42^*^*^^ kinase activity. p42^"'^ became active 8 h after doxycycline removal (Figure 2.15c). This indicated that a cellular response to Ras^'^ occurred at the same time or very soon after its expression. Confluent cultures of STRas c l8 cells were incubated in low mitogen conditions (either DMEM alone or DMEM with 0.25% serum) for 48 h and then doxycycline was washed out of the cells and the cells were cultured in the specific low mitogen conditions for the indicated time periods. Cells were then assayed for their ability to incorporate tritiated thymidine which had been added to the cells 2 h prior to harvest. The largest induction of DNA synthesis occurred between 20 and 24 h after doxycycline removal (Figure 2.15d). DNA synthesis reached higher levels in the presence of 0.25% NCS. Since Ras^'^ induction took 8-10 h, this suggested that cells took approximately 14 h to progress cells from quiescence into S-phase upon Ras^'^ induction. However it must also be noted that Ras^'^ protein levels increased for at least 24 h and this may have influenced Ras^'^ induced S-phase entry. Induction of Ras^'^ in presence of 0.25% NCS induced the highest level of DNA synthesis, although Ras^’^ also induced DNA synthesis in the absence of exogenous mitogens. Therefore serum may assist Ras^'^ induction of DNA synthesis or alternatively a low concentration of serum in the growth media may affect cell survival. Autocrine factors induced by Ras^'^ may also have contributed to the mitogenic ability of Ras^'^ To investigate this further one could block growth factor receptors on the cell surface by using a general growth factor receptor inhibitor, for example suramin and then test whether Ras^'^ was still able to stimulate DNA synthesis in the absence of growth factor signalling.

2.2.8 Differential effects of Ras and Raf-1 activation In comparison to Raf-1, Ras was a much more potent mitogen. In our experiments we have activated Raf-1 steroid hormone receptor fusion proteins with an extensive range of hormone concentrations, across its mitogenic window, and expressed a range of levels of RafCAAX and yet Raf-1 signals have only induced a maximum of four fold induction of DNA synthesis over background levels (Figure 2.7, Figure 2.8 and Figure 2.12). In comparison, Ras^'^ is able to induce DNA synthesis 10-15 fold over background values (Figure 2.15). When activated strongly, Raf-1 induces p21^^^ which causes cell cycle arrest. Weak signals which do not induce p21^'P ', but induce Cyclin D l, initiate DNA

79 Chapter Two - Ras and Raf and the Cell Cycle

synthesis. Therefore we were interested in whether the reason for the superior ability of Ras^^^ to induce DNA synthesis over Raf was caused by differences in p21^‘'^‘ regulation. Thus we examined the profile of p 2 l‘^‘‘’ ' expression upon stimulation of DNA synthesis by Ras^'^ in low mitogen conditions. Confluent, serum-deprived quiescent cultures of STRas c l8 cells were incubated in the presence or absence of doxycycline and DNA synthesis at the indicated time points was measured by thymidine incorporation analysis.

Cell lysates were taken for Western blot analysis. p 2 1 ^r: protein became upregulated only after the cell had already entered S-phase, 22 h after removal of doxycycline (Figure 2.16). In a similar experiment performed using STRCX 6 cell, p21^'^''^ was upregulated at least 14 h after doxycycline removal. This was prior to the induction of S-phase. In addition the fold induction of DNA synthesis over their respective background values by Ras^'^ is six times higher than that of RafCAAX (Figure 2.16). Therefore Ras and Raf- 1 activation differentially regulate p21^^\ and this correlates with their relative abilities to induce DNA synthesis. Since p21^'^ ' expression is dependent on the strength of activation of Raf-1, the delayed induction of p21^‘'’ ' by Ras^'^ may occur because Ras^'^ is unable to activate ERK signals to the same degree as RafCAAX. Alternatively, Ras^'^ may actively downregulate p21^'P ' expression through a Raf-independent effector pathway. One would expect that if the former hypothesis were true that Ras^'^ and Raf-1 would have similar mitogenic abilities and yet the potency of Ras^'^ to stimulate DNA synthesis is much stronger than activated Raf-1. A requirement for a Raf-independent pathway downstream of Ras for DNA synthesis induction is also indicated by experiments performed with Ras effector domain mutants. A Ras^'^ mutant, which can activate Raf and the ERK MAP kinase pathway, is unable to stimulate DNA synthesis and yet DNA synthesis can be induced if this mutant is co-expressed with another Ras effector domain mutant that cannot activate ERK (Joneson et aL, 1996b). Our results suggest that this pathway would be able to downregulate p21^^' induction by Raf-1. To investigate whether a Ras-mediated pathway could counteract Raf-1 mediated upregulation of p21, we generated a cell-line in which ARafiER could be activated in the presence of activated Ras^'^. ARER cells were infected with pBPSTRl and pBPSTRl Ras^'^ retroviral supernatant and selected for resistance to G418 and puromycin in the absence of doxycycline. These cells were pooled into a polyclonal population and are referred to as ARER/ST and ARER/Ras^'^ cells.

To test whether Ras was able to counteract induction of p21^’’’‘’ by ARafiER, sub­ confluent serum-deprived, quiescent cultures of ARER/ST and ARER/Ras^^^ cells were treated with the indicated concentrations of 4-OH tamoxifen. Western lysates were taken, separated by SDS-PAGE and Western blotted. Expression of Ras^'^ in ARER/Ras^'^

80 Chapter Two - Ras and Raf and the Cell Cycle cells was confirmed by immunoblotting with the pan-ras antibody. In addition these cells also had a higher basal level of ERK phosphorylation which is indicated by the mobility shift in Figure 2.17a. This indicated that Ras^'^ was active in these cells.

Even though ERK was activated in ARER/Ras^'^ cells, p21^‘P ‘ expression was downregulated. This indicated that Ras^'^ could actively inhibit p21^‘*^* expression. Furthermore, the presence of Ras^^^ also attenuated the ability of ARafiER to induce p2 1 ^ri when cells were stimulated with 4-OH tamoxifen. Thus in the presence of strong ERK activation, Ras^'^ was able to counteract induction of p21^'P'\ Thus in addition to upregulating p21^^^ through Raf, Ras can also suppress p21^^^ , probably through another effector pathway.

We also tested the ability of these cells to induce DNA synthesis by measuring their ability to incorporate BrdU. ARER/Ras^'^ cells either unstimulated or treated with 1 nM 4-OH tamoxifen had a higher level of DNA synthesis than the control cell-line, which correlated with the reduced level of p21^'P '. However, stronger activation of ARafiER inhibited DNA synthesis in ARER/Ras^'^ cells to a greater extent than control cells even though p2l‘^'P ' levels were reduced. Therefore it appears that an additional p21^‘P ‘-independent inhibitory mechanism is induced in response to the combination of Ras and Raf activation. NIH 3T3 cells are null for the cell cycle inhibitors plb^^^'^ and pl9^^^^, eliminating possible involvement of these proteins. However, these cells do contain the other cell cycle inhibitory proteins for example plS^’^'*® and p27’^'’’.

Attempts were also made to generate a cell line in which Ras and Raf could both be regulated by infecting either STRas cells with LXSN ARafAR retrovirus or RafAR cells with BPSTRl Ras^'^ retrovirus. However none of the clones selected were able to regulate Ras"^'^ expression. Therefore a system in which Ras and Raf could both be regulated seemed in viable.

2.3 Summary

p 2 iCip-i, induced by activation of Raf-1 or Ras independently of p53 function, causes inhibition of DNA synthesis in the presence of serum by entering and inhibiting the activities of cyclin-CDK complexes. In addition, activated Ras and Raf-1 are able to stimulate mitogen-independent DNA synthesis. However the specificity of the cellular response to Raf-1 depends on the strength of the Raf-1 signal. In the absence of serum, weak to moderate activation of Raf-1 induces Cyclin Dl which correlates with mitogenic ability. In contrast strong Raf-1 signals induce p21^'^' and a cell cycle arrest in G l.

81 Chapter Two - Ras and Raf and the Cell Cycle

Therefore we conclude that Raf-1 is able to Figure 2.1 The strength of Raf- control opposing cellular responses because 1 activation determines signal different intensities of Raf-1 stimulate specificity differential gene expression. Ras^'" is also able to inhibit DNA synthesis in the presence of mitogens, however in the absence of serum, the potency of Ras^'" to stimulate DNA synthesis is much stronger than activated Raf-1. This correlates with an ability p21 Cyclin Dl to repress and delay p21‘^'P ‘ expression in comparison to Raf-1 activation. Furthermore, Ras is able to attenuate Raf-1-mediated p21*^'P" r * * induction. This indicates that Ras^'^ induces an activity that is able to downregulate p21^‘P'' through a Raf-independent signal transduction pathway which alters a potentially inhibitory signal into a mitogenic one. In the next chapter we explore this hypothesis by activating known Ras effector pathways and testing their abilities to attenuate Raf-1-mediated p21‘^''’ ‘ induction and inhibition of DNA synthesis. Chapter Two - Ras and Raf and the Cell Cycle

2,4 Figures - Chapter Two

83 Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.2 LXSN RafAR a) pLXSN RafAR PCR amphfied fragments encoding the kinase domain of c-Raf-1 (CRm aa 305 to 648) fused to the CAAX motif of Ki-Ras (Ki-Ras aa 169 to 188) and the hormone binding domain of the human androgen receptor (HBD huAR aa 646 to 917) were cloned in frame with an amino terminal 9E10 Myc epitope (Myc tag) into the replication deficient retroviral vector pLXSNS. b) Expression of RafAR in RafAR cells. RafAR and LXSN cells were grown in DMEM with 10% stripped NCS. Cells were lysed and 50 \ig of protein was subject to SDS- PAGE then analysed by Western blotting using the 9E10 antibody directed against the Myc tag. c) RafAR is activated by R1881. Confluent cultures of RafAR and LXSN cells were incubated in DMEM with 0.1% stripped NCS for 48 h and stimulated with 0.01% ethanol, 500 nM R1881 or 10% stripped NCS for 30 min. p42^’^'^^ was immunoprecipitated from 100 pg of protein. Immunocomplexes were collected on protein A sepharose beads, assayed for kinase activity with MBP as the substrate and subject to SDS-PAGE. The gel was then dried and exposed to X-OMAT film.

This experiment was performed by A.Sewing

84 Figure 2 .2 a)

HBD huAR (aa646-917) CR3 Raf-1 (aa305-648)

Myc CAAX tag RafAR Motif

LXSN LTR SV Neo LTR

LX Raf SN AR b )

RafAR

c) RafAR LXSN RI 881 - + NCS1 (500 nM) e m ^ MBP Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.3 Raf causes cell cycle arrest a) Activation of RafAR inhibits DNA synthesis. Subconfluent cultures of RafAR and LXSN cells growing in DMEM with 10% stripped NCS were treated with 0.01% ethanol or 500 nM R1881 for 16 h. DNA synthesis was measured by incubation with tritiated thymidine for 2 h prior to harvesting and assaying for thymidine incorporation. b) RafAR activation inhibits cells in G l. Subconfluent cultures of RafAR and LXSN cells growing in DMEM with 10% stripped NCS were treated with 0.01% ethanol or 500 nM R1881 for 16 h. DNA synthesis was measured by incubation with BrdU for 2 h prior to harvesting. Cells- were fixed in 70% ethanol and stained with propidium iodide (PI) for detection of total DNA and with anti-BrdU-FITC conjugated antibody for detection of DNA synthesis. Cells were then analysed by FACS. c) Effect of RafAR on protein expression. Subconfluent cultures of RafAR and LXSN cells growing in DMEM with 10% stripped NCS were treated with 0.01% ethanol or 500 nM R1881 for 16 h prior to lysis. 30-50 jig of protein was separated by SDS-PAGE and analysed by Western blotting. The blots were probed with antibodies against Cyclin E (sc-481), CDK2 (sc 163), CDK4 (sc260), p21°'”' (sc-757), p27“ '” (sc-528), Cyclin Dl (287.3) and pRb (14001A). d) RafAR activation downregulates Gl cyclin-dependent kinase activity. Cyclin E and Cyclin H were immunoprecipitated from 100 jig of protein using sc-481 and sc-609 respectively, Cyclin Dl was immunoprecipitated from 300 jig of protein using DCS 11. Immunocomplexes were collected on protein A beads (protein G beads in the case of Cyclin Dl) and their kinase activity towards specific substrates were determined. Substrates were Histone HI for Cyclin E, GST-pRb for Cyclin Dl and GST-CDK2 for Cyclin H.

This experiment was performed by A.Sewing

86 Figure 2.3 a) b)

1400 □ +EtOH +EtOH •2 1200 +R1881

Q- 1 0 0 0 Üo £ 800

^ 600 400 600 Propidfum Iodide

+R1881 S 200

RafAR LXSN

200 4 0 0 Propidium iodide + R1881

+ R1881 c) CDK2

p21 CDK4

p27 Cyclin D1

pRb Cyclin E

+ R1881 d) aCyclin E H!

IP aCyclin D1 pRb

aCyclin H CDK2 Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.4 is responsible for Raf-l-dependent inhibition of Gl Cyclin-associated kinase activity a) RafAR activation induces p21^'^'^ to enter CDK complexes. Cell lysates were taken from RafAR cells growing in DMEM with 10% stripped NCS that had been treated with 0.01% ethanol or 500 nM R1881 for 16 h. 250 jig of protein was used to immunoprecipitate CDK2 and CDK4, which were collected on protein A sepharose beads, boiled in SDS-sample buffer and separated by SDS-PAGE with a sample of total protein lysate in one lane. Gels were transferred to PVDF membranes and probed for p2 icip-i^ CDK2 and CDK4 with sc-757, sc-163 and sc-260 antibodies respectively. b) p21^'^' causes inhibition of Cyclin E-associated kinase activity. The inhibitory activity of lysates before and after activation of RafAR was tested with human Cyclin E-CDK2 complexes expressed in Rati cells (Perez-Roger et aL, 1997) as a target. Lysates were prepared from RafAR cells treated with 0.01% ethanol or 500 nM R1881 for 24 h. Samples of lysate from cells treated with R1881 were immunodepleted with either an antibody to p21^''"'' (sc-757) or with 2 jig unrelated immunoglobulin G (IgG). Target extract (10 jig) containing human Cyclin E-CDK2 complexes was mixed with 25 pg of extract, either from uninduced cells or from cells treated with R1881 depleted with IgG or anti-p21. As a control target extract mixed with lysis buffer was used. The mixed extracts were incubated at 20°C for 30 min. Cyclin E-CDK2 complexes were immunoprecipitated with an antibody specific for human Cyclin E (sc-198) and kinase activity was measured using histone HI as the substrate. c) Analysis of p21^'^' levels in lysate of the experiment described in the legend to panel b. Lysates of the cells after activation with antibodies to p21^'^ ' and IgG and before depletion were analysed by Western blotting with an antibody against p21^^' (sc-757).

This experiment was performed by A.Sewing Figure 2.5 RafAR induces transcription from the p21^'P * promoter

70 to 80% confluent RafAR cells were transiently co-transfected with 3.5 pg of a full length human p 2 l‘^'’’ ' promoter-luciferase construct (pCip-l-Luc) and a 2.5 pg of P- galactosidase reporter construct (CHllO-lacZ) using the standard calcium phosphate protocol. The precipitate was removed after 12 h and after another 12 h the cells were treated with 500 nM R1881 or 0.01% ethanol for 24 h. Cells lysates were harvested and assayed for luciferase and p-galactosidase activity. The luciferase values were normalised against P-galactosidase activity as a control for transfection efficiency.

This experiment was performed by A.Sewing

88 Figure 2.4 IP a) aCDK2 aCDK4 lysate I------11------1 R 1881 - + - + + (500 nM)

éÊÊb p2icipi

CDK2 CDK4

b) c)

RafAR extract + 4 - 4 - R1881 + + (500 nM)

histone —^ ,p 2 l C ip i H1 cf C; s >s.

immuno- immunodepletion depletion

Figure 2 .5

^ cO

R1881 (500 nM) Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.6 is responsible for Raf-dependent inhibition of growth in MEFs

Analysis of RafAR function in knockout MEFs. wt MEFs null for p53 (p53-/-), p21^'^'^ (p21^‘P‘*-/-) or Cyclin Dl (Dl-/-) were infected with pLXSN3 RafAR retrovirus. Subconfluent polyclonal populations of puromycin resistant cells growing in 10% foetal bovine serum (FBS) were treated with ethanol (0.01%) or 500 nM R1881 for 16 h: a) Growth inhibition after activation of RafAR. DNA synthesis was measured by incubation with tritiated thymidine for 2 h prior to harvesting and assaying for incorporation. b) Induction of p21^'P ’ and Cyclin Dl after hormone treatment. 50 |ig of protein from lysates of knockout MEFs were separated by SDS-PAGE and analysed by Western blotting for expression of p21^'‘’ ' and Cyclin Dl with sc-757 and 287.3 antibodies respectively.

This experiment was performed by A.Sewing

90 0) •ê 3H Thymidine incorporation (cpm) 3 ro rv) en N O en O b) O O Oen O

■o en OJ T 3 en I + eo ■O r\j un O O + 13

O Tr\3 3 + Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.7 RafAR is able to stimulate DNA synthesis in a dose-dependent manner a) RafAR is able to stimulate different levels of ERK activity. Confluent cultures of RafAR cells were incubated in DMEM with 0.1% stripped NCS for 48 h. Cells were then stimulated with the indicated concentrations of testosterone for 16 h. Cell lysates were taken and p42^'"^ was immunoprecipitated and its kinase activity was tested with myelin basic protein (MBP) as the substrate b) RafAR can induce DNA synthesis in a dose-dependent manner. Confluent cultures of RafAR cells were incubated in DMEM with 0.1% stripped NCS for 48 h. Cells were then stimulated with the indicated concentrations of testosterone for 18 h. DNA synthesis was measured by incubation with tritiated thymidine 2 h prior to harvesting and assaying for incorporation. c) RafAR differentially upregulates p21^‘'^' and Cyclin Dl expression. Confluent cultures of RafAR cells were incubated in DMEM with 0.1% stripped NCS for 48 h. Cells were then stimulated with the indicated concentrations of testosterone for 16 h. Cell lysates were taken and 30 p,g of protein were separated by SDS-PAGE and western blotted, the membrane was cut into two pieces and then analysed for expression of Cyclin Dl and p21^'P‘' with 287.3 and sc-757 antibodies respectively.

This experiment was performed by A.Sewing

92 Figure 2.7

a)

-4— MBP

0 2 10 500

Testosterone (nM)

b) 2000

1500

o o -E 1000 0)

I-

5 500

0 1 2 5 10 20 50 500 Testosterone (nM)

c) Cyclin D l

Cipi .4k* W./*. p21

0 2 10 500

Testosterone (nM) Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.8 Activation of ARafiER provokes a similar response to RafAR a) ARafiER consists of the CRm domain of human c-Raf-1 (aa 305 to 648) fused to the amino terminus of an EcoRI/Clal fragment consisting of the hormone binding domain of the HE14 allele of the human oestrogen receptor (Samuels et aL, 1993). b) ARafiER activates ERK phosphorylation in a dose-dependent manner. Confluent cultures of ARER cells were incubated in DMEM containing 0.25% NCS for 36 h. Fresh media with 0.25% or 10% NCS with indicated concentrations of P-oestradiol was added for 30 min. Cells were then lysed and proteins were separated on a MAP kinase shift gel by SDS-PAGE and analysed sequentially for total p42^‘^ and phosphorylated p 4 2 ^ and p4 4 Erki yy W'estem blotting with 122.2 and phospho p42/44 MAP kinase antibodies respectively. c) ARafiER induces mitogen-independent DNA synthesis in a dose-dependent manner. Confluent cultures of ARER cells were incubated in DMEM containing 0.25% NCS for 36 h. Cells were then incubated in fresh media containing 0.25% or 10% stripped NCS as indicated, the indicated concentrations of P-oestradiol or 0 .0 1 % ethanol and tritiated thymidine for 22 h. The cells were then assayed for tritiated thymidine incorporation. d) ARafiER causes inhibition of cell cycle progression. Subconfluent cultures of ARER/ARlf cells (described in Chapter 3) were cultured in DMEM with 10% stripped NCS. Fresh media containing 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) was added to the cells for 16 h. DNA synthesis was measured by the addition of tritiated thymidine 3 h prior to harvest and analysis.

94 Figure 2.8 a) N CR3 Raf-1 HBD huER

PP42ERK2 b) P42ERK2

ppERKZ ppERKl 0 0.1 1.0 5.0 500 10% 1 ------INCS p-oestrodiol (nM) c)

24000

12000

2 10000 o Q. UO 8000 > 4000 t- X en 2000

0 0.5 1 1.5 500 0.1 0.75 1.25 2.5 2 0 |io% NCS p-oestrodiol (nM) d)

1 6 0 0 0 0

.9 120000

o Q. 8 8 0 0 0 0 c

I 4 0 0 0 0

0 0 25 50 100

4-OHT (nM) Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.9 Tetracycline repressible retrovirus, pBPSTRl

The pBPSTRl retrovirus consists of a cytomegalovirus promoter (CMV) containing tet operator (tetO) sequences upstream of a cDNA of the gene to be induced (gene X). A simian virus 40 promoter (SV40) drives expression of a VP 16-tetracycline repressor fusion protein (tTA) which is a transcriptional activator. In the absence of tetracycline or doxycycline tTA binds to the tetO sequences and activates transcription from the CMV promoter. Tetracycline and doxycycline bind tTA and prevent its interaction with tetO sequences. The puromycin resistance gene is regulated by the long terminal repeat (LTR) of the retrovirus.

96 Figure 2.9

Repression in th e presence of D o x /T e t

A c tiv a tio n in th e absen ce o f D o x /T e t

Protein X Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.10 RafCAAX expression is inducible in STRCX clones

Clones of STRCX were selected in the presence of doxycycline (100 ng/ml) and 2.5 pg/ml puromycin. Two dishes of each clone were cultured in the presence or absence of doxycycline (100 ng/ml) in DMEM with 10% NCS for 72 h. Cells were harvested and 50 jig of protein lysate was separated by SDS-PAGE and analysed by Western blot for expression of RafCAAX using the 9E10 antibody.

Figure 2.11 RafCAAX expression inhibits DNA synthesis

Subconfluent of STRCX clones 6 , 11, 15 and 16 and ST cells were incubated in DMEM with 10% NCS in the presence or absence of doxycycline (100 ng/ml) for 46 h. DNA synthesis was measured by addition of tritiated thymidine for 3 h prior to harvest and assaying for incorporation.

98 Figure 2.10

1 2 3 4

RafCAAX

5 6 7 8

RafCAAX

10 11 13 14

RafCAAX

15 16 17 18

. - : RafCAAX

Dox + - + - + - + - 100 ng/ml)

Figure 2.11

35000 □ + Dox - Dox

30000 CLO

o 25000 g o CL 20000 o o _c

0) 15000 c

E 1 0000

X 5000 co

RCX6 RCX11 RCX15 RCX 16 ST Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.12 RafCAAX induction of DNA synthesis is dose dependent

a) RafCAAX expression levels are regulatable. Confluent cultures of STRCX 6 cells were incubated in DMEM containing 0.25% serum and doxycycline (100 ng/ml) for 48 h. The doxycycline was washed out and fresh media with the indicated concentrations of doxycycline was applied to the cells for 28 h. Photographs of the cells were taken prior to harvesting. 50 |Xg of total protein was separated by SDS-PAGE and analysed by Western blot. Membranes were sequentially probed for RafCAAX and endogenous Raf- 1 using 9E10 and sc-227 respectively. b) RafCAAX induces DNA synthesis in a dose-dependent manner. Confluent cultures of

STRCX 6 cells were incubated in DMEM containing 0.25% serum and doxycycline (100 ng/ml) for 48 h. The doxycycline was washed out and fresh media containing tritiated thymidine and the indicated concentrations of doxycycline was applied to the cells for 28 h. Cells were assayed for tritiated thymidine incorporation

100 Figure 2.12 a) Raf CAAX

Raf-1

Dox 100 0 100 5 1 0.5 0.1 0 (ng/ml) ST STRCX 6

Dox (100 ng/ml) No Dox

b) 6000

E OCL c o

o 4000 Q. O _c c

X co

100 1 0.5 0.1 Dox (ng/ml) Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.13 Ras expression is inducible in STRas clones

Clones of STRas were selected in the presence of doxycycline (100 ng/ml) and 2.5 |ig/ml puromycin. Two dishes of each clone were cultured in the presence or absence of doxycycline (100 ng/ml) in DMEM with 10% NCS for 72 h. Cells were harvested and 30 pg of protein lysate was separated by SDS-PAGE and analysed by Western blot for expression of Ras using the Y13-259 antibody.

102 Figure 2.13

1 2 3 ^ ST

#*# Ras

5 6 7 8

Ras

11 12 13 14

m # # «## Ras 15 16 17 18

m Ras

Dox 100 ng/ml) + - + - + - + - + Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.14 Ras expression inhibits DNA synthesis

Sparse cultures of STRas c l 8 and ST cells were incubated in DMEM with 10% NCS in the indicated concentrations of doxycycline for 65 h. a) Ras^'^ expression inhibits serum-stimulated DNA synthesis. DNA synthesis was measured by the addition of tritiated thymidine to the cells 4 h prior to harvesting. b) Ras^*^ expression levels are regulatable and induce p21^^\ Lysates were taken and 30 jig of protein was separated by SDS-PAGE and analysed by Western blot. Membranes were sequentially probed for Ras and p21^^' using pan-ras and sc-397 antibodies respectively. c) Ras^'^ expression retards cells in G l. Cells were trypsinised, fixed in 70% ethanol, permeabilised and stained with propidium iodide. The DNA content of the cells was then analysed by fluorescence activated cell scanning.

104 Figure 2.14

a) 40000 ■STRas □ ST E CL 30000

C o

o CL o 20000 o _c

0) c

E 10000

X co

100 5 1 0.5 0.1 0 Dox (ng/ml)

b)

Ras %. ..rnwm. JHMI

p2icipi . - -

Dox (ng/ml) 100 100 5 1 0.5 0.1 0 0

STRas + + + + ST +

C) Cell-line Dox (ng/ml) Percentage of cells in Gl ST 100 61.45

ST 0 59.00

STRas 100 63.81

STRas 5 65.16

STRas 1 71.78

STRas 0.5 71.28

STRas 0.1 73.05

STRas 0 74.89 Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.15 expression induces mitogen-independent DNA synthesis a & b) Ras^'^ expression is induced at 8-10 h. Subconfluent cultures of STRas clB cells in DMEM with 10% NCS and doxycycline (100 ng/ml) had doxycycline washed away and were incubated in its absence for the indicated time periods. Cells were then harvested and 30 jig of protein was separated by SDS-PAGE and analysed by Western blot for expression of Ras using the pan-ras antibody. For (b) the membrane was stripped and re-probed for p21^^' expression with sc-397 antibody. c) Ras^^^ induction stimulates p42^*^^^ kinase activity. Confluent cultures of STRas clS cells were incubated in DMEM with 0.25% NCS in the presence of doxycycline (100 ng/ml) for 48 h. Doxycycline was then gently washed out of the cells and the cells were harvested at the indicated time points. 1 0 0 |ig of protein was immunoprecipitated with

1 2 2 . 2 antibody and immunocomplexes were analysed for p42^'^^ kinase activity using MB? as a substrate. d) Ras^'^ expression induces DNA synthesis in the absence of mitogens. Confluent cultures of STRas c l 8 cells were incubated in the presence of doxycycline (100 ng/ml) in either DMEM alone or DMEM with 0.25% NCS for 48 h. Doxycycline was washed out of the cells and the cells were incubated for the indicated time periods in the absence of doxycycline. Tritiated thymidine was added for 2 h prior to harvesting for analysis of DNA synthesis.

106 Figure 2.15

a) w mm Ras Minus 24 0 2 4 6 8 1012 24 Dox (h) '------' ST STRas cl 8

b) Ras

p2iCipi Minus 0 Dox (h) - 24.36 48 48 ST STRascl 8 ST

C) MBP

Minus 0 0 1 2 16 Dox (h) ST *— STRas cl 8 d) 60000 0% serum 0.25% serum E 50000 OQ. 5 40000

30000

c 20000

10000

12 16 20

Minus Dox (h) Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.16 and RafCAAX differentially upregulate

Confluent cultures of STRas c l 8 cells or STRCX cells (as indicated) were incubated in the presence of doxycycline (100 ng/ml) in DMEM with 0.25% NCS for 48 h. Doxycycline was washed out of the cells and the cells were incubated for the indicated time periods in the absence of doxycycline. a) Ras^‘^ induces a higher level of DNA synthesis than RafCAAX. Tritiated thymidine was added for 2 h prior to harvesting for analysis of DNA synthesis. The figure shows fold increase in DNA synthesis over background since the STRas and STRCX experiments were carried out at different times. b) Western lysates were taken and 50 pg of protein were separated by SDS-PAGE and analysed by Western blot. Membranes were probed for Ras, p21^'P ’ and Cyclin D1 expression with pan ras, sc-397 and 287.3 antibodies respectively.

108 Figure 2.16 a) 16.0 • STRas 14.0 STRCX

2.0 o Q. O _c 10.0

CD C 8.0 >>E c 6.0

CD COC/5 E 4.0 o _c

o 2.0

0.0 10 20 30 40 50 Time minus Dox (h) b)

^ Ras STRas l_ p2lCip1

_ 0 14 22 30 38 46 Minus Dox (h)

p 2 1 Cipi

STRCX Cyclin D1

p-tubuiin

14 22 30 38 Minus Dox (h) Chapter Two - Ras and Raf and the Cell Cycle

Figure 2.17 downregulates induction by ARaf:ER a) Expression of Ras^'^ reduces p21^'^'^ expression and induction. Confluent cultures of ARER/Ras^^^ and ARER/ST cells were incubated in 0.25% stripped NCS for 24 h. Cells were then trypsinised and seeded subconfluently on new dishes in DMEM with 0.25% DMEM for 24 h. Fresh media was then applied containing 10% stripped NCS and serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) for 24 h. Cell lysates were taken and 40 pg of protein was separated by SDS-PAGE and analysed by Western blot for expression of Ras, Cyclin D1 and ^-tubulin as a loading control with pan ras, sc-6246, 287.3 and T4026 antibodies. In addition, 10 pg of protein was separated on a MAP kinase shift gel and analysed for p42^'"'^ phosphorylation with 1 2 2 . 2 antibody.

b) Induction of DNA synthesis by Ras^'^ is inhibited by ARafiER. Confluent cultures of ARER/Ras^'^ and ARER/ST cells were incubated in 0.25% stripped NCS for 24 h. Cells were then trypsinised and seeded subconfluently on new dishes in DMEM with 0.25% DMEM for 24 h. Fresh media was then applied containing 0.25% stripped NCS and serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) for 24 h. BrdU (10 pM) was applied to the cells 4 h prior to harvesting the cells for analysis of DNA synthesis by FACS. Cells were fixed in 70% ethanol and stained with propidium iodide (PI) for detection of total DNA and with anti-BrdU-FITC conjugated antibody for measurement of DNA synthesis by FACS analysis.

110 Figure 2.17

4-OHT nM a) 1 1 0 1 10 100 10% NCS 1 II 111 ■ Il i| 1

mm mm mm mm . mm ******* wwM» n É b mrnm- m m Ras

^ mm * — ^ ppERK2 am m m «m 3 KBS««ERK2

— WM» *WW» WMWW p2i^'p-i

'«WWW». 4WW#- "«WWWTI ..mmmo- 1 ■m— Cyclin D1

■m— p-tubulin

ARER/Ras^i2 - + . + ARER/ST + - + - + - + - + -

b) 10 □ ARER/ST ARER/Ras

O 2 - 8 6 _c =) -o m & 4 B mc E 0) o CL ^

1 10 1 0 0

4-OHT nM Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

3. The Effects of PI 3-kinase, Rif and RhoA on Raf-1 Regulation of the Cell Cycle

112 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

3.1 Introduction

In the previous chapter we have observed that Ras^'^ has a greater ability to induce DNA synthesis than Raf-1. We have proposed that the differences may be caused by the ability of Ras to activate a Raf-independent pathway which downregulates p21^'^ ' expression induced by Raf-1 activation.

In addition to the Raf family, two other protein families have met the criteria required to be considered genuine Ras effectors. PI 3-kinases and Ral-GEFs are both able to bind Ras in a GTP-dependent manner, they are able to reproduce downstream effects of Ras, and interference with their function inhibits cellular responses to Ras activation (Campbell et a i, 1998). This was discussed at length above. Furthermore, both have been shown to have a mitogenic influence on the cell. Intact PI 3-kinase binding sites are required on the PDGF receptor for PDGF stimulation of DNA synthesis (Valius and Kazlauskas, 1993). Moreover, dominant negative PI 3-kinase mutants, neutralising PI 3-kinase antibodies or specific chemical inhibitors to PI 3-kinase are able to inhibit growth factor and serum-stimulated DNA synthesis (Cheatham et ai, 1994; Jhun et al., 1994; Roche et al., 1994). They are also able to inhibit Ras-mediated transformation (Rodriguez-Viciana et al., 1997). Moreover, a constitutively active mutant of PI 3-kinase has been shown to support mitogen-independent DNA synthesis (Frevert and Kahn, 1997). Constitutively active Ral-GDS like factor (Rif), has been shown to promote colony formation in reduced mitogen conditions (Wolthuis et al, 1997). A dominant negative mutant of Ral was also able to inhibit Ras-mediated transformation (Urano et al., 1996). In addition, experiments with Ras effector domain mutants have demonstrated that Ras-mediated DNA synthesis was dependent on activation of at least two effector pathways (Joneson et al., 1996b). This supports our hypothesis that Raf-1 requires additional Ras signals to efficiently induce DNA synthesis.

Therefore the ability of PI 3-kinase and RalGEFs to alter the cellular response to Raf-1 activation was tested to determine whether they could counteract Raf-1 induction of p21^’'^' and increase mitogenic stimulation by Raf-1.

3.2 Results

3.2.1 Cell Cycle Regulation by Phosphatidylinositol-3’ Kinase and Raf-1

To investigate the effect of PI 3-kinase on cell growth, cell-lines with constitutive PI 3- kinase activity were generated from ARER cells. Mammalian expression vectors, pEFBos rCD2pl 10 and pEFBos rCD2pllOR-P (a kind gift from D.Cantrell) were stably co-transfected with the selection marker pJ 6 Puro into ARER cells and pools of puromycin

113 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1 resistant ARER/pllO and ARER/pllOR-P cells were generated. rCD2pllO is a fusion protein comprising of the pi 10 subunit of PI 3-kinase and the transmembrane domain of the rat CD2 cell surface antigen (Reif et al., 1996). The rCD2 domain serves to localise the pi 10 domain to the intracellular membrane causing constitutive activation (Reif et al., 1996). A control cell-line was also generated that expressed a kinase-inactive mutant, rCD2pllOR-P, which had a single point mutation (R1130P) in its kinase domain (Dhand et al., 1994).

We tested whether PI 3-kinase activity could increase the efficiency of Raf-mediated DNA synthesis initiation and downregulate p21^'^\ Serum-deprived, sub-confluent, quiescent cultures of ARER/pllO and ARER/pllOR-P cells were stimulated with 4-OH tamoxifen or ethanol at the indicated concentrations for 30 h and their DNA synthesis was measured by a tritiated thymidine incorporation assay. In addition cell lysates were taken, separated by SDS-PAGE and analysed by Western blot for expression of rCD2pllO fusions, Cyclin Dl, p21^'P ', p27*^‘’’ and for ERK phosphorylation.

Expression of rCD2pllO and rCD2pllOR-P was detected in ARER/pllO and ARER/pl lOR-P cells (Figure 3.1a). However, expression of rCD2pllOR-P was very low compared to rCD2pl 10. The low expression may be due to a growth inhibitory effect of the mutant pi 1 0 molecule, possibly through sequestration, however a similar number of ARER/pl lOR-P puromycin resistant colonies were obtained as compared to the ARER/pl 10 transfectants. The degree of ERK phosphorylation acts as an indicator of ARaf:ER activity. ERK proteins were not phosphorylated in the absence of 4-OH tamoxifen and ERK phosphorylation was not detected in 1 nM 4-OH tamoxifen. However, addition of 10 nM 4-OH tamoxifen stimulated ERK phosphorylation and lOOnM 4-OH tamoxifen resulted in the highest phosphorylation. There was no difference in the degree of phosphorylation between ARER/pl 10 and ARER/pl lOR-P cells, which indicated that PI 3-kinase activation did not increase ARafiER activation of ERK.

ARER/pl 10 cells had a two fold higher basal level of DNA synthesis than control cells which was further activated by stimulation of ARafiER with 1 nM 4-OH tamoxifen. However the combined induction of DNA synthesis by ARafrER and PI 3-kinase activation was only equivalent to the sum of the effect of each individually. In addition, ARER/pl 10 cells demonstrated a degree of resistance to maximal ARafiER activation and maintained a higher level of DNA synthesis than control cells in the same concentration of hormone (Figure 3.1b).

Unexpectedly, PI 3-kinase co-operated with Raf-1 to induce p21^'^'^ expression. 1 nM 4- OH tamoxifen was insufficient to induce p21^‘‘’ ’ by activation of ARafiER alone, however it could induce p21^'^'' in the presence of PI 3-kinase activity (Figure 3.1a). This indicated that PI 3-kinase changed the threshold of Raf activity required for p21^‘‘’’’

114 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1 expression. In addition, the presence of PI 3-kinase activity allowed strong ARafiER activation to induce much higher expression levels of p 2 1 ^'^' than ARafiER alone.

In spite of the co-operative induction of p21^'P * by PI 3-kinase in response to ARafiER activation, this did not prevent induction of DNA synthesis. Indeed weak activation of ARafiER by 1 nM 4-OH tamoxifen in the presence of PI 3-kinase stimulated more DNA synthesis than Raf alone even though p21^'P ’ has been induced in the ARER/pllO cells and not the control cells (Figure 3.1a and b). Furthermore cells treated with 10 nM 4-OH tamoxifen prevented DNA synthesis in cells with ARafiER alone while cells in the presence of PI 3-kinase activity had higher DNA synthesis levels. However much more p2 l ‘^'p ' was expressed in the presence of PI 3-kinase. This shows that p 2 l‘^'’’ ’ concentration does not necessarily correlate with cell cycle progression.

To understand how PI 3-kinase induced DNA synthesis we examined the relative levels of Cyclin Dl and p27*^'P'. The presence of PI 3-kinase activity increased the expression levels of Cyclin Dl and reduced expression of the cell cycle inhibitor p27’^'P'. This may explain the ability of cells in the presence of PI 3-kinase activity alone to induce DNA synthesis. However ARafiER activation also reduced p27"^^' levels, which went down as p 2 1 ^'P ' level were induced, therefore, the reduction in p27’^'P' could not explain the superior mitogenic ability of PI 3-kinase in the presence of strong Raf activity. In addition, Cyclin Dl levels in response to strong Raf activation are equivalent in the presence or absence of PI 3-kinase, which eliminated the possibility that Cyclin Dl was sequestering the extra p21^''’ ’. However another factor may be able to sequester the excess p21^'‘’ *, the relative kinase activities of the cyclin-CDK complexes would need to be determined to investigate this further.

We also assessed whether in addition to inducing DNA synthesis in the absence of mitogens, PI 3-kinase was able to attenuate Raf-mediated inhibition of DNA synthesis in the presence of serum, since we had specifically demonstrated that this was dependent on p 2 iCip-i ^RER/piio and ARER/pl lOR-P cells were cultured at subconfluence in 10% NCS with the indicated concentrations of 4-OH tamoxifen for 16 h. Their DNA synthesis was measured by tritiated thymidine incorporation analysis. Unstimulated ARER/pllO and ARER/pl lOR-P cells had a similar level of DNA synthesis in the presence of NCS (Figure 3.1c). The presence of PI 3-kinase activity could attenuate, but not prevent ARafIER-mediated inhibition of DNA synthesis.

In conclusion, PI 3-kinase was unable to mimic the downregulation of p21^'P ’ by Ras, which suggests Ras does not use this pathway to affect p21^'^'^ levels. Indeed PI 3- kinase and Raf-1 co-operatively induced p21^'P'\ However PI 3-kinase demonstrated mitogenic potential which correlated with downregulation of p27’^‘‘’’ and induction of Cyclin Dl. Furthermore PI 3-kinase was able to increase the ability of weak Raf activity

115 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1 to induce DNA synthesis and also provided some resistance to inhibition of DNA synthesis by strong Raf-1 activation.

3.2.2 The effect of Raf-1 activation in the presence of RalGEF activity

Another family of Ras effectors are the RalGEFs. The effect of constitutive activation of this pathway was investigated to test whether it could attenuate the cellular response to ARafiER activation. Due to a possibility of synergy between RalGEFs and PI 3-kinase these experiments were carried out in the presence or absence of PI 3-kinase activity.

We used a constitutively activated form of the RalGEF family member, Rif in which the activation domain of Rif had been fused to the CAAX motif of Ki-Ras to localise the protein to the membrane (Wolthuis et al, 1996). This protein is referred to as RlfCAAX. An inactive version of RlfCAAX that has had its transactivation domain deleted (Wolthuis et al, 1996) was used as a control and is referred to as ARlfCAAX. Both proteins were fused to HA epitope tags for detection purposes. ARER cells were stably co-transfected with mammalian expression vectors, pmt RlfCAAX or pmt ARlfCAAX (Both plasmids were kind gifts from J. Bos) and pEFBos rCD2pllO or pEFBos rCD2pllOR-P and the selection marker pJ 6 Puro. These cells were selected for resistance to puromycin and four new cell lines, ARER2, ARER2/Rlf, ARER2/pl 10 and ARER2/Rlf/pl 10 were generated. These cell-lines were tested for protein expression. Lysates from each cell-line was subject to immunoprécipitation with the HA antibody and immunocomplexes were separated by SDS-PAGE and analysed by Western blotting with the HA antibody. RlfCAAX was detected in ARER2/Rlf and ARER/Rlf/pl 10 cells, however ARlfCAAX was not detected in ARER2 or ARER2/pllO cells (Figure 3.2a). The lack of detectable expression may be due to a defect in the expression plasmid (although this plasmid gives the expected restriction enzyme digest pattern). It could also indicate that the protein acted in a dominant negative manner that could not be tolerated in the cells. However a similar number of ARER2 or ARER2/pllO puromycin resistant colonies were obtained as compared to the ARER2/Rlf and ARER/Rlf/pl 10 transfectants. Total cell lysates were also analysed for rCD2pl 10 expression by Western blotting. rCD2pl 10 was expressed in ARER2/pl 10 and ARER2/Rlf/pl 10 cells. However as in ARER/pl lOR-P cells above, expression of rCD2pl lOR-P was very low (Figure 3.2b).

The ability of these molecules to promote mitogen-independent DNA synthesis was tested in response to ARafiER activation. Serum-deprived, confluent cultures of ARER2, ARER2/Rlf, ARER2/pl 10 and ARER2/Rlf/pllO cells were stimulated with the indicated concentrations of 4-OH tamoxifen or ethanol for 30 h and their DNA synthesis was assessed by a tritiated thymidine incorporation assay.

116 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

In the absence of ARafiER activation, RlfCAAX induced a degree of mitogen- independent DNA synthesis, however this was very low compared to unstimulated ARER2/pllO cells expressing activated PI 3-kinase (Figure 3.2c). Expression of RlfCAAX did not significantly assist induction of DNA synthesis by weak ARafiER activation. Furthermore, it provided no protection against inhibition of DNA synthesis by strong Raf-1 signals.

Interestingly, in the absence of ARafiER activation, Rif activity co-operated with PI 3- kinase activity to induce a higher level of mitogen-independent DNA synthesis than PI 3- kinase alone or in combination with activated ARafiER. Thus Rif did have mitogenic ability, but only in combination with PI 3-kinase, not Raf. This implied that activation of Raf-independent Ras effector pathways were sufficient for DNA synthesis and that activation of Rif was permissive for PI 3-kinase stimulation of DNA synthesis. However, since both ARER2/pl 10 and ARER2/Rlf/pl 10 cells had similar DNA synthesis levels when treated with 10 and 100 nM 4-OH tamoxifen, the presence of Rif in addition to PI 3-kinase activity provided no more protection against Raf-mediated inhibition of DNA synthesis than PI 3-kinase alone.

Therefore it appeared that the RalGEF effector pathway could not attenuate DNA synthesis inhibition by ARafiER in the presence or absence of PI 3-kinase activity and so was not investigated further.

3 .2 .3 Rho signals and Raf upregulation of p21^'P *

The small GTPase RhoA has recently been proposed to have a vital role in Ras^'^ induction of DNA synthesis. Olson and colleagues (1998) have demonstrated that in contrast to NIH 3T3 cells, microinjection of Ras^'^ did not induce DNA synthesis in quiescent Swiss 3T3 cells. Quiescent Swiss 3T3 cells are thought to have no basal level of Rho activity because they are devoid of stress fibres, whereas quiescent NIH 3T3 cell contain stress fibres. Activation of Rho in quiescent Swiss 3T3 fibroblasts, by co­ microinjection of RhoA^''* or application of Exoli cytotoxic necrotising factor-1 (CNF-1) which selectively stimulates Rho activity (Flatau et al., 1997; Schmidt et al., 1997), was shown to downregulate Ras-induced p21^’'’'* expression and allow induction of DNA synthesis. Furthermore, Ras^'^ induced cell cycle progression in NIH 3T3 cells or serum-induced DNA synthesis in Swiss 3T3 cells was sensitive to the RhoA specific inhibitor, C3 transferase, which permitted induction of p21^'^ ' (Olson et al., 1998). Thus Rho activity was able to inhibit Ras^'^-mediated upregulation of p21^'^ ' which then permitted a mitogenic response to Ras^^^.

The differences we observe between the ability of Ras^'^ and Raf-1 activation to regulate p21^'P ' may therefore be related to their relative abilities to induce Rho activity. Raf and

117 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

Rho signalling are thought to activate separate pathways because their co-activation leads to synergistic focus formation. In addition many possible mechanisms have been proposed that would permit Ras regulation of Rho activity. For example, the RasGAP, p i20°^^ binds directly to the RhoGAP, p i90°"^^ (Settleman et al., 1992). In addition, RhoGEFs such as Vav are regulated by events which can be mediated by Ras, such as PI 3-kinase activity (Han et al., 1998). Ras^^^ has also been demonstrated to increase the nucleotide exchange activity of the RasGEF, Sos on the Rho family member, Racl (Nimnual et al., 1998). A link between the Ras effector family, the RalGEFs and Rho family proteins has also been implied since Ral binding protein 1 (RalBPl/RLIP 1/RIP 1) has been shown to have GAP activity towards Cdc42 and Racl, but not RhoA (Cantor et al., 1995; Jullien-Flores et al., 1995; Park and Weinberg, 1995). Furthermore, a function for RhoA downstream of Ras is suggested because dominant negative mutants of Rho have been shown to inhibit Ras-mediated focus formation (Khosravi-Far et al., 1995; Prendergast et al., 1995; Qiu et al., 1995b). These data taken in relation to the differences in p21^'*’ ' induction between activated Ras and Raf-1 in our experiments, support a model in which Ras^'^ could stimulate Rho activity in NIH 3T3 cells through a Ras effector pathway distinct from Raf which would inhibit Raf-mediated induction of p2 iCip-i However, since serum induces Rho activity and we have observed induction of p 2 l‘^'P*' and inhibition of DNA synthesis by Ras and Raf-1 activation in the presence of serum Rho may have a more subtle role for example, delaying the onset of p21*^’P'* expression.

To investigate the possibility of RhoA involvement, a new cell-line was generated. ARER cells were stably co-transfected with a mammalian expression vector encoding a constitutively activated RhoA mutant, RhoA^'“^ with a myc tag, pLink RhoA^''* or the empty vector and the selection marker pJ 6 Puro. Cells were selected for resistance to puromycin and polyclonal populations were obtained and are referred to as ARER/Rho or ARER/plink.

The effect of RhoA activity on Raf-1-mediated induction of p21^'*’'’ was then tested. In addition we assessed whether activated RhoA would affect the ability of ARafiER to stimulate DNA synthesis. Quiescent, subconfluent, serum-deprived ARER/Rho and ARER/plink cells were stimulated with the indicated concentrations of 4-OH tamoxifen for 30 h. Western lysates were separated by SDS-PAGE and immunoblotted. DNA synthesis was measured by both tritiated thymidine and BrdU incorporation.

Expression of RhoA was detected by Western blotting using the 9E10 antibody to detect the Myc tag (Figure 3.3). Cyclin Dl levels were induced in unstimulated ARER/Rho cells compared to ARER/plink cells indicating that RhoA was active. This was also evident from the exaggerated transformed morphology these cells demonstrated upon

118 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

ARafrER activation in comparison to ARafrER activation alone. A similar morphological change was observed in cells expressing both activated Ras and RhoA (Khosravi-Far et aL, 1995). However the significance of this change is unclear since the contribution of morphological alterations to transformation has not yet been explained. j In contrast to our expectations RhoA co-operated with Raf to induce p21^'^\ This effect was very similar to the response of these cells to constitutive activation of PI 3-kinase. However, the presence of RhoA activity did not induce DNA synthesis and did not assist DNA synthesis induction by ARafrER. Indeed, in response to strong ARafrER activation with 100 nM 4-OH tamoxifen the degree of DNA synthesis was actually reduced in ARER/Rho cells compared to ARER/plink cells (Figure 3.3b and c). This may have been a response to the substantially higher levels of p 2 1 ^'^' in these cells compared to controls. The inability of RhoA to support DNA synthesis is consistent with reports which show RhoGEFs only poorly stimulate mitogen-independent growth (Schwartz et al., 1996). However this contrasts with experiments in which microinjection of activated RhoA was able to induce DNA synthesis (Olson et at., 1995).

We had observed a delay in the induction of p 2 l‘^'P ' by Ras^'^, therefore we tested the rate of p21^'"''' induction by Raf-1 in the presence of RhoA to test whether RhoA delayed induction of p21^‘P ’ rather than inhibiting its expression. Serum-deprived, confluent ARER/Rho and ARER/plink cells were stimulated for the indicated time periods with 4- OH tamoxifen and then harvested. Cell lysates were separated by SDS-PAGE and analysed by Western blot. The presence of RhoA^*'* accelerated p21^‘'’'' induction by

ARafiER. 8 h after 4-OH tamoxifen addition p21^'P ' was absent from ARER/plink cells, but was induced to a substantial degree in ARER/Rho cells. p21^'^'' began to be induced in ARER/plink cells by 12 h, but at a lower level than in the ARER/Rho cells at either 8 or 12 h. In addition, the presence of RhoA activity was unable to prevent the reported transient upregulation of p21^'P ' by serum (Figure 3.3d) (Michieli e ta l, 1994).

RhoA induced Cyclin Dl expression in both unstimulated and stimulated ARER/Rho cells. However, this was insufficient to stimulate DNA synthesis. The inability of RhoA^''^ to stimulate mitogen-independent DNA synthesis may have been due to the high levels of p27’^P‘ in the cells. ARER/pl 10 cells also expressed a higher level of Cyclin Dl compared to control cells and superinduce p21^'^ ' in a similar manner to the ARER/Rho cells. However, in contrast to the ARER/Rho cells, constitutive PI 3-kinase activity downregulated p27’^*'’’ expression. p27‘^'’' levels were also downregulated by ARafiER activation and addition of serum. Therefore, downregulation of p27^'P% correlated with mitogenic signalling, and thus the inability of Rho to reduce p27’^'P’ levels may have prevented initiation of DNA synthesis.

119 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

In addition, ARER/Rho cells had a higher level of ERK phosphorylation in the absence and presence of 4-OH tamoxifen. Rho signalling has been demonstrated to feed into the ERK MAP kinase module (Renshaw et al., 1997). However, since this did not occur if ARER/Rho cells were subconfluent, this may not be significant to the p21^'P** induction.

To test whether RhoA would behave differently in the presence of serum the ability of constitutively activated RhoA to attenuate ARafiER mediated cell cycle arrest was assessed in serum-stimulated asynchronously growing ARER/Rho and ARER/plink cells. However, similar to the experiments shown in Figures b and c, Rho did not alter Raf inhibition of DNA synthesis (Figure 3.3e).

Therefore, in contrast to its reported role, RhoA activation was unable to prevent upregulation of pll^'^ ' by ARafiER or by serum. Furthermore, it was unable to induce DNA synthesis or protect against DNA synthesis inhibition by ARafiER and actually reduced the low mitogenic ability of strongly activated ARafiER. This may be related to the superinduction of p21^'^ ' that occurred upon co-activation of RhoA and Raf-1 signals. These properties of RhoA^''^ contrast its reported abilities upon microinjection or activation using CNF-1. This is possibly due to the different exposure of the cells to RhoA, caused by the different techniques of inducing Rho activity. Microinjection or CNF-1 treatment causes acute activation of RhoA, whereas our cells were exposed to constitutive RhoA activation which may also result in cellular adaptation. As we have demonstrated above the strength and duration of activation of a signal transduction pathway can have contrasting effects.

