Life Science Journal Acta Zhengzhou University Overseas Edition Life Science Journal L I F E S C I E N C Marsland Press E J O U

Home , Rudaki (crater)

Volume 10, Number 1 (Cumulative No.32) Par t 17 March 25, 2013 ISSN:1097-8135 Volume 10, Number 1, Par t 17 March 25, 2013 ISSN:1097-8135

Life Science Journal Acta Zhengzhou University Overseas Edition Life Science Journal L i f e S c i e n c Marsland Press e J o u

PO Box 180432 r n a Richmond Hill, New York 11418, USA l 2 0 1 3 Vo Website: l

http://www.lifesciencesite.com u m e 1 0 , N

Emails: u m b

[email protected] e r 1

[email protected] , P a r t 1 7 I S

Phone: (347) 321-7172 S N : 1 0 9 7 - 8 1 3 5

Cover design: CAO, Zhaolong Photograph: YANG, Yizhong; YOUNG, Mary

ISSN 1097-8135 Website: http://www.lifesciencesite.com

9 771097 813002 Volume 10, Number 1, Par t 17 March 25, 2013 ISSN:1097-8135

Life Science Journal

Website: http://www.lifesciencesite.com

Emails: MARSLAND PRESS [email protected] Multidisciplinary Academic Journal Publisher [email protected] Life Science Journal ISSN: 1097-8135 http://www.lifesciencesite.com

Life Science Journal - Acta Zhengzhou University Oversea Version ISSN: 1097-8135 Life Science Journal, the Acta Zhengzhou University Oversea Version, is an international journal with the purpose to enhance our natural and scientific knowledge dissemination in the world under the free publication principle. The journal is calling for papers from all who are associated with Zhengzhou University-home and abroad. Any valuable papers or reports that are related to life science - in their broadest sense - are welcome. Other academic articles that are less relevant but are of high quality will also be considered and published. Papers submitted could be reviews, objective descriptions, research reports, opinions/debates, news, letters, and other types of writings. Let's work together to disseminate our research results and our opinions. Editor-in-Chief: Shen, Changyu, Ph.D., Professor, Chinese Academy of Sciences Associate Editors-in-Chief: Ma, Hongbao; Cherng, Shen; Xin, Shijun Editorial Boards: Aghdam, Hashemi; An, Xiuli; Cao, Zhaolong; Chandra, Avinash; Chen, George; Dong, Ziming; Duan, uangcai; Edmondson, Jingjing; Fu, Qiang; Fu, Xianzhen; Gao, Danying; Han, Quancheng; Han, Zhijiang; Hosseini, Seyyed Mousa; Huang, Shuan-Yu; Kan, Quancheng; Lang, Jinghe; Li, Hui; Li, Xinhua; Li, Yan; Li, Yuhua; Li, Yusheng; Li, Zhen; Lindley, Mark; Liu, Hongmin; Liu, Hua; Liu, Xinjing; Ma, Changsheng; Ma, Margret; Ma, Yongsheng; Maio, Zhongrong; Ming, Gongguang; Mousavi, Amin; Nie, Wei; Qi, Yuanming; Qiao, Nancy X; Qin, Jie; Qin, Qin; Qin, Yuhua; Ouyang, Da; Sabyasachi Chatterjee; Seryasat, Omid Rahmani; Shang, Fude; Shi, Lifeng; Song, Chunpeng; Song, Yongping; Spurr, Lydia; Sun, Yan; Sun, Yingpu; Sun, Yiwu; Tan, Song; Venkatesh, Jaganathan; Wang, Jianliu; Wang, Lidong; Wang, Longde; Wang, Xiaoying; Wang, Yilong; Wang, Yongjun; Wang, Zhonggao; Wen, Jianguo; Wu, Ziying; Xu, Cunshuan; Xu, Yuming; Xue, Changgui; Yang, Qian; Young, Jenny; Zaki, Mona; Zhang, Guangxian; Zhang, Hong; Zhang, Jianying; Zhang, Kehao; Zhang, Liusuo; Zhang, Mingzhi; Zhang, Rui; Zhang, Shengjun; Zhang, Shuijun; Zhang, Suming; Zhang, Wei; Zhang, Xueguo; Zhang, Yanzhou; Zhang, Zhan; Zhang, Zhao; Zhang, Zhenxiang; Zhu, Huaijie. Introductions to Authors 1. General Information: (1) Goals: As an international journal published both in print and on internet, Life Science Journal is dedicated to the dissemination of fundamental knowledge in all areas of nature and science. The main purpose of Life Science Journal is to enhance our knowledge spreading in the world under the free publication principle. It publishes full-length papers (original contributions), reviews, rapid communications, and any debates and opinions in all the fields of nature and science. (2) What to Do: The Life Science Journal provides a place for discussion of scientific news, research, theory, philosophy, profession and technology - that will drive scientific progress. Research reports and regular manuscripts that contain new and significant information of general interest are welcome. (3) Who: All people are welcome to submit manuscripts in life science fields. Papers of other fields are also considered. (4) Copyright and Responsibility of Authors to their Articles: When the manuscript(s) is submitted to the journal, the authors agree the following: All the authors have participated sufficiently in this work; The article is not published elsewhere; Authors are responsibility on the contents of the article; The journal and author(s) have same right for the copyright of the article and either of the journal or author(s) can use it by anyway without noting the other party. (5) Publication Costs: US$640 per article to defray costs of the publication will be paid by the authors when it is received. (6) Advertisements: The price will be US$400/page, and we normally accept one advertisement for one page. Other size of the advertisement please contact with our editorial office through email. 2. Manuscript Preparation - Each manuscript is suggested to include the following components but authors can do their own ways: (1) Title: including the complete article title; each author’s full name; institution(s) with which each author is affiliated, with city, state/province, zip code, and country; and the name, complete mailing address, telephone number, facsimile number (if available), and at least one email address for author(s). (2) Abstract: including Background, Materials and Methods, Results, and Discussions. (3) Key Words. (4) Introduction. (5) Materials and Methods. (6) Results. (7) Discussions. (8) Acknowledgments. (9) References. 3. Manuscripts Submission: (1) Submission Methods: Submission through email ([email protected] or [email protected]) is encouraged. (2) Software: The Microsoft Word file. (3) Font: Normal, Times New Roman, 10 pt, single space. (4) Page Setup: Paper-Letter size; Margins-2.54 cm each side; Header/Footer-1.27 cm. (5) Indent: Type 8 spaces in the beginning of each new paragraph. (6) Manuscript: Don’t use “Footnote” or “Header and Footer”. (7) Email: At least one author’s email must be put under title. (8) Title: Use Title Case in the title and subtitles, e.g. “Molecular Study of Stem Cell”. (9) Figures and Tables: Use full word of figure and table, e.g. Figure 1. Annul Income of Different Groups, Table 1. Annual Increase of Investment. (10) References: Cite references by “last name, year”, e.g. “(Smith, 2003)”. References should include all the authors’ last names and initials, title, journal, year, volume, issue, and pages etc. Reference Examples: Journal Article: Hacker J, Hentschel U, Dobrindt U. Prokaryotic chromosomes and disease. Science 2003;301(34):790-3. Book: Berkowitz BA, Katzung BG. Basic and clinical evaluation of new drugs. In: Katzung BG, ed. Basic and clinical pharmacology. Appleton & Lance Publisher. Norwalk, Connecticut, USA. 1995:60-9. (11) Submission Address: [email protected] or [email protected], Marsland Press, PO Box 180432, Richmond Hill, New York 11418, USA, 347-321-7172.

Life Science Journal - Acta Zhengzhou University Overseas Edition (Life Sci J), ISSN: 1097-8135 PO Box 180432, Richmond Hill, New York 11418, USA http://www.lifesciencesite.com; http://www.sciencepub.net; [email protected]; [email protected]

358 Failure to Construct a Meaningful Border for Democracy in E. L. 2942-2947 Doctorow's: The book of Daniel Zohreh Ramin , Seyyed Mohammad Marandi

359 Prevalence of Plasmodium Vivax Using PCR Method in Afghan Refugee Ghamkol 2948-2953 Camp District Kohat, Pakistan Sultan Ayaz , Riaz Ullah , Shehzad Zarin

360 Biological potential of Phlomis bracteosa 2954-2957 Riaz Ullah

361 The Association Of Maxillary Accessory Ostia With Chronic Rhinosinusitis What 2958-2966 is essential; ventilation or drainage. Ahmed Hussien MD.

362 Outcomes after partial middle turbinate resection in surgical treatment of 2967-2972 extensive sinonasal polyposis. Ahmed Hussien MD.

363 Dominant theory of international relations, discuss the role of language, from the 2973-2977 perspective of postmodernism. (With emphasis on the common language of Iran, Tajikistan) Mahmoud Shahbandi, Azadeh Mashaei

364 Clinical Implications for Vascular Endothelial Growth Factor Levels among 2978-2983 Egyptians with Pulmonary Tuberculosis Magdy Omar, Tawfik ElAdl, Samir Abdullah , Hossam Hamza, Tawfik ElAdl and Mostafa Neamatallah

365 Correlation between CD4+, CD8+ T Cells Count and Liver Function Tests in 2984-2989 Chronic Hepatitis C Infection. Hoda El Tayeb, Ahmed Shawky, Noha A. El Nakeeb, and Hala B.Othman, Enas H. Allam.

366 Analysis of constraints faced by small scale broiler famers in Capricorn district in 2990-2996 Limpopo province Ntuli Vusi and Oladele O.I

367 Factors influencing farmers’ attitude towards formal and informal Financial 2997-3001 Markets in the Northern Cape, South Africa Ward, L and Oladele O.I.

368 Topological and Singular Solitons of B(m, n) Equation with Generalized 3002-3005 Evolution Bouthina S. Ahmed and Anjan Biswas

369 Genotypic characterization of Giardia duodenalis in children in Menoufiya and 3006-3015 Sharkiya governorates, Egypt Gehan S. Sadek, Magda A. El-Settawy and Soha A. Nasr

I 370 Comparative Study of Radioactive Content in Soils from Different Countries 3016-3020 Abdel-Baset Abbady, Zain Al-Amoudi

371 Decolonization in Beecher Stowe’s Uncle Tom Cabin, Life among the Lowly 3021-3029 Hajiali Sepahvand

372 Significance of Urinary Monocyte Chemoattractant Protein-1 in Early Detection 3030-3039 of Nephropathy in Type 2 Diabetic Patients Mona I Nabih, Ahmed El-Mazny, Nadia A Mohamed and Amal R El-Shehaby

373 In Vitro Activity of nano-silver against Pulmonary Pathogenic Fungi 3040-3043 Chao Xu, Chuanwen Gao, Hua Zhang, Jianli Chen

374 Expression and clinical significance of NF-κB and VEGF-C in esophageal 3044-3047 squamous cell carcinoma Zheng Tang, Yongxia Wang, Aihong Yang, Xinlai Qian Yu Wang

375 The nurse-patient relationship cognitive differences: Revelation for continuing 3048-3051 nursing education Wanhong Wei, Qiaofang Yang, Weihua Liu, Yulan Chang

376 The effect of audit quality on stock valuation in initial public offering 3052-3056 Mosaieb Akrami Shahrasbi. Asghar Karimi Khorami.

377 Unilateral Versus Bilateral Laparoscopic Ovarian Drilling in Clomiphene Citrate 3057-3060 Resistant Polycystic Ovary Syndrome Abdelhafeez M.A., Ali M. S., Sayed S. N.

378 Antibodies to Cyclic Citrullinated Peptides (Anti-CCP) as a Marker of 3061-3065 Association between Type 1 Diabetes Mellitus (T1DM) and Rheumatoid Arthritis (RA) in Children and Adolescent Doaa Shahin , Rawia A. Swelam, Abeer Fathy , Dina A. Shahin, Mohamed Attiya

379 The use of microarrays to reveal the probabilistic gene network associated with 3066-3069 the response of rice to low-energy ion beam bombardment Xiangli Yu, Yonghui Li and Huiyuan Ya

380 Anesthetic Induction with Propofol versus Ketamine Pre and Post Lower Pole 3070-3080 Nephrectomy in Dogs Shekidef, M. H.; Helal, I. E and Ramadan, Taha

381 Electrogastrographic (EGG) and Gastric Emptying Changes in Patients with 3081-3088 Duodenal Ulcer .The Effect of H. Pylori Eradication Samia A. Abdo, HishamS. Abdel Fattah, Uomna Kamel

382 The comparison of ambiguity, loneliness feeling and responsibility 3089-3095 tolerance among the children of singlechild and multi child families Hanie Shokri Mirhosseini, Zahra Rafiee Javid.

II Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Failure to Construct a Meaningful Border for Democracy in E. L. Doctorow's: The book of Daniel

Zohreh Ramin1 , Seyyed Mohammad Marandi2

1. Assistan Professor, University of Tehran, Tehran, Iran1. 2. Associate Professor of English Language and Literature, University of Tehran, Tehran, Iran2 [email protected]

Abstract: In his Reporting the Universe, a book of non-fiction, Doctorow, like many other Western writers, represents his orientalist mode of thought as he divides societies into two broad categories: countries, mainly Eastern, which are governed by a religious ruler, whose system of governance is an "absolutist theocracy" and in which the people are fanatic, religious, and backward-minded. According to Doctorow, the absolutist theocracy in such countries have safeguarded their power by suppressing freedom of expression, hence a hindrance to the outburst of multiplicity of voices and actions, regarded as a threat to the state. On the other hand, Western countries, specifically America, which are not governed by absolutist theocracy and have accepted the fact that holy texts have been communally redacted, have, according to this view, blessed their countries with the gift of freedom of expression and multiplicity, hence opening space for emergence of contradictory ideas, never claiming perfection. However, the ironical point in Doctorow is between what he claims in his nonfictional work and what he proves in his novels. His major novels reveal the impossibility of evolution and change, as the outcome of this so called democracy is nothing but degeneration, lack of justice and impracticality of freedom. With regard to Doctorow's stance towards American democracy and focusing on The Book of Daniel, the present paper aims to show the impossibility and impracticality of Doctorow's claims regarding the American democratic system. While Doctorow believes America is governed by a democratic system which can evolve, his novels, which deal with the American past, delineate a bleak and dark picture of this democratic society in which no evolution is observable and history is the continual repetition of human tragedy. [Zohreh Ramin, Seyyed Mohammad Marandi. Failure to Construct a Meaningful Border for Democracy in E. L. Doctorow's: The book of Daniel. Life Sci J 2013;10(1):2942-2947](ISSN:1097-8135). http://www.lifesciencesite.com. 358

Key Words: Doctorow, civil society, theocracy, democracy, evolution.

Introduction American novelists: a serious writer who is also Doctorow inaugurated his writing career at a popular; a political writer who is also a stylist, an time when America was experiencing a major original writer who is highly eclectic; a historical disillusionment in the political and social sphere. His writer who invents the past" (8). It comes as no writing vocation began with the publication of his surprise then, that although Doctorow sets his novels first novel Welcome to Hard Times in 1960. This was in specific, often critical, historical contexts, yet his a time in which metafiction was gaining widespread novels deviate from traditional nineteenth-century popularity as a literary technique. However, the realist history novels. ambience of cynicism, characteristic of the political Despite the variety in content, historical and social context of the 1960s, is by no means setting and narrative character and voice, almost all confined to his first novel. The spirit of the novels employ metafiction to some extent. disparagement and disillusionment towards social Doctorow's novels are paradoxically unique and and political issues which found its way into similar, radical and conservative, postmodern and Doctorow's first novel is later extended to cover his modern. But there develops a certain undeniable entire oeuvre. consistency, surfacing in his first novel and Doctorow's writings can be studied as continuing down to his last. Concentrating on The instances of Hutcheon's "historigraphic metafiction" Book of Daniel, the present paper aims to uncover the since Doctorow is not only concerned about the past paradoxical nature of the novel and Doctorow's but his novels demonstrate his concern on how that possible intention. past has been constructed and has affected the construction of the identity and culture of the Why The Book of Daniel? American nation. Praising the novelist's The Book of Daniel is set in the 60s but heterogeneity, Douglas Fowler has observed anticipates the earlier 30s, 40s and 50s, and attempts Doctorow's construction of history: "E. L. Doctorow to capture the transitional phase from the Old Left to is a remarkable phenomenon among contemporary the New Left, concentrating on communism and

http://www.lifesciencesite.com 2942 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

radicalism. The content of the book is based on the time and point of view, and disrupting the narrative's controversial case of Julius and Ethel Rosenberg, the chronological order by providing historical and American-Jewish communist couple who were analytical passages. Like Blue, the narrator of convicted and executed in 1953 for conspiracy to Welcome to Hard Times, Daniel is highly self- commit espionage during a time of war. They were conscious of himself as a writer. The novel contains charged for passing information about the atomic many self-reflexive elements in the form of bomb to the Soviet Union. This was the first monologues "The way to start may be," “ how would execution of civilians charged with espionage in I get this scene to record?....how do I establish United States history and has remained controversial sympathy?"(16) and dialogues directed to the reader ever since. Since the truth of the Rosenberg case and "A NOTE TO THE READER"(66) or "Who are you their role as spies has been enigmatic, it served as an anyway? Who told you you could read this? Is appropriate subject for Doctorow's book, at least at nothing sacred?"(72) the time when he was writing the novel. The book of Daniel is a significant departure Doctorow’s major emphasis in the novel is from Doctorow's earlier work in terms of style. on the impossibility of knowing the truth about the Unlike the western Welcome to Hard Times and the past. This is best reflected in his depiction of the science fiction Big as Life, which were innovative narrator of the book, Daniel Isaacson, the imaginary employments of popular fictional modes, The Book of son of the Rosenberg couple, who undertakes a quest Daniel challenges the reader’s expectation through to know the truth about his family history. However, shattering the narrative line, and fragmenting the the only thing Daniel can finally come to single narrative voice through providing a acknowledge is how illusive history is: "Of one thing multiplicity of viewpoints from which the story is we are sure. Everything is elusive. God is elusive. narrated. Daniel is on a quest of discovery but this Revolutionary morality is elusive. Justice is elusive." discovery is twofold. Not only is he seeking a family (The Book of Daniel, 54) history but he is also attempting to write a PhD The book consists of four sections dissertation. Like Blue he attempts to find his voice "Memorial Day," "Halloween," "Starfish," and and come to an understanding of his own personality "Christmas." After their parents' execution, Daniel at the same time. and his sister Susan are adopted by lower-class Doctorow believes that all texts, including liberals. Set in 1967, when Daniel is 25, the time of historical ones, are fictional and any attempt to find the novel is one of social and political upheavals due the border between the two is futile. to the popular counter-cultural movement of the time Citing the original history of the novel, and the rise to popularity of the New Left. To come Doctorow notes that early novelists including Defoe up with a better understanding about himself, Daniel and Cervantes presented their writings as "histories”, tries to understand his family history. He is also as "false documents". Doctorow's major tenet writing his doctoral dissertation at Columbia towards history is that it is always composed and that University during this time of great political historians are narrators. (24) instability. Daniel uses different narratorial devices According to Harter and Thompson, for and describes his childhood before his parents' arrest, Doctorow, discovery rather than statement is the time they were held in prison, their execution and important; " searching is very much the issue. Thus, his own as well as his sisters' life after their parents' much of the author's energy at the book's outset and, execution. It is through his narration that we learn of indeed, throughout, goes into the creation of Daniel his sisters' plight and attempt at suicide and her as artist figure." Harter and Thompson believe that ultimate death and his own attempt at understanding the continual shifts in point of view in the book the truth about his parents' past. enhance the main issue of "searching" rather than Although the narrative is set in 1967, the coming up with answers and solutions. Daniel's time continually shifts as Daniel's mind roams over ultimate awareness, they claim, is that the world and the past. The narrative's shift in time places two ultimately the self are fragmented and a fragmented specific times alongside each other for the reader to narrative which continually shifts in time and point of ponder over; the Old Left of the 1940s and 1950s, or view has been the best way to reflect this. his parents' world, and the New Left of the 1960s However, what Doctorow is reflecting in the which is Daniels's own time and age. Within this narrative is his fluctuating political convictions which historical context, Doctorow embarks on creating a have been translated from an outside observance of fictive account of the real life Rosenbergs. social and political matters to a narrative which is an Daniel begins his highly self-conscious incarnation his dualistic attitude towards the left and story, which is also his PhD dissertation, by radicals. commenting on his writing, shifting constantly in

http://www.lifesciencesite.com 2943 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The Narrative of The Book of Daniel is Doctorow likewise challenges the possibility of loaded with functionality. That Doctorow is critical freedom and escape from that regime. of the American judicial system stands at the forefront in the novel. Doctorow does not attempt to The illusions of the truth and the left solve the problem of the Rosengebrg/Issacson case The Book of Daniel is Doctorow's open since this is virtually impossible. By recreating the condemnation of injustice in the American story of the trial and the execution of the couple, seen government, reflected through the story of a family mainly from the eyes of their imaginary orphaned son history told by Daniel Rosenberg. Daniel recalls his and occasionally their daughter, the narrative childhood when his father had educated him on how stimulates the sympathy of the reader toward the to look differently at advertisements, arousing at a children, and provokes hatred and disgust at the very early age in the child a critical and analytical injustice and prejudice lying at the heart of the mode of thinking "He worked on me to counteract the American system. bad influence of my culture... Did I ever wonder why To draw forth the sympathy of the reader, my radio programs had commercials? He'd find me involving him/her in the process of attempting to reading the back of my cereal box at breakfast and locate the truth while confronting a malicious and break the ad down and show what it appealed to, how unjust government, Doctorow has been very scruple it was intended to make me believe something that concerning the dominant narrative voice. This wasn't - that eating the cereal would make me an explains why having started writing the book athlete (42). This analytical mode of thinking remains primarily in an entirely third person point of view, with Daniel in his adulthood, and becomes the Doctorow then discarded the hundred and fifty pages grounds by which he tries to find the truth of his he had already written, realizing it had to be " parents' case. Daniels's voice" as he wrote the book anew. Daniel In this novel, Doctorow deviates from and Susan are very disturbed children and the traditional modes of storytelling. One such mode is devastating impact of the execution of their parents shifts in time. The novel covers less than a year, from represents the disturbed condition of the age. Memorial Day in 1967 to the spring of 1968, when Columbia University is closed down by radical Cutting both ways: the illusion of extremism demonstrators and Daniel is forced to leave the That Doctorow combines fact and fiction in library. The novel moves both in place and time. his narratives reflects his playful approach to history Spatially, the novel begins from Massachusetts to and narrative as a means through which he can New York to Washington DC, to Disneyland and approach both sides of his argument. back to New York. Temporally, the novel moves in By reconstructing history, he highlights the and out of various times including the Red Decade of shortcomings and problems of the American political the 1930s, the courtship of Daniels' parents, scenes system of administration which encourages from his childhood in the 1940s, and various other individuals to be self-centered, voracious and racist. historical periods. However, by vacillating between Since Doctorow employs a postmodern style in this the Old left of the time of the Issacsons and the New book, discussing Doctorow's indictment of one side Left, at the time of Daniel, Doctorow does not intend of the argument would not do justice to the narrative to indict the American system of government by content and personal attitude of the author. offering the Left as a savior for the American nation. Although all his novels reflect a harsh and Doctorow’s metafictional narrative shatters both violent criticism of capitalism, yet Doctorow seems sides of the argument, conservative and radical. to be skeptical of an alternative system which would In the figure of the Issacson couple, compensate the deficiencies and shortcomings of Doctorow embodies the failure of the Old American what he primarily sets out to impeach. Left. The communist party which the Issacsons gave Many critics including John G. Parks have up their lives for disclaimed them on their arrest. It referred to the postmodern, even polyphonic nature was only once they found they were being of Doctorow's fiction; "In Doctorow, dialogue or propagated as martyrs that they were reclaimed. The polyphonic fiction is both disruptive or even failure of the New Left is best demonstrated in subversive of regimes of power, and restorative of Daniel's encounter with Artie Sternlicht. Artie neglected or forgotten or unheard voices in the analyzes and criticizes the Old Left; "The American culture" ("The Politics of Polyphony" 455). Communist Party set the Left back fifty years. I think According to Parks, Doctorow challenges the power they worked for the FBI" (166). However Artie is not of the regime with the power of freedom. However, aware of the limitations of the New Left, which is the major focus of this paper is to demonstrate that symbolically depicted in the mural on the walls of his even as he challenges the power of the regime, home which says; "EVERYTHING THAT CAME

http://www.lifesciencesite.com 2944 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

BEFORE IS ALL THE SAME"(151). Stephan the truth. Doctorow has constructed the plot in such a Cooper observes this statement as a disregard and way that the rebellious Susan is finally silenced while neglect of history. (Cooper 117). In fact using the Daniel, the passive brother, survives. Daniel's view words of Eagleton, the Leftist critique of a totalizing about his parents differed greatly from Susan's, who view of history, is itself complicit with its own preferred to idealize them. For Daniel, they were not critique: by observing the past as unitary, the New central to the Left; in fact Daniel finds their roles Left will have problems analyzing the present. Artie were mistakenly magnified by themselves and the US is also suffering from the same misconception the government. But for Susan, they were martyrs. Issacsons experienced: like them he believes the New That Daniel fails to discover anything new Left is the vanguard of a new movement. or any proof about the past, is Doctorow’s intention Daniel is well aware of the impracticality of in demonstrating the ultimate failure and the Left, Old and New. Through Daniel, Doctorow impracticality of leftist or broadly speaking has represented his disappointment and disbelief in subversive contemplation. Doctorow’s indictment of the possibility of change. The juxtaposition of two the Left then is reflected not only through Daniel’s scenes from the novel can highlight Daniel and failed attempt at recovering truth but his excessive Doctorow’s disbelief: In 1940, the Issacsons along contemplation over issues. with many other families decide to attend a lecture by Doctorow indicts Daniel's and on a much Paul Robeson, an American concert singer, recording broader plane, deconstructive modes of thinking artist, athlete and actor who became noted for his which attempt to plunge deep into abstract matters political radicalism and activism in the civil rights and issues, guided by intense analysis and inquiry but movement. On the way, their bus is viciously are impotent at fulfilling practicality. Not only does attacked by a crowd who yell out offensive anti- he delineate the problems of the new left and Semite and racial insults. radical’s in the content of the novel, he also Many years later, Daniel is severely beaten demonstrates symbolically through the character of in an anti-war march. But Unlike the optimistic Daniel the impossibility of postmodern and youthful New Leftists including Artie, Daniel's bitter deconstructive modes of narrative in guiding thinkers personal experience has left him pessimistic of any to an ultimate resolution which can alleviate tensions. possibility for change. He is aware of the strong The polyphonic structure of the narrative power of the establishment, which suppresses any opens up a locus for Daniel to temporarily ponder possibility for change and this is why his attitude in over the possibility of recovering the truth of his the anti-war march is different from other protestors, parents' case. His self-conscious mode of writing and observing their naiveté in expressing joy at being shifts in time and point of view can be observed as jailed. safety-valves, like a carnival for a temporary Doctorow's skepticism and disbelief in the subversion of the hierarchies, but only temporary, for practicality of the Left is also reflected in fictive ultimately, Daniel needs to return to his regular life character of Susan. Daniel and Susan are both fictive and join mainstream culture. descendents of the real Rosenbergs. Both are Although the novel initially sets out to mentally devastated by the death of their parents at a challenge and subvert the American regime of very early age but according to Parks "Daniel and injustice and inequality, the challenge of hegemony Susan Lewin-Issacson are the casualties of history. fails in this novel on two major planes, symbolically Each copes with this experience of trauma and loss figured in the character of Daniel and Susan. Through differently"(40). While Daniel prefers to take his Daniel's analytical mind, Doctorow wishes to open time, pondering and analyzing matters related to the up new horizons of thinking which deviate from death of their parents, searching for the truth, Susan mainstream beliefs and ideas. From this vantage is a desperate activist who has no doubt in their point, new possibilities and truths are supposed to parents' innocence. If Daniel is the analytically emerge, as the result of subverting previously held minded brother, contemplating and analyzing issues, ideas and beliefs. However, Daniel's deconstructive Susan is the practical radical. Unlike Daniel, she is mode of thinking reflected in his self-conscious certain of their parents’ innocence and strongly narration yields no ultimate teleology regarding his inclined to act on their behalf. Daniel prefers to be a parents' case. In practice also such modes of thinking passive recipient; he cannot believe in their parents’ fail as Susan, who has a strong faith in the Left is innocence unless he is offered some “truth” or silenced through death. Ultimately, theory and “proof”. practice yield no satisfactory ends as they are both And yet Susan, the radical child, dies, while ridden with faults and drawbacks. Daniel, who is only stirred to action after fourteen years, decides to set out on the quest for retrieving

