Niacin Promotes Cardiac Healing After Myocardial Infarction Through Activation of the Myeloid Prostaglandin D2 Receptor Subtype 1 S

Home , Laropiprant

Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2017/01/05/jpet.116.238261.DC1

1521-0103/360/3/435–444$25.00 http://dx.doi.org/10.1124/jpet.116.238261 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 360:435–444, March 2017 Copyright ª 2017 by The American Society for Pharmacology and Experimental Therapeutics

Niacin Promotes Cardiac Healing after Myocardial Infarction through Activation of the Myeloid Prostaglandin D2 Receptor Subtype 1 s

Deping Kong, Juanjuan Li, Yujun Shen, Guizhu Liu, Shengkai Zuo, Bo Tao, Yong Ji, Ankang Lu, Michael Lazarus, Richard M. Breyer, and Ying Yu Department of Pharmacology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin, China (D.K., Y.S., Y.Y.); Key Laboratory of Food Safety Research, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, University of Chinese Academy of Sciences, Shanghai, China (D.K., G.L., S.Z., B.T., Y.Y.); Department of Gastroenterology (J.L.), and Department of Cardiology (A.L.); Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, China; The Key Downloaded from Laboratory of Cardiovascular Disease and Molecular Intervention, Atherosclerosis Research Centre, Nanjing Medical University, Nanjing, Jiangsu, China (Y.J.); International Institute for Integrative, Sleep Medicine, University of Tsukuba, Tsukuba City, Ibaraki, Japan (M.L.); and Department of Veterans Affairs, Tennessee Valley Health Authority, and Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee (R.M.B.) Received October 10, 2016; accepted December 30, 2016 jpet.aspetjournals.org

ABSTRACT

Niacin is a well established drug used to lower cholesterol and PGD2 release in macrophages and shifted macrophages to M2 prevent cardiovascular disease events. However, niacin also causes polarization both in vitro and in vivo by activation of DP1 and cutaneous flushing side effects due to release of the proresolution accelerated inflammation resolution in zymosan-induced perito- mediator prostaglandin D2 (PGD2). Recent randomized clinical trials nitis in mice. Moreover, niacin treatment facilitated wound healing have demonstrated that addition of niacin with laropiprant [a PGD2 and improved cardiac function after MI through DP1-mediated M2 at ASPET Journals on September 27, 2021 receptor subtype 1 (DP1) blocker] to statin-based therapies does not bias and timely resolution of inflammation in infarcted hearts. In significantly decrease the risk of cardiovascular disease events, addition, we found that niacin intake also stimulated M2 polari- but increases the risk of serious adverse events. Here, we tested zation of peripheral monocytes in humans. Collectively, niacin whether, and how, niacin beneficial effects on myocardial ischemia promoted cardiac functional recovery after ischemic myocardial require the activation of the PGD2/DP1 axis. Myocardial infarction infarction through DP1-mediated M2 polarization and timely (MI) was reproduced by ligation of the left anterior descending resolution of inflammation in hearts. These results indicated that branch of the coronary artery in mice. We found that niacin increased DP1 inhibition may attenuate the cardiovascular benefits of niacin.

Introduction fatty acid (FFA) release from adipocytes (Carlson, 1963) and reduces plasma FFA levels in humans during fasting (Carlson Niacin, also known as vitamin B3 or nicotinic acid, is a safe, and Oro, 1962) through its specific receptor GPR109A (Soga broad-spectrum lipid-lowering agent used to prevent cardio- et al., 2003; Tunaru et al., 2003; Wise et al., 2003). Niacin also vascular events (Dunbar and Goel, 2016). Niacin inhibits free suppresses hepatic low-density lipoprotein, very-low-density lipoprotein, and triglyceride synthesis through inhibition of This work was supported by the National Natural Science Foundation of diacylglycerol acyltransferase 2 (Ganji et al., 2004) and increases China [Grants 81525004, 91439204, 31200860, and 91639302], Shanghai Committee of Science and Technology Key Program [Grants 14JC1407400, plasma high-density lipoprotein cholesterol (HDLc) indepen- 15140902000], Science and Technology Service Network Initiative [Grant KFJ- dent of the GPR109A receptor or FFA suppression (Knouff EW-STS-099], Postdoctoral Fellowship Program of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences [Grants 2012KIP514 and et al., 2008; Zhang et al., 2012). In addition, niacin displays 2013KIP312], and the National Institutes of Health [Grants GM15431 and multiple anti-inflammation properties, including regulation DK37097], as well as a Merit Award from the Department of Veterans Affairs, of the expression of cell adhesion molecules (Tavintharan Vanderbilt University [1BX000616]. Y.J. and Y.Y. are Fellows at the Jiangsu Collaborative Innovation Center for Cardiovascular Disease Translational et al., 2009), nuclear receptors, and scavenger receptors Medicine. (Rubic et al., 2004; Knowles et al., 2006), through mecha- A recommended section: Cardiovascular dx.doi.org/10.1124/jpet.116.238261. nisms that are unrelated to its effects on HDLc (Lukasova s This article has supplemental material available at jpet.aspetjournals.org. et al., 2011). Moreover, niacin suppresses atherogenesis in

ABBREVIATIONS: DP1, prostaglandin D2 receptor type 1; DP2, prostaglandin D2 receptor type 2; FFA, free fatty acid; HDLc, high-density lipoprotein cholesterol; H-PGDS, hematopoietic-type PGDS; IFNg, interferon g; IL, interleukin; KO, knockout; L-PGDS, lipocalin-type PGDS; LPS, lipopolysaccharide; Mac, macrophage; MI, myocardial infarction; MS/MS, tandem mass spectrometry; PCR, polymerase chain reaction; PG, prostaglandin; PGD2, prostaglandin D2; PGDM, prostaglandin D2 metabolite; PGDS, PGD2 synthase; PMN, peripheral monocyte; STAT, signal transducer and activator of transcription; TNFa, tumor necrosis factor-a; WT, wild-type.

435 436 Kong et al. hyperlipidemic mice through GPR109A-mediated suppres- Reagents. Interferon g (IFNg) and interleukin 4 (IL-4) were sion of immune cells (Lukasova et al., 2011). purchased from Peprotech (Rocky Hill, NJ). Lipopolysaccharide (LPS), However, one major limitation of niacin is its induction of niacin, zymosan, and thioglycolate were purchased from Sigma-Aldrich dermal side effects, e.g., facial flushing (Dunbar and Gelfand, (St. Louis, MO). 2010), resulting from stimulation of the GPR109A receptor in Peritoneal Macrophage Isolation and Treatment. Peritoneal macrophages were induced and prepared by an i.p. injection of 3% skin immune cells (Benyó et al., 2005). Vasodilatory prosta- Brewer’s thioglycolate as described previously (Yang et al., 2010). glandin (PG) D2 (PGD2), perhaps PGE2 as well, secreted in Macrophages were allowed to adhere overnight (37°C, 5% CO2) and inflammatory cells, such as Langerhans cells, is thought to be washed with fresh medium to remove unattached cells before use. involved in niacin-induced flushing through PGD2 receptor Macrophage polarization was subsequently induced with LPS (1 mg/ml) subtype 1 (DP1) (Hanson et al., 2010). PGD2 is an arachidonic plus IFNg (20 ng/ml) or IL-4 (20 ng/ml) and analyzed by reverse- acid metabolite derived from sequential reaction of cyclooxyge- transcription polymerase chain reaction (PCR) or western blotting, as nases and PGD2 synthases (PGDSs) (Ricciotti and FitzGerald, described later. 2011). Two distinct PGDSs, the hematopoietic PGDS (H-PGDS) Myocardial Infarction Mouse Model. Left anterior descending and the lipocalin PGDS (L-PGDS), mediate the last regulatory artery ligation was used in mice to induce myocardial infarction (MI). – steps in the biosynthetic pathway of PGD production (Urade In brief, both male and female mice (6 8 weeks of age) were anesthetized 2 with isoflurane (2%) using an induction chamber, and the left anterior and Eguchi, 2002; Aritake et al., 2006). PGD interacts mainly 2 descending coronary artery was completely ligated to induce left with two G-protein–coupled receptors: the DP1 receptor stim-