3.3 Summary

Although we have observed that Ras^'^ can attenuate induction of p21^'^ ' by Raf, we have found no evidence from our experiments that constitutive activation of the PI 3- kinase and RalGEF Ras effector pathways can mimic the effects of Ras. Moreover, in contrast to its reported ability, constitutive expression of RhoA^'"* does not suppress p21^'P ' or counteract the effects of Raf. However, we have found that PI 3-kinase has mitogenic ability which may be related to its abihty to downregulate p27*^’^' and induce Cyclin Dl. Furthermore PI 3-kinase can increase the ability of Raf to induce DNA synthesis and suprisingly this occurs in the presence of high levels of p21^'^'\ In addition, although Rif is ineffectual as a mitogen when expressed alone, DNA synthesis is synergistically activated by PI 3-kinase and Rif. In contrast Rif is unable to alter the response of cells to Raf. Finally both PI 3-kinase and RhoA are able to co-operate with Raf-1 to induce p21^'P ' which is contrary to the effect of Ras on Raf-1-mediated p21^’‘’'' induction.

120 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

3.4 Figures- Chapter Three

121 Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

Figure 3.1 Activated Raf:ER and PI 3-kinase induce mitogen independent DNA synthesis

a) PI 3-kinase induces DNA synthesis alone and in co-operation with ARafiER. Subconfluent cultures of ARER/pl 10 and ARER/pl lOR-P cells were incubated in 0.25% stripped NCS for 36 h. Fresh media was then applied containing 0.25% stripped NCS and serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) and tritiated thymidine for 25 h. Cells were harvested and analysed for tritiated thymidine incorporation. In addition cells were counted and DNA synthesis was normalised for cell number.

b) Effect of PI 3-kinase activity and ARafiER activation on protein expression. Subconfluent cultures of ARER/pl 10 and ARER/pl lOR-P cells were incubated in 0.25% stripped NCS for 36 h. Fresh media was then applied containing 0.25% stripped NCS and serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) for 25 h. Cell lysates were taken and 25 |ig of protein was separated by SDS-PAGE and analysed by Western blot for expression of rCD21 p21^'P ‘, p27'^‘'’’, Cyclin D l, phosphorylated p42^'‘‘Vp44^'‘‘', total p42^"’"^ and ^-tubulin as a loading control with anti^ rCD2 ^c-6246, sc-1641, 287.3, phospho p42/44ERK, 122.2 and T4026 antibodies respectively.

c) PI 3-kinase activity hinders ARafiER inhibition of DNA synthesis. Subconfluent cultures of ARER/pl 10 and ARER/pl lOR-P cells were incubated in 10% stripped NCS for 20 h. Fresh media was then applied containing 10% stripped NCS and the indicated concentrations of 4-OH tamoxifen or ethanol (0.01%) for 18 h. Tritiated thymidine was added to the cells 2.5 h prior to harvesting and analysing for thymidine incorporation.

122 0 ) T 1 3H Thymidine Incorporation/cell to' J3 DD c (arbitrary units) m m —T 3 DD (D Y Y CO _L

O % H

I O 3H Thymidine Incorporation (cpm) I o o

t t t t 11 t ■D O "O N) '< o c N) o D m m N l i rv) ccr O 5 ’ "O ■o ■o' -o' -1^ t ? D rc m o m DO '

IV) Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1 Figure 3.2 RlfCAAX does not affect regulation of the cell cycle by Raf a) RlfCAAX is expressed. ARER2, ARER2/Rlf, ARER2/pl 10 and ARER2/Rlf/pl 10 in DMEM with 10% NCS were harvested in Triton X-100 buffer. 400 p,g of protein was immunoprecipitated with HA antibody overnight at 4°C. Immunocomplexes were then separated by SDS-PAGE and analysed by Western blotting with anti-HA antibody. Lane 1) ARER2; Lane 2) ARER2/Rlf/pllO; Lane 3) ARER2/pllO cells; Lane 4) ARER2/Rlf cells b) rCD2pllO protein is expressed. Confluent cultures of ARER2, ARER2/Rlf, ARER2/pl 10 and ARER2/Rlf/pl 10 cells were incubated in DMEM with 0.25% stripped NCS for 72 h. Cell lysates were taken and proteins were separated by SDS-PAGE and sequentially immunoblotted with anti rCD2 and 287.3 antibodies against rCD2pll0 and Cyclin Dl respectively. Two different exposures of the rCD2 blot are shown. Lane 1) ARER2; Lane 2) ARER2/Rlf/pl 10; Lane 3) ARER2/pl 10 cells; Lane 4) ARER2/Rlf cells c) DNA synthesis analysis of cell-lines in response to ARafiER activation. Confluent cultures of ARER2, ARER2/Rlf, ARER2/pllO and ARER2/Rlf/pl 10 cells were incubated in DMEM with 0.25% stripped NCS for 48 h. Fresh media was then applied containing 0.25% stripped NCS and serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%), for 25 h. To measure DNA synthesis tritiated thymidine was added to the cells 20 h prior to harvesting. Cells were assayed for thymidine incorporation. In addition cells were counted and DNA synthesis was normalised for cell number.

124 Figure 3.2 a)

RIfCAAX

12 3 4

b)

rCD2 mm. Cyciin D1

non-specific band 12 3 4

c)

14000 □ OnM4-OHT ^ 12000 □ 1 nM 4-OHT ■ lO nM O HT ■ lOOnMOHT 10000

8000

6000

4000

ARER2 ARER2/Rlf ARER2/ ARER2/ / p i 10 p i 10 RIf Chapter Three - PI 3-kinase, Rif and Rho on Regulation the Cell Cycle by Raf-1

Figure 3.3 The effects of Rho activity on Raf-mediated effects a) Subconfluent cultures of ARER/Rho and ARER/plink cells growing in DMEM with 10% stripped NCS were treated with 100 nM 4-OH tamoxifen or ethanol (0.01%) for 18 h. DNA synthesis was measured by adding tritiated thymidine 3 h prior to harvesting and analysing for thymidine incorporation. b, c and d) Confluent cultures of ARER/Rho and ARER/plink cells were incubated in 0.25% stripped NCS for 24 h. Cells were then trypsinised and seeded subconfluently on new dishes in DMEM with 0.25% DMEM for 24 h. Fresh media was then applied containing serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) and 0.25% or 10% stripped NCS if indicated for 30 h. b) DNA synthesis was measured by addition of tritiated thymidine 4 h prior to harvesting the cells for analysis of thymidine incorporation. c) BrdU (10 pM) was applied to the cells 4 h prior to harvesting the cells for analysis of DNA synthesis by FACS. Cells were fixed in 70% ethanol and stained with propidium iodide (PI) for detection of total DNA and with anti-BrdU-FlTC conjugated antibody for detection of DNA synthesis. d) Cell lysates were taken and 50 pg of protein was separated by SDS-PAGE and sequentially analysed by Western blot for expression of RhoA^'"^, p21^^% p27'^'^\ Cyciin D l, phosphorylated p42^"‘‘Vp44^'''', total p42^"*‘^ and p-tubulin as a loading control with 9E10, SC-6246, sc-1641, 287.3, DPERK, 122.2 and T 4 0 2 6 antibodies. Two different exposures of the p21‘^'P ‘ Western blot are shown. e) Confluent cultures of ARER/Rho and ARER/plink cells were incubated in 0.25% stripped NCS for 48 h. Fresh media was then applied containing serial dilutions of 4-OH tamoxifen at the indicated concentrations or ethanol (0.01%) and 0.25% or 10% stripped NCS if indicated for the indicated time periods. Cell lysates were taken and 50 pg of protein was separated by SDS-PAGE and sequentially analysed by Western blot for expression of RhoA^’'^, p21^^% p27’^'’', Cyciin Dl, phosphorylated p42^’’’'Vp44^'^''', total p4 2 Erk2 p-tubulin as a loading control with 9E10, sc-6246, sc-1641, 287.3, DPERK, 122.2 and T4026 antibodies.

126 CP H TO ■Ç5 O O TO o (n m TO c TO TO 3 cr r\o r\o l\0 —T o ' 's i m t ; c 3 (D o 5 ' ■5' 7^ i r\o Î 3 CO CO D c 'o^ ;:: 6 '0/, -P^ % 6 Qi ::: CD ri O j i ) '^4 II if I t II %Z « 'o^ % n It "4 %\ # 'Ox,

O 3H Thymidine Incorporation/cell (arbitrary units) Percentage BrdU Incorporation Thymidine Incorporation (cpm) no4^0)0ooro4:^0) oooooooo ooooooooo 4^ 0 5 0 0 o r\o o o o o o o o o o o o o o o o o ■ □ s s m m J3 ■ □ 1 J3 5 -P^ m 6 . 3 -o ]0 — 1 + % 6 ■D o o H % ■ 3 H o 3

o o H z k 8 Chapter Four - Rac and the Cell Cycle

4. The Effect of Rad activation on the Ceil Cycle

128 Chapter Four - Rac and the Cell Cycle

4.1 Introduction

Rac is a member of the Rho family of Ras-like small GTPases. Racl has been shown to be involved in actin and cytoskeletal reorganisation, membrane trafficking, activation of stress activated MAP kinase pathways, the generation of reactive oxygen species and regulation of transcription via the serum response element (SRE) and NFkB. Furthermore it is reported to have a role in the regulation of DNA synthesis and cellular transformation (Van Aelst, 1997; Zohn et al., 1998). Ras is believed to activate Rac since Ras^'^ induction of membrane ruffling is dependent on Rac function (Nobes et at., 1995; Ridley et al., 1992). Many putative mechanisms through which Ras may regulate Rac have been identified. These are summarised in Figure 1.7 and Figure 1.8. They include activation of Rac through the Ras effector, PI 3-kinase. This may occur through activation of RhoGEFs such as Vav and perhaps Sos which have been shown to be activated through pathways controlled by the lipid products of PI 3-kinase activity. In addition, Sos has GDP-GTP exchange activity towards both Rac and Ras through different domains. Ras may also regulate Rac through its RalGEF effector pathway since RBPl acts as a GAP for Rac and Cdc42.

Rac is also required for Ras transformation and co-operates with activated Raf-1 in focus formation assays (Khosravi-Far et al., 1995; Qiu et al., 1995a). This implies that Ras may mediate transformation through Rac and Raf through separate effector pathways. Furthermore, Rac is also required for serum stimulated DNA synthesis (Olson et al., 1995; Qiu et al., 1995a) and when constitutively activated has been shown to stimulate proliferation in the absence of adhesion (Khosravi-Far et al., 1995; Qiu et al., 1995a) or mitogens (Lamarche et al., 1996; Olson et al., 1995). Taken together with the requirement for Rac in Ras signal transduction, this implies that Rac has an important role as a downstream target of Ras in Ras^'^ induced DNA synthesis.

However, the mechanisms through which Rac regulates the cell cycle have not yet been elucidated. Therefore we have generated a cell-line in which activated Racl can be regulated to investigate the effect of Racl on the cell cycle.

4.2 Results

4.2.1 Generating cells encoding inducible Racl'"*^

To generate a cell-line with inducible activated Racl a cDNA of constitutively activated Racl with a glycine to valine mutation at codon 12, (equivalent to the mutation in Ras) was sub-cloned as a BamHl/EcoRV fragment from pEXV3 Racl^'^ (a kind gift from A.

129 Chapter Four - Rac and the Cell Cycle

Ridley) into the tetracycline regulatable retroviral vector described earlier, pBPSTRl (Paulus et al., 1996) (Figure 2.8). This cDNA was tagged with the myc epitope that is specifically recognised by the 9E10 antibody (Evan et al., 1985). This construct will be referred to as pBPSTRl Racl^'^. Attempts to make a stable GP+E cell-line producing BPSTRl Racl^'^ retrovirus were unsuccessful, therefore retrovirus was prepared from transiently transfected Bose 23 cells. pBPSTRl Racl^^^ and pBPSTRl viral supernatants were used to infect NIH 3T3 cells. They were then selected in the presence of doxycycline for resistance to puromycin. These cells will be referred to as STRAC and ST cells respectively. STRAC cells were both ring cloned and pooled. The STRAC polyclonal population was tested for its ability to regulate Racl^'^ expression. Sub- confluent cells were grown in the presence or absence of doxycycline for 48 h in DMEM with 10% NCS. Cell lysates were separated by SDS-PAGE and analysed for expression of Racl^'^ by Western blotting using the 9E10 antibody. We found that the pool expressed a very low level of Racl^'^ in the presence of doxycycline which increased significantly upon removal of doxycycline from the media (Figure 4.1a). This indicated that Racl^'^ expression in these cells was regulatable. Clones were then tested for Racl^'^ expression and regulatability in the same way as the pool. Out of 51 clones tested, from two separate infection events, three regulatable clones were obtained (Figure 4.1b). The majority of clones did not express Racl"^’^ and a few others expressed a very low level of Racl^'^, but with no regulation. The three clones, which will be referred to as STRAC.C, STRAC.7 and STRAC. 10, were used to investigate the effect of Racl^'^ in NIH 3T3 cells.

Although Racl^'^ has been reported to be a transforming oncogene in NIH 3T3 cells (Qiu et al., 1995a), we did not observe any morphological changes to STRAC cells upon removal of doxycycline. In the previous chapter induction of Ras^'^ and RafCAAX in STRas and STRCX cells respectively, caused the cells to become spindly and refractile, features of morphological transformation in comparison with the uninduced cells (Figure 2.12). Therefore we had no confirmation that induction of Racl^'^ in STRAC cells induced a cellular response. Racl^'^ has been reported to stimulate transcription from the serum response element (SRE) (Hill et al., 1995), to activate the INK MAP kinase (Minden eta l, 1995), to induce mitogen- and anchorage-independent growth (Khosravi- Far et al., 1995; Olson et al., 1995; Qiu et al., 1995a) and to induce pinocytosis and formation of membrane ruffles (Ridley et al., 1992). We therefore tested whether induction of Racl^'^ in the STRAC cells would elicit some of the reported biological effects of activated Rac.

130 Chapter Four - Rac and the Cell Cycle

4.2.2 Activation of the SRE by Rac

The serum response element (SRE) is a regulatory sequence found in many growth factor-regulated promoters, including that of c-fos (Treisman, 1990). It is activated in response to serum, but also by other signals such as lysophosphatidic acid which signals through RhoA and AIF/ which globally activates heterotrimeric G-proteins (Treisman, 1992; Treisman, 1994). Recent work has shown that transient transfection of Racl^^^ in NIH 3T3 cells induces SRE activation from a co-transfected SRE reporter constmct (Hill et al, 1995). Therefore the ability of Racl^^^ to stimulate transcriptional activity from the SRE was tested in STRAC cells. Transient transfection assays were performed using a reporter construct p4xSRE TKCAT (a kind gift from R.Treisman). This had a series of four serum response elements (CCCATATATGGG) inserted in front of a basic thymidine kinase (TK) promoter which was upstream of a chloramphenicol acetyl transferase (CAT) cDNA. SRE activation was tested in the three STRAC clones and ST cells. In addition, to ensure the SRE was able to respond to activated Racl in these cells, a mammalian expression vector encoding Racl^'^, pEXV3 Racl^'^ or the empty vector were co­ transfected. pEXV3 Racl^'^ had previously been shown to activate transcription from the SRE (Hill and Treisman, 1995). 16 h after transfection the cells were incubated in DMEM with 1% NCS in the presence or absence of doxycycline for 48 h. To determine whether the SRE responded to serum in these cells and to provide a comparison for the degree of activation stimulated by Racl^'^, 20% NCS was added to control dishes of each cell type 12 h prior to harvesting. The cell lysates were then assayed for the ability to acetylate chloramphenicol by assessing CAT activity. Unexpectedly, neither STRAC cells from which removal of doxycycline had induced Racl^'^ nor cells which had been co-transfected with pEXV3 Racl^*^ stimulated any SRE transcriptional activation (Figure 4.2). In contrast, serum was able to stimulate transcription from the SRE to around 14 fold above basal levels, which indicates that the SRE reporter was functional and one pathway responsible for SRE activation was intact in these cells. This suggested that the SRE was unable to respond to Racl^'^ in these cells or possibly that a functional Racl^*^ was not being expressed from either the STRAC cells or the transfected vector.

We repeated the experiments in the NIH 3T3 cell-line that had been used in the published work to see if differences between the NIH 3T3 cell-lines could explain the difference we observed. A similar transient transfection assay was performed on our parental NIH 3T3 cell-line (referred to as NIH 1) and on the specific NIH 3T3 cells in which the work showing activation of the SRE by Racl^^^ had been performed (Hill et al., 1995), which for the purposes of these experiments, we named NIH 2 (a kind gift from R.Treisman). To control for differences in TK promoter activity and cell number in response to semm or Racl^’^, we also used another pBLCAT2 derivative that has 4 yeast pheromone

131 Chapter Four - Rac and the Cell Cycle response elements (PRE) (ATGAAAC), in place of the SRE elements upstream of the TK promoter, p4xPRE TKCAT (also a kind gift from R.Treisman). The PRE is an element that responds to the yeast transcription factor STE 12, but has no basal activity in mammalian cells and is unresponsive to a variety of stimuli, such as serum, PDGF and anisomysin (personal communication E.Sahai). CAT activity stimulated in p4xPRE transfected cells was used to normalise SRE activity. pEXV3 Racl^'^ or the empty vector were co-transfected into NIH 1 and NIH 2 cells with p4xSRE TKCAT or p4xPRE TKCAT. The cells were maintained in DMEM with 1% NCS for 48 h and then harvested and assayed for CAT activity. If indicated, cells were stimulated by the addition of 20% NCS 12 h prior to harvesting. The resulting CAT activities were then normalised to give the fold increase in SRE-mediated transcriptional activation in response to serum or Racl^'^ expression. In NIH 2 cells, both serum and Racl^'^ stimulated transcriptional activity from the SRE in accordance with the published work (Figure 4.3a). However, SRE-mediated transcriptional activity in NIH 1 cells was only stimulated by serum and not by Racl^'^ (Figure 4.3a). Thus it appears that there is a fundamental difference between the cell-lines and the NIH 1 cells are lacking a pathway linking Racl^'^ to the SRE that is intact in NIH 2 cells.

To assess whether activation of the SRE by Racl^'^ is a common property of rodent fibroblasts, we tested the activation of the SRE by Racl^^^ and serum in a rat fibroblast cell-line. Rat 1 cells and in primary mouse embryo fibroblasts (MEFs), concurrently with both strains of NIH 3T3 cells. Either p4xSRE or p4xPRE were co-transfected with pEXV3 Racl^'^ or the empty vector. Their CAT activity was determined after serum deprivation and after re-stimulation with serum if indicated.

The SRE in both Rat 1 cells and MEFs responded to serum stimulation; in Rat 1 cells it was stimulated 11 fold and in MEFs, 3 fold over cells transfected with p4xPRE (Figure 4.3b). However in both cell-types the SRE did not respond well to Racl^'^ expression: transcription mediated by the SRE in Rat 1 cells increased by only 2 fold whereas it remained at background levels in MEFs.

Thus activation of the SRE by Racl^'^ is not a general feature in fibroblasts. The inability of Racl^'^ to reproduce the effects of serum indicates that Racl does not participate in a linear pathway between serum and the SRE. Furthermore it appears that stimulation of transcription from the SRE is not a vital aspect of Racl function in fibroblasts since NIH 1, Rat-1 and MEFs proliferate without this ability.

Our reason for this investigation into the SRE was to test whether induction of Racl^^^ from the STRAC clones could induce cellular responses. However, this was not a suitable assay in which to test this since the SRE did not respond to activated Racl in these cells.

132 Chapter Four - Rac and the Cell Cycle

4.2.3 Activation of JNK/SAPK by Rac

Activated Racl and other Rho family members have been reported to activate the INK MAP kinase pathway (Minden et al, 1995). This pathway is also activated in response to stress such as UV and y-irradiation, osmotic stress, DNA damaging agents such as anisomysin or by Ras^'^ (Kyriakis and Avruch, 1996). INK targets include transcription factors and other kinases which go on to regulate transcription (Figure 1.6). Therefore we tested the ability of Racl^'^ induction in STRAC.C cells to activate INK kinase activity.

Confluent, quiescent cultures of STRAC.C and ST cells in DMEM with 0.5% NCS were incubated in the presence or absence of doxycycline for 16 h and then assayed for INK activity. As a control, matched dishes of STRAC.C and ST cells in the presence of doxycycline were exposed to UV light, a stress stimulus. INK was immunoprecipitated from cell lysates and its activity was determined by its ability to phosphorylate GST-c- jun. Induction of RacU’^ was unable to activate JNK. In contrast, UV light stimulated a high level of JNK activity (Figure 4.4). Therefore since UV light but not RacU'^ expression was able to activate JNK activity this suggests that the JNK pathway is unresponsive to RacU*^ in these cells. However, again this did not inform us about the ability of Rac^'^ induction in STRAC cells to elicit a cellular response.

4.2.4 Induction of DNA synthesis by Racl''*^

It has been reported that Rac 1 activity is both necessary and sufficient for DNA synthesis in Swiss 3T3 fibroblasts. Specifically, dominant negative Racl mutants were able to inhibit serum-stimulated DNA synthesis and microinjection of constitutively activated Racl into quiescent cells was shown to initiate DNA synthesis (Lamarche et a l, 1996; Olson et al., 1995). Expression of activated Racl itself in Rati cells has been demonstrated to induce focus formation and tumours when injected into nude mice (Qiu et a l, 1995a). Furthermore, a dominant negative mutant of Racl was able to inhibit Ras- mediated transformation of NIH 3T3 cells (Khosravi-Far et at., 1995; Qiu et al., 1995a). Many of the RacGEFs have also been shown to have oncogenic potential (Zohn et al., 1998). Thus it appears that Racl has an important role in mitogen stimulation of DNA synthesis which may involve its activation downstream of Ras. However the signals regulated by Racl that mediate these aspects of growth control have not yet been elucidated.

4.2.4.1 Racl^’^ does not support mitogen-independent growth

We tested whether RacU'^ could stimulate colony formation in low mitogen conditions. 1x10'^ cells were cultured in the presence or absence of doxycycline for 3 weeks in 0.5%, 2% or 10% NCS. RacU'^ was unable to support colony formation in 0.5% NCS.

133 Chapter Four - Rac and the Cell Cycle

However, STRAC.C cells in the absence of doxycycline formed more numerous and dense colonies than cells in the presence of doxycycline in both 2% and 10% NCS (Figure 4.6a). This suggested that Rac^'^ was able to assist, but not reproduce, the mitogenic abilities of serum.

We then tested whether Racl^'^ induction could stimulate DNA synthesis in STRAC.C cells in reduced serum conditions. Confluent, serum-deprived, quiescent STRAC.C and ST cells were cultured in the presence or absence of doxycycline for 30 h. As a control, 10% NCS was added to equivalent dishes for the same time period in the presence or absence of doxycycline. DNA synthesis was measured by tritiated thymidine incorporation (Figure 4.6b). The induction of DNA synthesis by serum addition was assisted by the co-expression of Racl^'^ which concurs with the colony formation assays. However, induction of Racl^'^ did not stimulate DNA synthesis in serum- deprived conditions. Thus, in contrast to the published effect of Racl^'^ in Swiss 3T3 cells, activated Racl was not able to induce mitogen-independent growth in NIH 3T3 cells. This may be due to cell type specific differences. We have already described differences in the abilities of two lines of NIH 3T3 cells to differentially regulate the SRE in response to Racl^'^ (Figure 4.3). Alternatively this difference could be due to different expression levels of Racl^'^ or the different methods of introduction of the activated oncogenes, microinjection induces a very high and rapid upregulation of the signal in a background of unstimulated cells, whereas we induced Racl^'^ expression more slowly by relieving transcriptional repression.

4.2,4,2 Racl^^^ does support anchorage-independent growth

In addition to requiring mitogens for cell cycle progression, non-transformed fibroblasts also require adhesion to a substratum. Expression of an activated oncogene such as Ras^’^ enables cell cycle progression in the absence of anchorage, presumably by mimicking adhesion signals, such as those from specific integrin receptors. Activated Racl has also been shown to induce colony formation in soft agar assays (Khosravi-Far et al., 1995; Qiu et a l, 1995a). Racl may have a role in integrin-mediated signalling. For example, dominant negative mutants of Racl and Ras, and the PI 3-kinase inhibitor wortmannin, are able to suppress integrin a6p4 activation of JNK (Maniero et al., 1995).

We tested whether Racl^'^ was able to induce anchorage-independent growth by assessing whether induction of Racl'*^’^ caused STRAC.C cells to form colonies in soft agar. 5x10^ and 2x1 O'* cells of the three STRAC clones and polyclonal populations of ST, LXSN R acl^'\ LXSN Ras^'^ and LXSN cells (NIH 3T3 cells which constitutively express Racl^'^ and Ras^'^ respectively and cells infected with the empty vector, kind gifts from A.Lloyd and P.Rodriguez-Viciana) were seeded in soft agar in the presence or

134 Chapter Four - Rac and the Cell Cycle absence of doxycycline and cultured for 26 days. Colonies were then stained with 0.1% Neutral Red, photographed and counted (Table 4.1a & b and Figure 4.5)).

Table 4.1a Formation of colonies in soft agar Number Colonies in Percentage Colonies in Percentage of cells presence of colony absence of Cell-line colony seeded doxycycline formation doxycycline formation

ST 5x10^ 1 0 0.2% 9 0.18%

2 x1 0 " 2 0.04% 4 0.08% STRAC.C 5x10^ 53 1.06% 916 18.32%

2 x1 0 " 29 0.15% 2558 12.79% STRAC.7 5x10^ 58 1.16% 386 7.72%

2 x1 0 " 59 0.3% 288 1.44% STRAC. 10 5x10^ 71 1.42% 767 15.34%

2 x1 0 " 45 0 .23% 436 2.18%

Table 4.1b Formation of colonies in soft agar Cell-line Number of cells Colonies Percentage seeded colony formation LXSN 5x10" 147 2.94%

LXSN 2 x1 0 " 1 2 2 0.61% LXSN Racl^'^ 5x10" 908 18.16%

LXSN Racl^'" 2 x1 0 " 2580 12.9% LXSN Ras'"'^ 5x10" 361 7.22%

LXSN Ras""" 2 x1 0 " 2476 12.38%

Colonies in soft agar were formed by the three STRAC clones in the absence, but not in the presence, of doxycycline and no colony formation was observed with ST cells. Of the clones, STRAC.C had the highest colony formation with 18% of the seeded cells able to grow anchorage-independently in the absence of doxycycline compared with 1 % in the presence of doxycycline. In the absence of doxycycline 7% and 12% of STRAC clones 7 and 1 0 respectively were able to grow in soft agar compared to 1 .2 % and 1 .4 % in the presence.

LXSN Racl^'^ cells formed a similar number of colonies in soft agar as LXSN Ras^'^ cells. However, LXSN Ras^'^ cells formed colonies much sooner and they grew faster than LXSN Racl^'^ cells.

The density at which the cells were seeded also appeared to be an important factor in the colony forming ability of the cells. For each cell-line, except LXSN R as^'\ whether in

135 Chapter Four - Rac and the Cell Cycle

the presence or absence of doxycycline, cells seeded at the higher density of 2 x1 0 ^ cells per 4 ml of agar had a lower percentage of colony formation. This was especially clear with STRAC.7 and STRAC. 10 where the percentage colony formation in the absence of

doxycycline dropped from 8 % and 15% to 1.5% and 2% respectively. This may have been due to a limited supply of an essential factor in the growth media or alternatively that autocrine signals were excreted by the cells which inhibited growth. Both STRAC.C and LXSN Racl^^^ were less affected by culture at a higher density. Their percentage colony formation reduced from 18% to 13% in both cases. A higher percentage of LXSN Ras'^'^ cells formed colonies at greater cell density, possibly due to mitogenic autocrine signals induced by Ras^^^.

We have demonstrated that Racl^'^ is able to replace an essential signal that is normally provided by cell contact with the substratum, but cannot replace signals provided by mitogens. However, it appears that Racl^'^ is able to co-operate with mitogenic signals to increase DNA synthesis levels. Importantly, stimulation of DNA synthesis by Racl^'^ is unlikely to involve JNK activity or transcriptional activation via the SRE since Racl^'^ does not stimulate these responses in STRAC cells.

4.2.4.3 Optimising conditions for Racl^^^-induced anchorage-independent grow th

Colony formation in soft agar is a long term assay from which one is unable to retrieve cells for biochemical analysis. In order to perform biochemical analysis of Racl^'^- induced DNA synthesis we required a culture system in which short-term assays could be performed.

We tested three techniques: 1) A suspension matrix of methylcellulose (MC) with DMEM and 10% NCS referred to as MC matrix from which cells can be retrieved by diluting out the MC with PBS A (Assoian et al., 1989); 2) tissue culture dishes coated in agarose mixed with DMEM to which cells are unable to adhere (Guadagno and Assoian, 1991) and 3) tissue culture dishes coated with poly (2-hydroxyethylmethacrylate) (polyHEMA) which acts as a cell repellent.

Confluent, serum-deprived, quiescent STRAC.C cells were trypsinised and 1x10^ cells were incubated in the presence of 10% NCS in either 2 ml of growth media on polyHEMA or agarose coated dishes. Alternatively, cells were mixed with 2 ml of MC matrix. All cells were cultured in the presence or absence of doxycycline in 10% NCS for 48 h and their DNA synthesis was assessed by tritiated thymidine incorporation analysis. In addition, the DNA content of cells incubated on polyHEMA coated dishes or in MC matrix was measured by propidium iodide staining and analysis by FACS.

136 Chapter Four - Rac and the Cell Cycle

Induction of Racl'^'^ increased DNA synthesis in aU three culture systems (Figure 4.7a). The largest fold increase in DNA synthesis occurred on polyHEMA coated dishes. The FACS analysis of PI content showed that polyHEMA cultures had a population of ceUs in the sub-Gl region with a DNA content less than 2N (Figure 4.7b). This suggested some cells were dying. However we chose this method of cultivation for the majority of our investigation since it gave the largest difference in DNA synthesis between cells in the presence and absence of doxycycline and we were specifically interested in performing biochemical analysis.

In addition, the ability of STRAC.C cells in suspension to induce Rac^'^ was also investigated. Serum-deprived confluent STRAC.C cells were trypsinised and put into suspension on polyHEMA coated dishes in the presence or absence of doxycycline. Cells were harvested at the indicated time points and lysates were separated by SDS-PAGE and analysed for Rac^'^ expression by Western blotting. Rac^'^ expression reached maximum expression levels by 24 h and its regulation was unaffected by the lack of adhesion (Figure 4.7c).

The soft agar assay (Table 4.1) had indicated that the density at which the cells were cultured affected the colony forming potential of the cells. Therefore we assessed whether cell density affected the DNA synthesis of cells in suspension. Confluent, serum-deprived, quiescent, STRAC.C cells were resuspended in DMEM with 10% NCS and equal numbers were put into suspension at different densities on polyHEMA coated dishes in the presence or absence of doxycycline for 72 h. DNA synthesis was measured by thymidine incorporation analysis. The results showed that the DNA synthesis of the cells, both in the presence of doxycycline and with Racl^'^ induction, was affected by the density at which the cells were cultured. Cells cultured at low density had a higher level of DNA synthesis than cells grown at high density. Nevertheless, Racl^'^ was able to induce a higher level of DNA synthesis at each density indicating an ability to partially overcome the limiting or inhibitory factor involved (Figure 4.8). This concurs with the effect we observed in the soft agar assay.

4.2.5 The effect of Racl^'^ on the G1 Cycling

Upon loss of anchorage, NIH 3T3 cells are reported to downregulate the expression and the associated kinase activities of Cyclins Dl, E and A to varying extents even though serum is present in the medium (Bohmer et a i, 1996; Guadagno et al., 1993; Schulze et al., 1996; Zhu et al., 1996b). In addition, in some cell-types, the expression levels of p 2 1 ^'’^' and p27*^P' have also been reported to be upregulated upon removal of anchorage. Ectopic expression of Cyciin Dl or Cyciin A in fibroblast cell-lines has also been reported to induce cell proliferation in non-adherent cells (Carstens et a l, 1996; Guadagno et a l.

137 Chapter Four - Rac and the Cell Cycle

1993; Kang and Krauss, 1996; Resnitzky, 1997; Schulze et al., 1996). Furthermore, Cyciin A expression is specifically dependent on adhesion, independently of the kinase activity of Cyciin D and Cyciin E complexes. NRK cells have constitutive Cyciin Dl- and E-associated kinase activities and pRb phosphorylation in the absence of anchorage but are dependent on adhesion for Cyciin A expression and subsequent cell cycle progression (Guadagno et al, 1993; Zhuet a l, 1996b).

The reported effects of loss of anchorage on protein expression are not consistent and therefore we wanted to determine the effects on Cyciin D l, Cyciin A and p27*^*’* protein levels if anchorage was removed from STRAC.C cells in the presence of serum. Confluent, serum-deprived, quiescent STRAC.C cells were trypsinised and plated in 10% NCS either as a suspension culture on polyHEMA coated dishes or as an adherent culture on normal tissue culture plastic, for 30 h. Cell lysates were then separated by SDS- PAGE and analysed by Western blot for expression of Cyciin D l, Cyciin A and p27^''\ As expected Cyciin Dl and A proteins were highly expressed in adherent, sub-confluent STRAC.C cells proliferating in 10% NCS. The levels of both Cyciin Dl and A were dramatically reduced in the absence of adhesion. p27'^'’' levelswereunaffected by the loss of adhesion (Figure 4.9).

It has been reported that Cyciin Dl mRNA levels become reduced upon removal of anchorage which implies that the downregulation of Cyciin Dl may be transcriptional (Zhu et at., 1996b). To determine whether the downregulation of Cyciin Dl protein we had observed was transcriptional, we examined the activity of the Cyciin Dl promoter upon removal of adhesion to substratum. A Cyciin Dl promoter reporter construct, pGL2 Cyciin Dl (a kind gift from J.Downward), containing 1.8 kb of the human Cyciin Dl promoter cloned upstream of a luciferase gene in the pGL2 vector (pGL2 Cyciin Dl) was stably transfected into ST cells or a promoterless control were stably co-transfected into ST cells with pJ 6 Hygro, a plasmid encoding a hygromycin resistance gene. The cells were selected for hygromycin resistance and polyclonal populations were obtained. ST cell-lines containing pGL2 and pGL2 Cyciin Dlwill be referred to as ST GL2 and ST Dl respectively.

To assess the regulation of the Cyciin Dl promoter upon removal of anchorage, confluent, serum-deprived, quiescent cultures of ST GL2 and ST Dl cells were trypsinised and resuspended in DMEM with 10% NCS. The samples corresponding to the zero hour time-point were harvested immediately and the others were incubated on polyHEMA coated dishes for the indicated times prior to harvesting. Cell lysates were analysed for luciferase activity with a luminometer by assaying the amount of light emitted upon cleavage of luciferin. The activity of the Cyciin Dl promoter decreased dramatically when the cells were suspended in 10% NCS (Figure 4.10). After 3 hours its activity was

138 Chapter Four - Rac and the Cell Cycle reduced to 50% of the activity of cells which had been harvested immediately. After 9 h in suspension the activity of the Cyciin Dl promoter was reduced to 20%. The ST GL2 cells had a minimal level of luciferase activity that did not change in this experiment. Thus it appears that reduction of Cyciin Dl expression upon loss of anchorage occurs at least in part by transcriptional downregulation.

4.2.5.1 Racl^^^ regulation of cell cycle proteins

We have demonstrated that Cyclins Dl and A in STRAC.C cells become downregulated upon removal of anchorage. We tested whether Racl^'^ was able to induce DNA synthesis by inducing these proteins. Furthermore the pattern of induction of protein activation was determined in relation to the initiation of DNA synthesis.

Confluent, serum-deprived, quiescent STRAC.C cells were trypsinised and put into suspension on polyHEMA coated dishes in the presence and absence of doxycycline. Cells were labelled with tritiated thymidine for 2 h at the indicated time points to determine DNA synthesis levels. Cell lysates from parallel cultures were taken at the indicated times. In addition, cell lysates were taken from sub-confluent, adhered, asynchronously growing cells and confluent serum-deprived adherent cultures. Lysates were separated by SDS-PAGE and analysed for cyciin expression by Western blot. Alternatively they were assayed for Cyciin E- or Cyciin A-associated kinase activity.

DNA synthesis began 22h after removal of doxycycline and maximal DNA synthesis occurred at 30 h (Figure 4.11a). Induction of Cyciin Dl and Cyciin E expression and Cyciin E-associated kinase activity occurred 22 h after removal of doxycycline which correlated with the initiation of DNA synthesis. However, Cyciin E expression levels increased by a meagre degree compared to the increase in Cyciin E-associated kinase activity. Cyciin A expression levels increased 30 h after removal of doxycycline and Cyciin A-associated kinase activity increased by two fold over its basal level 34 h after doxycycline removal and continued to increase thereafter (Figure 4.11b). Thus the earliest events following Racl^'^ induction are the expression of Cyciin Dl protein and upregulation of Cyciin E-associated kinase activity. After which Cyciin A protein and its associated kinase activity were induced.

Absolute comparisons between adhered and suspended STRAC.C cells are difficult since it was not technically possible to control for cell number and so the effect of cell proliferation and death were not accounted for. However, equal numbers of STRAC.C cells were adhered in 10% NCS or put into suspension in 10% NCS and assayed for DNA synthesis after 38 h. Adhered cells (in the presence of doxycycline) incorporated over 10 times more than Rac^'^ expressing cells in suspension (Data not shown). This indicates that adhesion gives a much greater proliferative signal than Rac"^'\ This is

139 Chapter Four - Rac and the Cell Cycle reflected in the difference of cyclin-associated kinase activities and Cyciin Dl and A protein levels, which are much higher in the adhered cultures than the suspension cultures even in the presence of Racl^'^ Interestingly, although the kinase activity of Cyciin E in the adhered culture is over seven times higher than the maximum activation by Racl^^^ in suspension, the expression level of Cyciin B protein is lower. This suggests that inhibitor proteins are important in regulating Cyciin E-associated kinase activity in suspension. Interestingly, in comparison to adhered STRAC.C cells arrested by serum deprivation, Rac^^^ expressing cells have a higher level of Cyciin E-associated kinase activity and Cyclins D l, E and A protein, which implies that these cells are progressing through the cell cycle. The low level of DNA synthesis may be due to cell death in the suspension cultures.

4.2.6 The role of PI 3-kinase in anchorage-independent DNA synthesis

We have demonstrated that Racl^^^ is able to propagate signals that are usually activated by adhesion. Thus it is probable that Racl is constitutively activating integrin-mediated pathways. Furthermore, activated Racl and Cdc42 (but not Rho) have been shown to activate PI 3-kinase in vitro (Bokoch et aL, 1996). In contrast another group has reported that Racl^'^ is unable to activate PI 3-kinase in vitro (Rodriguez-Viciana et aL, 1994). However, in mammary epithelial cells integrin-mediated invasion can be reproduced by the overexpression of Racl^'^, Cdc42^'^ which require PI 3-kinase activity to elicit these effects (Keely et aL, 1997). In addition IL-2 activation of PKCÇ has implicated a role for PI 3-kinase downstream of Rho GTPases (Gomez et aL, 1997). Therefore PI 3-kinase may be required downstream of Rac, particularly in transmitting signals from integrin receptors. However, there is also a lot of evidence which suggests PI 3-kinase also activates Rac. For example, activation of Racl by activation of the PDGF receptor is dependent on PI 3-kinase function and the production of PI (3,4,5)Pg lipids (Hawkins et aL, 1995). Furthermore, activation of Racl-mediated effects by PDGF, insulin and activated Ras can be inhibited by the specific PI 3-kinase inhibitors wortmannin and LY 294002 or dominant negative PI 3-kinase mutants (Kotani et aL, 1995; Nobes et aL, 1995; Rodriguez-Viciana et aL, 1997). However, Racl-mediated events can also be activated independently of PI 3-kinase (Genot et aL, 1998; Hawkins et aL, 1995). Thus it appears that the relationship between PI 3-kinase and Racl is complex. However, since Racl^'^ has been shown to require PI 3-kinase for integrin mediated signalling, we used the PI 3-kinase specific inhibitor, LY 294002 to test whether PI 3-kinase activity was necessary for Rac 1^'^-mediated anchorage-independent DNA synthesis. LY 294002 competes for the ATP-binding site of the catalytic subunit of PI 3-kinase (Vlahos et aL, 1994). To assess the activation state of PI 3-kinase we analysed the phosphorylation of a downstream target of PI 3-kinase, Akt/PKB, using a

140 Chapter Four - Rac and the Cell Cycle phospho-specific antibody made against the phosphorylated serine 473 on Akt/PKB. Phosphorylation of this serine is inhibited by wortmannin indicating a dependence on PI 3-kinase activity for phosphorylation (Alessi et aL, 1996) and thus was a good indicator of PI 3-kinase activity.

4.2. 6,1 Optimising the conditions for the use of LY 294002

To assess the optimal concentration of LY 294002 for inhibition of PI 3-kinase activity we tested the ability of different LY 294002 concentrations to prevent PI 3-kinase- mediated phosphorylation of Akt/PKB by EOF. Confluent, serum-deprived quiescent STRAC.C cells in DMEM with 5 |Xg/ml insulin were media changed into similar media containing the indicated concentrations of LY 294002 dissolved in DMSO (or DMSO alone as a control). Five hours later, EOF was added to the indicated dishes for 3 min prior to harvesting the cells. Cell lysates were separated by SDS-PAGE and the expression levels and phosphorylation status of Akt/PKB were analysed by Western blotting. Addition of EOF stimulated a high degree of Akt/PKB phosphorylation and this was partially inhibited by 2 and 5 jiM LY 294002 and fully inhibited by the addition of 10 and 50 )iM LY 294002 (Figure 4.12a). The ability of EOF to stimulate PI 3-kinase activity was not affected by DMSO. In addition, the phosphorylation status of p42'"''^ and p4 4 erki response to LY294002 was assessed using a phospho-specific p44/42^‘‘ antibody. The ERKs were still phosphorylated by EOF in the presence of LY 294002, however, the level of phosphorylation was reduced by about 4 fold in the presence of LY 294002. This indicated that either LY 294002 or an indirect effect was downregulating MEK activity. A similar reduction in MEK activity has been reported with another PI 3- kinase inhibitor, wortmannin in vivo, however when MEK activity in response to wortmannin was tested in vitro it was unaffected (Marra et aL, 1995). This suggests that the inhibition of MEK is due to an effect of the reported cross talk between the Raf and PI 3-kinase pathways (Frost et aL, 1997; King et aL, 1998), rather than non-specific action of the inhibitor compound directly on MEK. In addition the inhibitor also slightly reduced the expression levels of Akt/PKB, which may indicate that a low level of PI 3- kinase activity (or an LY 294002 sensitive activity) is required to maintain Akt/PKB protein levels.

The duration of LY 294002 inhibition was also tested. Confluent, serum-deprived quiescent STRAC.C cells in DMEM with 5 pg/ml insulin and doxycycline were media changed into similar media containing 10 |iM LY 294002 dissolved in DMSO or DMSO. EOF was added to the indicated dishes for 3 min at the indicated time points and the cells were then analysed for expression and phosphorylation of Akt/PKB. 10 |iM LY 294002 was able to inhibit PI 3-kinase activity for up to 32 h (Figure 4.12b). This indicated that this inhibitor was suitable for analysing DNA synthesis induction.

141 Chapter Four - Rac and the Cell Cycle

4,2,6.2 Inhibition of PI 3-kinase activity in anchorage-independent DNA syn th esis

The effect of LY 294002 on anchorage-independent DNA synthesis by Racl^'^ was tested. Confluent, serum-deprived quiescent STRAC.C cells in DMEM with 5 |ig/ml insulin and doxycycline had the indicated concentration of LY 294002 or DMSO added to them for 1 h and then the cells were trypsinised and put into suspension on polyHEMA coated dishes in the presence or absence of doxycycline and DMEM with 10% NCS and the indicated concentration of LY 294002 or DMSO. Their DNA synthesis was determined by tritiated thymidine incorporation analysis after 30 h in suspension.

The basal DNA synthesis rates of cells in the presence of doxycycline and also the DNA synthesis rates of cells with induced Racl^'^ expression were inhibited by the addition of LY 294002 and this was a dose-dependent response. At 10 |iM LY 294002 their DNA synthesis was 10% that of their uninhibited levels (Figure 4.12). However the induction of DNA synthesis by Racl^'^ remained constant at around 2-2.5 fold (see insert, Figure 4.13 ). Thus Racl induction of DNA synthesis appeared to be independent of PI 3-kinase activity. However, PI 3-kinase activity may be required for DNA synthesis but independently from the Racl signal. Alternatively, the inhibition of PI 3-kinase activity may be causing cell death which would reduce the DNA synthesis index. Akt/PKB is an important survival signal and has been shown to rescue a particular form of apoptosis, anoikis, in epithelial cells upon loss of adhesion. Therefore inhibition of Akt/PKB- mediated survival signals may be causing apoptosis in the absence of fibroblast adhesion. However confirmation of this would require further investigation.

4.2.7 The effect of Raf-1 activation upon the ability of Racl^^^ to control cell proliferation

The effect of activated Racl on cell cycle control was initially addressed as part of our larger question about the mechanisms used by Ras to govern cell proliferation. Racl had been shown to be an essential element downstream of Ras for the transformation and promotion of mitogen-independent DNA synthesis. Transformation assays have implicated Racl on a signalling pathway downstream from Ras and distinct from Raf due to the co-operation of Racl and Raf signals in focus formation assays. Thus we were interested in whether Racl could counteract the inhibitory properties of Raf and whether Racl and Raf signals could co-operate together to induce anchorage-independent DNA synthesis.

A cell-line in which both Raf and Racl activation could be induced separately was generated. STRAC.C cells were infected with GPE LXSN ARER viral supernatant and then selected for resistance to G418 and puromycin. These cells will be referred to as STRAC/RER cells. The ability of these cells to induce Racl"^’^ and ARafiER activity and

142 Chapter Four - Rac and the Cell Cycle

the effect of these proteins on cell cycle regulatory proteins was tested. In addition the ability of these proteins to induce DNA synthesis was also tested. Confluent, serum- deprived, quiescent cultures of STRAC/RER cells were trypsinised and seeded onto polyHEMA coated dishes in the presence or absence of doxycycline (and BrdU for DNA synthesis analysis) and in the indicated concentrations of 4-OH tamoxifen or ethanol for 36 h. To assess DNA synthesis BrdU-treated cells were collected and a single cell suspension was made. Cells were then cytospun onto glass slides, fixed and immunostained for BrdU incorporation and their total DNA was counterstained with Hoechst 33258. The percentage of BrdU positive cells was then assessed. Cell lysates were separated by SDS-PAGE and analysed by Western blotting. The ability of the STRAC/RER cells to induce DNA synthesis in the absence of anchorage after being placed in suspension from an asynchronously growing population was also investigated. STRAC/RER cells were incubated in MC matrix in the indicated conditions and their DNA synthesis was measured after 48 h by tritiated thymidine incorporation analysis.

Expression of Racl^'^ remained regulated by doxycycline in STRAC/RER cells, although strong Raf-1 activation slightly increased Racl^'^ levels. Dose-dependent phosphorylation of ERK2 occurred in response to activation of ARaf.ER by the indicated concentrations of 4-OH tamoxifen (Figure 4.14a). The effect of Racl^'^ expression and ARafiER activation was similar in both cases. Activation of ARafiER with 100 nM or 5 nM 4-OH-tamoxifen reduced the basal levels of anchorage-independent DNA synthesis by approximately 4 fold. Racl^'^ expression afforded a small degree of protection but DNA synthesis levels were still below basal levels. Weak activation of ARafiER had no effect on the ability of Racl^'^ to induce anchorage-independent DNA synthesis. Therefore it appeared that ARafiER activation could not act mitogenically in the absence of adhesion.

The expression levels of p 2 l‘^'P ‘ were analysed to determine if the ability of Racl^'^ to partially resist ARafiER mediated inhibition was due to an ability to inhibit p21^''^'' upregulation. Induction of p21^'P ‘ and Cyciin Dl by ARafiER were unaffected by Racl^'^. However activation of ARafiER completely inhibited Cyciin A expression, thus this may be involved in ARafiER-mediated inhibition of DNA synthesis. In addition p27’^*p' levels were not downregulated by ARafiER activation as they had been in the absence of serum. This suggests that growth factors and adhesion may regulate p27‘^‘^' levels differently.

To test whether activation of Raf-1 could support anchorage-independent growth,

STRCX 6 and STRCX 16 cells (Section 2.2.6), NIH 3T3 cells containing RafCAAX under the control of a doxycycline repressible promoter (Figure 2.9), were tested for their ability to form colonies in soft agar in the presence or absence of doxycycline. The

143 Chapter Four - Rac and the Cell Cycle indicated number of STRCX 6 and 16 and STRAC.C cells were seeded in soft agar in the presence or absence of doxycycline and cultured for 20 days. Colonies were then stained with 0.1% Neutral Red, photographed and counted (Table 4.2).

Table 4.2 Colony formation in soft agar by RafCAAX

Cell-line Number of Colonies in presence Colonies in absence cells seeded of doxycycline of doxycycline STRAC.C 2x10" 44 668 STRCX6 5x10" 7 3 2x10" 6 6 STRCX16 5x10" 7 20 2x10" 11 12

Induction of RafCAAX through removal of doxycycline did not induce formation of colonies in soft agar, in contrast to STRAC.C cells.

Therefore we have been unable to demonstrate any ability of Raf-1 activation, either through different levels of ARafiER activation or induction of RafCAAX to stimulate anchorage-independent growth. Furthermore, ARafiER demonstrated no ability to co­ operate with Racl^'^ to induce anchorage-independent growth. However, strong activation of ARafiER was able to inhibit the ability of Racl^'^ to induce DNA synthesis in suspension. This demonstrated that ARafiER was able to inhibit anchorage- independent DNA synthesis. This implies that Raf-1 activation is not mitogenic in anchorage-independent conditions and is unable to replace adhesion-mediated signals.

4.2.8 RhoA^^^ can support anchorage independent growth

In the previous chapter we demonstrated that RhoA^''* was unable to support mitogen- independent growth or co-operate with Raf to induce mitogen-independent growth. To determine whether RhoA^''* had similar properties to Racl^'^ we used the ARER/Rho cells to test whether RhoA^'"^ was able to support anchorage-independent growth. ARER/Rho and ARER/plink cells were suspended in polyHEMA cultures from an asynchronously growing population. After 16 h 4-OH tamoxifen was added for a further 16 h and DNA synthesis was measured by tritiated thymidine incorporation analysis. ARER/Rho cells had 2-3 fold higher levels of DNA synthesis than control cells. In a similar manner to STRAC/RER cells, activation of ARafiER inhibited DNA synthesis to below basal levels in both cell-lines indicating that RhoA^'"^ was unable to protect the cells from Raf-1-mediated cell cycle inhibition. Therefore we have shown that RhoA^''^ was able to support anchorage-, but not mitogen-independent DNA synthesis and thus has similar properties to Racl'^'l Racl has been shown to activate Rho-mediated signal transduction (Nobes and Hall, 1995). However it is thought that Racl and RhoA act on

144 Chapter Four - Rac and the Cell Cycle

separate pathways in relation to cellular transformation because while activated Racl and PI 3-kinase are unable to co-operate with each other to induce focus formation, RhoA^^^ can co-operate with either activated Racl or PI 3-kinase (Rodriguez-Viciana et aL, 1997). This indicated that RhoA and Racl contributed separately to transformation.

4.3 Summary

Thus Racl^'^ is able to induce anchorage, but not mitogen-independent growth in NIH 3T3 cells. This may occur because Racl^'^ induction is sufficient to rescue the downregulation of G1 cyclins and their respective associated kinase activities that occurs upon loss of anchorage. These abilities are probably independent of serum response factor (SRF) and JNK activity since Racl^’^ does not activate these signals in STRAC cells. In addition, Racl^'^ is able to induce DNA synthesis independently of PI 3-kinase activity, however, PI 3-kinase activity appears necessary for either basal DNA synthesis or cell survival. Raf-1 activity is able to inhibit anchorage DNA synthesis induced by Racl^'^ probably through induction of p21^'‘’ ‘. Furthermore Raf-1 activity appears unable to induce or assist Rac 1^'^-mediated anchorage-independent growth. Finally RhoA^''* demonstrates similar properties to Racl^'^ and is able to induce anchorage-, but not mitogen-independent DNA synthesis which is also sensitive to inhibition by RafiER activation.

145 Chapter Four - Rac and the Cell Cycle

4.4 FigureS’Chapter Four

146 Chapter Four - Rac and the Cell Cycle

Figure 4.1 Racl'"*^ expression is regulated in STRAC cells After infection with BPSTRl or BPSTRl Racl^'^ NIH 3T3 cells were for resistance to 2.5mg/ml puromycin in the presence of doxycycline (100 ng/ml). Selected cells, referred to as ST and STRAC cells respectively, were then either ring cloned, or pooled to form a polyclonal population.