http://www.lifesciencesite.com 2945 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Double removal from reality Susan, he is not certain of his parents’ innocence. But Doctorow is among those writers who neither is he successful in fulfilling his desire for employs deconstruction as an application and truth. practice, with specific interest in American history. Perhaps the most outstanding section of the The application of deconstruction in this sense with novel which is of particular relevance to our Doctorow as with many other American scholars argument is the last part of the novel;"Christmas." accordingly becomes political, "because of its This includes Daniel's trip to Disneyland, the place deployment at the site of a specific historical where he can meet Sleig Mindish, the friend and conflict."(Clayton, 54) As such, Doctorow's double- neighbor who had betrayed his parents and who sided practice finally does not result in a radical remained the only possible gateway to knowing the change. But then what does Doctorow finally achieve? truth. Doctorow has quite wittily closed the book by As already discussed, if Doctorow's fiction culminating Daniel’s quest for truth in a location shows instances of subversions, this is either only which is a symbol of illusion, constructed by the transitory or not portentous to the state. Any action in American system. Of course Disneyland plays an the novel which appears to be an uprising against the important part in the novel, a symbol of what state, or in the form of escape from tyranny and America has been built upon and how influential it oppression, is finally suppressed. Any instance of has been in constructing and maintaining the subversion is a safety-valve for the unheard voices. American culture and identity. At the end, although new perspectives have been The park consists of five divisions; offered, everything is restored to its original status. Frontierland, Tomorrowland, Fantasyland, In his most important non-fictional book Adventureland, and Main Street USA. Doctorow's Reporting the Universe (2003), Doctorow has political intention in this part is voiced through outspokenly represented his political interests. These Daniel; "What Disneyland proposes is a technique of political interests can be traced throughout nearly all abbreviated shorthand culture for the masses, a his novels. At the end of a chapter entitled mindless thrill, like an electric shock that insists at "Apprehending Reality", Doctorow states;" We are the same time on the recipient's rich psychic relation indebted as Americans to an underlying civil religion to his country's history and language and literature." that accounts for the exceptionalism we claim as a (305) nation. A civil society can evolve. A theocracy At Disneyland, Daniel confronts what cannot."(110) A writer, no matter how impersonal he William Irwing Thompson has described as "the edge intends to be, cannot help but frame his narratives of history" because once there, he experiences being with his own personal beliefs, making it impossible in a place where "past and future come together to to be an objective writer. And since Doctorow shatter the prevailing order of society”. Disneyland is believes in the evolving capacity of his civil society, a world where everything is built on myth and he has no hesitation in reflecting this perception in fairytale, reinforcing the motif of fakeness and his fiction. betrayal. It is a replica of all the tales and stories Throughout the novel, we follow Daniel as which are themselves mere mythical construction, he proceeds with his quest for his family history, recalling Plato’s notion of the shadow on the cave as engaging in complex analytical thought. Nevertheless, being doubly removed from reality. Consequently, it at the end he comes full circle back to his starting is especially ironical that Daniel's quest for truth has point. Although his quest may have taught him many ultimately ended in this place which rather than being things about himself and the deficiencies of the state, a gateway to the truth of history, is a doubly-removed he also learns of the deficiencies of the New Left just version of truth. To exacerbate matters, Mindish, who the same. Nor does his plight for the truth finally lead is supposedly the only person who can relieve Daniel him to an absolutely stable position of knowledge. So of this burden, is incapable of telling him the truth like Welcome to Hard Times, the novel's cyclic about his parents due to his senility. So the novel structure represents the cyclic structure of history and ends where it begun; the Issacson case remains open the impossibility of escape from it. and Daniel never manages to learn the truth of his Unlike the claim of many critics, Doctorow parents' involvement in the espionage. is very conservative in this novel. His silencing of Doctorow is well aware of the manipulative Susan, Daniel's rebellious sister, at a very early age power of the state which is why he has chosen to end reflects symbolically his distrust at such extreme the novel in this particular location. Disneyland skeptical way of thinking. Rather than political action, manipulates the public by providing for them a Daniel prefers analysis. Susan wants to establish a "synthetic identity" (Harter and Thompson 44) and a foundation in the name of her parents to redeem the composed history. The closing of the novel at this past but Daniel's motives are ambiguous since unlike point reinforces the impossibility of knowing the

http://www.lifesciencesite.com 2946 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

truth and the power of the system to control the lives towards leftist, radical and rebellious actions and of individuals. What is ultimately left of the Issacson characters. radicals is a son whose quest for knowing the truth Considering Doctorow’s statement has remained hampered. The system is too powerful regarding the success and possibility of evolution in a to be challenged, even if that challenge is a mere civil society, one cannot help but observe that quest for truth. Doctorow's ambivalent political stance in this novel Daniel's failure can be juxtaposed with the reflects his failure to uphold his optimistic attitude strength of the system in creating myths, towards the success of democracy and its capacity to symbolically represented in Disneyland, and offering precipitate progress. them as popular truths and reality to the nation. The search for truth in such a system can only result in a Bibliography: double-removal from reality. 1. Cooper, Stephen. "Cutting Both Ways: E. L. Daniels' narrative continually shifts between Doctorow's Critique of the Left." South Atlantic two timelines, that of the old and the new left. There Review, Vol. 58, No. 2 (May, 1993): 111-125. is no progression in the end because the basis of the 2. Doctorow, E.L. The Book of Daniel. London: novel is constructed on the conception of Daniel's Penguin Books, 1971. limitation in knowing. The novel ends where it began, 3. Reporting the Universe. Harvard: Harvard leaving Daniel and his provisional understanding University Press, 2003. about his family untouched and his mind still full of 4. Fowler, Douglas. Understanding E. L. unanswered questions about the truth of his parents' Doctorow. New York: University of South case. The New Left will inescapably end where the Carolina Press, 1992. old Left ended; the acceptance of the status quo. 5. Harter, Carol and James R.Thompson. (1990). The novel has depicted the power of the E.L. Doctorow. Boston: Twayne Publishers. system in controlling the lives of individuals, for the 6. Parks, John G. E. L. Doctorow. New York: entire plight and confusion of Daniel and the Continum, 1991. "The Politics of Polyphony: premature death of Susan is due to the decisions of The Fiction of E. L. Doctorow." Twentieth the American juridical system. However, as Century Literature, Vol. 37, No. 4, pp. 454-463. Doctorow demonstrates, there is no alternative as this system will continue to govern and direct the lives of future generations of Americans, through the 2/22/2013 “fairytale” versions of truth they “construct” for their nation through other Disneylands. The ultimate conclusion Doctorow's conservative narrative can lead Daniel to is the acceptance of the status quo.

Conclusion The Book of Daniel, a work published during the turbulent years of the counter-culture movement, coincides with the emergence of the then- new techniques of subversive narrative construction. Though the novel may appear to be indicting the American judicial system through highlighting the controversial Rosenberg case, yet Doctorow's ultimate stance towards the case appears to be ambivalent. Although Doctorow appears to be upholding radicalism and liberalism, yet a closer scrutiny of the novel proves otherwise. Initially, Doctorow sets out to break the frames of traditional realist historical fiction by merging the border between fact and fiction. But just as this frame-breaking does not intend to bestow superiority to fiction over fact, nor does it favor a radical, rebellious and entirely subversive attitude. As demonstrated in this research, Doctorow takes an equally criticizing approach

http://www.lifesciencesite.com 2947 [email protected] Life Science Journal 2013;10(x) http://www.lifesciencesite.com

Prevalence of Plasmodium Vivax Using PCR Method in Afghan Refugee Ghamkol Camp District Kohat, Pakistan

Riaz Ullah1*, Sultan Ayaz 2, Shehzad Zarin 2, Jameel A. Khader3, Naser M. AbdEIslam3 1Department of Chemistry, Sarhad University of Science and Information Technology, Peshawar, KPK, Pakistan 2Department of Zoology, Kohat University of Science and Technology Kohat, KPK, 26000, Pakistan 3Arriyadh Community College, King Saud University, Riyadh, Saudi Arabia

Corresponding Author Dr Riaz Ullah. [email protected]

Abstract: Malaria is a disease caused by protozoan parasites belongs to the genus Plasmodium, which is transmitted by female Anopheles mosquito. It causes more than one million deaths per year. Afghan Refugees in Pakistan are at higher risk of malarial infection. Blood samples were collected from Afghan refugees in Ghamkol camp district Kohat. The samples were analyzed by Hemometer and Polymerase Chain Reaction. A total of 220 blood samples were examined by poly merease chain reaction (PCR) from susceptible peoples resides in Afghan refugee Ghamkol camp district Kohat. The DNA were extracted and amplified through PCR which confirmed the P.vivax detection. Overall prevalence of malaria 50.00% (110/220), among these Males were 50.00% (78/156) and females were 46.87% (30/64). It was observed an average low level of Hb(9.98gm/dl) in P. vivax infection patients. It was concluded that children at the age 1-20 years were more susceptible for malarial infection than above ages. Plasmodium vivax was more prevalent in Afghan refugee Ghamkol camp Kohat. [Riaz Ullah, Sultan Ayaz, Shehzad Zarin, Jameel A. Khader, Naser M. AbdEIslam. Prevalence of Plasmodium Vivax Using PCR Method in Afghan Refugee Ghamkol Camp District Kohat, Pakistan Life Sci J 2013;10(1):2948-2953] (ISSN:1097-8135). http://www.lifesciencesite.com. 359

Keywords: Prevalence, Plasmodium vivax and PCR

1. Introduction dept of health, 2011). The most hazardous and most Malaria is a prehistoric disease caused by problematical malaria is caused by P. falciparum that protozoan parasites belongs to the genus Plasmodium, may cause severe renal failure, low blood sugar, non which is transmitted by female Anopheles mosquito cardiopulmonary edema and black water fever, while (Cox, 2010). Malaria is the one of the 5 harmful than highest manifestation of the malaria is the diseases that causes casualties in pediatric cerebral malaria (Bhalli & Samiullah, 2001; populations (Jamal et al., 2005). Amongst blood Mohapatra et al., 2006). infections it is the most common communal health Majority of countries affected by the crisis of the tropics particularly in emergent countries Malaria are amongst the poorest countries in the with its morbidity and mortality at deplorable globe. Malaria is prevalent in Pakistan (Murtaza et al., elevated levels (Cabe, 2001). The yearly death rate of 2004). In Pakistan, an probable 500,000 cases of malaria is about 1.5 to 2.7 million public while about malaria arise annually (Ali et al., 2008) while in 300 to 500 million individuals are at risk of malaria Afghanistan occurrence of malaria was estimated to (Upadhyay et al., 2011). Malaria caused more than be 3 million cases annually, but study from 2001 to one million deaths per year globally (Bhalli & 2005 reviled that the frequency of P. falciparum and Samiullah, 2001). The probable occurrence of P. vivax, is increased from 3 million cases annually malaria worldwide has compacted by 17 percent (Abdur rab et al., 2003). In Pakistan there are two since 2000 and malaria-specific death rates by 26 species of Plasmodium which are prevailing i.e. P. percent. These rates of turn downs are lower than vivax and P. falciparum (Khan et al., 2004). Afghan globally agreed targets for 2010 (reductions of 50 Refugees in Pakistan are at elevated risk of malarial percent) but nevertheless, they symbolize a chief infectivity as compare to the local population, it is accomplishment (World Malaria Report, 2011). suggested that Afghan public have brought the There are about four species of Plasmodium malarial infection by them from Afghanistan i.e. Plasmodium vivax, Plasmodium falciparum, (Suleman, 1988). Clinical complications are directly Plasmodium malariae and Plasmodium ovale proportional to the Parasite count up at the (Upadhyay et al., 2011).Additional species that erythrocytic stage, upper the parasitic density, high chiefly transmit disease to primates (Plasmodium will be the complications (Murthy et al., 2000). simiovale and P.knowlesi) may infects humans There are lots of diagnostic techniques for mainly those working in the jungle habitats near the recognition of malaria, still broadly used may contaminated infected primates (Washington state perhaps be only 50 % precise (Chiodini, 1998). Test

http://www.lifesciencesite.com 2948 [email protected] Life Science Journal 2013;10(x) http://www.lifesciencesite.com

like microscopy (thin and thick smears), judgment of PCR could be performed with minimum expenditure thin and thick blood slides under the microscope is for confirmation. well thought-out a gold standard in the finding of malaria. Microscopy is very sensitive, revealing, low- DNA Extraction: cost but labor-intensive technique, requiring at least DNA was extracted by Vivantis GF-1 25 minutes to one hour from Sample assortment to Nucleic Acid Extraction Kits with the end outcome (Bain et al., 1997). The rapid antigen manufacturer’s protocol. detection test (histidine-rich protein-2 Plasmodium Primers: aldolase and Plasmodium lactate dehydrogenase) and For the finding of P. vivax four published Polymerase Chain Reaction (PCR) which is very primers were designed to detect the P.vivax sensitive, precise, accurate and expensive test circumsporozoite (VCS) protein. Those four primers (Durand et al, 2005). Looking to above hazards and are VCS-OF (Outer Forward), VCS-OR (Outer importance of malarial parasites the current study is Reverse), VCS-NF (Inner Forward) and VCS-NR designed to carry out the prevalence and molecular (Inner Reverse). detection of malarial parasites in Afghan refugee Sequence: camp district Kohat. VCS-OF ATGTAGATCTGTCCAAGGCCATAAA VCS-OR TAATTGAATAATGCTAGGACTAACAATATG 2. Material and Methods 58 degree C Annealing Temperature for 25 Cycles Study Area (Mallika, et al., 2005). District Kohat is an area of the 2,545 square Sequence: kilometers (983 sq mile) located at 33°35'13N VCS-NF GCAGAACCAAAAAATCCACGTGAAAATAAG 71°26'29E with 489 meters (1607 feet) latitude with VCS-NR CCAACGGTAGCTCTAACTTTATCTAGGTAT 1,250,000 population (1998 cencus) in Khyber 62 degree C Annealing Temperature for 30 Cycles Pakhtunkhwa province of Pakistan (Location of (Mallika, et al., 2005). Falling Rain Genomics, Inc. 1996-2010). Ghamkol DNA Amplification camp is located about 5 kilometers at the North-East PCR was performed by Nyx technic Thermal Cycler of Kohat city. Ghamkol Camp is the largest Afghan in two rounds.the PCR mix was prepared which Refugee camp in Kohat; it is divided in to 3 camps i.e. included tag bufferNH3 (SO)4 2.2ml, MgCl2 2.4ml, Camp no.1, Camp no. 2 and Camp no. 3. Afghan dNTPs (50mM) 1.1ul, VCS-OF 1.0ul, VCS-or 1.0ul Refugees migrated from Afghanistan during Soviet tag polymerase 0.5ul, target DNA5.0ul and the distil War in 1980s. According to Census Report 2009 water add upto 20ul. All the reagent were remain the there are about 1.7 million Afghan peoples registered same in 2nd round except the primers VCS-OF and in Pakistan. Most of them live in Khyber VCS-OR which are replaced by VCS-NF and VCS- pukhtunkhwa. (Express Tribune, 2011) Patient NR PCr was performed with the following selection Afghani population (who were suspected to programmed;PCR Conditions for Round 1; with have malarial infection) was included in this study. initial denaturation cycle 1 at 95oc for 5minutes, 25 Blood samples were randomly collected from varying cycle including denaturation at 94ocfor 0.45minute, age groups (1-51 years old) from both the sexes annealing at 58oc for 0.45minute , extension at 72oc during visit whom was clinical suspected.. The for 0.50 minte and final extension at 72oc for 5.00 complete record of each subject was recorded on a minutes and similarly the the programmed for 2nd separate Performa regarding to his/her clinical round as , with initial denaturation cycle 1 at 95oc for histories, hygienic condition and socio-economic 5minutes, 25 cycle including denaturation at 94ocfor status. 0.45minute, annealing at 61oc for 0.45minute , Sample Collection and processing extension at 72oc for 0.50 minute and final extension 3 ml blood was collected by disposable at 72oc for 5.00 minutes. sterile syringe from each patient and poured into 5ml GEL Electrophoresis: EDTA tube to avoid blood clotting. Each tube was For the detection of PCR amplified VCS labeled according to the patient specific ID code as gene, gel electrophoresis was performed and per proforma record and the samples were processed visualized in UV Transilluminator. in the Molecular Parasitology & Virology Laboratory, Data Analysis Department of Zoology Kohat University of Science Statistical study was done by means of and Technology Kohat for further experimental “STATISTIX”, version 9.0, Korean made software. analysis by Hemometer, Microscopy, Rapid Variables included for evaluation were age, sex and Diagnostic Test and PCR. The Microscopy and RDT area for parasitic infection. was used for initial screening of the samples so that 3. Results

http://www.lifesciencesite.com 2949 [email protected] Life Science Journal 2013;10(x) http://www.lifesciencesite.com

A total of 220 blood samples (Male = 156 and susceptible peoples resides in Afghan refugee Female = 64) were randomly collected from

Fig; 1 DNA Gel result, M; 50bp marker, Lane; 12, 13, 18,19, 29 positive Lane; 35 positive control, Lane; NC negative control

Fig; 2 Showing the effect of ponds on the prevalence of malaria disease.

http://www.lifesciencesite.com 2950 [email protected] Life Science Journal 2013;10(x) http://www.lifesciencesite.com

Table-2: By Age Prevalence of Plasmodium vivax in Afghan Refugee Ghamkol Camp

Age Groups PCR Total Cases (in years) P. vivax +ve (%) -ve(%) <1 4 2 (50.00) 2(50.00) 1-10 46 20 (43.47) 26(56.52) 11-20 70 36(51.42) 34(48.57) 21-30 56 34(60.71) 22(39.28) 31-40 34 14(41.17) 20(58.82) 41-50 4 2 (50.00) 2 (50.00) 51> 6 2(33.33) 4(66.66) Total 220 110 110

Average Hb level 14

12 12.2 9.98 10

4 HB (gm/dl) level

0 -ve Population P. vivax +ve Population

Fig; 3 Hemoglobin level analysis

Table-1 Sex wise prevalence of Plasmodium vivax Plasmodium vivax Male Female Diagnostic Technique Total positive +ve -ve +ve -ve n (%) n (%) n (%) n (%) PCR 110 78(50.00) 78(50.00) 30(46.87) 34(50.00)

Ghamkol camp district Kohat in the months years 36 positive cases were observed, in age group September, 2011. Overall prevalence of malaria 21-30 years 34 positive cases were observed, in age 50.00% (110/220), among these Males were found to group 41-50 years and 51> years 2 positive cases be more infected with malaria i.e. 50.00% (78/156) as were observed in each. A large population of age compared females i.e. 46.87% (30/64) as shown in group 11-20 years was positive in this study (Table- table-1. All the samples were experimentally 2). evaluated by a Polymerase Chain Reaction and 600bp By ponds prevalence: bands were visualized in 2%agarose gel.(figure-1). Among 110 PCR positive patients, 81.81% By Age Prevalence (90/110) lived in the area where there were ponds or In age group less than 1 year, only 2 positive dense greenery, while rest of the 18.18% (20/110) cases were examined. In age group 1-10 years 20 live in the area with no ponds or greenery. A large positive cases were observed, in age group 11-20 numbers of malaria infected population were those

http://www.lifesciencesite.com 2951 [email protected] Life Science Journal 2013;10(x) http://www.lifesciencesite.com

people who live near ponds, which are the mosquito In present study, a total of 110 PCR positive breeding places. (Fig.2) patients 50.00% (78/156) male while 46.87% (30/46) female were positive for the malarial infection, a large number of male population was positive as Clinical Symptoms: compare to female, with male to female ratio of Among 110 PCR positive patients 102 had 1.15:0.5. Similar case was in the study of Idris et al., Headache, 94 had back pain, and 106 had 2007. This may be due to the activities of the male temperature while 50 had vomiting. Temperature and population in Afghan refugees where male are active Headache were the most frequent clinical symptoms for the outside activities and are more prone to biting in malaria positive patients. of the mosquitoes and malarial infection while female Hemoglobin level analysis are restricted to their homes and are comparatively An average low Hb level i.e. 9.98gm/dL was safe for the bite mosquitoes.In the current study it is observed in positive cases as compare to negative revealed that the infection of the P. vivax was ones which was 12.2gm/dL (Figure-3). concentrated the younger age groups as compare to 4. Discussions older ages, similar findings were reported by Malaria is one of the vital community health Carneiro et al., 2010. troubles in Pakistan. Globally it affects about 300 In this study I used 61 degree Celsius million populations, and also causes more than one annealing temperature at 25 cycles for VCS-NF and million mortalities per annum. Malaria attacks on all VCS-NR, and got positive amplified product of Pvcs age groups and both of the sexes. Accurate while Aarti, et al, 2010 used for Plasmodium Vivax identification of the malarial parasites and its Circumsporozoite (Pvcs) primers for the treatment is very necessary for the anticipation of the amplification of Plasmodium Vivax DNA This Malaria (Jamal et al., 2005). Malaria was a major contrast is may be due to voltage fluctuation of the health trouble during emergency in Afghanistan and electricity in the laboratory as protocol of Aarti, et al, still a health issue in the refugees in who came into 2010 was not giving proper results in current study. Pakistan (Rowland, 2001). Zucker, 1996 suggested It was proved in the current study as that the import of malaria by travelers, immigrants, improper DNA extraction Hemoglobin remains intact and refugees is important and rising health problem. in the extracted DNA, which adversely affect the Current study reveled that Afghan Refugees PCR and do not give proper results. Same findings resides in Ghamkol camp District Kohat are at higher were concluded in the study of Al-Soud, 2001 and risk of Plasmodium vivax malarial infection. Housing Radstrom et al., 2004. situation of the Ghamkol is not good as it should be. Malaria infection causes lower the There is no proper drainage system as a result of hemoglobin level which was studied in all positive which water logged condition is so common that patients. A low Hemoglobin level was observed in provide the best breeding place for mosquitoes. The malaria positive cases i.e. an average 9.98 gm/dl for finding of the present study coincides with the the infection of P. vivax. this parameter was studied previous study conducted by Suleman, 1988. by DeMaeyer & Adiels-Tegman, 1985 and concluded Poor Afghani people are unable to protect that Hemoglobin concentration becomes lower due to themselves from malaria; same situations (that lead to RBC destruction and also due to the removal of spread malaria) were reported by W.H.O, 1990 and parasitized and non-parasitized RBCs. Zulueta, 1989. 5. Conclusion It was reported that refugees can have a very It was found that children at the age 1-20 elevated occurrence of malaria infections with or years were more susceptible for malarial infection without showing any symptoms (Babiker in 1998; than above ages. Plasmodium vivax was sole Franks 2001). The finding of the above study was aetiological agent for cause of malaria in Afghan correlated with the present study that Afghan refugee Ghamkol camp Kohat Pakistan. refugees are at higher risk of malarial infection in Acknowledgements: Ghamkol camp district Kohat. The authors are thankful to the Deanship of In current study a high percentage (50.00%) Scientific Research, King Saud University Riyadh for of the Afghani population (reside in Ghamkol Camp funding the work through the research Group project District Kohat) were confirmed positive for the No RGP-VPP- 076. Authors also wish to thanks HEC malaria infection. Positive results for P. vivax of this Pakistan for promoting the activity of science and study are somewhat matching (with a little bit technology in Pakistan. increase) with the study of Idrees et al., 2007. increase may be due to managemental, hygienic and Corresponding Author: environmental condition of the area. Dr. Riaz Ullah

http://www.lifesciencesite.com 2952 [email protected] Life Science Journal 2013;10(x) http://www.lifesciencesite.com

Department of Chemistry 14. Franks, S., Koram, G. E, Wagner, K., Tetteh, D., Sarhad University of Science and Information McGuinness, J.G., Wheeler, F., Nkrumah, L., Technology Peshawar KPK Pakistan Ranford-Cartwright, and Riley, E. M. (2001). Frequent and persistent, asymptomatic Plasmodium falciparum infections in African infants, References characterized by multilocus genotyping. Journal of 1. Abdur-rab, M., Freeman, T.W., Rahim, S., Durrani, Infectious diseases, (183):796–804. N., Simon-Taha, A. and Rowland, M. (2003). High 15. Idris, M., Sarwar, J., Fareed, J. (2007). Pattern of altitude epidemic malaria in Bamian Province, central malarial infection diagnosed at ayub Teaching Afghanistan.. East Mediterranean Health Journal, hospital abbottabad. Journal of Ayub Medical (9):232–239. College Abbottabad, 19(2). 2. Ali, H., Ahsan, T., Mahmood, T., Bakht, S.F., Farooq, 16. Jamal, M.M., Ara, J., Ali, N. (2005). Malaria in M.U. and Ahmed, N. (2008). Parasite density and the pediatric age group: a study of 200 cases. Pakistan spectrum of clinical illness in falciparum malaria. Armed Forces Medical Journal, 55(1):747. Journal of College of Physicians and Surgeons 17. Jamal, M.M., Ara, J., Ali, N. (2005). Malaria in Pakistan, (18):362-8. pediatric age group: a study of 200 cases. Pakistan 3. Al-Soud, W.A. and Radstrom, P. (2001). Purification Armed Forces Medical Journal, 55(1):747. and characterization of PCR-inhibitory components 18. Khan, M.A., Smego, R.A., Rizvi, S.T, and Beg, M.A. in blood cells. Journal of Clinical Microbiology, (2004). Emerging drug resistance and guidelines for (39):485-493. treatment of malaria. Journal of College of 4. Babiker, H.A., Abdel-Muhsin, L.C., Ranford- Physicians and Surgeons Pakistan, (14):319-24. Cartwright, Satti, G. and D. Walliker. (1998). 19. Mallika, I., Pukrittayakamee, S., Grüner, A.C., Rénia, Characteristics of Plasmodium falciparum parasites L., Letourneur, F., Looareesuwan, S., White, N.J. and that survive the lengthy dry season in eastern Sudan Snounou, G. (2005). Practical PCR genotyping where malaria transmission is markedly seasonal. protocols for Plasmodium vivax using Pvcs and American journal of tropical medicine and hygiene, Pvmsp1. Malaria Journal, (4):20. (59):582–590. 20. Murtaza, G., Memon, I.A. and Noorani, A.K. (2004). 5. Bain, B.J. and Chiodini, P.L. (1997). The laboratory Malaria prevalence in Sindh. Medical Channel, diagnosis of malaria. England Journal of Medicine, 10(2):41-2. (19):165-70. 21. Murthy, G.L, Sahay, R.K, Srinivasan, V.R, Upadhaya, 6. Bhalli, M.A. and Samiullah. (2001). Plasmodium A.C, Shantaram, V. and Gayatri, K. (2000). Clinical falciparum malaria - a review of 120 cases. Journal profile of P. falciparum malaria in tertiary care of College of Physicians and Surgeons Pakistan, hospital. Journal of Indian Medical Association, (1):300-3. (98):160-2. 7. Cabe J. (2001). Washington State Department of 22. Radstrom, P., Knutsson, R., Wolffs, P., Lovenklev, Health, 2011 Reporting and Surveillance Guidelines M. and Lofstrom, C. (2004). Pre-PCR processing: National Institute of Health News Release, 1-2. strategies to generate PCR-compatible samples. 8. Carneiro, I. , Roca-Feltrer, A., Griffin, JT., Smith, L., Molecular Biotechnology (26):133-146. Tanner, M. (2010). Age-Patterns of Malaria Vary 23. Suleman, M. (1988). Malaria in Afghan refugees in with Severity, Transmission Intensity and Seasonality Pakistan. Transactions of the Royal Society of in Sub-Saharan Africa: A Systematic Review and Tropical Medicine and Hygiene, 82(1): 44–47. Pooled Analysis. PLoS ONE, 5(2):10 24. Upadhyay, D.N., Sharma, M.L., Sony, Y. and Rajnee. 9. Chiodini, P.L. (1998). Non-microscopic methods for (2011). Comparison in serum profile of peroxidants diagnonsis of malaria. Lancet, (351): 80-1. (MDA) and nonenzymatic antioxidants (Vit E and C) 10. Cox, F.E.G. (2010). History of the discovery of the among patients suffering from falciparum malaria. malaria parasites and their vectors. Parasites & Journal of Pakistan Medical Institute. (25):96-100. Vectors, (3):5. 25. Washington State Department of Health, 2011 11. De-Maeyer, E. and Adiels-Tegman, M. (1985). The Reporting and Surveillance Guidelines National prevalence of anemia in the world. World Health Institute of Health News Release, 1-2. Statistics Quarterly, (38): 302-316. 26. World Health Organization, (1990). World Malaria 12. Durand, F., Drassous, B., Fricker-Hidalgo, H., Situation in 1990, (6): 801-4. Carpentier, F., Brion, J.P. and Grillot, R. (2005). 27. World Health Organization. (2011). World Malaria Performance of the new malaria rapid diagnostic test Report. with returned travelers: a 2-year retrospective study 28. Zucker, J. R. (1996). Changing patterns of in a French teaching hospital. Clinical Microbiology autochthonous malaria transmission in the United and Infection, (11):903-907. States: a review of recent outbreaks. Emerging 13. Francis, E.G. (2010). History of the discovery of the Infectious Diseases, (2):37–43. malaria parasites and their vectors. Parasites and Zulueta, J. (1989). Malaria in Afghan Refugees. Vectors, (3): 5. 29. United Nations High Commissioner for Refugees. Geneva.

2/6/2013

http://www.lifesciencesite.com 2953 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Biological potential of Phlomis bracteosa

Riaz Ullah 1*, Jameel A. Khader2, Naser M. AbdEIslam2, Sultan Ayaz3, Iqbal Hussain4, Shabir Ahmad4

1Department of Chemistry, Sarhad University of Science and Information Technology Peshawar, KPK, Pakistan 2Arriyadh Community College, King Saud University, Riyadh, Saudi Arabia 3Department of Zoology, Kohat University of Science and Technology Kohat, KPK, 26000, Pakistan 4Department of Chemistry, Kohat University of Science and Technology Kohat, KPK, 26000, Pakistan Corresponding Author Dr Riaz Ullah [email protected]

Abstract: The aim of this study was to investigate the biologically active fractions of Phlomis bracteosa against Insecticidal Bioassay, cytotoxicity (brine shrimp bioassay) and Phytotoxicity. Methanol, n-hexane, chloroform, ethyl acetate and water fractions derived from the aerial parts of Phlomis bracteosa were screened for various in vitro biological activities. These fractions did not display any significant results. [Riaz Ullah, Jameel A. Khader, Naser M. AbdEIslam, Sultan Ayaz, Iqbal Hussain, Shabir Ahmad, Biological potential of Phlomis bracteosa. Life Sci J 2013;10(1):2954-2957] (ISSN: 1097-8135). http://www.lifesciencesite.com. 360

Key words: Phlomis bracteosa, biological activities, crude fractions

1. Introduction The whole parts of P. bracteosa were dried The genus Phlomis (Lamiaceae) consists of in dark, chopped and ground to coarse powder. The about 100 species (Albaladejo et al., 2004; powdered plant (3 Kg) was initially extracted with Kyriakopoulou et al.,2001). A number of which are methanol (7 days × 3) at room temperature. The employed as stimulant and tonics in Anatolian folk combined methanol extract was evaporated under medicine (Calis and Kırmızıbekmez, 2004). Phlomis reduced pressure leaving behind a greenish, syrup species are explained by Dioscorides as herbal residue (155 g). The methanol extract was partitioned medicines, and are in practice ethno- in various fractions through separating funnel. It was pharmacologically in herbal drugs for respiratory partitioned in hexane (45 g), chloroform (60 g), tract ailments and for local healing of injuries. Some ethylacetate (28 g) and water (22 g) successively Phlomis species are used in folk medicine for their analgesic and antidiarrheal properties, and for the 2.3. Brine Shrimp Lethality Bioassay Methodology treatment of ulcers and hemorrhoids. There are few Via the protocol of (Meyer et al., 1982), reports about the pharmacological and biological brine shrimp (Artemia salina larvae) eggs were effects of Phlomis. Some studies have shown various hatched in a shallow rectangular plastic dish, filled activities such as anti-inflammatory, immuno- with artificial seawater, which was prepared by suppressive, antimutagenic, anti-nociceptive, mixing a commercial salt mixture (Instant Ocean, antifibriel, free radical scavenging, anti-malarial, and Aquarium System, Inc., Mentor, OH, USA) with anti-microbial effects (Sarkhail et al., 2006). double distilled water. An unequal partition was Different classes of glycosides comprising made in the plastic dish with the help of a perforated diterpenoids, iridoids, phenylpropanoids, device. An approximately 50 mg of eggs were phenylethanoids and flavonoids have been identified sprinkled into the large compartment, which was from the genus Phlomis. Many of these darkened while the smaller compartment was opened phenylpropanoids showed significant biological to ordinary light. After two days a pipette collected activities, such as cytotoxic, cytostatic, anti- naupil from the lighter side. A sample of the test inflammatory, immuno-suppressant and anti- fraction was prepared by dissolving 20 mg of each microbial (Kamel et al., 2000). fraction in 2 ml of methanol. From this stock solution, 1000,100 and 10 μg/mL was transferred to 12 vials; 2. Materials and Methods three for each dilution, and three vials were kept as 2.1. Plant materials control having 2 ml of methanol only. The solvent The whole parts of the plant P. bracteosa was allowed to evaporate overnight. After two, when were collected from the Kurram Agency NWFP, shrimp larvae were ready, I ml of sea water was Pakistan in June 2005 and were identified by Mr. added to each vial along wit 10 shrimps and the Naveed Botanist: at the Department of Botany, volume was adjusted with sea water to 5 ml per vial. University of Peshawar NWFP Pakistan. Herbarium After 24 hours, the number of surviving shrimps specimens were deposited in Department of Botany. counted. Data was analysed by a Finney computer 2.2. Extraction program to determine the LD50 (Finney, D.J. 1971).