ventricular ischemia (Gao et al., 2010). Downloaded from ɑ ulates adenylyl cyclase through G s, whereas DP2 [initially Cell Sorting from Post-MI Hearts. Mice were anesthetized and called chemoattractant receptor T helper type 2 (CRTH2)] intracardially perfused with 40 ml of ice-cold phosphate-buffered inhibits adenylyl cyclase through Gɑi and increases intracellu- saline to exclude blood cells. The heart was dissected, minced with fine 1 lar Ca2 (Malki et al., 2005; Spik et al., 2005). DP1 and DP2 are scissors, and enzymatically digested with a cocktail of collagenase I linked to different signaling pathways and appear to have (450 U/ml), collagenase XI (125 U/ml), DNase I (60 U/ml), and distinct functions within the immune system (Kostenis and hyaluronidase (60 U/ml; Sigma-Aldrich) for 1.5 hours at 37°C with Ulven, 2006). DP1 antagonism suppresses niacin-induced vaso- gentle agitation. After digestion, the tissue was triturated and passed jpet.aspetjournals.org dilation in both mice and humans (Cheng et al., 2006). Many through a 70-mm cell strainer. Leukocyte-enriched fractions were isolated by 37–70% Percoll (GE Healthcare, Piscataway, NJ) density studies have shown that cyclooxygenase-2–derived PGD pro- 2 gradient centrifugation, as described elsewhere (Yan et al., 2013). motes resolution of inflammation (Rajakariar et al., 2007). DP1 Cells were removed from the interface and washed with RPMI is highly expressed in monocytes and macrophages (Rajakariar 1640 cell culture medium prior to staining with anti-CD45 and anti- 1 1 et al., 2007; Sandig et al., 2007), and PGD2-induced macrophage CD11b antibodies and sorting into three populations: CD45 CD11b M2 polarization facilitates inflammatory resolution through (myeloid cells), CD451CD11blow (lymphocytes), and CD452CD11blow 1 1 DP1-mediated suppression of Janus kinase 2 (JAK2)/signal (nonleukocytes). The CD45 CD11b population could be further at ASPET Journals on September 27, 2021 transducer and activator of transcription (STAT) 1 signaling divided into CD11b1F4/801 macrophages and CD11b1Ly-6G1 (Kong et al., 2016). However, whether niacin shapes macrophage neutrophils. polarization and accelerates inflammatory resolution through Echocardiography. Transthoracic echocardiography was performed at different time points after surgery using an echocardiograph PGD2 release remains unclear. (Vevo2100, VisualSonics, Canada). The investigator was blinded to In the recent Heart Protection Study 2–Treatment of HDLc group assignment. Mice were anesthetized by isoflurane inhalation. to Reduce the Incidence of Vascular Events (HPS2-THRIVE) Two-dimensional parasternal long-axis views of the left ventricle were trial, niacin therapy, combined with laropiprant (a DP1 antag- obtained for guided M-mode measurements of the left ventricle onist), did not markedly decrease the risk of major cardiovascular internal diameter at end diastole and end systole, as well as the events, but did increase the risk of serious side effects (Landray interventricular septal wall thickness and posterior wall thickness. et al., 2014). However, it is unclear whether the cardiovascular Flow Cytometry. Isolated peripheral blood cells and leukocytes benefits of niacin can be confounded by DP1 inhibition (Song and isolated from the heart were analyzed by flow cytometry. To block FitzGerald,2013;DunbarandGoel,2016).Inthisstudy,we nonspecific binding of antibodies to Fcg receptors, isolated cells were first incubated with anti-CD16/32 antibody (BD Biosciences, San evaluated the effects of niacin on PGD2 secretion and monocyte/macrophage M2 polarization through DP1 activation in Jose, CA) at 4°C for 5 minutes. Subsequently, the cells were stained mice using zymosan-induced peritonitis and myocardial infarc- with a mixture of the following antibodies at 4°C for 30 minutes: anti–CD45-fluorescein isothiocyanate (PE), anti–CD11b-fluorescein tion mouse models and analysis of the effects of niacin intake in isothiocyanate (FITC), anti–Ly6G-PE-Cy7, anti–Ly6C-Allophycocyanin humans. Our findings provide important insights into the effects (APC) (eBioscience, San Diego, CA), anti–F4/80-BV421, and of niacin on myocardial recovery from ischemic injury through anti–CD206-APC (BioLegend, San Diego, CA). Human peripheral activation of the DP1 receptor, suggesting that DP1 blockers may blood monocytes were defined as SSClow CD14high cells. After undermine the cardioprotective effects of niacin. staining with 7-amino-actinomycin D (Sigma-Aldrich) to discrimi- nate dead cells, flow cytometry was performed on a FACSCalibur Materials and Methods (BD Biosciences), and the data were analyzed with FlowJo software (version 9, Tree Star, Ashland, OR). F/F Animals. DP1 mice were maintained on a C57BL/6 genetic PGD2 Extraction and Analysis. Cell supernatants or peritoneal background and crossed with C57BL/6 LysMCre mice to generate exudates (500 ml) were used for PG extraction after protein quantifi- DP1F/FLysCre mice; these mice are referred to as macrophage (Mac)- cation, as previously reported (Lu et al., 2015). An internal standard DP1 knockout (KO) mice (Kong et al., 2016). DP1F/F littermates (2 ml) was added to the sample in 40 ml of citric acid (1 M) and 5 mlof [hereafter referred to as wild-type (WT) mice] were used as exper- 10% butylated hydroxytoluene, and the sample was then vigorously imental controls. All animals were maintained and used in accor- shaken with 1 ml of solvent (normal hexane:ethyl acetate, 1:1) for dance with the guidelines of the Institutional Animal Care and Use 1 minute. The organic phase supernatant was collected after centri- Committee of the Institute for Nutritional Sciences, University of fugation (6000 Â g) for 10 minutes. The eluate was dried under nitrogen Chinese Academy of Sciences. and analyzed by electrospray triple/quadruple liquid chromatography Macrophage DP1 Mediates Resolution Effect of Niacin 437