(a)Two dishes of the STRAC pool was cultured for 24 h in DMEM with 10% NCS in the presence of doxycycline. Doxycycline was then washed out of the cells and re-added to one dish and then incubated for a further for 48 h. Cell lysates were taken and 50 pg of protein was separated by SDS-PAGE gel and analysed by Western blotting using the 9E10 antibody. (b) Pairs of clones of STRAC cells and the ST polyclonal population were cultured for 24 h in DMEM with 10% NCS in the presence of doxycycline. Doxycycline was then washed out of the cells and re-added to one dish and then incubated for a further for 72 h . Cell lysates were taken and 50 pg of protein was separated by SDS-PAGE gel and analysed by Western blotting using the 9E10 antibody.

147 Figure 4.1

a)

RacV12

Dox (100 ng/ml)

2 13 16 C b)

RacV12

7 10 11

RacV12

35 36 37 38

RacV12

39 40 41 ST

RacV 1 2

+ + + + Dox (100 ng/ml) Chapter Four - Rac and the Cell Cycle

Figure 4.2 Racl^^^ expression does not induce SRE activity

The LipofectAmine reagent was used to transiently transfect ST, STRAC.C, STRAC.7 and STRAC. 10 cells. Four dishes of each cell-line were transfected with 0.5 |ig of p4xSRE, in addition, one dish of each cell-line was co-transfected with 0.5 jig of pEXV3 R ac l^ '\ while the other three were co-transfected with 0.5 pg of pEXV3. Cells were continuously cultured in the presence of doxycycline unless otherwise indicated. The LipofectAmine-DNA mix was applied to the cells for 5 h after which cells were incubated in DMEM with 10% NCS for 16 h. Then the cells were washed in DMEM and cultured in DMEM with 1% serum. One dish that had been transfected with pEXV3 was cultured in the absence of doxycycline, while the rest were cultured in the presence of doxycycline. Another pËXV3 transfected dish was re-stimulated with 20% NCS 14 h prior to harvesting. Cells were harvested and analysed for CAT activity 48 h later. Each point was performed in triplicate.

149 Figure 4.2

12000

□ STR1 10000 ■ STRAC.C □ STRAC.7

8 0 0 0 STRAC.10 E Q.U

•M>, '> 6 0 0 0 uTO t- < u 4 0 0 0

2000

0

Dox (100 ng/ml) pEXVS Racvi2 NCS (2 0 % ) + Chapter Four - Rac and the Cell Cycle

Figure 4.3 The response of the SRE to Racl'"*^ differs in different rodent fibroblasts a) The LipofectAmine reagent was used as described above to transiently transfect six dishes of NIH 1 and NIH 2 cells. Each cell-line was co-transfected with either 0.5 pg of p4xSRE or p4xPRE and 0.5 |ig pEXVB or p4xSRE and pEXVB Racl^^^. In addition untransfected cells were used to provide a background measure of CAT activity. After transfection the cells were washed in DMEM and cultured in DMEM with 1% NCS. Cells were harvested and analysed for CAT activity 48 h later. One dish of each cell-line transfected with p4xSRE or p4xPRE and pEXVS was stimulated with 20% NCS 14 h prior to harvesting. The CAT activity of the untransfected control was deducted from the CAT activities of the transfected cells. The factor of difference between CAT activity from unstimulated p4xPRE transfected cells and their serum-stimulated counterparts was used as a normalising factor for the CAT activities obtained from cells transfected with p4xSRE. Values are shown as fold activation over the unstimulated SRE which is taken as 1. Each point was performed in duplicate. b) Transient transfections into NIH 1, NIH 2 and Rati cells were performed as above. Each cell-line was co-transfected with either p4xSRE or p4xPRE and pEXVS or pEXV3 Racl^'^. The calcium phosphate method was used for MEFs with 2.5 pg of each vector and 5 pg of pUC19 carrier DNA. The precipitate was removed after 16 h and then MEFs were incubated in DMEM with 1% NCS and treated as described above. The CAT activity of the untransfected control was deducted from the CAT activities of the transfected cells. The factor of difference between CAT activity from p4xPRE transfected cells unstimulated and those stimulated with serum or with Racl^'^, were used as normalising factors for the CAT activities obtained from p4xSRE transfected cells stimulated with serum or with Racl^'^ respectively. Values are shown as fold activation over the un stimulated SRE which is taken as 1. Each point was performed in duplicate.

151 (Q C cS

Û) 00 Fold CAT activity Fold CAT activity Chapter Four - Rac and the Cell Cycle

Figure 4.4 JNK is not activated by induction of Racl'^*^

Confluent cultures of ST and STRAC.C cells were incubated in DMEM with 0.5% NCS and doxycycline. 36 h later, cells were washed with warm DMEM and one dish was incubated in the absence of doxycycline while the other two were cultured in the presence for a further 16 h. 30 min prior to harvesting, the media from one of the dishes in the presence of doxycycline was removed and reserved and 10 ml of PB SA was added to the dish, the cells were then subjected to 25 seconds of UV light. The PB SA was then removed and the media replaced. All cells were harvested 30 min later using JNK lysis buffer.

Figure 4.5 Induction of Racl'"*^ allows colony formation in soft agar

STRAC.C, STRAC 10 and ST cells in DMEM with 10% (v/v) serum and doxycycline were washed and trypsinised. A soft agar assay was performed with 4x10^ and 2x1 O'* cells in the presence or absence of doxycycline for 26 days. Cells were then stained with 0.1 % Neutral Red, photographed and colonies were counted. Dishes that were seeded with 2x104 cells are shown for ST,STRAC.C and STRAC.10 cells in the presence of doxycycline. The colony numbers are shown in Table 4.1.

153 Figure 4.4 ST STRAC.C

GST-c-jun

UV - + +

Dox (100 ng/ml) + + + +

Figure 4.5 Dox (>100 ng/ml) +

STRAC.C

STRAC.10

ST Chapter Four - Rac and the Cell Cycle

Figure 4.6 Racl'"*^ is unable to induce mitogen-independent growth

(a) 1x10* STRAC.C cells were seeded in full growth media with doxycycline (100 ng/ml). The next day they were washed and cultured in DMEM containing 10%, 2% or 0.5% serum in the presence or absence of doxycycline for 3 weeks. Then the dishes were stained with crystal violet and photographed.

(b) Confluent cultures of STRAC.C cells were serum deprived for 48 h in media containing 0.5% serum in the presence of doxycycline (100 ng/ml). Doxycycline was then washed out and the cells were cultured in the presence or absence of doxycycline for

30 h. Tritiated thymidine was added 6 h prior to harvesting and assaying for thymidine incorporation.

155 3 g TI ( Û X (q ‘ c o (D o b) 3H Thymidine Incorporation/cell (arbitrary units)

o o

ai I

ra in

y. o m Chapter Four - Rac and the Cell Cycle

Figure 4.7 Racl'"*^ induces DNA synthesis in a variety of anchorage- independent culture methods a) Confluent cultures of STRAC.C cells were incubated in DMEM with 1% NCS for 48 h. Cells were then trypsinised, resuspended in DMEM with 10% NCS and counted. 1x10^ cells were plated in DMEM with 10% NCS and tritiated thymidine in the presence or absence of doxycycline on dishes coated with either polyHEMA or agarose or 1x10^ cells were suspended in 2 ml of MC matrix. Cells were harvested after 48 h and assayed for tritiated thymidine incorporation. b) Confluent cultures of STRAC.C cells were incubated in DMEM with 0.5% NCS for 48 h. Cells were then trypsinised, resuspended in DMEM with 10% NCS and counted. 3x10* cells were seeded in DMEM with 10% NCS in the presence of doxycycline either on dishes coated with polyHEMA or were suspended in 15 ml of MC matrix for 36 h prior to fixing and staining with propidium iodide and analysing with a FACScan machine. c) STRAC.C cells were seeded confluently, then serum starved in DMEM with 0.25% NCS for 48 h in the presence of doxycycline (100 ng/ml). Cells were then placed into suspension on polyHEMA coated dishes in the presence or absence of doxycycline for stated time period. Cells were harvested, loaded onto an SDS-PAGE gel, western blotted and probed with 9E10 antibody. Lanes 11 and 12 are STRAC.C lysates from adhered cells cultured in DMEM with 0.25% (lane 11) or 10% (v/v) (lane 12) NCS in the presence of doxycycline. Lane 13 is a lysate from NIH 3T3 LXSN Ras^'^ cells.

Figure 4.8 The basal rate of DNA synthesis is compromised in high density conditions

Confluent cultures of STRAC.C cells were incubated in DMEM with 0.5% NCS and doxycycline for 48 h. Cells were then trypsinised, resuspended in DMEM with 10% NCS and counted. 1x10* cells were incubated in 2.5 ml or 0.5 ml DMEM with 10%

NCS in the presence or absence of doxycycline on 6 or 24 well dishes respectively coated with polyHEMA for 72 h. Tritiated thymidine was added for 9 h prior to harvesting and analysing the amount of thymidine incorporation.

157 Figure 4.7

a) b)

5000 s E ■■ § a . □ + Dox ■ - Dox c 4000 g o

o 3000 8 400 Propidium Iodide

- 2000 I Ë 1000 I: co poly- agarose methyl-

HEMA coating cellulose 400

C) 1 2 3 4 5 6 7 8 910111213

RacVi2

Dox (100 ng/ml) + + + + + + + Time in suspension 24 45 49 66 75 minus dox (h)

Figure 4.8

E 3000 Q. □ + Dox 'c O 2 5 0 0 ■ - Dox

O 2000 Q. O ü C 1500 m c 1000 E >. 500 I co 0 6 well 24 well Chapter Four - Rac and the Cell Cycle

Figure 4.9 Removal of adhesion causes downregulation of G1 Cyclins

Confluent cultures of STRAC.C cells were incubated in DMEM with 0.5% NCS for 48 h. Cells were then trypsinised, resuspended in DMEM with 10% NCS. Cells were seeded in DMEM with 10% NCS with doxycycline either on dishes coated with polyHEMA or on normal tissue culture plastic. Cells were incubated thus for 30 h prior to harvesting. Cell lysates were separated by SDS-PAGE and analysed by Western blotting. The blot was sequentially probed with 287-3, sc-596 and sc-528 antibodies against Cyclin D l, Cyclin A and p27*^'’’ respectively.

Figure 4.10 Removal of adhesion rapidly downregulates Cyclin Dl

transcription

ST GL2 and ST Dl cells were seeded confluently and incubated in DMEM with 5 |Xg/ml insulin and doxycycline for 48 h. Cells were then trypsinised and resuspended on ice in DMEM with 10% NCS to inactivate the trypsin and counted. 2x10^ cells of each cell-line was immediately harvested and frozen on dry ice. Other samples of equal cell numbers were seeded onto polyHEMA coated dishes in DMEM with 10% NCS and harvested 3 or 9 h later, then frozen. All samples were stored at -80°C overnight, prior to assaying for luciferase activity the following day. Each point was performed in duplicate.

159 Figure 4.9

n Cyclin D1

Cyclin A

p27 Kip1

Figure 4.10

100

° STGL2 ST Dl 80

lôi co 60

40

20

0 3 9 Time in Suspension (h) Chapter Four - Rac and the Cell Cycle

Figure 4.11 Induction of Racl^*^ induces S-phase and upregulates G1 cyclin expression and activity

Confluent cultures of ST and STRAC.C cells were incubated in DMEM with 0.5% NCS and doxycycline for 36 h. Cells were then trypsinised and resuspended on ice in DMEM with 10% NCS to inactivate the trypsin and counted. a) For the thymidine incorporation assay, 1x10^ cells were seeded on polyHEMA coated dishes for the indicated times. Tritiated thymidine was added 2 h prior to harvesting for analysis of tritiated thymidine incorporation.

b) For biochemical analysis 6x10^ cells were seeded on polyHEMA coated dishes in DMEM with 10% NCS in the presence or absence of doxycycline and harvested at the time indicated. Alternatively lysates were taken from cells cultured in adherent conditions either confluent in 0.5% or subconfluent in 10% NCS with doxycycline in DMEM (Lanes 12 and 13). To analyse protein expression levels, cell lysates were separated by SDS- PAGE and analysed by Western blot. The blots were sequentially probed with 287.3, E23 and sc-481 antibodies recognising Cyclin Dl, Cyclin A and Cyclin E respectively. Cyclin A and Cyclin E-associated kinase activities were assayed by immunoprécipitation with E72 and sc-481 antibodies and protein G sepharose and they were assayed for their ability to phosphorylate Histone HI.

161 Figure 4.11

a)

2500 E □ + Dox OCL ■ - Dox 2000 C o

o 1500 Q. O _c CCD 1 0 0 0

E >' 500 \-SI X co

14 18 22 26 30 34 38 42 46 Time (h)

b)

NCS (10%) + 4 - 4 - + + + +

Time in suspension (h) 14 14 18 22 26 30 34 38 42 46 46 0 0

Dox (1 00 ng/ml) + -- ...... -- + + +

Cyclin D1 WB

Cyclin E WB .mmw «MM» « i P » # # #

Cyclin E IP Histone NI

Cyclin A WB

Cyclin A IP Histone H1 ± L 1 2 3 4 5 6 7 8 910111213 Chapter Four - Rac and the Cell Cycle

Figure 4.12 PI 3-kinase is inhibited by LY 294002 for at least 32 h

a) Confluent cultures of STRAC.C cells were incubated in DMEM with 5 [ig/ml insulin and doxycycline. The cells were media changed into DMEM, insulin and the indicated concentration of LY 294002 or its solvent DMSO for 5 h. EOF (50 ng/ml) was added to the indicated dishes for 3 min and then cells were harvested. Cell lysates were separated by SDS-PAGE and analysed by Western blot. Blots were sequentially probed with AKTSer473, 9272 and phospho p42/44 MAP kinase antibodies against phosphorylated AKT, total AKT and phosphorylated p44/p42^"''^.

b) Confluent cultures of STRAC.C cells were incubated in DMEM with 5 |ig/ml insulin and doxycycline. The cells were media changed into DMEM, insulin and 10 |iM of LY 294002 or its solvent, DMSO for the indicated times. EOF (50 ng/ml) was added to the indicated dishes for 3 min and then cells were harvested. Cell lysates were separated by SDS-PAGE and analysed by Western blot. Blots were sequentially probed with AKT Ser473 and 9272 antibodies against phosphorylated AKT and total AKT, respectively.

Figure 4.13 Anchorage-independent growth induced by Racl^^^ is not

dependent on PI 3-kinase activity

Confluent cultures of STRAC.C cells were incubated in DMEM with 5 pg/ml insulin and doxycycline. The cells were media changed into DMEM, insulin, doxycycline and the indicated concentration of LY 294002 or its solvent, DMSO for 1 h prior to trypsinisation. 1x10^ cells were seeded onto polyHEMA coated dishes in DMEM with 10% NCS in the presence or absence of doxycycline and in the indicated concentration of

LY 294002 for 32 h. Tritiated thymidine was added to the cells 6 h prior to harvesting and a thymidine incorporation assay was performed.

163 Figure 4.12 a) b)

EGF + - + + + + EGF + + + + +

LY (uM) - 2 5 10 50 Time(h) 24 24 8 16 24 32

LY (pM) - - 10 10 10 10

■phospho- AKT phospho- AKT

■AKT

AKT

■phospho- ERK

Figure 4.13

8 0 0 0 O -f- D o x Fold ■ - D o x Increase 7 0 0 0

6 0 0 0

5 0 0 0

4 0 0 0

3 0 0 0

2000

1 000

0 LY (|iM) 10

dox (100 ng/ml) + Chapter Four - Rac and the Cell Cycle

Figure 4.14 Raf inhibits the ability of Racl^^^ to induce anchorage- independent growth

STRAC.C cells were infected with LXSN RER retrovirus and cells resistant to 2.5 |Xg/ml puromycin and 1 mg/ml G418 were pooled to form a polyclonal population. a) STRAC/RER cells were incubated in 0.5% NCS for 48 h then trypsinised and seeded onto polyHEMA coated dishes in DMEM with 10% stripped NCS, insulin and if indicated doxycycline and ethanol or the indicated concentration of 4-OH tamoxifen. Cells were harvested after 36 h (SUSP). In addition cell lysates were taken from subconfluent populations of STRAC/RER cells adhered in DMEM with 10% stripped NCS in the presence of doxycycline (ADR). Cell lysates were separated by SDS-PAGE, using both a 12.5% gel and a MAP kinase shift gel and analysed by western blotting. The MAP kinase blot was probed with 122.2 antibody against p42^^'^^ and the other blot was probed with 9E10, then cut into two pieces which were sequentially probed with 287.3 then sc-596 and sc-391 then sc-527 to detect Cyclin Dl, Cyclin A, p21^'^^ and p27‘^''’* respectively. b)STRAC/RER cells were incubated in 0.5% stripped NCS for 48 h then trypsinised and seeded onto polyHEMA coated dishes in DMEM with 10% stripped NCS, insulin, BrdU and if indicated doxycycline and ethanol or the indicated concentration of tamoxifen. Cells were harvested after 36 h. Cells were then cytospun onto glass slides and fixed. Their BrdU content was analysed by immunohistochemistry using an anti-BrdU antibody and all cells were marked by staining with Hoechst 33258. Cells were photographed and counted, the total cell number for each point was between 150 and 250. The percentage of BrdU positive cells is represented in the figure. c) STRAC/RER cells incubated in DMEM with 10% stripped NCS were trypsinised and 1.5x10^ cells were incubated in MC matrix and if indicated, doxycycline and ethanol or the indicated concentration of tamoxifen for 48 h. Tritiated thymidine was then mixed in and cells were incubated for a further 14 h and then harvested and assayed for thymidine incorporation. Figure 4.15 RhoA^^^ induces anchorage-independent growth

ARER/Rho and ARER/plink cells cultured in DMEM with 10% stripped NCS were trypsinised and 1x10^ cells were incubated on polyHEMA coated 6 well plates in DMEM with 10% stripped NCS. 16 h later 100 nM 4-OH tamoxifen or ethanol was added to the indicated cells for 22 h. Tritiated thymidine was added to the cells 6 h prior to harvesting and a thymidine incorporation assay was performed. Each point was performed in triplicate.

165 o Cells incorporating BrdU (Q Thymidine Incorporation (cpm) (û C c —T (% of total cell number) (D (D

CJl

3H Thymidine Incorporation (cpm)

— i. — L M ro co en 0 en 0 en 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

DD ■ □ m

"D r- &) 3 ' M 7T f # u 0 1 t # 1 f 0 DD m 1 100 m 1 3 1 m I :- ■■ 10 J 3 z r » 1 O i“D 1 # 100 E $ 1 t e 10 1 1 _ II t # 1 1 > 1 J 0 [ M 1 # O T3M -O11 T3 Chapter Five - Discussion

5. Discussion

167 Chapter Five - Discussion

5 . 1 Regulation of the cell cycle by Ras and Raf

5.1.1 Signal strength determines signal specificity A possible mechanism by which multiple effects can be generated by activation of the same signal transduction pathway has been identified. We have shown that Raf-1 signals of different strengths are able to differentially induce protein expression, which has consequences for the mitogenic response of the cell. The specificity of ERK signalling is also determined by the duration of activation (Marshall, 1995). For example, in PCI2 cells NGF causes cell cycle arrest and differentiation and has been shown to prolong activation of ERK for at least 24 h, these effects can be mimicked by constitutively activated Ras or MEKl (Cowley et al., 1994; Decker, 1995; Noda et al., 1985). In contrast EGF stimulates ERK activation only transiently and stimulates mitogenesis (Decker, 1995). Interestingly it has been shown recently that although NGF initially stimulates Ras-mediated activation of ERK, the sustained ERK activation is independent of Ras and is mediated by Rapl, a Ras family member through activation of B-Raf and MEKl (York et al., 1998). B-Raf may be the principal target of NGF stimulation because it is able to activate ERK more strongly than Raf-1 (Pritchard et al., 1995). This implies that regulation of both duration and strength of signals are mechanisms used by the cell to determine signal specificity. Hormonal activation of ARaf:ER constitutively activates ERK and prevents growth factor stimulated DNA synthesis of 3T3 fibroblasts and Schwann cells (Lloyd et al., 1997; Samuels and McMahon, 1994). We have shown that this inhibition can be prevented by reducing the strength of the Raf-1 signal. It would be interesting to observe whether altering the duration of Raf-1 activation would have similar effects, i.e. whether a short intense pulse of Raf-1 activation, to mimic growth factor stimulation, would be sufficient to have a proliferative effect in NIH 3T3 cells, and also whether this would be more mitogenic than sustained Raf-1 activation at a low level. The finding that a cell can utilise a single pathway to elicit multiple effects has profound implications for the conclusions that have been drawn from studies in which proteins have simply been overexpressed or inhibited. We have demonstrated the value of using an inducible system which allows the level of activation of a signal to be controlled, rather than just switching signals on and off, since additional properties may be revealed.

5.1.2 Signal specificity is regulated by differential protein expression

Cell growth, arrest or death are some of the consequences of Ras or Raf-1 activation of specific signal transduction pathways. We have proposed a mechanism through which Ras may elicit two of these effects: proliferation and cell cycle arrest. We have shown that Raf-1 target proteins have different thresholds of induction by Raf-1. This is

168 Chapter Five - Discussion demonstrated by the ability of RafAR to induce Cyclin D l, but not at moderate levels of activation. Whereas strongly activated RafAR is able to induce both pZl^'^"^ and Cyclin D l. Analogous work by Woods et al (1997) has shown that the presence of p2 iCip-i CDK2 and CDK4 complexes and their associated kinase activities is sensitive to the level of activation of AB-Raf:ER, and this correlates with the ability of AB-RafiER to stimulate DNA synthesis.

This ability to differentially regulate protein expression which correlates with the effects on DNA synthesis has led to a model of Raf signal strength determining cellular responses through differential protein induction. Such that in the absence of p21^''’ ‘ induction, Cyclin Dl protein is expressed and CDK2 and CDK4 complexes are active and are able to phosphorylate pRb and drive cell cycle progression. However, induction of p 2 icip-i yy strong Raf-1 signals inhibits cyclin/CDK kinase activities and pRb remains hypophosphorylated. One might expect that in the absence of Cyclin Dl Raf-1 activation may cause a more profound arrest. However since Cyclin D l null MEFs are inhibited to a similar extent to wild type MEFs upon activation of RafAR there is probably redundancy with other D-type cyclins. Importantly as Ras’^'^ or RafAR signal intensities increase we observe gradual inhibition of DNA synthesis and a gradual induction of p 2 iCip-i suggests that a delicate and sensitive balance exists between the cyclin- associated complexes and p 2 1 ^''^'' that controls their kinase activity which regulates the contrasting effects of Raf-1 activation.

Interestingly, recent studies into the development of dorsal appendages on the Drosophila egg have revealed a mechanism where different thresholds of ERK activity, regulated by the EGF receptor, induce expression of different genes which change cell fate. Initially ERK is weakly activated by Gurken, a Drosophila homologue of TGFa, through the EGF receptor. This activates Spitz (another TGFa homologue) which promotes the development of the dorsal appendages. However Spitz further activates ERK through a positive autocrine loop and when ERK activity increases beyond a certain threshold, Argos expression is induced. This protein is inhibitory to the development of the dorsal appendages because it activates a negative feedback loop and downregulates ERK (Wasserman and Freeman, 1998). Thus different strengths of ERK activity induce differential protein expression which has developmental consequences.

5.1.3 Raf-induced cell cycle inhibition is mediated by * We have demonstrated both genetically and biochemically that p21^'‘’*‘ is required for inhibition of DNA synthesis by activated Raf-1. Woods et al (1997) have analogous findings through the use of various Raf family oestrogen receptor fusion proteins. This concurs with the observation in Schwann cells that the expression of antisense p21^'P ' constmcts reduced the degree of DNA synthesis inhibition caused by ARaf:ER activation

169 Chapter Five - Discussion

(Lloyd et al., 1997). Suggestive but not conclusive evidence from investigations into NGF-mediated cell cycle arrest of PCI2 cells also supports a major role for as a mediator of Raf/MEK/ERK induced cell cycle arrest. NGF stimulation of PCI2 cell differentiation and cell cycle arrest involves a MEK dependent translational upregulation of p21^*P ' (Pang et at., 1995; van Grunsven et at., 1996). Furthermore, ectopic expression of p21^‘P ' can arrest the cells and stimulate neurite outgrowth (Erhardt and Pittman, 1998). In addition NGF-mediated cell cycle arrest of NIH 3T3 cells ectopically expressing the NGF receptor, TrkA, upregulates p21‘^’'’ ' which enters CDK2 and CDK4 complexes which are inactivated (Decker, 1995; Pumiglia and Decker, 1997). We have shown that p21^'^' enters and specifically inhibits the associated kinase activities of G1 cyclin/CDK complexes. Activation of D-type cyclin-associated kinase activity is necessary for the phosphorylation of pRb, which is required for progression through G 1. We have shown that pRb becomes hypophosphorylated upon RafAR activation. RafAR activation also inhibits Cyclin E-associated kinase activity which also has a role in pRb phosphorylation, but has additional roles which may involve initiation of immediate early transcription. Thus inhibition of these activities by p21^'^' should be sufficient to prevent G1 to S-phase progression.

5.1.4 upregulation by Raf is independent of p53 We have shown that RafAR activation can increase p21^‘P ' promoter activity. p21^'^'' is a transcriptional target of p53 (el-Deiry et a l, 1993) yet we have shown in MEFs that

p2 icip-i pj-Qtein levels can be induced by RafAR in the absence of p53. This was also observed by another group who performed similar work using ARaf:ER molecules (Woods et a l, 1997). Nevertheless, p53 function has been shown to be necessary for growth inhibition and a senescent phenotype that was observed in MEFs that were retrovirally infected with Ras^'^ or with MEKl'’^^ (a constitutively active MEKl mutant). Rather than these oncogenes inhibiting DNA synthesis in p53 null MEFs as we had observed upon RafAR activation; Ras^'^ and MEK’’^^ actually promoted DNA synthesis (Lin et a l, 1998; Serrano et a i, 1997). This response concurred with experiments in which Ras^'^ expression permitted p53 null MEFs to proliferate in the absence of anchorage and form tumours when injected into nude mice (Tanaka et al, 1994). This difference in p53-dependency is unlikely to involve Ras-mediated, Raf independent pathways since a similar requirement for p53 is observed with constitutively active MEKl. Furthermore Ras^'^ mediates proliferative inhibition through MEK since growth arrest can be partially inhibited by the MEK specific inhibitor, PD 98059 (Lin et a l, 1998). The difference in p53-dependency in MEFs is more likely to be associated with the different kinetics of Raf-1-MEKl-ERK activation. We have observed that different intensities of Raf signals can elicit different responses. The kinetics (and probably the

170 Chapter Five - Discussion

intensities) of activation of ERK caused by rapid activation of RafAR with hormone will differ from constitutive expression of MBKl^^^ or Ras^'^. This is probably what contributes to the difference in p53 dependency. Rapid activation of RafAR may induce an additional inhibitory mechanism which is independent of p53 function, for example, upregulation of p21^'^^'. This mechanism may not be induced by constitutive expression of Ras^'^ or because it is blocked by feedback loops caused by constitutive ERK activation, which are not established in the case of rapid RafAR activation. Indeed ARafrER cells activate ERK to 20 fold lower levels if they have been selected continuously in the presence of activating hormone compared to ARaf:ER activation in cells which were selected in the absence of hormone (Kerkhoff and Rapp, 1998). Thus RafAR may control two mechanisms that lead to growth arrest; a p53-independent upregulation of p21^''’*‘ and possibly a p53-dependent pathway, that may or may not involve p 2 1 ^''^'\ whereas constitutive expression of Ras^'^ or MEK®*^^ may induce only the p53-dependent inhibitory pathway. Furthermore, p53-dependency appears to vary between cell types since ARaf:ER-mediated inhibition in Schwann cells is p53-dependent, indicating the absence of a mechanism allowing p53-independent upregulation of p 2 1 ^''’ ' in response to rapid activation of ARaf:ER (Lloyd et ai, 1997).

5.1.5 Putative mechanisms for p53 independent induction of There are many instances of p21^'^ ' upregulation in cells deficient of p53 function, however the mechanisms of induction have not been fully defined (el-Deiry, 1998). Although we have not categorically demonstrated it, our results suggest that Raf is able to induce p21^'^ ' transcription in the absence of p53 function. Induction of p21^'^'' transcription in the absence of p53 has been demonstrated many times (el-Deiry, 1998; Michieliet a i, 1994). The transcriptional co-activator p300 has been implicated in this. A mutant of the adenovirus El A protein that specifically sequesters p300 is able to block NGF-mediated, p53-independent, upregulation of p21^'P ' in PC 12 cells in addition to preventing the subsequent cell cycle arrest and neurite outgrowth (Billon et al., 1996). Furthermore, the transcriptional upregulation of p21^'^'' that occurs upon keratinocyte terminal differentiation also requires p300 or a protein with similar El A binding properties (Missero etal., 1995). Since activation of ERK has been implicated in PC 12 cell and keratinocyte differentiation it is possible that p300 may have a role in the Raf- mediated growth inhibition we observe. In addition, the transcription factor and tumour suppressor protein, IRF-1 has been shown to transcriptionally induce p21^''"'' independently of p53 in response to DNA damage or TGF p (Miyazaki et al, 1998; Tanaka et a l, 1996). Binding sites for the Ets family and Spl family of transcription factors within the p21^'P'' promoter have also been demonstrated to be necessary for upregulation of p 2 1 ^'^^' promoter activity in response to factors that are able to mediate p53-independent upregulation of p 2 1 ^'P’’ and growth arrest

171 Chapter Five - Discussion

(Biggs et a/., 1996; Funaoka et al., 1997; Nakano et a i, 1997). These data suggest that a variety of different mechanisms have the capacity to regulate p53-independent induction of p 2 l ‘^’‘’’* transcription. We have demonstrated that pll^'^ ' can be transcriptionally upregulated by Raf-1 activation. However other mechanisms may also regulate p21^’p*‘ expression. p21^'^ ' levels can be upregulated independently of transcription, for example induction of p 2 1 ° ‘^‘ by okadaic acid is not inhibited by the transcriptional inhibitor, actinomycin D, whereas transcription is required for p21^'^T induction by the phorbol ester TPA (Zeng and el- Deiry, 1996). This may occur in part through stabilisation of p21^'C'^ mRNA which has been shown to occur by a mechanism dependent on MEK in response to stimulation by PKC-activating phorbol esters (Akashi et at., 1999). is also regulated by post- transcriptional mechanisms involving translational regulation and protein stability (Hengst and Reed, 1996; Pagano et al., 1995). Protein degradation may also have a role in regulating p21^'^'' levels since p2l‘^'‘’ ' is a target of ubiquitination (Maki and Howley, 1997). In addition to regulating the activity of p21^'^ ' through control of its expression levels, there is also some evidence suggesting that p 2 1 ^'P ' activity may also be regulated by a p2 1 ‘''P ' inhibitor protein (Hermeking et al., 1995). This concurs with our observations in which PI 3-kinase activity was able to stimulate DNA synthesis in the presence of high levels of p21^''^''. However this protein has not yet been identified. It may be the case that multiple proteins are able to sequester inhibitors from their cyclin/CDK targets. For example, Cdc25A is upregulated by c-myc and can compete with p21^''’ ’ for Cyclin/CDK binding (Sahâet al., 1997). The HPV16 oncoprotein E7 is also able to block inhibition by p21^''"'' (Funk et al., 1997). An unidentified activity is also able to inhibit p27*^''’' inhibition in response to c-myc to promote cell cycle progression. The effects of the unidentified inhibitor cannot be reproduced by Cdc25A or the G1 cyclins (Vlach et al., 1996).

5.1,6 is not necessary for Ras or Raf-mediated cell cycle arrest of human fibroblasts Interestingly, in contrast to murine fibroblasts, human fibroblasts appear able to arrest and acquire a senescent phenotype in response to activation of the Ras-Raf pathway independently of p21^'^ ' or p53. Activated ARaf.ER or constitutively expressed Ras^'^ were able to inhibit the proliferation of non-immortalised IMR-90 human fibroblasts expressing the human papilloma virus E 6 protein (which ablated p53 and p21‘^‘'’ ‘ expression) or a dominant negative p53 mutant, respectively (Serrano et al., 1997; Zhu et al., 1998). The difference in response of the human and murine cells may be due to the presence of additional checkpoint control pathways in human cells. Human cells are much more resistant to immortalisation and transformation than rodent cells. For

172 Chapter Five - Discussion

example, co-expression of activated Ras, HPV E 6 and E7 (which inactivates pRb) and overexpression of telomerase does not permit human fibroblasts to grow in soft agar (Morales et al., 1999). This indicates that human cells are well protected against oncogenic activation and that multiple mechanisms protect the cells. These probably involve multiple cell cycle inhibitor proteins, for example both piand pll^'^"^ are induced by ARafrER activation in IMR-90 cells (Zhu et al., 1998) and p27'^‘’* is induced in human small cell lung carcinoma cells (Ravi et al., 1998). However, although overexpression of a single inhibitor is sufficient to induce cell cycle arrest (Zhu et al., 1998), the loss of one is insufficient for deregulated growth, for example, neither inhibition of p21^'P"' or plb*^*^"* (through the use of a dominant negative CDK4 mutant) was able to prevent cell cycle inhibition by Ras (Serrano et al., 1997; Zhu et al., 1998). This implies that there are multiple backup mechanisms in place. It would therefore be of interest to inhibit multiple cell cycle inhibitor proteins in human fibroblasts and assess the response of the cells to Ras or Raf activation.

5.1.7 Utilisation of a developmental differentiation pathway as a defence against oncogenic activation

Inhibition of cell proliferation by activation of Ras, Raf and MEKl has been demonstrated in many mammalian cell types, including : non-immortalised human fibroblasts; human small cell lung cancer cells; rat fibroblastic cell-lines; rat Schwann cells; PC 12 cell and, as we and others have shown, primary and immortalised murine fibroblasts (Lin et al., 1998; Lloyd et a l, 1997; Noda et a l, 1985; Olson et a l, 1998; Pritchard et a l, 1995; Ravi et a l, 1998; Samuels and McMahon, 1994; Serrano et a l, 1997; Sewing et a l, 1997; Woods e ta l, 1997; Zhu e ta l, 1998). Interestingly many instances of Ras or Raf activation result in differentiation. For example, NGF stimulation or activation of Ras or MEKl causes PCI2 cells to differentiate, phenotypically demonstrated as cell cycle arrest and neurite outgrowth (Cowley et a l, 1994; Decker, 1995; Noda et a l, 1985). Moreover, the importance of regulated Raf signalling in differentiation is demonstrated in vivo by the aberrant differentiation patterns in transgenic mice expressing activated Ras and Raf. For example, expression of activated Raf in the thymus accelerates T-cell differentiation (O'Shea eta l, 1996) and activated Ras under the control of the keratin 10 promoter resulted in increased differentiation which led to hyperkeratosis of the skin (Bailleul et a l, 1990). Furthermore, the Ras/Raf/ERK pathway has been implicated in differentiation in invertebrates. In Drosophila, Ras and Raf are required for terminal differentiation of the R7 photoreceptor cell and posterior terminal cell fates (Dickson et a l, 1992; Lu et a l, 1993; Sprenger et a l, 1993). In C.elegans the Raf homologue, Lin45, is involved in the transmission of inductive signals that promote migration and terminal differentiation of vulval precursor cells from the homologues of the GGF

173 Chapter Five - Discussion

receptor and Ras, Let23 and Let60 respectively (Han et ai, 1993; Sternberg et al., 1993). The mechanism for cell cycle arrest by MAP kinase cascades through induction of cyclin/CDK inhibitor proteins is also conserved in yeast. Pheromone-mediated G1 arrest in S.cerevisiae is executed via a MAP kinase cascade which activates an ERK homologue, Fus3, which regulates the activity of the transcription factor, Stel2. Stel2 is necessary for proper regulation of the Cln/Cdc28 kinase inhibitor, Farl, which mediates G1 cell cycle arrest (McKinney and Cross, 1995; Oehlen et ai, 1996; Peter gf at., 1993; Peter and Herskowitz, 1994). Therefore although transient activation of the ERK MAP kinase pathway is required for controlled cell cycle progression, aberrant, constitutive activation of this pathway has the potential to cause deregulated cell proliferation. However, the cell utilises a developmental mechanism for terminal differentiation as a protective mechanism against sustained oncogenic activation of the ERK MAP kinase pathway. This would lead to cell cycle arrest and thus prevent propagation of a potentially tumorigenic cell. In fibroblasts activation of this pathway has been shown to result in senescence (Lin et a l, 1998; Serrano etal., 1997; Zhu etal., 1998). This may be an alternative to differentiation since fibroblasts are not thought to differentiate.

5.1.8 Physiological relevance of controlling cellular responses by signal strength We have proposed a mechanism that a cell may use for determining signal specificity based on constitutive activation of signalling pathways which mimics a similar scenario to oncogenic activation. As discussed above the development of dorsal appendages in the Drosophila egg rely on ERK signals of different strengths (Wasserman and Freeman, 1998). Sustained activation of ERK by NGF has also revealed a mechanism in which differentiation is determined by the duration of activation of a signal (Marshall, 1995; York et al., 1998). A multitude of possible physiological mechanisms that could be utilised to regulate the degree of activation of a signalling pathway have already been identified. For example ERK activity has been shown to be regulated by the availability and type of growth factors (Decker, 1995) and the availability of their receptors (Fan et al., 1995); by the attachment of cells to substratum and ligation of integrin receptors (Hotchin and Hall, 1995; Zhu and Assoian, 1995); by the phosphorylation of Sos (Foschi et al., 1997); by the presence of Ras effectors that may compete with Raf for Ras binding and activation (Kikuchi and Williams, 1996); by the different strengths of activation of Raf family members (Pritchard et al., 1995); by the action of specific MAP kinase phosphatases (Duffetal., 1995; Foschi etal., 1997; Sun et ah, 1993); by the availability of scaffold/adaptor proteins (Schaeffer er a/., 1998; Whitmarsh eta l, 1998) and by many other factors which regulate the activities of proteins upstream of ERK (Grammer and Blenis, 1997).

174 Chapter Five - Discussion

5.1.9 Signal specificity is also affected by the expression of other regulatory proteins

The ability of different strengths of Raf signals to differentially activate downstream pathways provides an explanation for the contrasting abilities of A-Raf and B-Raf oestrogen receptor fusion proteins to induce DNA synthesis at similar levels of hormonal stimulation (Pritchard et al, 1995). Signal specificity can also be altered by the activation

of other proteins, for example, c-myc is able to induce sequestration of p 2 1 ^^^ and thus inhibit cell cycle arrest by RafAR (Sewing et a i, Manuscript in preparation). Similarly, the introduction of v-mil (avian v-Raf) into macrophages is able to co-operate with v-myc and induce DNA synthesis in reduced serum conditions (Graf et al., 1986). Viral oncogenes are also able to change the response of cells to Raf-1 activation, expression of both SV40 Large T Antigen and Adenovirus El A are able to rescue inhibition of cell cycle progression by ARafiER activation (Lloyd et al, 1997; Ravi et al., 1998).

5.1.10 RafAR-mediated upregulation of pll*^*'* ' and growth inhibition is not dependent on Cyclin D1 We and others have shown that activated Ras and Raf-1 are able to upregulate Cyclin D1 protein levels (Filmus et al., 1994; Liu et al., 1995; Lloyd et al., 1997; Winston et al., 1996). Although it is mainly considered an activator of DNA synthesis, Cyclin D1 has also been implicated in cell cycle arrest. For example, ectopic expression of Cyclin D1 in PC 12 cells can promote cell cycle arrest and differentiation (Yan and Ziff, 1995). In addition, a p53-dependent arrest in mouse fibroblasts requires Cyclin D1 induction (Del Sal et ai, 1996). Moreover, ectopic induction of Cyclin D1 expression in NIH 3T3 cells has recently been shown to induce p2l‘^'P ' and p53. However this did not lead to cell cycle inhibition instead these cells acquired the ability to grow in soft agar (Hiyama et al., 1997). In this case p21^'P ' may have had a role in promoting cyclin-CDK complex assembly or stability (LaBaer et al., 1997). However through the use of Cyclin D1 null MEFs we have demonstrated that the presence of Cyclin D1 is not necessary for the Raf- mediated cell cycle arrest or the upregulation of However the participation of other D-type cyclins cannot be discounted.

5.1.11 Activated Ras has greater ability to induce DNA synthesis than activated Raf-1

Ras'^'^ is much more potent at inducing DNA synthesis than activated Raf-1. This concurs with the reported properties of Ras effector domain mutants. The Ras^'^^^^ mutant is able to bind Raf and stimulate ERK activation, however it was unable to stimulate DNA synthesis unless it was co-expressed with another Ras mutant, Ras^'^°^^ (Joneson et al., 1996b). Thus activation of two separate signal transduction pathway by Ras is more mitogenic than Ras-mediated activation of Raf. In addition the capacity of Raf-1 to stimulate DNA synthesis is severely restricted by the narrow window in which

175 Chapter Five - Discussion

Raf signals are sufficiently strong to induce positive signals such as Cyclin D1 upregulation, but not so strong as to induce p21^^\ In comparison, high levels of Ras^’^ efficiently induce DNA synthesis. It would be of interest to determine whether further activation of Ras would also cease to induce DNA synthesis, i.e. whether the mitogenic differences were due to differences in the relative activity of endogenous Raf activated by Ras^'^ and the Raf-1 mutants. However Raf-independent downstream targets of Ras may also affect the activity of the ERK MAP kinase pathway. Downstream targets of Ras, for example, Rac and Rho, have been shown to affect activation of Raf and MEK by Ras (Frost et ah, 1997; King et al, 1998; Renshaw et al., 1996). Therefore one could not be sure whether differences in ERK activation by Ras'^*^ and Raf-1 mutants were quantitative or due to activation of Raf-independent signal transduction pathways by Ras feeding into the ERK MAP kinase module.

5.1.12 A Ras-mediated pathway inhibits Raf induction of p21^*‘’ *

The differences in the stimulation DNA synthesis by Ras and Raf-1 may be caused by

their contrasting abilities to induce p 2 1 ^’'’ ' in serum-deprived cells. p 2 1 ^^' is the main factor responsible for Raf-mediated inhibition and when expressed by similar mechanisms of gene induction RafCAAX upregulates p21^‘‘’ ’ much sooner than Ras^'^. Importantly, induction of p21^^' by RafCAAX occurs prior to S-phase entry, in contrast to induction of p21^^' by Ras^'^ which occurs after S-phase has started. This latter observation is

also supported by microinjection data in which p 2 1 ^'^ ' was not induced by Ras^'^ in serum-deprived NIH 3T3 cells (Olson et ai, 1998).

Furthermore, we have demonstrated that Ras^'^ is able to downregulate p21^'P'‘ induced by ARafiER suggesting the participation of an additional Ras effector pathway. Neither constitutive activation of PI 3-kinase nor RalGEF pathways were able to mimic the effect of Ras^'^. Therefore either downregulation of p21^^' is the function of another Ras effector pathway, or our experiments were unsuited to reveal this ability of PI 3-kinase or Rif. The number of putative Ras effectors is large and growing and any of these proteins are potential candidates for downregulation of p21^'P'\ In addition, rather than affecting p21^'P ' levels downstream of ERK, Ras may activate another pathway which feeds back negatively into the ERK MAP kinase cascade. PI 3-kinase, conventional PKCs, Rho family GTPases and PAK have been implicated in regulation of ERK activation either independently of Ras or other elements of the ERK MAP kinase cascade. However, we do not observe an effect of Ras^'^ on ARafrER-mediated ERK phosphorylation, but changes may occur that are too subtle to be detected by Western blot. Alternatively downregulation of p21^‘P ' may also be due to cellular adaptation to constitutive ERK activation by Ras^'^ which may alter the cellular response to additional ERK activation by

176 Chapter Five - Discussion

ARafiER. One could test this by constitutively expressing RafCAAX in cells expressing ARafiER and testing whether a similar effect is observed.

Viral and cellular oncogenes are able to counteract Ras or Raf upregulation of p 2 1 ° r \ SV40 large T antigen counteracts upregulation of p21^^^ in Schwann cells, probably through its sequestration of p53 which is necessary for p21^^^ induction (Lloyd et al., 1997). RhoA activity has also been shown to downregulate in response to Ras"^'^ and inhibit its transcription (Olson et at., 1998). However the mechanism by which this occurs has not yet been elucidated.

5.1.13 Differential regulation of Rho activity by Ras and Raf

Due to the reported ability of Rho activity to inhibit Ras-mediated upregulation of p21^^' (Olson et at., 1998), the difference between Ras and Raf-mediated induction of p21^'^^ could be rationalised if they were found to influence RhoA activity differently. It is not yet known whether this is the case or even whether Ras directly activates RhoA. Reagents to test this have very recently been developed. These allow the amount of active RhoA in the cell to be measured by its ability to bind to the Rho-binding domain of one of its specific effectors, Rhotekin (Ren et al., 1999). As previously discussed, many links between Ras and Rho activity have been postulated. Proposed mechanisms for biochemical interaction include the physical interaction of p l 2 0 '^“‘^'^^ and pl90’^‘’°°'^‘*, RasGEFs which are able to also act as Rho family GEFs or Ras-mediated regulation of RhoGEFs through PI 3-kinase activity. In addition, dominant negative RhoB has been shown to inhibit Ras, but not Raf transformation (Prendergast et al., 1995). However as discussed below regulation of p21^‘'’ ' by RhoA is more complex than initially proposed, and constitutive RhoA activity does not inhibit p21^^' induction by Ras, Raf or serum.

5.1.14 Co-operative regulation of p21^'^'' induction by Raf-1 and RboA or PI 3-kinase

We have demonstrated that both PI 3-kinase and RhoA signals can co-operate with ARafER to induce p21^^'. We also show that the presence of RhoA^*'^ accelerates induction of p21^^' by ARaf:ER activation. Since neither constitutive activation of PI 3- kinase nor RhoA upregulates p21^'P'’ alone they must either upregulate an essential limiting factor necessary for p21^'P ' induction by Raf-1, or downregulate an inhibitory element. This implies that multiple signals can feed into and regulate p21^^' expression and that Raf-1 induction of p21^^' is not through a linear pathway.

Superinduction of p 2 1 ^^i by co-activation of Raf-1 and RhoA or PI 3-kinase (which acts upstream of Rac) concurs with the observations that Rac and Rho signals feed into the ERK MAP kinase pathway at the level of PAK and permit or assist Raf and Ras activation of ERK (Frost et a l, 1997; Frost et al., 1996; King et al., 1998; Renshaw et al., 1996).

177 Chapter Five - Discussion

We observe a higher level of ERK phosphorylation in serum-deprived confluent RER/Rho cells. This could lead to a greater induction of p21^r^ since we have shown that induction is sensitive to the level of ERK activation. However neither RhoA nor PI 3-kinase activity upregulates ARaf:ER-mediated activation of ERK in cells which

are subconfluent, even though p 2 1 ^'^^ levels in these cells are still superinduced. Therefore activated RhoA and PI 3-kinase must also affect p21^'^ ' expression through mechanisms independent of ERK activation. Alternatively regulation of ERK may occur through mechanisms independent of its phosphorylation state or in a manner too subtle to detect by Western blot analysis.

The ability of RhoA^''* to superinduce p21^^^ upon ARafiER activation contrasts starkly with the reported abihty of RhoA to downregulate p21^^' expression (Olson et al., 1998). However mechanisms are present in cells which allow p21^'^^ induction in the presence of Rho activity. For example, serum, which activates Rho, also transiently upregulates p21^^' when added to quiescent cells (Michieli et at., 1994). Furthermore, in the presence of serum, Ras and Raf-1 activation are able to induce p21^^' in subconfluent NIH 3T3 cells. Nevertheless contact-inhibited Swiss 3T3 cells in the

presence of serum did not induce p 2 1 ^'^ ' upon microinjection of Ras^'^, indeed these cells were induced to initiate DNA synthesis (Olson et al., 1998). This disparity may result from the different proliferative states of the cells. The inhibitory effect of RhoA on p 2 1 ^'p ' expression may only occur in response to acute activation of the RhoA pathway through microinjection or treatment with CNF-1 which specifically activates Rho proteins. Cells may respond differently to the sustained activation of the RhoA pathway and may also have adapted to RhoA activation and downregulated certain responses. One could activate Rho activity using CNF-1 in the presence of ARafiER activation to determine whether the method of Rho activation is responsible for the differences we observe. Alternatively, Ras^'^ may co-operate with RhoA to downregulate p21^^' through a Raf-independent pathway which cannot be mimicked by ARafiER. This would fit with our observed differences in the relative abilities of Ras and Raf to induce p21^^\ A further distinction between the experimental methods involved was that microinjection of Ras^'^ occurred within a background of non-Ras^'^ expressing cells, in contrast to our experiments in which every cell was induced to express Ras^'^ or activate Raf-1. Therefore there is a possibility that autocrine signals from normal cells may affect the behaviour of the cells.

However the observation that RhoA^'"^ in one case represses p21^'^^ and in another stimulates p 2 l‘^‘‘’ ‘ reiterates what we have discovered about signal specificity i the conditions in which a signal is activated can have major implications on the response of the cell to that signal. We have demonstrated an important point, that there is a link

178 Chapter Five - Discussion between Rho activity and expression which can lead to promotion or inhibition of p2 icip-i depending on the context of the cell.

5.1.15 PI 3-kinase is able to positively regulate DNA synthesis

Cells expressing a constitutively activated PI 3-kinase mutant were demonstrated to support mitogen-independent growth. This concurs with other data indicating a mitogenic role for PI 3-kinase activity. Recently the abihty of PI 3-kinase to induce S-phase has been confirmed. A regulatable PI 3-kinase mutant has been generated that consists of a membrane targeted pi 1 0 subunit fused to the hormone binding domain of the oestrogen receptor. Activation of this mutant in a quiescent serum-deprived rat embryo fibroblast cell-line initiated cell cycle entry and also supported growth in soft agar in the presence of serum (Klippel et al., 1998). Furthermore a cell-permeable peptide, based on the p85 binding region of the PDGF receptor that was able to bind p85 and activate PI 3-kinase activity has been demonstrated to stimulate DNA synthesis to the same degree as serum or EOF. This induction was sensitive to inhibition by wortmannin and rapamycin indicating the requirement for PI 3-kinase and pyo^^wnase activities. Furthermore it was independent of MEK activation and the peptide did not lead to ERK phosphorylation (Derossi et at., 1998). This suggests that the ERK MAP kinase cascade was not involved in this induction. This contrasts with experiments in which PI 3-kinase activity was induced by a monoclonal antibody, which stimulated DNA synthesis. This was sensitive to inhibition of but also inhibition of Ras and MEK (Mcllroy et al., 1997). Thus by consensus it appears that PI 3-kinase requires for its mitogenicity. has been shown to be required for serum-stimulated DNA synthesis however its mechanism of action is unknown. It can directly regulate translation through phosphorylation of the S 6 subunit of the ribosomal complex, and furthermore its substrates include transcription factors indicating it can also regulate transcription {GmmvnQi et al., 1996).

It is of interest to note that although the pi 10-oestrogen receptor fusion protein initiated S- phase in serum-deprived conditions, the cells were unable to complete the cell cycle and underwent apoptosis. Therefore prolonged activation of PI 3-kinase activity to the level induced by the pi 10:ER protein may have been incompatible with completion of S-phase which caused the cells to die. Our ARER/pl 10 cells may have downregulated PI 3-kinase to a level compatible with cell growth, or may have undergone genetic changes to adapt to constitutive activation of PI 3-kinase. Alternatively strongly activated PI 3-kinase or this particular mutant may have the capacity to directly induce apoptosis in contrast to its recognised role as a survival signal.

The mitogenic ability of PI 3-kinase may be related to the increased levels of Cyclin D1 and downregulation of p27*^'^'. This inverse relationship of p27^P' and Cyclin D1 also

179 Chapter Five - Discussion

occurred when quiescent cells were stimulated with serum or Raf, both of which are mitogenic signals. Furthermore, although RhoA'^^"‘ upregulated Cyclin D l, it did not reduce p27*^‘’* levels and also did not induce mitogen-independent growth. It would be of interest to test whether PI 3-kinase induces DNA synthesis through downregulation of

p2 7 Kipi then allows activation of the G1 cyclin-CDK complexes.

Furthermore, while both RhoA and PI 3-kinase co-operated with Raf to induce p21^^\ only PI 3-kinase activity provided resistance to inhibition of DNA synthesis by these high

p2 icip-i levels. Therefore it would be interesting to find out how PI 3-kinase activity is able to overcome this induction of p21^^' and stimulate DNA synthesis. Myc activation is able to abrogate RafAR induced cell cycle arrest in the presence of high levels of p21^^ This is believed to occur through the upregulation of Cyclin Dl and D2 which sequester p21^'‘’ ' and thus lead to Cyclin E-associated kinase activation (Perez-Roger et al.. Manuscript in preparation). PI 3-kinase activity may utilise a similar mechanism, although ARafiER induced similar levels of Cyclin Dl in the presence or absence of PI 3- kinase activity. This would require further investigation into the expression and activities of the components of cyclin-CDK complexes.