2954

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

2.4. Phytotoxicity Bioassay Methodology with muslin cloth tied by means of rubber bands, or This test was performed according to the small jars or wide mouthed bottles sealed with filter modified protocol of (McLaughlin, J.L, 1988). paper (Whatman No. 29, black) and paraffin wax (to According to McLaughlin “The test fraction were prevent contamination) are suitable. The media incorporated with sterilized E-medium at different should be sterilized at 60 C for one hour. The insects concentrations i.e. 10, 100, 1000 μg/mL. in methanol. are exposed to test sample (each fraction) by contact Sterilized conical flasks were inoculated with method using filter paper. 1 ml of different fractions of desired concentrations prepared from the concentration of every fraction is applied by stock solution and allowed to evaporate overnight. micropipette to 90 mm diameter filter papers and Each flask was inoculated with 20 ml of sterilized E- then placed in the petri dishes. After that adult insects medium and added ten Lemna acquinoclialis Welv., of same size and age in each batch are transferred to each containing a rosette of three fronds. Other flasks Petri dishes. A check batch is treated with solvent for were supplemented with methanol serving as determination of solvent effect. A control batch is negative control and reference inhibitor.i.e. parquet kept for determination of environmental effects. serving as positive control. Treatment was replicated Another batch supplemented with reference three times and the flasks incubated at 30°C in Fisons insecticides e.g. coopex and Deeis (synthetic Fi-Totron 600H growth cabinet for seven days, 9000 Pyrethroids) are used. All these are kept without food lux intensity, 56+10 rh (relative humidity) and 12 throughout 24 hours exposure period. Mortality hours day length. Growth of Lemna acquinoctialis in counts are done after 24 hours exposure period.LC50 fraction containing flask was determined by counting Values then determined by probate mortality curve the number of fronds per dose and growth inhibitor that is drawn on log-log graph paper. (Majeed, I 1994, calculated with reference to negative control Naqvi S. N. H., Parveen, F 1991, Parveen F 1994) (McLaughlin, J.L, 1988). 3. Result and Discussion 3.1. Brine-shrimp lethality bioassay 2.5. Insecticidal Bioassay Methodology The fractions obtained were determined for Concentration of trial sample (each fraction) cytotoxicity in the brine-shrimp lethality bioassay by (1571.33 μgcm2) was set. Permethrin (coopexTM) using the protocol of Meyer ( Meyer, et al 1982) of was used as standard drug with 235.71 μg/cm2 conc. these fractions were screened at three concentration The stored grain pests are nurtured in the laboratory levels i.e. 1000,100 10 /ml and LD50= values were under controlled temperature and humidity, so that calculated by using Finny computer program (Finney, the insects of uniform age and size were available for D.J. 1971). Standard drug used was etoposide. All the the experiments. Ten pairs of insects are reared in 9.0 tested fractions did not show any significant diameter and 11.0 cm high plastic bottles containing cytotoxic activity results are given in (Table 1-5) 250 g of breeding media. Then bottles are covered Table-1 Cytotoxicity of Methanol Fraction Dose (µg/mL) No. of Shrimps No. of Survivors LD50(µg/mL) STD. Drug LD50(µg/mL) 1000 30 21 - Etoposide 7.4625 100 30 25 10 30 28 No. of Replicates: 03

Table-2 Cytotoxicity of Ethyl acetate Fraction Dose (µg/mL) No. of Shrimps No. of Survivors LD50(µg/mL) STD. Drug LD50(µg/mL) 1000 30 24 - Etoposide 7.4625 100 30 26 10 30 27 No. of Replicates: 03 Table-3 Cytotoxicity of Choroform Farction Dose µg/mL) No of Shrimps No. of Survivors LD50(µg/mL) STD.Drug LD50(µg/mL) 1000 30 21 - Etoposide 7.4625 100 30 23 10 30 26 No. of Replicates: 03

2955

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table-4 Cytotoxicity of n-Hexane Fraction

Dose (µg/mL) No. of Shrimps No of Survivors LD50(µg/mL) STD.Drug LD50(µg/mL) 1000 30 16 - Etoposide 7.4625 100 30 20 10 30 21 No. of Replicates: 03 Table-5 Cytotoxicity of Water Fraction

Dose (µg/mL) No. of Shrimps No of Survivors LD50(µg/mL) STD.Drug LD50(µg/mL) 1000 30 20 - Etoposide 7.4625 100 30 21 10 30 23 No. of Replicates: 03

3.2. Phytotoxicity bioassay assay was performed at three different concentrations The phytotoxicity of all fractions obtained i.e. 1000,100 and 10 µg/ml.(Table 6-10). It is from the crude methanolic extract was carried out concluded from table 6-10 the results are non against Lemna acquinootialis Welv. And considered significant by using the procedure of McLauughlin et al. this

Table-6 Phytotoxicity of Methanolic fraction Name of Conc. of Comp(µg/mL) No. of Fonds %Growth Conc. of Std. Drug Plant Sample Control Regulation (µg/mL) Lemna Minor 1000 17 16 0 0.015 100 18 -11.5 10 19 -24 Table-7 Phytotoxicity of Ethyl Actate Fraction Name of Plant Conc. Of Compd (µg/mL) No. of Fonds % Growth Conc. Of Std. Sample Control Regulation Drug(µg/mL) Lemna Minor 1000 19 16 -3.5 0.015 100 17 -17.75 10 15 -11.5 Table-8 Phytotoxicity of Chloroform Fraction Name of Plant Conc. Of Compd (µg/mL) No. of Fonds % Growth Conc. Of Std. Sample Control Regulation Drug(µg/mL) Lemna Minor 1000 14 16 5.25 0.015 100 17 0 10 19 -16.75 Table-9 Phytotoxicity of n-Haxane Fraction Name of Plant Conc. Of Compd (µg/mL) No. of Fonds % Growth Conc. Of Std. Sample Control Regulation Drug(µg/mL) Lemna Minor 1000 13 16 5.21 0.015 100 12 -2.13 10 13 -13.65 Table-10 Phytotoxicity of Water Fraction Name of Plant Conc. Of Compd (µg/mL) No. of Fonds % Growth Conc. Of Std. Sample Control Regulation Drug(µg/mL) Lemna Minor 1000 16 16 7.45 0.015 100 17 -12.13 10 18 -15.78

3.3. Insecticidal activity From table 11-15 it showed that all tested fractions are showed no activities. Table 11 Insecticidal activity of Methanol fraction

2956

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Name of Insects % Mortality Sample Tribolium castaneum 100 0 0 Sitophilus oryzae 100 0 0 Rhyzopertha dominica 100 0 0 Callosbruchus analis 100 0 0 Trogoderma granarium - - - Table 12 Insecticidal activity of Ethyl acetate fraction Name of Insects % Mortality Sample Tribolium castaneum 100 0 0 Sitophilus oryzae 100 0 0 Rhyzopertha dominica 100 0 0 Callosbruchus analis 100 0 0 Trogoderma granarium - - - Table 13 Insecticidal activity of Chloroform Faction Name of Insects % Mortality Sample Tribolium castaneum 100 0 0 Sitophilus oryzae 100 0 0 Rhyzopertha dominica 100 0 0 Callosbruchus analis 100 0 0 Trogoderma granarium - - - Table 14 Insecticidal activity of n-Hexane fraction Name of Insects % Mortality Sample Tribolium castaneum 100 0 0 Sitophilus oryzae 100 0 0 Rhyzopertha dominica 100 0 0 Callosbruchus analis 100 0 0 Trogoderma granarium - - - Table 15 Insecticidal activity of Water fraction Name of Insects % Mortality Sample Tribolium castaneum 100 0 0 Sitophilus oryzae 100 0 0 Rhyzopertha dominica 100 0 0 Callosbruchus analis 100 0 0 Trogoderma granarium - - -

Acknowledgements: The authors are thankful to the 5. Kyriakopoulou I, Magiatis P, Skaltsounis AL, Aligiannis N, Deanship of Scientific Research, King Saud Harvala C (2001). Samioside, a new phenylethanoid glycoside with free-radical scavenging and antimicrobial University Riyadh for funding the work through the activities from Phlomis samia. J. Nat. Prod., 64: 1095-1097. research Group project No RGP-VPP- 076. Authors 6. Majeed, I., Proc. Pakistan Congr. Zool. 14, 44, 1994 also wish to thanks HEC Pakistan for promoting the 7. McLaughlin, J.L. (1988) Bioassay For Discovery of activity of science and technology in Pakistan Antitumoral, Antiviral Agents from Natural Sources In: Proceedings of NIH Workshop Bethesda Oct. 18-19, 1988, Corresponding Author: p.22 Dr. Riaz Ullah; Department of Chemistry 8. Meyer, B.N., N.R. Ferrigni, J.E. Putnam & L.B.Jacobson Sarhad University of Science and Information (1982), Brine shrimp: a constituent general bioassay for Technology Peshawar KPK Pakistan active plant constituents, Planta Med. 45: 31- 41 9. Naqvi S. N. H., Parveen, F., Pak. J. Entomol. 6, 35, 1991. References 10. Parveen F., Proc. Pakistan Congr. Zool. 14, 43, 1994 1. Albaladejo RG, Aparicio A, Silvestre S (2004). Variation 11. Sarkhail P, Monsef EHR, Amin G, Surmaghi MHS, Shafiee patterns in the Phlomis × composita (Lamiaceae) hybrid A (2006). Phytochemical study of Phlomis olivieri Benth. complex in the Iberian Peninsula. Bot. J. Linn. Soc. 145: 97- And Phlomis persica Boiss. DARU. 14:115-121. 108. 3/2/2013 2. Calis I, Kırmızıbekmez H (2004). Glycosides from Phlomis lunariifolia. Phytochem. 65: 2619-2625. 3. Finney, D.J. (1971) Probit Analysis, 3rd ed.,Cambridge University Press, Cambridge. 4. Kamel MS, Mohamed KM, Hassanean HA, Ohtani K, Kasai R, Yamasaki K (2000). Iridoid and megastigmane glycosides from Phlomis aurea. Phytochem., 55: 353-357.

2957

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The Association Of Maxillary Accessory Ostia With Chronic Rhinosinusitis What is essential; ventilation or drainage.

Ahmed Hussien MD.

ENT Department Benha Faculty of Medicine, Benha University, Egypt. [email protected]

Abstract: Objectives: The study aimed to assess the role of the maxillary sinus accessory or secondary ostia in the pathophysiology of chronic maxillary sinusitis, and to solve the argument between surgeons as regards the close association between isolated maxillary sinusitis and the presence of accessory maxillary ostia and for a healthy sinus; drainage or ventilation is required. Patients &Methods: The study included 54 patients of both sexes with chronic or recurrent rhinological symptoms. All patients underwent examination by rigid nasal endoscopy (0&30 degree) for inspection of the inside of the nasal cavity and the lateral nasal wall. Computed tomography of the paranasal sinuses in the direct coronal plane without contrast was done for all patients pre-operatively after adequate medical treatment. Then, the patients had been classified into two groups; group A (with radiological finding of isolated maxillary sinusitis) which include 25 patients, group B (without radiological finding of maxillary sinusitis) either radiologically free or with anatomical variation as deviated septum, concha bullosa and/ or hypertrophied turbinates), which include 29 patients. The patients in each group had been classified into two subgroups according to the presence or absence of accessory ostium (AO); -Subgroups I (A-I and B-I with AO) -Subgroups II (A-II and BII without AO).Twenty six patients (25 patients from group A with isolated maxillary sinusitis and one patient from group B with accessory ostium) underwent middle meatal antrostomies (MMA) under general anesthesia with hypotensive technique. The accessory ostium was connected to the natural ostium, the size of the created opening was around 8-10mm. Surgery was tailored according to the individual pathology as evidenced by the CT scan, the preoperative and operative findings. Post-operative evaluation was done for patients through systematic nasal endoscopy and sinuscopy over 2 years. Results: The patient's ages ranged from 13-47 years with a mean age of 26 years. Twenty six patients were males (48.1%) and the other twenty eight were females (51.9%).Twenty six patients underwent MMA (48.1%).A healthy middle meatus (MM) with no evidence of stenosis was noted in all cases operated upon. No adhesion or granulation tissue was present in the MM. There was no crust or discharge in the area. The surgical area had healed completely and lined with normal healthy mucosa. All widened ostia remained patent and healthy. The widened MO was patent in all cases. There was a statistically significant difference between presence and absence of AO in each group in the study, (P<0.05).There was no statistically significant difference between group A and group B as regard the main complaint (P>0.05). There was no statistically significant difference between group (A-I) and group (B-II) as regard the main complaint (P>0.05). The circulating mucous (circular flow) was found in two patients (22.22%) out of 9 patients exhibiting accessory ostium (AO). Conclusion: It could be concluded that there is a close association between isolated maxillary sinusitis and the presence of accessory maxillary ostia as the fontanelle defects could serve as maintainers of a chronic inflammation of the maxillary sinus. Also it appears that the sinus drainage via the natural ostium is more essential and mandatory than sinus aeration, in contrary with the condition in the middle ear cleft where the aeration is the most essential because of the higher incidence of chronic maxillary sinusitis (CMS) in the sinuses being better ventilated via AO. [Ahmed Hussien. The Association Of Maxillary Accessory Ostia With Chronic Rhinosinusitis What is essential; ventilation or drainage. Life Sci J 2013;10(1):2958-2966]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 361

Key words: chronic maxillary sinusitis, accessory ostium.

1. Introduction Marple et al. (17). Chronic rhinosinusitis (CRS) is a Computed tomography (CT) is the gold multifactorial disease. Factors contributing can be standard for investigation of inflammatory sinus mucociliary impairment, bacterial infection, allergy, or disease, Hagtvedt et al. (7). Nasal endoscopy has anatomical variations in the nasal cavity. The multiple uses in both the medical and surgical ostiomeatal complex, a functional unit of the paranasal management of chronic rhinosinusitis. Nasal sinuses plays a key role in the pathogenesis of endoscopy is the standard for tissue sampling, rhinosinusitis, Simmen (23). Chronic rhinosinusitis evaluation of the mucosa and identifying structural (CRS) is characterized by mucosal inflammation alterations, Kuhn (15). affecting both the nasal cavity and paranasal sinuses;

2958 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Maxillary sinusitis is a common condition. (prechamber) connecting the ostium to the nasal cavity, Impaired drainage and reduced ventilation of the Stammberger and Hawke (27). Normal drainage of paranasal sinuses are known to increase the risk of a the sinuses is a complex function of both the more long-standing inflammatory process, Kennedy production of mucous (mucous secretion) and the et al. (12). The ostium must be patent to maintain flow ciliary mechanisms that transport the mucous through from the sinus into the nasal cavity and maxillary and out of the sinuses and into the nasal cavity (the sinusitis is most often due to obstruction of the mucociliary transportation mechanism). Normal maxillary sinus ostium (MO), Messerklinger (18). drainage of the mucous from the sinuses depends to a Functional endoscopic sinus surgery (FESS) is a new large extent on the amount of mucous produced , its and exciting treatment for chronic sinusitis. It has composition, the effectiveness of ciliary beat, mucosal become an increasingly popular treatment for chronic resorption and the condition of ostia, Stammberger inflammatory paranasal sinus diseases. The basic and Hawk (27). Defects in the fontanelle region of the purposes of FESS are to restore the diseased ostio- lateral nasal wall have been described as "accessory" meatal complex (OMC) and to re-establish ventilation or "secondary" ostia, Mladina et al. (19). Recirculation and drainage of the dependent larger sinuses, of nasal mucus occurs when secretions that have been Kennedy et al. (14). The goal of FESS is to restore transported out of the natural maxillary ostium return normal mucociliary flow in the sinus. It was proved to the sinus via a surgically created or accessory that normal mucociliary clearance (MCC) is directed ostium. Recirculation increases the risk of persistent towards the natural ostium and surgery that relieves sinus infection, Gutman and Houser (6). obstruction in this area is supportive of the sinus Recirculation of mucus between adjacent openings returning to normal, with restoration of normal into the maxillary antrum is a relatively common mucociliary function, Stammberger (24). The cause of persistent sinusitis in either the pre- or endoscopic middle meatal maxillary antrostomy postsurgical patient. The condition is easily diagnosed (MMA) is one of the most commonly performed with the nasal endoscope, Kane (10). endoscopic procedures, and had been accepted as a There is a great controversy among minimally invasive technique for the treatment of investigators as regard the possible role of the chronic and recurrent acute maxillary sinusitis maxillary accessory or secondary ostia in the resistant to medical therapy. It restores sinus drainage pathophysiology of chronic rhinosinusitis, and what is and ultimately improves sinus mucociliary function. It essential for the functioning maxillary sinus; sinus promotes sinus ventilation and preserves sinus mucosa, ventilation or sinus drainage. Stammberger (25). Despite this, we commonly see In this study we try to solve for the first time, failed antrostomies requiring revision surgery, to our knowledge the argument between surgeons as Kennedy and Adappa (13). regards the close association between isolated Although anatomic variations of the nasal area are maxillary sinusitis and the presence of accessory rarely encountered, they are important as they may maxillary ostia and for a healthy sinus; drainage or lead to serious clinical consequences or to difficulties ventilation is required. during surgical procedures, Kantarci et al. (11). Since 2. Patients and methods: the beginning of the endoscopic era in the field of Fifty eight adult patients of both sexes with rhinosinusology, one term has been frequently chronic or recurrent rhinological symptoms were emphasized: the “accessory ostium” of the maxillary included in this study. Four patients were lost for the sinus, Joe et al. (8). Maxillary accessory ostium is one evaluation, so they were excluded from this study. of the anatomical variations that may play a role in the This study was done in ENT Department, Benha development of chronic maxillary sinusitis. Although Faculty of Medicine during the period from February some authors claim that accessory ostia develop 2010 to January 2012. The following criteria were following acute maxillary sinusitis, it is not clear applied to the patients for performance this work; whether they are congenital or acquired, Genc et al. (5). Inclusion criteria: A possible mechanism of formation of accessory ostia o Adult patients, with nasal obstruction, nasal is obstruction of the primary ostium by maxillary discharge, headache, diminution or loss of smell sinusitis or due to anatomic and pathologic factors in despite of appropriate medical therapy. the middle meatus resulting in the rupture of Exclusion criteria: membranous areas known as fontanel, Kumar et al. o History of allergy or asthma and systemic disease (16). The health and normal function of the paranasal like cystic fibrosis and T.B. sinuses and their lining mucous membranes depends o Acute maxillary sinusitis, sinusitis of dental origin primarily on two important factors: ventilation and and fungal sinusitis drainage. Normal ventilation of the sinuses requires o Patients with nasal polyposis and previous sinus both a patent sinus ostium and a patent pathway surgery.

2959

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

o Patients with radiological finding of pansinusitis. -Group B: BI which include one patient with The selected patients were submitted to the accessory ostium and BII which include 28 patients following: without accessory ostium. 1-Conventional anterior rhinoscopy. The collected data were recorded after taking consents 2-CT scan of the paranasal sinuses in the direct from the patients and submitted to statistical analysis. coronal plane without contrast were done for all Twenty six patients (all patients from group A patients pre-operatively after adequate medical with isolated chronic maxillary sinusitis, and one treatment. patient from group BI with accessory ostium) The patients were classified into two groups: underwent middle meatal antrostomy (MMA) under -The group A (with radiological finding of isolated general anesthesia with hypotensive technique. The chronic maxillary sinusitis) which include 25 patients, accessory ostium was connected to the natural ostium, 11 males and 14 females, aged 13 - 47 years (an the size of the created opening was around 8-10mm. average 26.92 years). Surgery was tailored according to the individual -The group B (without radiological finding of chronic pathology as evidenced by the CT scan, the maxillary sinusitis either radiologically free or with preoperative and operative findings. Nasal packing anatomical variation as deviated septum, concha were applied and removed after 24 hours. Nasal bullosa and/ or hypertrophied turbinates) which alkaline douches, antibiotics, and decongestants were includes 29 patients, 15 males and 14 females, aged 15 used for 2 weeks. These twenty six patients submitted - 41years (an average 25.93 years). for full post-operative evaluation period. Then, all patients had been submitted to a Post-operative evaluation was done for patients comprehensive nasal endoscopy using rigid zero and initially after 1 week, 1 month, three months and then thirty degree 4mm nasal endoscopes. every six months for two years. According to Anand and Glasgold (2), The Post-operative evaluation included: topical anesthetic and decongestant were used to A- Systematic nasal endoscopy: it was performed anesthetize the nasal cavity before nasal endoscopy. using 0 and 30 degree 4mm endoscope to inspect the About 2 ml of 10% xylocaine is mixed with 2 m1 of 1: surgical area (MT, MM and MO).The middle turbinate 1000 adrenaline and 5 m1 of normal saline. Cotton (MT) was examined for its presence. The middle pledget are dipped in the solution, squeezed dry and meatus (MM) was evaluated as regard presence of used to pack the nasal cavity at different sites; IM, discharge, edema, adhesion, and crusting. The MO MM and on the septum. Packs are left in place for 5 was examined for its patency, shape, size, and flow of minutes. mucus. The area was cleaned of crust, discharge and According to, Schlosser and Kennedy (22), granulation tissue. Any adhesions between the MT and endoscopic examination of the nasal cavity and the the lateral wall were divided. The created ostium was lateral nasal wall was done in three steps:- assessed and cleaned if necessary. Estimation of the A) Inspection of the nasal vestibule, inferior size of the ostium was done by the use of maxillary meatus and nasopharynx, to get a general survey and curette which has dimensions of about 3-5 mm. orientation within the nose. B) Examination of the B-Sinuscopy: it was performed via the canine fossa sphenoethmoidal recess and the superior meatus. C) route. The canine fossa was the preferred route of Examination of the MM and the lateral nasal wall with entry as this provides the best visualization of the MO its structures (UP, BE, hiatus semilunaris and area. Through the cannula, the ostium was evaluated infundibulum, anterior and posterior fontanelles, and from inside using the endoscope 30 degree for its, frontal recess). patency and flow of mucus. Examination of the anterior and posterior 3. Results: fontanel was done carefully to identify presence or Total of (54) patients were examined by nasal absence of fontanel defects, presence or absence of endoscopy under local anesthesia, suffering from circulating mucous and whether the defect is anterior, chronic or recurrent rhinological symptoms during the posterior or both anterior and posterior in relation to period from February 2010 to January 2012. The the UP. patient's ages ranged from 13-47 years with a mean Endoscopic examination was done on both age of 26 years. Twenty six patients were male sides of the nasal cavity, and the patients in each group (48.1%), and the other twenty eight were female were classified into two subgroups according to the (51.9%). presence or absence of accessory ostium (AO). There was no statistically significant -Group A: AI which include 8 patients with difference between group A in comparison with group accessory ostium and AII which include 17 patients B as regard the age of presentation, (P>0.05),Table (1). without accessory ostium.

2960

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table (1): comparison between group A and group B as regard the age. Age

A B Total Range (years) 13- 47 15- 41 13- 47 Mean (years) 26.92 25.93 26.39 + SD 9.1 7.4 t. test 0.4 p. value >0.05

Figure (1); CT scan of paranasal sinuses coronal view with right side complete maxillary sinus opacity associated with accessory ostium (Arrow).

Coronal CT scans of the paranasal sinuses No adhesion or granulation tissue was present in the were done for all patients pre-operatively after MM. There was no crust or discharge in the surgical adequate medical treatment. Isolated opacity of area. The surgical area had healed completely and maxillary sinus (MS) was seen in 25 patients out of lined with normal healthy mucosa. All widened ostia 54 patients (46.2%), and clear MS were seen in 29 remained patent and healthy. The widened MO was patients (53.7) (Fig.1). patent in all cases (26) operated upon (100%) as seen Among these 54 patients, twenty six patients either by zero or thirty degree endoscope. The neo- underwent MMA (48.1%); twenty five patients from ostium was circular in shape in 14 cases out of 26 group (A) and one patient from group (BI). Twenty (53.8%), oval in 12 cases (46.2%). As regard patency five patients underwent unilateral MMA while only of the antrostomy opening , it was considered large if one patient underwent bilateral MMA. it was more than 7 mm in size, wide if it was( 4-6 Follow up was done 9-24 months postoperatively mm) and stenosed if it was less than 3 mm. In our (mean 14.3 months); the twenty six patients were work; the ostia were stenosed but asymptomatic in 4 seen for evaluation. cases (15.4%), wide in 17 cases (65.4%) and widely Patients were classified into 2 groups as regard patent in 5 cases (19.2%). The natural MO was the radiological finding widened 8-10mm in size and this ended by a patent - Group (A): This included 25 patients (46.2%), with functioning ostium (no closure) in all patients radiological finding of isolated chronic maxillary operated upon. The natural MO was widened to 8-10 sinusitis. mm to prevent post-operative stenosis due to scarring - Group (B): This included 29 patients (53.7%), (after complete healing),( Figure 2). without radiological finding of isolated chronic 2- Sinuscopy: Each sinus cavity was examined using maxillary sinusitis. the zero and 30 degree rigid endoscope passing The assessment included: through the inserted cannula. The sinus cavity was 1-Nasal endoscopy: This revealed that the MT was in empty of secretions in all cases and the lining mucosa place (no lateralization) in all cases operated upon was healthy. The MO was patent and healthy in all (twenty six cases) (100%). There was no synechia operated cases. medially or laterally and MT had normal healthy The main complaint of patients (group A) mucosa. Cases with concha bullosa (1 patient); the was "headache" (48%), then "nasal obstruction" (32%) lateral half of the turbinate had healed completely and "nasal discharge" was found in (20%), while in without any adhesion with the lateral nasal wall. A group B, the most common complaint was "nasal healthy MM with no evidence of stenosis was noted. obstruction" (41.38%), then "headache"

2961

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

(34.48%),then "nasal discharge" (17.24%) and the statistically significant difference between group A least common was "hyposmia" which appeared in and group B as regard the main complaint (P>0.05), only two patients of group B (6.9%) . There was no Table (2).

Table (2); Comparison between group A and group B as regard the distribution of the main complain. A B Total

No. % No. % No. % Headache 12 48% 10 34.48% 22 40.74% Nasal obstruction 8 32% 12 41.38% 20 37.04% Nasal discharge 5 20% 5 17.24% 10 18.52% Hyposmia 0 0% 2 6.9% 2 3.7% Total 25 100% 29 100% 54 100% X2 2.7

P-value >0.05

Accessory ostium was found in 9 patients out of chronic maxillary sinusitis (32%).while group (A-II) 54 patients. The accessory ostium (AO) was located refers to the other 17 patients. in the fontanel region during the endoscopic nasal In group (B-I), the AO was found in only one examination (16.67%), while in 47 patients; Group patients out of 29 patients (3.45%).while group (B-II) (A-II,B-II) no AO was found in their fontanel region refers to the other 28 patients, during endoscopic nasal examination (83.33%). There was a statistically significant difference In group (A-I), the AO was found in 8 between presence and absence of AO in each group patients out of 25 patients suffering from isolated in the study, (P<0.05), (Figure 3, Table 3).

Figure (3): Right side endonasal endoscopic Figure (2): Left side endonasal endoscopic evaluation showing; MT: (white arrow), AO: evaluation after MMA seen by zero endoscope: (yellow arrow) & UP: (blue dot). (yellow arrow).

Table (3); Comparison between the studied groups regarding presence of AO. AO Z P-value With (І) Without (ІІ) Total N 8 17 25 A % 32% 68% 100% N 1 28 29 B 5.02 <0.05 % 3.45% 96.55% 100% N 9 45 54 Total % 16.67% 83.33% 100%

2962

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The main complaint of group (A-I) patients (4). In group (A- I, B-I); only one patient from group (with AO), was "headache" (62.50%), then "nasal (A-I) was found to have double AO in both the obstruction" (25.00%), and “nasal discharge" anterior and posterior fontanels (11.11%). The AO (12.50%), while in group A-II ( without AO) we was found to be in the anterior fontanel in another found that the most common complaint was two patients (22.22%) and in the posterior fontanel in "headache" (52.94%), then "nasal obstruction" six patients (66.67%), (Table 5 &Figure 3). (33.30%), then the least common was "nasal The circulating mucous (circular flow) was found discharge" (11.76%).There was no statistically in two patients (22.22%) of those 9 patients significant difference between group (A-I ) and group exhibiting accessory ostium (AO), (Table 6 & Figure ( A-II) as regard the main complaint (P>0.05), Table 4).

Table (4); Comparison between group A-I and group A-II as regard the distribution of the main complain. A-І A-ІI Total A

No. % No. % No. % Headache 5 62.50% 9 52.94% 14 56% Nasal obstruction 2 25% 6 33.30% 8 32% Nasal discharge 1 12.50 2 11.76% 3 12% Total 8 100% 17 100% 25 100% X2 1.3 P-value >0.05

Table (5); The location of the accessory ostium (AO). AO

No. % AF 2 22.22% PF 6 66.67% Both 1 11.11% Total 9 100%

Figure (3): Right side endonasal endoscopic evaluation showing; anterior AO (yellow arrow), posterior AO (white arrow) &UP (blue dot).