TABLE 1 Primers for real-time PCR analysis in mice

Gene Sense Antisense H–PGDS GGAAGAGCCGAAATTATTCGCT ACCACTGCATCAGCTTGACAT L–PGDS TGCAGCCCAACTTTCAACAAG TGGTCTCACACTGGTTTTTCCT DP1 AACCTCTATGACATGCACAGGCG AAGGCTTGGAGGTCTTCTGAGTC DP2 TCTCAACCAATCAGCACACCCGA GATGTAGCGGAGGCTAGAGTTGC IL-1b AGCTCTCCACCTCAATGGAC GACAGGCTTGTGCTCTGCTT IL-12b TGGTTTGCCATCGTTTTGCTG ACAGGTGAGGTTCACTGTTTCT TNFa ACGGCATGGATCTCAAAGAC CGGACTCCGCAAAGTCTAAG MCP1 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT NOS2 ACATCGACCCGTCCACAGTAT CAGAGGGGTAGGCTTGTCTC YM1 CAGGTCTGGCAATTCTTCTGAA GTCTTGCTCATGTGTGTAAGTGA MRC1 CTCTGTTCAGCTATTGGACGC CGGAATTTCTGGGATTCAGCTTC IL-10 TCAAGGATGCACATCAAAAGGC AGGCAGCAACTTCCTCCCT Dectin GACTTCAGCACTCAAGACATCC TTGTGTCGCCAAAATGCTAGG L32 TTAAGCGAAACTGGCGGAAAC TTGTTGCTCCCATAACCGATG GAPDH CCCTTATTGACCTCAACTACATGGT GAGGGGCCATCCACAGTCTTCTG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Downloaded from tandem mass spectrometry (MS/MS) (4000Q Trap; AB Sciex, Concord, acetonitrile in water and dried with vacuum for 15 minutes. The Ontario, Canada). Chromatographic separation was performed on a analyte and internal standard were eluted from the cartridge using ZORBAX SB-Aq high-performance liquid chromatography column 1 ml of 5% acetonitrile in ethylacetate. The eluate was collected and (3.0 Â 250 mm, 5 mm; Agilent, Santa Clara, CA) using 0.1% acetic acid dried under a gentle stream of nitrogen. The resulting residue was in water (mobile phase A) and acetonitrile (mobile phase B) as the then dissolved in 100 ml of 10% acetonitrile in water and passed

mobile phase for binary gradient elution. The column flow rate was through small centrifugal filters with a 0.2-mm nylon membrane prior jpet.aspetjournals.org 0.4 ml/min; the column temperature was 25°C, and the autosampler to analysis by mass spectrometry. The urinary creatinine was used to was kept at 4°C. The binary elution gradient was 30% B to 53% B in normalize the prostaglandin metabolites. 15 minutes, and then to 90% B in 1 minute, maintained at 90% B for Collection of Human Plasma and Urine. Sixteen healthy 3 minutes. The column was equilibrated for 10 minutes with the initial volunteers (20–30 years old) who did not take any nonsteroidal anti- solvent composition between injections. PGD2 was detected and inflammatory drugs within 1 week were administered niacin (500 mg/day, quantified in negative ion mode, and the electrospray potential was orally) for 3 days. Peripheral blood samples were collected 12 hours maintained at 24.5 kV and heated to 500°C. For MS/MS analysis, before and after niacin intake. Urine samples were collected at the at ASPET Journals on September 27, 2021 PGD2/internal standards were subjected to collision-induced fragmen- indicated time point [before (time 0) and after (time 1, 2, 3, 4, 6, and tation. PG production was normalized to total protein. 12 hours)] after niacin intake. Urinary PGDMs were quantified by

PGD2 Metabolite Analysis. Urinary PGD2 metabolite (PGDM) liquid chromatography MS/MS, and peripheral monocytes were was extracted and quantitated as previously reported (Song et al., sorted for gene-expression analyses. The experiment was approved 2008). In brief, mouse urine was collected for 24 hours in metabolic by the Human Ethics Committee of Shanghai Ruijin Hospital, and cages with fasting treatment after niacin or carboxymethylcellulose all volunteers provided informed consent before the start of the treatment from the third day post-MI. Samples (100 ml) were spiked experiment. 2 with internal standard (10 ml[H6]tetranor PGDM) contained in RNA Extraction and Quantitative Real-Time PCR. Total acetonitrile. Two times the urine volume of an aqueous solution of RNA samples from sorted cells or adherent macrophages were methoxy-amine HCl (1 g/ml) was added and allowed to stand for prepared using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands) or 30 minutes at room temperature and then diluted to 1 ml using water. TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufac- The solid-phase extraction cartridge was conditioned with 1 ml of turer’s instructions. Total RNA (1 mg) was reverse transcribed to acetonitrile and equilibrated with 1 ml of water. The sample was cDNA with a Reverse Transcription Reagent kit (TAKARA, Shanghai, applied to the cartridge, which was then washed with 1 ml of 5% China), according to the manufacturer’s instructions. The resulting

TABLE 2. Primers for real-time PCR analysis in human samples.

Gene Sense Anti–sense COX-1 CGCCAGTGAATCCCTGTTGTT AAGGTGGCATTGACAAACTCC COX-2 CTGGCGCTCAGCCATACAG CGCACTTATACTGGTCAAATCCC H–PGDS ACCAGAGCCTAGCAATAGCAA AGAGTGTCCACAATAGCATCAAC L–PGDS GGCGTTGTCCATGTGCAAG GGACTCCGGTAGCTGTAGGA DP1 CTGGGCAAGTGCCTCCTAAG CAACGAGTTGTCCAATGCGG DP2 AAAAGGCTCGGGAAGGTTAAATG ACCGGGGAACCAAGAGAGAG IL-1b ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA IL–12b ACCCTGACCATCCAAGTCAAA TTGGCCTCGCATCTTAGAAAG TNFa CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG NOS2 TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCC Arg1 GTGGAAACTTGCATGGACAAC AATCCTGGCACATCGGGAATC MRC1 TCCGGGTGCTGTTCTCCTA CCAGTCTGTTTTTGATGGCACT Dectin GGAAGCAACACATTGGAGAATGG CTTTGGTAGGAGTCACACTGTC Fizz1 CCGTCCTCTTGCCTCCTTC CTTTTGACACTAGCACACGAGA GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase. 438 Kong et al.

Fig. 1. Niacin stimulates M2 macrophage polarization in vitro. (A) Cultured primary peritoneal mouse macrophages were treated with LPS/IFNg or IL-4 for 24 hours after washing, then the cells were exposed to niacin (3 mM) for 30 minutes, the supernatants were collected, and PGD2 was analyzed by mass spectrometry. *P , 0.05; **P , 0.01 versus vehicle (n = 6). (B and C) Effects of niacin pretreatment (3 mM, 30 min- Downloaded from utes) on proinflammatory (B) and anti-inflammatory (C) gene expression. (D and E) Effects of niacin pretreatment (0.5–3 mM, 30 minutes) on phosphorylation of STAT1 (D) and STAT6 (E) in peritoneal macrophages. (F and G) Effects of niacin pretreatment (3 mM, 30 minutes) on phosphorylation of STAT1 (F) and STAT6 (G) in WT and DP1-deficient peritoneal macrophages. *P , 0.05 versus vehicle; jpet.aspetjournals.org #P , 0.05 versus WT (n = 6). Data are expressed as the mean 6 S.E.M. All western blots were repeated three times, and other results were verified in two independent experiments. Statistical significance was determined using unpaired Student’s t tests. at ASPET Journals on September 27, 2021