5.1.16 Ras controlled pathways can work together to induce DNA synthesis

We also demonstrated that multiple Ras effector pathways induce mitogen-independent growth to a larger extent than one alone. This supports the hypothesis that activation of multiple Ras effector pathways control Ras-induced or Ras-mediated cell cycle progression. Further support derives from the ability of any two of the Ras effector domain rhutants Ras^'^*^'^°, Ras^'^^^^ or Ras^'^^^^ to induce focus formation (Rodriguez- Viciana et at., 1997). Furthermore these data also show that different combinations of Ras effector pathways, through co-expression of activated mutants of Ras target proteins can co-operate to induce foci. This is similar to our observation that PI 3-kinase can co­ operate with Raf or Rif to induce DNA synthesis. However the specific combination of Ras effectors appears important since co-activation of Raf-1 and Rif did not significantly increase DNA synthesis levels. It is possible that Raf-1 and Rif are components of the same pathway, however, co-expression of Rif and PI 3-kinase caused a synergistic increase in DNA synthesis, while activation of Raf-1 in the presence of PI 3-kinase only increased DNA synthesis additively. This suggests that Raf and Rif use different mechanisms to co-operate with PI 3-kinase. A more likely alternative is that Rif activation is permissive for PI 3-kinase, but not Raf-1, signal transduction. A method of co- inducing PI 3-kinase and Raf-1 or Rif activity in the same cell would enable a more thorough investigation into the contribution of each of these pathways on DNA synthesis.

180 Chapter Five - Discussion

5.1.17 Future Directions

It would be of interest to elucidate the mechanism by which Raf upregulates transcription and to test whether this involves p300. In addition, to further understand the downregulation of p21^‘P'‘ by Ras^^^ one should determine if it is due to transcriptional downregulation or whether Ras^’^ alters p21^‘P'' mRNA or protein stability. Furthermore, one could try to reproduce the downregulation of p21^*P** by Ras with Ras effector domain mutants and thus narrow down candidate effector pathways.

The synergistic ability of PI 3-kinase and Rif to induce DNA synthesis would also be worth investigating, especially using regulatable molecules such as the recently developed pllOiER (Klippel et al., 1998). Moreover it would be of interest to determine whether these pathways induce DNA synthesis independently of ERK activation or whether these pathways feed into the ERK MAP kinase module. For example, sustained activation of ERK by PDGF has been shown to be dependent on PKCs and PI 3-kinase activity, but independent of MEK (Grammer and Blenis, 1997).

Investigations into how PI 3-kinase is able to induce DNA synthesis in the presence of high p21‘^'P ‘ may reveal novel mechanisms for regulating the inhibitory properties of CKIs. It would be of interest to determine whether the mechanism utilised by PI 3-kinase to overcome p21^''’ ’ induction by Raf are similar to those of c-myc involving sequestration by D-type cyclins (Perez-Roger et al.. Manuscript in preparation)

181 Chapter Five - Discussion

5.2 Rac and its effect on the cell cycle

5.2.1 Separation of Rac- and Rho-mediated anchorage- and mitogen- independent growth

We and others have demonstrated that activated Rac can support and initiate DNA synthesis in the absence of anchorage (Khosravi-Far et al., 1995; Qiu et al., 1995a; Westwick et ah, 1997). Rac^^^ must therefore able to propagate signals normally provided by adhesion to substratum. Rac^'^ has also been reported to induce mitogen- independent growth upon microinjection (Lamarche et al., 1996; Olson et al., 1995). However, since Rac^^^ does not stimulate mitogen-independent DNA synthesis or colony formation in STRAC.C cells Rac may have two independent roles in DNA synthesis initiation which may be cell type dependent or dependent on Rac signal strength. We observe the same separation in ARER/Rho cells and a similar response is observed upon stable transfection of Rho guanosine exchange factors, Lbc and Dbl, into Swiss 3T3 cells, which could induce anchorage- but not mitogen-independent DNA synthesis (Schwartz et al., 1996). Rac and Rho are linked to adhesion-mediated signalling processes. Rac function has been shown to be necessary downstream of integrins for mammary epithelial cell invasion and collagenase expression in synovial fibroblasts (Keely et al., 1997; Kheradmand et al., 1998). In addition, a requirement for Rho has been demonstrated for integrin-mediated activation of the MAP kinase pathway by the use of Rho specific inhibitors (Renshaw et al., 1996). Integrin and growth factor mediated signals have been shown to converge at the level of ERK activation (Miyamoto et al., 1996).

5.2.2 Rac may be required for DNA synthesis through its activation of PAK

The requirement for Rac, Rho and Cdc42 that has been demonstrated for serum- stimulated DNA synthesis using dominant negative versions of these proteins (Khosravi- Far etal., 1995; Olson eta i, 1995; Prendergast et al., 1995; Qiu et al., 1997; Qiu et al., 1995a; Qiu et al., 1995b). Furthermore, there are indications that activation of multiple Rho family proteins are required for DNA synthesis initiation. For instance, although RhoA^''^ has been shown to induce mitogen-independent DNA synthesis (Olson et al., 1995), a dominant negative Rac mutant is able to inhibit DNA synthesis in the presence of serum stimulated Rho activity (Khosravi-Far et a l, 1995; Nobes and Hall, 1995; Qiu et al., 1995b). This indicates that Rho activity is insufficient to stimulate DNA synthesis in the absence of Rac function. However, it is important to bear in mind that the mode of action and importantly the specificity of these dominant negative mutants is not established. The proposed mechanism of inhibition is through the sequestration of RhoGEFs, however there are multiple RhoGEFs which have exchange activity towards

182 Chapter Five - Discussion multiple members of the Rho family. Furthermore, RhoGEFs have additional functions, for example Sos acts as a RasGEF. Therefore S17N-type Rho family mutants may inhibit non-targeted factors that are necessary for mitogenesis and give a false impression of the necessity of Rho family proteins. However, these mutants demonstrate some specificity, since Rac^^^ does not inhibit ERA stimulation of stress fibres by Rho (Nobes and Hall, 1995). Furthermore, the necessity for Rho activation in DNA synthesis has also been demonstrated with the Rho specific inhibitor, C3 transferase.

Adhesion and mitogens are required for fibroblast proliferation. Thus the requirement for Rho family proteins in serum-stimulated DNA synthesis may utilise their ability to mediate signals from adhesion complexes. Integrin-mediated signals have been demonstrated to feed into the Ras-Raf-MEK-ERK pathway at the level of Ras, Raf and MEK (King et al., 1997; Miyamoto et al., 1996; Nobes et al., 1995; Renshaw et al., 1997; Renshaw et al., 1996). Moreover, adhesion signals have been shown to be necessary for growth factor activation of MEK (Renshaw etal., 1997). Constitutively activated MEK also co-operates with activated Ras to form much larger soft agar colonies than Ras alone, but does not assist Ras^'^ Figure 5.1 Possible in adhered low-mitogen conditions. This mechanism for Rac-mediated adhesion signal indicates that MEK is providing signals that are limited by the lack of adhesion Growth Factor Fibronectin (Renshaw et al., 1997). Ras Receotor receotor transformation requires Rac and Rho ------1 4 9 activity, however, since they are unable to Ras ------=— ► PI3-K mimic the ability of Ras to stimulate mitogen-independent growth, they Raf Rac probably do not act downstream of Ras in a linear pathway. PAKl is an effector of MEKl PAK Rac and was recently shown to phosphorylate MEKl and Raf-1 and ERK influence their activation (Frost et al., 1997; King etal., 1998). PAK3 activation was also deemed necessary for Raf activation by Ras (King et al., 1998). These pathways may provide a mechanism through which Rac^‘" could replace the requirement for adhesion-mediated upregulation of MEK through activation of PAK. A requirement for Rac to mediate adhesion signalling could also explain why Rac inhibition prevents serum-stimulation of DNA synthesis and Ras^'^ transformation (Khosravi-Far É?/

In addition, PI 3-kinase has also been shown to be necessary for integrin-mediated activation of Raf-1, MEKl and ERK, but not Ras (King etal., 1997; Nobes etal., 1995). We have demonstrated that Rac^'- is able to upregulate anchorage-independent DNA Chapter Five - Discussion

synthesis in the absence of PI 3-kinase activity. However, Ras^'^ and specific growth factors have been shown to require PI 3-kinase activity for Rac-mediated reorganisation of the actin cytoskeleton (Hawkins et al., 1995; Kotani et al., 1994; Nobes and Hall, 1995; Rodriguez-Viciana et al., 1997; Wennstrom et al., 1994a) indicating that PI 3- kinase can activate Rac. Therefore PI 3-kinase may mediate integrin activation of Rac, which would permit PI 3-kinase to activate ERK through PAK. Indeed we have shown that inhibition of PI 3-kinase activity with LY 294002 reduces ERK activation by EGF.

However upregulation of ERK activity through Rac activation of PAK, cannot be the only mechanism required to induce anchorage-mediated growth, since we have shown that ARafiER is able to upregulate ERK activity in the absence of anchorage and yet when activated to different levels it does not stimulate DNA synthesis. Indeed the response of the cells to ARafiER activation appears to be identical to adherent cells, with differential expression of Cyclin Dl and p21^'P ' caused by different strengths of Raf-1 signal. It may be that transient activation of the ERK MAP kinase cascade by serum is required for Rac^'^ to assist in the upregulation of MEK. Especially since we do not observe an increase in ERK phosphorylation upon Rac^'^ expression.

Reported experiments in which constitutively activated MEK mutants have been expressed in NIH 3T3 cells have yielded contradictory findings. One group showed that MEK activation was sufficient for formation colony formation (Cowley et al., 1994), while other investigators observed no anchorage independent growth (Renshaw et a l, 1997), although these groups used different MEK mutants. Furthermore, contrary to our findings with ARafiER and RafCAAX, an amino terminal tmncated constitutively activated Raf mutant, ARaf22W has been reported to promote colony formation in soft agar (Oldham et al., 1996). These contradictory findings are probably founded in the different abilities of these mutant proteins to activate ERK which we have seen can stimulate different cellular responses.

5.2.3 Activation through the SRE is unnecessary for anchorage- independent DNA synthesis

We have demonstrated that Rac^'^ in NIH 3T3 (NIH 1) cells does not induce SRE- mediated transcription indicating that activation of the SRE is not required for Rac^'^- induced anchorage-independent growth. This concurs with the ability of SRF null embryonic stem cells, in which the major SRE binding protein, SRF is not present, to proliferate normally. This implies that SRF is not necessarily required for proliferation, although it does appear to be required for mesoderm formation in the developing embryo (Arsenian et al., 1998). Nevertheless, experiments using competitive inhibition have suggested that SRF is required for DNA synthesis in some cell types. For example, microinjection of double stranded oligonucleotides encoding the SRE, SRF specific

184 Chapter Five - Discussion

antibodies or polypeptides containing the DNA binding domain of SRF have all been shown to inhibit DNA synthesis induced by senim or microinjected Ras^^^ in Ref52 fibroblasts (Gauthier-Rouviere et al., 1993; Gauthier-Rouviere et al., 1991; Gauthier- Rouviere etal., 1990). In addition, transcriptional induction of anti-sense SRF RNA in myogenic cells has been shown to inhibit cell proliferation (Soulez et al., 1996).

5.2.4 Serum-mediated activation of SRF is independent of Rac

As we have demonstrated serum, but not activated Rac, stimulates transcription from the SRE in our NIH 1 cell-line, which implies that semm-mediated activation of SRF does not occur directly through activation of Rac, although a requirement for Rac input cannot be discounted. To our knowledge, although Rho activity has been shown to be necessary for induction of SRF activity by serum through the use of C3 transferase (Hill and Treisman, 1995), no requirement for Rac in serum stimulation of the SRE has been demonstrated. Rac has however been shown to be necessary for polyoma virus middle T antigen to signal to SRF in co-transfection assays using dominant negative Rac mutants with middle T antigen (Urich et al., 1997). Thus it is probable that middle T activates a distinct pathway to serum.

5.2.5 Activation of JNK is not required for initiation of DNA synthesis

Since JNK was not activated by Rac^'^ in STRAC cells, we can conclude that JNK activation is not required for Rac^'^-mediated induction of anchorage-independent DNA synthesis. Furthermore, activation of JNK has been shown to be dispensable for Rac^'^ induction of mitogen-independent DNA synthesis in Swiss 3T3 cells. The Rac effector domain mutant, Rac^^'^'^ was able to stimulate mitogen-independent DNA synthesis upon microinjection, but was unable to activate JNK in transient transfection assays (Lamarche et al., 1996; Westwick et al, 1997). This mutant was also able to induce focus formation in co-operation with RafCAAX. Furthermore, Rac effector domain mutants, Rac*'^'^'^^ and Rac^^'^^^, that were able to activate JNK and the SRF but not bind or activate PAK, had reduced focus formation ability in co-operation with RafCAAX (Westwick et al., 1997). Thus it appears that the ability of activated Rac to overcome constraints on DNA synthesis by loss of anchorage, lack of mitogens or contact inhibition is independent of JNK activation.

5.2.6 Rac induction of Cyclin Dl may mediate anchorage-independent growth

We have demonstrated that Rac"^’^ is able to rescue Cyclin Dl expression upon loss of anchorage. Overexpression of Cyclin Dl in NIH 3T3 and Rati cells has been reported to promote DNA synthesis in the absence of anchorage (Resnitzky, 1997; Zhu et al., 1996a). Thus induction of Cyclin Dl by Rac^'^ may be sufficient to promote anchorage-

185 Chapter Five - Discussion

independent DNA synthesis. Furthermore, overexpression of Cyclin Dl is also able to upregulate Cyclin A in Rati cells in suspension (Resnitzky, 1997) which correlates with Rac^^^-mediated upregulation of Cyclin A which we observe after Cyclin Dl induction. Recently, ectopic induction of Cyclin Dl in NIH 3T3 cells has been shown to support colony formation in soft agar (Hiyama et al., 1997). Moreover, primary fibroblasts transformed by activated Ras and Cyclin Dl are able to form colonies in soft agar (Lovec etal., 1994).

5.2.7 induction of mitogen-independent DNA synthesis may be a secondary effect of actin reorganisation

Induction of DNA synthesis by Rac^^^ has only been demonstrated in confluent serum- deprived Swiss 3T3 cells. It is of interest to note that the induction of membrane ruffles in NIH 3T3 cells by Rac^'^ is much less profound than in Swiss 3T3 cells (personal communication P.Rodriguez-Viciana). [This is also suggested from published investigations into Rac function by the change in cell-type from NIH 3T3 cells to porcine aorta endothelial cells for demonstration of actin reorganisation (Rodriguez-Viciana et al., 1997; Westwick et al., 1997)]. The property of actin reorganisation has not yet been separated from the ability of Rac^'^ to induce DNA synthesis in Rac effector domain mutants (Lamarche et al., 1996). Therefore, induction of DNA synthesis may be a consequence of the disruption of contact inhibition through induction of membrane ruffles induced by the microinjected Rac^’^, rather than by a direct effect of Rac^^^ on cell cycle control proteins. Alternatively, the properties of the cell types may vary in other ways. For example the reported properties of activated Rho in rodent fibroblasts contrast greatly. In some instances activated Rho is reported to be able to induce malignant transformation and yet in others, cells display no properties of transformation (Khosravi-Far et al., 1995; Perona et al., 1993; Prendergast et al., 1995; Qiu et at., 1995b). Furthermore, the different methods of protein activation may be responsible, since microinjection transmits a large signal very rapidly in contrast to transcriptional derepression or constitutive expression.

5.2.8 can assist DNA synthesis induced by additional factors

Although we do not observe Rac^'^ induction of mitogen-independent DNA synthesis, we have demonstrated that Rac^'^ can assist colony formation and increase DNA synthesis in cells that are in the presence of mitogens and therefore not quiescent. Rati cells stably expressing Rac^'^ have been shown to have a higher rate of proliferation in reduced serum conditions than control cells, although both cell populations increase in cell number indicating that the cells are not arrested (Qiu et al., 1995a). Furthermore, another group has stated that NIH 3T3 cells expressing Rac’’’^ are able to proliferate in 1% NCS

186 Chapter Five - Discussion

but do not show their data (Khosravi-Far et ai, 1995). We show that Rac^^^ expression in STRAC.C cells cultured in 2% NCS supports more dense and numerous colonies than control cells. It may be possible to titrate the concentration of serum added to the cells such that one could suppress growth stimulated by serum, but maintain growth mediated by tlie combination of Rac^^^ and serum. Therefore it appears that although Rac activation is unable to replace mitogen-signalling it is able to counteract some limiting factor to cell proliferation.

5.2.9 Future directions for investigations into Rac-mediated DNA synthesis

Many questions remain about the mechanisms utilised by Rac to regulate DNA synthesis. It would be of interest to investigate whether Rac^^^ mediates anchorage-independent DNA synthesis via PAK, and whether this is dependent on activation of MEK. Furthermore, it would be interesting to test whether stimulation of anchorage-independent DNA synthesis occurs through Rac^'^ input into ERK activation and whether Rac acts as a mediator between integrins and ERK activation. One should also test whether this involves PI 3-kinase and/or Ras.

Further work using the STRAC cells we have developed is impeded by the low percentage of cells (approx. 25%) which are induced to initiate DNA synthesis. This effect is not large enough to acquire mechanistic biochemical information about Rac^^^ induction of DNA synthesis since Rac^'^ stimulated events leading to initiation of DNA synthesis would be masked by the 75% of cells that do not initiate DNA synthesis. Thus another system should be utilised to investigate these effects which would allow identification of the cells that were induced to initiate cell cycle progression. One possibility is to utilise fluorescent activated cell sorting to isolate cells which have initiated progression through G1 by using a green fluorescent protein reporter construct driven by a G1 activated promoter, such as Cyclin Dl.

187 Chapter Six - Materials and Methods

6. Materials and Methods

188 Chapter Six - Materials and Methods

6,1 Materials

6,1,1 Equpiment Centrifuges Centaur 2, MSB Megafuge 1.0 R, Heraeus Microcentrifuge, MSB Centra-4R centrifuge, IBC J-6M/B centrifuge, Beckman

Incubators Water Jacketed Incubators, Forma Scientific and Heraeus

Agarose gel electrophoresis equipment Mini gel system, Hybaid Ltd Midi gel system, Northumbria Biologicals Ltd

Western Transfer Equipment Trans-blot SD Semi-dry Electrophoretic Transfer Cell, Bio-Rad Genie blotter. Idea Scientific

Polyacrylamide gel electrophoresis equipment Mini-protean II, Bio-Rad Midi gel system, Atto Sequencing gel system, model S2, BRL

Spectrophotometer UV-Visible spectrophotometer DU-20, Beckmann

Microscopes Diaphot, Nikon TMS, Nikon Axiophot, Zeiss

PCR machine PTC 200, MJ Research

189 Chapter Six - Materials and Methods

Power packs Power-pac 300, Bio-Rad DC power supply ISOTECH IPS 302 A, RS Components Power supply model 500/200, Bio-Rad Power supply model 3000/300, Bio-Rad Power supply model 200/2.0, Bio-Rad

Shaking Bacterial Incubators Controlled Environment Incubator Shaker and G24 Environmental Incubator Shaker, New Brunswick Science

Miscellaneous Multi-purpose Scintillation Counter LS6500, Beckman Phosphor-Imager, Molecular Dynamics Milli-Q Water system, Millipore Transilluminator model TL-33, UVP Transilluminator cabinet model CC-60 Filter disk vacuum manifold, Millipore Luminometer 1251, Bio Orbit, with LKB wallac pump RIOO/TW Rotatest Shaker platform, Luckham Ltd Rocking platform 3013, Jencons Ltd

6.1.2 Frequently Used Solutions Phosphate buffered saline A (PBSA) 6.5 mM Na2HP04, 1.5 mM KH2P04, 2.5 mM KCl, 140 mM NaCl Tris-EDTA (TE) 10 mM Tris-HCl pH 8.0, 1 mM EDTA Tris saline 24 mM Trizma base (Sigma), 0.8% (w/v) NaCl, 0.38% (w/v) KCl, 0.01% (w/v) Na2HP04, 0.1% (w/v) dextrose, pH 7.7 (adjusted with HCl)

190 Chapter Six - Materials and Methods

6.1.3 Antibodies

Table 6.1 Primary antibodies used in this thesis

Antibody Detected Source Antibody type Dilution for name Antigen purpose Anti-DPERK Thr202& Sigma Mouse 1:1000 for Western Tyr 204 monoclonal M8159 phosphory lated p42""" and p44«rki

SC-474 JNK Santa Cruz rabbit polyclonal 5 |xl per 100 pg of protein for IP anti BrdU BrdU Beckton Mouse 2 pi per cell pellet for Dickinson monoclonal FACS analysis anti BrdU BrdU Amersham- Mouse undiluted for Pharmacia monoclonal immunofluorescence SC-198 human Santa Cruz rabbit polyclonal Cyclin E phospho Thr 202 & New England purified mouse 1:1000 for Western p42/44 MAP Tyr 204 Biolabs monoclonal kinase phosphory lated p42'"‘^ and p44“'“ AKT Ser473 Ser473 New England purified mouse 1:1000 for Western 92715 phosphory Biolabs monoclonal lated Akt/ PKB AKT 9272 Akt New England purified rabbit 1:1000 for Western Biolabs polyclonal T4026 p-tubulin Sigma purified mouse 1:2000 for Western monoclonal sc-163 cdk2 Santa Cruz purified rabbit 1:1000 for Western polyclonal SC-260 cdk4 Santa Cruz purified rabbit 1:1000 for Western polyclonal SC-596 Cyclin A Santa Cruz purified rabbit 1:200 for Western polyclonal E23 Cyclin A T.Hunt, purified mouse 1:500 for Western ICRF monoclonal E72 Cyclin A T.Hunt, purified mouse 1 pg per 200 pg of ICRF monoclonal cell lysate 287.3 Cyclin Dl G.Peters, rabbit serum bleed 1:1000 for Western ICRF out

191 Chapter Six - Materials and Methods

DCS 11 Cyclin Dl J.Bartek, purified mouse 1 M-g per 200 |ig of ICB, IgG2A cell lysate Copenhagen monoclonal SC-481 (M20) Cyclin E Santa Cruz purified mouse 0.5 lig/ml for monoclonal Western. 0.5 |Lig per 100 jig of protein for IP HA HA tag Boehiinger purified mouse 5-10 pg/ml for IP epitope Mannheim monoclonal 0.5 jig/ml for Western 122.2 MAP C.Marshall, rabbit serum 1:15000 for Western, kinase ICR, London 1 pi per 50 pg of (Leevers and protein lysate for IP/ Marshall, kinase assay 1992) 9E10 Myc tag G.Evan, purified mouse 1:100 for Western epitope ICRF monoclonal sc 757 p21^'P' Santa Cruz purified rabbit 1:100 for Western polyclonal SC-6246 p2l‘=’P-' Santa Cruz mouse 1:1000 for Western monoclonal SC-397 p21^'P-' Santa Cruz rabbit polyclonal 1:100 for Western sc-1641 p27Kip-i Santa Cruz mouse 1:1000 for Western monoclonal SC-528 (C-19) p27Kip-i Santa Cruz purified rabbit 0.5 pg/ml for polyclonal Western 14001 pRb Pharmingen purified mouse 1:500 for Western monoclonal SC-227 C-20 Raf-1 Santa Cruz purified rabbit 0.5 pg/ml polyclonal Y13-259 Ras ICRF rat monoclonal 1:10 for Western pan-ras (Ab-4) Ras Oncogene Mouse 1:1000 for Western Science monoclonal rCD2 ratCD2 for D.Cantrell, purified mouse 1:1000 for Western rCD2pllO ICRF monoclonal fusions

Table 6.2 Secondary antibodies used in this thesis

A ntibody Detected Antigen Source Antibody type Dilution name for purpose NA9340 Rabbit Amersham Donkey anti-rabbit 1:2000 for immunoglobulins coupled to horseradish Western peroxidase (HRP)

192 Chapter Six - Materials and Methods

NA931 Mouse Amersham Sheep anti-mouse 1:2000 for immunoglobulins coupled to HRP Western NA932 Rat Amersham Sheep anti-rat coupled 1:2000 for immunoglobulins to HRP Western 115-096- Mouse Jackson Goat anti-mouse 1:300 for 006 immunoglobulins immunores conjugated to FTTC immunofluo each rescence laboratories F313 Mouse DAKO Rabbit anti-mouse 1:10 for immunoglobulins FTTC conjugated FACS analysis

6.1.4 Plasmids

Table 6.3 Plasmids and expression vectors used in this thesis

Name Details Source p4xPRE TKCAT 2x SRE oligos: R.Treisman, CTAOrXholCGATGAAACAAACATGAAACGT ICRF, (Xho) inserted into Xho site of pBLCAT2 unpublished p4xSRE TKCAT 2X PRE oligos: R.Treisman, TCGArXholGCCCATATATGGGCAGACCAGC ICRF, CCATATATGGGCGArXhol inserted into Xho unpublished site of pBLCAT2 pBLCAT2 Chloramphenicol acetyl transferase reporter HL (Luckow construct for transient transfection into eukaryotic and Schütz, cells. Contains tk promoter for analysis of cis- 1987) acting elements in front of a heterologous promoter. pBluescript II cloning vector Stratagene pBluescript Rac^*^ myc tagged human Rac-1^'^ inserted into EcoRI BW site from pcEXV3 Rac^'^ and tested for direction by restriction digest. pBPSTRl tetracycline retroviral vector, containing tet S. Reeves operator sequences within a CMV promoter, and Harvard MS, encoding tTA (a fusion of the tet repressor protein Boston and the VP 16 transactivator) under the control of (Paulus et al, an SV40 promoter. Also encoding puromycin 1996) resistance gene under the control of the 5'LTR. pBPSTRl Ras^'" Ras^'^ cDNA was subcloned as a BamHI fragment BW into pBPSTRl and then tested for direction by restriction digest pBPSTRl Rac""'" BamHI/EcoRV myc tagged human Rac-1^'^ BW fragment from pBluescript Rac^'^ directionally cloned into BamHI/Pmel sites of pBPSTRl

193 Chapter Six - Materials and Methods

pBPSTRl RafCAAX from pMT-SM-myc-raf-CAAX blunt- BW RafCAAX end ligated as a EcoRI (blunted with Klenow fragment of DNA polymerase)/SmaI fragment into the Pmel site of pBPSTRl. Then tested for direction by restriction digest. pcDNA3 mammalian expression plasmid with neomycin InVitrogen resistance gene and cytomegalovirus (CMV) promoter driven expression pcDNA3 Rac''" myc tagged human Rac-1^^^ inserted into EcoRI BW site from pcEXV3 Rac^'^ and tested for direction by restriction digest pcEXV3 mammalian expression vector with S V40 enhancer R.Treisman, ICRF (Miller and Germain, 1986) pcEXV3 Rac''" human Rac-1^'^ inserted into EcoRI site. Rac has A.Ridley, myc epitope tag on its amino terminus Ludwig (MEQKLISEEDL) Inststute, London pCMV Ras''" human Ha-ras^'^ cDNA inserted as EcoRI AS fragment into pcDNA3 pLink RhoA'"" human Rho-1^'"^ inserted into Nco I/EcoR I of R.Treisman, PEFPlink ICRF pEFBos rCD2-pl 10 chimeric molecule of rat CD2 (extracellular and D.Cantrell transmembrane domain) plus the catalytic pi 10 ICRF (Reifet subunit of PI 3-kinase, with myc epitope tag on a l, 1996) the carboxy terminus inserted into mammalian expression vector, pEF-Bos (Mizushima and Nagata, 1990). pEFBos rCD2- Same as pEFBos rCD2-pl 10 except the pi 10 D.Cantrell, pllOR/P subunit of PI 3-kinase point mutated in its ATP ICRF (Reifgf binding site (R916P in pi 10 and R1130P in rCD2- al, 1996) pllO) pLink mammalian expression vector with myc epitope tag R.Treisman, at 5' end of polylinker ICRF pJ6Hygro Hygromycin resistance gene inserted into HL Hindll/Clal site of pJ6Q pJ6Puro Puromycin resistance gene inserted into HL Hindll/Clal site of pJ6Q pJ6f2 mammalian expression vector with Rat (3 actin HL promoter driving expression (Morgenstem and Land, 1990b) pLXSN moloney murine leukaemia virus retroviral vector AL (Miller with neomycin resistance gene and Rosman, 1989) pLXSN3 derived from pLXSN with new polylinker inserted AS

194 Chapter Six - Materials and Methods pLXSN3 RafAR A HindD/EcoRI fragment encoding amino acids AS (Sewing 305-647 of the human c-Raf-1 protein fused to the etal., 1997) 20 carboxy terminal amino acids of K-ras was amplified with the c-RafCAAX encoding sequence in pcDNA3 as a template (primers 1 & 2). This fragment was fused to the fragment encoding the carboxy terminus of the hormone binding domain of the human androgen receptor (amino acids 646- 917), which was amplified by PCR (primers 3 & 4) and cloned in frame with a fragment encoding an amino-terminal Myc tag into the retroviral vector pLXSN3 (a modified version of pLXSN) pLXSP moloney murine leukaemia virus retroviral vector AS derived from pLXSN but with puromycin resistance gene replacing neomycin resistance gene pLXSP3 derived from pLXSP with new polylinker inserted AS pLXSP3 RafAR Same cloning as pLXSN3 RafAR, but pLXSP3 AS (Sewing was used as the vector etal., 1997) pMT-SM-myc-raf- RafCAAX inserted into mammalian expression C.Marshall, CAAX vector, pMT-SM (Kaufman et ai, 1989) as Spe 1/ ICR, London EcoRI fragment. RafCAAX is human c-raf-1 tagged with the myc epitope on its amino terminus (MEQKLISEEDL) and with the CAAX motif from K-Ras on its carboxy terminus (Leevers et al., 1994). pMT3-ARlf-CAAX As pMT2-HA-Rlf-CAAX, but Rif has catalytic J.Bos, domain deleted (bases 635-983) University of Utrecht, (Wolthuis et a/., 1997) pMT3-Rlf-CAAX Rif amino terminus (aal-532) with K-Ras CAAX J.Bos, motif on carboxy terminus inserted as Sal I/Not I (Wolthuis et fragment into pMT2-SM-HA mammalian al., 1997) expression vector (derived from pMT2 with HA epitope tag at 5' end). pCip-l-Luc Reporter construct with the luciferase gene under Xin Lu, the control of the full length human p21^'^^ Ludwig Inst promoter. for Cancer Research, London (el- Deiry et al, 1993) pCHllO-lacZ Reporter construct with the b-galactosidase gene Pharmacia under the regulation of SV40 promoter pUC19 cloning vector HL (Yanisch- Perron et al., 1985) AL; Alison Lloyd AS: Andreas Sewing, HL: Hartmut Land, ICRF

195 Chapter Six - Materials and Methods

6.1.5 PCR Primers primer 1: 5’ TGTAAGC-TTACGGAGTACTCACAGCCGAA3'; primer 2: SP6 primer 3: TGTGGATCCGCCA-CCATGACTGAGGAGACAACCCAGAAG 3'; primer 4: 5TGTAAGCTTGGCCG-CTGCCTGGGTGTGGAAATAGATGGG3'

6.1.6 Parental cells-lines

Table 6.4 Parental cells and cell-lines used in this thesis

Cell line Cell Type Source NIH 3T3 (also referred immortalised mouse embryo fibroblast C. Marshall, ICR, to as. NIH 1 in Chapter London 4) NIH 2 A different line of NIH 3T3 cells R. Treisman, ICRF Rat-1 immortalised rat embryo fibroblast HL GP+E ecotropic packaging cell-line HL (Markowitz eta i, 1990) Bose 23 ecotropic packaging cell-line (Pear et HL a i, 1993) Cyclin Dl -/- MEFs primary fibroblasts from a Cyclin Dl- C. Dickson, ICRF /- trangenic mouse embryo p53-/- MEFs primary fibroblasts from a p53-/- M.Fried, ICRF trangenic mouse embryo p2U'P-‘-/- MEFS primary fibroblasts from a p21^'‘’ ’-/- T.Jacks, MIT trangenic mouse embryo

6.1.7 Generated stable cell-lines Unless otherwise stated, construction of these cell-lines was performed as part of this thesis. Table 6.5 Cell-lines used or generated in this thesis

Name Parental Vectors Infection / Resistance pool/ cell-line stably Transfection clone integrated GPE LXSN GP+E pLXSN Transfection 1 mg/ml pool Gift from AL G418 GPE RER GP+E pLXSN Raf.ER Transfection 1 mg/ml pool Gift from AL G418 GPE Rac^'^ GP+E pLXSN Rac""" Transfection 1 mg/ml pool Gift from PR G418 GPE Ras^'" GP+E pLXSN Ras""" Transfection 1 mg/ml pool Gift from AL G418 GPE STRl GP+E pBPSTRl Transfection 2.5 pg/ml pool Ras""'' Ras""" Puro GPE STRl GP+E pBP STRl Transfection 2.5 pg/ml pool Puro

196 Chapter Six - Materials and Methods

RafAR MEFs wtMEFs LXSP3 RafAR Infection 1.25 ng/ml pool Puro RafAR p21 -/- p21-/- LXSP3 RafAR Infection 1.25 pg/ml pool MEFs MEFs Puro RafAR p53-/- p53-/- LXSP3 RafAR Infection 1.25 pg/ml pool MEFs MEFs Puro RafAR Cyclin Cyclin LXSP3 RafAR Infection 1.25 pg/ml pool Dl-/- MEFs Dl-/- Puro MEFs ARER2/pllO ARER pMT3- Transfection 1 mg/ml pool ARlfCAAX, G418, 2.5 pEFBos rCD2- pg/ml Puro pllO & pJ6Puro ARER2 ARER pMT3- Transfection 1 mg/ml pool ARlfCAAX, G418, 2.5 pEFBos rCD2- pg/ml Puro pllOR-P, pJ6Puro ARER/pl 10 ARER pEFBos rCD2- Transfection 1 mg/ml pool pllO & G418, 2.5 pJ6Puro pg/ml Puro ARER/pl lOR ARER pEFBos rCD2- Transfection 1 mg/ml pool -P pllOR-P& G418, 2.5 pJ6Puro pg/ml Puro ARER/pLink ARER pLink& Transfection 1 mg/ml pool pJ6Puro G418, 2.5 pg/ml Puro ARER/Ras ARER pBPSTRl Infection 1 mg/ml pool Ras""" G418, 2.5 pg/ml Puro ARER/Rho^*'* ARER pLink Rho^'"^ & Transfection 1 mg/ml pool pJ6Puro G418, 2.5 pg/ml Puro ARER2/Rlf/p ARER pMT3- Transfection 1 mg/ml pool 110 RlfCAAX, G418, 2.5 pEFBos rCD2- pg/ml Puro pllO & pJ6Puro ARER2/Rlf/ ARER pMT3- Transfection 1 mg/ml pool RlfCAAX, G418, 2.5 pEFBos rCD2- pg/ml Puro pllOR-P& pJ6Puro ARER/ST ARER pBPSTRl Infection 1 mg/ml pool G418, 2.5 pg/ml Puro RafAR NIH 3T3 pLXSN RafAR Infection 1 mg/ml pool Gift from AS G418 ARER NIH 3T3 pLXSNARaf- Infection 1 mg/ml pool Gift from AL 1:ER G418 LXSN Rac^'^ NIH 3T3 pLXSN Rac'"' Infection 1 mg/ml pool Gift from PR G418

197 Chapter Six - Materials and Methods

ST NIH 3T3 pBPSTRl Infection 2.5 pg/ml pool Puro STRAC NIH 3T3 pBPSTRl Infection 2.5 pg/ml pool Rac""': Puro STRAC NIH 3T3 pBPSTRl Infection 2.5 pg/ml clones clones Rac""': Puro STRas NIH 3T3 pBPSTRl Infection 2.5 pg/ml pool Ras""" Puro STRas clones NIH 3T3 pBPSTRl Infection 2.5 pg/ml clones Ras""'' Puro STRCX NIH 3T3 pBPSTRl Infection 2.5 pg/ml pool RafCAAX Puro STRCX NIH 3T3 pBPSTRl Infection 2.5 pg/ml clones clones RafCAAX Puro STDl ST pGL2 CyclinDl Transfection 2.5 pg/ml pool & pJ6Hygro Puro, 150 pg/ml Hygro ST GL2 ST pGL2& Transfection 2.5 pg/ml pool pJ6Hygro Puro, 150 pg/ml Hygro STRAC/RER STRAC.C pLXSNARaf- Infection 1 mg/ml pool 1:ER G418 AL: Alison Lloyd, PR: Pablo Rodriguez-Viciana, AS: Andreas Sewing, HL: Hartmut Land, ICRF

198 Chapter Six - Materials and Methods

6.2 Methods

6.2.1 Maintenance of cell stocks

All cells were grown in water jacketed humidified incubators at 37°C with 10% €0%. Cells were routinely maintained in DMEM (Media production, ICRF) with 10% (v/v) serum, 100 |Ltg/ml kanamycin (Sigma), 2 p.g/ml gentamycin (Gibco BRL). NIH-3T3 cells were grown in new bom calf semm (Gibco BRL), GP+E (Markowitz et al., 1990) and Bose 23 (Pear et a l, 1993), viral producer cells. Rat 1 cells and mouse and rat embryo fibroblasts (MEFs and REFs respectively) were grown in foetal calf serum (Bioclear UK Ltd). Cells expressing fusion proteins containing the hormone binding domains of steroid receptors were grown as above, but in DMEM minus phenol red (Media production, ICRF) and the serum was charcoal stripped.

6.2.1.1 Selection markers

Cells stably expressing selection markers had antibiotics added to their media thus: Puromycin resistance : Cell-lines were selected and cultivated in 2.5-4 mg/ml puromycin (Sigma) in dH20. The selection of primary MEFs and REFs was begun at 1 mg/ml and increased, if necessary, to 2.5 mg/ml. Neomycin resistance; All cells were selected and cultivated in 1 mg/ml G418 geneticin (Gibco BRL) from 100 mg/ml stock in 10 mM Hepes pH 7. Hygromycin resistance: All cells were selected and cultivated in 150 |ig/ml hygromycin B (Calbiochem) Selection was always performed against an uninfected / untransfected control.

6.2.1.2 GPT selection

To maintain the viral producing capability of the GP+E and Bose 23 cell-lines, they were routinely re-selected in GPT selective media (Mulligan and Berg, 1981) for one week. After re-selection the cells were then weaned in HT medium for at least 24 h. 500 ml of GPT selective media : 403 ml DMEM+ antibiotics, 50 ml foetal calf serum, 20 ml 25x Xanthine, 5 ml l(X)x Glutamine, 10 ml 50x HAT, 5 ml lOOx Mycophenolic acid, 1 ml 500x Aminopterin, 1 ml 500x Thymidine. HT media : Similar to GPT selective media, but HT supplement (Gibco) replaces HAT supplement and it contains no mycophenolic acid. Stocks 25x Xanthine (Sigma): 6.25 mg/ml; 1.56 g was added to 250 ml of 0.1 M NaOH, filtered and stored at 4°C lOOx Mycophenolic acid (Gibco-BRL): 2.5 mg/ml; 0.25 g was added to 100 ml of 0.1 M NaOH, neutralised with 0.1 M HCl (checked with pH paper), filtered and stored frozen in 5 ml aliquots.

199 Chapter Six - Materials and Methods

50x HAT Supplement (Sigma H-0262): One vial was dissolved in 10 ml of dH20 , filtered and stored frozen 500x Aminopterin (Sigma): 1 mg/ml; 0.05 g was added to 50 ml DMEM, filtered and stored frozen. 5(X)x Thymidine: 3 mg/ml; 0.15 g was added to 50 ml DMEM, filtered and stored frozen.

6.2.1.3 Charcoal stripping of serum

0.5% (w/v) activated charcoal (Sigma) and 0.05% (w/v) dextran (Sigma) was mixed into 500 mis of serum and stirred at 37°C for 3 h. The charcoal was then pelleted at 3000 rpm (Beckman J-6M/E centrifuge) for 10 min and then filtered through a 0.45 joM filter unit (Nalgene Ltd or Millipore Ltd) and frozen in 50 ml aliquots.

6.2.1.4 Passaging of cell-lines

NIH 3T3 fibroblasts, GP+E cells and their derivatives were passaged every three days and diluted to a 1:10 ratio. Rat 1 cells were passaged every three days and diluted to a 1:20 ratio. REFs and MEFs were passaged every three days and diluted to a 1:6 ratio. Bose 23 cells were passaged every two days and diluted to a 1:3 ratio. 4 ml of trypsin (2.5 mg/ml in Tris saline) (media production, ICRF) was added to 16 ml of versene (0.2 mg/ml EDTA in PB SA) (media production, ICRF). Cells were washed two times with PBS A and 1 ml of trypsine-versene mix was added to a 100 mm dish. Cells were returned to the 37°C incubator until they had lifted off the dish, cells were then taken up in normal growth media and diluted (or counted) and seeded on new dishes as required. Cells were counted by adding 200 jil of cells in suspension to 10 ml of Isoton (Coulter Electronics Ltd) and 0.5 ml was counted with a Coulter Counter (Coulter Electronics Ltd).

6.2.1.5 Freezing of cells

Cells were trypsinised and taken up in growth media. They were then pelleted at 1200 rpm (MSE Centaur 2) for 3 min. The supernatant was removed and the cells were resuspended in freeze media (50% (v/v) serum, 40% (v/v) DMEM and 10% (v/v) Dimethyl sulphoxide (DMSO) (Sigma)). One 90% confluent 100 mm dish would be resuspended in 2 ml of cold freeze media and aliquoted into 4 freezing vials (Nunc). Vials were then put into polystyrene freezing boxes (Whatman) and frozen at -80°C for two days before putting into liquid nitrogen storage.

200 Chapter Six - Materials and Methods

6.2.1.6 Retrieval of cell stocks from liquid nitrogen

Vials were removed from liquid nitrogen storage and immediately incubated at 37°C until defrosted, then added immediately to normal growth media without antibiotic selection. When the cells had adhered and started to spread, their media were changed to remove DMSO from the cells. Antibiotics used for selection were not added to resistant cells until at least 24 h after retrieval.

6.2.1.7 Quiescence of cells To arrest cells in the GO phase of the cell cycle, the cells were seeded to a confluent density (for example 5 x 10^ NIH 3T3 cells in a six well dish) in normal growth media and left to settle overnight in an incubator. The next day the cells were washed twice with DMEM and cultured in DMEM containing 0.25% (v/v) serum (unless otherwise stated) and usual antibiotics and incubated for 24-48 h.

6.2.1.8 Crystal violet staining of colonies To stain colonies of cells, dishes were washed twice with PBS A, then a 1% (w/v) crystal violet (Sigma) solution in 10% (v/v) methanol was poured onto cells, then very gently washed away with tap water until no more colour was released. Dishes were then air- dried and colonies were counted, or photographed.

6.2.2 Growing cells in anchorage independent conditions

6.2.2.1 Poly HEM A

10 mg/ml polyHEMA (poly(2-hydroxyethylmethacrylate)) (Sigma) solution was prepared by adding the crystals to 100% (v/v) ethanol and stirring at 37°C overnight. The solution was then stored at 37°C. Dishes were coated by adding half the normal media volume for the dish size (e.g. 5 ml per 100 mm dish) of polyHEMA solution and leaving the dish open in a tissue culture hood for approximately 1 h, until dish had dried and then recoating. When dishes were coated twice they were subjected to 30 min UV irradiation. Whereupon they were stored at 4°C for a maximum of 2 weeks. Unless otherwise stated, cells were quiesced, trypsinised and counted. Then the required number of cells were added to a polyHEMA coated dish in growth media containing 10% (v/v) serum and insulin (5 pg/ml) (Sigma) and usual antibiotics. To harvest, media containing the cells was transferred to a polypropylene tube and dishes or wells washed out twice with PBS A and added to the tube. Cells were pelleted at 1500 rpm in a Heraeus Megafuge 1.0 R for 5 min and if required, transferred to an Eppendorf tube and washed twice in PBSA. If a single cell suspension was required cells were resuspended in 250 |xl of PBSA and 250 pi of Accumax (TCS Biologicals) and incubated

201 Chapter Six - Materials and Methods at 37°C for 10 min. Cells were then forced through a syringe with a 25 G x 2” needle 3 times.

6.2.2.2 Methylcellulose

To prepare methylcellulose a 1000 ml sterile erlenmeyer was weighed and 225 ml of sterile dHjO was added and brought to the boil on a hot plate. 10 g of methylcellulose, which had been UV sterilised for 30 min, was vigorously stirred into the water, until no lumps were present. The suspension was then returned to the hot plate and brought to the boil once more. Immediately on boiling the suspension was cooled to approximately 50°C under running water, then 250 ml of 2x DMEM (Media production, ICRF) was added and mixed well by swirling. The erlenmeyer was then weighed and dH20 was added so the weight of the suspension minus the original weight of the erlenmeyer was 503 g. The suspension was stirred strongly overnight in the cold room and then aliquoted and frozen at -20°C. (Note: the erlenmeyer was covered with aluminium foil when out of the tissue culture hood, all ingredients were added in the hood in sterile conditions and an aliquot was tested for contamination before use) Cell suspensions were made by adding methylcellulose drop-wise to serum and antibiotics and any other necessary reagent and gradually mixing them until a uniform solution was obtained containing 10% (v/v) serum. The required number of quiescent cells was then put into the bottom of a 50 ml polypropylene tube in 1/lOth final volume of normal growth media and the required amount of methylcellulose growth media was added drop-wise and gradually mixed into the cell containing media. Tubes were capped loosely and put into a 3TC incubator. To harvest: ice-cold PBSA was gradually added to the tube and mixed thoroughly, tubes were centrifuged at 3500 rpm (Heraeus Megafuge 1.0 R) for 25 min at 4°C, the PBSA was removed and the procedure was repeated at least two more times, until all methylcellulose was removed. Cells were then harvested as required.

6.2.2.3 Soft agar

2x stocks of agarose in dH 2 0 were prepared in advance [1.8% (w/v) and 1% (w/v) low gelling temperature agarose (Seaplaque agarose (PMC Bioproducts))] and autoclaved. These stocks were re-heated in the microwave and when completely melted, cooled to 37°C. The other ingredients were heated to 37°C before addition to the melted agarose. 60 mm dishes were coated with 4 ml of bottom agar (see below) and allowed to set at room temperature. Then 4 mis of top agar (see below) was mixed with the specified number of cells, poured on top and allowed to solidify at room temperature. After which, the dishes were put into the incubator. Every 3-4 days 0.5 ml of normal growth media was added. (In the case of cells growing in the presence of doxycycline, top agar was

202 Chapter Six - Materials and Methods prepared with doxycycline (100 ng/rnl) added and on feeding doxycycline of 500 ng/ml was added to the media). After 2-4 weeks in culture, when colonies were easily visible to the naked eye, the cells were stained, by addition of 1 ml of 0.1% (w/v) Neutral Red (Sigma) solution in PBSA, at 37°C for 3 h. Dishes were then photographed by the photography department (ICRF). Bottom agar : 0.9% (w/v) agarose, 10% (v/v) serum, 40% (v/v) 2x DMEM (Media Production, ICRF), 100 pg/ml Kanamycin (Sigma), 2 pg/ml Gentamycin (Gibco BRL). Top agar: 0.5% (w/v) agarose, 10% (v/v) serum, 40% (v/v) 2x DMEM (Media Production, ICRF), 100 pg/ml Kanamycin (Sigma), 2 pg/ml Gentamycin (Gibco BRL).

6.2.3 Transfection

6 .2 .3.1 LipofectAmine transfections

The day before transfection, 1.25 x 10^ cells were seeded in a 6 well dish. On the day of transfection 0.7-1 jig of DNA was mixed with 100 pi of OptiMEM media (GibcoBRL) and 7-10 pi of LipofectAmine (GibcoBRL) (for a 1:7-10, DNA : LipofectAmine ratio) was mixed separately with 100 pi of OptiMEM. The two mixtures were then combined and incubated at room temperature for 30 min. In the meantime, the cells were washed once with OptiMEM and incubated in 800 pi of OptiMEM in the incubator. After 30 min incubation the DNA/LipofectAmine mixture was added to the cells which were then returned to the incubator for 5-6 h. After this incubation the cells were washed once with their normal growth media, before having 3 ml normal growth media added and were then returned to the incubator. This method is shown for transfection in 6 well dishes, but was scaled up for larger dishes.

6 .2 .3 .2 Calcium phosphate transfections (after Wigler et al., 1979)

Cells were seeded to 60-80% confluency the day before transfection. On the evening of transfection the cells were media changed 30 min before transfection into 6 ml of normal growth media. 5-20 pg of DNA in polystyrene 6 ml tubes (Falcon) was mixed with 500 pi of Ix HEPES buffered saline (HBS) (25 mM HEPES pH 7.1, 140 mM NaCl, 1.5 mM

Na2 HP0 4 ) then 20-25 pi* of 2.5 M CaCl 2 was added and immediately shaken. Tubes were incubated at room temperature for 10 min until a fine white precipitate had formed: this solution was then added drop-wise onto the cells which were then incubated in the incubator overnight. Next morning cells were media changed into fresh growth media. *-The amount of CaCl 2 was optimised for each batch of HBS.

203 Chapter Six - Materials and Methods

6.2,3,3 Transient transfections

For transient transfections the cells were grown for 24-48 h after transfection before the relevant assay was performed. If the assay required low serum conditions; the morning after transfection the serum conditions were reduced and the cells maintained in those conditions for 36-48 h before the assay was performed.

6.2.4 Retroviral infections

6 .2 .4 .1 Preparation of retroviral supernatants

6.2.4.1.1 GP+E cell-lines GP+E cell-lines were grown to 90% confluency on a 100 mm dish. They were then washed with DMEM to remove selective antibiotics and 4 ml of fresh media (containing the serum requirements of the cells to be infected) was added to the cells. 36-48 h later the media were collected from the cells and filtered through a 0.45 mM filter and either used immediately or frozen in aliquots on dry ice in methanol and stored at -80°C.

6.2.4.1.2 Transient transfection of Bose 23 cells Bose 23 cells were seeded or grown to a density of 90% confluency on a 100 mm dish 24 h before transfection. Cells were then transiently transfected using the calcium phosphate method with retroviral DNA, using a similar method to that described above. However, in addition, 25 |iM chloroquine (Sigma) was added to the media prior to transfection and the precipitate was only applied to the cells for 8-10 h. After the precipitate was removed the cells had fresh growth media added overnight and the next morning 4 ml of fresh media (containing the serum requirements of the cells to be infected) was added. The virus was harvested as described above.

6.2.4.2 Retroviral infection of cells

Cells to be infected were seeded 24 h prior to infection at a confluency of 70-80%. Viral supernatants were mixed with 8 }xg/ml polybrene (Sigma) (from a lOOx stock solution of 0.8 mg/ml kept at 4°C). 2 ml of this mix was applied to one 100 mm dish and incubated at 37°C for 2 h. After which the viral supernatant was aspirated from the cells and the cells were incubated with normal growth media for 24-48 h.

6.2.5 Selection of stably transfected or infected cells

Newly infected or transfected cells were split into selective growth media containing relevant selective antibiotics 36-48 h post-infection or -transfection. The dilution to which cells were split depended on whether pools were required or individual colonies. If pools were required cells were split at two times the dilution they were normally passaged. If

204 Chapter Six - Materials and Methods individual colonies were required the cells were split much more harshly at titrated dilutions. The selective media were changed every 3 days until equivalent cells, not expressing selection markers, all died. Cells were then pooled or ring-cloned and maintained in selective media.

6.2.5.1 Pooling of cells

If pooled populations of cells were required, dishes containing selected colonies were trypsinised and resuspended in selective media, pelleted at 1200 rpm (MSE Centaur 2) for 5 min and resuspended in selective media. They were then plated at densities of approximately 1x10^ cells per 15 cm dish, grown to sub-confluency and either expanded further or frozen down as cell stocks.

6.2.5.2 Ring cloning

If individual clones were required, dishes that were sparsely populated with colonies were examined and colonies were circled on the underside of the dish with a marker pen. The cells were washed twice with PBSA. The edge of autoclaved clean glass cloning cylinders (V.A. Howe) were dipped into sterile (autoclaved) silicon grease and placed around the required colonies, forming a seal. 100 p,l of trypsin-versene was then added to each and after 3 minutes the cells were transferred to fresh selective media in 24 well dishes. Clones were cultured in these dishes until they had grown to almost confluency and were then split on to larger and larger dishes until there were enough cells to utilise or freeze down.