Table (6): Relation of the accessory ostium to mucous circulation. AO

No. % NO Circular Flow 7 77.78% Circular Flow 2 22.22% Total 9 100%

2963

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Figure (4): Right side endonasal endoscopic evaluation, showing: A streak of pus (yellow arrow) coming out of a posterior AO of the right maxillary sinus. & (white arrow) points to MT.

4. Discussion: deviated septum, concha bullosa and/ or Maxillary sinusitis is a common condition. hypertrophied turbinates, 15 males and 14 females Impaired drainage and reduced ventilation of the (51.72% - 48.28% respectively) aged 15- 41 years paranasal sinuses are known to increase the risk of a (an average 25.93 years). Our results showed that more long-standing inflammatory process, Kennedy there is no statistically significant difference between et al. (12). Maxillary accessory ostium is one of the the two groups as regard to age and sex (P- anatomical variations that may play a role in the value >0.05). These results go in hand with, Reh et development of chronic maxillary sinusitis, Genc et al., (21), who stated that older patients had scores that al. (5). The basic purposes of functional endoscopic were similar to younger patients with regard to CT sinus surgery (FESS) are to restore the diseased findings and there is no specific age range ostiomeatal complex (OMC) and to re-establish predisposing for chronic sinusitis. ventilation and drainage of the dependent larger In group A we found that the most common sinuses, Kennedy et al., (14). FESS restores sinus complaint was "headache" (48%), then "nasal drainage, ultimately improves sinus mucociliary obstruction" (32%) and then "nasal discharge" function, and promotes sinus ventilation and (20%), while in the group B, we found that the most preserves sinus mucosa, Stammberger (25). common complaint was "nasal obstruction" Since the beginning of the endoscopic era in the field (41.38 %), then "headache" (34.48%), then "nasal of rhinosinusology, one term has been frequently discharge" (17.24%) and the least common was emphasized: the “accessory ostium” of the maxillary "hyposmia" (6.9%).Our results showed that there is sinus, Joe et al (8). These defects have been no statistically significant difference between the two categorized as iatrogenic (surgically created) or groups as regard their complaint (P-value >0.05), and accessory ostia (presumed to be physiological). these results were in accordance with, However, they have been clinically related to chronic Bhattacharyya (4), who stated that the diagnosis of infection of the maxillary sinus by few authors, CRS based on symptom criteria is difficult because Gutman and Houser (6). most symptoms not distinguish between In our study we examined 54 patients radiographically normal and diseased patients. presented at ORL clinics of Benha University In patients of group A, AO was found in Hospital, because of chronic rhinological symptoms; (32%) while in patients of group B, AO was found nasal obstruction, nasal discharge, facial pain and/or only in (3.45%), these results showed a strongly hyposmia. The patients were classified into two positive statistically significant difference between groups according to their radiological finding, group the two groups (P-value <0.05). This is to some A and group B. extent in agreement with, Mladina et al., (19) who Group A; which includes 25 patients with reported that there was a statistically significant radiological findings of isolated maxillary sinusitis, difference between the groups of patients and 11 males and 14 females (44% - 56% respectively) controls, as the posterior fontanelle defect was found aged 13 - 47 years (an average 26.92 years). much more frequently in patients suffering from Group B; which includes 29 patients without any CMS than in the group of healthy subjects (19.3% radiological finding of maxillary sinusitis either and 0.48% respectively). Also, our results go in hand radiologically free or with anatomical variation like; with, Mladina et al., (19), who reported that the

2964

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

fontanelle defect is not a physiological accessory fontanelle may provide only maxillary sinus aeration ostium because if it was just an individual anatomical if the natural ostium is obstructed. variety, we should be able to find it in many subjects In our study the widened MO was patent in with otherwise healthy maxillary sinuses, and said all cases (26) operated upon (100%) as seen either by the defect of the posterior fontanelle indicates chronic zero or thirty degree endoscope. The neo-ostium was maxillary sinusitis (CMS), just like a defect of the circular in shape in 14 cases out of 26 (53.8%), oval eardrum indicates chronic otitis media. in 12 cases (46.2%). The natural MO was widened 8- In support of these data, Jog and McGarry 10mm in size and this ended by a patent functioning (9) in their study investigated the association and the ostium (no closure) in all patients operated upon. prevalence of AO and reported that eight percent These results agreed with Stammberger and (8%) of the patients with rhinitis or sinusitis, had AO Posawetz (26) who mentioned that maintenance of and only two percent (2%) of controls had AO. functioning ostium can be expected where the In our study the overall prevalence of AO diameter is more than 2.5-3mm. was (16.67%). This result agreed with, Anon et al., (3) In conclusion, our study revealed that there who stated that the accessory ostia into the maxillary is a close association between isolated maxillary sinus had been reported in 25% to 50% of his sinusitis and the presence of accessory maxillary patients, the difference may be due to larger number ostia. The accessory ostia are usually single and of patients included in that study. Our results differs frequently found in the posterior fontanelle region. from, Yanagisawa et al., (28) who stated that Fontanelle defects could serve as maintainers of a accessory ostia of the maxillary sinus, located on the chronic inflammation of the maxillary sinus. lateral wall of the middle nasal meatus, were present In our study, it appears that the sinus in 30% of the general population as an anatomical drainage via the natural ostium is more essential and variety. Our results showed a strong relation between mandatory than sinus aeration, because of the higher the presence and absence of AO and isolated incidence of chronic maxillary sinusitis (CMS) in the maxillary sinusitis with positive statistically sinuses being better ventilated via AO, as our results significant difference between patients with AO and showed AO in (32%) of patients with radiological patients without AO, (P-value <0.05). finding of CMS compared with only (3.45%) of In our study, single AO were found in patients without radiological finding of CMS. (88.89%) of patients with AO, while double AO So we can concluded that in the maxillary were found in (11.11%), and this result differs from, sinus, the drainage of the sinus is more essential than Mladina et al., (19) who found double AO in (68.03%) sinus ventilation in contrary with the condition in the of his study. The difference may be due to larger middle ear cleft where the aeration is the most number of patients included in that study, and go in essential. hand with, Kumar et al., (16) who reported double AO in only one patient (12.5%) of eight patients with References: AO among total 30 patients included in their study. 1. Albu S, Tomescu E.: (2004): Small and large In our study 6 patients had AO in the PF middle meatus antrostomies in the treatment of region (66.67%), and only one patient had the defect chronic maxillary sinusitis. Otolaryngol Head on both AF and PF (11.11%) while another two had Neck Surg.; 131(4):542-7 the defect only in the region of AF (22.22%). This 2. Anand V.K. and Glasgold M.J.: (2003): result agreed with, Jog and McGarry (9), who stated Functional endoscopic sinus surgery. In: that the AO was generally found in the posterior Operative otorhinolaryngology. Bleach N., fontanelle and its appearance in the anterior Milford C. and Van-Hasselt A. (Edts.). fontanelle was much less frequent in their experience. Blackwell Science Ltd., (Section 3), (Chap. 27) The circulating mucous was found in two patient Pp.196. (22.22%) of those with AO, these results are in 3. Anon J., Rontal M. and Zinreich S.: (1996): agreement with, Mladina et al., (19) who found the Maxillary sinus anatomy. In: Anatomy of the circulating mucous in (9.17%) of patients with AO. paranasal sinuses. Anon J., Rontal M. and In our study the AO was connected to the natural Zinreich S. (Edts.). New York: Thieme; p. 18-21. ostium to avoid the circular flow which goes in hand 4. Bhattacharyya N.: (2006): Clinical and symptom with, Albu and Tomescu (1) who reported that, criteria for the accurate diagnosis of chronic persistent accessory maxillary ostia were statistically rhinosinusitis. Laryngoscope; 116(7 Pt 2 Suppl significant predictors of poor surgical outcome. 110):1-22. However, our results are contrary with, Prasanna 5. Genc S., Ozcan M., Titiz A. and Unal A.: (2008): and Mamatha (20) who reported that enlarging the Development of maxillary accessory ostium accessory ostium or opening the membranous

2965

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

following sinusitis in rabbits. Rhinology; 46(2): Munich. Quoted from Stammberger, H. (1990): 121-4. Functional endoscopic sinus surgery. The 6. Gutman M, and Houser S.: (2003): Iatrogenic Messerklinger technique. B C Decker. maxillary sinus recirculation and beyond. Ear Philadelphia. Schaefer, S.D. (1998): An Nose Throat J.; 82(1): 61-3. anatomic approach to endoscopic intranasal 7. Hagtvedt T., Aalokken T.M. and Notthellen J.: ethmoidectomy. Laryngoscope 108: 1628-34. (2003): A new low-dose CT examination 19. Mladina R., Vuković K, and Poje G.: (2009): compared with standard-dose CT in the The two holes syndrome. Am J Rhinol Allergy; diagnosis of acute sinusitis. Eur Radiol; 13: 976- 23(6): 602-4. 80. 20. Prasanna LC, Mamatha H. (2010): The location 8. Joe J.K., Ho S.Y., and Yanagisawa E.: (2000): of maxillary sinus ostium and its clinical Documentation of variations in sinonasal application. Indian J Otolaryngol Head Neck anatomy by intraoperative nasal endoscopy. Surg. 2010 Oct; 62(4):335-7. Laryngoscope; 110: 229-235. 21. Reh D., Mace J., Robinson J. and Smith T.: 9. Jog M. and McGarry G.W.: (2003): How (2007): Impact of age on presentation of chronic frequent are accessory sinus ostia? J Laryngol. rhinosinusitis and outcomes of endoscopic sinus Otol.; 117:270-272. surgery. Am J Rhinol; 21(2):207-13. 10. Kane K.J.: (2007): Recirculation of mucus as a 22. Schlosser R.J. and Kennedy D.W.: (2008): Nasal cause of persistent sinusitis. Am J Rhinol.; 11(5): endoscopy. In: Scott-Brown’s 361-9. Otorhinolaryngology, Head and Neck Surgery 7th 11. Kantarci M., Karasen R.M., Alper F., Onbas O., ed.: Gleeson M., Browning G.G., Burton M.J., Okur A. and Karaman A.: (2004): Remarkable Clarke R., Hibbert J., Jones N.S., lund V.J., anatomic variations in paranasal sinus region and Luxon L.M. and Wathinson J.C. (Edts), Edward their clinical importance. Eur. J. Radiol.; 50: Arnold (publishers) Ltd. Vol. (2): 1344- 1354. 296-302. 23. Simmen D.B.: (2008): Medical and surgical 12. Kennedy D.W., Zinreich S.J. and Rosenbaum treatment options in the management of upper A.E.: (1985): Fuctional endoscopic sinus surgery: airway diseases. Ther Umsch.; 65(3): 175-80. theory and diagnostic evaluation. Arch 24. Stammberger H.: (1991): Functional Endoscopic Otolaryngol; 111: 576-82. Sinus Surgery. B C Decker Philadelphia. 13. Kennedy DW, Adappa ND; (2011): Endoscopic 25. Stammberger, H. (1990): Functional endscopic maxillary antrostomy: not just a simple sinus surgery. Concept, indications and results of procedure. Laryngoscope; Oct; 121(10):2142-5. the Messerklinger technique. Eur. Arch 14. Kennedy, D.W.; Zinreich, S.J.; Shaalan, H.; Otorhinolaryngol. 247: 63-76. Kuhn, F.; Naclerio, R. (1987): Endoscopic 26. Stammberger, H. and Posawetz W. (1990): middle meatal antrostomy. Theory, technique Functional endoscopic sinus surgery. Concept, and patency. Laryngoscope 97: [Suppl. 43]: 1-9. indication and results of the Messerklinger 15. Kuhn F.A.: (2004): Role of endoscopy in the technique. Eur. Arch Otorhinolaryngol,247:63- management of chronic rhinosinusitis. Ann Otol 76. Rhinol Laryngol Suppl.; 193: 15-8. 27. Stammberger H. and Hawke M.: (1993): 16. Kumar H., Choudhry R. and Kakar S.: (2001): Essentials of Functional Enoscopic Sinus Accessory Maxillary Ostia: Topography and Surgery. Mosby St. Louis. Clinical Application. J Anat. Soc. India; 50(1): 28. Yanagisawa E., Yanagisava K., Christmas D.A., 3-5. and Yanagisawa R.: (2004): Endoscopic views 17. Marple B.F., Stankiewicz J.A., Baroody F.M., of the ostia and ostia-like structures in the lateral Chow J.M., Conley D.B., Corey J.P., Ferguson nasal wall. Ear Nose Throat J 83:446–448. B.J., Kern R.C., Lusk R.P., Naclerio R.M., Orlandi R.R. and Parker M.J.: (2009): Diagnosis and management of chronic rhinosinusitis in adults. Postgrad Med.; 121(6): 121-39. 18. Messerklinger, W. (1978): Endoscopy of the nose. Urban und Schwarzenberg. Baltimore,

2/22/2013

2966

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Outcomes after partial middle turbinate resection in surgical treatment of extensive sinonasal polyposis.

Ahmed Hussien MD.

ENT Department Benha Faculty of Medicine, Benha University, Egypt. [email protected]

Abstract: Objectives: The study aimed to compare two different techniques of middle turbinate (preservation versus resection) in endoscopic surgical treatment of extensive sinonasal polyposis and analyzing its effect on recurrence rates and postoperative nasal airflow resistance. Study design: A prospective study was performed. Patients & Methods: Forty patients with a mean age of 35.3 years, with sinonasal polyposis stage 3 at endoscopic evaluation and a Kennedy score of (IV) were recruited in this study. The patients had been classified into two groups; group (A) with middle turbinate preservation, which include 20 patients and group (B) with middle turbinate resection, which include also 20 patients. Recurrence rates were evaluated in a 2-year follow-up. For functional evaluation, we applied anterior active rhinomanometry one week preoperatively and 6 months postoperatively to determine nasal airflow resistance (NAR) and to compare the difference between the two groups. Results: Postoperative synechia was reported in 6 cases of group (A), while in group (B) no cases were detected. The difference in the two groups was strongly statistically significant (P<0.05). Regarding to recurrence of polyposis, in group (A), 12 patients showed recurrence, while in group (B), 6 patients showed recurrence. The difference in the two groups was statistically significant (z test 1.9, p <0.005). The patients of both groups showed significant reduction of mean NAR after surgery in both nostrils (p<0.001). Conclusion; A better control of relapse of sinonasal polyposis in patients subjected to resection compared with patients subjected to conservative surgery on middle turbinate. By leaving the superior and posterior parts of the turbinate, the anatomical landmarks are preserved. No significant short or long-term complications have resulted from our partial resection of the middle turbinate. We recommended partial middle turbinate resection in endoscopic surgical management of extensive sinonasal polyposis. [Ahmed Hussien. Outcomes after partial middle turbinate resection in surgical treatment of extensive sinonasal polyposis. Life Sci J 2013;10(1):2967-2972]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 362

Key words: Nasal polyposis, ESS, Middle turbinate.

1. Introduction lateral nasal wall is a common The prevalence of nasal polyposis is complication ,Kinsella et al. (16), and Schaefer et al. estimated to be between 1% and 4% of the general (28) and may lead to restenosis of the region and population, Holmstrom et al. (10). Nasal polyps can recurrent disease, Kennedy (14) and Vleming et al. often recur after medical and/or surgical therapy, and (36). The surgical fate of the middle turbinate has factors influencing this tendency have to be remained a point of contention throughout the investigated further, Marchioni et al. (22). history of sinus surgery. Early teaching was divided, The effect of middle turbinate resection on with Wigand advocating routine middle turbinate normal sinus and nasal physiology remains uncertain. resection, whereas Messerklinger taught routine The nasal turbinates are thought to function preservation, Stewart (32) and Messerklinger (23). collectively to direct and assist in lamination of Many rhinologists agree that a diseased, nasal airflow, humidify and warm inspired air, and destabilized, or obstructing MT should be partially provide a mechanical defense against particulate resected. However, the potential benefit of partial matter. MT resection in the absence of these indications is As compared to the inferior turbinate, the not as clear. Those who advocate partial MT MT is significantly smaller, contain less vascular resection report their observations of decreased and erectile tissue, account for a negligible portion incidence of both synechia formation and of nasal airway resistance, and is believed to have postoperative lateralization of the middle turbinate, less functional significance, LaMear et al. (18). The higher long-term patency rates of the middle meatal anterior part of the middle turbinate, lying just antrostomy, LaMear et al. (18) and Davis et al. (5), medial to the ostiomeatal complex, may exhibit improved nasal airflow, and decreased nasal anatomic deformity and mucosal hyperactivity, resistance ,Cook et al. (4). They also suggest that exacerbating restriction to sinus ventilation. After access to the ethmoid labyrinth is improved both surgery to the OMC, adhesion or synechiae intraoperatively and postoperatively, Stewart (32). formation between the middle turbinate and the The arguments against MT resection relate primarily

2967 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

to the loss of an important anatomic landmark as o Group (A): 22 patients undergoing well as the potential alteration of nasal function, endoscopic sinus surgery for sinonasal polyposis development of atrophic rhinitis, promotion of with preservation of the middle turbinate bilaterally. (33) frontal sinusitis, and hyposmia, Swanson et al. . o Group (B): 24 patients undergoing The aim of our study was to compare two endoscopic sinus surgery for sinonasal polyposis groups of patients affected by extensive nasal with middle turbinate resection bilaterally. polyposis undergoing endoscopic sinus surgery (ESS) The technique of middle turbinate resection was and with different approaches adopted regarding the similar at each site, utilizing through-cutting middle turbinate (preservation or resection). instruments to remove the anteroinferior two thirds Recurrence rates and nasal air flow resistance (NAR) of the turbinate preserving the superior and lateral in the groups were evaluated in a 2-year follow-up attachments as a land mark and a small stump study. posteriorly in the region of the sphenopalatine foramen (Figs. I and 2). The decision to resect or 2. Patients and methods: preserve the middle turbinate was taken during Forty-six (46) consecutive patients who had surgery as a limitation of this study. No other sinonasal polyposis (with bilateral disease) and were method of preoperative assignment to resection or scheduled to have endoscopic sinus surgery (ESS) preservation was utilized. for extensive sinonasal polyposis were enrolled from Postoperatively, nasal saline irrigation for 2 otolaryngology clinic at Benha faculty of medicine months was prescribed to all patients. Topical during the period from October 2008 to October corticosteroid therapy was administrated to every 2011.The ages of the patients ranged from15 to 60 patient in both groups, with a constant dose of 400 years, with a mean of 35.3 years. There were 26 UG in 2 separate doses (50 UG X 2 in each nostril male and 20 female patients in this study. twice daily) for 4 months. Sinonasal polyposis was studied on the Post operative nasal endoscopy for follow-up basis of nasal endoscopic office examination and every 1 month for the 1st 6 months and every 3 classified into three stages where (0) no polyps, (1) months for the following 2 years. The presence of mild polyposis (small polyps not reaching the upper polyps in the nasal fossa (even micro polyps) at edge of the inferior turbinate), (2) moderate endoscopic evaluation was considered to indicate polyposis (medium sized polyps reaching between polyposis recurrence. A comparison between both the upper and lower edge of the inferior turbinate) groups was carried out, and the rate of recurrence in and (3) severe polyposis (large polyps reaching relation to the surgical technique was evaluated. The below the lower edge of the inferior turbinate). In time of recurrence for both groups was reported and addition, the patients were classified into four stages noted if it occurred within 6 months, 1, or 2 years on basis of computed tomography (CT) of paranasal from surgery. sinuses by means of the Kennedy CT stage system, For functional evaluation, we applied Kennedy(13) : stage (I), opacity of a single sinus or anterior active rhinomanometry (The Mercury bilateral opacity limited to the middle meatus; stage Electronic Ltd rhinomanometer nr 7d ,Scotland) for (II), opacity of both middle meati and one adjacent every patient in this study one week preoperatively sinus; stage (III), bilateral ethmoidal opacity with and 6 months postoperatively to determine nasal involvement of one or two adjacent sinuses; stage airflow resistance (NAR) and to compare the (IV), diffuse opacity in all of the paranasal sinuses. difference between the two groups. Data for each -Inclusion criteria: nostril were registered at 150 Pa and expressed in All patients are stage (3) sinonasal polyposis at Pa/cm3/s. endoscopic evaluation and with a Kennedy score of Statistical analysis: stage (IV) and not responsive to medical treatment The statistical analysis was done by SPSS 16: the was recruited. data were presented in Mean & SD and the -Exclusion criteria: comparison was done by: Patients suffering from antrochoanal polyp, mycotic 1. Paired t test (in comparison of pre and sinusitis or inverted papilloma and revision cases postoperative finding in the same group) were excluded. 2. Independent t test (in comparison of post - Computed tomography study (coronal and axial operative finding in the 2 different groups) views without contrast) for the nose and paranasal P<0.05= significant (S) P>0.5= non significant sinuses were performed for all patients in this study (NS) preoperatively. - According to the surgical techniques the patients were classified into two groups:

2968

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

cases after 15 months (z test 0.8, p >0.005), and 4 cases after 18 months (z test 0.9, p >0.005). While in group (B), 6 patients showed recurrence (1 case after 12 months (z test 1.01 , p >0.005), , 3 cases after 15 months (z test 0.8 , p >0.005) and 2 cases after 18 months (z test 0.9 , p >0.005) .The difference in the two groups was statistically significant at 9 months and not statistically significant at 12 & 15 & 18 months. The difference in the total recurrence was Figure 1 Figure 2 statistically significant, the patients in group (A) had (Diagram showing middle turbinate before and a risk of recurrence two times higher than the patients after resection) in group (B) (z test 1.9 , p <0.005) ,Table (1). Regarding to functional rhinomanometric 3.Results data, the patients who had undergone ESS with Six of 46 patients (2 of group A and 4 of resection of middle turbinate, group (B) showed a group B) were lost during the follow up period, so the preoperative mean NAR of (2.09 ± 0.21 Pa/cm3/s) for final study groups comprised 40 patients. The right nostril and (1.66 ± 0.12 Pa/cm3/s) for left nostril, average age at the time of operation for group A (20 while 6 months postoperatively NAR was (0.52 ± patients) was 32.2 years (range 15-60 years), of 0.05 Pa/cm3/s) for right nostril and (0.5 ± 0.12 Pa/ which 12 patients {60%} were males and 8 patients cm3/s) for left nostril respectively. Significant {40%} were females While in group B (20 patients) reduction of mean NAR after surgery was confirmed the average age was 39.1 years (range 24-58 years) of for both nostrils (group B) by statistical analysis which 6 were males{30%} and 14{70%} were (preoperative NAR vs. 6 months postoperative NAR, females (t test, p <0.001).The patients who had undergone Postoperative bleeding after pack removal ESS with middle turbinate preservation group (A), occurred in one patient (5%) in group (B), and in two showed a preoperative mean NAR of (1.96 ± 0.13 Pa/ patients (10%) in group (A). Bleeding in all cases cm3/s) for right nostril and (2.07± 0.32 Pa/cm3/s) for was stopped by conservative treatment. left nostril, while 6 months postoperatively NAR was Postoperative synechia was reported in 6 cases (30%) (0.55 ± 0.05 Pa/cm3/s) for right nostril and( 0.65 ± of group (A), while in group (B) no cases were 0.04 Pa/cm3/s) for left nostril respectively. Significant detected. The difference in the two groups was reduction of mean NAR after surgery was confirmed strongly statistically significant (P<0.05). for both nostrils (group A) by statistical analysis Postoperative crustation was marked in (preoperative NAR vs. 6 months postoperative NAR, Group (B) than Group (A) but after 3 months no (t test p <0.001). Mean preoperative NARs were not crustation was detected. significantly different between both groups (t test Regarding to recurrence of polyposis during p>0.5). On the other hand, the mean postoperative the 2-years follow up, 18 patient (45%) of the 40 NARs were not statistically different comparing these patients had a recurrence of nasal polyposis, In group two surgical techniques (t test p>0.5). Tables (2,3,4). (A), 12 patient showed recurrence (3 cases had a recurrence after 9 months (z test 1.8, p <0.005), 5

Table (1): Postoperative recurrence of sinonasal polyposis Polyp recurrence Group (A) Group (B) z P Time 9 Months 3 cases (15%) ------1.8 < 0.005 (S) 12 Months ------1 case (5%) 1.01 > 0.005 (NS) 15 Months 5 cases (25%) 3 cases (15%) 0.8 > 0.005 (NS) 18 Months 4 cases (20%) 2 cases (10%) 0.9 > 0.005 (NS) TOTAL 12 cases (60%) 6 cases (30%) 1.9 < 0.005 (S)

2969

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table (2 ): comparison between preoperative and postoperative NAR in patients with middle turbinate resection (group B). Preoperative Postoperative t P RT. side NAR (pa/Cm3/S) 2.09 0.52 <0.001 30.2 Mean±SD ± 0.21 ± 0.05 (S) LT.side NAR (pa/Cm3/S) 1.66 0.5 <0.001 21.8 Mean±SD ±0.12 ± 0.12 (S)

Table (3): comparison between preoperative and postoperative NAR in patient without turbinate resection (group A). Items Preoperative Postoperative t p RT. side NAR. (pa/Cm3/S) 1.96 0.55 78.9 <0.001 Mean±SD ± 0.13 ± 0.05 LT.side NAR. (pa/Cm3/S) 2.07 0.65 21.6 <0.001 Mean±SD ±0.32 ± 0.04

Table (4) : comparison between postoperative NAR in patients with and without middle turbinate resection. with resection without resection t P RT.t side NAR (pa/Cm3/S) 0.52 0.55 1.8 > 0.05 Mean±SD ± 0.05 ± 0.05 LT. side NAR… 0.5 0.65 1.9 > 0.05 (pa/Cm3/S) Mean±SD ± 0.12 ± 0.04

4. Discussion: neuropeptides,Havas and Lowinger (9).Moreover, it Surgery represents the gold standard in is often destabilized, altered by the pathology, treatment of nasal polyposis when medical therapy Friedman(6) or some abnormalities can be present fails to control the pathology, Alobid et al. (1). There (paradoxical curvature or concha are different opinions among rhinologists regarding bullosa) ,Morgenstien and Kreieger (24). Partial the potential benefits of whether the middle turbinate, middle turbinate resection leaving the superior part of the crucial structure lying medially to the OMC, the turbinate with its attachment ( axilla),the should be resected or should be preserved as much as landmark might improve the long-term Patency of possible in the treatment of sinonasal polyposis. middle meatus antrostomy and might facilitate the Some surgeons favor middle turbinate preservation, endoscopic visualization of the intranasal anatomy, believing that the middle turbinate can play a part in sphenoethmoidal region intraoperatively and directing airflow, humidifying inspired air, providing diagnosis of postoperative occurrence of polyposis defense against offending particulate matter, and relapse, Morgenstein and Krieger (24) ,and Zhang possibly providing a local hematological response (39). with secretion of IgA, Thornton (34). A decreased risk In view of the different opinions about of complications (such as lamina papyracea lesion, preservation or resection of the middle turbinate bleeding, CSF rhinorrhea, orbital hematoma, during ESS, the aim of our study was to compare two nasolacrimal duct stenosis, anosmia/hyposmia, different techniques of middle turbinate (resection frontal or sphenoidal sinusitis, drying, crusting and versus preservation) in endoscopic surgical treatment atrophic rhinitis, Vleming et al. (36), and the loss of an of extensive sinonasal polyposis and analyzing its important landmark also favors its preservation, effect on recurrence rates and postoperative nasal Thornton(34) . airflow resistance. On the other hand, some others authors prefer In our study, we have analysed for the first time, middle turbinate resection, believing that the to our knowledge this controversial subject with aerodynamic and protective role of the middle objective parameters, excluding subjective turbinate in the diseased state is not clearly parameters as most of the previous studies reported understood, Friedman (6). The middle turbinate could measurements based on subjective improvement of play a role in the pathogenesis of inflammatory the symptoms, not supported by endoscopic findings sinonasal disease secreting vasoactive sensory and functional measurements, Giger et al. (7), Kaplan,

2970

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

and Kountakis(12) , Stankiewicz and Chow (31), Paulsson et al. (25).Also, resection of the middle Lanza and Kennedy (21). turbinate in cases of polypectomy prolongs the time Our result showed postoperative bleeding after to symptomatic recurrence by decreasing mucosal pack removal in one patient (5%) in group (B), and in surface area on which polyps may grow and later two patients (10%) in group (A).Bleeding in all cases obstruct the sinonasal cavities, Zachary et al. (38). was stopped by conservative treatment. our results go The analysis of data concerning postoperative in hand with, Brescia et al. (3) who did not encounter NAR after 6 months demonstrates a statistically any such problem. significant improvement of mean NAR in patients of Our result showed Postoperative synechiae in 6 both groups. We found no significant statistical cases (30%) of group (A), while in group (B) no differences between the two techniques and this may cases were detected. The difference in the two groups be due to the sample size and only few patients with was strongly statistically significant (P<0.05). Our recurrence. This result goes in hand with that results concur with, Havas and Lowinger (9) who reported by ,Brescia et al. (3) , who found that partial found 0% synechiae in resection cases compared to middle turbinectomy does not have short- or mid- 8.5% in turbinate preservation, and with, Vleming et term negative effects on nasal airflow and resistances, al. (36) who found no synechiae after middle turbinate and also matches the results obtained by, Giger et al. resection. This may be due to the fact that middle (8) and Cook et al. (4). turbinate resection prevents lateralization of turbinate over antrostomy site and thus decreases the synechiae. Conclusion Our results showed marked crustation in Group A better control of relapse of sinonasal (B) than Group (A) but after 3 months polyposis in patients subjected to resection compared postoperatively no crustation was detected and it was with patients subjected to conservative surgery on not significant. These results is coincide middle turbinate, who relapsed more frequently. with ,Morgenstein and,Krieger (24), and Cook et al. Enhanced access for office endoscopic (4) who failed to show significant deleterious effects examination and cleaning of surgical site was also related to turbinate resection such as crustation or achieved. By leaving the superior and posterior parts atrophic rhinitis. Also, Lawson (20) in his study of the turbinate, the anatomical landmarks are reported no cases of crustation or atrophic rhinitis. preserved. No significant short or long-term Our result showed recurrence of sinonasal complications have resulted from our partial resection polypi in 12 cases (60%) of group (A) and 6 cases of the middle turbinate. (30%) of group (B). So, the resection of middle We conclude that partial middle turbinate turbinate is associated with a lower rate of recurrence, resection appears to be promising and to be this result coincide with, Marchioni et al. (22) who considered in patients with extensive sinonasal reported a better control of nasal relapse in patients polyposis. who underwent middle turbinate resection compared with those who underwent middle turbinate References preservation who tended to relapse more frequently, 1) Alobid I, Benitez P, Bernal-Sprekelsen M, Roca and with ,Havas and Lowinger(9) who found a very J, Alonso J, Picado C, et al. Nasal polyposis and low rate of polyp recurrence in patients with turbinate its impact on quality of life: comparison resection when compared with turbinate preservation between the effects of medical and surgical patients . Also our results go in hand with, Zachary treatments. Allergy 2005;60:/452_8. et al. (38) who reported that patients undergoing 2) Brescia G,Pavin A,Giacomelli A,Boninsegna middle turbinate resection did show greater M,Florio A,Marioni G. Partial middle improvement in endoscopy score which persisted turbinectomy during endoscopic sinus surgery after controlling confounding factors. Also our results for extensive sinonasal polyposis:Short-and go in hand with, Kidder et al. (15) who concluded that mid-term outcomes. Acta Otolaryngol 2008; removal of the middle turbinate yielded a lower rate 128:73-77. of polyp recurrence without any increase in 3) Cook PR, Begegni A, Bryant WC, et al. Effect postoperative morbidity. To explain this, it has been of partial middle turbinectomy on nasal airflow reported that resection of the middle turbinate and resistance. Otolaryngol Head Neck Surg reduces vasoactive neuropeptide secretion, Havas 1995; 113:413-419. and Lowinger (9). The persistence of middle 4) Davis WE, Templer JW, LaMear WR, et al. turbinate could give an altered airflow into the Middle meatus antrostomy: patency rates and surgical cavity, causing an augmented risk of risk factors. Otolaryngol Head Neck Surg 1991; postoperative nasal synechiae formation and 104:467-471. contributing to the higher rates of recurrence,