cDNA was amplified for 40 cycles. L32 and glyceraldehyde 3-phosphate Inc., San Diego, CA). Two-tailed Student’s t test and analysis of dehydrogenase (GAPDH) mRNA were amplified as internal controls. variance were used for comparisons between different groups. Each sample was analyzed in triplicate and normalized to a reference P values ,0.05 were considered statistically significant. RNA. PCR products were confirmed by a single band of expected size on a 2% agarose gel. The primer sequences for PCR are summarized in Tables 1 and 2. Results Western Blotting. The protein concentrations of adherent or sorted macrophage lysates were determined using a BCA Protein Niacin Promotes M2 Macrophage Polarization via Assay Kit (Pierce, Rockford, IL). Equal quantities of proteins were Activation of the PGD2/DP1 Axis. We previously found denatured and resolved by sodium dodecyl sulfate polyacrylamide gel that PGD2 triggers macrophage M2 polarization (Kong electrophoresis on 10% gels, transferred to nitrocellulose membranes, et al., 2016). To explore whether niacin alters macrophage incubated with 5% skimmed milk for 1–1.5 hours, and then incubated polarization through PGD2,wefirsttestedPGD2 generation with primary antibodies overnight at 4°C. Primary antibodies were in niacin-treated macrophages. As shown in Fig. 1A, niacin diluted as follows: anti–phospho-STAT1 (58D6) (1:1000; Cell Signaling (3 mM, 30 minutes) (Meyers et al., 2007) markedly enhanced Technology, Danvers, MA), anti-STAT1 (1:1000; ABclonal Technology, PGD secretioninbothLPS/IFNg-andIL-4–challenged – 2 Woburn,MA),antiphospho-STAT6 (pY641) (1:1000; BD Biosciences), macrophages in vitro for induction of M1 and M2 polariza- and anti-STAT6 (1:1000; ABclonal Technology). Antiactin antibodies (1: tion, respectively. Interestingly, niacin (3 mM) effectively 2000; Sigma-Aldrich) were used as a loading control. The membranes were then incubated in horseradish peroxidase–labeled secondary anti- suppressed LPS/IFNg-induced proinflammatory gene ex- – bodies in blocking buffer for 2 hours. Blots were developed using an pression and enhanced IL-4 induced anti-inflammatory F/F enhanced chemiluminescence reagent (Thermo Scientific, Waltham, MA). expression in WT macrophages (DP1 ), but not in their F/F Cre Statistical Analysis. All data are expressed as the means 6 S.E.M. DP1-deficient counterparts (DP1 Lys , Mac-DP1 KO; Data were analyzed in GraphPad Prism 5 (GraphPad Software, Fig. 1, B and C). It has been proposed that STAT1 activation Macrophage DP1 Mediates Resolution Effect of Niacin 439

Fig. 2. Niacin accelerates resolution in zymosan-induced peritonitis through DP1 activation. (A–I) Effects of niacin on zymosan-induced peritonitis in mice. Niacin (600 mg/kg, every 12 hours) was administered 24 hours after zymosan challenge (A), and peritoneal cells were harvested as indicated. PGDS and DP1 expression levels (B) were examined in macro-

phages, and the influence of niacin on total Downloaded from infiltrated inflammatory cells (C), total macrophages (D), M2 polarization ratio (E), and TNFa (F) and M2 (G–I) expression was assayed in macrophages isolated at the resolution stage of zymosan-induced peritonitis. *P , 0.05, **P , 0.01 versus carboxymethylcellulose (B) or as indicated (C–I); n =4–6. All data are

expressed as the mean 6 S.E.M. P values were jpet.aspetjournals.org calculated using two-way analysis of variance followed by Bonferroni post-hoc tests (C–I) or unpaired Student’s t tests (B). CMC, carboxymethylcellulose; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ns, not significant. at ASPET Journals on September 27, 2021

is indispensable for M1 macrophage polarization, whereas were increased in peritoneal macrophages from zymosan- M2 macrophage differentiation requires STAT6 activity treated mice (Fig. 2B). Notably, niacin reduced both total (Sica and Mantovani, 2012). We have also reported that infiltrated inflammation cells and macrophages at the DP1 mediates M2 polarization through suppression of the later stages of zymosan-induced peritonitis in WT mice STAT1 pathway and activation of the STAT6 pathway (Fig. 2, C and D), thereby accelerating resolution. Additionally, (Kong et al., 2016). Similarly,herewefoundthatniacin niacin markedly increased the CD11b1F4/801CD2061 macro- pretreatment depressed LPS/IFNg-induced STAT1 activa- phage ratio (M2-like) at the resolution phase (both 48 and tion (Fig. 1D) and enhanced IL-4–induced STAT6 activation 72 hours) in zymosan-treated mice (Fig. 2E). Moreover, consis- (Fig. 1E) in macrophages in a dose-dependent manner, in- tent with our observations in vitro, niacin also suppressed dicating niacin promotes macrophage polarization toward proinflammatory gene expression [i.e., tumor necrosis M2 status. Notably, these effects were disrupted by DP1 dele- factor-a (TNFa)] and induced anti-inflammatory gene ex- tion (Fig. 1, F and G). Therefore, our findings indicate that pression [i.e., arginase 1 (Arg1); chitinase 3-like 3 (YM1); and niacin modulated macrophage polarization via activation of the CD206, mannose receptor, C type 1 (MRC1)] in peritoneal PGD2/DP1 axis. macrophages from WT mice (Fig. 2, F–I). None of these Niacin Accelerates Resolution through DP1 in a alterations were observed in Mac-DP1 KO mice (Fig. 2, C–G). Zymosan-Induced Mouse Model of Peritonitis. Next, Thus, niacin facilitated inflammatory resolution by pro- we examined the effect of niacin on zymosan-induced moting DP1-mediated macrophage polarization toward an peritonitis in mice. Niacin (600 mg/kg) (Wang et al., M2-like state. 1990; Nagai et al., 1994; Godin et al., 2012) was adminis- Niacin Improves post-MI Recovery by Promoting teredtomice24hoursafterzymosanchallenge(Fig.2A), DP1-Mediated Inflammatory Resolution. We have con- and peritoneal macrophages were isolated for gene- firmed that there was an increase of PGD2 in ischemic heart expression analysis. H-PGDS and DP1 expression levels post-MI (Fig. 3A). Again, niacin increased total body PGD2 440 Kong et al. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 27, 2021

Fig. 3. Niacin treatment improves recovery in post-MI mice by promoting DP1 activation–dependent M2 polarization and timely resolution. (A) PGD2 production in ischemic hearts after MI. Mice underwent left anterior descending ligation for 2 weeks, and then heart tissues were collected for PG extraction and examined by liquid chromatography MS/MS. **P , 0.01, n = 6. (B and C) Effects of niacin (600 mg/kg, twice daily) on urinary PGDM (B) and PGDS, DP1 and DP2 expression in peripheral monocytes (C) in mice. *P , 0.05, **P , 0.01 versus carboxymethylcellulose (CMC); (n=6). (D–G) Effects of niacin on inflammatory resolution and macrophage polarization in Mac-DP1 KO mice. Inflammatory cells were harvested from infarcted hearts, and total CD45+ leukocytes (D), macrophages (E), and M1/M2 cell ratios (F and G) were analyzed. *P , 0.05, **P , 0.01 as indicated (n =4–6). (H and I) Macrophages sorted at day 14 were used to examine proinflammatory (H) and anti-inflammatory (I) gene expression. *P , 0.05 versus carboxymethylcellulose; #P , 0.05 versus WT (n = 6). (J) Representative echocardiography images with M-mode views of infarcted hearts after niacin treatment on day 14 post-MI. Arrows and lines mark left ventricular inner diameters in systole (dashed, white) and diastole (solid, blue). (K) Effects of niacin (600 mg/kg, twice daily) on heart functions post-MI in Mac-DP1 KO and WT mice. Niacin was administered from days 3 to 14 after MI. *P , 0.05; n =8–10 per group. Data are presented as means 6 S.E.M. and are representative of two independent experiments. Statistical analysis was performed using two-way analysis of variance followed by Bonferroni post-hoc tests (D–G and K) or unpaired Student’s t tests (A, B, C, H, and I). GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LVEF, left ventricular ejection fraction; ns, not significant; Ucr, Urinary Creatinine. production in mice, and upregulated both H-PGDS and DP1 leukocytes and CD11b1F4/801 macrophages to the infarcted expression in macrophages recruited to infarcted hearts at day hearts in WT mice on days 7 and 14 after MI (Fig. 3, D and E; 14 after experimental MI (Fig. 3, B and C). Interestingly, Supplemental Fig. 1). Moreover, niacin also reduced the niacin alleviated the inflammatory response to ischemia and CD11b1F4/801CD2062 macrophage ratio (M1-like) but increased accelerated resolution by reducing the infiltration of CD451 the CD11b1F4/801CD2061 macrophage ratio (M2-like) in WT Macrophage DP1 Mediates Resolution Effect of Niacin 441

TABLE 3 Effect of niacin treatment on recovery of Mac-DP1 KO mice 14 days post-MI All mice were female. Data are presented as means 6 S.E.M. and are representative of two independent experiments. Statistical analysis was performed using a two-way analysis of variance followed by a Bonferroni post-hoc test.