6.2.5.3 Tritiated thymidine incorporation assay

All thymidine assays (unless otherwise stated) were performed in triplicate. Cells were incubated with 1-2 pi per ml of media with tritiated thymidine (185 GBq/mmole 5.0 Ci/mmole) (Amersham) for the stated amount of time. If the cells were attached, the media were removed and the cells were lysed in 1-2 ml 1% (w/v) SDS and added to a polypropylene tube. The wells were then washed out with 1-2 ml of PBSA which was also added to the polypropylene tube. If the cells were in suspension, the cells were collected by centrifugation and lysed in the polypropylene tube with 2 ml SDS after which 2 ml of PBSA was added. An equal volume of freshly made, ice-cold, 15% (v/v) Tricholoroacetic Acid (TCA) (BDH) (stored as a 100% (w/v) solution at 4°C) was added to the lysed cells in PBSA. The lysates were vortexed and incubated on ice for 10 min. Lysates were then filtered through glass microfibre filters (Whatman 2.5 cm circles) on a Millipore vacuum manifold, the tubes were washed out with 8 ml ice-cold 5% (v/v) TCA which was poured through the filters. Filters were then washed with 20 ml ice-cold 5% (v/v) TCA and then

205 Chapter Six - Materials and Methods

5 ml 100% (v/v) ethanol. The filters were dried and then put into a scintillation vial with 5 ml scintillation fluid (Ultima Gold). The radioactive decay was measured on a scintillation counter (Beckman LS65(X)).

6.2.5.4 Cell cycle analysis by FACS Cells were treated with 10 |iM BrdU (from 2 mM stock in dH20 stored at -20°C in the dark) for the required amount of time. Cells were then trypsinised and resuspended in DMEM containing 10% serum. The cells were then pelleted at 1200 rpm (MSB Centaur 2) for 5 min and the supernatant was removed. Cells were washed twice with PBSA and resuspended in 250 pi of PBSA. The cells were then vortexed whilst 700 pi of ice-cold ethanol was gradually added to the cells, which were subsequently incubated on ice for 30 min. Cells were then pelleted and washed twice in PBSA, prior to the addition of 2 M HCl for 20 min at room temperature with frequent mixing. After which cells were washed twice in PBSA and once with PBS-BT (0.5% (v/v) Tween 20 and 0.05% (w/v) BSA in PBSA). 2 pi of anti-BrdU antibody (Beckton-Dickinson) was added directly to the cell pellet for 15 min at room temperature, then washed twice in PBS-BT. 50 pi of FITC-conjugated rabbit-anti-mouse immunoglobulins (DAKO) was added for 15 min at room temperature and cells were washed once in PBS-BT. 100 pi of 100 pg/ml Ribonuclease (Sigma) and 400 pi of propidium iodide (PI) (50 pg/ml) was added to the cells which were analysed on a fluorescence activated cell scanner (FACScan) by flow cytometry, using pulse processing to gate out cell doublets and clumps.

6.2.5.5 Cytospin

Cells in suspension were harvested and a single cells suspension was obtained. Cells were either counted or an estimate was made at the cell number (from known seeding density) and three dilutions of cells (5x10^, 10x10^, 20x10^) were added to 100 pi of PBSA. Frosted end slides (washed once in methanol and dried) and a Cytospin filter (Shandon) were slid into the cytospin funnel apparatus. Cells in PBSA were added to the funnel and centrifuged at 500 rpm for 5 min in a Cytospin 2 (Shandon). Cells were then air dried for 5 min, circled with a Dako immunohistochemistry pen (Dako), and fixed. The slide with optimal cell distribution was used for immunofluoresence.

6.2. S. 6 BrdU staining for immunofluorescence

Cells were fixed in methanol at -20°C for 10 min, washed twice with PBSA, and then incubated for 5 min with 2 M HCl and 0.01% (v/v) Triton X-100 in PBSA, washed twice in PBSA, and then blocked for 30 min in blocking solution (3% (w/v) BSA, 10% (v/v) serum (foetal bovine or goat (Gibco-BRL)), 5% (w/v) fat-free dried milk powder, 0.01% (v/v) Tween-20 in PBSA). Cells were then washed twice in PBSA and incubated with 60

206 Chapter Six - Materials and Methods pi of undiluted anti-BrdU antibody (Amersham-Pharmacia) for 45 min in the dark. Cells were then washed 5-6 times with 0.01% (v/v) Tween-20 in PBSA. A fluoroescein isothiocyanate (FITC) conjugated goat anti-mouse secondary antibody (Jackson Immunoresearch Laboratories) was diluted 1:300 in blocking solution with 0.1 pg/ml Hoechst 33258 and incubated on the cells for 30 min. Cells were then washed 5-6 times and mounted in mounting medium under a coverslip. Mounting medium was prepared by mixing 6 g of glycerol and 2.4 g of MOWIOL (Harlow Chemical Company) to 6 ml of dH20 with occasional agitation for 2 h at RT. Then 12 ml of 200 mM Tris-HCl (pH 8.5) was added and medium was heated to 50°C for 10 min with occasional mixing and then spun at 5000 rpm (Heraeus Megafuge 1.0 R) for 15 min. The supernatant was then aliquoted and stored at -20°C, a working solution was kept at 4°C for 1 month and brought to RT before use.

6.2.6 SDS-polyacrylamide electrophoresis (after Laemmli, 1970). A resolving gel of 7.5-12.5% (w/v) acrylamideibisacrylamide (37.5:1)* (Anachem 30% (w/v) stock), 0.375 M Tris-HCl pH 8.8, 0.1% (w/v) SDS, 0.05% (v/v) N,N,N’,N’,- tetramethylethylenediamine (TEMED) and 0.12% (w/v) ammonium persulphate (APS) was prepared. This was poured between the glass plates of a gel apparatus, to approximately 1 cm below the reach of the comb. Butan-2-ol-saturated TE was layered on top of the gel, which was left to polymerise. After which the gel border was washed three times with dH20 and blotted dry with Whatman 3MM paper. A stacking gel of 3- 5% (w/v) acrylamide-.bisacrylamide (37.5:1), 0.12 M Tris-HCl pH 6.8, 0.1% (w/v) SDS, 0.167% (v/v) TEMED and 0.22% (w/v) APS was then prepared and poured on top of the resolving gel. A comb was inserted into the gel and the gel was left to polymerise, upon which the comb was removed. The gel was put into the electrophoresis apparatus and Ix SDS-PAGE running buffer (20mM Tris base, 190 mM glycine (Sigma), 0.1% SDS, pH 8.3) was added. SDS- PAGE sample buffer to a Ix concentration (3% (w/v) SDS, 62.5 mM Tris-HCl pH 6.8, 10% (v/v) glycerol, 3.2% (v/v) p-mercaptoethanol, 0.05% (w/v) bromophenol blue) was added to the cell lysate which was heated to 95°C for 3 min and then loaded onto an SDS polyacrylamide gel using a Hamilton syringe. Molecular weight markers (Amersham Rainbow Markers) were also loaded. The gel was subject to electrophoresis at 80 v until the samples had entered the resolving gel, then the voltage was increased to 150-250 v. * MAPK shift gels: Resolving SDS polyacrylamide gels for analysing ERK phosphorylation had a different acrylamide to bisacrylamide ratio: 15% acrylamide (from 30% acrylamide solution, Scotlab) and 0.075% bisacrylamide (from 2% N,N'-methylene bisacrylamide solution, Scotlab), the stacking gels was made as described above. MAPK shift gels were run until the 30 kD marker had just run out of the gel.

207 Chapter Six - Materials and Methods

6.2.7 Western blotting After electrophoresis 1000 ml of blotting buffer (20 mM Tris base, 15 mM glycine, 20% (v/v) methanol) was prepared, a PVDF membrane (Immobilon, Millipore) was cut to the size of the resolving gel, soaked for 2 min in methanol then washed with dH 2 0 and equilibrated in blotting buffer for 5 min. The electrophoresis apparatus was dismantled, the stacking gel was discarded and the resolving gel was equilibrated in blotting buffer for 5 min. 3 sheets of 3MM paper cut to size and soaked in blotting buffer, were placed onto the pads (Scotch-Brite, boiled in 0.1% SDS for 1 h and washed well, before initial use) of the blotting apparatus (Genie blotter. Idea Scientific) which was filled with blotting buffer. The gel was placed on the 3MM paper, the polyvinylidene difluoride (PVDF) membrane (Millipore) placed on top and 3 more pieces of 3MM paper placed on top. At each stage, bubbles were excluded from the 'sandwich'. Blotting pads were then placed on top of the 'sandwich' and the apparatus was put together and subject to 25 v for 45 min at 4°C. Then apparatus was dismantled and the membrane washed twice in PBSA. If required the membrane was then stained for total protein with Ponceau S solution (Sigma) to look at efficiency of transfer and then washed 5-6 times with PBSA. The membrane was then blocked in western blocking buffer (5% (w/v) fat-free milk powder (Mikrobiologie) and 0.01% (v/v) Tween-20 in PBSA) for at least 30 min to prevent non-specific binding. Primary antibody was then added, diluted in western blocking buffer, for 1-4 h room temperature or over-night at 4°C, with agitation (on a shaking or rocking platform or on a rotating wheel). The membrane was then washed five times for 5 min periods in western washing buffer (0.01% (v/v) Tween-20 in PBSA). Secondary antibody conjugated to horseradish peroxidase was then added, diluted in blocking buffer for 45 min at room temperature, then washed 5 times for 5 min. The membrane was then rinsed in PBSA and ECL detection reagent was added (ECL (Amersham) for 1 min exactly or ECL-kPlus (Amersham) for 5-10 min). The membrane was then wrapped in Saranwrap and exposed to Kodak X-OMAT AR film.

6.2. 7.1 Membrane stripping Western blot membranes were stripped of bound antibodies to allow detection of other proteins on the same filter. Filters were rinsed in PBSA and then incubated with rocking for 20 min in 200 mM glycine (pH 2.5) and 0.4% SDS at room temperature. The membrane was then rinsed in 1 M Tris pH 7.5 and then washed 5-6 times with PBSA. The membranes were then blocked and reprobed as described above.

208 Chapter Six - Materials and Methods

6.2.8 Cell lysate preparation

6.2 .8.1 Lysis buffers For most SDS-PAGE, SDS lysis buffer was used : 2% (w/v) SDS, 60 mM Tris-HCl pH 6.8, 16 mM dithiothreitol (DTT) (Boehiinger Mannheim), 1% (v/v) (19 pg/ml) aprotinin (Sigma). For immunoprécipitation, Cyclin A and B kinase assays and some SDS-PAGE, Triton X- 100 lysis buffer was used : 1% (v/v) Triton X-100, 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% (v/v) aprotinin, 100 ug/ml phenyl-methyl-sulphonyl fluoride (PMSF) (10 mg/ml stock in isopropanol), 10 mM sodium fluoride (NaF) (0.5 M stock), 1 mM sodium orthovanadate (NagVO^) (20 mM stock; NagVO^ is dissolved in dH20 and pH adjusted to 10.0 with NaOH, solution becomes yellow and is then boiled until it becomes colourless, stored at room temperature) and 1 mM DTT. For some kinase assays NP40 lysis buffer was used : 0.5% (v/v) NP40, 50 mM Tris- HCl pH 7.8, 200 mM NaCl, 25 mM NaF, 1% (v/v) aprotinin, 100 pg/ml PMSF, 1 mM NagVO^, ImMDTT. For INK kinase assays JNK lysis buffer was used : 20 mM Hepes, 2 mM EGTA, 50 mM p-glycerol-phosphate, 1 mM DTT, 1 mM NasVO^, 1% (v/v) Triton X-100, 10% (v/v) glycerol, 400 pM PMSF, 5 pg/ml leupeptin, 5 pg/ml aprotinin.

6.2.8.2 Cell lysate preparation for Western blot Cell monolayers were washed twice with ice-cold PBSA. Cells were then scraped with a rubber policeman and transferred to an Eppendorf tube. Cells were pelleted by a 3 min spin at 6500 rpm in an MSE Microcentrifuge and the PBSA was removed. Cells grown in suspension were collected and washed as described above. Cell pellets were lysed in 50-100 pi of lysis buffer, vortexed, then heated to 95°C for 5 min and spun at 13000 rpm at 4°C for 10 min. The supernatant was transferred to a new Eppendorf tube and the protein concentration was determined (see below). SDS-PAGE sample buffer was then added and if not used immediately, lysates were stored at -20°C.

6.2.8.3 Protein concentration determination In most cases the Bio-Rad Protein Assay (Bio-Rad) was used according to the manufacturer's instructions. 1 pi of lysate was added to 1 ml of Bio-Rad reagent (diluted 1:5 in dH20) in a spectrophotometer cuvette. These were mixed and incubated at room temperature for 5 min. Its absorbance was then read at 595 nm using a spectrophotometer, against a blank of diluted Bio-Rad reagent. Concurrently a BSA standard curve was made. 0, 1, 2, 4, 6 and 8 pg of BSA in lysis buffer were each added to Bio-Rad reagent and the absorbances were determined after 5 min. This standard curve was then used to calculate the protein concentrations of the cell lysates.

209 Chapter Six - Materials and Methods

In cases where the lysis buffer was incompatible with this system, the Bio-Rad assay was used. Reagent S was diluted with reagent A in a 1:50 ratio to make reagent A/S. In the following order, 10 |il of lysate, 50 |xl of reagent A/S and 400 p,l of reagent B were added to the spectrophotometer cuvette, mixed and incubated at room temperature for 15 min. The absorbance of the samples was measured at 750 nm and concentrations were calculated against a BSA standard curve as above.

6.2.9 Immunoprécipitation Cell pellets were collected as described above. Cells were then lysed in 500-800 pi of lysis buffer and vortexed, incubated on ice for 5 min, vortexed again and then centrifuged at 13000 rpm (lEC Centra-4R centrifuge) at 4°C for 10 min. The supernatant was removed to a new Eppendorf tube and the protein concentration determined. Samples were either used immediately or flash frozen on dry-ice in methanol and stored at -80°C. 30 pi of protein A or protein G sepharose beads (4 Fast Flow, Pharmacia) for each immunoprécipitation (IP) were washed twice in lysis buffer and then blocked with 3% BSA in PBSA for 30 min on a rotating wheel at 4°C. They were then washed twice in lysis buffer. Primary antibody and the blocked protein sepharose beads were added to 10-200 pg of cell lysate in 800 pi of lysis buffer. Tubes were then incubated on a rotating wheel at 4°C for 2 h to overnight. Beads were then pelleted at 6000 rpm (MSE Microcentrifuge) and washed 3 times with lysis buffer (if a kinase assay was to be performed the samples were taken to this point and then the kinase assay protocol was followed). Beads were then pelleted a final time and resuspended in 25 pi of Ix SDS- PAGE sample buffer, heated to 95°C for 5 min, the beads were pelleted again and the supernatant was loaded on an SDS-PAGE gel.

6.2.10 Kinase assays

6.2.10.1 Cyclin E and Cyclin A Proteins were immunoprecipitated in Triton X-100 lysis buffer with 1 pg of antibody (anti-Cyclin E (Santa Cruz, sc-481), anti-Cyclin A (monoclonal E72, ICRF)). After washing with lysis buffer, the protein bound beads were then washed three times with kinase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl^, 1 mM DTT) and then pelleted and all buffer removed with a 25 G needle and syringe. The beads were resuspended in

30 pi kinase reaction mix [50 mM Tris-HCl pH 7.5, 10 mM MgCl 2 , 1 mM DTT, 30 pM Adenosine triphosphate (ATP), 0.5 pg/pl Histone HI (Boehringer Mannheim), 0.1 pCi/pl [^^P] yATP (Amersham)], vortexed briefly and incubated at 30°C for 30 min in a shaking heating block. 7 pi of 5x SDS-PAGE sample buffer was added to stop the reaction and the samples were heated to 95°C for 5 min. The beads were then pelleted and the supernatant was loaded onto an SDS-PAGE gel. After the gel was run, it was fixed in gel fixative (10% methanol and 10% acetone) for 5 min. The gel was then dried

210 Chapter Six - Materials and Methods for 45 min at 85°C on a gel dryer (Bio-Rad) onto Whatman 3MM paper and then exposed to X-OMAT film (Kodak) at -80°C.

6 .2 .1 0 .2 Cyclin D1 (after Carlson et al., 1996) Cells were lysed by addition of Cyclin D1 IP buffer (50 mM Hepes pH 7.5, 150 mM NaCl, ImMEDTA, 2.5 mM EGTA, 0.1% (v/v) Tween 20, 10% (v/v) glycerol, 10 mM b-glycerophosphate, 0.1 nM PMSF, 10 |ig/ml leupeptin, 20 units/ml aprotinin, 1 mM NaF and O.lmM Na^VOJ . Samples were then subject to 15 sec sonication on ice. 300 jLtg of protein was subject to immunoprécipitation with 1.5 |xg of DCS 11 anti-Cyclin D1 monoclonal antibody and 30 pi of protein G sepharose beads. After washing with lysis buffer, the protein G bound beads were then washed three times with Cyclin D1 kinase buffer (50 mM Hepes pH 7.5, ImM NaF, 10 mM MnClj, 2.5 mM EGTA and 1 mM DTT) and then pelleted and all buffer removed with a 25 G needle and syringe. The beads were resuspended in 40 pi kinase reaction mix (kinase buffer with 20 pM ATP, 0.4 mg of GST- pRb and 0.1 pCi/pl [^^P] yATP ), vortexed briefly and incubated at 30°C for 30 min in a shaking heating block. 7 pi of 5x SDS-PAGE sample buffer was added to stop the reaction and the samples were heated to 95°C for 5 min. The samples were then subject to SDS-PAGE. The gel was fixed, dried and exposed to film as above.

6.2.10.3 MAP kinase assay Proteins were immunoprecipitated in NP40 lysis buffer with 1-2 pi 122.2 MAPK kinase rabbit polyclonal antibody (a gift from Chris Marshall). After washing with lysis buffer the beads were washed three times with kinase buffer (50 mM Tris-HCl pH 7.5, 10 mM

MgCl 2 , 1 mM DTT) and then pelleted and all buffer removed with a 25 G needle and syringe. The beads were resuspended in 25 pi kinase reaction mix (50 mM Tris-HCl pH 7.5, 10 mM MgCli, 1 mM DTT, 0.1 M adenosine triphosphate (ATP), 15 pg myelin basic protein (MBP) (Sigma), 1 pCi [^^P] yATP), vortexed briefly and incubated at 30°C for 20 min in a shaking heating block. 6 pi of 5x SDS-PAGE sample buffer was added and the samples heated to 95°C for 5 min. The beads were then pelleted and the supernatant was subject to SDS-PAGE. The gel was fixed, dried and exposed to film as above.

6.2.10.4 JNK kinase assay Proteins were immunoprecipitated in JNK lysis buffer with 5 pi of JNK-1 antibody (sc- 474). After washing with lysis buffer, the beads were washed three times with LiCl wash (500 mM LiCl, 100 mM Tris-HCl pH 7.5, 0.1% (v/v) Triton X-100, 1 mM DTT) and then three times with JNK kinase buffer (20 mM MOPS pH 7.2, 2 mM EGTA, 10 mM MgCl 2 , 1 mM DTT, 0.1 % (v/v) Triton X-100), pelleted and all buffer was removed with a 25 G needle and syringe. The beads were resuspended in 20 pi kinase buffer, 7.5 pi of Mg-ATP reaction mix (50 mM MgCl 2 , 100 pM ATP, 2 pCi [^^P] yATP) and 10 pg

211 Chapter Six - Materials and Methods of GST-jun protein, vortexed briefly and incubated at 30°C for 20 min in a shaking heating block. 6 |xl of 5x SDS-PAGE sample buffer was added and the samples heated to 95°C for 5 min. The beads were then pelleted and the supernatant was subject to SDS- PAGE. The gel was fixed, dried and exposed to X-OMAT film as described above.

6.2.11 Reporter assays

6.2.11.1 CAT assay Cells were washed twice with PBSA. The plates were then drained and the residual PBSA aspirated away. 150 pi of CAT lysis buffer (0.1% (v/v) Triton X-100, 0.25 mM Tris (pH 8.0)) was added drop-wise to the plates. The plates were swirled gently and then incubated on ice for 3-5 min (until only the nuclei were visible under the microscope). The lysates were scraped off the plates with rubber policeman and were transferred to Eppendorf tubes. The collected lysates were then frozen on dry ice and then freeze thawed twice more, then vortexed and spun at 13000 rpm in a MSE Microcentrifuge for 3 min. The supernatants were transferred to fresh Eppendorf tubes and stored at -80°C. 30 pi of extract was heated to 68°C for 15 min, cooled down to room temperature and added to a fresh mix of 1 pi chloramphenicol (Sigma) stock solution (5 mg/ml), 2 pi “'‘C Acetyl CoA (54 mCi/mmole) (Amersham), 1.6 pi acetyl CoA (Sigma) stock solution (5 mg/ml), 7.5 pi 1 M Tris-HCl pH 8.0 and 38.5 pi of dH20. The reaction was incubated at 37°C for 1-4 h. At the end of the incubation the reaction tubes were transferred to ice. 200 pi of ice-cold ethyl acetate was added to the tube, vortexed vigorously for 30 sec and spun at 13000 rpm in a MSE Microcentrifuge for 3 min. From the phase separated mixture, 150 pi of the upper organic phase was transferred to a scintillation vial containing 5 ml scintillation fluid (Ultima Gold). A blank control of untransfected extracts was used as a negative control.

6.2.11.2 p-galactosidase assay Lysates were prepared as for CAT assay or luciferase assay (but without heating). 150 pi of lysate with 150 pi of p-gal reaction buffer (120 mM Na 2 HP0 4 .7 H2 0 , 80 mM

NaH 2 P 0 4 .H2 0 , 1.33 mg/ml 0-nitrophenyl-p-D-galactopyranoside (ONPG) (Sigma), 2 mM MgCl 2 , 0.27% (v/v) p-mercaptoethanol (Sigma)) were mixed and then incubated at 37°C for 15 min-4 h. When an obvious yellow colour developed, the reaction was stopped with 500 pi of 1 M Na 2 C0 3 . The Eppendorf tubes were then spun for 10 min at 13000 rpm (microcentrifuge), then 400 pi of the supernatant was transferred to a spectrophotometer cuvette and its absorbance was read at 420 nm against a mock extract as negative control.

212 Chapter Six - Materials and Methods

6.2.11.3 Luciferase assay If the assay was to be done in conjunction with a CAT or P-gal assay, a 100 mm dish was washed twice with PBSA and drained. 100 |li1 of 0.25 M Tris-HCl pH 7.5 was added and the cells were scraped off the dish using a rubber policeman. Cells were transferred to an Eppendorf tube where they were pipetted up and down vigorously. The cells were then put through three freeze-thaw cycles and then spun at 13000 rpm (microcentrifuge) for 10 min. The supernatant was assayed for luciferase activity. Alternatively, if only the luciferase activity was required, the cells were washed twice with PBSA, the plate drained and then cells lysed in 150 jil of luciferase lysis buffer (0.65% NP40, 10 mM Tris pH 8.0, 1 mM EDTA pH 8.0, 150 mM NaCl) on ice for 5 min. The lysate was then scraped from the dish and transferred to an Eppendorf tube, centrifuged at 13000 rpm (microcentrifuge) for 1 min and assayed for luciferase activity. To assay for luciferase activity 20 p,l of lysate was added to 350 |xl of luciferase reaction

buffer (25 mM glycylglycine pH 7.8 (Sigma), 5 mM ATP pH 8.0, 15 mM MgS 0 4 ) in a luminometer cuvette and the samples were loaded into the luminometer. The machine then injected 33 |il of 3 mM luciferin (sodium salt, Sigma) into the reaction mixture and measured the peak luminescence.

6.2.12 Preparation of glutathione-S-transferase (GST)-fusion proteins Plasmid DNA coding for the required GST fusion protein under the control of an isopropyl p-D-thiogalactoside (IPTG) inducible promoter was transformed into BL21 (DE3) competent bacteria and a 50 ml overnight LB culture was grown. This was used to inoculate a 450 ml culture, which was grown until its absorbance at 600 nm was 0.8-1.0. The bacteria were then induced with 1 mM IPTG for 3-4 h shaking at 37°C. The bacteria were then spun down and resuspended in 8 ml of ice-cold lysis buffer ( 1 % (v/v) Triton X-100, 10 mM EDTA pH 8.0, 0.5 mg/ml PMSF, 0.08 mg/ml aprotinin) with gentle pipetting. Lysates were then transferred to 6x 2 ml Eppendorf tubes and lysed further by sonication for two 10 sec bursts. The tubes were centrifuged at 13000 rpm at 4°C (Centra-4R centrifuge) for 10 min and supernatants were passed through a 0.45 |iM filter to remove unlysed bacteria and DNA. Supernatants were then applied to the prepared column (see below) at 4°C and the run-through collected and put through the column two more times. The column was then washed twice with one column volume of 1% (v/v) Triton X-100 in PBSA then once with PBSA. Five protein fractions were eluted, each by addition of 500 pi of elution buffer (50 mM Tris pH 8.0 and 5 mM glutathione (Sigma)). Each fraction was assayed for protein content. A sample of each fraction was also subject to analysis by SDS-PAGE. The gel was coomassie stained in 0.1% (w/v) Coomassie Blue (Bio-Rad), 41% methanol and 7% glacial acetic acid and destained in 41% methanol and 7% glacial acetic acid then dried on a gel drying frame (Idea Scientific).

213 Chapter Six - Materials and Methods

Columns (Bio-Rad) were prepared in advance and constantly kept at 4°C throughout the procedure: 1 ml of glutathione sepharose 4B slurry (Pharmacia), was added to the column to make a bed of approximately 500 jxl, which was washed with one column volume of PBSA and then one column volume of 1% (v/v) Triton X-100 in PBSA. The column was not allowed to dry out.

6.2.13 Restriction enzyme digestion Reactions were carried out in 20 |xl total volume with lOx reaction buffer (NEB) and 5 units of enzymes (NEB unless otherwise stated) on 0.5-2 pg DNA, at 37°C for 1 h. The reactions were stopped by addition of 5x DNA loading dye (50 mM EDTA pH 8.0, 100 mM Tris pH 8.0, 50% (v/v) glycerol, 0.4% (w/v) bromophenol blue) and were subject to agarose gel electrophoresis.

6.2.14 Agarose gel electrophoresis The percentage of agarose used to make the gels depended on the size of the fragments analysed, but varied between 0.75% (w/v) for fragment over 2 kbp to 5% (w/v) for fragments of around 100 bp. In addition the type of agarose used also depended on the application. In most instances SeaKem le agarose (EMC Bioproducts) was used. For retrieval of DNA from low gelling temperature agarose SeaPlaque agarose (PMC Bioproducts) was used and for resolving fragments less than 500 bp, Nusieve GTG agarose (PMC Bioproducts) was used. To form the gel, agarose was added to 100 ml of Ix TAE buffer (40 mM TrisOAc, 2 mM EDTA pH 8.0) and heated on a high setting in a microwave until the agarose had fully dissolved. Upon cooling, ethidium bromide to a concentration of 0.01 pg/ml was added and the gel poured into a gel forming tray of the appropriate size with a teflon comb. When set, the gel was submerged in Ix TAE buffer, in an appropriate gel electrophoresis tank. The samples in DNA loading buffer were carefully loaded and subject to electrophoresis at a constant voltage of 80-100 v, depending on the size of gel used. A molecular weight marker (1 kb ladder Gibco BRL) was added to one lane. DNA bands were visualised on a long wave UV transilluminator and if necessary bands were excised using clean razor blades.

6,2.14.1 Extraction of DNA from agarose gels Various method of DNA extraction were used: 1) - Low gelling temperature agarose was used for the electrophoresis and the required band was excised in as small an amount of agarose as possible. The volume was increased to 100 pi with dH20 and the mixture was heated to 68°C to melt the agarose and then maintained at 37°C, before addition to the ligation reaction. 2) - Excised band from normal agarose were dissolved in 3 volumes of 6 M Nal at 50°C. 5 pi of glassmilk solution (silica matrix in dH20)(Geneclean II Kit, Bio 101 Inc) was

214 Chapter Six - Materials and Methods added and incubated on ice for 5 min. The mixture was then spun at 13000 rpm (MSE Microcentaur) and the glassmilk pellet washed three times in 500 p.1 of chilled 'New Wash' (Geneclean II Kit, Bio 101 Inc). The pellet was then resuspended in 5 pi of TE and incubated at room temperature for 5 min to dissolve the DNA, spun again and the supernatant removed to another tube. The pellet was again resuspended in 5 pi of TE, incubated, spun and the supernatant added to the previous one. This supernatant was used for the ligation reaction. 3) -100 pi of dH20 was added to a spin column (GenElute Agarose spin columns (Supelco Inc)) and spun for 1 min (Eppendorf centrifuge 5414), the column was removed to a fresh Eppendorf tube and the excised band was added to the column and spun for 10 min. This eluate was used for the ligation reaction.

6.2.15 Ligation reactions Ligation reactions were carried out in 20 pi total volume, with lOx ligation buffer (NEB), 10 mM ATP and 0.4 units of ligase (NEB), using 20-50 ng vector DNA and a vector to fragment ratio of 1:2-5. Reactions were carried out at room temperature for 2 h or overnight.

6.2.16 Dephosphorylation of vector DNA Restriction digestion reactions were incubated at 68°C for 20 min to inactivate the restriction enzymes*. Then 1 unit of calf intestinal alkaline phosphatase (GIF) (NEB) was added to the reaction and incubated at 37°C for 30 min. Reactions were incubated with 5 mM EDTA at 68°C for 20 min to inactivate the GIF. Alternatively vectors were dephosphorylated with shrimp alkaline phosphatase (SAP) (Boehringer Mannheim). Restriction digests were inactivated then 50 pmol of DNA from the digest was added to lOx SAP reaction buffer (Boehringer Mannheim), dH20 and 1 unit of SAP in a total volume of 20 pi. Vectors with 5’ or 3’ overhangs were incubated at 37°G for 5 min and blunt ended vectors were incubated at 37°G for 1 h. Reactions were incubated at 68°G for 20 min to inactivate the SAP. *If the restriction enzymes were not heat inactivatable, then EDTA to a concentration of 5 mM was added to stop the reaction and the reaction was phenol-chloroform extracted and the DNA precipitated (in the presence of 1 pg of glycogen) and resuspended in lOx GIF reaction buffer (NEB), dIÎ20 and 1 unit of GIF.

6.2.17 PhenoI-Chloroform extraction of DNA The volume of the sample was increased, if necessary, to 100 pi with dH20. An equal volume of phenol-chloroform (1:1) (Sigma) was added. The reaction was then vortexed for 10 sec and spun at 13000 rpm in an MSE Microcentrifuge for 1 min. The aqueous upper phase was transferred to another tube and the DNA was precipitated.

215 Chapter Six - Materials and Methods

6.2.18 Ethanol precipitation of DNA To precipitate DNA out of a sample, 10% of the sample volume of 3 M sodium acetate was added to the sample (if the quantity of DNA was very small (less than 1 pg) 1 pg of glycogen was also added to the sample). Then twice the new sample volume of 100% (v/v) ethanol was added and mixed. The sample was then incubated on dry-ice for 10 min. The sample was then centrifuged at 13000 rpm (MSE Microcentrifuge) for 10 min. The supernatant was removed and 500 pi of 70% (v/v) ethanol was added. The DNA was pelleted for 5 min at 13000 rpm. The supernatant was removed and the pellet was dried and resuspended in dHjO or TE.

6.2.19 Transformation of DKSa E.coli To prepare competent bacteria, a single colony of DH5a was picked from a fresh LB agar plate into 3 ml of LB media (10 g/1 Bactotryptone, 5 g/1 yeast extract, 10 g/l NaCl, adjusted to pH 7.5 with 5 M NaOH) and grown overnight. 100 ml of LB was inoculated with 1 ml of overnight culture and left to grow with vigorous shaking at 37°C until the absorbance of the culture at 600 nm reached 0.5. The flask was transferred to ice and rapidly cooled down. The bacteria were pelleted at 2000 rpm (Heraeus Megafuge 1.0 R) for 10 min at 4°C and the supernatant discarded. The pellet was resuspended in 15 ml of sterile ice cold 50 mM CaCl] by gentle pipetting on ice. After incubating 30 min on ice the bacteria were pelleted again and the supernatant discarded and the pellet resuspended in 3 ml sterile ice cold 50 mM CaClj and 20% (v/v) glycerol by gentle pipetting on ice. The bacteria were then frozen on dry ice in 100 pi aliquots and stored at -80°C. To transform bacteria with DNA, 100 pi aliquot of competent DH5a, thawed on ice, was mixed with 10 pi of a 20 pi ligation or 50 ng plasmid DNA and incubated on ice for 20 min. The bacteria were then heat-shocked at 37°C for 2 min and incubated on ice for a further 2 min. They were then incubated in 700 pi of LB at 37°C for 45 min. After which the bacteria were pelleted at 6500 rpm (MSE Microcentrifuge). The cell pellet was resuspended in 100 pi of LB and plated onto LB/Amp agar plates containing 100 mg/ml ampicillin (Sigma) in 1.5% (w/v) agar (DEFCO laboratories). Plates were incubated at 37°C overnight. Bacterial colonies were grown up in 2 ml LB containing 100 pg/ml ampicillin overnight, shaking at 37°C and miniprepped.

6.2.20 Mini-preps by Alkaline Lysis A bacterial colony was picked and grown in 2 ml LB overnight with shaking at 37°C. 1.5 ml of the mini-prep was pelleted at 13000 rpm (MSE microfuge) for 1 min in an Eppendorf tube and the pellet was resuspended in 100 pi of solution 1 (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA). Cells were then lysed by addition of 200 pi of solution 2 (0.2 M NaOH, 1% (w/v) SDS). The tubes were then inverted gently to mix

216 Chapter Six - Materials and Methods

and incubated on ice for 5 min. Then 150 pi of ice-cold solution 3 (5 M KOAc pH 4.8 [made by mixing 2 volumes of 5 M acetic acid (1 volume of glacial acetic acid diluted with 2.5 volumes of dH20) with 1 volume of 5 M potassium acetate] was added and mixed immediately by gentle inversion. Lysates were incubated on ice for 5 min, then spun at 13000 rpm (MSE microfuge) for 1 min and the supernatant was transferred to another tube. The supernatant was then phenol-chloroform extracted and ethanol precipitated. The DNA was then resuspended in 50 pi of TE. 100 pg/ml ribonuclease (Sigma) (prepared as a 10 mg/ml stock and boiled for 10 min, then stored at -20°C) was added and samples were incubated at 37°C for 15 min. Mini-prep DNA was then analysed by restriction digest.

6.2.21 Qiagen Spin-prep Mini-preps Bacteria were pelleted and resuspended in 250 pi of PI buffer. 250 pi of P2 buffer was added and tube was inverted gently for lysis, then incubated on ice for 5 min. 350 pi of N3 buffer was then added and the tube inverted gently to mix and then incubated on ice for 10 min. The tube was then spun at 13000 rpm (MSE microfuge) for 1 min and the supernatant was transferred to a Qiagen spin-prep column. It was spun through the column at 13000 for 30 sec into a 2 ml Eppendorf tube and the spin-through was discarded. The column was then washed with 750 pi of buffer PE with a 30 sec spin and the spin-through discarded. The column was then spun for a further 30 sec to remove all liquid. 50 pi of TE was then applied, allowed to absorb for 30 sec, then the column was spun for 1 min into a fresh tube. DNA was analysed by restriction digest.

6.2.22 Qiagen Maxi-prep

1 ml of a mini-prep culture were added to 100 ml of LB and incubated at 37°C with shaking overnight. 50 ml of the culture was pelleted in polypropylene tubes at 5800 rpm (Heraeus 1.0 R) for 8 min. The pellet was resuspended in 10 ml of PI buffer, then lysed in 10 ml of P2 buffer and mixed by gentle inversion. It was then incubated at room temperature for 5 min. 10 ml of ice-cold P3 buffer was added, mixed by gentle inversion and tubes were incubated on ice for 20 min. Tubes were then spun at 5800 rpm (Heraeus 1.0 R) for 30 min. In the mean-time Qiagen Maxi columns were equilibrated with 10 ml of QBT buffer. The bacterial supernatants were then applied to the columns through gauze to filter out the white precipitate. After the supernatants had run through the columns were washed with 30 ml of QC buffer, then the columns were transferred to fresh 50 ml polypropylene tubes and 15 ml of QF elution buffer was applied. When run through, 10.5 ml of isopropanol was added to the eluted DNA, mixed and the tubes were spun at 5800 rpm (Heraeus 1.0 R) for 30 min. The DNA pellet was then washed with 1 ml 70% (v/v) ethanol, dried and resuspended in 250 pi of TE.

217 Chapter Six - Materials and Methods

6.2.23 Polymerase chain reaction

To extract genomic DNA from mammalian cells, approximately 2x10^^ cells were lysed in 50 |il of digestion buffer (50 mM Tris pH 8.0, 20 mM NaCl, 0.1% (w/v) SDS and 1 mg/ml Proteinase K), vortexed and incubated at 55°C for 3 h. 500 |xl of dH^O was then added and samples were boiled for 5 min, then spun for 10 sec in a microfuge at 13000 rpm. 1 |il of the supernatant was used per PCR reaction.

Reactions were prepared on ice in 30 |xl total volume with lOx PCR reaction buffer (Promega), 200 |iM dNTPs, 1 |iM of each primer and 50 ng of template DNA or 1 pi of cell lysate and 1 pi of Taq polymerase (PICTAQ, ICRF). For each reaction, control reactions were perfomed with either template DNA or primers absent.

5 pi of the reaction was subject to agarose gel electrophoresis to analyse the PCR products and the remaining 25 pi was purified using a PCR purification column (Qiagen), prior to digestion with restriction enzymes.

218 Chapter Seven - Bibliography

7. Bibliography

Abo, A., Pick, E., Hall, A., Totty, N., Teahan, QG. and Segal, A.W. (1991) Activation of the NADPH oxidase involves the small GTP-binding protein p21rac1. Nature, 353, 668-670. Adah, H., Lowy, D.R., Willumsen, B.M., Der, C.J. and McCormick, F. (1 988 ) Guanosine triphosphatase activating protein (GAP) interacts with the p21 ras effector binding domain. Science, 2A0, 518-521. Adra, C.N., Manor, D., Ko, J.L., Zhu, S., Horiuchi, T., Van Aelst, L, Cerione, R.A. and Lim, B. (1997) RhoGDIgamma: a GDP-dissociation inhibitor for Rho proteins with preferential expression in brain and pancreas. Proc Natl Acad Sci U SA, 9A, 4 2 7 9 - 4284. Akashi, M., Osawa, Y., Koeffler, H.P. and Hachiya, M. (1999) p21WAF1 expression by an activator of protein kinase C is regulated mainly at the post-transcriptional level in cells lacking p53: important role of RNA stabilization. Biochem J, 3 37, 607-616. Akimoto, K., Takahashi, R., Moriya, S., Nishioka, N., Takayanagi, J., Kimura, K., Fukui, Y., Osada, S., Mizuno, K., Mirai, S., Kazlauskas, A. and Ohno, S. (1996) B3F or PDGF receptors activate atypical PKCIambda through phosphatidylinositol 3 - kinase. Em bo J, 15, 788-798. Aktas, H., Cai, H. and Cooper, G.M. (1997) Ras links growth factor signaling to the cell cycle machinery via regulation of cyclin D1 and the Cdk inhibitor p27KIP1. Mo! Cell Biol, 17, 3850-3857. Alberts, A.S., Bouquin, N., Johnston, L.H. and Treisman, R. (1998) Analysis of RhoA-binding proteins reveals an interaction domain conserved in heterotrimeric G protein beta subunits and the yeast response regulator protein Skn7. J Biol Chem, 273, 8616-8622. Alberts, A.S. and Treisman, R. (1998) Activation of RhoA and SAPK/JNK signalling pathways by the RhoA- specific exchange factor mNETI. Embo J, 17, 4075-4085. Albright, C.F., Giddings, B.W., Liu, J., Vito, M. and Weinberg, R.A. (1 993) Characterization of a guanine nucleotide dissociation stimulator for a ras-related GTPase. Embo Journal, 12, 339-347. Alessi, D.R., Andjelkovlc, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and Hammings, B.A. (1996) Mechanism of activation of protein kinase B by insulin and IGF-1. Em bo J, 15, 6541-6551. Alessi, D.R. and Cohen, P. (1998) Mechanism of activation and function of protein kinase B. Curr Opin Genet Dev, 8, 55-62. Alessi, D.R., Smythe, C. and Keyse, S.M. (1993) The human CL100 gene encodes a Tyr/Thr-protein phosphatase which potently and specifically inactivates MAP kinase and suppresses its activation by oncogenic ras in Xenopus oocyte extracts. Oncogene, 8, 2015-2020. Alevizopoulos, K., Vlach, J., Hennecke, S. and Amati, B. (1997) Cyclin-e and c-myc promote cell-proliferation in the presence of p16(ink4a) and of hypophosphorylated retinoblastoma family proteins. Embo J, 16, 5322-5333.

219 Chapter Seven - Bibliography

Anderson, N.G., Li, P., Marsden, L.A., Williams, N., Roberts, T.M. and Sturgill, T.W. (1991) Raf-1 is a potential substrate for mitogen-activated protein kinase in vivo. B iochem J, 277, 573-576. Anderson, N.G., Mailer, J.L., Tonks, N.K. and Sturgill, T.W. (1990) Requirement for integration of signals from two distinct phosphorylation pathways for activation of MAP kinase. N ature, 343, 651-653. Aronheim, A., Engelberg, D., Li, N., al-Alawi, N., Schlessinger, J. and Karin, M. (1994) Membrane targeting of the nucleotide exchange factor Sos is sufficient for activating the Ras signaling pathway. Cell, 78, 949-961. Arsenian, S., Weinhold, B., Oelgeschlager, M., Ruther, U. and Nordheim, A. (1 998) Serum response factor is essential for mesoderm formation during mouse embryogenesis. Embo J, 17, 6289-6299. Aspenstrom, P. (1997) A Cdc42 target protein with homology to the non-kinase domain of PER has a potential role in regulating the actin cytoskeleton. Curr Biol, 7, 479-487. Assoian, R.K., Boardman, L.A. and Drosinos, S. (1989) A preparative suspension culture system permitting quantitation of anchorage-independent growth by direct radiolabeling of cellular DNA. Anal Biochem, 177, 95-99. Bagrodia, S., Derijard, B., Davis, R.J. and Cerione, R.A. (1995a) Cdc42 and PAK- mediated signaling leads to Jun kinase and p38 mitogen-activated protein kinase activation. J Biol Chem, 270, 27995-27998. Bagrodia, S., Taylor, S.J., Creasy, C.L., Chernoff, J. and Cerione, R.A. (1995b) Identification of a mouse p21Cdc42/Rac activated kinase [published erratum appears in J Biol Chem 1996 Jan 12;271(2):1250]. J Biol Chem, 270, 22731-22737. BailleuI, B., Surani, M.A., White, S., Barton, S.C., Brown, K., Blessing, M., Jorcano, J. and Balmain, A. (1990) Skin hyperkeratosis and papilloma formation in transgenic mice expressing a ras oncogene from a suprabasal keratin promoter. Cell, 62, 697-708. Ballester, R., Marchuk, D., Boguski, M., Saulino, A., Letcher, R., Wigler, M. and Collins, F. (1990) The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell, 63, 851-859. Balmain, A. and Pragnell, I.B. (1983) Mouse skin carcinomas induced in vivo by chemical carcinogens have a transforming Harvey-ras oncogene. Nature, 303, 72 - 74. Barbacid, M. (1987) ras genes. [Review] [270 refs]. Annual Review of Biochemistry, 56, 779-827. Bardwell, L., Cook, J.G., Voora, D., Baggott, D.M., Martinez, A.R. and Thorner, J. (1998) Repression of yeast ste12 transcription factor by direct binding of unphosphorylated kssi mapk and its regulation by the ste7 mek. Genes Dev, 1 2, 2887-2898,. Barfod, E.T., Zheng, Y., Kuang, W.J., Hart, M.J., Evans, T., Cerione, R.A. and Ashkenazi, A. (1993) Cloning and expression of a human CDC42 GTPase-activating protein reveals a functional SH3-binding domain. J Biol Chem, 268, 26059- 26062. Beck, T.W., Huleihel, M., Gunnell, M., Bonner, T.l. and Rapp, D.R. (1987) The complete coding sequence of the human A-raf-1 oncogene and transforming activity of a human A-raf carrying retrovirus. Nucleic Acids Research, 15, 595-609. Ben Ze'ev, A. (1997) Cytoskeletal and adhesion proteins as tumor suppressors. Current Opinion In Cell Biology, 9, 99-108.

220 Chapter Seven - Bibliography

Best, A., Ahmed, S., Kozma, R. and Lim, L. (1996) The Ras-related GTPase Rad binds tubulin. J Biol Chem, 271, 3756-3762. Bielinski, D.F., Pyun, H.Y., Linko-Stentz, K., Macara, I.G. and Fine, R.E. (1993) Ral and Rab3a are major GTP-binding proteins of axonal rapid transport and synaptic vesicles and do not redistribute following depolarization stimulated synaptosomal exocytosis. Biochim Blophys Acta, 1151, 246-256. Biggs, J.R., Kudlow, J.E. and Kraft, A.S. (1996) The role of the transcription factor Spl in regulating the expression of the WAF1/CIP1 gene in U937 leukemic cells. J Biol Chem, 271, 901-906. Billon, N., van Grunsven, L.A. and Rudkin, B.B. (1996) The CDK inhibitor p21 WAFI/Cipl is induced through a p300-dependent mechanism during NGF- mediated neuronal differentiation of PCI2 cells. O ncogene, 13, 2047-2054. Bobak, D.A., Nightingale, M.S., Murtagh, J.J., Price, S.R., Moss, J. and Vaughan, M. (1989) Molecular cloning, characterization, and expression of human ADP- ribosylation factors: two guanine nucleotide-dependent activators of cholera toxin. Proa Natl Acad Scl USA, 86, 6101-6105. Bohmer, R.M., Scharf, E. and Assoian, R.K. (1996) Cytoskeletal integrity is required throughout the mitogen stimulation phase of the cell cycle and mediates the anchorage-dependent expression of cyclin D1. Molecular Biology of the Cell, 7, 101- 111. Bokoch, G.M. (1994) Regulation of the human neutrophil NADPH oxidase by the Rac GTP-binding proteins. Curr OpIn Cell Biol, 6, 212-218. Bokoch, G.M., Vlahos, C.J., Wang, Y., Knaus, U.G. and Traynor-Kaplan, A.E. (1 996) Rac GTPase interacts specifically with phosphatidylinositol 3-kinase. Biochemical J o u r n a l, 315, 775-779. Bonner, T., O'Brien, S.J., Nash, W.G., Rapp, U.R., Morton, C.C. and Leder, P. (1984) The human homologs of the raf (mil) oncogene are located on human chromosomes 3 and 4. S c ie n c e , 223, 71-74. Bortner, D.M. and Rosenberg, M.P. (1995) Overexpression of cyclin A in the mammary glands of transgenic mice results in the induction of nuclear abnormalities and increased apoptosis. Cell Growth Differ, 6, 1579-1589. Bortner, D.M. and Rosenberg, M.P. (1997) Induction of mammary gland hyperplasia and carcinomas in transgenic mice expressing human cyclin E. Mol Cell Biol, 1 7, 453-459. Bos, J.L. (1989) ras oncogenes in human cancer: a review [published erratum appears in Cancer Res 1990 Feb 15;50(4):1352]. Cancer Res, 49, 4682-4689. Bos, J.L. (1997) Ras-like GTPases. Blochim Blophys Acta, 1333, Ml 9-31. Boulton, T.G., Nye, S.H., Robbins, D.J., Ip, N.Y., Radziejewska, E., Morgenbesser, S.D., DePinho, R.A., Panayotatos, N., Cobb, M.H. and Yancopoulos, G.D. (1991) ERKs: a family of protein-serine/threonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF. Cell, 65, 663-675. Bourne, H.R., Sanders, D.A. and McCormick, F. (1990) The GTPase superfamily: a conserved switch for diverse cell functions.Nature, 3A8, 125-132. Bowteil, D., Fu, P., Simon, M. and Senior, P. (1992) Identification of murine homologues of the Drosophila son of sevenless gene: potential activators of ras. Proc Natl Acad Scl USA, 89, 6511-6515.

221 Chapter Seven - Bibliography

Brehm, A., Miska, E.A., McCance, D.J., Reid, J.L, Bannister, A.J. and Kouzarides, T. (1998) Retinoblastoma protein recruits histone deacetyiase to repress transcription [see comments]. Nature, 39"\, 597-601. Brill, S., Li, S., Lyman, C.W., Church, D.M., Wasmuth, J.J., Weissbach, L., Bernards, A. and Snijders, A.J. (1996) The Ras GTPase-activating-protein-related human protein IQGAP2 harbors a potential actin binding domain and interacts with calmodulin and Rho family GTPases. Mol Cell Biol, 16, 4869-4878. Brotherton, D.H., Dhanaraj, V., Wick, S., Brizuela, L., Domaille, P.J., Volyanik, E., Xu, X., Parisini, E., Smith, B.O., Archer, S.J., Serrano, M., Brenner, S.L., Blundell, T.L. and Laue, E.D. (1998) Crystal structure of the complex of the cyclin D- dependent kinase Cdk6 bound to the cell-cycle inhibitor p19INK4d.Nature, 3 95, 244-250. Brtva, T.R., Drugan, J.K., Ghosh, S., Terrell, R.S., Campbell-Burk, S., Bell, R.M. and Der, C.J. (1995) Two distinct Raf domains mediate interaction with Ras. J Biol C h e m , 2 7 0 , 9809-9812. Bruder, J.T., Heidecker, G. and Rapp, U.R. (1992) Serum-, TPA-, and Ras-induced expression from Ap-1/Ets-driven promoters requires Raf-1 kinase. Genes Dev, 6, 545-556. Brugarolas, J., Chandrasekaran, C., Gordon, J.I., Beach, D., Jacks, T. and Hannon, G.J. (1995) Radiation-induced cell cycle arrest compromised by p21 deficiency. N a tu re , 377, 552-557. Buday, L. and Downward, J. (1993) Epidermal growth factor regulates p21 ras through the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell, 73, 611-620. Burbelo, P.D., Drechsel, D. and Hall, A. (1995) A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rac GTPases. J Biol Chem, 2 7 0 , 29071-29074. Bustelo, X.R., Suen, K.L., Leftheris, K., Meyers, C.A. and Barbacid, M. (1994) Vav cooperates with Ras to transform rodent fibroblasts but is not a Ras GDP/GTP exchange factor. O ncogene, 9, 2405-2413. Cacace, A.M., Michaud, N.R., Therrien, M., Mathes, K., Copeland, T., Rubin, G.M. and Morrison, D.K. (1999) Identification of constitutive and ras-inducible phosphorylation sites of KSR: implications for 14-3-3 binding, mitogen-activated protein kinase binding, and KSR overexpression. Mol Cell Biol, 19, 229-240. Cai, H., Szeberenyi, J. and Cooper, G.M. (1990) Effect of a dominant inhibitory Ha­ ras mutation on mitogenic signal transduction in NIH 3T3 cells. Mol Cell Biol, 1 0, 5314-5323. Cales, C., Hancock, J.F., Marshall, C.J., Hall, A. (1988) The cytoplasmic protein GAP is implicated as the target for regulation by the ras gene product. Nature, 332, 548-551. Campbell, S.L., Khosravi-Far, R., Rossman, K.L., Clark, G.J. and Der, C.J. (1 998) Increasing complexity of Ras signaling. Oncogene, ^7, 1395-1413. Cantor, S.B., Urano, T. and Feig, L.A. (1995) Identification and characterization of Ral-binding protein 1, a potential downstream target of Ral GTPases. Mol Cell Biol, 15, 4578-4584. Capon, D.J., Seeburg, P.H., McGrath, J.P., Hayflick, J.S., Edman, U., Levinson, A.D. and Goeddel, D.V. (1983) Activation of Ki-ras2 gene in human colon and lung carcinomas by two different point mutations. N ature, 304, 507-513.