2971

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

5) Friedman WH. Surgery for chronic hyperplastic middle turbinate resection in endoscopic rhinosinusitis. Laryngoscope 1975; surgical treatment of nasal polyposis. Acta 85:1999_2009. Otolaryngol 2008;128:1019–1026. 6) Giger R, Dulguerov P, Quinodoz D, Leuba D, 19) Messerklinger W. Endoskipische diagnose and Landis BN, Lacroix JS, et al. Chronic chirurgie der rezidivierender Sinusitis. In: panrhinosinusitis without nasal polyps: long- Krajira Z, ed. Advances in Nose and Sinus term outcome after functional endoscopic sinus Surgery. Zagreb, Croatia: Zagreb University; surgery. Otolaryngol Head Neck Surg 1985. 2004;/131:/534_41. 20) Morgenstein KM, Kreieger MK. Experience in 7) Giger R, Landi BN, Zheng C, Malis DD, middle turbinectomy. Laryngoscope Ricchetti A, Kurt AM, et al. Objective and 1980;/90:/1596_601. subjective evaluation of endoscopic nasal 21) Paulsson B, Dolata J, Larsson I, Ohlin P, surgery outcomes. Am J Rhinol Lindberg S. Paranasal sinus ventilation in 2003;/17:/327_33. healthy subjects and in patients with sinus 8) Havas TE, Lowinger DSG. Comparison of disease evaluated with the 133-xenon washout functional endonasal sinus surgery with and technique. Ann Otol Rhinol Laryngol without partial middle turbinate resection. Ann 2001;/110:/667_74. Otol Rhinol Laryngol 2000;/109:/ 634_9. 22) Schaefer SD,Manning S,Close LG.Endoscopic 9) Holmstrom M,Holmberg K,Lundblad paranasal sinus surgery:indication and L,Norlander T,Stierna P.Current perspectives on consideration.Laryngoscope 1989;99:1-5. the treatment of nasal polyposis: a Swedish 23) Stankiewicz JA, Chow JM. Nasal endoscopy opinion report. Acta Otolaryngol (stockh) 2002; and the definition and diagnosis of chronic 122:736-44. rhinosinusitis. OtolaryngolHead Neck Surg 10) Kaplan BA, Kountakis SE. Role of nasal 2002;/126:/623_7. endoscopy in patients undergoing endoscopic 24) Stewart MG. Middle turbinate resection. Arch sinus surgery. Am J Rhinol 2004;/18:/161_4. Otolaryngol Head Neck Surg1998; 124:104-106. 11) Kennedy DW. Prognostic factors, outcomes and 25) Swanson PB, Lanza LC, Vining EM, et al. The staging in ethmoid sinus surgery. Laryngoscope effect of middle turbinate resection upon the 1992; 102:/1_18. frontal sinus. Am J Rhinol 1995 ;9: 191- 195. 12) Kennedy DW, Zinreich SJ, Rosembaum AE, 26) Thornton RS. Middle turbinate stabilization Johns ME. Functional endoscopic sinus surgery. technique in endoscopic sinus surgery. Arch Arch Otolaryngol 1985;/111:/576_82. Otolaryngol Head Neck Surg 13) Kidder TM, Toothill RJ, Unger JD. Ethmoid 1996;/122:/869_72. sinus surgery. Laryngoscope 1974; 84:1525-34. 27) Vleming M, Middelweerd RJ, De Vries N. 14) Kinsella JB,Calhoun KH,Bradfield JJ,Hokanson Complications of endoscopic sinus surgery. JA,Baietey BJ.Complication of endoscopic Otolaryngol Head Neck Surg sinus surgery in a residency training 1992;/118:/617_22. program.Laryngoscope 1995;105:1029-32. 28) Wynn R, Har-EI G. Recurrence rates after 15) LaMear WR, Davis WE, Templer JW, et al. endoscopic sinus surgery for massive sinus Partial endoscopic middle turbinectomy polyposis. Laryngoscope 2004; 114:811-813. augmenting functional endoscopic sinus surgery. 29) Zachary M. Soler,Peter H. Hwang,Jess Otolaryngol Head Neck Surg 1992;107:382-389. Mace,Timothy L. Smith. Outcomes After 16) Lawson W. The intranasal ethmoidectomy: Middle Turbinate Resection:Revisiting a evolution and an assessment of the procedure. Controversial Topic. Laryngoscope 2010; Laryngoscope 1994; 104(part2):l-49. 120:832–837. 17) Lanza DC, Kennedy DW. Adult rhinosinusitis 30) Zhang J. Management of middle turbinates in defined. Otolaryngol Head Neck Surg endoscopic sinus surgery. Zhonghua Er Bi Yan 1997;/117:/51_7. Hou Ke Za Zhi 1999;/34:/98-9. 18) Marchioni D, Alicandri-Ciufelli M, Mattioli F, et al. Middle turbinate preservation versus

2/22/2013

2972

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Dominant theory of international relations, discuss the role of language, from the perspective of postmodernism. (With emphasis on the common language of Iran, Tajikistan)

Mahmoud Shahbandi, Azadeh Mashaei

Researchers at the Center for International Studies. Tehran University. Tehran, Iran [email protected]

Abstract: Certainly the language of today's communications and relationships and dialogue is the main role of human societies. In Tajikistan, the Russian force in publishing, rather than the native language, at the time of the Tsar, and the 70 years of Soviet domination, and from the Tajik Persian culture and identities of his years, from his homeland of Iran, was isolated.With the collapse of the Soviet Union and Tajikistan's efforts to preserve their language, culture, freedom and light valves, the development of language and identity and pride in their language, the Tajik opened. If the dominant thinking in Russian and Soviet pressure, the longer the duration, the future of the Persian language, identity and culture, Persian, Tajik, will lead to destruction. Two Persian-speaking nations, Iran and Tajikistan, with a common language, culture and identity are similar, and the common cultural roots several thousand years, the artificial boundaries of the nation - from the cultural geography of the country, is separated. But the positive potential of resistance, such as language and culture and have a common identity, Together to feel the historical Moreover, the interaction work together. Such a concept, so it is important that all countries with various tricks intended to penetrate through the publication of their language, and the two nations are less able to identify the two countries., Or take back the Persian culture. [Mahmoud Shahbandi, Azadeh Mashaei. Taxonomic Diversity of Understorey Vegetation in Kumaun Himalayan Forests. Life Sci J 2013;10(1):2973-2977] (ISSN:1097-8135). http://www.lifesciencesite.com. 363

Keywords: Iran, Tajikistan, language, identity, culture, history, theory, and postmodernism. Discussion

Introduction: And the chance to meet people. Manifestations of With the collapse of the Soviet Union, and the Persian culture and literary trends boosting shaky state of culture of Russian military, the new celebration of Persian culture, such as reinforced face of Central Asia and Iran. The problem of Library, Ferdowsi build cultural symbols such as thought, belief or identity crisis in the region was statues and sculpture Amir Tajik somoni and other formed. (Jamali, p 2) All Central Asian long Iranian symbols, show interest, bias and strong cultural roots territory was large, with longstanding history and Iranian and Persian in Tajikistan. civilization and culture are rooted in the Persian Tajiks are Iranian descent., And feel the ancestors. Were seeking roots and cultural same race with the Iranians, among them are deeply background of his mind. rooted. In other words, one of the main pillars of the Although in terms of historical and cultural identity of Tajik, the Persian language has integration of all the countries of the region closer to historically. And the relationship between the two the newly independent republics. Witnessed between countries is unbreakable. Keep in the shade of a them, Tajikistan is the only fundamental to the common language, customs and traditions of Persia. culture and the unique circumstances of Iran is Tajik s live in a place that makes waves. Because Persian. Language on Iran. To seven hundred years maintaining a common language, customs and before Christ, the historical evidence is available. traditions, the Iranians, Tajiks living in depth, can be Historically, we know that the vast land of ancient felt. Like traditional Mehregan , Sadeh, and noroz Persia), the land of Khorasan (eastern) border of and showed deep interest and dedication deep Tibet and Chinese Turkestan and southeast of the cultural ties with Iran are Tajik s. country, Punjab sabulous, And noon (south) to Regardless of economic power, technology, document the Persian Gulf and Sea of Oman and the communication, and the potential energy superpower north of the country and the Scythians and their in the world (fa.wikipedia.org) The role of language organization (Southern Russia Today) from the as a key component of the relationship for both Danube to the west, and Greece and Syria, Hijaz and countries is undeniable. We review several theories Yemen joined Plains. The origins of language and of international relations before the First World War the language is today. Talks said. Thus cultural and and after, Follow the most recent guidelines of civilizational affinities between Iran and Tajikistan International Relations countries after World War II, have caused relations between the two countries is and the newest theories in terms of time, we will. beyond the political and economic considerations, Recent theories of International Relations (post

http://www.lifesciencesite.com 2973 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

modernism) on the role of language in fostering strengthen communication, the process can be international relations verify. established and fix this. Finally, according to the Cultural History of Theories and approaches: Iran and Tajikistan approaches available resources Realist and idealist approach: and cultural commonalities between the two Pragmatic or realist approach, attitude and countries and Discuss the role of national identity and approach of the study of foreign policy interest of its common elements, we will study. many scientists and analysts, is located. Morgenthau's With the collapse of the Soviet Union and (1) political realism is the most important intellectual the independence of the stability of Tajikistan, Iran, foundations, (Seif Zadeh, 1374, p 34) Realism in fraternal organizations step forward. Confirmed the politics, in matters of foreign policy and international presence of the peace process in Tajikistan as a vital relations based on the facts and issues are ingredient of the language played an important role. emphasized objective. The idealist approach, in Realism in politics, in matters of foreign terms of values, and apart from the fact that the issues policy and international relations, based on existing studied. facts and issues are emphasized objective. The A – statism : the realists that state sovereignty idealist approach, in terms of values, and separate is an important actor in the international arena. from the reality of things, review and looks. Actors, such as multinational corporations and In general, both political and economic international and regional organizations, although a terms, despite the attempt of both nations shared role, however, have witnessed the rise and decline. culture and discourse as cultural leaders, Rudaki, (Sariolghalam, 1379, p 13). Ferdowsi's ruling dynasty, the Samanids Iranian B - Survival of security: the realists, the main values and traditions that are admired by the people purpose of government is to protect its survival, of Tajikistan. , Bright future for further relations which have raised the issue in terms of security. between the two countries, the association offers. Iran "Survival , is the goal of all governments, and to in the areas of identity and nation building Tajiks achieve other goals, to be achieved." (Syfzadeh, 1376, who are exposed to storm the Russian culture and p 96.) Turkish pressure, cultural fit and family to act as a C - Self-help: in the country, the law and regulations base. On the other hand, nationalist Uzbek, Tajik is applicable to and respect. the limit. In terms of political geography, Uzbekistan, In the international arena, states, due to the the Tajik national revival and the power issue, not absence of a higher authority, in order, to prevent the happy. Because Iranian Persian culture, able to stand use of force, are forced, which maintain their own against the influx of other cultures, particularly in security and their suppliers. Thus, except for the the Turkish language. Therefore, the influx of Turkic purpose of providing information, and is not possible culture and strengthen the independent Tajikistan in to maintain strength and thus increase their own Central Asia and the Persian country, Iran with Farsi power, or in other words, self-help, the most language is only strong country in the region, the important principle is to the security of a state. (Haji- country's best friend, would Tajikistan. Now, after Yousefi, 1381, p 1009). the collapse of the Soviet Union, the opportunity, Objectives and national interests there has to close, and needs, this opportunity, on Definition of foreign policy: behalf of current and future relations between the two "Foreign policy is a strategy (strategy) or pre- countries to develop sustainable and properly used, designed policies, the decision by one country against and Tajik government from any enemy propaganda countries or international entity, to be used for the that the two countries are to avoid, and its purpose of achieving specific goals which is defined management. In the current situation, and the new in terms of national interests. »(Jack. c. Plano, p6). rules of international behavior, is taking shape in the 1 - national interests and foreign policy: least practical changes that occur in international Interests of the nation, one of the key politics, it can affect the relationship between the knowledge, political science terms, which include the countries. Role of Persian language and dialogue, the most critical needs of the state, and the influence of two countries could turn back the time lost in the two such factors on the behavior of states is considered. countries. 2-Foreign policy goals: In a world where the latest guidelines and Basically, each state has its own foreign policy theories of international relations, was based on in the direction that, ultimately, wants and needs the language and discourse, and both nations have security, strategic, economic, political, cultural or potentials are high., And the relationship to try to military, in the short term or long term, is provided. further strengthen. And in the presence of coalitions (ghavam, 1375, p 108). and regional organizations such as the Shanghai and

http://www.lifesciencesite.com 2974 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Governments to achieve its methods and goals, the decision-making strategies to plan, and the selecting and tracking, which are as follows: implementation of their decisions effectively as 1 - power politics 2- the politics of power maple, adopt, and their role, effective as those in the increase 3 - Power Politics Show (Ameri, 1374, pp. international environment, can not be ignored. 282-283) Attitude of postmodernism:"Post" means in Formulation of objectives. (Main axes): Farsi: post is. And postmodernism, the concept of In order to achieve the goals of foreign policy, post-modernists, post-modernity and post-modernity the country needs are factors, which can form abroad is. raised their efficiency and help them achieve their So-called post-modern, post-modernism and goals, internal and external, which is short, we deal post-modernity, with no significant difference. with it. School, post-modernism, modernism and A. - The internal consistency between the modernity are in school, and the principles and objectives elements of it, to critique and challenge the state The support of foreign policy goals, it is crucial skepticism and denial puts. Like many other that the "national spirit" is called (Firoozabady, 1381, expressions and interpretations of postmodernism, p 11.) with instability and insecurity in the sense of a B - related goals, and the ability of national systematic theory, the philosophy is not Balance between national goals and national comprehensive; But a complex and interconnected interests is vital powers. If the goal of a political and diverse body of thought, perception, detection, system is beyond its national power, leading to the recognition, interpretation, interpretations, destruction of its resources, will be. (Firoozabadi, interpretations, different views of popular culture and 1381, p 11) draw a picture of the multiplicity of interrelated C - applying appropriate tools phenomena. In fact, the other side of the coin, Naturally, inappropriate tools with national pluralism and pluralism postmodernism goals, regardless of the scope and power of postmodernist thinking is based. discourse, and problem makes it impossible to Post-modern, all his physical and mental achieve national goals. capabilities to serve the feminist movement, gay, side D - strategies tailored to national interests with the environmental movement, the Greens, and Naturally, foreign policy will be successful if, the side with the movements for peace and nuclear direction and strategy fit with national resources and disarmament, were used. His movements were adopt domestic and international conditions. generally in line with separatist movements and cult, (Firoozabadi, same, p 13). were led. Movements are generally in line with their Factors that influence the direction of foreign own separatist and sectarian movements were led. policy making Postmodern French attitude to the world as the key to 1 - External factors: Such as, the structure and freedom and prosperity, and spectacular discoveries processes of the international system, and the balance in the New World, pluralistic, and "some god" offer! of power bipolar or multipolar or unipolar process Postmodernity represents a fall or rapid of decision making and strategy, Overall, the success changes and developments in modern forms of or failure of a country's influence in international political, social, economic and cultural, from the mid- relations. nineteenth century until the mid-twentieth century, 2 - Internal factors:Some of the important most industrialized countries in the West, the factors affecting internal: 1 - Values, 2 - Capable and dominant way, it is. domestic needs 3 - and public interest lobby 4 – Principles and elements of postmodernism Geographical 5 - The role of decision. Postmodernism, principles, and no special Naturally, these factors may either separately or framework. This school is a school of escaping together, the process of orientation and transition conflict and context. However, some negative and policy to be effective. positive elements and components of the theory are Geopolitical and geographical position of the pointed out. country 1. Pluralism and reject any unification Effect of geographical factors such as the formalisms: Diversity, plurality, fragmentation and geographic region of a country or natural products, dispersion of the basic principles of the school. state or national politics, the inventions and Postmodernists any Centralism, nationalism power discoveries of how the geographical factors, can be and authority are contrary to belief, ie, the one central changed. (Ali Babaei, 1383, p 191). truth, the life, deny, and pluralism, and pluralism, In other words, individuals can, in defining agreed. national interests, directly affect the effectiveness of

http://www.lifesciencesite.com 2975 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

2. Relativism: Adherents of this school, and do On the other hand, apart from looking realistic, not in any absolute truth and fixed everything, idealism, new look for the name of the Marxists, with considered a partial truth. these thoughts arise. They believed that the 3. Nihilism: Traditional community effort, international system that is causing the conflict. mainly based on the theory of "divine providence" We saw that realists believed, the main actor is was located, and the theory of the universe, with the the person that decides. supervision and guidance of God moving, and Dreamers, only the government, together with progress toward a specific goal. international and regional organizations, believed. But in modern schools, instead of divine But Marxists, only the international system, providence, the earthly successor, the thinking went believed that an unjust system of colonialism and material, sat, and intellectual and academic programs, imperialism has created, and Understand the rather than the rovidence of God and the teachings of principles of economics, not politics, and the force of revelation, were located. But postmodernism, rather law, Across all economic theories to consider. (In the than a belief in a divine power, nihilism and 70s) and say the class system is a system of absurdity of thinking institutions. Thus, no purpose, oppression and imperialism. no goal, contributing to the chaos, division, vulgarity, They were divided into several groups. To no core, no nonsense central and reflection, discuss a number of imperialism, dependency and recreation, and entertainment, the postmodernists. development and other is Proponents of the concept They Promiscuous and carelessness, to escape the of culture horror of the modern world, and push legislation Believed, not a global village and no country formal consider dry. outside the influence of the media and 4. Emphasis on language and discourse: communications can not operate outside of the Postmodernism, all knowledge, discourse as a village. product. Index of arguments that, in recent decades, So the world is global and universal, and formed the attention of theorists, especially postmodern the group known as globalization. located. . Based on the theory of discourse, truth can Profile of globalization: not be confined to a specific culture and knowledge. Universalism against realism, liberalism, and The root idea of the look and pluralistic relativism, unlike the rest of government. They argue that: all knowledge is, as noted above, these two 1. International players are dependent on social categories is based on the idea of postmodernism. class. They begin their ethnicity, Neither (fa.wikipedia.org). governments nor companies .2. Believe that the Final harvest: power and force of realism and militarism, unlike the General theories governing the relations main characters knew. Unlike liberalism, the culture between states, the First World War, based on and the cultural elements considered essential Anarchism thinking , and the only way, knew the element. These are the elements that makes the force, and to avoid the chaos created by the realism economy .3.Unlike the two that are not dynamic. of the parties, are discussed. Disturb the balance of Analytical levels is low. They believe that the power, and the First World War, the failure of realist analysis is extremely large. Theory and global thinking was proved. Therefore, dreamers or liberal level. Unlike realists, who positivist methods used, theory, it is into the game. and the Liberals, then in effect were consistent with Being honest and lawful men, and anarchic realism, and They used the method of science and absolute ignorance of people, through the trial and error, the Marxists were qualitatively organization of international economic cooperation. oriented style, And or descriptive and qualitative Their thoughts. So, after thinking about it, the methods of proof, set aside.4. Believed that in League of Nations between the wars, to contain international relations, a key component of the tensions between states, are formed ,But after 30 language., And the element of language is, that years, the Second World War, also fails to be liberal which makes the whole thing is. Cases, Such as force, idealism. Realist theory has rebuilt itself, combining army, government, governance, and ..... All human science with the humanities, and the behaviorists mind, but not out, And, say, if, through human created schools. From institutions, governments use language and concepts to know, can the yin to control. In these situations, the thesis of a world international relations, we understand. government, the UN, and the veto power of five And, the main element concepts, language ., In members, to manage relations between countries, other words, they believe that the concepts, which are with the theory of realism offer. human knowledge, and to make international Therefore, the world economy, the world's first, relations realized. International Relations is, the total second and third became. , Or the first and second. concept of security, peace, war, and .... . Who, with

http://www.lifesciencesite.com 2976 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

their knowledge, we can, in fact, we realize, In fact, 4- Ali Babaei, Golamreza., Dictionary of postmodern, instead of being a man of knowledge, International Relations (Tehran, Office of examine. (Yekta and shahbandi, (2011). As a result, Political and International Studies - the progress of nations in international relations International, Spring 1383 theory, the theory of the relationship between Iran 5- Sri Alqlm, Mahmoud, Iranian foreign policy and Tajikistan, according to the role of language and review and theoretical integration paradigm, dialogue in international relations, And also in the Center for Strategic Studies, 1379 two countries, at present, with emphasis on the role 6- Seif-Zadeh, Hosein., "The Theory of International of language is central to the ideas of postmodernism, Relations' publication Tehran Ghomes 1374 is most effective, and it can be considered. Since the 7- Seif Zadeh, Hosein.," Principles and models of foundation of the postmodern thinking in foreign policy decision-making in Tehran, State international relations, an element of the language, Department Publication 1376 and the dialogue is., Iran and Tajikistan is rich mix of 8- ,Jamali, Majid., historical commonalities between culture and language are similar, dialogue and Iran and the Central Asian countries, the report language can be a key component of the relationship, explores the Islamic Culture and Relations between the two countries. Organization, Central Asia and Pacific department, agency documents and reports, References: 9-Yekta, Hussain & shahbandi mahmoud, Executive 1-qavam, S. Abdolali. principles of foreign policy Secretary of the Faculty of Law and Political and international politics, Tehran - 1375 Science Quarterly politics at Tehran publication samt. University &Executive Secretary, Departments 2-Amir, Houshang, principles of international of Scientific Excellence . Personal interview, relations, publishing Agah, Tehran, 1374 (2011)7/10/90 Tehran, Shouters: Mahmoud 3-Haji-Yousefi, Amir Muhammad, Waltz's theory Shahbandi. and Iranian foreign policy, the comparative 10-C. Plano, Roy Olton, "The International Relations study of the Cold War and post-Cold War Dictionary, " (Colifornia:Longmant1988). Foreign Policy Journal, 16, Winter 1381 12-www.wikipedia.org.

2/22/2013

http://www.lifesciencesite.com 2977 [email protected] Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Clinical Implications for Vascular Endothelial Growth Factor Levels among Egyptians with Pulmonary Tuberculosis

Magdy Omar1, Tawfik ElAdl2, Samir Abdullah 2 , Hossam Hamza1, Tawfik ElAdl2 and Mostafa Neamatallah3

Chest1 & Internal Medicine2Departments, Benha University; Medical Biochemistry Department3, Mansoura University; Egypt. [email protected]

Abstract: Introduction: Vascular endothelial growth factor (VEGF) is a potent angiogenic factor. Intense angiogenesis has been found in active pulmonary tuberculosis. VEGF role in tuberculosis (TB) has not been fully elucidated. Aim: This study aimed to measure serum VEGF levels in active pulmonary tuberculosis and changes following chemotherapy. Subjects and Methods: Twenty five consecutive patients with active pulmonary tuberculosis and 15 healthy control subjects were enrolled in this prospective randomized controlled study. Complete medical history, full clinical examination, complete blood examination, erythrocyte sedimentation rate, liver function tests, kidney function tests, fasting blood sugar, radiological examination by plain X ray chest, tuberculin skin test by Mantoux method, sputum for acidfast bacilli by Zeil Neilsen stain and estimation of serum VEGF before treatment, 3 months and 6 months after treatment. Results: There was no statistical significant difference (p value >0.05) between patients and control group regarding age in years (with a mean of 36.75 ±8.95 for patients and 26.2±4.4 for control group) and smoking index in packs/year (with a mean of 239.65 ±215.40 for patients and 190.6 ±115.2 for control group). There was a highly statistical significant difference(p value<0.001) between patients pretreatment and control group as regarding serum VEGF (pg/ml)(with a mean of 596.02 ± 298.15 for patients and 336.61± 70.45 for control group). There was statistical significant difference(p value<0.05) between patients, 3 months after treatment and control group as regarding serum VEGF(pg/ml) (with a mean of 490.01 ±290.14 for patients and 336.60 ±70.45 for control group).There was a statistical significant difference(p value<0.05) between patients,6 months after treatment and control group as regarding serum VEGF( pg/m) (with a mean of 380.01 ±280.13 for patients and 336.6 ± 70.45 for control group). There was a statistical significant difference (p value<0.05) for serum VEGF levels(pg/ml) in patients pretreatment, 3 and 6 months after treatment( with a mean of 596.02 ± 218.15 pretreatment, 490.01±240.11 three months after treatment, 380.01±217.12 six months after treatment). In conclusion: our observations revealed that increased serum VEGF may be an indicator of active pulmonary tuberculosis, since levels were higher in patients with active pulmonary tuberculosis and were lower after successfull treatment. The role of VEGF medicated angiogenesis in pathogenesis and progression of pulmonary tuberculosis lesions should be further elucidated. [Magdy Omar, Tawfik ElAdl, Samir Abdullah, Hossam Hamza, Tawfik ElAdl and Mostafa Neamatallah. Clinical Implications for Vascular Endothelial Growth Factor Levels among Egyptians with Pulmonary Tuberculosis. Life Sci. J 2013;10(1):2978-2983]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 364

Key Words: Vascular endothelial growth factor,TB,Chemotherapy.

1. Introduction: countries. Tuberculosis in Egypt is considered the Pulmonary tuberculosis is one of the second most important public health problem after granulomatous diseases, and its pathogenesis has Bilharziasis. The annual risk of infection (ARI) in been linked to monocytes and alveolar macrophages1. Egypt stands at 0.32%. As each one percent of ARI Yet there are few serological markers that keenly corresponds to approximately 50 new smear positive reflect its activity. Recently, vascular endothelial case annually, we can expect about 10.000 new smear growth factor (VEGF), which induces angiogenesis in positive patients each year in Egypt7. Vascular malignant tumors2, was found to be associated with endothelial growth factor (VEGF) is a potent Crohn’s disease3. Although detailed immunological mediator of angiogenesis which has multiple effects mechanisms of pulmonary tuberculosis are still in lung development and physiology. VEGF is unclear, alveolar macrophages are reported to play an expressed in several parts of the lung and the pleura important role through the cytokine interaction with while it has been shown that changes in its expression T-cells4,5. Additionally, intense angiogenesis has been play a significant role in the pathophysiology of some found in active pulmonary tuberculosis of the most common respiratory disorders, such as lesions .VEGF is known to be associated with acute lung injury, asthma, chronic obstructive angiogenesis6.In terms of incidence of tuberculosis, pulmonary disease, obstructive sleep apnea, Egypt is ranked among the midlevel incidence idiopathic pulmonary fibrosis, pulmonary

2978

Life Science Journal 2013;10(1) http://www.lifesciencesite.com hypertension, pleural disease, and lung cancer. for acid fast bacilli by microscopy and radiographic However, the exact role of VEGF in the lung is not abnormalities consistent with pulmonary TB), and clear yet, as there is contradictory evidence that decision by a physician to treat with a full course of suggests either a protective or a harmful anti-TB chemotherapy or, a patient with at least one role8,9 .VEGF is 45-KD homodimeric glycoprotein sputum specimen positive for acid fast bacilli by stimulating normal and abnormal vessel growth10. microscopy, which is culture positive for M. VEGF is essential for neo-angiogenesis during Tuberculosis. embryonic development, wound healing, and tumor Exclusion criteria: growth11. We excluded patients with rheumatoid Its role in the pathophysiology of cardiovascular arthritis, diabetes mellitus, acute or chronic liver disease is less well established, however, preliminary disease, and immunological abnormalities that data suggests a therapeutic benefit of VEGF predispose to opportunistic infection and the presence application in patients with coronary artery and of positive HIV, patients on corticosteroids or other peripheral vascular disease12. A part from a number immunesuppressive agents. Also, patients with co- of cytokines, hormones, and growth factors, the existing connective tissue disorder, hematological expression of the VEGF gene is mainly stimulated by malignancies, and pulmonary diseases such as asthma, hypoxia through mediation of hypoxia-inducible COPD and lung cancer, were excluded. Fifteen factor (HIF)13. Recently,EGF induces angiogenesis in apparently healthy subjects were taken as control malignant tumors 14, it was also found to be group for comparison. The diagnosis of tuberculosis associated with Crohns disease15. Intense was made according to the 1990 edition of Diagnostic angiogenesis has been found in active pulmonary Standards and Classification of Tuberculosis tuberculosis lesions16. Among the numerous published by the American Lung Association23. For angiogenic factors,VEGF is the most extensively all patients and the control group thorough history studied and is significantly related to the severity of taking, full clinical examination, complete blood inflammatory lung diseases, such as active examination, Erythrocyte sedimentation rate(before, tuberculosis, chronic bronchitis, pulmonary 3 and 6 months after the beginning of therapy) , aspergilloma, and pulmonary disease caused by cystic fasting and 2 hrs post prandial blood sugar, plain X- fibrosis17-21.Alveolar macrophages are reported to ray chest PA-and lateral views (at diagnosis , 3 and play an important role through the cytokine 6 months after treatment), tuberculin skin testing by interactions with T cells22. Some investigators have Mantaux methods, sputum for acid fast bacilli by reported that VEGF levels were higher in sera of Z.N stain ( at diagnosis and every month ) and patients with active pulmonary tuberculosis than in estimation of vascular endothelial growth factor sera of patients with inactive pulmonary tuberculosis levels(before treatments, 3 and 6 months of and in acute bronchitis18. treatments).All patients were treated with standard Aim of the work: anti-TB drugs which consisted of : Isoniazide 300 mg The aim of this study was to evaluate the levels once daily for 6 months, Rifampicine 600 mg once of VEGF among Egyptian patients with active daily for six months, Ethambutol 1.5 gm once daily pulmonary tuberculosis and changes following for two months and Pyrazinamide 1.5-2 gm once antituberculosis chemotherapy. daily for two months. 2. Subjects and Methods: Measurements of VEGF: This prospective, randomized, controlled study VEGF levels in sera of patients and control group comprised consecutive twenty five patients within were measured with a commercially available Human two years period. They were selected from the VEGF Quantikine Elisa Kit (R&D systems; outpatient clinic of Internal Medicine and Chest Minneapolis, MN) according to manufacturer, s Departments of Benha University Hospitals and they instructions. The sensitivity of the VEGF kit was 5 gave verbal consent after explanation of the study pg/ml. purposes and procedures. Statistical analysis: Inclusion criteria: All data were recorded on an investigative Patients with newly diagnosed active pulmonary report form. Data were expressed as mean ± standard tuberculosis, new patients who have never had deviation (SD). P< 0.05 level considered statistically treatment for TB or who has taken anti-TB drugs for significant. All data were transferred to IBM-card less than 4 weeks, sputum of patients were smear using IBM-PC with analysis of data by a statistical positive(smear positive pulmonary TB patients is programme: SPSS (statistical package for social defined as: patient with at least two sputum science). Software package, v g 0.05 (USA. Lyyb. specimens positive for acidfast bacilli by microscopy Echo soft carporatem ). Correlation between variables or patient with at least one sputum specimen positive was evaluated by pearson's correlation coefficient.