Vehicle Niacin

WT (n = 8) Mac-DP1 KO (n =8) WT(n = 9) Mac-DP1 KO (n = 10) LVEF (%) 35.74 6 1.992 18.32 6 2.144** 49.85 6 1.707# 20.75 6 0.6724** LVFS (%) 17.26 6 1.146 8.376 6 1.006** 25.23 6 1.014# 8.47 6 0.2887** LVIDd (mm) 4.710 6 0.1769 5.233 6 0.2329* 4.206 6 0.1893 5.110 6 0.2400* LVIDs (mm) 3.920 6 0.1516 4.798 6 0.2289** 3.030 6 0.1223# 4.643 6 0.2118** BNP (pg/ml) 125.1 6 2.545 133.624 6 1.557* 98.2 6 2.131## 130.5 6 1.002** CKMB (pg/ml) 19.82 6 0.211 21.581 6 0.231* 17.75 6 0.212# 21.54 6 0.289** LVM/HW 0.691 6 0.016 0.593 6 0.152* 0.729 6 0.127 0.605 6 0.017* HW/BW 0.007 6 0.0003 0.009 6 0.0003** 0.007 6 0.0001 0.009 6 0.0002

BNP, brain natriuretic peptide; BW, body weight; CKMB, creatine kinase; HW, heart weight; LVEF, left ventricular ejection fraction; LVFS, left ventricular fractional shortening; LVIDd, left ventricular internal diameter at diastole; LVIDs, left ventricular internal diameter at systole; LVM, left ventricular mass. *P , 0.05; **P , 0.01 versus WT; #P , 0.05; ##P , 0.01 versus vehicle. Downloaded from mice on days 7 and 14 after MI (Fig. 3, F and G), suppressed the not in Mac-DP1 KO mice after MI (Fig. 3, J and K; Table 3; expression of proinflammatory genes (i.e., IL-1b, TNFa, and nitric Supplemental Fig. 2). Since DP1 activation may have gender oxidesynthase2[NOS2]), and increased the expression of anti- differential responses in vasculature in mice (Song et al., inflammatory genes (i.e., YM1, Arg1,andMRC1) in infiltrated 2012), we also compared the effect of Mac-DP1 deletion in macrophages from WT mice but not Mac-DP1 KO mice (Fig. 3, H cardiac recovery after MI between male and female mice. and I), indicating that niacin promoted M2 polarization in Again, Mac-DP1 deficiency markedly impaired cardiac re- jpet.aspetjournals.org infarcted hearts through DP1. Accordingly, niacin dramatically covery after MI in mice (Supplemental Table 1), but we failed restored cardiac function and tissue damage in WT mice but to observe significant differences of heart functions between at ASPET Journals on September 27, 2021

Fig. 4. Niacin stimulates peripheral monocyte M2 polarization via DP1 activation in LPS-challenged mice. (A) Experimental design for niacin (600 mg/kg) treatment in LPS-challenged (8 mg/kg) mice. (B–F) Peripheral monocytes were sorted (B) to examine the mRNA levels of PGDS (C) and DP1 (D), proinflammatory (E), and anti-inflammatory (F) gene expression in the presence and absence of niacin. *P , 0.05, **P , 0.01 versus carboxymethylcellulose (CMC); #P , 0.05 versus WT (n =5–6). All graphs are shown as the mean 6 S.E.M. Data are representative of two independent experiments. Statistical significance was determined using unpaired Student’s t tests. GAPDH, glyceraldehyde 3-phosphate dehydrogenase. 442 Kong et al. Downloaded from jpet.aspetjournals.org

Fig. 5. Niacin intake promotes M2-like bias in human peripheral monocytes. (A) Diagram of niacin intake and blood-sample collection. (B) Urinary PGDMs were measured at different time points after niacin intake (n = 4). (C–F) CD14+ human peripheral monocytes (C) were monitored for PGDS, DP1