222 Chapter Seven - Bibliography

Carlson, B.A., Dubay, M.M., Sausviile, E.A., Brizuela, L. and Worland, PJ. (1996) Flavopiridol induces G1 arrest with inhibition of cyclin-dependent kinase (CDK) 2 and CDK4 in human breast carcinoma cells. Cancer Res, 56, 2973-2978. Carpenter, C.L., Auger, K.R., Duckworth, B.C., Hou, W.M., Schaffhausen, B. and Cantley, L.C. (1993) A tightly associated serine/threonine protein kinase regulates phosphoinositide 3-kinase activity. Mol Cell Biol, 1657-1665. Carpenter, G., Nishibe, S., Todderud, G., Ball, R. and Wahl, M. (1991) Activation of second messenger pathways by epidermal growth factor. Origins of Human Cancer: A comprehensive review. Cold Spring Harbour Laboratory Press, pp. 255-263. Carstens, C.P., Kramer, A. and Fahl, W.E. (1996) Adhesion-dependent control of cyclin E/cdk2 activity and cell cycle progression in normai cells but not in Ha-ras transformed NRK cells. Exp Ceii Res, 229, 86-92. Casillas, A.M., Amaral, K., Chegini-Farahani, S. and Nel, A.E. (1993) Okadaic acid activates p42 mitogen-activated protein kinase (MAP kinase; ERK-2) in B - lymphocytes but inhibits rather than augments cellular proliferation: contrast with phorbol 12-myristate 13-acetate. Biochem J, 290, 545-550. Catzavelos, C„ Bhattacharya, N., Ung, Y.C., Wilson, J.A., Roncari, L., Sandhu, C., Shaw, P., Yeger, H., Morava-Protzner, I., Kapusta, L., Franssen, E., Pritchard, K.l. and Slingerland, J.M. (1997) Decreased levels of the cell-cycle inhibitor p27Kip1 protein: prognostic implications in primary breast cancer [see comments]. Nat Med, 3, 227-230. Chan, A.M., Miki, T., Meyers, K.A. and Aaronson, S.A. (1994) A human oncogene of the RAS superfamily unmasked by expression cDNA cloning. Proc Nati Acad Sci USA, 91, 7558-7562. Chan, F.K., Zhang, J., Cheng, L., Shapiro, D.N. and Winoto, A. (1995) Identification of human and mouse pi 9, a novel CDK4 and CDK6 inhibitor with homology to p16ink4. Moi Ceii S/o/, 15, 2682-2688. Chang, E.H., Furth, M.E., Scolnick, E.M. and Lowy, D.R. (1982) Tumorigenic transformation of mammalian cells induced by a normal human gene homologous to the oncogene of Harvey murine sarcoma virus. Nature, 297, 479-483. Chang, H.W., Aoki, M., Fruman, D., Auger, K.R., Bellacosa, A., Tsichlis, P.N., Cantley, L.C., Roberts, T.M. and Vogt, P.K. (1997) Transformation of chicken cells by the gene encoding the catalytic subunit of PI 3-kinase. Science, 276, 1848- 1850. Chardin, P., Camonis, J.H., Gale, N.W., van Aelst, L., Schlessinger, J., Wigler, M.H. and Bar-Sagi, D. (1993) Human Sosi: a guanine nucleotide exchange factor for Ras that binds to GRB2. S cien ce, 260, 1338-1343. Charles, C.H., Sun, H., Lau, L.F. and Tonks, N.K. (1993) The growth factor-inducible immediate-early gene 3CH134 encodes a protein-tyrosine-phosphatase. Proc Natl Acad Sci USA, 90, 5292-5296. Cheatham, B., Vlahos, C.J., Cheatham, L., Wang, L., Blenis, J. and Kahn, C.R. (1994) Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Moiecuiar & Ceiiuiar B/o/ogy, 14, 4902-4911. Chedid, M., Michieli, P., Lengel, C., Huppi, K. and Givol, D. (1994) A single nucleotide substitution at codon 31 (Ser/Arg) defines a polymorphism in a highly conserved region of the p53-inducible gene WAF1/CIP1.O ncogene, 9, 3021-3024.

223 Chapter Seven - Bibliography

Chen, H.C., Appeddu, P.A., !soda, H. and Guan, J.L. (1996a) Phosphorylation of tyrosine 397 in focal adhesion kinase Is required for binding phosphatidylinositol 3- kinase. J Biol Chem, 271, 26329-26334. Chen, Q., Lin, T.H., Der, C.J. and Juliano, R.L. (1996b) Integrin-mediated activation of MEK and mitogen-activated protein kinase is independent of Ras [published erratum appears in J Biol Chem 1996 Sep 6;271 (36):22280]. J Biol Chem, 271, 18122-18127. Chen, R.H., Juo, P.C., Curran, T. and Blenis, J. (1996c) Phosphorylation of c-Fos at the C-terminus enhances its transforming activity. O n co g en e, 12, 1493-1502. Chenevix-Trench, G., Behm, F. and Westin, E. (1987) Allelic variation of the c - raf-1 oncogene in non-Hodgkin's lymphoma. Leukem ia, 1, 82-86. Chew, Y.P., Ellis, M., Wilkie, S. and Mittnacht, S. (1998) pRB phosphorylation mutants reveal role of pRB in regulating 8 phase completion by a mechanism independent of E2F.O ncogene, 17, 2177-2186. Chou, M.M. and Blenis, J. (1996) The 70 kDa 86 kinase complexes with and is activated by the Rho family G proteins Cdc42 and Rad. Cell, 85, 573-583. Chuang, T.H., Bohl, B.P. and Bokoch, G.M. (1993a) Biologically active lipids are regulators of Rac.GDI complexation. J Biol Chem, 268, 26206-26211. Chuang, T.H., Xu, X., Kaartinen, V., Heisterkamp, N., Groff en, J. and Bokoch, G.M. (1995) Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein family. Proc Natl Acad Sci U S A, 82, 10282-10286. Chuang, T.H., Xu, X., Knaus, U.G., Hart, M.J. and Bokoch, G.M. (1993b) QDP dissociation inhibitor prevents intrinsic and GTPase activating protein-stimulated GTP hydrolysis by the Rac GTP-binding protein. J Biol Chem, 268, 775-778. Chung, J., Grammer, T.C., Lemon, K.P., Kazlauskas, A. and Blenis, J. (1994) PDGF- and insulin-dependent pp7086k activation mediated by phosphatidylinositol-3-OH kinase. N ature, 370, 71-75. Cicchetti, P., Ridley, A.J., Zheng, Y., Cerione, R.A. and Baltimore, D. (1995) 3BP- 1, an 8H3 domain binding protein, has GAP activity for Rac and inhibits growth factor-induced membrane ruffling in fibroblasts. Embo J, 14, 3127-3135. Clark, G.J., Drugan, J.K., Rossman, K.L., Carpenter, J.W., Rogers-Graham, K., Fu, H., Der, C.J. and Campbell, 8.L. (1997a) 14-3-3 zeta negatively regulates raf-1 activity by interactions with the Raf-1 cysteine-rich domain. J Biol Chem, 272, 20990-20993. Clark, G.J., Kinch, M.8., Rogers-Graham, K., 8ebti, 8.M., Hamilton, A.D. and Der, C.J. (1997b) The Ras-related protein Rheb is farnesylated and antagonizes Ras signaling and transformation. J Biol Chem, 272, 10608-10615. Clark, G.J., Quilliam, L.A., Hisaka, M.M. and Der, C.J. (1993) Differential antagonism of Ras biological activity by catalytic and 8rc homology domains of Ras GTPase activation protein. Proc Natl Acad Sci USA, 90, 4887-4891. Clark, G.J., Westwick, J.K. and Der, C.J. (1997c) p120 GAP modulates Ras activation of Jun kinases and transformation. J Bid Chem, 272, 1677-1681. Clark, 8.G., 8tern, M.J. and Horvitz, H.R. (1992) C. elegans cell-signalling gene sem-5 encodes a protein with 8H2 and 8H3 domains [see comments]. Nature, 3 5 6, 340-344. Clifton, A.D., Young, P.R. and Cohen, P. (1996) A comparison of the substrate specificity of MAPKAP kinase-2 and MAPKAP kinase-3 and their activation by cytokines and cellular stress. FEBS Lett, 392, 209-214.

224 Chapter Seven - Bibliography

Cohen, L, Mohr, R., Chen, Y.Y., Huang, M., Kate, R., Dorin, D., Tamanoi, F., Goga, A., Afar, D., Rosenberg, N. and et a!. (1994) Transcriptional activation of a ras-like gene (kir) by oncogenic tyrosine kinases. Proc Natl Acad Sol USA, 91, 12448- 12452. Cook, S.J. and McCormick, F. (1993) Inhibition by cAMP of Ras-dependent activation of Raf. Science, 262, 1069-1072. Coso, O.A., Chiariello, M., Yu, J.C., Teramoto, H., Crespo, P., Xu, N., Miki, T. and Gutkind, J.S. (1995) The small GTP-binding proteins Rad and Cdc42 regulate the activity of the JNK/SAPK signaling pathway. Ce//, 81, 1137-1146. Cowley, S., Paterson, H., Kemp, P. and Marshall, C.J. (1994) Activation of MAP kinase kinase is necessary and sufficient for PCI2 differentiation and for transformation of NIH 3T3 cells. Cell, 77, 841-852. Cox, A.D., Brtva, T.R., Lowe, D.G. and Der, C.J. (1994) R-Ras induces malignant, but not morphologic, transformation of NIH3T3 cells. Oncogene, 9, 3281-3288. Crespo, P., Schuebel, K.E., Ostrom, A.A., Gutkind, J.S. and Bustelo, X.R. (1997) Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the vav proto­ oncogene product. Nature, 385, 169-172. Crews, C.M., Alessandrini, A. and Erikson, R.L. (1992) The primary structure of MEK, a protein kinase that phosphorylates the ERK gene product. Science, 258, 478-480. D'Adamo, D.R., Novick, S., Kahn, J.M., Leonard!, P. and Pellicer, A. (1997) rsc: a novel oncogene with structural and functional homology with the gene family of exchange factors for Ral. O ncogene, 14, 1295-1305. D'Arcangelo, G. and Halegoua, S. (1993) A branched signaling pathway for nerve growth factor is revealed by Src- , Ras-, and Raf-mediated gene inductions. Mol Cell 8/0/, 13, 3146-3155. D'Souza-Schorey, C., Boshans, R.L., McDonough, M., Stahl, P.O. and Van Aelst, L. (1997) A role for PORI, a Rad-interacting protein, in ARF6-mediated cytoskeletal rearrangements. EMBO Journal, 16, 5445-5454. Datta, S.R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y. and Greenberg, M.E. (1997) Akt phosphorylation of BAD couples survival signals to the cell- intrinsic death machinery. Ce//, 91, 231-241. de Vries-Smits, A.M., Burgering, B.M., Leavers, S.J., Marshall, C.J. and Bos, J.L. (1992) Involvement of p21ras in activation of extracellular signal-regulated kinase 2 [see comments]. Nature, 357, 602-604. Debant, A., Serra-Pages, C., Seipel, K., O'Brien, S., Tang, M. and Park, S.H. (1 996) The multidomain protein Trio binds the LAR transmembrane tyrosine phosphatase, contains a protein kinase domain, and has separate rac-specific and rho-specific guanine nucleotide exchange factor domains. Proc Natl Acad Sci USA, 93, 5466- 5471. Decker, S.J. (1995) Nerve growth factor-induced growth arrest and induction of p21Cip1/WAF1 in NIH-3T3 cells expressing TrkA. J Biol Chem, 270, 30841 - 30844. DeFeo, D., Gonda, M.A., Young, H.A., Chang, E.H., Lowy, D.R., Scolnick, E.M. and Ellis, R.W. (1981) Analysis of two divergent rat genomic clones homologous to the transforming gene of Harvey murine sarcoma virus. Proc Natl Acad Sci USA, 78, 3328-3332. DeGregori, J., Kowalik, T. and Nevins, J.R. (1995a) Cellular targets for activation by the E2F1 transcription factor include DMA synthesis- and G1/S-regulatory genes

225 Chapter Seven - Bibliography

[published erratum appears in Mo! Cell Biol 1995 Oct;15(10):5846-7]. Mol Cell 6/0/, 15, 4215-4224. DeGregori, J., Leone, G., Ohtani, K., Miron, A. and Nevins, J.R. (1995b) E2F-1 accumulation bypasses a G1 arrest resulting from the inhibition of G1 cyclin- dependent kinase activity. G enes Dev, 9, 2873-2887. del Peso, L., Gonzalez-Garcia, M., Page, 0., Herrera, R. and Nunez, G. (1997) lnterleukin-3-induced phosphorylation of BAD through the protein kinase Akt. S c ie n c e , 278, 687-689. Del Sal, G., Murphy, M., Ruaro, E., Lazarevic, D., Levine, A.J. and Schneider, 0. (1996) Cyclin D1 and p21/waf1 are both involved in p53 growth suppression. O n co g en e, 12, 177-185. Deng, 0., Zhang, P., Harper, J.W., Elledge, S.J. and Leder, P. (1995) Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell, 82, 675-684. Denouel-Galy, A., Douville, E.M., Warne, P.H., Papin, 0., Laugier, D., Calothy, G., Downward, J. and Eychene, A. (1998) Murine Ksr interacts with MEK and inhibits Ras-induced transformation. Current Biology, 8, 46-55. Dent, P., Haser, W., Haystead, T.A., Vincent, L.A., Roberts, T.M. and Sturgill, T.W. (1992) Activation of mitogen-activated protein kinase kinase by v-Raf in NIH 3T3 cells and in vitro. S c ie n c e , 257, 1404-1407. Dent, P., Jelinek, T., Morrison, D.K., Weber, M.J. and Sturgill, T.W. (1 995) Reversal of Raf-1 activation by purified and membrane-associated protein phosphatases [published erratum appears in Science 1995 Sep 22;269(5231):1657]. S c ie n c e , 268, 1902-1906. Dent, P. and Sturgill, T.W. (1994) Activation of (His)6-Raf-1 in vitro by partially purified plasma membranes from v-Ras-transformed and serum-stimulated fibroblasts [published erratum appears in Proc Natl Acad Sci U S A 1995 Sep 12;92(19):9009]. Proc Natl Acad Sci U S A, 9^, 9544-9548. DePaolo, D., Reusch, J.E., Carel, K., Bhuripanyo, P., Leitner, J.W. and Draznin, B. (1996) Functional interactions of phosphatidylinositol 3-kinase with GTPase- activating protein in 3T3-L1 adipocytes. Mol Celi Biol, 16, 1450-1457. Der, C.J., Krontiris, T.G. and Cooper, G.M. (1982) Transforming genes of human bladder and lung carcinoma cell lines are homologous to the ras genes of Harvey and Kirsten sarcoma viruses. Proc Natl Acad Sci USA, 79, 3637-3640. Derossi, D., Williams, E.J., Green, P.J., Dunican, D.J. and Doherty, P. (1998) Stimulation of mitogenesis by a cell-permeable PI 3-kinase binding peptide. Biochem Biophys Res Commun, 25^, 148-152. Dhand, R., Hiles, I., Panayotou, G., Roche, S., Fry, M.J., Gout, I., Totty, N.F., Truong, O., Vicendo, P., Yonezawa, K. and et al. (1994) PI 3-kinase is a dual specificity enzyme: autoregulation by an intrinsic protein-serine kinase activity. EMBO Journal, ^3, 522-533. Di Cunto, F., Calautti, E., Hsiao, J., Ong, L., Topley, G., Turco, E. and Dotto, G.P. (1998) Citron rho-interacting kinase, a novel tissue-specific ser/thr kinase encompassing the Rho-Rac-binding protein Citron. J Biol Chem, 273, 29706- 29711. Dickson, B., Sprenger, F., Morrison, D. and Hafen, E. (1992) Raf functions downstream of Rasi in the Sevenless signal transduction pathway [see comments]. N a tu re , 360, 600-603.

226 Chapter Seven - Bibliography

Diekmann, D., Abo, A., Johnston, C., Segal, A.W. and Hall, A. (1994) Interaction of Rac with p67phox and regulation of phagocytic NADPH oxidase activity. Science, 265, 531-533. Diekmann, D., Brill, S., Garrett, M.D., Totty, N., Hsuan, J., Monfries, C., Hall, C., Lim, L and Hall, A. (1991) Bcr encodes a GTPase-activating protein for p21 rac. Nature, 35A, 400-402. Dobrowolski, S., Harter, M. and Stacey, D.W. (1994) Cellular ras activity is required for passage through multiple points of the G0/G1 phase in BALB/c 3T3 cells. Molecular & Cellular Biology, 14, 5441-5449. Dowdy, S.F., Hinds, P.W., Louie, K., Reed, S.I., Arnold, A. and Weinberg, R.A. (1993) Physical interaction of the retinoblastoma protein with human D cyclins. Cell, 7 3, 499-511. Downward, J. (1998) Mechanisms and consequences of activation of protein kinase B/Akt. Current Opinion In Cell Biology, 10, 262-267. Downward, J., Graves, J.D., Warne, P.H., Rayter, S. and Cantrell, DA. (1990) Stimulation of p2Iras upon T-cell activation [see comments]. Nature, 346, 71 9- 723. Drugan, J.K., Khosravi-Far, R., White, M.A., Der, C.J., Sung, Y.J., Hwang, Y.W. and Campbell, S.L. (1996) Ras interaction with two distinct binding domains in Raf-1 may be required for Ras transformation. J Biol Chem, 271, 233-237. Duchesne, M., Schweighoffer, F., Parker, F., Clerc, F., Frobert, Y., Thang, M.N, and Tocque, B. (1993) Identification of the SH3 domain of GAP as an essential sequence for Ras-GAP-mediated signaling. S cien ce, 259, 525-528. Dudek, H., Datta, S.R., Franke, T.F., Birnbaum, M.J., Yao, R., Cooper, G.M., Segal, R.A., Kaplan, D.R. and Greenberg, M.E. (1997) Regulation of neuronal survival by the serine-threonine protein kinase Akt [see comments). Science, 275, 661-665. Duff, J.L., Monia, B.P. and Berk, B.C. (1995) Mitogen-activated protein (MAP) kinase is regulated by the MAP kinase phosphatase (MKP-1) in vascular smooth muscle cells. Effect of actinomycin D and antisense oligonucleotides. J Biol Chem, 270, 7161-7166. Dulic, V., Drullinger, L.F., Lees, E., Reed, S.I. and Stein, G.H. (1993) Altered regulation of G1 cyclins in senescent human diploid fibroblasts: accumulation of inactive cyclin E-Cdk2 and cyclin D1-Cdk2 complexes.Proceedings of the National Academy of Sciences of the United States of America, 90, 11034-11038. Dulic, V., Kaufmann, W.K., Wilson, S.J., TIsty, T.D., Lees, E., Harper, J.W., Elledge, S.J. and Reed, S.I. (1994) p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell, 76, 1013-1023. Dulic, V., Lees, E. and Reed, S.l. (1992) Association of human cyclin E with a periodic G1-S phase protein kinase. Science, 257, 1958-1961. Duronio, R.J., Brook, A., Dyson, N. and O'Farrell, P.H. (1996) E2F-induced S phase requires cyclin E. G enes Dev, 10, 2505-2513. Duronio, R.J. and O'Farrell, P.H. (1995) Developmental control of the G1 to S transition in Drosophila: cyclin Eis a limiting downstream target of E2F. Genes Dev, 9, 1456-1468. Egan, S.E., Giddings, B.W., Brooks, M.W., Buday, L., Sizeland, A.M. and Weinberg, R.A. (1993) Association of Sos Ras exchange protein with Grb2 is implicated in tyrosine kinase signal transduction and transformation [see comments). Nature, 363, 45-51.

227 Chapter Seven - Bibliography el-Deiry, W.S. (1998) p21/p53, cellular growth control and genomic integrity. Current Topics in Microbiology & immunology, 227, 121-137. el-Deiry, W.S., Harper, J.W., O'Connor, P.M., Velculescu, V.E., Canman, G.E., Jackman, J., Pietenpol, J.A., Burrell, M., Hill, D.E., Wang, Y. and et al. (1994) WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis. Cancer Research, 54, 1169-1174. el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M., Lin, D., Mercer, W.E., Kinzler, K.W. and Vogelstein, B. (1993) WAF1, a potential mediator of p53 tumor suppression, Celi, 75, 817-825. Elbendary, A., Berchuck, A., Davis, P., Havrilesky, L., Bast, R.C., Jr., Iglehart, J.D. and Marks, J.R. (1994) Transforming growth factor beta 1 can induce CIP1/WAF1 expression independent of the p53 pathway in ovarian cancer cells. Cell Growth D iffer, 5, 1301-1307. Ellis, R.W., Defeo, D., Shih, T.Y., Gonda, M.A., Young, H.A., Tsuchida, N., Lowy, D.R. and Scolnick, E.M. (1981) The p21 src genes of Harvey and Kirsten sarcoma viruses originate from divergent members of a family of normal vertebrate genes. Nature, 292, 506-511. Engel, K., Ahlers, A., Brach, M.A., Herrmann, F. and Gaestel, M. (1995) MAPKAP kinase 2 is activated by heat shock and TNF-alpha: in vivo phosphorylation of small heat shock protein results from stimulation of the MAP kinase cascade. J Ceil Biochem, 57, 321-330. Erhardt, J.A. and Pittman, R.N. (1998) Ectopic p21(WAF1) expression induces differentiation-specific cell cycle changes in PCI2 cells characteristic of nerve growth factor treatment. J Bioi Chem, 273, 23517-23523. Eva, A. and Aaronson, S.A. (1983) Frequent activation of c-kis as a transforming gene in fibrosarcomas induced by methylcholanthrene. S cien ce, 220, 955-956. Evan, G.I., Lewis, G.K., Ramsay, G. and Bishop, J.M. (1985) Isolation of monoclonal antibodies specific for human c-myc proto- oncogene product. Mol Cell Biol, 5, 3610-3616. Fabian, J.R., Vojtek, A.B., Cooper, J.A. and Morrison, D.K. (1994) A single amino acid change in Raf-1 inhibits Ras binding and alters Raf-1 function. Proceedings of the National Academy of Sciences of the United States of America, 91, 5982-5986. Fam, N.P., Fan, W.T., Wang, Z.X., Zhang, L.J., Chen, H. and Moran, M.F. (1 997) Cloning and characterization of ras-grf2, a novel guanine-nucleotide exchange factor for ras. Mol Ceil Bioi, 17, 1396-1406. Fan, Z., Lu, Y., Wu, X., DeBlasio, A., Koff, A. and Mendelsohn, J. (1995) Prolonged induction of p21Cip1/WAF1/CDK2/PCNA complex by epidermal growth factor receptor activation mediates ligand-induced A431 cell growth inhibition. J Cell Biol, 131, 235-242. Fanger, G.R., Johnson, N.L. and Johnson, G.L (1997) MEK kinases are regulated by EGF and selectively interact with Rac/Cdc42. Embo J, 16, 4961-4972. FantI, W.J., Muslin, A.J., Kikuchi, A., Martin, J.A., MacNicol, A.M., Gross, R.W. and Williams, L.T. (1994) Activation of Raf-1 by 14-3-3 proteins. Nature, 371 , 612-614. Farnsworth, C.L., Freshney, N.W., Rosen, L.B., Ghosh, A., Greenberg, M.E. and Feig, L.A. (1995) Calcium activation of Ras mediated by neuronal exchange factor Ras- GRF. N ature, 376, 524-527. Farrar, M.A., Alberol, I. and Perlmutter, R.M. (1996) Activation of the Raf-1 kinase cascade by coumermycin-induced dimerization. Nature, 383, 178-181.

228 Chapter Seven - Bibliography

Feig, LA. and Cooper, G.M. (1988) Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol Cell Biol, 8, 32 35- 3243. Feramisco, J.R., Gross, M., Kamata, T., Rosenberg, M. and Sweet, R.W. (1984) Microinjection of the oncogene form of the human H-ras (T-24) protein results in rapid proliferation of quiescent cells. Ce//, 38, 109-117. Fero, M.L., Rivkin, M., Tasch, M., Porter, P., Carow, G.E., Firpo, E., Polyak, K., Tsai, L.H., Broudy, V., Perlmutter, R.M., Kaushansky, K. and Roberts, J.M. (1996) A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell, 85, 733-744. Field, S.J., Tsai, F.Y., Kuo, F., Zubiaga, A.M., Kaelin, W.G., Jr., Livingston, D.M., Orkin, S.H. and Greenberg, M.E. (1996) E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell, 85, 549-561. Filmus, J., Robles, A.I., Shi, W., Wong, M.J., Colombo, L.L. and Conti, C.J. (1994) Induction of cyclin DI overexpression by activated ras. O ncogene, 9, 3627-3633. Finkel, T. (1998) Oxygen radicals and signaling. Curr Opin Cell Biol, 10, 2 48- 253. Finlin, B.S. and Andres, D.A. (1997) Rem is a new member of the Rad- and Gem/Kir Ras-related GTP-binding protein family repressed by lipopolysaccharide stimulation. J Biol Chem, 272, 21982-21988. Fischer, R., Wei, Y., Anagli, J. and Berchtold, M.W. (1996) Calmodulin binds to and inhibits GTP binding of the ras-like GTPase Kir/Gem. J Biol Chem, 27 A , 25067- 25070. Flatau, G., Lemichez, E., Gauthier, M., Chardin, P., Paris, S., Fiorentini, C. and Boquet, P. (1997) Toxin-induced activation of the g-protein p21-rho by deamidation of glutamine. Nature, 387, 729-733. Florenes, V.A., Bhattacharya, N., Bani, M.R., Ben-David, Y., Kerbel, R.S. and Slingerland, J.M. (1996) TGF-beta mediated G1 arrest in a human melanoma cell line lacking p15INK4B: evidence for cooperation between p21Cip1A/VAF1 and p27Kip1. O n co g en e, 13, 2447-2457. Foschi, M., Chari, S., Dunn, M.J. and Sorokin, A. (1997) Biphasic activation of p21ras by endothelin-1 sequentially activates the ERK cascade and phosphatidylinositol 3-kinase. Embo J, 16, 6439-6451. Fotedar, R., Fitzgerald, P., Rousselle, T., Cannella, D., Doree, M., Messier, H. and Fotedar, A. (1996) p21 contains independent binding sites for cyclin and cdk2: both sites are required to inhibit cdk2 kinase activity. O n co g en e, 12, 2155-2164. Franke, T.F., Kaplan, D.R. and Cantley, L.C. (1997) PI3K: downstream AKTion blocks apoptosis. Cell, 88, 435-437. Frevert, E.U. and Kahn, B.B. (1997) Differential effects of constitutively active phosphatidylinositol 3-kinase on glucose transport, glycogen synthase activity, and DNA synthesis in 3T3-L1 adipocytes. Molecular & Cellular Biology, 17, 190-198. Friend, S.H., Bernards, R., Rogelj, S., Weinberg, R.A., Rapaport, J.M., Albert, D.M. and Dryja, T.P. (1986) A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature, 323, 643-646. Frost, J.A., Steen, H., Shapiro, P., Lewis, T., Ahn, N., Shaw, P.E. and Cobb, M.H. (1997) Cross-cascade activation of ERKs and ternary complex factors by Rho family proteins. Em bo J, 16, 6426-6438.

229 Chapter Seven - Bibliography

Frost, J.A., Xu, S., Hutchison, M.R., Marcus, S. and Cobb, M.H. (1996) Actions of Rho family small G proteins and p21-activated protein kinases on mitogen-activated protein kinase family members. Molecular & Cellular Biology, ^6, 3707-3713. Fruman, D.A., Meyers, R.E. and Cantley, L.C. (1998) Phosphoinositide kinases. Annu Rev Biochem, 67, 481-507. Fu, H., Xia, K., Pallas, D.C., Cui, C., Conroy, K., Narsimhan, R.P., Mamon, H., Collier, R.J. and Roberts, T.M. (1994) Interaction of the protein kinase Raf-1 with 14-3-3 proteins [see comments]. Science, 266, 126-129. Fujisawa, K., Fujita, A., Ishizaki, T., Saito, Y. and Narumiya, S. (1996) Identification of the Rho-binding domain of p160ROCK, a Rho-associated coiled-coil containing protein kinase. Journal of Biological Chemistry, 271, 23022-23028. Fukui, M,, Yamamoto, T., Kawai, S., Maruo, K. and Toyoshima, K. (1985) Detection of a raf-related and two other transforming DNA sequences in human tumors maintained in nude mice. Proceedings of the National Academy of Sciences of the United States of America, 82, 5954-5958. Fukumoto, Y., Kaibuchi, K., Hori, Y., Fujioka, H., Araki, S., Ueda, T., Kikuchi, A. and Takai, Y. (1990) Molecular cloning and characterization of a novel type of regulatory protein (GDI) for the rho proteins, ras p21-like small GTP-binding proteins. O n co g en e, 5, 1321-1328. Funaoka, K., Shindoh, M., Yoshida, K., Hanzawa, M., Hida, K., Nishikata, S., Totsuka, Y. and Fujinaga, K. (1997) Activation of the p21 (Wafl/Cipl ) promoter by the ets oncogene family transcription factor E1AF. Biochem Biophys Res Commun, 2 36, 79-82. Funk, J.O., Waga, S., Harry, J.B., Espling, E., Stillman, B. and Galloway, D.A. (1997) Inhibition of CDK activity and PCNA-dependent DNA replication by p21 is blocked by interaction with the HPV-16 E7 oncoprotein. Genes Dev, 11, 20 90- 2100. Gale, N.W., Kaplan, S., Lowenstein, E.J., Schlessinger, J. and Bar-Sagi, D. (1 993) Grb2 mediates the EGF-dependent activation of guanine nucleotide exchange on Ras [see comments]. N ature, 363, 88-92. Gao, X., Chen, Y.Q., Wu, N., Grignon, D.J., Sakr, W., Porter, A.T. and Honn, K.V. (1995) Somatic mutations of the WAF1/CIP1 gene in primary prostate cancer. O n co g en e, AA, 1395-1398. Gauthier-Rouviere, C., Cai, Q.Q., Lautredou, N., Fernandez, A., Blanchard, J.M. and Lamb, N.J. (1993) Expression and purification of the DNA-binding domain of SRF: SRF-DB, a part of a DNA-binding protein which can act as a dominant negative mutant in vivo. Exp Cell Res, 209, 208-215. Gauthier-Rouviere, C., Cavadore, J.C., Blanchard, J.M., Lamb, N.J. and Fernandez, A. (1991) p67SRF is a constitutive nuclear protein implicated in the modulation of genes required throughout the G1 period. Cell Regulation, 2, 575-588. Gauthier-Rouviere, C., Fernandez, A. and Lamb, N.J. (1990) ras-induced c-fos expression and proliferation in living rat fibroblasts involves C-kinase activation and the serum response element pathway. EMBO Journal, 9, 171-180. Genot, E., Cleverley, S., Henning, S. and Cantrell, D. (1996) Multiple p21 ras effector pathways regulate nuclear factor of activated T cells. Embo J, 15, 392 3- 3933. Genot, E., Reif, K., Beach, S., Kramer, I. and Cantrell, D. (1998) P21 ras initiates rac-1 but not phosphatidyl-inositol-3 kinase pkb, mediated signaling pathways in T-lymphocytes. O n co g en e, 17, 1731-1738,.

230 Chapter Seven - Bibliography

Gerwins, P., Blank, J.L and Johnson, G.L (1997) Cloning of a novel mitogen- activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. J Biol Chem, 272, 8288-8295. Ghosh, S., Xie, W.Q., Quest, A.F., Mabrouk, G.M., Strum, J.C. and Bell, R.M. (1994) The cysteine-rich region of raf-1 kinase contains zinc, translocates to liposomes, and is adjacent to a segment that binds GTP-ras. J Biol Chem, 269, 10000-10007. Giancotti, F.G. (1997) Integrin signaling; specificity and control of cell survival and cell cycle progression. Curr Opin Cell Biol, 9, 691-700. Giancotti, F.G. and Mainiero, F. (1994) Integrin-mediated adhesion and signaling in tumorigenesis. Biochim Biophys Acfa, 1198, 47-64. Girard, F., Strausfeld, U., Fernandez, A. and Lamb, N.J. (1991) Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell, 67, 1169-1179. Glaven, J., Whitehead, I., Kay, R. and Cerione, R. (1996) Lfc and Isc are guanine- nucleotide exchange factors for the rho-GTP-binding protein. Mol Biol Cell, 7, 3055-3055. Godowski, P.J., Picard, D. and Yamamoto, K.R. (1988) Signal transduction and transcriptional regulation by glucocorticoid receptor-LexA fusion proteins. Science, 241, 812-816. Gomez, J., Garcia, A., R, B.L., Bonay, P., Martinez, A.C., Silva, A., Fresno, M., Carrera, A.C., Eicher, S.C. and Rebollo, A, (1997) IL-2 signaling controls actin organization through Rho-like protein family, phosphatidylinositol 3-kinase, and protein kinase C-zeta. J Immunol, 158, 1516-1522. Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline- responsive promoters. Proc Natl Acad Sci U S A, 69, 55 47- 5551. Gosser, Y.Q., Nomanbhoy, T.K., Aghazadeh, B., Manor, D., Combs, C., Cerione, R.A. and Rosen, M.K. (1997) C-terminal binding domain of rho gdp-dissociation inhibitor directs n-terminal inhibitory peptide to GTPases. N ature, 387, 814-819. Gotoh, Y., Matsuda, S., Takenaka, K., Hattori, S., Iwamatsu, A., Ishikawa, M., Kosako, H. and Nishida, E. (1994) Characterization of recombinant Xenopus MAP kinase kinases mutated at potential phosphorylation sites. Oncogene, 9, 1891-1898. Gotoh, Y., Nishida, E. and Sakai, H. (1990) Okadaic acid activates microtubule- associated protein kinase in quiescent fibroblastic cells. Eur J Biochem, 193, 671 - 674. Graf, T., von Weizsaecker, F., Grieser, S., Coll, J., Stehelin, D., Patschinsky, T., Bister, K., Bechade, C., Calothy, G. and Leutz, A. (1986) v-mil induces autocrine growth and enhanced tumorigenicity in v-myc-transformed avian macrophages. Cell, 45, 357-364. Graham, S.M., Cox, A.D., Drivas, G., Rush, M.G., D'Eustachio, P. and Der, C.J. (1994) Aberrant function of the Ras-related protein TC21/R-Ras2 triggers malignant transformation. Mol Cell Biol, 4108-4115. Grammar, T.C. and Blenis, J. (1997) Evidence for mek-independent pathways regulating the prolonged activation of the erk-map kinases. Oncogene, 14, 16 35- 1642. Grammar, T.C., Cheatham, L., Chou, M.M. and Blenis, J. (1996) The p70S6K signalling pathway: a novel signalling system involved in growth regulation. Cancer Surv, 27, 271-292.

231 Chapter Seven - Bibliography

Graziano, S.L, Cowan, B.Y., Carney, D.N., Bryke, C.R., Mitter, N.S., Johnson, B.E., Mark, G.E., Planas, A.T., Catino, J.J., Comis, R.L. and et al. (1987) Small cell lung cancer cell line derived from a primary tumor with a characteristic deletion of 3p. C ancer Res, 47, 2148-2155. Gu, Y., Rosenblatt, J. and Morgan, D.O. (1992) Cell cycle regulation of CDK2 activity by phosphorylation of Thr160 and Tyr15. Embo J, 11, 3995-4005. Gu, Y., Turck, C.W. and Morgan, D.O. (1993) Inhibition of CDK2 activity in vivo by an associated 20K regulatory subunit. Nature, 366, 707-710. Guadagno, T.M. and Assoian, R.K. (1991) G1/S control of anchorage-independent growth in the fibroblast cell cycle. J Cell Biol, 115, 1419-1425. Guadagno, T.M., Ohtsubo, M., Roberts, J.M. and Assoian, R.K. (1993) A link between cyclin A expression and adhesion-dependent cell cycle progression [published erratum appears in Science 1994 Jan 28;263(5146);455j. Science, 262, 1 572- 1575. Guan, K.L., Jenkins, C.W., Li, Y., Nichols, M.A., Wu, X., O'Keefe, C.L., Matera, A.G. and Xiong, Y. (1994) Growth suppression by p18, a p16INK4/MTS1- and p14INK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function. G en es Dev, 8, 2939-2952. Guan, K.L., Jenkins, C.W., Li, Y., O'Keefe, C.L., Noh, S., Wu, X., Zariwala, M., Matera, AG. and Xiong, Y. (1996) Isolation and characterization of p19INK4d, a p16-related inhibitor specific to CDK6 and CDK4. Mol Biol Cell, 7, 57-70. Guerrero, I., Calzada, P., Mayer, A. and Pellicer, A. (1984) A molecular approach to leukemogenesis: mouse lymphomas contain an activated c-ras oncogene. Proc Natl Acad Sci U S A, 8^, 202-205. Gulbins, E., Coggeshall, K.M., Baier, G., Katzav, S., Burn, P. and Altman, A. (1 993) Tyrosine kinase-stimulated guanine nucleotide exchange activity of Vav in T cell activation [see comments]. S cien ce, 260, 822-825. Gulbins, E., Coggeshall, K.M., Langlet, C., Baler, G., Bonnefoy-Berard, N., Burn, P., Wittinghofer, A., Katzav, S. and Altman, A. (1994) Activation of Ras in vitro and in intact fibroblasts by the Vav guanine nucleotide exchange protein. Mol Cell Biol, 1 4, 906-913. Habets, G.G., Scholtes, E.H., Zuydgeest, P., van der Kammen, R.A., Stam, J.C., Berns, A. and Collard, J.G. (1994) Identification of an invasion-inducing gene, Tiam-1, that encodes a protein with homology to GDP-GTP exchangers for Rho-like proteins. Cell, 77, 537-549. Hafner, S., Adler, H.S., Mischak, H., Janosch, P., Heidecker, G., Wolfman, A., Pippig, S., Lohse, M., Ueffing, M. and Kolch, W. (1994) Mechanism of inhibition of Raf-1 by protein kinase A. Mol Cell Biol, 14, 6696-6703. Hajj, 0., Akoum, R., Bradley, E., Paquin, F. and Ayoub, J. (1990) DNA alterations at proto-oncogene loci and their clinical significance in operable non-small cell lung cancer. C ancer, 66, 733-739. Hall, A., Marshall, G.J., Spurr, N.K. and Weiss, R.A. (1983) Identification of transforming gene in two human sarcoma cell lines as a new member of the ras gene family located on chromosome 1. Nature, 303, 396-400. Han, J., Das, B., Wei, W., Van Aelst, L., Mosteller, R.D., Khosravi-Far, R., Westwick, J.K., Der, C.J. and Broek, D. (1997) Lck regulates Vav activation of members of the Rho family of GTPases. Mol Cell Biol, 17, 1346-1353.

232 Chapter Seven - Bibliography

Han, J., Luby-Phelps, K., Das, B., Shu, X., Xia, Y., Mosteller, R.D., Krishna, U.M., Faick, J.R., White, M.A. and Broek, D. (1998) Role of substrates and products of PI 3-kinase in regulating activation of Rac-related guanosine triphosphatases by Vav. S c ie n c e , 279, 558-560. Han, M., Golden, A., Han, Y. and Sternberg, P.W. (1993) C. elegans lin-45 raf gene participates in let-60 ras-stimulated vulval differentiation. Nature, 3S3, 133- 140. Hancock, J.F. and Hall, A. (1993) A novel role for RhoGDI as an inhibitor of GAP proteins. Em bo J, 12, 1915-1921. Hannon, G.J. and Beach, D. (1994) p15INK4B is a potential effector of TGF-beta- induced cell cycle arrest [see comments]. Nature, 371, 257-261. Hara, K., Yonezawa, K., Sakaue, H., Ando, A., Kotani, K., Kitamura, T., Kitamura, Y., Ueda, H., Stephens, L., Jackson, T.R. and et al. (1994) 1-Phosphatidylinositol 3 - kinase activity is required for insulin- stimulated glucose transport but not for RAS activation in CHO cells. Proc Natl Acad Sci U S A, 9^, 7415-7419. Harden, N., Lee, J., Loh, H.Y., Ong, Y.M., Tan, I., Leung, T., Manser, E. and Lim, L. (1996) A Drosophila homolog of the Rac- and Cdc42-activated serine/threonine kinase PAK is a potential focal adhesion and focal complex protein that colocalizes with dynamic actin structures. Molecular & Cellular Biology, 16, 1896-1908. Harper, J.W., Adami, G.R., Wei, N., Keyomarsi, K. and Elledge, S.J. (1993) The p21 Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclin- dependent kinases. C e l l ,7 5 , 805-816. Harper, J.W. and Elledge, S.J. (1998) The role of Cdk7 in CAK function, a retro- retrospective. G enes Dev, 12, 285-289. Harper, J.W., Elledge, S.J., Keyomarsi, K., Dynlacht, B., Tsai, L.H., Zhang, P., Dobrowolski, S., Bai, C., Connell, C.L., Swindell, E. and et, a.i. (1995) Inhibition of cyclin-dependent kinases by p21.Molecular Biology of the Cell, 6, 387-400. Hart, M.J., Eva, A., Evans, T., Aaronson, S.A. and Cerione, R.A. (1991a) Catalysis of guanine nucleotide exchange on the CDC42Hs protein by the dbl oncogene product. Nature, 354, 311-314. Hart, M.J., Eva, A., Zangrilli, D., Aaronson, S.A., Evans, T., Cerione, R.A. and Zheng, Y. (1994) Cellular transformation and guanine nucleotide exchange activity are catalyzed by a common domain on the dbl oncogene product. J Biol Chem, 2 6 9, 6 2 - 65. Hart, M.J., Jiang, X., Kozasa, T., Roscoe, W., Singer, W.D., Gilman, A.G., Sternweis, P C. and Bollag, G. (1998) Direct stimulation of the guanine nucleotide exchange activity of pi 15 RhoGEF by Galpha13. Science, 230, 2112-2114. Hart, M.J., Maru, Y., Leonard, D., Witte, O.N., Evans, T. and Cerione, R.A. (1992) A GDP dissociation inhibitor that serves as a GTPase inhibitor for the Ras-like protein CDC42HS. Science, 253, 812-815. Hart, M.J., Sharma, S., elMasry, N., Qiu, R.G., McCabe, P., Polakis, P. and Bollag, G (1996) Identification of a novel guanine nucleotide exchange factor for the Rho GTPase. J Biol Chem, 271, 25452-25458. Hart, M.J., Shinjo, K., Hall, A., Evans, T. and Cerione, R.A. (1991b) Identification of the human platelet GTPase activating protein for the CDC42Hs protein. J Biol Chem, 266, 20840-20848. Harvey, J.J. (1964) An unidentified virus which causes the rapid production of tumours in mice. Nature, 204, 1104-1105.

233 Chapter Seven - Bibliography

Hatakeyama, M., Brill, J.A., Fink, G.R. and Weinberg, R A (1994) Collaboration of G1 cyclins in the functional inactivation of the retinoblastoma protein. G enes Dev, 8, 1759-1771. Hawkins, P.T., Eguinoa, A., Qiu, R.G., Stokoe, D., Cooke, F.T., Walters, R., Wennstrom, S., Claesson, W.L., Evans, T., Symons, M. and et, a.i. (1995) PDGF stimulates an increase in GTP-Rac via activation of phosphoinositide 3-kinase. Current Biology, 5, 393-403. Haystead, T.A., Weiel, J.E., Litchfield, D.W., Tsukitani, Y., Fischer, E.H. and Krebs, E.G. (1990) Okadaic acid mimics the action of insulin in stimulating protein kinase activity in isolated adipocytes. The role of protein phosphatase 2a in attenuation of the signal. J Biol Chem, 265, 16571-16580. He, J., Allen, J.R., Collins, V.P., Allalunis-Turner, M.J., Godbout, R., Day, R.S.r. and James, C D. (1994) CDK4 amplification is an alternative mechanism to pi 6 gene homozygous deletion in glioma cell lines. Cancer Res, 54, 5804-5807. Heidecker, G., Huleihel, M., Cleveland, J.L., Kolch, W., Beck, T.W., Lloyd, P., Pawson, T. and Rapp, D.R. (1990) Mutational activation of c-raf-1 and definition of the minimal transforming sequence. Mol Cell Biol, 10, 2503-2512. Helin, K. (1998) Regulation of cell proliferation by the E2F transcription factors. Curr Opin Genet Dev, 8, 28-35. Hengst, L., Gopfert, U., Lashuel, H. and Reed, S. (1998) Complete inhibition of Cdk/cyclin by one molecule of p21Cip1. Genes and Development, 12, 3882-3888. Hengst, L. and Reed, S.l. (1996) Translational control of p27Kip1 accumulation during the cell cycle. Science, 27^, 1861-1864. Hermeking, H., Funk, J.O., Reichert, M., Ellwart, J.W. and Eick, D. (1995) Abrogation of p53-induced cell cycle arrest by c-Myc: evidence for an inhibitor of P21WAF1/CIP1/SDI1. O n c o g e n e , 1409-1415. Hesketh, R. (1997) The oncogenes and tumour supressor gene facts book. Academic Press. Higashi, H., Suzuki-Takahashi, L, Saitoh, S., Segawa, K., Taya, Y., Okuyama, A,, Nishimura, S. and Kitagawa, M. (1996) Cyclin-dependent kinase-2 (Cdk2) forms an inactive complex with cyclin DI since Cdk2 associated with cyclin DI is not phosphorylated by Cdk7- cyclin-H. Eur J Biochem, 237, 460-467. Hildebrand, J.D., Taylor, J.M. and Parsons, J.T. (1996) An SH3 domain-containing GTPase-activating protein for Rho and Cdc42 associates with focal adhesion kinase. Mol Cell Biol, 16, 3169-3178. Hill, C.S. and Treisman, R. (1995) Differential activation of c-fos promoter elements by serum, lysophosphatidic acid, G proteins and polypeptide growth factors. Em bo J, 14, 5037-5047. Hill, C.S., Wynne, J. and Treisman, R. (1995) The Rho family GTPases RhoA, Rad, and CDC42HS regulate transcriptional activation by SRF. Ce//, 81, 1159-1170. Hinds, P.W., Mittnacht, S., Dulic, V., Arnold, A., Reed, S.l. and Weinberg, R.A. (1992) Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell, 70, 993-1006. Hirai, H., Roussel, M.F., Kato, J.Y., Ashmun, R.A. and Sherr, C.J. (1995) Novel INK4 proteins, pi 9 and pi8, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. Mol Cell Biol, 15, 2672-2681.

234 Chapter Seven - Bibliography

Hiyama, H., lavarone, A., LaBaer, J. and Reeves, S A (1997) Regulated ectopic expression of cyclin DI induces transcriptional activation of the cdk inhibitor p21 gene without altering cell cycle progression. O ncogene, 14, 2533-2542. Hofer, F., Fields, S., Schneider, C. and Martin, G.S. (1994) Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator. Proceedings of the National Academy of Sciences of the United States of America, 91, 11089-11093. Hoffmann, I., Draetta, G. and Karsenti, E. (1994) Activation of the phosphatase activity of human cdc25A by a cdk2-cyclin E dependent phosphorylation at the G1/S transition. Em bo J, 13, 4302-4310. Hofmann, F. and Livingston, D.M. (1996) Differential effects of cdk2 and cdk3 on the control of pRb and E2F function during G1 exit. G enes Dev, 10, 851-861. Homma, Y. and Emori, V. (1995) A dual functional signal mediator showing RhoGAP and phospholipase C- delta stimulating activities. Em bo J, 14, 286-291. Hordijk, P.L., ten Klooster, J.P., van der Kammen, R A , Michiels, F., Oomen, L.C. and Collard, J.G. (1997) Inhibition of invasion of epithelial cells by Tiaml-Rac signaling. Science, 278, 1464-1466. Horii, Y., Beeler, J.F., Sakaguchi, K., Tachibana, M. and Miki, T. (1994) A novel oncogene, ost, encodes a guanine nucleotide exchange factor that potentially links Rho and Rac signaling pathways. EMBO J, 13, 4776-4786. Hotchin, N.A. and Hall, A. (1995) The assembly of integrin adhesion complexes requires both extracellular matrix and intracellular rho/rac GTPases. J Cell Biol, 431, 1857-1865. Hotchin, N.A. and Hall, A. (1996) Regulation of the actin cytoskeleton, integrins and cell growth by the Rho family of small GTPases. [Review] [73 refs]. Cancer Surveys, 2 7 , 311-322. Hotta, K., Tanaka, K., Mino, A., Kohno, H. and Takai, Y. (1996) Interaction of the Rho family small G proteins with kinectin, an anchoring protein of kinesin motor. Biochem Biophys Res Commun, 225, 69-74. Howe, L.R., Leevers, S.J., Gomez, N., Nakielny, S., Cohen, P. and Marshall, C.J. (1992) Activation of the MAP kinase pathway by the protein kinase raf. Ceil, 71 , 335-342. Hu, C.D., Kariya, K., Tamada, M., Akasaka, K., Shirouzu, M., Yokoyama, S. and Kataoka, T. (1995a) Cysteine-rich region of Raf-1 interacts with activator domain of post- translationally modified Ha-Ras. J Biol Chem, 270, 30274-30277. Hu, K.Q. and Settleman, J. (1997) Tandem SH2 binding sites mediate the RasGAP- RhoGAP interaction: a conformational mechanism for SH3 domain regulation. Embo J, 16, 473-483. Hu, Q., Klippel, A., Muslin, A.J., FantI, W.J. and Williams, L.T. (1995b) Ras- dependent induction of cellular responses by constitutively active phosphatidylinositol-3 kinase. S c ie n c e , 268, 100-102. Huleihel, M., Goldsborough, M., Cleveland, J., Gunnell, M., Bonner, T. and Rapp, U.R. (1986) Characterization of murine A-raf, a new oncogene related to the v-raf oncogene. Molecular & Cellular Biology, 6, 2655-2662. Huwiler, A., Brunner, J., Hummel, R., Vervoordeldonk, M., Stabel, S., van den Bosch, H. and Pfeilschifter, J. (1996) Ceramide-binding and activation defines protein kinase c-Raf as a ceramide-activated protein kinase. Proc Natl Acad Sci U S A, 93, 6959-6963.

235 Chapter Seven - Bibliography

Ikawa, S., Fukui, M., Ueyama, Y., Tamaoki, N., Yamamoto, T. and Toyoshima, K. (1988) B-raf, a new member of the raf family, is activated by DNA rearrangement. Molecular & Cellular Biology, 8, 2651-2654. Inoue, H., Yamashita, A. and Hakura, A. (1996) Adhesion-dependency of serum- induced p42/p44 MAP kinase activation is released by retroviral oncogenes. V irology, 225, 223-226. Irani, K., Xia, Y., Zweier, J.L, Sollott, S.J., Der, C.J., Fearon, E.R., Sundaresan, M., Finkel, T. and Goldschmidt, C.P. (1997) Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts [see comments]. Science, 275, 1649-1652. Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A., Fujita, A., Watanabe, N., Saito, Y., Kakizuka, A., Morii, N. and Narumiya, S. (1996) The small GTP-binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic dystrophy kinase. EMBO Journal, 15, 1885-1893. Jahner, D. and Hunter, T. (1991) The ras-related gene rhoB is an immediate-early gene inducible by v- Fps, epidermal growth factor, and platelet-derived growth factor in rat fibroblasts. Mol Cell Biol,^^, 3682-3690. Jeffrey, P.D., Russo, A.A., Polyak, K., Gibbs, E., Hurwitz, J., Massague, J. and Pavletich, N.P. (1995) Mechanism of CDK activation revealed by the structure of a cyclinA-CDK2 complex [see comments]. Nature, 376, 313-320. Jhun, B.H., Rose, D.W., Seely, B.L., Rameh, L., Cantley, L., Saltiel, A.R. and Olefsky, J.M. (1994) Microinjection of the SH2 domain of the 85-kilodalton subunit of phosphatidylinositol 3-kinase inhibits insulin-induced DNA synthesis andc-fos expression. Molecular & Cellular Biology, 14, 7466-7475. Jiang, H., Lin, J., Su, Z.Z., Herlyn, M., Kerbel, R.S., Weissman, B.E., Welch, D.R. and Fisher, P.B. (1995a) The melanoma differentiation-associated gene mda-6, which encodes the cyclin-dependent kinase inhibitor p21, is differentially expressed during growth, differentiation and progression in human melanoma cells. Oncogene, 10, 1855-1864. Jiang, H., Luo, J.Q., Urano, T., Frankel, P., Lu, Z., Foster, D.A. and Feig, L.A. (1995b) Involvement of Ral GTPase in v-Src-induced phospholipase D activation. N a tu re , 378, 409-412. Jimenez, C., Jones, D.R., Rodriguez-Viciana, P., Gonzalez-Garcia, A., Leonardo, E., Wennstrom, S., von Kobbe, C., Toran, J.L., R-Borlado, L., Calvo, V., Copin, S.G., Albar, J.P., Caspar, M.L., Diez, E., Marcos, M.A., Downward, J., Martinez, A.C., Merida, I. and Carrera, A.C. (1998) Identification and characterization of a new oncogene derived from the regulatory subunit of phosphoinositide 3-kinase. EMBO Jo u rn a l, 17, 743-753. Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H. and Okayama, H. (1994) Cdc25A is a novel phosphatase functioning early in the cell cycle. Embo J, 13, 1549-1556. Joly, M., Kazlauskas, A. and Corvera, S. (1995) Phosphatidylinositol 3-kinase activity is required at a postendocytic step in platelet-derived growth factor receptor trafficking. J Biol Chem, 270, 13225-13230. Joly, M., Kazlauskas, A., Fay, F.S. and Corvera, S. (1994) Disruption of PDGF receptor trafficking by mutation of its PI-3 kinase binding sites. Science, 263, 684-687. Joneson, T. and Bar-Sagi, D. (1998) Arad effector site controlling mitogenesis through superoxide production. J Bioi Chem, 273, 17991-17994.