2979

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

3. Results: after treatments and control group as regarding serum Twenty five consecutive patients (20 males and VEGF (pg/ml)(with a mean of 490.01 ±290.14 for 5 females) and 15 healthy control subjects (10 males patients and 336.60 ±70.45 for control group ) (Table and 5 females)were enrolled in this study (Table2). 4). There was a statistical significant difference(p There was no statistical significant difference (p value<0.05) between patients,6 months after value >0.05) between patients and control group treatments and control group as regarding serum regarding age in years (with a mean of 36.75 ±8.95 VEGF( pg/m)(with a mean of 380.01 ±280.13 for for patients and 26.2±4.4 for control group) and patients and 336.6 ± 70.45 for control group) smoking index in packs/year(with a mean of 239.65 (Table5). There was a statistical significant difference ±215.40 for patients and 190.6 ±115.2 for control (p value<0.05) of serum VEGF levels(pg/ml) in group) (Table 1). There was a highly statistical patients pretreatments, 3 and 6 months after significant difference (p value<0.001) between treatments (with a mean of 596.02 ± 218.15 patients pretreatment and control group as regarding pretreatment, 490.01±240.11for three months after serum VEGF (pg/ml) (with a mean of 596.02 ± treatment, 380.01±217.12 for six months after 298.15 for patients and 336.61± 70.45 for control treatment)(Table 6). group) (Table 3). There was statistical significant difference (p value<0.05)between patients, 3 months

Table 1: Statistical comparison between patients and control group regarding age(years) and smoking index (SI)(packs/ year): Range Mean ±SD P value Significant Age: Patients 20-52 36.75 8.95 >0.01 Non significant 19-39 26.2 4.4 Control SI:Patients 200-400 239.65 215.40 >0.01 Non significant Control 160-500 190.6 115.2

Table 2: Sex distribution in patients and control: Patients Control Male 20 (80) % 10 (66.6%) Female 5 (20) % 5 (33.2%) Total 25 15

Table 3: Statistical comparison between patients pretreatment active pulmonary tuberculosis and control group as regarding serum VEGF (pg/ml): VEGF Mean ±SD P value Significant Patients 596.02 298.15 <0.001 Highly significant Control 336.61 70.45

Table 4: Statistical comparison between patients 3 months after treatments and control group as regarding serum VEGF(pg/ml): VEGF Mean ±SD P value Significant Patients 490.01 290.14 <0.05 Significant Control 336.60 70.45

Table 5:Statistical comparison between patients 6 months after treatments and control group as regarding serum VEGF( pg/m): VEGF Mean ±SD P value Significant Patients 380.01 280.13 <0.05 Significant Control 336.6 70.45

2980

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table 6: Statistical comparison of serum VEGF levels(pg/ml) in patients pretreatments, 3 months and 6 months after treatments: VEGF Mean ±SD P value Significant Pretreatment 596.02 218.15 <0.05 Significant 3 months after treatment 490.01 240.11 Pretreatment 596.02 218.15 <0.001 Highly significant 6 months after treatment 380.01 217.12 3 months after treatment 490.01 240.11 <0.05 Significant 6 months after treatment 380.01 217.12

4. Discussion: compared with healthy individuals. They indicated that Tuberculosis is a disease with high mortality and increased serum VEGF levels subdue cavity formation morbidity. Approximately one third of the world through local immunity in active pulmonary population is infected with tubercle bacillus, and there tuberculosis. Our study also demonstrated that there are 8 million deaths annually from tuberculosis in the were a significant difference in levels of serum VEGF world24.Despite the new knowledge about the levels between patients with active pulmonary pathogenesis and activity of tuberculosis, it remains an tuberculosis before treatment and the same patients 3 important disease especially in developing countries25. months after treatment, as patients with active VEGF is the major mediator of angiogenesis and pulmonary tuberculosis had higher levels of serum vascular permeability. VEGF, also known as vascular VEGF and these levels significantly decreased with permeability factor or vasculotropin, has potent treatment. These results are in agreement with that angiogenic mitogenic, and vascular permeability done by other investigators23 who found that the serum enhancing activities that are specific for endothelial VEGF levels of patients with active pulmonary cells. But in healthy tissues,VEGF expression has been tuberculosis were significantly decreased 3 months found in activated macrophages, neutrophils, after beginning of therapy. Our study found also that Hepatocytes, smooth muscle cells, Leydig cells and in there is highly significant difference regarding serum the bronchial epithelium. The most important factors VEGF for those patients with active pulmonary for increasing VEGF expression are tissue tuberculosis before treatment and 6 months after inflammation, hypoxia and transforming growth factor treatment. Our results are also in agreement with the β levels26. Although increased VEGF levels have been same study done by other investigators23 who followed demonstrated in patients with malignancies27, there are up ten active pulmonary tuberculosis patients and only few reports showing increased levels of VEGF in examined the serum level of VEGF at the end of patients with infectious diseases, especially pulmonary tuberculosis treatment and they found that there is a tuberculosis28. significant decrease of VEGF levels between active In the present study, we demonstrated levels of pulmonary tuberculosis patients before and 6 months VEGF in sera of patients with active pulmonary after treatment. According to these findings, serum tuberculosis before treatments, 3 and 6 months after VEGF levels of patients with active pulmonary treatment and comparing these levels with levels in tuberculosis were decreasing parallel to tuberculosis healthy volunteers. treatment. We demonstrated that, there was no significant In a study done by other investigators16, they correlation between patients and control group found that there is intense angiogenesis present in regarding age and smoking index. Our study also active pulmonary lesions. It is generally accepted that demonstrated that, there was higher significant activated macrophages are the main cells that secrete difference between levels of VEGF between patients VEGF in tuberculosis lesion. In the study done by with active pulmonary tuberculosis before treatments Matsuyoma et al. 23, they showed by and control healthy volunteers. This finding is in immunohistochemistry that the expression of VEGF agreement with other study23 which reported that occurred in the alveolar macrophages around active VEGF levels were higher in the sera of patients with tuberculosis lesions. Based on these findings, we active pulmonary tuberculosis than in patients with suggest that serum VEGF levels increased in our inactive tuberculosis or healthy subjects. Our study active pulmonary tuberculosis patients possibility due was also in agreement with another trial28 which to increased production and secretion of VEFG, showed that patients with active pulmonary especially by the alveolar macrophages. So, circulating tuberculosis, who did not have typical chest Cavities, VEGF levels are increased in patients with active had significantly higher serum VEGF levels when pulmonary tuberculosis compared to healthy controls

2981

Life Science Journal 2013;10(1) http://www.lifesciencesite.com and patients with old tuberculosis, and decrease after growth factor in patients with inflammatory bowel successful treatment23,29. The source of VEGF in disease. Scand. J Gastroenterol, 33:504–508. pulmonary tuberculosis is believed to be the alveolar 4.Ridley MJ,Heather CJ,Brown I, and Willoughby DA macrophages and the CD4 T-lymphocytes29,30. (1983): Experimental epithelioid cell granulomas, Alveolar macrophages in pulmonary tuberculosis may tubercle formation and immunological competence: release VEGF together with several cytokines and an ultrastructural analysis. J Pathol, 141:97–112. contribute to the recruitment of T-cells to the lesion18. 5. Boom WH,Wallis RS and Chevenak KA(1991): Serum VEGF levels were found higher in TB patients Human Myobacterium tuberculosis-reactive without cavitary lesions compared to those with CD41T-cell clones: heterogeneity in antigen typical chest cavities, suggesting that increased serum recognition, cytokine production, and cytotoxicity VEGF levels may subdue cavity formation28. However, for mononuclear phagocytes. Infec Immun, this finding was not replicated in subsequent studies23. 59:2737–2743. Two studies had reported that VEGF levels may be 6. Kumararatne DS,Pithie AS,Drysdale P, Gaston used for the diagnosis of active tuberculosis, with great JS,Kiessling R,Iles PB,Ellis CJ, and Wise R(1990): sensitivity (93% and 95.8% for cut-off values of 250 Specific lysis of mycobacterial antigen-bearing pg/mL and 458.5 pg/mL, respectively) but with macrophages by class II MHC-restricted polyclonal relatively low specificity23,29. VEGF may serve as a T cell lines in healthy donors or patients with marker of disease activity in tuberculosis; however, tuberculosis. Clin Exp Immunol, 80:314–323. further studies are needed in this direction. The weak 7. Tuberculosis control guide, MOHP, 2000. point in our trial is the relatively low number of 8. Papaioannou AI, Kostikas K, Kollia P and patients recruited. Recommendations: Further studies, Konstantinos I Gourgoulianis KI(2006):Clinical on larger scales, must be done to correlates serum implications for Vascular Endothelial Growth VEGF levels to that expressed in alveolar Factor in the lung: friend or foe?.Respiratory macrophages around active tuberculosis lesions by Research, 7:128 doi: 10.1186/1465-9921-7-128). immunohistochemistry. And also, to correlate and 9. Voelkel NF, Vandivier RW, Tuder RM(2006): compare the changes that occurs in serum levels of Vascular endothelial growth factor in the lung.Am VEGF and other new inflammatory markers of J Physiol Lung Cell Mol Physiol ,290 (2): L209-21. tuberculosis e.g. IL 2 receptors; also the role of VEGF 10.Ferrara N(1999):Molecular and biological mediated angiogenesis in the pathogenesis of properties of vascular endothelial growth factor.J pulmonary tuberculosis should be further elucidated. Mol Med, 77: 527-543. Additional studies with larger numbers of pulmonary 11.Stacker SA and Acheu MG (1998):The vascular tuberculosis patients are needed to clarify the point. endothelial growth factor family: proteins which guide the development of the vascular system. Int.J Conclusion: Exp Pathol, 79:255-265. Although the diagnosis and activities of 12.Baumgartner I, Piczek A , Manor O, Blair R and tuberculosis is ultimately accomplished by isolation of Isner JM(1998):Constitutive expression of VEGF TB bacilli, the increased serum VEGF levels in our 165 after intramuscular gene transfer promotes patients with active pulmonary tuberculosis may be an collateral vessel development in patients with important finding,VEGF may be a useful non invasive critical hindlimb ischemia.Circulation: 1114-1123. screening marker for active tuberculosis, as a negative 13.Semenza GL, Agnif A, Feldser D, Lyer N, Kotch L result greatly reduces the likelihood of tuberculosis. and Laughner E(2000):Hypoxia, HIF-1 , and the However, a positive result requires confirmation. pathphysiology of common human disease. Adv Exp Med Biol, 475:123-130. References 14.Muttern JR, Koomagi M and Volm W(1997): 1. Fraser RG, Peter Pare JA,Pare PD, Fraser RS, and Coexpression of VEGF and vFGF in Human Genereux GP(1989):Diagnosis of Diseases of the epidermoid lung carcinoma is associated with Chest, 3rd ed., Vol. 2. W. B.Saunders, Philadelphia: increased vessel density. Anticancer Resp, 882–940. 17:2249-2252. 2. Mattern JR, Koomagi N, and Volm M (1997): 15.Griga TA, Tromm J, Spring A and May Coexpression of VEGF and bFGF in human B(1998):Increased serum level of vascular epidermoid lung carcinoma is associated with endothelila growth factor in patients with increased vessel density.Anticancer Res, 17: 2249– inflammatory Bowel disease.J Gastroentrol,33:504- 2252. 508. 3. Griga T,Tromm A,Spranger J, and May B(1998): 16.Ridley MJ, Heather J, Brawn R and Willaughby Increased serum level of vascular endothelia DA (1983): Experimental epithelial cell granulonas,

2982

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

tubercle formation and immunological competence: 23.American Thoracic Society(1990):Diagnostic an ultrastrucutral analysis.J Pathol, 141:79-112. standards and classification of tuberculosis.Am 17.Park HY, Hahm CR, Jeon K, Koh WJ, Suh GW, Rev Respir Dis,142:725–735. Chung MP, Kim H, Kwon JO, and Um SW(2012): 24.Raviglione M, Snider D and Kochi(1995):Global Serum Vascular Endothelial Growth Factor and epidemiology of tuberculosis mortality and Angiopoietin-2 Are Associated with the Severity of morbidity epidemic JAMA, 213:220-226. Systemic Inflammation Rather than the Presence of 25.Dvorak HF, Brown LF and Detmar M(1995): Hemoptysis in Patients with Inflammatory Lung Vascular permeability factor , vascular endothelial Disease. Yonsei Med J.March 1; 53(2): 369–376. growth factor, Micro vascular permeability and 18. Matsuyama W, Hashiguchi T, Matsumuro K, angiogenesis. Am J Pathol, 146:1029-1039. Iwami F, Hirotsu Y, Kawabata M, et al.(2000): 26.Taichman, N.S., Young . S. and Crushly. A.T., Increased serum level of vascular endothelial (1997): Human Neutophils secrete vascular growth factor in pulmonary tuberculosis. Am J endothelial growth factor.J Leukoc Biol, 62, 397- Respir Crit Care Med ;162:1120–1122. 400. 19. Kanazawa H(2007): Role of vascular endothelial 27.Mall Jw, Schwenk W and Philipp AW:(2002): growth factor in the pathogenesis of chronic Serum vascular endothelial growth factor levels obstructive pulmonary disease. Med Sci Monit; correlate better with tumour stage in small cell lung 13:RA189–RA195. cancer than albumin, neurons specific enolose or 20.Inoue K, Matsuyama W, Hashiguchi T, Wakimoto lactate delychogenase. Respirology, 7:99-102. J, Hirotsu Y, Kawabata M, et al.(2001): Expression 28.Abe Y, Nakamura M, Oshika Y, Hatanaka H, of vascular endothelial growth factor in pulmonary Tokunaga T, Ohkubo Y, Hashizume T, Suzuki K, aspergilloma. Intern Med; 40:1195–1199. Fujino T(2001): Serum levels of vascular 21. McColley SA, Stellmach V, Boas SR, Jain M, endothelial growth factor and cavity formation in Crawford SE (2000): Serum vascular endothelial active pulmonary tuberculosis. Respiration , growth factor is elevated in cystic fibrosis and 68(5):496-500. decreases with treatment of acute pulmonary 29.Alatas F, Alatas O, Metintas M, Ozarslan A, exacerbation. Am J Respir Crit Care Med; Erginel S, Yildirim H(2004): Vascular endothelial 161:1877–1880. growth factor levels in active pulmonary 22.Boom WH and Cheneuak KA(1991):Human tuberculosis.Chest, 125(6):2156-2159. mycobacterium tuberculosis- reactive CD4+Tcell 30.Matsuyama W, Kubota R, Hashiguchi T, Momi H, clones: Heterogeneity in antigen recognition Kawabata M, Nakagawa M, Arimura K, Osame cytokine production, and cytotoxicity for M(2002): Purified protein derivative of tuberculin mononuclear phagocytes. Infect Immun, 59:2737- upregulates the expression of vascular endothelial 2743. growth factor in T lymphocytes in vitro. Immunology, 106(1):96-101.

2/2/2013

2983

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Correlation between CD4+, CD8+ T Cells Count and Liver Function Tests in Chronic Hepatitis C Infection.

Hoda El Tayeb1, Ahmed Shawky1, Noha A. El Nakeeb1, and Hala B.Othman2, Enas H. Allam3.

Departments of 1Internal Medicine, 2Clinical Pathology and 3 Tropical Medicine , Faculty of Medicine, Ain Shams University [email protected]

Abstract: T cells are believed to be involved in the pathogenesis of important liver diseases including both autoimmune liver diseases and viral hepatitis. The aim of this study was to find if there is a correlation between liver function tests and levels of CD4 and CD8 in patients with chronic hepatitis C virus (HCV) infection to determine the role of T cells in the pathogenesis of HCV. Patients and methods: This study was conducted on 60 patients with chronic HCV infection proved by PCR. The patients were divided into 3 groups; Group 1: included 20 patients with normal liver function tests and normal abdominal ultrasound. Group 2: included 20 patients with abnormal liver function tests and normal abdominal ultrasound. Group 3: included 20 patients with abnormal laboratory results and abnormal abdominal ultrasound. Immunophenotyping of peripheral blood lymphocytes by flow cytometry for CD4 & CD8 was done for all groups. Results: This study showed a highly significant positive correlation between CD4 T-cell counts and liver enzymes, also there was a highly significant positive correlation between CD8 T-cell count and bilirubin level and a negative correlation between CD4 T-cell count and CD8 T-cell count. Conclusion: CD4 and CD8 T-cell counts may represent a non invasive method to determine the immune response against chronic HCV infection. [Hoda El Tayeb, Ahmed Shawky, Noha A. El Nakeeb, and Hala B.Othman, Enas H. Allam. Correlation between CD4+, CD8+ T Cells Count and Liver Function Tests in Chronic Hepatitis C Infection. Life Sci. J 2013;10(1):2984-2989]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 365

Key words: CD4 and CD8 T-cell, HCV. conflicting results have been reported for their roles in 1. Introduction HCV replication and liver inflammation. Several T lymphocytes play a central role in investigators have shown that the HCV specific inflammatory diseases of liver such as viral hepatitis, cytotoxic T lymphocytes (CTL) response is inversely autoimmune hepatitis through their diffuse effector correlated with viral load, suggesting its inhibitory functions and their regulatory effect on other immune capacity on HCV replication. Also, HCV-specific cells (Law et al., 2003). Hepatitis C virus (HCV) is CD8+ T cells in chronic hepatitis C patients were the most common cause of chronic liver disease found to possess lesser capacity to proliferate and worldwide as replication of the virus takes place produce less IFN-γ in response to HCV antigens primarily in the liver (Thimme et al., 2002). However, (Wedemeyer et al., 2002). liver damage is not directly caused by the virus, rather Since CD8+ T cells are reported to be involved is by the interplay between the virus and the immune in HCV-induced liver inflammation, inefficient CD8+ system which results in the replacement of healthy T cells may evoke only milder hepatocyte injury, liver tissue with fibrous scar tissue (Tedeschi, 2009). which level is not sufficient for HCV eradication Antibodies directed against several HCV (Wedemeyer et al., 2002). Several mechanisms have proteins can be detected in chronic patients. A variety been proposed for T cell functional failure observed in of autoimmune or immune complex-mediated diseases chronic HCV infection: have also been associated with chronic HCV infection 1) HCV-escape mutation. (Tedeschi, 2009). 2) Primary T cell failure or T cell exhaustion. In chronic hepatitis C patients, HCV-specific 3) Impaired antigen presentation. CD4+ T cells were functionally impaired and their 4) Suppression by HCV proteins. activity was not sustained, which was in clear contrast 5) Impaired T cell maturation. (Ulsenheimer et al., with resolved cases. Inoculation studies of infectious 2005). HCV to recovered chimpanzees demonstrated that Aim of the study CD4+ T cell help was indispensable for the To find out a correlation between the development of effective CD8+ T cell response to laboratory results and level of CD4+ and CD8+ T cells protect from HCV persistence (Ulsenheimer et al., to determine the role of T cells in patients having 2003). chronic HCV infection. With regard to HCV-specific CD8+ T cells observed during the chronic stages of disease,

2984

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

in the dark, at room temperature, 1.0 ml of 2.Patients and Methods laboratory prepared ammonium chloride based This study was conducted on 60 patients with lysing solution was added and RBC lysis was chronic HCV infection proved by PCR at Ain Shams allowed for 10 min at room temperature. University Hospitals in the period from January 2012 Samples were washed once and re-suspended in to June 2012. The patients were divided into 3 groups 0.5 mL of phosphate buffered saline (PBS). as follows: Group 1 included twenty patients with normal liver Cells were analyzed using Coulter EPICS XL function tests and normal abdominal ultrasound. flow cytometer with System II software (Coulter, Group 2 included twenty patients with abnormal liver USA). Lymphocytes were electronically gated in a function tests [including elevated liver enzymes, linear forward scatter / log side scatter histogram. The and/or increased bilirubin levels and/or prolonged percentages of cells expressing CD4 and CD8 were prothrombin time (PT)] and normal abdominal estimated in a two-parameter histogram. Then the ultrasound. absolute count was calculated. Group 3 included twenty patients with abnormal liver Statistical Analysis function tests [including elevated liver enzymes, Statistical package for Social Science (SPSS and/or increased bilirubin levels and/or prolonged 15.0.1 for windows; SPSS Inc, Chicago, IL, 2001) prothrombin time (PT)] and abnormal abdominal program was used to analyze and calculate the ultrasound in the form of hepatomegaly, statistics of our results. hepatosplenomegaly. 3.Results All patients involved in the study were subjected to: A total of 60 patients with HCV infection were 1) Full History taking and clinical examination. included in this study. They were divided into three 2) Investigations: groups according to laboratory findings of liver - Liver function tests: function test. They were 15 males (75%) and 5 . ALT (Alanine aminotransferase). females (25%) in group I, 14 males (70%) and 6 . AST (Aspartate aminotransferase). females (30%) in group II and 15 males (75%) and 5 . Serum Bilirubin (total and direct). females (25%) in group III with no statistically . Serum albumin. significant difference between the three groups - Prothrombin time (PT). regarding gender (p >0.05). - Abdominal Ultrasound. The mean age of studied groups was 48.2±7.2 - Immunophenotyping by flow cytometry for years in group I, 42.9±10.5 years in group II and measurement of CD4+ & CD8+ T cell counts. 48.7±10.3 years in group III with no statistically For lymphocytes staining, 50 uL of whole blood significant difference between the three groups (with leucocytic count adjusted to 10,000 regarding age (p > 0.05). cell/uL) was placed into polystyrene tubes and There was no significant difference between was simultaneously stained with 5 ul of FITC- the three studied groups regarding the level of viremia labeled anti-human CD4 and PE-conjugated (Table 1). anti-human CD8 monoclonal antibodies (Immunotech, USA). After 15 min incubation

Table (1): Comparison between the three studied groups as regard HCV- PCR. Group Abnormal lab and US Post Hoc Normal lab and US (Gr1) Abnormal lab and Normal US (Gr2) P* Sig (Gr3) test Mean ± SD Mean ± SD Mean ± SD Gr1 Vs Gr3 187900 ± 187550 ± 160675 ± PCR (IU/L) .067 NS Gr2 Vs Gr3 114420.23 157251.88 135216.33 Gr1 Vs Gr2 There was a highly significant difference between the three studied groups as regards CD4 count (Table 2).

Table (2): Comparison between the three studied groups as regard CD4 count (% of total lymphocytic count). Group Post Group 1 Group 2 Group 3 P* Sig Hoc test Mean ± SD Mean ± SD Mean ± SD 31.53 ± 41.66 ± 36.32 ± Gr1 Vs Gr2 CD4 .008 HS 8.66 11.87 8.83 *ANOVA

2985

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

There was a highly significant difference between the three studied groups as regards CD8 count (Table 3).

Table (3): Comparison between the three studied groups as regard CD8 count (% of total lymphocytic count). Group Post Group 1 Group 2 Group 3 P* Sig Hoc test Mean ± SD Mean ± SD Mean ± SD 23.05 ± 22.75 ± 34.78 ± Gr1 Vs Gr3 CD8 .001 HS 3.57 10.64 7.89 Gr2 Vs Gr3

A highly significant positive correlation was found between CD4 counts and liver enzymes (AST and ALT), but no significant correlation could be detected between CD4 count and serum albumin, total Bilirubin, direct Bilirubin, Prothrombin time or PCR in the three groups (Tables 4,5,6).

Table (4): Correlation between CD4, liver function tests and PCR in Group 1 S albumin AST ALT Total Bil Direct Bil PT PCR CD4 r 0.04 .472 .415 .013 .006 0.33 .204 P 0.76 .0001 .001 .919 .962 0.1 .117 Sig NS HS HS NS NS NS NS

Table (5): Correlation between CD4, liver function tests and PCR in Group 2 S albumin AST ALT Total Bil Direct Bil PT PCR CD4 r 0.05 .543 .422 .019 .008 0.30 .255 P 0.7 .001 .001 .721 .852 0.12 .208 Sig NS HS HS NS NS NS NS

Table (6): Correlation between CD4, liver function tests and PCR in Group 3 S albumin AST ALT Total Bil Direct Bil PT PCR CD4 r 0.04 .401 .501 .029 .003 0.2 .298 P 0.76 .004 .001 .601 .799 0.15 .718 Sig HS HS NS NS NS S There was a highly significant positive correlation between CD8 count and both Bilirubin (total and direct) and prothrombin time but there was no significant correlation between CD8 count and serum albumin, liver enzymes (AST and ALT) or PCR in the three groups (Tables 7, 8 and 9).

Table (7): Correlation between CD8, liver function tests and PCR in group 1 S albumin AST ALT Total Bil Direct Bil PT PCR 0.03 0.43 CD8 r .038 -.052 .424 .407 -.027 P 0.75 .772 .695 .001 .001 0.001 .840 Sig NS NS NS HS HS HS NS

Table (8): Correlation between CD8, liver function tests and PCR in group 2 S. albumin AST ALT Total Bil Direct Bil PT PCR CD8 r 0.035 .046 -.043 .353 .510 0.5 -.031 P 0.76 .892 .451 .001 .001 0.001 .779 Sig NS NS NS HS HS HS NS

2986

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table (9): Correlation between CD8, liver function tests and PCR in group 3 S. albumin AST ALT Total Bil Direct Bil PT PCR r 0.052 .041 -.059 .632 .532 0.51 -.029 CD8 P 0.695 .903 .567 .001 .001 0.001 .557 Sig NS NS NS HS HS HS NS

There was a significant negative correlation between CD4 and CD8 count in the three groups (Table 10 and Fig 1).