(D), proinflammatory (E), and anti-inflammatory (F) gene expression. *P , 0.05, **P , 0.01 versus before niacin (n = 15). All graphs are shown as the at ASPET Journals on September 27, 2021 mean 6 S.E.M. Statistical significance was determined using unpaired Student’s t tests. Cre, Creatinine; FSC, Forward Scatter; hGAPDH, human glyceraldehyde 3-phosphate dehydrogenase. male and female Mac-DP1 KO mice before and after MI Discussion (Supplemental Table 1). Niacinhasbeenusedinthetreatmentofdyslipidemia Niacin Modulates Peripheral Monocyte Polarization (Carlson and Oro, 1962; Carlson, 1963); however, adverse in Both Mice and Humans. We also examined the effects of effects, including facial flushing, limit its use in part by enhancing niacin (600 mg/kg) on polarization of peripheral monocytes in PGD synthesis (Dunbar and Gelfand, 2010; Hanson et al., LPS-challenged mice (Fig. 4A). Expression of L-PGDS and DP2 2 2010). Here, we found that niacin facilitated post-MI healing was relatively low in mouse peripheral monocytes (Fig. 4, B–D). Interestingly, niacin enhanced H-PGDS and DP1 expression in through PGD2 receptor DP1-induced M2 polarization and peripheral blood monocytes (CD451CD11b1Ly6G2Ly6C1; Fig. resolution of inflammation. 4, B–D), but did not affect L-PGDS or DP2 expression (Fig. 4, PGD2 is involved in the resolution of inflammation (Gilroy B–D). As anticipated, LPS challenge induced proinflammatory et al., 1999). Consistent with this, H-PGDS deficiency results M1 gene expression, which was blunted by niacin pretreatment in impaired inflammatory resolution in mice (Rajakariar in WT peripheral monocytes (PMNs) but not in Mac-DP1 KO et al., 2007), and the proresolution effects of PGD2 are believed PMNs (Fig. 4E). Moreover, niacin was only able to augment to contribute to balancing the secretion of pro- versus anti- anti-inflammatory M2 gene expression in WT monocytes, inflammatory cytokines through the DP1 receptor (Rajakariar whereas DP1-deficient cells were unaffected (Fig. 4F). et al., 2007). We found that PGD2 promotes M2 polarization Next, to determine whether niacin had the same effects in and resolution of acute inflammation, including MI, through humans, blood and urine samples were collected from healthy DP1-mediated suppression of JAK2-STAT1 signaling (Kong volunteers before and after a 3-day administration of niacin et al., 2016). Interestingly, in vascular inflammation animal (Fig. 5A). As previously described (Song et al., 2008), niacin models, DP1 activation restrains aneurysm formation in treatment resulted in substantial PGD2 production (Fig. 5B). males and atherogenesis in females (Song et al., 2012). We Interestingly, H-PGDS and L-PGDS expression levels were and others found DP1 mediates cardioprotection in both significantly increased in human CD141 PMNs, but no signif- genders (Tokudome et al., 2009; Kong et al., 2016). Niacin icant effects were observed with respect to DP1 expression (Fig. stimulates PGD2 biosynthesis in inflammatory cells through 5, C and D). Accordingly, niacin induced the downregulation and the GPR109A receptor (Benyó et al., 2005; Maciejewski-Lenoir upregulation of M1 and M2 markers, respectively, in human et al., 2006). Accordingly, in this study, we showed that niacin PMNs (Fig. 5, E and F), indicating that niacin also promoted promoted the resolution of inflammation and cardiac recovery human monocyte M2 polarization. from ischemia by activating DP1. In accordance with these Macrophage DP1 Mediates Resolution Effect of Niacin 443 observations, niacin inhibits various inflammatory reactions Canner PL, Berge KG, Wenger NK, Stamler J, Friedman L, Prineas RJ, and Friedewald W (1986) Fifteen year mortality in Coronary Drug Project patients: in different disease models (Godin et al., 2012). long-term benefit with niacin. J Am Coll Cardiol 8:1245–1255. Immediate-release niacin has been shown to ameliorate lipid Carlson LA (1963) Studies on the effect of nicotinic acid on catecholamine stimulated lipolysis in adipose tissue in vitro. Acta Med Scand 173: profiles and improve outcomes in patients with acute myocar- 719–722. dial infarction (Canner et al., 1986; Carlson and Rosenhamer, Carlson LA and Oro L (1962) The effect of nicotinic acid on the plasma free fatty acid; demonstration of a metabolic type of sympathicolysis. Acta Med Scand 172: 1988). However, in two recent clinical trials [Atherothrombosis 641–645. Intervention in Metabolic Syndrome with Low HDL/High Carlson LA and Rosenhamer G (1988) Reduction of mortality in the Stockholm Ischaemic Heart Disease Secondary Prevention Study by combined treatment with Triglycerides: Impact on Global Health Outcomes (AIM-HIGH) clofibrate and nicotinic acid. Acta Med Scand 223:405–418. (Boden et al., 2011) and HPS2-THRIVE (Landray et al., 2014)], Cheng K, Wu TJ, Wu KK, Sturino C, Metters K, Gottesdiener K, Wright SD, Wang Z, an extended-release alternative failed to recapitulate the O’Neill G, Lai E, et al. (2006) Antagonism of the prostaglandin D2 receptor 1 suppresses nicotinic acid-induced vasodilation in mice and humans. Proc Natl benefits of the established cardioprotective regimen of nia- Acad Sci USA 103:6682–6687. cin, despite significant increases in HDLc and reduction of Dallob A, Luo WL, Luk JM, Ratcliffe L, Johnson-Levonas AO, Schwartz JI, Dishy V, Kraft WK, De Hoon JN, Van Hecken A, et al. (2011) The effects of laropiprant, a triglyceride levels in patients. These contradictory findings selective prostaglandin D2 receptor 1 antagonist, on the antiplatelet activity of may be related to clinical design and outcomes, such as un- clopidogrel or aspirin. Platelets 22:495–503. Dunbar RL and Gelfand JM (2010) Seeing red: flushing out instigators of niacin- balanced use of statins and ezetimibe (Song and FitzGerald, associated skin toxicity. J Clin Invest 120:2651–2655. 2013) and possibly the dosage of the extended-release niacin Dunbar RL and Goel H (2016) Niacin Alternatives for Dyslipidemia: Fool’s Gold or Gold Mine? Part I: Alternative Niacin Regimens. Curr Atheroscler alternative (Dunbar and Goel, 2016). In the HPS2-THRIVE trial, Rep 18:11. combinational use of the DP1 antagonist laropiprant may also Ganji SH, Tavintharan S, Zhu D, Xing Y, Kamanna VS, and Kashyap ML (2004) Downloaded from Niacin noncompetitively inhibits DGAT2 but not DGAT1 activity in HepG2 cells. J have been an important factor (Song and FitzGerald, 2013). In Lipid Res 45:1835–1845. experimental animals, pharmacological inhibition or genetic Gao E, Lei YH, Shang X, Huang ZM, Zuo L, Boucher M, Fan Q, Chuprun JK, Ma XL, and Koch WJ (2010) A novel and efficient model of coronary artery ligation and deletion of DP1 augments abdominal aneurysm formation, myocardial infarction in the mouse. Circ Res 107:1445–1453. enhances angiotensin II–induced hypertensive responses, and Gilroy DW, Colville-Nash PR, Willis D, Chivers J, Paul-Clark MJ, and Willoughby increases high-fat diet–induced atherosclerosis (Song et al., 2012; DA (1999) Inducible cyclooxygenase may have anti-inflammatory properties. Nat Med 5:698–701. jpet.aspetjournals.org Strack et al., 2013). Moreover, the PGD2-DP1 axis mediates the Godin AM, Ferreira WC, Rocha LT, Ferreira RG, Paiva AL, Merlo LA, Nascimento cardioprotective effects of glucocorticoids against ischemia- EB, Jr, Bastos LF, and Coelho MM (2012) Nicotinic acid induces antinociceptive and anti-inflammatory effects in different experimental models. Pharmacol Bio- reperfusion injury (Tokudome et al., 2009; Katsumata et al., chem Behav 101:493–498. 2014), and we found that DP1 expression in macrophages Hanson J, Gille A, Zwykiel S, Lukasova M, Clausen BE, Ahmed K, Tunaru S, Wirth A, and Offermanns S (2010) Nicotinic acid- and monomethyl fumarate-induced facilitates cardiac healing after MI by accelerating resolution flushing involves GPR109A expressed by keratinocytes and COX-2-dependent (Kong et al., 2016). Thus, it is possible that DP1 inhibition by prostanoid formation in mice. J Clin Invest 120:2910–2919. Katsumata Y, Shinmura K, Sugiura Y, Tohyama S, Matsuhashi T, Ito H, Yan X, Ito laropiprant could block the beneficial effects of niacin in mice K, Yuasa S, Ieda M, et al. (2014) Endogenous prostaglandin D2 and its metabo- with myocardial infarction. Indeed, in the HPS2-THRIVE lites protect the heart against ischemia-reperfusion injury by activating Nrf2. at ASPET Journals on September 27, 2021 Hypertension 63:80–87. trial, laropiprant was found to contribute to some serious Knouff CW, Lim N, Song K, Yuan X, Walker MC, Townsend R, Waeber G, Matthews adverse events, such as excessive bleeding and infection, PM, Vollenweider P, Waterworth DM, et al. (2008) Pharmacological effects of lipid-lowering drugs recapitulate with a larger amplitude the phenotypic effects of given that laropiprant has high affinity for the thromboxane common variants within their target genes. Pharmacogenet Genomics 18: A2 receptor (Dallob et al., 2011) and that PGD2 has multiple 1051–1057. anti-inflammatory properties. Knowles HJ, te Poele RH, Workman P, and Harris AL (2006) Niacin induces PPARgamma expression and transcriptional activation in macrophages via HM74 In summary, our findings show that niacin promoted cardiac and HM74a-mediated induction of prostaglandin synthesis pathways. Biochem recovery after MI through DP1-mediated M2 polarization and Pharmacol 71:646–656. Kong D, Shen Y, Liu G, Zuo S, Ji Y, Lu A, Nakamura M, Lazarus M, Stratakis CA, timely resolution of inflammation, suggesting activation of DP1 Breyer RM, et al. (2016) PKA regulatory IIa subunit is essential for PGD2- receptor may represent a novel strategy for management of mediated resolution of inflammation. J Exp Med 213:2209–2226. Kostenis E and Ulven T (2006) Emerging roles of DP and CRTH2 in allergic in- cardiovascular disease. flammation. Trends Mol Med 12:148–158. Landray MJ, Haynes R, Hopewell JC, Parish S, Aung T, Tomson J, Wallendszus K, Acknowledgments Craig M, Jiang L, Collins R, et al.; HPS2-THRIVE Collaborative Group (2014) Effects of extended-release niacin with laropiprant in high-risk patients. N Engl J The authors thank Maohua Shi and Kai Cao for technical Med 371:203–212. assistance. Lu A, Zuo C, He Y, Chen G, Piao L, Zhang J, Xiao B, Shen Y, Tang J, Kong D, et al. (2015) EP3 receptor deficiency attenuates pulmonary hypertension through suppression of Rho/TGF-b1 signaling. J Clin Invest 125:1228–1242. Authorship Contributions Lukasova M, Malaval C, Gille A, Kero J, and Offermanns S (2011) Nicotinic acid inhibits progression of atherosclerosis in mice through its receptor GPR109A Participated in research design: Kong, Li, Shen, Yu. expressed by immune cells. J Clin Invest 121:1163–1173. Conducted experiments: Kong, Li, Shen, Liu, Zuo, Tao. Maciejewski-Lenoir D, Richman JG, Hakak Y, Gaidarov I, Behan DP, and Connolly Contributed new reagents or analytic tools: Tao, Ji, Lu, Lazarus, DT (2006) Langerhans cells release prostaglandin D2 in response to nicotinic acid. – Breyer. J Invest Dermatol 126:2637 2646. Malki S, Nef S, Notarnicola C, Thevenet L, Gasca S, Méjean C, Berta P, Poulat F, Performed data analysis: Kong, Li, Shen. and Boizet-Bonhoure B (2005) Prostaglandin D2 induces nuclear import of the sex- Wrote or contributed to the writing of the manuscript: Kong, determining factor SOX9 via its cAMP-PKA phosphorylation. EMBO J 24: – Shen, Yu. 1798 1809. Meyers CD, Liu P, Kamanna VS, and Kashyap ML (2007) Nicotinic acid induces secretion of prostaglandin D2 in human macrophages: an in vitro model of the References niacin flush. Atherosclerosis 192:253–258. Aritake K, Kado Y, Inoue T, Miyano M, and Urade Y (2006) Structural and functional Nagai A, Matsumiya H, Hayashi M, Yasui S, Okamoto H, and Konno K (1994) Effects characterization of HQL-79, an orally selective inhibitor of human hematopoietic of nicotinamide and niacin on bleomycin-induced acute injury and subsequent fi- prostaglandin D synthase. J Biol Chem 281:15277–15286. brosis in hamster lungs. Exp Lung Res 20:263–281. Benyó Z, Gille A, Kero J, Csiky M, Suchánková MC, Nüsing RM, Moers A, Pfeffer K, Rajakariar R, Hilliard M, Lawrence T, Trivedi S, Colville-Nash P, Bellingan G, and Offermanns S (2005) GPR109A (PUMA-G/HM74A) mediates nicotinic acid- Fitzgerald D, Yaqoob MM, and Gilroy DW (2007) Hematopoietic prosta- induced flushing. J Clin Invest 115:3634–3640. glandin D2 synthase controls the onset and resolution of acute inflammation Boden WE, Probstfield JL, Anderson T, Chaitman BR, Desvignes-Nickens P, through PGD2 and 15-deoxyDelta12 14 PGJ2. Proc Natl Acad Sci USA 104: Koprowicz K, McBride R, Teo K, and Weintraub W; AIM-HIGH Investigators 20979–20984. (2011) Niacin in patients with low HDL cholesterol levels receiving intensive statin Ricciotti E and FitzGerald GA (2011) Prostaglandins and inflammation. Arterioscler therapy. N Engl J Med 365:2255–2267. Thromb Vasc Biol 31:986–1000. 444 Kong et al.