236 Chapter Seven - Bibliography

Joneson, T., McDonough, M., Bar-Sagi, D. and Van Aelst, L. (1996a) RAC regulation of actin polymerization and proliferation by a pathway distinct from Jun kinase [published erratum appears in Science 1997 Apr 11 ;276(5310):185]. Science, 274, 1374-1376. Joneson, T., White, M.A., Wigler, M.H. and Bar Sagi, D. (1996b) Stimulation of membrane ruffling and MAP kinase activation by distinct effectors of RAS. Science, 271, 810-812. Jullien-Flores, V,, Dorseuil, O., Romero, F., Letourneur, F., Saragosti, S., Berger, R., Tavitian, A., Gacon, G. and Camonis, J.H. (1995) Bridging Ral GTPase to Rho pathways. RLIP76, a Ral effector with CDC42/Rac GTPase-activating protein activity. J Bioi Chem, 270, 22473-22477. Kamb, A., Gruis, N.A., Weaver-Feldhaus, J., Liu, Q., Harshman, K., Tavtigian, S.V., Stockert, E., Day, R.S.r., Johnson, B.E. and Skolnick, M.H. (1994) A cell cycle regulator potentially involved in genesis of many tumor types. Science, 264, 43 6- 440. Kang, J.S. and Krauss, R.S. (1996) Ras induces anchorage-independent growth by subverting multiple adhesion-regulated cell cycle events. Moi Ceii Bioi, 16, 3370- 3380. Kapeller, R. and Cantley, L.C. (1994) Phosphatidylinositol 3-kinase. Bioessays, 16, 565-576. Kato, J., Matsushime, H., Hiebert, S.W., Ewen, M.E. and Sherr, C.J. (1993) Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4. Genes Dev, 7, 331-342. Kato, K., Cox, A.D., Hisaka, M.M., Graham, S.M., Buss, J.E. and Der, C.J. (1 992) Isoprenoid addition to Ras protein is the critical modification for its membrane association and transforming activity. Proc Natl Acad Sci USA, 89, 6403-6407. Katz, M.E. and McCormick, F. (1997) Signal transduction from multiple Ras effectors. [Review] [50 refs]. Current Opinion in Genetics & Development,?, 7 5 - 79. Kauffmann-Zeh, A., Rodriguez-Viciana, P., Ulrich, E., Gilbert, C., Coffer, P., Downward, J. and Evan, G, (1997) Suppression of c-Myc-induced apoptosis by Ras signalling through PI(3)K and PKB. N ature, 385, 544-548. Kaufman, R.J., Davies, M.V., Pathak, V.K. and Hershey, J.W. (1989) The phosphorylation state of eucaryotic initiation factor 2 alters translational efficiency of specific mRNAs. Mol Cell Biol, 9, 946-958. Kavanaugh, W.M., Turck, C.W., Klippel, A. and Williams, L.T. (1994) Tyrosine 508 of the 85-kilodalton subunit of phosphatidylinositol 3- kinase is phosphorylated by the platelet-derived growth factor receptor. Biochemistry, 33, 11046-11050. Keely, P.J., Westwick, J.K., Whitehead, I.P., Der, C.J. and Parise, L.V. (1997) Cdc42 and Rad induce integrin-mediated cell motility and invasiveness through PI(3)K. N a tu re , 390, 632-636. Kerkhoff, E. and Rapp, U.R. (1998) High-intensity Raf signals convert mitotic cell cycling into cellular growth. Cancer Res, 58, 1636-1640. Keyomarsi, K., O'Leary, N., Molnar, G., Lees, E., Fingert, H.J. and Pardee, A.B. (1994) Cyclin E, a potential prognostic marker for breast cancer. Cancer Res, 54, 380-385. Kheradmand, F., Werner, E., Tremble, P., Symons, M. and Werb, Z. (1998) Role of Rad and oxygen radicals in collagenase-1 expression induced by cell shape change. S c ie n c e , 280, 898-902.

237 Chapter Seven - Bibliography

Khosravi-Far, R., Chrzanowska-Wodnicka, M., Soiski, P.A., Eva, A., Burridge, K. and Der, CJ. (1994) Dbl and Vav mediate transformation via mitogen-activated protein kinase pathways that are distinct from those activated by oncogenic Ras. Mol Cell Biol, 14, 6848-6857. Khosravi-Far, R., Soiski, P.A., Clark, G.J., Kinch, M.S. and Der, C.J. (1995) Activation of R ad, RhoA, and mitogen-activated protein kinases is required for Ras transformation. Molecular & Cellular Biology, 15, 6443-6453. Kikuchi, A., Demo, S.D., Ye, Z.H., Chen, Y.W. and Williams, L.T. (1994) ralGDS family members interact with the effector loop of ras p21. Molecular & Cellular B/o/ogy, 14, 7483-7491. Kikuchi, A. and Williams, L.T. (1994) The post-translational modification of ras p21 is important for Raf-1 activation. J Biol Chem, 269, 20054-20059. Kikuchi, A. and Williams, L.T. (1996) Regulation of interaction of ras p21 with RalGDS and Raf-1 by cyclic AMP-dependent protein kinase. Journal of Biological Chemistry, 27^, 588-594. Kimmelman, A., Tolkacheva, T., Lorenzi, M.V., Osada, M. and Chan, A.M. (1 997) Identification and characterization of R-ras3: a novel member of the RAS gene family with a non-ubiquitous pattern of tissue distribution. O n co g en e, 15, 2675-2685. Kimura, K., Hattori, S., Kabuyama, Y., Shizawa, Y., Takayanagi, J., Nakamura, S., Toki, S., Matsuda, Y., Onodera, K. and Fukui, Y. (1994) Neurite outgrowth of PCI 2 cells is suppressed by wortmannin, a specific inhibitor of phosphatidylinositol 3 - kinase. J Biol Chem, 269, 18961-18967. Kimura, K., Ito, M., Amano, M., Chihara, K., Fukata, Y., Nakafuku, M., Yamamori, B., Feng, J., Nakano, T., Okawa, K., Iwamatsu, A. and Kaibuchi, K. (1996) Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho- kinase) [see comments]. S c ie n c e , 273, 245-248. King, A.J., Sun, H., Diaz, B., Barnard, D., Miao, W., Bagrodia, S. and Marshall, M.S. (1998) The protein kinase Pak3 positively regulates Raf-1 activity through phosphorylation of serine 338. N ature, 396, 180-183. King, W.G., Mattaliano, M.D., Chan, T.O., Tsichlis, P.M. and Brugge, J.S. (1 997) Phosphatidylinositol 3-kinase is required for integrin-stimulated AKT and Raf- 1/mitogen-activated protein kinase pathway activation. Mol Cell Biol, 17, 440 6- 4418. Kirsten, W.H. and Mayer, L.A. (1967) Morphologic responses to a murine erythroblastosis virus. J. Natl Cancer Inst., 39, 311-335. Kiyokawa, H., Kineman, R.D., Manova-Todorova, K.O., Soares, V.C., Hoffman, E.S., Ono, M., Khanam, D., Hayday, A.C., Frohman, L.A. and Koff, A. (1996) Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function ofp27(Kip1). C ell, 8 5 , 721-732. Klippel, A., Escobedo, M.A., Wachowicz, M.S., Apell, G., Brown, T.W., Giedlin, M.A., Kavanaugh, W.M. and Williams, L.T. (1998) Activation of phosphatidylinositol 3 - kinase is sufficient for cell cycle entry and promotes cellular changes characteristic of oncogenic transformation. Mol Cell Biol, 18, 5699-5711. Knudsen, E.S., Buckmaster, C., Chen, T.T., Feramisco, J.R. and Wang, J.Y. (1 998) Inhibition of DNA synthesis by RB: effects on G1/S transition and S- phase progression. G enes Dev, 12, 2278-2292. Knudson, A.G., Jr. (1971) Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA, 68, 820-823.

238 Chapter Seven - Bibliography

Koff, A., Giordano, A., Desai, D., Yamashita, K,, Harper, J.W., Elledge, S., Nishimoto, T., Morgan, D.O., Franza, B.R. and Roberts, J.M. (1992) Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle. Science, 25 7, 1689-1694. Koh, J., Enders, G.H., Dynlacht, B.D. and Harlow, E. (1995) Tumour-derived p i 6 alleles encoding proteins defective in cell-cycle inhibition.N ature, 375, 506-510. Kohl, N.E., Conner, M.W., Gibbs, J.B., Graham, S.L, Hartman, G.D. and Oliff, A. (1995) Development of inhibitors of protein farnesylation as potential chemotherapeutic agents. J Cell Biochem SuppI, 22, 145-150. Koide, H., Batch, T., Nakafuku, M. and Kaziro, Y. (1993) GTP-dependent association of Raf-1 with Ha-Ras: identification of Raf as a target downstream of Ras in mammalian cells. Proc Natl Acad Sci USA, 90, 8683-8686. Kolch, W., Heidecker, G., Lloyd, P. and Rapp, U.R. (1991) Raf-1 protein kinase is required for growth of induced NIH/3T3 cells. N ature, 349, 426-428. Koopmann, J., Maintz, D., Schild, S., Schramm, J., Louis, D.N., Wiestler, O.D, and von Deimling, A. (1995) Multiple polymorphisms, but no mutations, in the WAF1/CIP1 gene in human brain tumours. Br J Cancer, 72, 1230-1233. Kotani, K., Hara, K., Kotani, K., Yonezawa, K. and Kasuga, M. (1 995) Phosphoinositide 3-kinase as an upstream regulator of the small GTP-binding protein Rac in the insulin signaling of membrane ruffling. Biochemical & Biophysical Research Communications, 208, 985-990. Kotani, K., Yonezawa, K., Hara, K., Ueda, H., Kitamura, Y., Sakaue, H., Ando, A., Chavanieu, A., Galas, B., Grigorescu, F. and et al. (1994) Involvement of phosphoinositide 3-kinase in insulin- or IGF-1-induced membrane ruffling. Embo J, 13, 2313-2321. Kozasa, T., Jiang, X., Hart, M.J., Sternweis, P.M., Singer, W.D., Gilman, A.G., Bollag, G. and Sternweis, P.O. (1998) pi 15 RhoGEF, a GTPase activating protein for Galpha12 and Galpha13. Sc/ence, 280, 2109-2111. Kozma, R., Ahmed, S., Best, A. and Lim, L. (1996) The GTPase-activating protein n - chimaerin cooperates with Rad and Cdc42Hs to induce the formation of lamellipodia and filopodia. Mol Cell Biol, 16, 5069-5080. Kuroda, S., Fukata, M., Kobayashi, K., Nakafuku, M., Nomura, N., Iwamatsu, A. and Kaibuchi, K. (1996a) Identification of IQGAP as a putative target for the small GTPases, Gdc42 and R ad. J Biol Chem, 271, 23363-23367. Kuroda, S., Ohtsuka, T., Yamamori, B., Fukui, K., Shimizu, K. and Takai, Y. (1996b) Different effects of various phospholipids on Ki-Ras-, Ha-Ras-, and RaplB-induced B-Raf activation. J Biol Chem, 271, 14680-14683. Kyriakis, J.M., App, H., Zhang, X.F., Banerjee, P., Brautigan, D.L., Rapp, U.R. and Avruch, J. (1992) Raf-1 activates MAP kinase-kinase. Nature, 358, 417-421. Kyriakis, J.M. and Avruch, J. (1996) Protein kinase cascades activated by stress and inflammatory cytokines. B lo essa ys, 18, 567-577. Kyriakis, J.M., Force, T.L., Rapp, U.R., Bonventre, J.V. and Avruch, J. (1 993) Mitogen regulation of c-Raf-1 protein kinase activity toward mitogen- activated protein kinase-kinase. J Biol Chem, 268, 16009-16019. LaBaer, J., Garrett, M.D., Stevenson, L.F., Slingerland, J.M., Sandhu, G., Ghou, H.S., Fattaey, A. and Harlow, E. (1997) New functional activities for the p21 family of GDK inhibitors. G enes Dev, 11, 847-862.

239 Chapter Seven - Bibliography

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. Lamarche, N., Tapon, N., Stowers, L, Burbelo, P.D., Aspenstrom, P., Bridges, T., Chant, J. and Hall, A. (1996) Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade. Ce//, 87, 519-529. Lamaze, C., Chuang, T.H., Terlecky, L.J., Bokoch, G.M. and Schmid, S.L. (1 9 9 6 ) Regulation of receptor-mediated endocytosis by Rho and Rac. Nature, 382, 177- 179. Lancaster, C.A., Taylor-Harris, P.M., Self, A.J., Brill, S., van Erp, H.E. and Hall, A. (1994) Characterization of rhoGAP. A GTPase-activating protein for rho-related small GTPases. J Biol Chem, 269, 1137-1142. Land, H., Parada, L.F. and Weinberg, R.A. (1983) Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature, 304, 596-602. Lange-Carter, C.A., Pleiman, C.M., Gardner, A.M., Blumer, K.J. and Johnson, G.L (1993) A divergence in the MAP kinase regulatory network defined by MEK kinase and Raf. S c ie n c e , 260, 315-319. Lee, C.H.J., Della, N.G., Chew, C.E. and Zack, D.J. (1996) Rin, a neuron-specific and calmodulin-binding small G-protein, and Rit define a novel subfamily of ras proteins. J Neurosci, 16, 6784-6794. Lee, M.H., Reynisdottir, I. and Massague, J. (1995) Cloning of p57KIP2, a cyclin- dependent kinase inhibitor with unique domain structure and tissue distribution. G enes Dev, 9, 639-649. Lee, R.M., Rapp, U.R. and Blackshear, P.J. (1991) Evidence for one or more Raf-1 kinase kinase(s) activated by insulin and polypeptide growth factors. Journal of Biological Chemistry, 266, 10351-10357. Lees, E. (1995) Cyclin dependent kinase regulation. Curr Opin Cell Biol, 7, 7 73- 780. Leeuwen, F.N., Kain, H.E., Kammen, R.A., Michiels, F., Kranenburg, O.W. and Collard, J.G. (1997) The guanine nucleotide exchange factor Tiami affects neuronal morphology; opposing roles for the small GTPases Rac and Rho. J Cell Biol, 13 9, 797-807. Leevers, S.J. and Marshall, C.J. (1992) Activation of extracellular signal-regulated kinase, ERK2, by p21ras oncoprotein. EMBO J, 11, 569-574. Leevers, S.J., Paterson, H.F. and Marshall, C.J. (1994) Requirement for Ras in Raf activation is overcome by targeting Raf to the plasma membrane. Nature, 3 69, 411-414. Lelias, J.M., Adra, C.N., Wulf, G.M., Guillemot, J.C., Khagad, M., Caput, D. and Lim, B. (1993) cDNA cloning of a human mRNA preferentially expressed in hematopoietic cells and with homology to a GDP-dissociation inhibitor for the rho GTP- binding proteins. Proc Natl Acad Sci USA, 90, 1479-1483. Lenormand, P., McMahon, M. and Pouyssegur, J. (1996) Oncogenic Raf-1 activates p70 86 kinase via a mitogen-activated protein kinase-independent pathway. Journal of Biological Chemistry, 27^ , 15762-15768. Leonard, D., Hart, M.J., Platko, J.V., Eva, A., Henzel, W., Evans, T. and Cerione, R.A. (1992) The identification and characterization of a GDP-dissociation inhibitor (GDI) for the CDC42Hs protein. J Biol Chem, 267, 22860-22868.

240 Chapter Seven - Bibliography

Lerner, E.G., Qian, Y., Blaskovich, M.A., Possum, R.D., Vogt, A., Sun, J., Cox, A.D., Der, C.J., Hamilton, A.D. and Sebti, S.M. (1995) Ras CAAX peptidomimetic FTI-277 selectively blocks oncogenic Ras signaling by inducing cytoplasmic accumulation of inactive Ras-Raf complexes. J Biol Chem, 270, 26802-26806. Leung, T., Chen, X.Q., Tan, I., Manser, E. and Lim, L. (1998) Myotonic dystrophy kinase-related Cdc42-binding kinase acts as a Cdc42 effector in promoting cytoskeletal reorganization. Mol Cell Biol, 130-140. Leung, T., How, B.E., Manser, E. and Lim, L. (1993) Germ cell beta-chimaerin, a new GTPase-activating protein for p21rac, is specifically expressed during the acrosomal assembly stage in rat testis. J Biol Chem, 268, 3813-3816. Leung, T., Manser, E., Tan, L. and Lim, L. (1995) A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes. J Biol Chem, 270, 29051-29054. Lewis, T.S., Shapiro, P.S. and Ahn, N.G. (1998) Signal transduction through MAP kinase cascades. Adv Cancer Res, 74, 49-139. Li, G., D’Souza-Schorey, 0., Barbieri, M.A., Roberts, R.L., Klippel, A., Williams, L.T. and Stahl, P.O. (1995a) Evidence for phosphatidylinositol 3-kinase as a regulator of endocytosis via activation of Rab5. Proceedings of the National Academy of Sciences of the United States of America, 92, 10207-10211. Li, G.P., Dsouzaschorey, C., Barbieri, M.A., Cooper, J.A. and Stahl, P.O. (1 997) Uncoupling of membrane ruffling and pinocytosis during ras signal-transduction. J Biol Chem, 272, 10337-10340. Li, N., Batzer, A., Daly, R., Yajnik, V., Skolnik, E., Chardin, P., Bar-Sagi, D., Margolis, B. and Schlessinger, J. (1993) Guanine-nucleotide-releasing factor hSosI binds to Grb2 and links receptor tyrosine kinases to Ras signalling [see comments]. N ature, 363, 85-88. Li, Y.J., Laurent-Puig, P., Salmon, R.J., Thomas, G. and Hamelin, R. (1995b) Polymorphisms and probable lack of mutation in the WAF1-CIP1 gene in colorectal cancer. O ncogene, 10, 599-601. Lin, A.W., Barradas, M., Stone, J.C., Vanaelst, L., Serrano, M. and Lowe, S.W. (1998) Premature senescence involving p53 and p16 is activated in response to constitutive mek/mapk mitogenic signaling. G enes Dev, 12, 3008-3019,. Lin, L.L., Wartmann, M., Lin, A.Y., Knopf, J.L., Seth, A. and Davis, R.J. (1993) cPLA2 is phosphorylated and activated by MAP kinase. Cell, 72, 269-278. Liu, J.J., Chao, J.R., Jiang, M.C., Ng, S.Y., Yen, J.J. and Yang-Yen, H.F. (1995) Ras transformation results in an elevated level of cyclin DI and acceleration of G1 progression in NIH 3T3 cells. Mol Cell Biol, 15, 3654-3663. Liu, M., Lee, M.H., Cohen, M., Bommakanti, M. and Freedman, L.P. (1 996 ) Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937. Genes Dev, 10, 14 2 - 153. Lloyd, A.C., Obermuller, F., Staddon, S., Barth, C.F., McMahon, M. and Land, H. (1997) Cooperating oncogenes converge to regulate cyclin/cdk complexes. Genes & Development, , 663-677. Lloyd, A.C., Paterson, H.F., Morris, J.D., Hall, A. and Marshall, C.J. (1989) p21H- ras-induced morphological transformation and increases in c-myc expression are independent of functional protein kinase C. Embo Journal, 8 , 1099-1104. Loda, M., Cukor, B., Tam, S.W., Lavin, P., Fiorentino, M., Draetta, G.F., Jessup, J.M. and Pagano, M. (1997) Increased proteasome-dependent degradation of the cyclin-

241 Chapter Seven - Bibliography dependent kinase inhibitor p27 in aggressive colorectal carcinomas [see comments]. Nat M ed, 3, 231-234. Lovec, H., Sewing, A., Lucibello, F.C., Muller, R. and Moroy, T. (1994) Oncogenic activity of cyclin DI revealed through cooperation with Ha- ras: link between cell cycle control and malignant transformation. O ncogene, 9, 323-326. Lowenstein, E.J., Daly, R.J., Batzer, A.G., Li, W., Margolis, B., Lammers, R., Ullrich, A., Skolnik, E.Y., Bar-Sagi, D. and Schlessinger, J. (1992) The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell, 7 0 , 431-442. Lowy, D.R. and Willumsen, B.M. (1993) Function and regulation of ras. [Review] [315 refs]. Annual Review of Biochemistry, 62, 851-891. Lu, X., Chou, T.B., Williams, N.G., Roberts, I. and Perrimon, N. (1993) Control of cell fate determination by p21ras/Ras1, an essential component of torso signaling in Drosophila. Genes Dev, 7, 621-632. Lucibello, F.C., Sewing, A., Brusselbach, S., Burger, C. and Muller, R. (1 99 3) Deregulation of cyclins DI and E and suppression of cdk2 and cdk4 in senescent human fibroblasts. Journal of Cell Science, 105, 123-133. Luckow, B. and Schütz, G. (1987) CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res, 15, 5490. Lukas, J., Bartkova, J., Rohde, M., Strauss, M. and Bartek, J. (1995) Cyclin DI is dispensable for G1 control in retinoblastoma gene- deficient cells independently of cdk4 activity. Mol Cell Biol, 15, 2600-2611. Lukas, J., Herzinger, T., Hansen, K., Moroni, M.C., Resnitzky, D., Helin, K., Reed, S.l. and Bartek, J. (1997) Cyclin E-induced S phase without activation of the pRb/E2F pathway. G enes Dev, 11, 1479-1492. Lukas, J., Muller, H., Bartkova, J., Spitkovsky, D., Kjerulff, A.A., Jansen-Durr, P., Strauss, M. andBartek, J. (1994a) DNA tumor virus oncoproteins and retinoblastoma gene mutations share the ability to relieve the cell's requirement for cyclin DI function in G1. J Cell Biol, 125, 625-638. Lukas, J., Pagano, M., Staskova, Z., Draetta, G. and Bartek, J. (1994b) Cyclin DI protein oscillates and is essential for cell cycle progression in human tumour cell lines. O n co g en e, 9, 707-718. Lukas, J., Petersen, B.C., Holm, K., Bartek, J. and Helin, K. (1996) Deregulated expression of E2F family members induces S-phase entry and overcomes p16INK4A-mediated growth suppression. Mol Cell Biol,'\6, 1047-1057. Luo, R.X., Postigo, A.A. and Dean, D.C. (1998) Rb interacts with histone deacetylase to repress transcription. Cell, 92, 463-473. Luo, Z., Tzivion, G., Belshaw, P.J., Va was, D., Marshall, M. and Avruch, J. (1 996) Oligomerization activates c-Raf-1 through a Ras-dependent mechanism. Nature, 383, 181-185. Lynch, E.D., Lee, M.K., Morrow, J.E., Welcsh, P.L., Leon, P.E. and King, M.C. (1997) Nonsyndromic deafness DFNA1 associated with mutation of a human homolog of the Drosophila gene diaphanous. Science, 276, 1315-1318. Macdonald, S.G., Crews, C.M., Wu, L., Driller, J., Clark, R., Erikson, R.L. and McCormick, F. (1993) Reconstitution of the Raf-1-MEK-ERK signal transduction pathway in vitro [published erratum appears in Mol Cell Biol 1994 Mar;14(3):2223-4J. Mol Cell Biol, 13, 6615-6620.

242 Chapter Seven - Bibliography

Mackay, D.J., Esch, F., Furthmayr, H. and Hall, A. (1997) Rho- and rac-dependent assembly of focal adhesion complexes and actin filaments in permeabilized fibroblasts: an essential role for ezrin/radixin/moesin proteins. Journal of Cell B io lo g y, 138, 927-938. Madaule, P., Furuyashiki, T., Reid, T., Ishizaki, T., Watanabe, G., Morii, N. and Narumiya, S. (1995) A novel partner for the GTP-bound forms of rho and rac. FEES L e tt, 377, 243-248. Magnaghi-Jaulin, L., Groisman, R., Naguibneva, I., Robin, P., Lorain, S., Le Villain, J.P., Troalen, F., Trouche, D. and Harel-Bellan, A. (1998) Retinoblastoma protein represses transcription by recruiting a histone deacetylase [see comments]. Nature, 391, 601-605. Maguire, J., Santoro, T., Jensen, P., Siebenlist, U., Yewdell, J. and Kelly, K. (1 994 ) Gem: an induced, immediate early protein belonging to the Ras family. Science, 2 6 5, 241-244. Mainiero, F., Murgia, C., Wary, K.K., Curatola, A.M., Pepe, A., Blumemberg, M., Westwick, J.K., Der, C.J. and Giancotti, F.G. (1997) The coupling of alpha6beta4 integrin to Ras-MAP kinase pathways mediated by She controls keratinocyte proliferation. Em bo J, 16, 2365-2375. Maki, C.G. and Howley, P.M. (1997) Ubiquitination of p53 and p21 is differentially affected by ionizing and UV radiation. Mol Cell Biol, 17, 355-363. Maniero, F., Pepe, A., Wary, K.K., Spinardi, L., Mohammadi, M., Schlessinger, J. and Giancotti, F.G. (1995) Signal transduction by the alpha 6 beta 4 integrin: distinct beta 4 subunit sites mediate recruitment of Shc/Grb2 and association with the cytoskeleton of hemidesmosomes. Embo J, 14, 4470-4481. Mann, D.J. and Jones, N.G. (1996) E2F-1 but not E2F-4 can overcome p16-induced G1 cell-cycle arrest. Curr Biol, 6, 474-483. Manser, E., Chong, C., Zhao, Z.S., Leung, T., Michael, G., Hall, C. and Lim, L. (1 995) Molecular cloning of a new member of the p21-Cdc42/Rac-activated kinase (PAK) family. Journal of Biological Chemistry, 270, 25070-25078. Manser, E., Huang, H.Y., Loo, T.H., Chen, X.Q., Dong, J.M., Leung, T. and Lim, L. (1997) Expression of constitutively active alpha-PAK reveals effects of the kinase on actin and focal complexes. Molecular & Cellular Biology, 17, 1129-1143. Manser, E., Leung, T., Salihuddin, H., Tan, L. and Lim, L. (1993) A non-receptor tyrosine kinase that inhibits the GTPase activity of p21cdc42. Nature, 363, 364- 367. Manser, E., Leung, T., Salihuddin, H., Zhao, Z.S. and Lim, L. (1994) A brain serine/threonine protein kinase activated by Cdc42 and R a d . Nature, 367, 40-46. Manser, E., Loo, T.H., Koh, C.G., Zhao, Z.S., Chen, X.Q., Tan, L., Tan, I., Leung, T. and Lim, L. (1998) PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol Ce//, 1, 183-192. Mansour, S.J., Matten, W.T., Hermann, A.S., Candia, J.M., Rong, S., Fukasawa, K., Vande Woude, G.F. and Ahn, N.G. (1994) Transformation of mammalian cells by constitutively active MAP kinase kinase. S cien ce, 265, 966-970. Marais, R., Light, Y., Paterson, H.F. and Marshall, C.J. (1995) Ras recruits Raf-1 to the plasma membrane for activation by tyrosine phosphorylation. Embo J, 1 4, 3136-3145. Marcus, S., Wigler, M., Xu, H.P., Ballester, R., Kawamukai, M. and Polverino, A. (1993) RAS function and protein kinase cascades. Ciba Found Symp, 176, 53-61; discussion 61-56.

243 Chapter Seven - Bibliography

Markowitz, D., Hesdorffer, C., Ward, M., Goff, S. and Bank, A. (1990) Retroviral gene transfer using safe and efficient packaging cell lines. Ann N Y Acad Sci, 612, 407-414. Marra, F., Pinzani, M., DeFranco, R., Laffi, G. and Gentilini, P. (1995) Involvement of phosphatidylinositol 3-kinase in the activation of extracellular signal-regulated kinase by PDGF in hepatic stellate cells. FEBS Letters, 376, 141-145. Marshall, C.J. (1995) Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell, QO, 179- 185. Marshall, C.J. (1996) Ras effectors. Curr Opin Cell B/o/, 8, 197-204. Marshall, M.S. (1993) The effector interactions of p21ras. Trends In Biochemical Sciences, ^6, 250-254. Marshall, M.S. and Hettich, L.A. (1993) Characterization of Ras effector mutant interactions with the NF1-GAP related domain. Oncogene, 6, 425-431. Martin, G.A., Bollag, G., McCormick, F. and Abo, A. (1995a) A novel serine kinase activated by rac1/CDC42Hs-dependent autophosphorylation is related to PAK65 and STE20 [published erratum appears in EMBO J 1995 Sep 1 ;14(17):4385]. E m b o J, 14, 1970-1978. Martin, G.A., Viskochil, D., Bollag, G., McCabe, P.C., Crosier, W.J., Haubruck, H., Conroy, L., Clark, R., O'Connell, P., Cawthon, R.M. and et al. (1990) The GAP- related domain of the neurofibromatosis type 1 gene product interacts with ras p21. C ell, 6 3 , 843-849. Martin, G.A., Yatani, A., Clark, R., Conroy, L., Polakis, P., Brown, A.M. and McCormick, F. (1992) GAP domains responsible for ras p21-dependent inhibition of muscarinic atrial K+ channel currents. Science, 255, 192-194. Martin, M., Andreoli, C., Sahuquet, A., Montcourrier, P., Algrain, M. and Mangeat, P. (1995b) Ezrin NH2-terminal domain inhibits the cell extension activity of the COOH-terminal domain. J Cell Biol, 128, 1081-1093. Martinerie, C., Cannizzaro, L.A., Croce, C.M., Huebner, K., Katzav, S. and Barbacid, M. (1990) The human VAV proto-oncogene maps to chromosome region 1 9 p 1 2 ----- 19p13.2. Hum Genet, 86, 65-68. Martys, J.L., Wjasow, C., Gangi, D.M., Kielian, M.C., McGraw, T.E. and Backer, J.M. (1996) Wortmannin-sensitive trafficking pathways in Chinese hamster ovary cells. Differential effects on endocytosis and lysosomal sorting. J Biol Chem, 271, 10953-10962. Matsui, T., Amano, M., Yamamoto, T., Chihara, K., Nakafuku, M., Ito, M., Nakano, T., Okawa, K., Iwamatsu, A. and Kaibuchi, K. (1996) Rho-associated kinase, a novel serine/threonine kinase, as a putative target for small GTP binding protein Rho. EMBO Journal, ^5, 2208-2216. Matsuoka, S., Edwards, M.C., Bai, C., Parker, S., Zhang, P., Baldini, A., Harper, J.W. and Elledge, S.J. (1995) p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene. G enes Dev, 9, 650-662. Matsushime, H., Ewen, M.E., Strom, D.K., Kato, J.Y., Hanks, S.K., Roussel, M.F. and Sherr, C.J. (1992) Identification and properties of an atypical catalytic subunit (p34PSK- J3/cdk4) for mammalian D type G1 cyclins. Ce//, 71, 323-334. Matsushime, H., Roussel, M.F., Ashmun, R.A. and Sherr, C.J. (1991) Colony- stimulating factor 1 regulates novel cyclins during the G1 phase of the cell cycle. Ce//, 65, 701-713.

244 Chapter Seven - Bibliography

Mattaj, I.W. and Englmeier, L (1998) Nucleocytoplasmic transport: the soluble phase. Annu Rev Biochem, 67, 265-306. Matuoka, K., Shibata, M., Yamakawa, A. and Takenawa, T. (1992) Cloning of ASH, a ubiquitous protein composed of one Src homology region (SH) 2 and two SH3 domains, from human and rat cDNA libraries. Proc Natl Acad Sci U SA, 89, 9015- 9019. McGlade, J., Brunkhorst, B., Anderson, D., Mbamalu, G., Settleman, J., Dedhar, S., Rozakis-Adcock, M., Chen, LB. and Pawson, T. (1993) The N-terminal region of GAP regulates cytoskeletal structure and cell adhesion. Embo J, 12, 3073-3081. McGrath, J.P., Capon, D.J., Smith, D.H., Chen, E.Y., Seeburg, P.M., Goeddel, D.V. and Levinson, A.D. (1983) Structure and organization of the human Ki-ras proto­ oncogene and a related processed pseudogene. Nature, 304, 501-506. Mcllroy, J., Chen, D., Wjasow, C., Michaeli, T. and Backer, J.M. (1997) Specific activation of p85-p110 phosphatidylinositol 3'-kinase stimulates DMA synthesis by ras- and p70 S6 kinase-dependent pathways. Molecular & Cellular Biology, 1 7, 248-255. McKinney, J.D. and Cross, F.R. (1995) FAR1 and the G1 phase specificity of cell cycle arrest by mating factor in Saccharomyces cerevisiae. Mol Cell Biol, 1 5, 2509-2516. McLaughlin, M.M., Kumar, S., McDonnell, P.C., Van Horn, S., Lee, J.C., Livi, G.P. and Young, P.R. (1996) Identification of mitogen-activated protein (MAP) kinase- activated protein kinase-3, a novel substrate of CSBP p38 MAP kinase. J Biol Chem, 271, 8488-8492. Medema, R.H., de Laat, W.L., Martin, G.A., McCormick, F. and Bos, J.L. (1 992) GTPase-activating protein SH2-SH3 domains induce gene expression in a Ras- dependent fashion. Mol Cell Biol, 12, 3425-3430. Meyerson, M. and Harlow, E. (1994) Identification of G1 kinase activity for cdk6, a novel cyclin D partner. Mol Cell Biol, 14, 2077-2086. Michaud, N.R., Fabian, J.R., Mathes, K.D. and Morrison, D.K. (1995) 14-3-3 is not essential for Raf-1 function: identification of Raf-1 proteins that are biologically activated in a 14-3-3- and Ras- independent manner.Mol Cell Biol, 15, 339 0- 3397. Michaud, N.R., Therrien, M., Cacace, A., Edsall, L.C., Spiegel, S., Rubin, G.M. and Morrison, D.K. (1997) KSR stimulates Raf-1 activity in a kinase-independent manner [published erratum appears in Proc Natl Acad Sci U S A 1998 mAR 3;95(5):2714-5]. Proc Natl Acad Sci U S A, 94, 12792-12796. Michieli, P., Chedid, M., Lin, D., Pierce, J.H., Mercer, W.E. and Givol, D. (1994) Induction of WAF1/CIP1 by a p53-independent pathway. Cancer Res, 54, 3391 - 3395. Michiels, F., Habets, G.G., Stam, J.C., van der Kammen, R.A. and Collard, J.G. (1995) A role for Rac in Tiami-induced membrane ruffling and invasion. Nature, 375, 338-340. Miki, H., Sasaki, T., Takai, Y. and Takenawa, T. (1998) Induction of filopodium formation by a WASP-related actin- depolymerizing protein N-WASP. Nature, 391, 93-96. Miller, A.D. and Rosman, G.J. (1989) Improved retroviral vectors for gene transfer and expression. Blotechnlques, 7, 980-982, 984-986, 989-990.

245 Chapter Seven - Bibliography

Miller, J. and Germain, R.N. (1986) Efficient cell surface expression of class II MHC molecules in the absence of associated invariant chain. J Exp Med, 164, 1478- 1489. Minden, A., Lin, A., Claret, F.X., Abo, A. and Karin, M. (1995) Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Ce//, 81, 1147-1157. Minden, A., Lin, A., McMahon, M., Lange, C.C., Derijard, B., Davis, R.J., Johnson, G.L. and Karin, M. (1994) Differential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK. Science, 266, 1719-1723. Missero, 0., Calautti, E., Eckner, R., Chin, J., Tsai, L.H., Livingston, D.M. and Dotto, G.P. (1995) Involvement of the cell-cycle inhibitor CiplA/VAFI and the E1A- associated pSOO protein in terminal differentiation. Proc Natl Acad Sci U S A, 92, 5451-5455. Missero, C., Di Cunto, F., Kiyokawa, H., Koff, A. and Dotto, G.P. (1996) The absence of p21Cip1AA/AF1 alters keratinocyte growth and differentiation and promotes ras- tumor progression. G enes Dev, 10, 3065-3075. Mittnacht, S. (1998) Control of pRB phosphorylation. Curr Opin Genet Dev, 8 ,2 1- 27. Mittnacht, S., Paterson, H., Olson, M.F. and Marshall, C.J. (1997) Ras signaling is required for inactivation of the tumor-suppressor pRb cell-cycle control protein. Curr Bioi, 7, 219-221. Miyamoto, S., Teramoto, H., Gutkind, J.S. and Yamada, K.M. (1996) Integrins can collaborate with growth factors for phosphorylation of receptor tyrosine kinases and MAP kinase activation: roles of integrin aggregation and occupancy of receptors. J Ceii Bioi, 135, 1633-1642. Miyazaki, M., Ohashi, R., Tsuji, T., Mihara, K., Gohda, E. and Namba, M. (1 998) Transforming growth factor-beta 1 stimulates or inhibits cell growth via down- or up-regulation of p21/Waf1. Biochem Biophys Res Commun, 2A6, 873-880. Mizuno, T., Kaibuchi, K., Yamamoto, T., Kawamura, M., Sakoda, T., Fujioka, H., Matsuura, Y. and Takai, Y. (1991) A stimulatory GDP/GTP exchange protein for smg p21 is active on the post-translationally processed form of c-Ki-ras p21 and rhoA p21. Proc Nati Acad Sci USA, 88, 6442-6446. Mizushima, S. and Nagata, S. (1990) pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res, 18, 5322. Monfar, M., Lemon, K.P., Grammer, T.C., Cheatham, L., Chung, J., Vlahos, C.J. and Blenis, J. (1995) Activation of pp70/85 86 kinases in interleukin-2-responsive lymphoid cells is mediated by phosphatidylinositol 3-kinase and inhibited by cyclic AMP. Moi Ceii Bioi, 15, 326-337. Moodie, S.A., Willumsen, B.M., Weber, M.J. and Wolfman, A. (1993) Complexes of Ras.GTP with Raf-1 and mitogen-activated protein kinase kinase [see comments]. Science,260, 1658-1661. Morales, C.P., Holt, S.E., Ouellette, M., Kaur, K.J., Yan, Y., Wilson, K.S., White, M.A., Wright, W.E. and Shay, J.W. (1999) Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat Genet, 2^, 115-118. Morgan, D.O. (1995) Principles of CDK regulation. Nature, 374, 131-134. Morgan, D.O. (1996) Under arrest at atomic resolution [news; comment]. Nature, 382, 295-296.

246 Chapter Seven - Bibliography

Morgenstern, J.P. and Land, H. (1990a) Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res, 18, 3587-3596. Morgenstern, J.P. and Land, H. (1990b) A series of mammalian expression vectors and characterisation of their expression of a reporter gene in stably and transiently transfected cells. Nucleic Acids Res, 18, 1068. Moriya, S., Kazlauskas, A., Akimoto, K., Hirai, S., Mizuno, K., Takenawa, T., Fukui, Y., Watanabe, Y., Ozaki, S. and Ohno, S. (1996) Platelet-derived growth factor activates protein kinase C epsilon through redundant and independent signaling pathways involving phospholipase C gamma or phosphatidylinositol 3-kinase. Proc Natl Acad Sci USA, 93, 151-155. Morris, J.D., Price, B., Lloyd, A.C., Self, A.J., Marshall, C.J. and Hall, A. (1989) Scrape-loading of Swiss 3T3 cells with ras protein rapidly activates protein kinase 0 in the absence of phosphoinositide hydrolysis. O ncogene, 4, 27-31. Morris, J.Z., Tissenbaum, H.A. and Ruvkun, G. (1996) A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. N a tu re , 382, 536-539. Morrison, D.K. and Cutler, R.E. (1997) The complexity of Raf-1 regulation. C urrent Opinion in Cell Biology, 9, 174-179. Moscow, J.A., He, R., Gnarra, J.R., Knutsen, T., Weng, Y., Zhao, W.P., Whang-Peng, J., Linehan, W.M. and Cowan, K.H. (1994) Examination of human tumors for rhoA mutations. Oncogene, 9, 189-194. Moss, J. and Vaughan, M. (1998) Molecules in the ARF orbit. J Biol Chem, 27 3, 21431-21434. Motokura, T., Bloom, T., Kim, H.G., Juppner, H., Ruderman, J.V., Kronenberg, H.M. and Arnold, A. (1991) A novel cyclin encoded by a bell-linked candidate oncogene. N a tu re , 350, 512-515. Mousses, S., Ozcelik, H., Lee, P.O., Malkin, D., Bull, S.B. and Andrulis, I.L. (1 995) Two variants of the CIP1/WAF1 gene occur together and are associated with human cancer. Hum Mol Genet, 4, 1089-1092. Moyers, J.S., Bilan, P.J., Zhu, J. and Kahn, C.R. (1997) Rad and Rad-related GTPases interact with calmodulin and calmodulin- dependent protein kinase II. J Biol Chem, 272, 11832-11839. Mulcahy, L.S., Smith, M.R. and Stacey, D.W. (1985) Requirement for ras proto­ oncogene function during serum-stimulated growth of NIH 3T3 cells. Nature, 313, 241-243. Muller, G., Storz, P., Bourteele, S., Doppler, H., Pfizenmaier, K., Mischak, H., Philipp, A., Kaiser, C. and Kolch, W. (1998) Regulation of Raf-1 kinase by TNF via its second messenger ceramide and cross-talk with mitogenic signalling. Embo J, 17, 732-742. Mulligan, R.C. and Berg, P. (1981) Selection for animal cells that express the Escherichia coli gene coding for xanthine-guanine phosphoribosyltransferase. Proc Natl Acad Sci USA, 78, 2072-2076. Murai, H., Ikeda, M., Kishida, S., Ishida, O., Okazaki-Kishida, M., Matsuura, Y. and Kikuchi, A. (1997) Characterization of Ral GDP dissociation stimulator-like (RGL) activities to regulate c-fos promoter and the GDP/GTP exchange of Ral. Journal of Biological Chemistry, 272, 10483-10490.

247 Chapter Seven - Bibliography

Nakajima, T., Fukamizu, A., Takahashi, J., Gage, F.H., Fisher, T., Blenis, J. and Montminy, M.R. (1996) The signal-dependent coactivator GBP is a nuclear target for pp90RSK. Cell, 86, 465-474. Nakano, K., Mizuno, T., Sowa, Y., Orita, T., Yoshino, T., Okuyama, Y., Fujita, T., Ohtani-Fujita, N., Matsukawa, Y., Tokino, T., Yamagishi, H., Oka, T., Nomura, H. and Sakai, T. (1997) Butyrate activates the WAFI/Cipl gene promoter through Spl sites in a p53-negative human colon cancer cell line. J Biol Chem, 272, 22199- 22206. Nakayama, K., Ishida, N., Shirane, M., Inomata, A., Inoue, T., Shishido, N., Horii, I., Loh, D.Y. and Nakayama, K. (1996) Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell, 8 5, 707-720. Nemenoff, R.A., Winitz, S., Qian, N.X., Van Putten, V., Johnson, G.L. and Heasley, L.E. (1993) Phosphorylation and activation of a high molecular weight form of phospholipase A2 by p42 microtubule-associated protein 2 kinase and protein kinase 0. J Biol Chem, 268, 1960-1964. Nevins, J.R. (1992) E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. S c ie n c e , 258, 424-429. Nigg, E.A. (1995) Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. B io e ssa y s, 17, 471-480. Nikolic, M., Chou, M.M., Lu, W., Mayer, B.J. and Tsai, L.H. (1998) The p35/Cdk5 kinase is a neuron-specific Rac effector that inhibits Paki activity. Nature, 3 95, 1 94-1 98. Nimnual, A.S., Yatsula, B.A. and Bar-Sagi, D. (1998) Coupling of Ras and Rac guanosine triphosphatases through the Ras exchanger Sos. Science, 279, 560-563. Nishiyama, T., Sasaki, T., Takaishi, K., Kato, M., Yaku, H., Araki, K., Matsuura, Y. and Takai, Y. (1994) rac p21 is involved in insulin-induced membrane ruffling and rho p21 is involved in hepatocyte growth factor- and 12-O-tetradecanoylphorbol- 13-acetate (TPA)-induced membrane ruffling in KB cells. Molecular & Cellular B io lo g y, 14, 2447-2456. Nobes, C.D. and Hall, A. (1995) Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Ce//, 81, 53-62. Nobes, C.D., Hawkins, P., Stephens, L. and Hall, A. (1995) Activation of the small GTP-binding proteins rho and rac by growth factor receptors. J Cell Sci, 10 8, 225-233. Noda, A., Ning, Y., Venable, S.F., Pereira-Smith, G.M. and Smith, J.R. (1994) Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp Cell Res,2^^, 90-98. Noda, M. (1993) Structures and functions of the K rev-1 transformation suppressor gene and its relatives. Biochim Biophys Acta, 1155, 97-109. Noda, M., Ko, M., Ogura, A., Liu, D.G., Amano, T., Takano, T. and Ikawa, Y. (1985) Sarcoma viruses carrying ras oncogenes induce differentiation- associated properties in a neuronal cell line. N ature, 318, 73-75. Norman, J.C., Price, L.S., Ridley, A.J. and Koffer, A. (1996) The small GTP-binding proteins, Rac and Rho, regulate cytoskeletal organization and exocytosis in mast cells by parallel pathways. Molecular Biology of the Cell, 7, 1429-1442. Novick, P. and Zerial, M. (1997) The diversity of Rab proteins in vesicle transport. Curr Opin Cell Biol, 9, 496-504.

248 Chapter Seven - Bibliography

O'Shea, C.C., Crompton, T., Rosewell, I.R., Hayday, A.C. and Owen, MJ. (1996) Raf regulates positive selection. Eur J Immunol, 26, 2350-2355. Oehlen, L.J., McKinney, J.D. and Cross, F.R. (1996) Ste12 and Mcml regulate cell cycle-dependent transcription of FAR1.Mol Cell B/o/, 16, 2830-2837. Ohtani, K., DeGregori, J. and Nevins, J.R. (1995) Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci USA, 92, 12146-12150. Okada, T., Kawano, Y., Sakakibara, T., Hazeki, O. and Ui, M. (1994) Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes. Studies with a selective inhibitor wortmannin. J Biol Chem, 2 6 9, 3568-3573. Okada, T., Masuda, T., Shinkai, M., Kariya, K. and Kataoka, T. (1996) Post- translational modification of H-Ras is required for activation of, but not for association with, B-Raf. J Biol Chem, 271, 4671-4678. Oldham, S.M., Clark, G.J., Gangarosa, L.M., Coffey, R.J., Jr. and Der, C.J. (1996) Activation of the Raf-1/MAP kinase cascade is not sufficient for Ras transformation of RIE-1 epithelial cells. Proc Natl Acad Sci USA, 93, 6924-6928. Olson, M.F., Ashworth, A. and Hall, A. (1995) An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1. Science, 269, 1270-1272. Olson, M.F., Pasteris, N.G., Gorski, J.L. and Hall, A. (1996) Faciogenital dysplasia protein (FGD1) and Vav, two related proteins required for normal embryonic development, are upstream regulators of Rho GTPases. Curr Biol, 6, 1628-1633. Olson, M.F., Paterson, H.F. and Marshall, C.J. (1998) Signals from Ras and Rho GTPases interact to regulate expression of p21Waf1/Cip1. Nature, 294, 295-299. Osada, S., Izawa, M., Koyama, T., Hirai, S. and Ohno, S. (1997) A domain containing the Cdc42/Rac interactive binding (CRIB) region of p65PAK inhibits transcriptional activation and cell transformation mediated by the Ras-Rac pathway. Febs Lett, 404, 227-233. Pagano, M., Pepperkok, R., Verde, F., Ansorge, W. and Draetta, G. (1992) Cyclin A is required at two points in the human cell cycle. Embo J, 11, 961-971. Pagano, M., Tam, S.W., Theodoras, A.M., Beer-Romero, P., Del Sal, G., Chau, V., Yew, P.R., Draetta, G.F. and Rolfe, M. (1995) Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27 [see comments]. S c ie n c e , 269, 682-685. Palmero, I. and Peters, G. (1996) Perturbation of cell cycle regulators in human cancer. Cancer Surv, 27, 351-367. Pang, L., Sawada, T., Decker, S.J. and Saltiel, A.R. (1995) Inhibition of MAP kinase kinase blocks the differentiation of PC-12 cells induced by nerve growth factor. J Biol Chem, 276, 13585-13588. Parada, L.F., Tabin, C.J., Shih, C. and Weinberg, R.A. (1982) Human EJ bladder carcinoma oncogene is homologue of Harvey sarcoma virus ras gene. Nature, 297, 474-478. Park, S.H. and Weinberg, R.A. (1995) A putative effector of Ral has homology to Rho/Rac GTPase activating proteins. O ncogene, 11, 2349-2355. Paulus, W., Baur, I., Boyce, F.M., Breakefield, X.O. and Reeves, S.A. (1996) Self- contained, tetracycline-regulated retroviral vector system for gene delivery to mammalian cells. J Virol, 70, 62-67. Payne, D.M., Rossomando, A.J., Martino, P., Erickson, A.K., Her, J.H., Shabanowitz, J., Hunt, D.F., Weber, M.J. and Sturgill, T.W. (1991) Identification of the

249 Chapter Seven - Bibliography

regulatory phosphorylation sites in pp42/mitogen- activated protein kinase (MAP kinase). Em bo J, 10, 885-892. Pear, W.S., Nolan, G.P., Scott, M.L. and Baltimore, D. (1993) Production of high- titer helper-free retroviruses by transient transfection. Proc Natl Acad Sol USA, 90, 8392-8396. Peeper, D.S., Upton, T.M., Ladha, M.H., Neuman, E., Zalvide, J., Bernards, R., DeCaprio, J.A. and Ewen, M.E. (1997) Ras signalling linked to the cell-cycle machinery by the retinoblastoma protein [published erratum appears in Nature 1997 Apr 3;386(6624):521]. N a tu re , 3B6, 177-181. Peppelenbosch, M.P., Qiu, R.G., de Vries-Smits, A.M., Tertoolen, L.G., de Laat, S.W., McCormick, P., Hall, A., Symons, M.H. and Bos, J.L (1995) Rac mediates growth factor-induced arachidonic acid release. Cell, 81, 849-856. Perez-Roger, I., Kim, S., Griffiths, B. and Land, H. (Manuscript in preparation) Myc-induced Cyclin D1 and D2 synthesis rates drive Cyclin E/CDK2 activation and proliferation by restricting binding of p27Kip1 and p21Cip1 to Cyclin e/CDK2. . Perez-Roger, I., Solomon, D.L., Sewing, A. and Land, H. (1997) Myc activation of cyclin E/Cdk2 kinase involves induction of cyclin E gene transcription and inhibition of p27(Kip1) binding to newly formed complexes. O ncogene, 14, 2373-2381. Perona, R., Esteve, P., Jimenez, B., Ballestero, R.P., Ramon, y.C.S. and Lacal, J.C. (1993) Tumorigenic activity of rho genes from Aplysia californica. Oncogene, 8, 1285-1292. Perona, R., Montaner, S., Saniger, L., Sanchez, P.I., Bravo, R. and Lacal, J.C. (1997) Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac-1 proteins. G enes Dev, 11, 463-475. Peter, M., Gartner, A., Horecka, J., Ammerer, G. and Herskowitz, I. (1993) FAR1 links the signal transduction pathway to the cell cycle machinery in yeast. Cell, 7 3, 747-760. Peter, M. and Herskowitz, I. (1994) Direct inhibition of the yeast cyclin-dependent kinase Cdc28-Cln by Farl. S cien ce, 285, 1228-1231. Peterson, S.N., Trabalzini, L., Brtva, T.R., Fischer, T., Altschuler, D.L., Martelli, P., Lapetina, E.G., Der, C.J. and White, G.C.n. (1996) Identification of a novel RalGDS-related protein as a candidate effector for Ras and Rapl. J Biol Chem, 271 , 29903-29908. Peto, R., Roe, F.J., Lee, P.N., Levy, L. and Clack, J. (1975) Cancer and ageing in mice and men. Br J Cancer, 32, 411-426. Phillips, A.C., Bates, S., Ryan, K.M., Helin, K. and Vousden, K.H. (1997) Induction of DNA synthesis and apoptosis are separable functions of E2F- 1. Genes Dev, 11 , 1853-1863. Pines, J. (1994) Protein kinases and cell cycle control. Semin Cell Biol, 5, 39 9- 408. Polyak, K., Kato, J.Y., Solomon, M.J., Sherr, C.J., Massague, J., Roberts, J.M. arxJ Koff, A. (1994a) p27Kip1, a cyclin-Cdk inhibitor, links transforming growth factor-beta and contact inhibition to cell cycle arrest. G enes Dev, 8, 9-22. Polyak, K., Lee, M.H., Erdjument-Bromage, H., Koff, A., Roberts, J.M., Tempst, P. and Massague, J. (1994b) Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell, 78, 59-66. Pomerance, M., Thang, M.N., Tocque, B. and Pierre, M. (1996) The Ras-GTPase- activating protein SH3 domain is required for Cdc2 activation and mos induction by

250 Chapter Seven - Bibliography oncogenic Ras in Xenopus oocytes independently of mitogen-activated protein kinase activation. Mol Cell Biol, 16, 3179-3186. Porter, P.L., Malone, K.E., Heagerty, P.J., Alexander, G.M., Gatti, L.A., Firpo, E.J., Daling, J.R. and Roberts, J.M. (1997) Expression of cell-cycle regulators p27Kip1 and cyclin E, alone and in combination, correlate with survival in young breast cancer patients [see comments]. Nat Med, 3, 222-225. Prendergast, G.C., Khosravi-Far, R., Solski, P.A., Kurzawa, H., Lebowitz, P.F. and Der, C.J. (1995) Critical role of Rho in cell transformation by oncogenic Ras. O n c o g e n e , 10, 2289-2296. Pritchard, C.A., Samuels, M.L, Bosch, E. and McMahon, M. (1995) Conditionally oncogenic forms of the A-Raf and B-Raf protein kinases display different biological and biochemical properties in NIH 3T3 cells. Molecular & Cellular Biology, 1 5, 6430-6442. Prive, G.G., Milburn, M.V., Tong, L., de Vos, A.M., Yamaizumi, Z., Nishimura, S. and Kim, S.H. (1992) X-ray crystal structures of transforming p21 ras mutants suggest a transition-state stabilization mechanism for GTP hydrolysis. Proc Natl A cad Scl USA, 89, 3649-3653. Pumiglia, K.M. and Decker, S.J. (1997) Cell cycle arrest mediated by the MEK/mitogen-activated protein kinase pathway. Proc Natl Acad Scl USA, 94, 448- 452. Qiu, R.G., Abo, A., McCormick, F. and Symons, M. (1997) Cdc42 regulates anchorage-independent growth and is necessary for Ras transformation. Mol Cell B iol, 17, 3449-3458. Qiu, R.G., Chen, J., Kirn, D., McCormick, F. and Symons, M. (1995a) An essential role for Rac in Ras transformation. Nature, 374, 457-459. Qiu, R.G., Chen, J., McCormick, F. and Symons, M. (1995b) A role for Rho in Ras transformation. Proc Natl Acad Scl USA, 92, 11781-11785. Quilliam, L.A., Huff, S.Y., Rabun, K.M., Wei, W., Park, W., Broek, D. and Der, C.J. (1994) Membrane-targeting potentiates guanine nucleotide exchange factor CDC25 and SCSI activation of Ras transforming activity. Proc Natl Acad Scl USA, 91, 8512-8516. Quilliam, L.A., Khosravi, F.R., Huff, S.Y. and Der, C.J. (1995) Guanine nucleotide exchange factors: activators of the Ras superfamily of proteins. B lo essa ys, 17, 395- 404. Quilliam, LA., Lambert, Q.T., Mickelson-Young, L.A., Westwick, J.K., Sparks, A.B., Kay, B.K., Jenkins, N.A., Gilbert, D.J., Copeland, N.G. and Der, C.J. (1996) Isolation of a NCK-associated kinase, PRK2, an SH3-binding protein and potential effector of Rho protein signaling. J Biol Chem, 271, 28772-28776. Rapp, U.R., Goldsborough, M.D., Mark, G.E., Bonner, T.I., Groff en, J., Reynolds, F.H., Jr. and Stephenson, J.R. (1983) Structure and biological activity of v-raf, a unique oncogene transduced by a retrovirus. Proceedings of the National Academy of Sciences of the United States of America, 80, 4218-4222. Ravi, R.K., Weber, E., McMahon, M., Williams, J.R., Baylin, S., Mai, A., Harter, M.L., Dillehay, L.E., Claudio, P.P., Giordano, A., Nelkin, B.D. and Mabry, M. (1 998) Activated Raf-1 causes growth arrest in human small cell lung cancer cells. J Clin Invest, ^0^, 153-159. Reddy, E.P., Reynolds, R.K., Santos, E. and Barbacid, M. (1982) A point mutation is responsible for the acquisition of transforming properties by the T24 human bladder carcinoma oncogene. Nature, 300, 149-152.