Table (10): Correlation between CD4 and CD8 in the three studied groups CD8 group 1 CD8 group 2 CD8 group 3 r -.266 -.324 -.212 CD4 P .040 .032 .022 Sig S S S

60.0

50.0

40.0

30.0 CD8

20.0

10.0

0.0

10 20 30 40 50 60 70 CD4

Figure (1) Correlation between CD4 and CD8 counts in the three groups could be detected between CD4 count and serum 4. Discussion albumin, total and direct Bilirubin, and prothrombin Hepatitis C virus (HCV) is a major cause of time. However a highly significant positive correlation liver disease globally (Alter, 2007). The virus is able was found between CD4+ counts and ALT levels. This to evade host innate and adaptive immune responses in agreed with both Rico et al.(2002) who analyzed immunocompetent adults and to set up persistent CD4+ T cell reactivity in liver and peripheral blood infection in the majority of people. Those persistently from HCV patients segregated by their ALT levels, infected are at risk of progressive liver fibrosis, and found that HCV-specific-induced T cell cirrhosis and cancer (Dazert et al., 2009). proliferation was less often in patients with normal The immunological response to HCV has an ALT, compared to patients with elevated ALT levels important bearing not only on the acute outcome (i.e. and Bolacchi et al.(2006) who found that the persistent infection versus spontaneous resolution), but proliferation of HCV specific CD4+ cells were also potentially on the long-term outcome in chronic significantly greater in patients with elevated ALT carriers. Successful outcome is associated with the level than in patients with normal ALT. While, maintenance of broadly directed CD4+ and CD8+ T- Barbara et al.(2007) highlighted unreported cell responses, with maintained functionality (Bowen association between low absolute CD4+ T cell counts and Walker, 2005). and cirrhosis in the absence of HIV infection and they In our study, there was a highly significant believed that low CD4+ T cell counts are the result of difference between the three studied groups as regard global sequestration of blood cell lines related to portal the CD4+ cell count. But no significant correlation

2987

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Rodriguez et al. (2007) studied the expression of CD4 hypertension. This hypothesis was supported by the and CD8 T-lymphocytes in peri-portal areas of hepatic strong association between low CD4+ T cell counts biopsy from patients with HCV and found that AST and splenomegaly, leucopenia, and severe was correlated significantly to CD8 and interface thrombocytopenia-conditions that are commonly seen hepatitis. in patients with cirrhosis, regardless of etiology. Also, in our study, no correlation was found Indeed, this study found that there was a between CD8 T cell counts and HCV viraemia levels highly significant positive correlation between CD4+ which came in agreement with Roe et al. (2009) and T cell count and AST level. This result could be Shen et al. (2010) explained by Aslan et al. (2006) who stated that the In this study there was a negative correlation presence of CD4+ counts was associated with elevated between CD4+ cells and CD8+ cells count which AST levels based on the fact that not only CD8+ T came in agreement with Nascimbeni et al. (2011) who cells but also CD4+ T cells may act as cytotoxic T performed a phenotypic analysis of CD4 & CD8 cells. double positive T-cells in blood and liver from The current study showed no significant patients chronically infected by HCV or HBV and correlation between CD4+ T cell counts and HCV found that CD4 T-cells were high but CD8 T-cells viraemic load which came in agreement with Shen et who found that no correlation was foundا (were low in patients infected by HCV while in HBV al. (2011 infected patients, the CD4 T-cells were low and the between HCV RNA level and the CD4+ cell count CD8 T-cells were high. However, Kim et al. (2005) while HCV core antigen concentration was negatively found that HCV specific CD8 T-cells responses correlated with the CD4+ cell count. On the other decline with diminishing absolute CD4 T-cell count hand, Beld et al. (1998) and Janice et al. (2001) found which provided a possible explanation for the more an inverse correlation between CD4+ T cell count and rapid HCV disease progression in the setting of the HCV RNA plasma levels which were higher in HIV HIV co-infection. co-infected individuals than in HIV seronegative patients with HCV. Conclusion: As regards the CD8 counts, the current study CD4 and CD8 T-cell counts might correlate found a highly significant difference between the three significantly with liver function tests in chronic HCV studied groups. Using the post hoc test, the infection. Also CD8 T-cell cytotoxicity was significance was between group 1 & 3 also between significantly correlated with the severity of liver group 2 & 3 being the highest in group 3 (with both disease but not with the level of HCV vireamia. So abnormal liver functions & abnormal ultrasound) CD4 and CD8 T-cell counts might represent a non compared to the other 2 groups. This could be invasive method to determine the immune response explained by Leroy et al. (2003) who have found a against chronic HCV infection. strong correlation between CD8 gene expression and both ALT serum level and histological activity index References (HAI). Their immunohistochemical analysis clearly 1. Alter,M.J. (2007): Epidemiology of hepatitis C showed CD8 staining in lobular and piecemeal virus infection. World J Gastroenterol. 13, 2436- necrosis areas providing evidence that conventional 2441. CD8+ T lymphocytes are the main cell effectors 2. Aslan N; Yurdaydin C; Wiegand J.; Greten T.; implicated in the pathogenesis of HCV infection. Ciner A.; Meyer M. F.; Heiken H.; Kuhlmann B; The current study found a highly significant Kaiser T.; Bozkaya H.; Tillmann H. L.; Bozdayi A. positive correlation between CD8 T-cell count and M.; Manns M. P.; Wedemeyer H.. (2006): both serum bilirubin level and prothrombin time Cytotoxic CD4+ T Cells in Viral Hepatitis C, J (parameters that correlate with the severity of the Viral Hepat. 13(8):505-14. disease) These findings agreed with Rodriguez et 3. Barbara H. Mc Govern, Yoav Golan, Marvin Lopez, al.(2007) who studied the expression of CD8 T- Daniel Pratt, Angela Lawton, Grayson Moore, Mark Epstein, and Tamsin A. Knox. (2007): The Impact lymphoctes by immunohistochemistry in portal and of Cirrhosis on CD4+ T Cell Counts in HIV- peri-portal areas of hepatic biopsies from patients with Seronegative Patients. HIV/AIDS.CID; 44:431-437. chronic HCV and found a positive correlation between 4. Beld M, Penning M, Lukashovv et al. (1998): CD8 T-cell densities and intensity of interface Evidence that both HIV and HIV- induced hepatitis. However, we didn’t find any correlation immunodeficiency enhance HIV replication among between CD8+ T cell count and (AST) levels. This HCV seroconvertors. Virology; 244: 504-512. was in agreement with Roe et al. (2009) who studied 5. Bolacchi F, Sinistro A, ciaprini C, Demin F, the phenotypic characterization of lymphocytes in Capozzi M, Carducci F C, Drapeau C M J, Rocchi HCV infection and found no correlation between CD8 G and Bergamini A. (2006). Increased hepatitis C and AST. On the contrary, Freeman et al. (2003) and

2988

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

and Liver of Patients during Chronic Hepatitis B virus (HCV) - specific CD4+ CD25+ regulatory T and C. PLoS ONE 6(5): e20145. lymphocytes and reduced HCV- specific CD4+ T 14. Rico MA, Quiroga JA, Subira D, et al. (2002): cell response in HCV- infected patients with normal Features of the CD4+ T-cell response in liver and versus abnormal alanin aminotransferase levels. peripheral blood of hepatitis C virus-infected Clin Exp Immunol. ; 144(2): 188-196. patients with persistently normal and abnormal 6. Bowen, D. G. and Walker, C. M. (2005): Adaptive alanine aminotransferase levels. J Hepatol.; 36:408– immune responses in acute and chronic hepatitis C 16. virus infection. Nature 436, 946–952. 15. Rodriguez A. T, Barbosa Th de Castro, Lidia 7. Dazert, E.,Neumann-Haefelin, C., Bressanelli, S., Yamamoto, Carla Paglairi, Elaine Raniero Fitzmaurice, K., Kort, J., Timm, J., McKiernan, S., Fernandes, Roosecelis Araujo Brazil, Heitor Franco Kelleher, D., Gruener, N. & other authors. (2009): de Andrade Junior, Maria Irma Seixas Duarte, Loss of viral fitness and cross-recognition by CD8+ Antonio Alci Barone. (2007):portal CD4+ and T cells limit HCV escape from a protective HLA- CD8+ T lymphocytes correlate to intensity of B27-restricted human immune response. J Clin interface hepatitis in chronic hepatitis C. Rev. Inst. Invest 119, 376–386. Med. Trop.paulo 49(6):371-378. 8. Freeman, A.J.; Pan,Y.; Harvey, C.E. et al. (2003): 16. Roe B, Coughlan S, Dean J, Lambert J S, Keating The presence of an intrahepatic cytotoxic Sh, Norris S, Bergin C, and Hall W W. (2009): lymphocyte response is associated with low viral Phenotypic characterization of lymphocytes load in patients with chronic hepatitis C virus HCV/HIV co-infected patients. Viral Immunology infection. J. Hepatology. 38:349-356. vol 22 November ; 39-47. 9. Janice M, Mathews Geer, Gloria Caldito, Sharon D. 17. Shen T, Zheng J, Xu Ch, Liu J, Zhang W, Lu F, Adley, Regina Willis, Angela C. Mire, Richard M Zhuang H. (2010):PD-1 expression on peripheral Jamison, Kenny L. McRae, John W. King and CD8+ TEM/TEMRA subsets closely correlated Wun- Ling Chang. (2001):Comparison of hepatitis with HCV viral load in chronic hepatitis C C viral loads in patients with or without human patients :Virology Journal ;7:310. immunodeficiency virus. Clin Diagn Lab Immunol; 18. Shen T, Chen X, Zhang W, Xi Y, Cao G, Zhi Y, 8(4):690-694. Wang Sh, Xu Ch, Wei L, Lu F and Zhuang H et al. 10. Kim A Y., Lauer G M., Ouchi K, Addo M M., (2011):A higher correlation of HCV core antigen Lucas M, Wiesch J Sch z, Timm J, Boczanowski with CD4+ T cell counts compared with HCV RNA M, Duncan J E., Wurcel A G., Casson D, Chung R in HCV/HIV-1 coinfected patients. Plosone. T., Draenert R, Klenerman P, and Walker B D.. 6(8):e23550. (2005): The magnitude and breadth of hepatitis C 19. Tedeschi A. (2009): Cryoglobulinemia. Blood Rev; virus–specific CD8+ T cells depend on absolute 21(4): 183–200. CD4+ T-cell count in individuals coinfected with 20. Thimme R, Bukh J, Spangenberg HC, et al. (2002): HIV-1; Blood ; 105 (3): 1170-1178 Viral and immunological determinants of hepatitis 11. Law MG, Dore GJ, Bath N, Thompson S, Crofts N, C virus clearance, persistence and disease. Proc Dolan K, Giles W, Gow P, Kaldor J, Loveday S, Natl Acad Sci USA 99: 15661-15668. Powell E, Spencer J, Wodak A. (2003): Modelling 21. Ulsenheimer A, Gerlach JT, Gruener NH, et al. hepatitis C virus incidence, prevalence and long- (2003): Detection of functionally altered hepatitis C term sequelae in Australia, Int J Epidemiol ; 32: virus-specific CD4 T cells in acute and chronic 717-724. hepatitis C. Hepatology 37: 1189-1198. 12. Leroy V, Vigan I, Mosnier J-F, Dufeu-Duchesne T, 22. Ulsenheimer A, Gerlach JT, Jung MC, et al. (2005): Pernollet M, Zarski J-P, Marche P N.and Jouvin- Plasmacytoid dendritic cells in acute and chronic Marche E (2003): Phenotypic and Functional hepatitis C virus infection. Hepatology 41: 643-651. characterization of intrahepatic T lymphocytes 23. Wedemeyer H, He XS, Nascimbeni M, et al. during chronic hepatitis C.Hepatology ; 38: 829- (2002): Impaired effector function of hepatitis C 841. virus-specific CD8+ T cells in chronic hepatitis C 13. Nascimbeni M, Pol S, Saunier B. (2011): Distinct virus infection. J Immunol 169: 3447-3458. CD4+CD8+ Double-Positive T Cells in the Blood

2/2/2013

2989

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Analysis of constraints faced by small scale broiler famers in Capricorn district in Limpopo province

Ntuli Vusi and Oladele O.I

Deaprtment of Agricultural Economics and Extension, North West University Mafikeng Campus Mmabatho 2735. [email protected]

Abstract: This paper examines constraints facing small scale broiler farmers face. in Capricorn district in Limpopo Province.Simple random sampling method was used by drawing from the hat to select farmers from the population based on the list of farmers in Capricorn District. From 10 selected villages in the district, 6 farmers were selected in each village to give a total sample size of 60. Data were collected through structured questionnaire on personal characteristics, production, marketing and financial constraints faced by small scale broiler farmers and .. analysed with SPSS (version 20), using frequency counts, percentages, and multiple regression. The study revealed that majority of the respondents are women, between 41 and 60 years, married, with secondary school level education having contact with extension agents, and have income of less than R50, 000 annually. Prominent constraints identified as affecting small scale broiler farmers include lack of access to credit, high interests rates, short repayment period, small stock size, , inadequate infrastructure and high feed costs, difficulty to access veterinary service, lack of biosecurity knowledge, long distance to the market, lack of storage facilities limited markets, unorganized market outlets and inability to participate in the high value markets. Significant determinants of marketing constraints were age (t = 2.243), religion (t = -2.381), frequency of extension contact (t = 2.154), type of extension agent (-1.699) broilers housing types (t = 2.273). Significant determinants of financial constraints were marital status (t = 1.937), Religion (t = -1.773), Type of extension agent (t = -1.86) and the number of years in broiler farming (-2.534) while Significant determinants of production constraints were labour sources (t = -2.084) and number of years in broiler farming (t = -2.286). These results imply that as labour sources increases production constraints decreases. However as the number of years in broiler farming increase the production constraints decreases. [Ntuli Vusi and Oladele O.I. Analysis of constraints faced by small scale broiler famers in Capricorn district in Limpopo province. Life Sci J 2013;10(1):2990-2996] (ISSN:1097-8135). http://www.lifesciencesite.com. 366

Keywords: broiler production, small-scale farmers, , marketing constraints financial constraints

Introduction South Africa include chickens, guinea fowls, turkeys, Agriculture plays a major role in South Africa. pigeons and ostriches. According to DAFF (2011) primary agriculture Broiler chicken production is an important contributed about 3% to South Africa’s gross domestic source of income and employment. Meat from broiler product (GDP) and about 7% to formal employment. chickens has become an important dietary component South Africa is divided into a number of farming of most people in South Africa. Chicken meat is an regions according to climate, natural vegetation, soil important source of high quality protein, is easily type and farming practices. Agricultural activities digested and contains all essential amino acids. It is include intensive crop production and mixed farming also an excellent source of vitamin A, thiamin, in winter rainfall and high summer rainfall areas to riboflavin and niacin; it is also an very important as a cattle ranches in the bushveld and sheep farming in ruminant feed and manure used in crop production more arid regions. South Africa’s agricultural (Robert, 1992). According to STAT SA (2009) North economy is dualistic; the highly capitalized West Province was the leading poultry producer as it commercial sector co-exists with a traditional which is produced 25% of the entire broiler meat in South characterized by low-technology small scale sector. Africa followed by Western Cape by 21%, Agriculture in South Africa is also characterized by Mpumalanga 18% and KwaZulu–Natal 15%. Limpopo unequal distribution of land, economic assets, support and Northern Cape were the least producers, services, market access, infrastructure and income producing 1% each of South African broiler meat. among the commercial and small scale farmers (DAFF According to Pedersen (1998) Broiler production 2011). Although South Africa is a country which is seems to be a much-preferred alternative of food secured when it comes to all major agricultural development in community based projects and products; exports growth rate has been slower than emerging or small scale farmers have shown keen that of imports. Major agricultural import products interest. This is because broiler production requires include wheat, rice, vegetable oils and poultry meat. less space than ruminants and is ready for human The type of poultry (broiler) commonly reared in consumption within a very short period of time.

2990

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Poultry production provides a constant source of method was used by drawing from the hat to select income and with huge customer demand. Poultry farmers from the population based on the list of production can play an important role in poverty farmers in Capricorn District. This method of selection alleviation and in the supply of quality protein to rural will give all small scale broiler farmers an equal people. opportunity of being selected. From 10 selected Many countries have initiated programs aimed at villages in the district, 6 farmers were selected in each improving small-scale poultry as a means of helping to village to give a total sample size of 60 small scale bring socio- economic benefits to rural communities farmers that were be used for this study. Data for the (Tyson 1995). Not much research or if any has been study was collected from primary sources. The conducted regarding the constraints facing small scale questionnaire had two sections, the first section had broiler farmers in Capricorn district. Broiler questions on personal characteristics of farmers (age, production seems to be a much-preferred alternative of sex, educational level, income range, number of development in community based projects and dependents and numbers of years in farming) and the emerging or small scale farmers have shown keen second section had questions on constraints faced by interest (Pedersen 1998). It is vital to analyze the small scale broiler farmers. Questionnaires were constraints small scale broiler farmers face so that administered personally by the researcher. Data was there could be some solutions to the problems they sorted, coded and analysed with SPSS (version 20), face and that they could develop to be commercial using frequency counts, percentages, to describe the farmers. South Africa as a country is unable to supply data and multiple regression were used to isolate enough poultry meat to satisfy the domestic market, determinants of constraints facing small scale broiler due to that reason South Africa end up becoming a net farmers. importer of broiler meat from countries such as Table 1 Personal and farm characteristics of small Argentina, Brazil, Canada and United States. There scale broiler farmers were concerns of dumping (poultry produced at a very Variables Frequencies Percentages low cost than it is produced locally) from countries Sex Female 35 58.3 such as Brazil in which South Africa is importing Male 25 41.7 poultry from, which posed a serious threat to local Marital status producers especially small scale farmers. The Single 10 16.7 Married 37 61.7 objective of the paper was to identify and analyze the Widowed 10 16.7 constraints faced by small scale broiler farmers in Divorced 3 5 Capricorn district. Specific objectives include Age identification of the demographic characteristics and 20-30 8 31-40 20.6 analysis of the financial, marketing and production 41-50 31.7 constraints facing small scale broiler farmers 51-60 31.7 Methodology Greater than 60 8 The study was carried out in Capricorn District Size of the household 1-5 23 38.3 of Limpopo Province. Capricorn district is one of the 6 6-10 37 61.7 districts of Limpopo province of South Africa. The Educational level district shares borders with four district municipalities Primary school 11 18.3 namely; Mopani (east), Sekhukhune (south), Vhembe Secondary school 22 36.7 High school 12 20 (north) and Waterberg (west). Capricorn District College 9 15 Municipality (CDM) is the economic hub and includes University 6 10 the capital, Polokwane. Nearly 44% of the populations Contact extension agents of CDM live in Polokwane, one of the fastest growing Yes 30 50 No 30 50 municipalities in the country. Daily temperatures vary Labour Sources from mid-20's to mid-30's with an average range of Self 14 23.3 between 17° and 27°C in the summer and 4° to 20°C Family 26 43.3 in the winter. The total area of the Capricorn District Hired 20 33.3 2 Broilers housing system Municipality is approximately 21,705 km . with Battery cage 2 3.3 coordinates of 23.8833° S, 29.4333° E. Own built structure 58 96.7 The population of this study was all small scale Level of income (R) broiler farmers in Capricorn District of the Limpopo Less than 50 000 49 81.7 51 000- 100 000 8 13.3 Province. Kirsten and Zyl (1998) defined small scale Above 100 000 3 5 farmers as farmers whose scale is too small to attract Membership of cooperatives the provision of services they need to significantly Yes 30 increase their productivity. Simple random sampling No 70

2991

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

RESULTS farmers, Table 4, the production constraint distribution The results in Table 1 presents the personal and of the small scale broiler farmers and Table 5 the farm characteristics of small scale broiler farmers, multiple regression analysis of socio-economic Table 2 shows financial constraints distribution faced characteristics and marketing, financial and production by small scale broiler farmers, Table 3 the marketing constraints facing small scale broiler farmers. constraint distribution faced by small scale broiler

Table 2: Financial constraints distribution faced by small scale broiler farmers Constraints The constraints faced by the farmers Severity Yes No Severe Moderate Low Low level of income 47(78.3)* 13(21.7) 9(15) 36(60) 2(3.3) Failure to provide collateral(s) 48(80) 12(20) 28(46.7) 20(33.3) - Waiting a long period before getting financial assistance or for the loan to 47(78.3) 13(21.7) 19(31.7) 27(45) 2(3.3) be approved. A lot of forms to fill in 41(68.3) 19(31.7) 15(25) 10(16.7) 14(23.3) Travelling cost to get to the financial institutions 53(88.3) 7(11.7) 28(46.7) 23(38.3) 2(3.3) Ambiguous terms and conditions 31(51.7) 29(48.3) 11(18.3) 15(25) 6(10) Lack of awareness about government sources of financial help 27(45) 33(55) 13(21.7) 10(16.7) 4(6.7) Lack of access to credit or loan 49(81.7) 11(18.3) 15(25) 31(51.7) 3(5) High interest on repayment 53(88.3) 7(11.7) 21(35) 32(53.5) - Lack of information about sources of finance. 39(65) 21(35) 6(10) 31(51.7) 3(5) High transaction costs (withdrawal) 50(83.3) 10(16.7) 18(30) 31(51.7) 1(1.7) Poor liquidity or inability to meet short term financial obligations 13(21.7) 47(78.3) 1(1.7) 8(13.3) 3(5) Amount loaned out does not make provision for consumption 25(41.7) 35(58.3) 17(28.3) 8(13.3) - Inability to repay the loan 3(5) 57(95) 1(1.7) 3(5) - Inability to continue saving 9(15) 51(85) 4(6.7) 2(3.3) 1(1.7) Not getting assistance in the language you fully understand 33(55) 27(45) 7(11.7) 17(28.3) 10(16.7) Inability to manage funds 7(11.7) 53(88.3) 5(8.3) - 1(1.7) Customers buying chickens on credit and not paying as they promised. 59(98.3) 1(1.7) 15(25) 36(60) 8(13.3) Small loan amount 52(86.7) 8(13.3) 40(66.7) 11(18.3) 1(1.7) Short repayment period 55(91.7) 5(8.3) 9(15) 44(73.3) 1(1.7) Small stock size 57(95) 3(5) 46(76.7) 7(11.7) 4(6.7) Lack of record keeping skills 45(75) 15(25) 30(50) 17(28.3) - Lack of financial management skills 23(38.3) 37(61.7) 4(6.7) 12(20) 10(16.7) *Figures in parentheses are percentages

Table 3: Marketing constraint distribution faced by small scale broiler farmers Constraints Constraints faced by farmers Severity

Yes No Severe Moderate Low No direct linkages with the consumers 3(5)* 57(95) 3(5) - - Not getting expected prices in the market 59(98.3) 1(1.7) 30(50) 29(48.3) - Not getting the chance to understand consumer’s behaviour 33(55) 27(45) 20(33.3) 12(20) - Not having enough storage facilities for your broilers 56(93.3) 4(6.7) 52(86.7) 1(1.7) 2(3.3) Not foreseeing the supply and demand situation in the market 54(90) 6(10) 12(20) 41(68.3) 1(1.7) Long distance to the market (consumers) 54(90) 6(10) 27(45) 25(41.7) 2(3.3) Too many competitors 44(73.3) 16(26.7) 6(10) 25(41.7) 14(23.3) Difficulties in selling products or lack of marketing strategies for your broilers 41(68.3) 19(31.7) 3(5) 35(58.3) 3(5) Lengthened or long broiler rearing periods 10(16.7) 50(83.3) 4(6.7) 4(6.7) 1(1.7) Lack of farmer cooperatives to fall under 39(65) 21(35) 32(53) 3(5) - Improper pricing of commodities (Broilers) or low selling price 56(93.3) 4(6.7) 6(10) 48(80) 1(1.7) Inability to participate in the high value and reliable market 55(91.7) 5(8.3) 50(83.3) 2(3.3) 1(1.7) Selling poor quality broilers 7(11.7) 53(88.3) 1(1.7) - 3(5) Lack of knowledge of quality parameters and standards. 13(21.7) 47(78.3) 11(18.3) 1(1.7) 1(1.7) Limited knowledge and use of market information 51(85) 9(15) 20(33.3) 24(40) 7(11.7) Limited market outlets 53(88.3) 7(11.7) 47(78.3) 6(10) - Limited customers 49(81.7) 11(18.3) 8(13.3) 40(66.7) 1(1.7) Monopoly by commercial farmers 11(18.3) 49(81.7) 5(8.3) 6(10) - Unorganised market 53(88.3) 7(11.7) 48(80) 3(5) 2(3.3) Products(broilers) perceived low standard or poor quality products 52(86.7) 8(13.3) 4(6.7) 45(75) 3(5) Poor packaging 24(40) 36(60) 8(13.3) 14(23.3) 2(3.3) *Figures in parentheses are percentages

Table 4: Production constraint distribution of the small scale broiler farmers Constraints Constraints faced by farmers Severity Yes No Severe Moderate Low Predation e.g. by dogs 33(55)* 27(45) - 20(33.3) 13(21.7) Diseases e.g. Newcastle, fowl pox and chronic respiratory disease. 52(86.7) 8(13.3) 4(6.7) 28(46.7) 20(33.3)

2992

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Lack of access to veterinary services 49(81.7) 11(18.3) 40(66.7) 7(11.7) 2(3.3) Lack of access to extension services 34(56.7) 26(43.3) 25(41.7) 3(5) 6(10) Feed limiting you from increasing the number of your birds( broiler) 45(75) 15(25) 14(23.3) 29(48.3) 2(3.3) High electricity costs 31(51.7) 29(48.3) 3(5) 25(41.7) 3(5) Poor water supply 1(1.7) 59(98.3) - - 1(1.7) Low quality feeds - 60(100) - - - Theft 44(73.3) 16(26.7) 3(5) 27(45) 14(23.3) Lack of capital 51(85) 9(15) 19(31.7) 32(53.3) 1(1.7) High feed costs 60(100) - 31(51.7) 29(48.3) - Lack of labour 36(60) 24(40) 17(28.3) 16(26.7) 3(5) Small land holding 39(65) 21(35) 32(53.3) 5(8.3) 1(1.7) Lack of infrastructure i.e. battery cage system 50(83.3) 10(16.7) 46(76.7) 2(3.3) - Unfavourable weather conditions 16(26.7) 44(73.3) 1(1.7) 7(11.7) 8(13.3) Consumption of chickens by your family without paying or house hold consumption 57(95) 3(5) 11(18.3) 37(61.7) 9(15) Poor management ability 30(50) 30(50) 5(8.3) 9(15) 19(31.7) Lack of biosecurity knowledge 48(80) 12(20) 18(30) 28(46.7) 2(3.3) *Figures in parentheses are percentages

Table 5: Multiple regression analysis of socio-economic characteristics and marketing, financial and production constraints facing small scale broiler farmers Marketing constraints Financial constraints Production constraints Constant 29.104(.448) 58.188(.188) 61.089(.065) Gender 2.369(.374) 2.891(.344) .895(.691) Age 3.205(.030)** .632(.702) -.714(.559) Marital status -1.740(.413) 4.667(.059)* .178(.921) Race -31.107(.430) -18.816(.676) -26.365(.430) Religion -2.320(.022)** -1.980(.083)* -.423(.612) Household size -.362(.610) .327(.687) .291(.716) Educational level -.822(.546) -.840(.590) -.714(.537) Membership of farmers’ group -5.154(.144) -4.782(.234) -1.861(.529) Extension Contact -1.857(.795) -7.181(.381) -7.236(.235) Frequency of extension contact 6.259(.037)** 4.773(.159) .535(.829) extension agent affliation -6.639(.096)* -8.324(.070)* -2.239(.503) Number of workers .926(.307) .262(.800) .474(.536) Labour sources 1.705(.442) -1.029(.685) 3.882(.043)** Income 3.428E-05(.646) 5.297E-05(.536) 5.165E-005(.415) Farming experience -1.256(.144) -2.452(.015)** -1.638(.027)** Broilers housing types 34.729(.028)** 22.042(.215) 15.507(.238) R .719 .724 .700 R square .517 .525 .489 F 2.882 2.966 2.575 Sig .003 .002 .007 Durbin-Watson 2.200 1.640 1.78 *Figures in parentheses are significant Significant at 10%*, Significant at 5%**, Significant at 1%***

DISCUSSION which accounts for 20%. This might be due fact that The results revealed that there were more women young people such as those under 20 years of age are (58.3%) than men (41.7%) as shown in Table 1 this not interested in agriculture or who would like to might be resulting from the fact that there are more pursue careers in agriculture as they regard agriculture women in the district and most women in rural areas as dirty work. rely on agriculture to provide for their families Table 1 further indicates that 61.7% of the Mutangadura (2005) also reported that small–scale respondent had household size of 6 to 10 persons, farmers the majority of whom are women, play a major while only 38.3% had 1 to 5. About 37% of the role in providing food for everyone in the family. Table respondents made had secondary school education 1 also indicates that 61.7% of the respondents were while only 25% had tertiary education. The role of married while 5% were divorced. As there are more extension officers is to provide information to farmers married people there would not be a need to outsource with information on how efficiently farmers can utilize labor as the family members could help in the their resources to produce at optimum, from the results operation of the farm enterprise. Oladele (2011) noted 50% of the farmers had contact with extension officers; that the high percentage of married farmers depend on out of which, 31.7% had contact with extension family labor. The results in Table 1 shows that majority occasionally. 50% of the farmers did not have contact of small scale broiler farmers in Capricorn district are with the extension officers. However, . 43.3% of the aged between 41 to 50 and 51 to 60 which with 31.7% extension officers were from government, 6.7% were respectively. This is followed by 31-40 age group from nongovernmental organizations and only 1.7%

2993

Life Science Journal 2013;10(1) http://www.lifesciencesite.com were from parastatals. Table 1 indicates that 91.7% of assurance whether they will be able to repay the loan the farmers had between 1 and 5 farm labor of which back. Low level of income disables farmers to about 43.3% of it was family labor, this might be due potentially meet their financial obligations which to the fact that the enterprises of most small scale eventually decrease their chances to access credit in farmers are not large to an extent at which they could financial institutions. Even though some farmers may be required to hire labor due to shortage of labor in the have access to finance (18.3%), the loan provided is farm, low profits also could also contribute as labor small to enable them achieve their objectives this is must be paid for the work they do. evident by Moreki (1997) who reported that lack of Table 1 further shows that about 96.7% of the access to credit hampers growth of broiler enterprises respondents use their own built structures to house since small-scale farmers lack access to credit for their boilers this could be due to the reason that battery transportation, purchase of feeds and birds. In terms of cages for housing chickens are expensive to construct record keeping, 75% of the respondents highlighted Durga et al. (2009) reported that farmers inadequate that they do not keep records which is very essential in knowledge of low cost scientific cage construction was agriculture as it helps farmers to keep in track of perceived as the most serious problem. About 82% of everything that is happening within the business. Small the small scale broiler farmers get an income of less sock size was one of the constraints the farmers than R50 000 annually which is about R4166 per indicated about 95% of the respondents indicated that month while only 5% of the respondents get an income that they are encountering this constraint at a severity above 100 000 annually. Moreki (1997) reported that rate of 76.7%. low level of income limits the growth of broiler Table 2 further indicate that about 88.3% of the enterprises. Since small scale farmers have to meet respondents have cover long distance to get to financial some financial obligations such as such as buying feeds, institutions as the financial institutions are not located electricity costs, veterinary services, pay for labor and where the farmers are situated and 46.7% are severely take care of family related obligations, with such small experiencing this constraint while 78.3% of the income generated it will not be easy for them to expand respondents have to wait long periods before getting their enterprises and become commercial farmers. The financial assistance or for their loans to be approved. level of income generated will depend on factors such About 91.7% indicated that the amount is small and as quality of production, products produced and the 86.7% of the respondents say the repayment period is types of farm activities (StatsSa, 2002). short. High transaction costs is another constraint From the results, 30% of the respondents who are which 83.3% of the respondents experienced. Banks members of cooperatives while 70% of the respondents charge users for withdrawals and deposits services, are not members of cooperatives. According to banks generate income from these costs (Botha et al., Ortmann, & King, . (2007) cooperatives provide 2009). smallholder farmers big benefits such as bargaining From Table 3 the results indicate that 95% of the power and resource sharing that lead to food security respondents have a direct linkage with consumers and and poverty reduction. Since 70% of the respondents 98.3% of the respondents do not get the prices they are are not members of farmer’s cooperatives they receive expecting in the market and this is considered as a the benefits such as bargaining power which are severe constraint. Abedullah (2007) reported that enjoyed by farmers under cooperatives. marketing system still remained in traditional and The results in Table 2 indicate that 78.3% of the heterogeneous condition in broiler farming, as a result, respondents experiences low level of income as a producers could not develop direct linkages with the constraint and 60% of the respondents experiences the consumers. About 88 % of the respondents indicated constraint moderately this findings agrees with the that there are limited market outlets, 88.3% of the findings by Christensen (1993) who reported that small respondents indicated that the markets were scale broiler farmers had poor liquidity due to low cash unorganised which implies that broiler farmers sell income and had limited access to credit and savings anywhere and at whatever price they desire. Almost 89% facilities, hence 80% of the respondents fail to provide of the respondents feel their customers perceive their collaterals to financial institutions to pledge as security products as poor or of low quality this might be due to for repayment of a loan and 46.7% of them experiences the fact that a small scale farmer might be lacking this constraint severely. About 98% of the respondents infrastructure for handling the broilers Okantah et al., indicated that customers are buying chickens on credit (2003) reported that most farmers had limited and not paying as they promised and 60% of the knowledge or access to ration formulations. Selling at respondents are affected by this constraint moderately low prices was reported by 93.3% of the respondents . which could lead to low level of income which affects Antwi (2011) who reported that the underlying reason the respondents negatively. Financial institutions for the inability of small scale farmers to participate in cannot risk giving out loans to farmers they don’t have high value markets may be due to their small sizes of