Rubic T, Trottmann M, and Lorenz RL (2004) Stimulation of CD36 and the key rodent hearts from ischemia/reperfusion injury by activating lipocalin-type pros- effector of reverse cholesterol transport ATP-binding cassette A1 in monocytoid taglandin D synthase-derived PGD2 biosynthesis. J Clin Invest 119:1477–1488. cells by niacin. Biochem Pharmacol 67:411–419. Tunaru S, Kero J, Schaub A, Wufka C, Blaukat A, Pfeffer K, and Offermanns S (2003) Sandig H, Pease JE, and Sabroe I (2007) Contrary prostaglandins: the opposing roles PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic of PGD2 and its metabolites in leukocyte function. J Leukoc Biol 81:372–382. effect. Nat Med 9:352–355. Sica A and Mantovani A (2012) Macrophage plasticity and polarization: in vivo Urade Y and Eguchi N (2002) Lipocalin-type and hematopoietic prostaglandin D veritas. J Clin Invest 122:787–795. synthases as a novel example of functional convergence. Prostaglandins Other Soga T, Kamohara M, Takasaki J, Matsumoto S, Saito T, Ohishi T, Hiyama H, Lipid Mediat 68-69:375–382. Matsuo A, Matsushime H, and Furuichi K (2003) Molecular identification of nic- Wang QJ, Giri SN, Hyde DM, Nakashima JM, and Javadi I (1990) Niacin attenuates otinic acid receptor. Biochem Biophys Res Commun 303:364–369. bleomycin-induced lung fibrosis in the hamster. J Biochem Toxicol 5:13–22. Song WL and FitzGerald GA (2013) Niacin, an old drug with a new twist. J Lipid Res Wise A, Foord SM, Fraser NJ, Barnes AA, Elshourbagy N, Eilert M, Ignar DM, 54:2586–2594. Murdock PR, Steplewski K, Green A, et al. (2003) Molecular identification of high Song WL, Stubbe J, Ricciotti E, Alamuddin N, Ibrahim S, Crichton I, Prempeh M, and low affinity receptors for nicotinic acid. J Biol Chem 278:9869–9874. Lawson JA, Wilensky RL, Rasmussen LM, et al. (2012) Niacin and biosynthesis of Yan X, Anzai A, Katsumata Y, Matsuhashi T, Ito K, Endo J, Yamamoto T, Takeshima PGD2by platelet COX-1 in mice and humans. J Clin Invest 122:1459–1468. A, Shinmura K, Shen W, et al. (2013) Temporal dynamics of cardiac immune cell Song WL, Wang M, Ricciotti E, Fries S, Yu Y, Grosser T, Reilly M, Lawson JA, accumulation following acute myocardial infarction. J Mol Cell Cardiol 62:24–35. and FitzGerald GA (2008) Tetranor PGDM, an abundant urinary metabolite re- Yang P, An H, Liu X, Wen M, Zheng Y, Rui Y, and Cao X (2010) The cytosolic nucleic flects biosynthesis of prostaglandin D2 in mice and humans. J Biol Chem 283: acid sensor LRRFIP1 mediates the production of type I interferon via a beta-catenin- 1179–1188. dependent pathway. Nat Immunol 11:487–494. Spik I, Brénuchon C, Angéli V, Staumont D, Fleury S, Capron M, Trottein F, Zhang LH, Kamanna VS, Ganji SH, Xiong XM, and Kashyap ML (2012) Niacin and Dombrowicz D (2005) Activation of the prostaglandin D2 receptor DP2/CRTH2 increases HDL biogenesis by enhancing DR4-dependent transcription of ABCA1 increases allergic inflammation in mouse. J Immunol 174:3703–3708. and lipidation of apolipoprotein A-I in HepG2 cells. J Lipid Res 53:941–950. Strack AM, Carballo-Jane E, Wang SP, Xue J, Ping X, McNamara LA, Thankappan A, Price O, Wolff M, Wu TJ, et al. (2013) Nicotinic acid and DP1 blockade: studies in mouse models of atherosclerosis. J Lipid Res 54:177–188. Address correspondence to: Dr. Ying Yu, Department of Pharmacology, Tavintharan S, Lim SC, and Sum CF (2009) Effects of niacin on cell adhesion and School of Basic Medical Sciences, Tianjin Medical University, Tianjin 300070, Downloaded from early atherogenesis: biochemical and functional findings in endothelial cells. Basic China; or Institute for Nutritional Sciences, Shanghai Institutes for Biological Clin Pharmacol Toxicol 104:206–210. Sciences, University of Chinese Academy of Sciences, 294 Taiyuan Road, Tokudome S, Sano M, Shinmura K, Matsuhashi T, Morizane S, Moriyama H, Tamaki Shanghai 200031, China. E-mail: [email protected]; [email protected] K, Hayashida K, Nakanishi H, Yoshikawa N, et al. (2009) Glucocorticoid protects jpet.aspetjournals.org at ASPET Journals on September 27, 2021 JPET#238261

THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS

Niacin promotes cardiac healing after myocardial infarction

through activation of the myeloid prostaglandin D2 receptor

subtype 1

Deping Kong, Juanjuan Li, Yujun Shen, Guizhu Liu, Shengkai Zuo, Bo Tao,Yong Ji, Ankang Lu, Michael Lazarus, Richard M. Breyer, Ying Yu

Department of Pharmacology, School of Basic Medical Sciences, Tianjin Medical

University, Tianjin 300070, China ( D.K., Y.S., Y.Y.);

Key Laboratory of Food Safety Research, Institute for Nutritional Sciences,

Shanghai Institutes for Biological Sciences, University of Chinese Academy of

Sciences, Shanghai 200031, China ( D.K., G.L., S.Z., B.T., Y.Y.); Department of Gastroenterology, Ruijin Hospital, Shanghai Jiaotong University School of

Medicine, Shanghai 200025, China (J.L.); The Key Laboratory of Cardiovascular

Disease and Molecular Intervention, Atherosclerosis Research Centre, Nanjing

Medical University, Nanjing, Jiangsu 210029, China (Y.J.); Department of

Cardiology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine,

Shanghai 200025, China (A.L.); International Institute for Integrative, Sleep

Medicine (WPI-IIIS), University of Tsukuba, Tsukuba City, Ibaraki 305-8575,

Japan (M.L.); Department of Veterans Affairs, Tennessee Valley Health Authority, and Department of Medicine, Vanderbilt University Medical Center, Nashville, TN

37232, USA (R.M.B.).

JPET#238261

Supplemental Methods

Immunofluorescence staining

For immunofluorescence staining, infracted hearts harvested at different time point were embedded in O.C.T. compound (Tissue Tek, Sakura, Torrance, CA, USA), then incised 8 µm sections and processed for immunostaining. Anti-CD45 (1:500,

Abcam, USA) primary antibody was used to label leukocytes; anti-CD68 (1:200,

AbDSerotec, Kidlington, UK) primary antibody were used to label macrophages, and then incubated with primary antibodies overnight at 4°C .After that slices were washed and incubated with appropriate secondary antibody (1:1,000) for 2 h at room temperature and then rinsed in PBS, counter-stained with DAPI, sealed with antifade reagent, and visualized using a laser scanning confocal microscope

(Olympus).

Infarct size evaluation

Myocardial infarction was determined by Evans blue/TTC double staining as described previously (Gao et al., 2010), Briefly, 14 days post MI, 0.2 ml of 2%

Evans blue dye was injected into the right ventricle, and then, hearts were removed and frozen at −80°C. The frozen heart was then cut transversely into

1-mm thick slices and stained with 2% tetrazolium chloride in PBS (pH 7.4) for

20 min in a 37°C water bath. After fixation for 4–6 h in 10% neutral buffered formaldehyde, each slice was weighed and photographed. Infarct areas were measured by automated planimetry using ImageJ software and calculated as the ratio of infarct weight to total weight.

Supplemental References

Gao E, Lei YH, Shang X, Huang ZM, Zuo L, Boucher M, Fan Q, Chuprun JK, Ma XL and Koch

WJ (2010) A novel and efficient model of coronary artery ligation and myocardial

infarction in the mouse. Circulation research 107:1445-1453.

JPET#238261

Supplemental Figure 1 A B 7d post MI 14d post MI 7d post MI 14d post MI

WT+CMC

WT+

Niacin

+CMC

Niacin

Supplemental Figure 1. Niacin treatment promotes timely resolution in post-MI

mice by promoting DP1 activation.

(A)Representative immunostaining of CD45 (red) in peri-infarct zones of hearts

from ischemic mice at day 7 and day 14 post-MI. (B) Representative immunostaining

of CD68 (red) in peri-infarct zones of hearts from ischemic mice at day 7 and

day 14 post-MI. Scale bar, 20 μm. Data are representative of two independent

experiments.

JPET#238261

Supplemental Figure 2 A

WT+CMC

WT+Niacin

KO+CMC

KO+Niacin

Supplemental Figure 2. Niacin treatment decreases infarct size in mice after

MI by promoting DP1 activation.

(A)Representative images of Evans blue and triphenyltetrazolium chloride (TTC) staining on heart sections two weeks after MI, followed by OPT IMAS software analysis for color enhancement. Dotted lines denote the infarct zone. The darkest area is normal heart tissue, whereas the gray area represents at-risk myocardial tissue. Bar,10 mm. (B) Infarct sizes were quantitated as shown in A. **p < 0.01 versus CMC, ##p < 0.01 versus WT; n = 5.Data are shown as the mean ± SEM and representative of two independent experiments. Statistical significance was determined using unpaired Student’s t tests.

Supplemental Table 1. Effect of macrophage deletion of DP1 receptor on cardiac recovery after MI in female and male mice.

Basal(♀) 14 days after MI(♀) Basal（♂） 14 days after MI（♂）

WT(n=8) KO(n=8) WT(n=12) KO(n=12) WT(n=8) KO(n=8) WT(n=7) KO(n=6)

LVEF(%) 58.42±2.233 57.96±2.323 38.90±2.560 19.85±1.200** 58.95±2.021 56.79±1.793 39.95±4.695 17.27±1.600**

LVFS(%) 30.97±1.103 31.02±0.432 25.53±2.115 11.28±1.163** 30.93±1.202 30.96±0.775 27.23±3.150 10.18±1.363**

LVIDd(mm) 4.022±0.215 3.959±0.112 4.920±0.453 5.543±0.212* 3.996±0.193 3.924±0.115 4.829±0.223 5.766±0.230*

LVIDs(mm) 2.802±0.146 2.669±0.205 3.762±0.454 5.012±0.403* 2.787±0.105 2.669±0.112 3.548±0.294 5.319±0.308**

BNP(pg/ml) 76.72±1.136 75.24±2.122 123.2±4.412 130.5±2.104* 77.08±2.008 74.95±1.974 119.2±3.419 131.7±3.492*

CKMB(pg/ml)16.92±0.306 16.86±0.206 19.25±0.322 21.06±0.104* 17.22±0.807 16.94±0.352 18.75±0.187 22.61±0.823*

LVM/HW 0.982±0.013 0.973±0.032 0.701±0.025 0.601±0.031* 0.978±0.102 0.979±0.094 0.729±0.097 0.540±0.084*

HW/BW 0.005±0.0001 0.005±0.0002 0.007±0.0001 0.009±0.0002** 0.005±0.0003 0.005±0.0002 0.007±0.0001 0.01±0.0002**

*p<0.05, **p<0.01 vs corresponding WT mice; KO, Mac-DP1 KO; EF, Ejection Fraction; FS, Fractional Shortening; LVIDd, Left Ventricular Internal Diameter at Diastole; LVIDs, Left Ventricular Internal Diameter at Systole; BNP, Brain Natriuretic Peptide; CK-MB, Creatine Kinase; LVM, Left Ventricular Mass; HW, Heart Weight; BW, Body Weight. Data are presented as means ± SEM and are representative of two independent experiments. Statistical analysis was performed using a two-way ANOVA followed by a Bonferroni post-hoc test .