251 Chapter Seven - Bibliography

Reibel, L, Dorseuil, O., Stancou, R., Bertoglio, J. and Gacon, G. (1991) A hemopoietic specific gene encoding a small GTP binding protein is overexpressed during T cell activation. Biochem Biophys Res Commun, 175, 451-458. Reid, T., Furuyashiki, T., Ishizaki, T., Watanabe, G., Watanabe, N., Fujisawa, K., Morii, N., Madaule, P. and Narumiya, S. (1996) Rhotekin, anew putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophiiin in the Rho- binding domain. J Biol Chem, 271, 13556-13560. Reif, K., Nobes, C.D., Thomas, G., Hall, A. and Cantrell, D.A. (1996) Phosphatidylinositol 3-kinase signals activate a selective subset of Rac/Rho- dependent effector pathways. Current Biology, 6, 1445-1455. Reifenberger, G., Reifenberger, J., Ichimura, K., Meltzer, P.S. and Collins, V.P. (1994) Amplification of multiple genes from chromosomal region 12q13-14 in human malignant gliomas: preliminary mapping of the amplicons shows preferential involvement of CDK4, SAS, and MDM2. Cancer Res, 54, 4299-4303. Reinhard, J., Scheel, A.A., Diekmann, D., Hall, A., Ruppert, C. and Bahler, M. (1995) A novel type of myosin implicated in signalling by rho family GTPases. Embo J, 14, 697-704. Ren, X.D., Bokoch, G.M., Traynor-Kaplan, A., Jenkins, G.H., Anderson, R.A. and Schwartz, M.A. (1996) Physical association of the small GTPase Rho with a 6 8 -kDa phosphatidylinositol 4-phosphate 5-kinase in Swiss 3T3 cells. Molecular Biology of the Cell, 7, 435-442. Ren, X.D., Kiosses, W.B. and Schwartz, M.A. (1999) Regulation of the small GTP- binding protein rho by cell adhesion and the cytoskeleton.Embo J, 18, 578-585. Ren, Y., Li, R., Zheng, Y. and Busch, H. (1998) Cloning and characterization of GEF- H1, a microtubule-associated guanine nucleotide exchange factor for Rac and Rho GTPases. J Biol Chem, 273, 34954-34960. Renshaw, M.W., Ren, X.D. and Schwartz, M.A. (1997) Growth-factor activation of map kinase requires cell-adhesion. Embo J, 16, 5592-5599. Renshaw, M.W., Toksoz, D. and Schwartz, M.A. (1996) Involvement of the small GTPase rho in integrin-mediated activation of mitogen-activated protein kinase. Journal of Biological Chemistry, 27^, 21691-21694. Resnitzky, D. (1997) Ectopic expression of cyclin D1 but not cyclin E induces anchorage- independent cell cycle progression. Mol Cell Biol, 17, 5640-5647. Resnitzky, D., Hengst, L. and Reed, S.l. (1995) Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1. Mol Cell 8 /0/, 15, 4347-4352. Reynet, C. and Kahn, C.R. (1993) Rad: a member of the Ras family overexpressed in muscle of type II diabetic humans. S cien ce, 262, 1441-1444. Ridley, A.J., Paterson, H.F., Johnston, C.L., Diekmann, D. and Hall, A. (1992) The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell, 70, 401-410. Ridley, A.J., Paterson, H.F., Noble, M. and Land, H. (1988) Ras-mediated cell cycle arrest is altered by nuclear oncogenes to induce Schwann cell transformation. Embo J,7, 1635-1645. Ridley, A.J., Self, A.J., Kasmi, F., Paterson, H.F., Hall, A., Marshall, C.J. and Ellis, C. (1993) rho famiiy GTPase activating proteins pi 90, bcr and rhoGAP show distinct specificities in vitro and in vivo.Em bo J, 12, 5151-5160.

252 Chapter Seven - Bibliography

Riva, C., Lavieille, J.P., Reyt, E., Brambilla, E., Lunardi, J. and Brambilla, C (1995) Differential c-myc, c-jun, c-raf and p53 expression in squamous cell carcinoma of the head and neck: implication in drug and radioresistance. Eur J Cancer B Oral Oncol, 384-391. Roche, S., Koegl, M. and Courtneidge, S.A. (1994) The phosphatidylinositol 3-kinase alpha is required for DNA synthesis induced by some, but not all, growth factors. Proceedings of the National Academy of Sciences of the United States of America, 91 , 9185-9189. Rodenhuis, S. (1992) ras and human tumors. Semin Cancer Biol, 3, 241-247. Rodriguez-Viciana, P., Warne, P.M., Dhand, R., Vanhaesebroeck, B., Gout, I., Fry, M.J., Waterfield, M.D. and Downward, J. (1994) Phosphatidylinositol-3-OH kinase as a direct target of Ras [see comments]. Nature, 370, 527-532. Rodriguez-Viciana, P., Warne, P.M., Khwaja, A,, Marte, B.M., Pappin, D., Das, P., Waterfield, M.D., Ridley, A. and Downward, J. (1997) Role of phosphoinositide 3 - OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell, 89, 457-467. Rodriguez-Viciana, P., Warne, P.M., Vanhaesebroeck, B., Waterfield, M.D. and Downward, J. (1996) Activation of phosphoinositide 3-kinase by interaction with Ras and by point mutation. Embo Journal, 15, 2442-2451. Rommel, 0., Radziwill, G., Lovric, J., Noeldeke, J., Heinicke, T., Jones, D., Aitken, A. and Moelling, K. (1996) Activated Ras displaces 14-3-3 protein from the amino terminus of c-Raf- 1. O n co g en e, 12, 609-619. Rommel, 0., Radziwill, G., Moelling, K. and Hafen, E. (1997) Negative regulation of raf activity by binding of 14-3-3 to the amino-terminus of raf in-vivo. Mech Dev, 64, 95-104. Ron, D., Zannini, M., Lewis, M., Wickner, R.B., Hunt, L.T., Graziani, G., Tronick, S.R., Aaronson, S.A. and Eva, A. (1991) A region of proto-dbl essential for its transforming activity shows sequence similarity to a yeast cell cycle gene, GDC24, and the human breakpoint cluster gene, bcr. New Biol, 3, 372-379. Rozakis-Adcock, M., Fernley, R., Wade, J., Pawson, I. and Bowtell, D. (1993) The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras activator mSosI [see comments]. Nature, 363, 83-85. Ruley, H.E. (1983) Adenovirus early region 1A enables viral and cellular transforming genes to transform primary cells in culture. N ature, 304, 602-606. Rush, M.G., Drivas, G. and D'Eustachio, P. (1996) The small nuclear GTPase Ran: how much does it run? B io essa ys, 18, 103-112. Russo, A.A., Jeffrey, P.D., Patten, A.K., Massague, J. and Pavletich, N.P. (1996a) Crystal structure of the p27Kip1 cyclin-dependent-kinase inhibitor bound to the cyclin A-Cdk2 complex [see comments]. Nature, 3S2, 325-331. Russo, A.A., Jeffrey, P.D. and Pavletich, N.P. (1996b) Structural basis of cyclin- dependent kinase activation by phosphorylation. Nat Struct Biol, 3, 696-700, Russo, A.A., Tong, L., Lee, J.O., Jeffrey, P.D. and Pavletich, N.P. (1998) Structural basis for inhibition of the cyclin-dependent kinase Cdk6 by the tumour suppressor p16INK4a. N a tu re, 395, 237-243. Saez, R., Chan, A.M., Miki, T. and Aaronson, S.A. (1994) Oncogenic activation of human R-ras by point mutations analogous to those of prototype H-ras oncogenes. O n co g en e, 9, 2977-2982.

253 Chapter Seven - Bibliography

Saha, P., Eichbaum, Q., Silberman, E.D., Mayer, BJ. and Dutta, A. (1997) p21CIP1 and Cdc25A: competition between an inhibitor and an activator of cyclin-dependent kinases. Mol Cell Biol, 17, 4338-4345. Samuels, M.L. and McMahon, M. (1994) Inhibition of platelet-derived growth factor- and epidermal growth factor-mediated mitogenesis and signaling in 3T3 cells expressing delta Raf-1 :ER, an estradiol-regulated form of Raf-1. Molecular & Cellular Biology, 14, 7855-7866. Samuels, M.L., Weber, M.J., Bishop, J.M. and McMahon, M. (1993) Conditional transformation of cells and rapid activation of the mitogen- activated protein kinase cascade by an estradiol-dependent human raf-1 protein kinase. Mol Cell Biol, 1 3, 6241-6252. Santos, E., Tronick, S.R., Aaronson, S.A., Pulciani, S. and Barbacid, M. (1982) T24 human bladder carcinoma oncogene is an activated form of the normal human homologue of BALB- and Harvey-MSV transforming genes. Nature, 298, 343-347. Schaap, D., van der Wal, J., Howe, L.R., Marshall, C.J. and van Blitterswijk, W.J. (1993) A dominant-negative mutant of raf blocks mitogen-activated protein kinase activation by growth factors and oncogenic p21ras. Journal of Biological Chemistry, 268, 20232-20236. Schaeffer, N.J., Catling, A.D., Eblen, ST., Collier, L.S., Krauss, A. and Weber, M.J. (1998) MPI: a MEK binding partner that enhances enzymatic activation of the MAP kinase cascade [see comments]. Science, 28^, 1668-1671. Scheffzek, K., Ahmadian, M.R., Kabsch, W., Wiesmuller, L., Lautwein, A., Schmitz, F. and Wittinghofer, A. (1997) The ras-rasgap complex - structural basis for GTPase activation and its loss in oncogenic ras mutants. Science, 277, 333-338. Scherle, P., Behrens, T. and Staudt, L.M. (1993) Ly-GDI, a GDP-dissociation inhibitor of the RhoA GTP-binding protein, is expressed preferentially in lymphocytes. Proc Nati Acad Sci USA, 90, 7568-7572. Schimmoller, P., Simon, I. and Pfeffer, S.R. (1998) Rab GTPases, directors of vesicle docking. J Biol Chem, 273, 22161-22164. Schmidt, G., Sehr, P., Wilm, M., Selzer, J., Mann, M. and Aktories, K. (1997) Gin 63 of Rho is deamidated by Escherichia coli cytotoxic necrotizing factor-1. Nature, 387, 725-729. Schulte, T.W., Blagosklonny, M.V., Ingui, C. and Neckers, L. (1995) Disruption of the Raf-1-Hsp90 molecular complex results in destabilization of Raf-1 and loss of Raf-1-Ras association. J Biol Chem, 270, 24585-24588. Schulte, T.W., Blagosklonny, M.V., Romanova, L., Mushinski, J.F., Monia, B.P., Johnston, J.F., Nguyen, P., Trepel, J. and Neckers, L.M. (1996) Destabilization of Raf-1 by geldanamycin leads to disruption of the Raf- 1 -MEK-mitogen-activated protein kinase signalling pathway. Mol Cell Biol, 16, 5839-5845. Schulze, A., Zerfass, K., Spitkovsky, D., Middendorp, S., Berges, J., Helin, K., Jansen-Durr, P. and Henglein, B. (1995) Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site. Proc Natl Acad Sci U SA, 92, 1 1264- 11268. Schulze, A., Zerfass-Thome, K., Berges, J., Middendorp, S., Jansen-Durr, P. and Henglein, B. (1996) Anchorage-dependent transcription of the cyclin A gene.M oi Ceil Biol, 16, 4632-4638. Schwartz, M.A., Toksoz, D. and Khosravi Far, R. (1996) Transformation by Rho exchange factor oncogenes is mediated by activation of an integrin-dependent pathway. Em bo J, 15, 6525-6530.

254 Chapter Seven - Bibliography

Sebastian, B., Kakizuka, A. and Hunter, T. (1993) Cdc25M2 activation of cyclin- dependent kinases by dephosphorylation of threonine-14 and tyrosine-15. Proc Natl A cad S ci USA, 90, 3521-3524. Sells, M.A., Knaus, U.G., Bagrodia, S., Ambrose, D.M., Bokoch, G.M. and Chernoff, J. (1997) Human p21-activated kinase (paki) regulates actin organization in mammalian-cells. Curr Biol, 7, 202-210. Serrano, M., Hannon, G.J. and Beach, D. (1993) A new regulatory motif in cell- cycle control causing specific inhibition of cyclin D/CDK4 [see comments]. Nature, 366, 704-707. Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D. and Lowe, S.W. (1997) Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16(ink4a). Ceil, 88, 593-602. Settleman, J., Albright, C.F., Foster, L.C. and Weinberg, R.A. (1992) Association between GTPase activators for Rho and Ras families. Nature, 359, 153-154. Sewell, J.L. and Kahn, R.A. (1988) Sequences of the bovine and yeast ADP- ribosyiation factor and comparison to other GTP-binding proteins. Proc Natl Acad Sci USA, 6 5 , 4620-4624. Sewing, A., Perez-Roger, I. and Land, H. (Manuscript in preparation) Myc rescues Raf-induced cell cycle arrest via inactivation of p21Cip1. . Sewing, A., Wiseman, B., Lloyd, A.C. and Land, H. (1997) High-intensity Raf signal causes cell cycle arrest mediated by p21Cip1. Molecular & Cellular Biology, 17, 5588-5597. Sheikh, M.S., Li, X.S., Chen, J.C., Shao, Z.M., Ordonez, J.V. and Fontana, J.A. (1 994) Mechanisms of regulation of WAFI/Cipl gene expression in human breast carcinoma: role of p53-dependent and independent signal transduction pathways.Oncogene, 9, 3407-3415. Sherr, C.J. (1993) Mammalian G1 cyclins. Cell, 73, 1059-1065. Shih, C. and Weinberg, R.A. (1982) Isolation of a transforming sequence from a human bladder carcinoma cell line. Cell, 29, 161-169. Shimizu, K., Birnbaum, D., Ruley, M.A., Fasano, O., Suard, Y., Ediund, L., Taparowsky, E., Goldfarb, M. and Wigler, M. (1983a) Structure of the Ki-ras gene of the human lung carcinoma cell line Calu- 1. N ature, 304, 497-500. Shimizu, K., Goldfarb, M., Suard, Y., Perucho, M., Li, Y., Kamata, T., Feramisco, J., Stavnezer, E., Fogh, J. and Wigler, M.H. (1983b) Three human transforming genes are related to the viral ras oncogenes. Proc Natl Acad Sci USA, 80, 2112-2116. Shiohara, M., el-Deiry, W.S., Wada, M., Nakamaki, T., Takeuchi, S., Yang, R., Chen, D.L., Vogelstein, B. and Koeffler, H.P. (1994) Absence of WAF1 mutations in a variety of human malignancies. Blood, 84, 3781-3784. Shpetner, H., Joly, M., Hartley, D. and Corvera, S. (1996) Potential sites of PI-3 kinase function in the endocytic pathway revealed by the PI-3 kinase inhibitor, wortmannin. J Cell Biol, 132, 595-605. Simon, M.A., Bowtell, D.D., Dodson, G.S., Laverty, T.R. and Rubin, G.M. (1991) Rasi and a putative guanine nucleotide exchange factor perform crucial steps in signaling by the sevenless protein tyrosine kinase. Cell, 67, 701-716. Sinn, E., Muller, W., Pattengaie, P., Tepler, I., Wallace, R. and Leder, P. (1 987) Coexpression of MMTV/v-Ha-ras and MMTV/c-myc genes in transgenic mice: synergistic action of oncogenes in vivo. Ceil, 49, 465-475.

255 Chapter Seven - Bibliography

Sithanandam, G., Dean, M., Brennscheidt, U., Beck, T., Gazdar, A., Minna, J.D., Branch, H., Zbar, B. and Rapp, U.R. (1989) Loss of heterozygosity at the c-raf locus in small cell lung carcinoma. O ncogene, 4, 451-455. Skolnik, E.Y., Batzer, A., Li, N., Lee, C.H., Lowenstein, E., Mohammadi, M., Margolis, B. and Schlessinger, J. (1993) The function of GRB2 in linking the insulin receptor to Ras signaling pathways. Science, 260, 1953-1955. Smith, M.R., Heidecker, G., Rapp, U.R. and Kung, H,F. (1990) Induction of transformation and DNA synthesis after microinjection of raf proteins. Molecular & Cellular Biology, 10, 3828-3833. Solomon, M.J., Lee, T. and Kirschner, M.W. (1992) Role of phosphorylation in p34cdc2 activation: identification of an activating kinase. Mol Biol Cell, 3, 13-27. Soos, T.J., Kiyokawa, H., Yan, J.S., Rubin, M.S., Giordano, A., DeBlasio, A., Bottega, S., Wong, B., Mendelsohn, J. and Koff, A. (1996) Formation of p27-CDK complexes during the human mitotic cell cycle. Cell Growth Differ,!, 135-146. Soulez, M., Rouviere, C.G., Chafey, P., Hentzen, D., Vandromme, M., Lautredou, N., Lamb, N., Kahn, A. and Tuil, D. (1996) Growth and differentiation of C2 myogenic cells are dependent on serum response factor. Mol Cell Biol, 16, 6065-6074. Spaargaren, M. and Bischoff, J.R. (1994) Identification of the guanine nucleotide dissociation stimulator for Ral as a putative effector molecule of R-ras, H-ras, K - ras, and Rap. Proceedings of the National Academy of Sciences of the United States of America,Q^, 12609-12613. Sprenger, F., Trosclair, M.M. and Morrison, D.K. (1993) Biochemical analysis of torso and D-raf during Drosophila embryogenesis: implications for terminal signal transduction. Moi Ceii Bioi, A3, 1163-1172. Stacey, D.W., Feig, L.A. and Gibbs, J.B. (1991) Dominant inhibitoryRas mutants selectively inhibit the activity of either cellular or oncogenic Ras. Moi Ceii Bioi, 11, 4053-4064. Stacey, D.W. and Kung, H.F. (1984) Transformaton of NIH 3T3 cells by microinjection of Ha-ras p21 protein. Nature, 3A0, 508-511. Stang, S., Bottorff, D. and Stone, J.C. (1997) Interaction of activated ras with raf-1 alone may be sufficient for transformation of rat2 cells. Moi Ceii Bioi, 17, 30 47- 3055. Stanton, V.P., Jr. and Cooper, G.M. (1987) Activation of human raf transforming genes by deletion of normal amino-terminal coding sequences. Molecular & Cellular Biology, 7, 1171-1179. Stanton, V.P., Jr., Nichols, D.W., Laudano, A.P. and Cooper, G.M. (1989) Definition of the human raf amino-terminal regulatory region by deletion mutagenesis. Mol Ceii Bioi, 9, 639-647. Steeg, P.S. and Abrams, J.S. (1997) Cancer prognostics: past, present and p27 [news; comment]. Nat Med, 3, 152-154. Steinman, R.A., Hoffman, B., Iro, A., Guillouf, C., Liebermann, D.A. and el-Houseini, M.E. (1994) Induction of p21 (WAF-1/CIP1) during differentiation. Oncogene, 9, 3389-3396. Stephens, L.R., Hughes, K.T. and Irvine, R.F. (1991) Pathway of phosphatidylinositol(3,4,5)-trisphosphate synthesis in activated neutrophils. Nature, 36A, 33-39.

256 Chapter Seven - Bibliography

Sternberg, P.W., Golden, A. and Han, M. (1993) Role of a raf proto-oncogene during Caenorhabditis elegans vulval development. Philos Trans R Sac Land B Biol Sci, 340, 259-265. Stokoe, D., Engel, K., Campbell, D.G., Cohen, P. and Gaestel, M. (1992) Identification of MAPKAP kinase 2 as a major enzyme responsible for the phosphorylation of the small mammalian heat shock proteins. FEBS Lett, 313, 307-313. Stokoe, D., Macdonald, S.G., Cadwallader, K., Symons, M. and Hancock, J.F. (1994) Activation of Raf as a result of recruitment to the plasma membrane [published erratum appears in Science 1994 Dec 16;266(5192): 1792-3]. Science, 264, 1463-1467. Stokoe, D. and McCormick, F. (1997) Activation of c-raf-1 by ras and src through different mechanisms - activation in-vivo and in-vitro. Em bo J, 16, 2384-2396. Sukumar, S., Notario, V., Martin-Zanca, D. and Barbacid, M. (1983) Induction of mammary carcinomas in rats by nitroso-methylurea involves malignant activation of H-ras-1 locus by single point mutations. Nature, 306, 658-661. Sulciner, D.J., Irani, K., Yu, Z.X., Ferrans, V.J., Goldschmidt-Clermont, P. and Finkel, T. (1996) rad regulates a cytokine-stimulated, redox-dependent pathway necessary for NF-kappaB activation. Moi Ceil Biol,'IG, 7115-7121. Sun, H., Charles, C.H., Lau, L.F. and Tonks, N.K. (1993) MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAP kinase in vivo. Cell, 75, 487-493. Sweeney, K.J., Sarcevic, B., Sutherland, R.L and Musgrove, E.A. (1997) Cyclin D2 activates Cdk2 in preference to Cdk4 in human breast epithelial cells. Oncogene, 1 4, 1 329-1 340. Symons, M., Derry, J.M., Karlak, B., Jiang, S., Lemahieu, V., Mccormick, F., Francke, U. and Abo, A. (1996) Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Ceil, 84, 723-734. Szczylik, C., Skorski, T., Nicoiaides, N.C., Manzelia, L., Malaguarnera, L., Venturelli, D., Gewirtz, A.M. and Calabretta, B. (1991) Selective inhibition of leukemia cell proliferation by BCR-ABL antisense oligodeoxynucleotides. Science, 253, 562-565. Tabin, C.J., Bradley, S.M., Bargmann, C.I., Weinberg, R.A., Papageorge, A.G., Scolnick, E.M., Dhar, R., Lowy, D.R. and Chang, E.H. (1982) Mechanism of activation of a human oncogene. Nature, 300, 143-149. Takahashi, K., Sasaki, T., Mammoto, A., Hotta, I., Takaishi, K., Imamura, H., Nakano, K., Kodama, A. and Takai, Y. (1998) Interaction of radixin with Rho small G protein GDP/GTP exchange protein Dbl. O ncogene, 16, 3279-3284. Takahashi, K., Sasaki, T., Mammoto, A., Takaishi, K., Kameyama, T., Tsukita, S. and Takai, Y. (1997) Direct interaction of the Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates the activation of the Rho small G protein. J B iol Chem, 272, 23371-23375. Takai, Y., Kaibuchi, K., Kikuchi, A., Sasaki, T. and Shirataki, H. (1993) Regulators of small GTPases. Ciba Found Symp, 176, 128-138; discussion 138-146. Takekawa, M., Posas, F. and Saito, H. (1997) A human homolog of the yeast Ssk2/Ssk22 MAP kinase kinase kinases, MTK1, mediates stress-induced activation of the p38 and JNK pathways. Embo J, 16, 4973-4982. Tan, E.C., Leung, T., Manser, E. and Lim, L. (1993) The human active breakpoint cluster region-related gene encodes a brain protein with homology to guanine

257 Chapter Seven - Bibliography nucleotide exchange proteins and GTPase-activating proteins. J Biol Chem, 2 68, 27291-27298. Tan, Y., Rouse, J., Zhang, A., Cariati, S., Cohen, P. and Comb, M.J. (1996) FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2. Embo J, 15, 4629-4642. Tanaka, N., Ishihara, M., Kitagawa, M., Harada, H., Kimura, T., Matsuyama, T., Lamphier, M.S., Aizawa, S., Mak, T.W. and Taniguchi, T. (1994) Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell, 7 7, 829-839. Tanaka, N., Ishihara, M., Lamphier, M.S., Nozawa, H., Matsuyama, T., Mak, T.W., Aizawa, S., Tokino, T., Oren, M. and Taniguchi, T. (1996) Cooperation of the tumour suppressors IRF-1 and p53 in response to DNA damage. Nature, 382, 816-818. Tang, Y., Chen, Z., Ambrose, D., Liu, J., Gibbs, J.B., Chernoff, J. and Field, J. (1997) Kinase-deficient Paki mutants inhibit Ras transformation of Rat-1 fibroblasts. Mol Cell Biol, 17, 4454-4464. Taparowsky, E., Suard, Y., Fasano, O., Shimizu, K., Goldfarb, M. and Wigler, M. (1982) Activation of the T24 bladder carcinoma transforming gene is linked to a single amino acid change. Nature, 300, 762-765. Tapon, N., Nagata, K., Lamarche, N. and Hall, A. (1998) A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-kappaB signalling pathways. EMBO Journal, 17, 1395-1404. Teo, M., Manser, E. and Lim, L. (1995) Identification and molecular cloning of a p21cdc42/rac1-activated serine/threonine kinase that is rapidly activated by thrombin in platelets. J Bio! Chem, 270, 26690-26697. Terada, Y., Tatsuka, M., Jinno, S. and Okayama, H. (1995) Requirement for tyrosine phosphorylation of Cdk4 in G1 arrest induced by ultraviolet irradiation. Nature, 376, 358-362. Teramoto, H., Coso, O.A., Miyata, H., Igishi, T., Miki, T. and Gutkind, J.S. (1996a) Signaling from the small GTP-binding proteins Rad and Cdc42 to the c-Jun N - terminal kinase/stress-activated protein kinase pathway. A role for mixed lineage kinase 3/protein-tyrosine kinase 1, a novel member of the mixed lineage kinase family. J Biol Chem, 271, 27225-27228. Teramoto, H., Crespo, P., Coso, O.A., Igishi, T., Xu, N. and Gutkind, J.S. (1996b) The small GTP-binding protein rho activates c-Jun N-terminal kinases/stress-activated protein kinases in human kidney 293T cells. Evidence for a Pak-independent signaling pathway. J Biol Chem, 271, 25731-25734. Therrien, M., Chang, H.C., Solomon, N.M., Karim, F.D., Wassarman, D.A. and Rubin, G.M. (1995) KSR, a novel protein kinase required for RAS signal transduction [see comments]. Cell, 83, 879-888. Therrien, M., Michaud, N.R., Rubin, G.M. and Morrison, D.K, (1996) KSR modulates signal propagation within the MAPK cascade. G enes Dev, 10, 2684-2695. Therrien, M., Wong, A.M. and Rubin, G.M. (1998) CNK, a RAF-binding multidomain protein required for RAS signaling. Cell, 95, 343-353. Thompson, T.C., Southgate, J., Kitchener, G. and Land, H. (1989) Multistage carcinogenesis induced by ras and myc oncogenes in a reconstituted organ. Cell, 5 6 , 917-930. Thorburn, J., McMahon, M. and Thorburn, A. (1994) Raf-1 kinase activity is necessary and sufficient for gene expression changes but not sufficient for cellular

258 Chapter Seven - Bibliography morphology changes associated with cardiac myocyte hypertrophy. J Biol Chem, 269, 30580-30586. Thorburn, J., Xu, S. and Thorburn, A. (1997) MAP kinase- and Rho-dependent signals interact to regulate gene expression but not actin morphology in cardiac muscle cells, Em bo J, 16, 1888-1900. Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Broek, D., Cameron, S., Broach, J., Matsumoto, K. and Wigler, M. (1985) In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell, 40, 27-36. Toyoshima, H. and Hunter, T. (1994) p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell, 78, 67-74. Trahey, M. and McCormick, F. (1987) A Cytoplasmic Protein Stimulates Normal N - ras p21 GTPase, but Does Not affect Oncogenic Mutants. Science, 238, 542-545. Traverse, S., Cohen, P., Paterson, H., Marshall, C., Rapp, U. and Grand, R.J. (1 993) Specific association of activated MAP kinase kinase kinase (Raf) with the plasma membranes of ras-transformed retinal cells. Oncogene, 8, 3175-3181. Treisman, R. (1990) The SRE: a growth factor responsive transcriptional regulator, S em in Cancer Biol, 1, 47-58. Treisman, R. (1992) The serum response element. Trends Biochem Sci, 17, 42 3- 426. Treisman, R. (1994) Ternary complex factors: growth factor regulated transcriptional activators. Curr Opin Genet Dev, 4, 96-101. Tzivion, G., Luo, Z. and Avruch, J. (1998) A dimeric 14-3-3 protein is an essential cofactor for Raf kinase activity. Nature, 394, 88-92. Ueda, T., Kikuchi, A., Ohga, N., Yamamoto, J. and Takai, Y. (1990) Purification and characterization from bovine brain cytosol of a novel regulatory protein inhibiting the dissociation of GDP from and the subsequent binding of GTP to rhoB p20, a ras p21-like GTP-binding protein. J Biol Chem, 265, 9373-9380. Ueda, Y., Mirai, S., Osada, S., Suzuki, A., Mizuno, K. and Ohno, S. (1996) Protein kinase C activates the MEK-ERK pathway in a manner independent of Ras and dependent on Raf.J Biol Chem, 271, 23512-23519. Ulsh, L.S. and Shih, T.Y. (1984) Metabolic turnover of human c-rasH p21 protein of EJ bladder carcinoma and its normal cellular and viral homologs. Mol Cell Biol, 4, 1647-1652. Urano, T., Emkey, R. and Feig, L.A. (1996) Ral-GTPases mediate a distinct downstream signaling pathway from Ras that facilitates cellular transformation. Embo Journal, 15, 810-816. Urich, M., Senften, M., Shaw, P.E. and Ballmer-Hofer, K. (1997) A role for the small GTPase Rac in polyomavirus middle-T antigen- mediated activation of the serum response element and in cell transformation. O ncogene, 14, 1235-1241. Valius, M. and Kazlauskas, A. (1993) Phospholipase C-gamma 1 and phosphatidylinositol 3 kinase are the downstream mediators of the PDGF receptor's mitogenic signal. Cell, 73, 321-334. Van Aelst, L., D'Souza-Schorey C. (1997) Rho GTPases and signaling networks. G enes Dev, 11, 2295-2322. Van Aelst, L., Barr, M., Marcus, S., Polverino, A. and Wigler, M. (1993) Complex formation between RAS and RAF and other protein kinases. Proceedings of the National Academy of Sciences of the United States of America, 90, 6213-6217.

259 Chapter Seven - Bibliography

Van Aelst, L, Joneson, T. and Bar Sagi, D. (1996) identification of a novel Racl- interacting protein involved in membrane ruffling. EMBO J, 15, 3778-3786. van den Berghe, N., Cool, R.H., Horn, G. and Wittinghofer, A. (1997) Biochemical characterization of C3G; an exchange factor that discriminates between Rapl and Rap2 and is not inhibited by Rap1A(S17N). O ncogene, 15, 845-850. van Grunsven, L.A., Billon, N., Savatier, P., Thomas, A., Urdiales, J.L. and Rudkin, B.B. (1996) Effect of nerve growth factor on the expression of cell cycle regulatory proteins in PCI2 cells: dissection of the neurotrophic response from the anti­ mitogenic response. O ncogene, 12, 1347-1356. Vanhaesebroeck, B., Stein, R.C. and Waterfield, M.D. (1996) The study of phosphoinositide 3-kinase function. Cancer Surv, 27, 249-270. Vawas, D., Li, X., Avruch, J. and Zhang, X.F. (1998) Identification of Norel as a potential Ras effector. J Biol Chem, 273, 5439-5442. Vecchio, G., Cavazzana, A.O., Triche, T.J., Ron, D., Reynolds, C.P. and Eva, A. ( 1 98 9) Expression of the dbl proto-oncogene in Ewing's sarcomas. O ncogene, 4, 897-900. Vlach, J., Hennecke, S., Alevizopoulos, K., Conti, D. and Amati, B. (1996) Growth arrest by the cyclin-dependent kinase inhibitor p27Kip1 is abrogated by c-Myc. Em bo J, 15, 6595-6604. Vlahos, C.J., Matter, W.F., Hui, K.Y. and Brown, R.F. (1994) A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4- morpholinyl)-8-phenyl-4H-1- benzopyran-4-one (LY294002). J Biol Chem, 269, 5241-5248. Vogel, U.S., Dixon, R.A., Schaber, M.D., Diehl, R.E., Marshall, M.S., Scolnick, E.M., Sigal, I.S. and Gibbs, J.B. (1988) Cloning of bovine GAP and its interaction with oncogenic ras p21. N ature, 335, 90-93. Vojtek, A.B., Hollenberg, S.M. and Cooper, J.A. (1993) Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell, 74, 205-214. Volknandt, W., Pevsner, J., Elferink, L.A. and Scheller, R.H. (1993) Association of three small GTP-binding proteins with cholinergic synaptic vesicles. FEBS Lett, 317, 53-56. Wan, M., Cofer, K.F. and Dubeau, L. (1996) WAF1/CIP1 structural abnormalities do not contribute to cell cycle deregulation in ovarian cancer. Br J Cancer, 7 3, 1 398- 1400. Wang, J., Chenivesse, X., Henglein, B. and Brechot, C. (1990) Hepatitis B virus integration in a cyclin A gene in a hepatocellular carcinoma. Nature, 3 43, 555- 557. Wang, J., Zindy, F., Chenivesse, X., Lamas, E., Henglein, B. and Brechot, C. (1 992) Modification of cyclin A expression by hepatitis B virus DNA integration in a hepatocellular carcinoma. Oncogene,!, 1653-1656. Wang, T.C., Cardiff, R.D., Zukerberg, L., Lees, E., Arnold, A. and Schmidt, E.V. (1994) Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature, 369, 669-671. Wang, Y., Xu, H.P., Riggs, M., Rodgers, L. and Wigler, M. (1991) byr2, a Schizosaccharomyces pombe gene encoding a protein kinase capable of partial suppression of the rasi mutant phenotype. Mol Cell Biol, 11, 3554-3563. Warne, P.H., Viciana, P.R. and Downward, J. (1993) Direct interaction of Ras and the amino-terminal region of Raf-1 in vitro. Nature, 364, 352-355.

260 Chapter Seven - Bibliography

Wary, K.K., Mainiero, F., Isakoff, SJ., Marcantonio, E.E. and Giancotti, F.G. (1996) The adaptor protein She couples a class of integrins to the control of cell cycle progression. Cell, 87, 733-743. Wary, K.K., Mariotti, A., Zurzolo, C. and Giancotti, F.G. (1998) A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell, 94, 625-634. Waskiewicz, A.J., Flynn, A., Proud, C.G. and Cooper, J.A. (1997) Mitogen-activated protein kinases activate the serine/threonine kinases Mnki and Mnk2. Embo J, 1 6 , 1909-1920. Wasserman, J.D. and Freeman, M. (1998) An autoregulatory cascade of EGF receptor signaling patterns the Drosophila egg [see comments). Cell, 95, 355-364. Watanabe, G., Saito, Y., Madaule, P., Ishizaki, T., Fujisawa, K., Morii, N., Mukai, H., Ono, V., Kakizuka, A. and Narumiya, S. (1996) Protein kinase N (PKN) and PKN- related protein rhophiiin as targets of small GTPase Rho. Scien ce, 271, 645-648. Watanabe, N. and Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A., Saito, Y., Nakao, K., Jockusch, B.M., Narumiya, S. (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target protein for Rho small GTPase and is a ligand for profilin. EMBO J, 16, 3044-3056. Weintraub, S.J., Chow, K.N., Luo, R.X., Zhang, S.H., He, S. and Dean, D.C. (1 995) Mechanism of active transcriptional repression by the retinoblastoma protein. Nature, 375, 812-815. Weintraub, S.J., Prater, C.A. and Dean, D.C. (1992) Retinoblastoma protein switches the E2F site from positive to negative element. Nature, 358, 259-261. Welch, H., Eguinoa, A., Stephens, L.R. and Hawkins, P.T. (1998) Protein kinase B and rac are activated in parallel within a phosphatidylinositide 30H-kinase- controlled signaling pathway. J Biol Chem, 273, 11248-11256. Welcker, M., Lukas, J., Strauss, M. and Bartek, J. (1996) Enhanced protein stability: a novel mechanism of D-type cyclin over- abundance identified in human sarcoma cells. Oncogene, ^3, 419-425. Welcker, M., Lukas, J., Strauss, M. and Bartek, J. (1998) p21 WAF1/CIP1 mutants deficient in inhibiting cyclin-dependent kinases (CDKs) can promote assembly of active cyclin D/CDK4(6) complexes in human tumor cells. Cancer Res, 5 S , 505 3- 5056. Wennstrom, S., Hawkins, P., Cooke, F., Hara, K., Yonezawa, K., Kasuga, M., Jackson, T., Claesson-Welsh, L. and Stephens, L. (1994a) Activation of phosphoinositide 3 - kinase is required for PDGF-stimulated membrane ruffling. Curr Biol, 4, 38 5- 393. Wennstrom, S., Siegbahn, A., Yokote, K., Arvidsson, A.K., Heldin, C.H., Mori, S. and Claesson-Welsh, L. (1994b) Membrane ruffling and chemotaxis transduced by the PDGF beta-receptor require the binding site for phosphatidylinositol 3' kinase. Oncogene, 9, 651-660. Wes, P.D., Yu, M. and Montell, C. (1996) RIC, a calmodulin-binding Ras-like GTPase. EmboJ,^5, 5839-5848. Westwick, J.K., Lambert, Q.T., Clark, G.J., Symons, M., Van Aelst, L., Pestell, R.G. and Der, C.J. (1997) Rac regulation of transformation, gene expression, and actin organization by multiple, PAK-independent pathways. Molecular & Cellular Biology, 17, 1324-1335.

261 Chapter Seven - Bibliography

White, M.A., Nicolette, C., Minden, A., Polverino, A., Van Aelst, L, Karin, M. and Wigler, M.H. (1995) Multiple Ras functions can contribute to mammalian cell transformation. Cell, SO, 533-541. White, M.A., Vale, T., Camonis, J.H., Schaefer, E. and Wigler, M.H. (1996) A role for the Ral guanine nucleotide dissociation stimulator in mediating Ras-induced transformation. Journal of Biological Chemistry, 2 7 16439-16442. Whitehead, I.P., Campbell, S., Rossman, K.L and Der, C.J. (1997) Dbl family proteins. Biochim Biophys Acta, 1332, F1-F23. Whitmarsh, A.J., Cavanagh, J., Tournier, 0., Yasuda, J. and Davis, R.J. (1998) A mammalian scaffold complex that selectively mediates MAP kinase activation [see comments]. Science, 2S‘\, 1671-1674. Wigler, M., Sweet, R., Sim, G.K., Wold, B., Pellicer, A., Lacy, E., Maniatis, T., Silverstein, S. and Axel, R. (1979) Transformation of mammalian cells with genes from procaryotes and eucaryotes. Cell, 16, 777-785. Winston, J.T., Coats, S.R., Wang, Y.Z. and Pledger, W.J. (1996) Regulation of the cell cycle machinery by oncogenic ras. O ncogene, 12, 127-134. Wittinghofer, A. and Nassar, N. (1996) How Ras-related proteins talk to their effectors. Trends Biochem Sc/, 21, 488-491. Wolfel, T., Hauer, M., Schneider, J., Serrano, M., Wolfel, C., Klehmann-Hieb, E., De Plaen, E., Hankein, T., Meyer zum Buschenfelde, K.H. and Beach, D. (1995) A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. S c ie n c e , 269, 1281-1284. Wolthuis, R.M., Bauer, B., van't, V.L., de, V.S.A., Cool, R.H., Spaargaren, M., Wittinghofer, A., Burgering, B.M. and Bos, J.L. (1996) RalGDS-like factor (Rif) is a novel Ras and Rap 1 A-associating protein. O ncogene, 13, 353-362. Wolthuis, R.M., de Ruiter, N.D., Cool, R.H. and Bos, J.L. (1997) Stimulation of gene induction and cell growth by the Ras effector Rif. EMBO Journal, 16, 6748-6761. Wolthuis, R.M.F., Zwartkruis, F., Moen, T.C. and Bos, J.L. (1998) Ras-dependent activation of the small GTPase ral. Curr Biol, 8, 471-474,. Wood, K.W., Qi, H., D'Arcangelo, G., Armstrong, R.C., Roberts, T.M. and Halegoua, S. (1993) The cytoplasmic raf oncogene induces a neuronal phenotype in PCI 2 cells: a potential role for cellular raf kinases in neuronal growth factor signal transduction. Proc Natl Acad Sci USA, 90, 5016-5020. Woods, D., Parry, D., Cherwinski, H., Bosch, E., Lees, E. and McMahon, M. (1 997) Raf-induced proliferation or cell cycle arrest is determined by the level of Raf activity with arrest mediated by p21Cip1. Molecular & Cellular Biology, 17, 5598-5611. Wu, J., Dent, P., Jelinek, T., Wolfman, A., Weber, M.J. and Sturgill, T.W. (1993a) Inhibition of the EGF-activated MAP kinase signaling pathway by adenosine 3',5'- monophosphate [see comments]. Science, 262, 1065-1069. Wu, J., Harrison, J.K., Dent, P., Lynch, K.R., Weber, M.J. and Sturgill, T.W. (1993b) Identification and characterization of a new mammalian mitogen- activated protein kinase kinase, MKK2. Mol Cell Biol, 13, 4539-4548. Wu, J., Michel, H., Rossomando, A., Haystead, T., Shabanowitz, J., Hunt, D.F. and Sturgill, T.W. (1992) Renaturation and partial peptide sequencing of mitogen- activated protein kinase (MAP kinase) activator from rabbit skeletal muscle. B iochem J, 285, 701-705.

262 Chapter Seven - Bibliography

Wu, W.J., Leonard, D.A., A-Cerione, R. and Manor, D. (1997) Interaction between Cdc42Hs and RhoGDI is mediated through the Rho insert region. J Biol Chem, 272, 26153-26158. Xia, K., Mukhopadhyay, N.K., Inhorn, R.C., Barber, D.L., Rose, P.E., Lee, R.S., Narsimhan, R.P., D'Andrea, A.D., Griffin, J.D. and Roberts, T.M. (1996) The cytokine-activated tyrosine kinase JAK2 activates Raf-1 in a p21ras- dependent manner. Proc Natl Acad Sci USA, 93, 11681-11686. Xing, H., Kornfeld, K. and Muslin, A.J. (1997) The protein kinase KSR interacts with 14-3-3 protein and Raf. Curr Biol, 7, 294-300. Xing, J., Ginty, D.D. and Greenberg, M.E. (1996) Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science, 273, 959-963. Xiong, Y., Connolly, T., Futcher, B. and Beach, D, (1991) Human D-type cyclin. Cell, 65, 691-699. Xiong, V., Hannon, G.J., Zhang, H., Casso, D., Kobayashi, R. and Beach, D. (199 3) p21 is a universal inhibitor of cyclin kinases. N ature, 366, 701-704. Xu, G.F., Lin, B., Tanaka, K., Dunn, D., Wood, D., Gesteland, R., White, R., Weiss, R. and Tamanoi, F. (1990a) The catalytic domain of the neurofibromatosis type 1 gene product stimulates ras GTPase and complements ira mutants of S. cerevisiae. Cell, 63, 835-841. Xu, G.F., O'Connell, P., Viskochil, D., Cawthon, R., Robertson, M., Culver, M., Dunn, D., Stevens, J., Gesteland, R., White, R. and et al. (1990b) The neurofibromatosis type 1 gene encodes a protein related to GAP. Cell, 62, 599-608. Yamamoto, M., Marui, N., Sakai, T., Morii, N., Kozaki, S., Ikai, K., Imamura, S. and Narumiya, S. (1993) ADP-ribosylation of the rhoA gene product by botulinum C3 exoenzyme causes Swiss 3T3 cells to accumulate in the G1 phase of the cell cycle. O n co g en e, 8, 1449-1455. Yamasaki, L., Jacks, T., Bronson, R., Goillot, E., Harlow, E. and Dyson, N.J. (1 9 96) Tumor induction and tissue atrophy in mice lacking E2F-1. Cell, 85, 537-548. Yan, G.Z. and Ziff, E.B. (1995) NGF regulates the PCI2 cell cycle machinery through specific inhibition of the Cdk kinases and induction of cyclin D1.J Neurosci, 15, 6200-6212. Yan, M., Dai, T., Deak, J.C., Kyriakis, J.M., Zon, L.I., Woodgett, J.R. and Templeton, D.J. (1994) Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activator SEK1. N ature, 872, 798-800. Yang, W.N. and Cerione, R.A. (1997) Cloning and characterization of a novel cdc42- associated tyrosine kinase, ack-2, from bovine brain. J Biol Chem, 272, 24819- 24824. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene, 33, 103-119. Yao, R. and Cooper, G.M. (1995) Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. S cien ce, 267, 2003-2006. Yao, R. and Cooper, G.M. (1996) Growth factor-dependent survival of rodent fibroblasts requires phosphatidylinositol 3-kinase but is independent of pp70S6K activity. Oncogene, ^3, 343-351.

263 Chapter Seven - Bibliography

Yee, W.M. and Worley, P.F. (1997) Rheb interacts with Raf-1 kinase and may function to integrate growth factor- and protein kinase A-dependent signals. Mol Cell e/o/. 17, 921-933. York, R.D., Yao, H., Dillon, T., Ellig, C.L, Eckert, S.P., McCleskey, E.W. and Stork, P.J. (1998) Rapl mediates sustained MAP kinase activation induced by nerve growth factor [see comments]. N ature, 392, 622-626. Yu, W., FantI, W.J., Harrowe, G. and Williams, LT. (1998) Regulation of the MAP kinase pathway by mammalian Ksr through direct interaction with MEK and ERK. Curr Biol, 8, 56-64. Yuasa, Y., Srivastava, S.K., Dunn, C.Y., Rhim, U.S., Reddy, E.P. and Aaronson, SA (1983) Acquisition of transforming properties by alternative point mutations within c-bas/has human proto-oncogene. Nature, 303, 775-779. Zarkowska, T. and Mittnacht, S. (1997) Differential phosphorylation of the retinoblastoma protein by G1/S cyclin-dependent kinases. J Biol Chem, 272, 12738-12746. Zeng, Y.X. and el-Deiry, W.S, (1996) Regulation of p21WAF1/CIP1 expression by p53-independent pathways. O ncogene, 12, 1557-1564. Zhang, H., Hannon, G.J. and Beach, D. (1994) p21-containing cyclin kinases exist in both active and inactive states. G enes Dev, 8, 1750-1758. Zhang, S., Han, J., Sells, M.A., Chernoff, J., Knaus, U.G., Ulevitch, R.J. and Bokoch, G.M. (1995a) Rho family GTPases regulate p38 mitogen-activated protein kinase through the downstream mediator Paki. J Biol Chem, 270, 23934-23936. Zhang, W., Grasso, L., McClain, C.D., Gambel, A.M., Cha, Y., Travali, S., Deisseroth, A.B. and Mercer, W.E. (1995b) p53-independent induction of WAF1/CIP1 in human leukemia cells is correlated with growth arrest accompanying monocyte/macrophage differentiation. Cancer Res, 55, 668-674. Zhang, X.F., Settleman, J., Kyriakis, J.M., Takeuchi, S.E., Elledge, S.J., Marshall, M.S., Bruder, J.T., Rapp, U.R. and Avruch, J. (1993) Normal and oncogenic p21ras proteins bind to the amino-terminal regulatory domain of c-Raf-1. Nature, 3 64, 308-313. Zhang, Y.H., Yao, B., Delikat, S., Bayoumy, S., Lin, X.H., Basu, S., McGinley, M., Chanhui, P.Y., Lichenstein, H. and Kolesnick, R. (1997) Kinase suppressor of ras is ceramide-activated protein-kinase. Cell, 89, 63-72. Zheng, C.F. and Guan, K.L. (1993) Properties of MEKs, the kinases that phosphorylate and activate the extracellular signal-regulated kinases. J Biol Chem, 268, 23933-23939. Zheng, Y., Bagrodia, S. and Cerione, R.A. (1994) Activation of phosphoinositide 3 - kinase activity by Cdc42Hs binding to p85. J Biol Chem, 269, 18727-18730. Zheng, Y., Fischer, D.J., Santos, M.F., Tigyi, G., Pasteris, N.G., Gorski, J.L. and Xu, Y. (1996a) The faciogenital dysplasia gene product FGD1 functions as a Cdc42Hs- specific guanine-nucleotide exchange factor. J Biol Chem, 271, 33169-33172. Zheng, Y., Olson, M.F., Hall, A., Cerione, R.A. and Toksoz, D. (1995) Direct involvement of the small GTP-binding protein Rho in Ibc oncogene function.J Biol Chem, 270, 9031-9034. Zheng, Y., Zangrilli, D., Cerione, R.A. and Eva, A. (1996b) The pleckstrin homology domain mediates transformation by oncogenic dbl through specific intracellular targeting. J Biol Chem, 27'\, 19017-19020.

264 Chapter Seven - Bibliography

Zhu, J., Bilan, P.J., Moyers, J.S., Antonetti, D A and Kahn, C.R. (1996a) Rad, a novel Ras-related GTPase, interacts with skeletal muscle beta- tropomyosin. J B iol Chem, 271, 768-773. Zhu, J., Woods, D., McMahon, M. and Bishop, J.M. (1998) Senescence of human fibroblasts induced by oncogenic Raf. G enes Dev, 12, 2997-3007. Zhu, X. and Assoian, R.K. (1995) Integrin-dependent activation of MAP kinase: a link to shape-dependent cell proliferation [published erratum appears in Mol Biol Cell 1996 Jun;7(6):1001]. Molecular Biology of the Cell, 6, 273-282. Zhu, X., Ohtsubo, M., Bohmer, R.M., Roberts, J.M. and Assoian, R.K. (1996b) Adhesion-dependent cell cycle progression linked to the expression of cyclin D1, activation of cyclin E-cdk2, and phosphorylation of the retinoblastoma protein. Journal of Cell Biology, ^33, 391-403. Zimmermann, S., Rommel, C., Ziogas, A., Lovric, J., Moelling, K. and Radziwill, G (1997) MEK1 mediates a positive feedback on Raf-1 activity independently of Ras and Src. O ncogene, 15, 1503-1511. Zindy, P., Eischen, C.M., Randle, D.H., Kamijo, T., Cleveland, J.L., Sherr, C.J. and Roussel, M.F. (1998) Myc signaling via the ARF tumor suppressor regulates p5 3- dependent apoptosis and immortalization. G enes Dev, 12, 2424-2433. Zohn, I.M., Campbell, S.L., Khosravifar, R., Rossman, K.L. and Der, C.J. (1 998) Rho-family proteins and ras transformation - the rhoad less traveled gets congested. Oncogene, M, 1415-1438,.

265