2994

Life Science Journal 2013;10(1) http://www.lifesciencesite.com production. About 93.3% of the respondents indicated management skills were highlighted by 50% of the that they do not have enough storage facilities for their respondents. broilers Abedullah (2007) reported that farmers cannot Marketing constraints: The results of multiple take the risk of keeping the broilers after the regression analysis of relationships between recommended growth period because after that period demographic characteristics and the marketing cost of production increases rapidly than the weight constraints faced by small scale broiler farmers is gain of bird. Also, 90% of the respondents further presented in table 5, the dependent variable with an F indicated that their customers are far which means value of 2.882, P<.05. Also an R value of 0.719 farmers have to travel long distances to reach their showed that there was a strong correlation between the customers. independent variables and marketing constraints. The From Table 4 the results show that most of the results further predicted 51.7% of variation in the respondents about 55% and 73.3% highlighted marketing constraints. Five out of 16 independent predation by dogs and theft as problems respectively. variables were significant, four variables being Predation by dogs is one of the highest constraint under significant at five percent and one being significant at production, experienced by the respondents which is in 10 percent. Significant determinants of marketing line with the findings by Pedersen (2000) reported that constraints were age (t = 2.243), religion (t = -2.381), the major cause of mortality was predation by dogs . frequency of extension contact (t = 2.154), type of Also, 88.3% of the respondents highlighted that they extension agent (-1.699) broilers housing types (t = do not have battery cages for their broilers, Durga et al 2.273). These results imply that the higher the age of (2009) also reported that problems of predators was the farmers, contact with extension agent and the type perceived as the most serious one. Poultry farming of housing for the broilers the better the marketing predator problem is unavoidable unless and until the constraints. However as religion and the type of system is at least partially modernized introducing extension agent increases the marketing constraints scientific housing and providing protection in terms of decline. proper enclosures especially for chicks the author Financial constraint: The results of multiple further elaborated that in the absence of such physical regression analysis of relationships between protection, predator problem would abound resulting in demographic characteristics and the financial loss of chicks and birds. Lack of capital was indicated constraints faced by small scale broiler farmers is by 85 % of the respondents which is consistent to the presented in table 5, the dependent variable with an F findings of Veerabhadraiah (2000) who reported value of 2.966, P<.05. Also an R value of 0.724 inadequate capital as a problem encountered by small showed that there was a strong correlation between the scale broiler farmers. independent variables and financial constraints. The Diseases such as Newcastle, fowl pox and chronic results further predicted 52.5% of variation in the respiratory which affects broilers were highlighted by financial constraints. Four out of 16 independent 86.7% of the respondents as a major constraint Poor variables were significant, one variable being access to veterinary services was highlighted by 81.7% significant at five percent and four variables being of the respondents. Ugwu (2009) reported that the significant at 10 percent. Significant determinants of common diseases prevalent in poultry, farms raising financial constraints were marital status (t = 1.937), broilers/cockerels are the Newcastle, fowl pox and Religion (t = -1.773), Type of extension agent (t = - chronic respiratory disease, while Moreki’s (1997) 1.86) and the number of years in broiler farming (- indicated that a rise in diseases affecting poultry 2.534).. contributes to low profit margins. Similarly, 80% of the Production constraint: The results of multiple respondents indicated that they were not aware of regression analysis of relationships between biosecurity measures which mean the broilers could demographic characteristics and the production easily get diseases from contaminated water or feeds constraints faced by small scale broiler farmers is and even from the people who handled them which presented in table 5, the dependent variable with an F might be the reason behind the vulnerability of the value of 2.58, P<.05. Also an R value of 0.489 shows a respondents’ broilers being susceptible to diseases. weak to moderate correlation between the independent Also, 75% of the respondents indicated that cost of variables and production constraints. The results feeds were limiting them from increasing the number further predicted 48.9% of variation in the production of their broilers which might be due to the fact that constraints. Two out of 16 independent variables were (100%) all of the respondents indicated that the costs of significant, the two variables being significant at five feeds are high this might be one of the contributing percent. Significant determinants of production reasons as to why the respondents are unable to constraints were labour sources (t = -2.084) and increase the number of their broilers as they wish. Poor number of years in broiler farming (t = -2.286). These results imply that as labour sources increases

2995

Life Science Journal 2013;10(1) http://www.lifesciencesite.com production constraints decreases. However as the 10. Durgga R V. and Subhadra M.R. 2009: Problems number of years in broiler farming increase the related to farm operations in poultry farming as production constraints decreases. perceived by farm women. Veterinary World, Vol.2(5): The study revealed that among small-scale broiler 191-192 11. http://www.gcis.gov.za/resource_centre/sa_info/pocket farmers in the study area there are more women than guide/2010/014_agriculture_forestry_and_fisheries.pdf men majority aged between 41 and 50 and 51 and 60 Accessed on the 9th of April 2012. respectively, married with secondary school level 12. Kirsten, J. F., & van Zyl, J. 1998. Definition of small education having contact with extension agents, and scale farmers in the South African context. South have income of less than R50, 000 annually. Prominent Africa. Agrekon, Vol 37, No 4:555. constraints identified as affecting small scale broiler 13. Moreki J. 1997. Small-scale poultry production system farmers include lack of access to credit, high interests in Serowe-Palapye sub-district (Botswana). A thesis rates, short repayment period, small stock size, broilers submitted for the Degree of Master of Applied Science bought on credit and not re-paid as promised, in Agriculture; Longerenong College, Institute of Land and Food and Resources, University of Melbourne. inadequate infrastructure such as battery cage, and high 14. Mushi, E.Z., M.G. Binta, G. R. Chabo, R.T.Ndebele, feed costs, difficulty to access veterinary service, lack and T.Ramathodi , 2000. Diseases and management of of biosecurity knowledge, long distance to the market, indigenous chickens in Oodi, Kagatlenga, district lack of storage facilities limited markets, unorganized Botswana. World‟s poult. Sci., 56:153-157 market outlets and inability to participate in the high 15. Mutangadura, G. B. “Gender, HIV/AID and Rural value markets. Livelihoods in Southern Africa: Addressing Challenges”. A Journal of Culture and African Women Corresponding Author Studies. Issue 7, 2005. Africa Resource Center, Inc. Oladele O. I. 16. Mwalusanya, N.A, Katule A. M, Mutayoba, S. K, Mtambo ,M .M. A, Olsen, J. E, and Minga, U M., 2002. Department of Agricultural Economics and Extension, Productivity of local chickens under village North-West University, Mafikeng Campus, South management conditions. Tropical Animal Health and Africa. E-mail: [email protected], Production 34:405- 416 17. Okantah S.A, P.A.T Aboe ', K. Boa-Amponsem, P.T. References Dorward- and M.J. Bryant- 2003 Small-scale poultry 1. Abedullah, A. M and K. Bukhsh 2007 Issues and production in peri-urban areas in Ghana Research Economics Of Poultry Production: A Case Study Of project report for United Kingdom Department for Faisalabad, Pakistan. Pakistan Vet. J.,27(1): 25-28. International Development (DFID) DFID. R7631, 2. Amudha, S. and Veerabhadraiah, V. 2000: Women in 18. Oladele O.I 2011 Contribution of Indigenous commercial poultry. Kurukshetra 48(9): 36-40. Vegetables and Fruits to Poverty Alleviation in Oyo 3. Antwi M and P. Seahlodi 2011 Marketing Constraints State, Nigeria. J Hum Ecol, 34(1): 1-6 Facing Emerging Small-Scale Pig Farmers in Gauteng 19. Ortmann, G.F. & King, P. (2007). Agricultural Province, South Africa. J Hum Ecol, 36(1): 37-42 Cooperatives I: History, Theory and Problems. 4. Botha Z, Van Zyl C, Skirrite I, Goodspeed I 2009. Agrekon, 46, 40-68. Understanding South African Financial Markets. 3rd 20. Pedersen, C.V., 2002. Farmer-Driven Research On Edition. Paarl, Cape Town: Van Schaik Publishers. Village Chicken Production In Sanyati, Zimbabwe Paarl, Cape Town. http://www-naweb.iaea.org/nafa/aph/public/18-farmer- 5. Botha, Z., Van Zyl, C., Skirrite, I. & Goodspeed, I. pedersen.pdf. Accessed on the 9th of April 2012 2009. Understanding South African Financial markets. 21. Tyson, J. 1995. Cases of ventilation problems in South 3rd edition, Van Schaik publishers. Paarl, pp 73-100 Africa. Poultry Bulletin, October: 459- 460. 6. Christensen, G, 1993. The limits to informal financial 22. Ugwu DS 2009: Baseline Study of Small and Medium intermediation. World Development, 21(5): 721–31. Scale Poultry Production in Enugu and Lagos States of 7. DAFF 2011 A Profile of the South African Broiler Nigeria. World Journal of Agricultural Sciences 5 (1): Market Value Chain 27-33. http://www.nda.agric.za/docs/AMCP/BroilerMVCP11- 23. van Ryssen, J.B.J 2001 Poultry litter as a feedstuff for 12.pdf Accessed on the 9th of April 2012. ruminants: A South African scene SA-ANIM SCI 8. DAFF 2011, Report on Agriculture, fprestry and 2001,vol2:http://www.sasas.co.za/Popular/Popular.html Fisheries in South Africa. 1 Accessed on the April, 9, 2012. 9. DAFF, (2009). 2010 Abstract of Agricultural Statistics. Directorate: Statistics, Department of Agriculture, Fisheries and Forestry.

2/2/2013

2996

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Factors influencing farmers’ attitude towards formal and informal Financial Markets in the Northern Cape, South Africa

Ward, L and Oladele O.I.

Deaprtment of Agricultural Economics and Extension, North West University Mafikeng Campus Mmabatho 2735. [email protected]

ABSTRACT: This study examines factors influencing farmers’ attitude towards formal and informal Financial Markets in the Northern Cape, South Africa. From each of the two districts selected, 80 farmers were randomly selected to give a sample size of 160, however seven questionnaires were discarded after it was discovered that only half of their questionnaires were properly filled, thus giving 153. A questionnaire was developed based on the objectives of the study to collect data on demographic details, farming experience, marital status, education level, ethnic group, land ownership, access to credit from commercial banks, credit worthiness, distance to credit institutions, collateral, formal and informal credit, characteristics of informal financial markets. Data collected were subjected to analysis with SPSS version 20 using frequency counts, percentages and Multiple regression analysis (OLS). Majority of the farmers (70.6%) have been farming for more than five years, between 51 and 65 years of age (54.9%), 77.8% are men. Most of the respondents (73.9%) use communal land to farm, with only 11.8% owning it, while some rent this land from the government (14.4%). Prominent constraints are stringent collateral requirements (86.3%), distant financial markets from farmers (80.4%), and high transaction costs (65.4%). The most prominent attitudinal statement as ranked by the farmers were more responsiveness to the needs of emerging farmers (88.9%) loans provided are too low(93.5%), and services are not sustainable (91.5%). The socio-economic characteristics were significantly related to attitude towards formal financial markets (F-value of 3.642, p<0.05) with five significant variables namely farming experience (t=2.41), land ownership (t=3.86) and type of dwelling (t=2.50), education level (t=1.71) and ethnic group (t=-1.71). [Ward, L and Oladele O.I. Factors influencing farmers’ attitude towards formal and informal Financial Markets in the Northern Cape, South Africa. Life Sci J 2013;10(1):2997-3001] (ISSN:1097-8135). http://www.lifesciencesite.com. 367

Keywords: Formal Credit markets, informal credit markets, national credit act, commercial banks.

Introduction through formal credit markets. Some communities Finance in agriculture plays a very significant role depend largely on the financial support of other family in generating enough capital for farmers, particularly members as an informal way of ensuring their access to the poor ones who find it hard to secure or access the credit to keep their small business up and running. The funds from the commercial banks that are less interested Northern Cape remains one of the Provinces that are too in small farmers due to their risk management policies. rural and less developed, where the majority of people It is for this reason that government deemed it fit to live in abject poverty. The level of unemployment in appoint a Strauss Commission to dissect the credit this Province is just as high as that of literacy, and the market with a view to identify loopholes and main majority of dwellers in these rural areas depend largely reasons why the credit market behaved the way it did. on agriculture as their source of income. Agriculture is According to Coetzee (1998), the Commission led to therefore regarded as the backbone of the Province the creation of government structures whose aim was to since the mining sector does not employ too many introduce policies and strategies in an effort to support people when the number of people who take up jobs small entrepreneurs and also restructure the existing and contribute to economic growth and development are credit institutions. Microfinance programmes were then considered. introduced by government to try and absorb some of the South Africa’s pro-poor micro financial risks that these institutions were exposed to. This institutions are based mainly in rural areas, but their included amongst others, the establishment of the Khula clients are not agricultural microenterprises due to the Enterprise under the auspices of the Department of fact that the country has few small-scale cash farmers Trade and Industry (DTI). Micro Agricultural Financial (Baumann, 2001). Agriculture’s contribution to the Institution of South Africa (MAFISA) was also Gross Domestic Products (GDP) is decreasing at an introduced by the then Department of Agriculture, and alarming rate, and more needs to be done to curb this. now known as the Department of Agriculture (DOA), This can only be achieved by ensuring that farmers Forestry and Fisheries (DAFF) in an effort to address enjoy the support they deserve from both the state and the challenges farmers were faced with in relation to the private sector on the provision of cheaper credit at lack of access to credit. MAFISA was launched in the all times, including Non-Governmental Organisations Northern Cape in 2007, and this credit policy’s main (NGO’s). The availability of credit in rural areas objective is to take credit to farmers and agribusinesses remains a serious challenge facing farmers, particularly to the far flung and deep rural areas where it is almost the emerging ones. Commercial banks are less impossible for such business people to access credit interested in lending their scarce resources to people in

2997 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

areas where transaction costs are extremely high. Gaetsewe and Pixley Ka Seme) of the five Districts of Government has been trying to encourage these the Province. Northern Cape is the biggest Province in institutions to invest hugely in rural areas for the country in terms of land size, but the smallest in development to take place, but the private sector is only terms of population size. Almost all the Districts are interested in investing their resources where the levels described as rural and lack the basic infrastructure of risk are very low for them to realise their returns on required for development to be stimulated, especially investment. South Africa is characterised by a the John Taolo Gaetsewe which is the only district with concentration of poor people in rural areas where the villages while others are made up of small towns and standard of living is low due to the high numbers of townships. From each of the two districts selected, 80 illiterate people. South Africa’s retail banks evolved to farmers were randomly selected to give a sample size of serve the needs of the white population, and their 160, however seven questionnaires were discarded after geographical coverage, institutional structures, and it was discovered that only half of their questionnaires business practices developed accordingly. South were properly filled, thus giving 153. A questionnaire African banks are rooted in the British ‘high street’ was developed based on the objectives of the study to tradition, with small branch operations or agencies collect data on demographic details, farming experience, providing a personalized service. Many middle class marital status, education level, ethnic group, land retail-banking products have traditionally been cross- ownership, access to credit from commercial banks, subsidised by commercial banking operations credit worthiness, distance to credit institutions, (Baumann, 2001). The objective of this study is to collateral, formal and informal credit, characteristics of analyse the factors influencing farmers’ participation in informal financial markets. Data collected were formal and informal Financial Markets in the Northern subjected to analysis with SPSS version 20 using Cape, South Africa frequency counts, percentages and Multiple regression Methods analysis (OLS) . The Northern Cape lies in the North Western part Results of South Africa, bordering Namibia and Botswana. This The results in Table 1 shows distribution by is a relatively dry Province with temperatures personal characteristics, Table 2 presents constraints fluctuating from one region to another, and these facing farmers on formal financial institutions, Table 3 temperatures can reach 40 degree Celsius in summer. depicts attitude of farmers towards informal financial This mainly happens in the western regions of the markets and Table 4 presents multiple regression Province, i.e. the Upington area. The Province analysis showing relationship between socio-economic contributes 2.4% to the country’s GDP, and this poor characteristics and attitude towards formal and informal performance can be attributed to its (Province) rural financial markets. nature. The survey was conducted in two (John Taolo

Table 1: Distribution by personal characteristics (n=153) Variables Frequency Percentage Farming experience Less than 1 year 3 2.0 1-2 years 10 6.5 3-5 years 32 20.9 Over 5 years 108 70.6 Age Less than 18 years 0 0 18-50 years 55 35.9 51-65 years 84 54.9 Over 66 years 14 9.2 Gender Male 119 77.8 Female 34 22.2 Education level No formal education 27 17.6 Up to Grade 7 57 37.3 Grade 8-12 66 43.1 Post-Secondary 3 2.0 Land status Own 18 11.8 Rent 22 14.4 Communal land 113 73.9 Enterprise Large stock 108 70.6

2998 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Small stock 43 28.1 Vegetables 1 0.7 Other 1 0.7 Distances Less than 100 km 6 3.9 100-150 km 17 11.1 Over 150 km 89 58.2 Not sure 41 26.8 Institution Yes No Land Bank 64 (41.8) 89 (58.2) MAFISA 61 (39.9) 92 (60.1) Family 99 (64.7) 54 (35.3) Friends 70 (45.8) 83 (54.2) Loan Sharks 47 (30.7) 106 (69.3) Savings Clubs 8 (5.2) 145 (94.8) Figures in parentheses are percentages of the total sample

Table 2: Constraints facing farmers on Formal financial Institutions Constraints Yes No ______Stringent collateral requirements 132 (86.3) 21 (13.7) Blacks are not good farmers 68 (44.4) 85 (55.6) High transaction costs 100 (65.4) 53 (34.6) Distant Financial Markets from farmers 123 (80.4) 30 (19.6) Lack of Information 59 (38.6) 94 (61.4) Poor repayment abilities 100 (65.4) 53 (34.6) Poor record keeping 49 (32.0) 104 (68.0) Poor financial and farm management 48 (31.4) 105 (68.6)

Table 3 Attitude of farmers towards Informal Financial Markets Statements SA A D SD ______More responsiveness to the needs of emerging farmers 17 (11.1) 119 (77.8) 14 (9.2) 3 (2.0) Financial services are easily and readily available 18 (11.8) 87 (56.9) 38 (24.8) 10 (6.5) Transaction costs are very low 20 (13.1) 34 (22.2) 78 (51.0) 21 (13.7) Turn-around time short 5 (3.3) 25 (16.3) 56 (36.6) 67 (43.8) More information provided 4 (2.6) 47 (30.7) 91 (59.5) 11 (7.2) Contracts are easy to understand 3 (2.0) 68 (44.4) 61 (39.9) 21 (13.7) Collateral not regarded as the main requirement 1 (0.7) 22 (14.4) 45 (29.4) 85 (55.6) Agents are more friendly 6 (3.9) 23 (15.0) 86 (56.2) 38 (24.8) Interest rates charged are very low 7 (4.6) 51 (33.3) 95 (62.1) Repayment terms are more flexible 2 (1.3) 41 (26.8) 71 (46.4) 39 (25.5) Loans provided are too low 91 (59.5) 52 (34.0) 5 (3.3) 5 (3.3) Services are not sustainable 71 (46.4) 69 (45.1) 11 (7.2) 2 (1.3) Interest rates too high due to high 62 (40.5) 64 (41.8) 22 (14.4) 5 (3.3) transaction costs There are no guarantees that loans will 57 (37.3) 65 (42.5) 24 (15.7) 7 (4.6) be accessed Not much information is provided 12 (7.8) 65 (42.5) 72 (47.1) 4 (2.6) No business skills provided 9 (5.9) 77 (50.3) 60 (39.2) 7 (4.6) Almost all clients are bad payers 6 (3.9) 6 (3.9) 31 (20.3) 110 (71.9) Borrowers may decide not to repay 3 (2.0) 11 (7.2) 83 (54.2) 55 (35.9 Figures in parentheses are percentages, SA-Strongly Agree; A-Agree; D-Disagree; SD-Strongly Disagree

2999 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table 4: Multiple regression analysis showing relationship between socio-economic characteristics and attitude towards formal and informal financial markets Variables Attitude to formal financial market Attitude to informal financial market B(SE) B(SE) Constant 11.83( 3.78)* ** 23.95(3.22) *** Farming experience 1.21(0.50 ) ** 0.37( 0.42) Age 8.74E-02(0.66 ) 0.25( 0.56) Gender 0.302( 0.74) 0.50( 0.63) Marital status -0.255( 0.48) -0.40( 0.40) Educational level 0.766( 0.44) * 0.27( 0.38) Ethnic group -1.43( 0.83) * -0.15( 0.70) Land ownership 1.65( 0.42) *** -1.76( 0.36) *** Type of dwelling 1.21( 0.48) ** -0.15( 0.41) Type of enterprise 0.35( 0.58) 971E-02( 0.49) R 0.43 0.43 R square 0.19 0.18 F 3.64 3.46 p 0.00 0.01 * Significant at 10%; ** Significant at 5%; *** Significant at 1%

Discussion rent this land from the government (14.4%). The results Majority of the farmers (70.6%) have been in this on land ownership can be ascribed to the policies of the business for a period longer than five years. This bears apartheid system prior to 1994 which did not allow testimony to the fact that farming is mainly practiced by black people to own land or even occupy and use older people. The study therefore confirms the productive land which was reserved for white people. hypothesis maintained by other researchers that people The Native Land Act of 1912 is to blame for this venture into farming when they retire from urban areas. skewed land ownership South Africa finds itself under, The age distribution per age category shows that the and the land reform programme implemented after 1994 agricultural sector is dominated by elderly people who also failed to redistribute land to blacks as per the goals view the sector as a retirement destiny for them. The and objectives of the current administration. The majority of the respondents (54.9%) are between 51 and Northern Cape is known for its livestock production, 65 years of age, and this confirms the fact that the youth and almost all the respondents on this study farm with it, is not so much interested in agriculture. Table 1shows both small and large and large stock is the most that 77.8% of farmers are men in spite of all efforts by predominant enterprise, hence 70.6% are cattle farmers. government to introduce programmes tailored made for Small stock is produced in the District but less of it women to enter the agricultural mainstream such as (28.1%) is produced as opposed to large stock. The Women in Agriculture and Rural Development study reveals that 58.2% of respondents stay more than (WARD). A small number of respondents (22.2%) are 150 kilometres away of credit institutions, with only women whose role in agricultural development is high 3.9% staying within a radius of 100 kilometres from and not even recognised by the sector in general. Table such institutions. Table 1 categorises lending 1 further shows that the education level of farmers with institutions as preferred by farmers at various levels. post secondary qualifications remains extremely low Most of the respondents (58.8%) do not enjoy the (2%) in the farming community, and this could mainly services of commercial banks, with 41.2% saying they be due to the fact that the sector is dominated by older do borrow from such institutions. Borrowing from people. Although the number of those with grade 8-12 family (64.7%), friends (45.8%) and loan sharks (30.7%) is high (43.1%), most of them do not have matriculation are the most popular sources of informal credit that certificate. According to Jari (2009), people with higher farmers rely upon in times of need. Zeller et al (2002) educational levels are more able to interpret information asserts that informal borrowers are able to urgently much better than those who have less education or no finance their required expenditures quickly at fewer or education at all. Wangai (2011) also asserts that no transaction costs at all. According to Zeller (1994), educational level is found to be an important element the risk of loan recovery is at a minimal level since with a positive impact on a small scale entrepreneur’s lenders only lend their financial resources to those they demand for credit. Its strength’s impact is said to are close with or form part of their social network increase with educational attainment, suggesting that within which contracts can be enforced. Table 2 entrepreneurs with higher education level were more presents the constraints facing farmers on formal inclined to apply for external funds as opposed to those financial institutions. Out of the 8 listed constraints, with lower education level. prominent constraints are stringent collateral Most of the respondents (73.9%) use communal requirements (86.3%), distant financial markets from land to farm, with only 11.8% owning it, while some farmers (80.4%), and high transaction costs (65.4%).

3000 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table 3 shows a list of 30 attitudinal statements attitude towards informal financial markets, i.e. the towards informal financial markets The respondents improved education level will not necessarily change were asked to rate the statements using 5 Likert scale as farmers’ attitude insofar as the informal credit market is follows; 1 (strongly disagree), 2 (Disagree) 3(Uncertain) concerned. 4 (Agree) and 5 (Strongly agree). The actual mean is 3 due to the rating scale and a mean of greater than 3 Corresponding Author denoted a positive attitude while a mean less than 3 Oladele O. I. denoted negative attitude towards informal financial Department of Agricultural Economics and Extension, markets. The results revealed an overwhelming general North-West University, Mafikeng Campus, South positive attitude by farmers towards informal financial Africa. E-mail: [email protected], markets. . The most prominent attitudinal statement as ranked by the farmers were more responsiveness to the References needs of emerging farmers (88.9%) loans provided are 1. Baumann T 2001 Microfinance and Poverty too low(93.5%), and services are not sustainable Alleviation in South Africa. Bay Research and (91.5%). Conversely farmers were not favourably Consultancy Services disposed towards informal financial markets in terms of http://www.tanzaniagateway.org/docs/Microfinanc almost all clients are bad payers (91.9%), interest rates e_and_Poverty_Alleviation_in_South%20Africa% charged are very low (95.9%), collateral not regarded as 20_Baum.pdf accessed March 2012 the main requirement (84.6%) and turn-around time is 2. Coetzee, G.K. (1992). Review of Conference on short (81.4%). "Rural Development and Finance", University of Table 4 shows that the socio-economic Ouagadougou (Burkina Faso). Development characteristics were significantly related to attitude Southern Africa, Vol. 9, No. 1:89-104. towards formal financial markets (F-value of 3.642, 3. Jari B (2009) Institutional and technical factors p<0.05). Three independent variables were significant influencing Agricultural marketing channel at 5% on attitude towards formal financial markets, and choices amongst smallholder and emerging they were farming experience (t=2.41), land ownership farmers in the kat river valley. Master of Science (t=3.86) and type of dwelling (t=2.50). These findings in Agriculture (Agricultural Economics) thesis imply that the more experienced farmers become, the Department of Agricultural Economics and more they participate on formal financial markets. The Extension Faculty of Science and Agriculture better the type of houses and more land farmers own, University of Fort Hare Alice the more they participate in formal financial markets. 4. Messah O B and Wangai P N (2011) Factors that Two independent variables were significant at 10%, and Influence the Demand for Credit for Credit they are the education level (t=1.71) and the ethnic Among Small- Scale Investors: a case study of group (t=-1.71). This implies that as farmers become Meru Central District, Kenya Research Journal of more educated they actively participate on formal Finance and Accounting Vol 2, No 2, 2011 financial markets, but their ethnic group does not 5. Zeller, (1994), “Determinants of Credits Rationing: change their attitude towards formal financial markets. A study of informal lenders and formal credit The table further shows that one socio-economic groups in Madagascar”, Discussion Paper No.2. characteristic was related to attitude towards formal Washington, D.C.:IFPRI. financial markets (F value of 3.46, p<0.01). A 6. Zeller, M., M. Sharma, A. Ahmed, and S. Rashid. significant relationship at 5% was observed between 2002. Group-based financial institutions for the land ownership (-4.84) and attitude towards informal rural poor in Bangladesh: An institutional-and financial markets. This implies that as farmers own household-level analysis. Research report No. 120. more land their attitude turns towards informal financial Washington, D.C.: International Food Policy markets. This means that the other independent Research Institute. variables do not necessarily have a bearing on farmers’

2/12/2013

3001 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Topological and Singular Solitons of B(m, n) Equation with Generalized Evolution

Bouthina S. Ahmed1 and Anjan Biswas2, 3

1Department of Mathematics, College of Girls, Ain Shams University, P. O. Box.11566, Cairo, Egypt 2Department of Mathematical Sciences, Delaware State University, Dover, DE 19901-2277, USA 3Department of Mathematics, Faculty of Science King Abdul-Aziz University, Jeddah, Saudi Arabia [email protected], [email protected]

Abstract: This paper studies the B(m, n) equation with generalized evolution. The ansatz method is applied to extract the topological as well as singular soliton solutions to the equation. It will be observed that specific choice of pairs parameter values, both of these solitons will exist. This will lead to four exhaustive cases and all of these cases are analyzed for the existence of soliton solutions. [Bouthina S. Ahmed and Anjan Biswas. Topological and Singular Solitons of B(m, n) Equation with Generalized Evolution. Life Sci J 2013; 10(1):3002-3005]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 368

Keywords: Evolution equation, Integrability, Solitons.

1. Introduction equation, where, in particular, The Case l=m=n=1 The theory of nonlinear evolution equations leads to the Boussinesq equation. In this paper, the (NLEEs) has made a remarkable progress in the past general case for l > 1 will be studied. Incidentally, this few decades [1-10]. There has been an overwhelming equation, for the special case with l=1 was studied advancement that was observed, especially with before by many authors [6]. regards to the integrability aspect of these NLEEs. 2. Topological soliton solution These NLEEs appear in various areas of research. A We assume the soliton solution to be of the form few of them are fluid dynamics, nuclear physics, q( x , t )= A tanhp B ( x− vt ) (2) plasma physics and nonlinear optics. Recently there has been a need for NLEEs in the Area of biological where A, B are free parameters and v represents the sciences. There are several kinds of NLEEs that are velocity of the soliton. The exponent p will be determined as a function of l, m and n. studied in this area of research. The nonlinear Schrodinger’s equation describes the dynamics of Substituting (2) into (1) yields, solitons in alpha-helix proteins. A lot of results have 22l lp −+2 lp lp 2 been obtained and reported in this direction [2-7]. lpv A B{( lp − 1)tanhττ − 2lp tanh ++ ( lp 1)tanh τ Very recently, Boussinesq equation (BE) has gained a +ampAm B22{( mp − 1)tanhmp−+ττ − 2mp tanhmp ++ ( mp 1)tanhmp 2 τ } lot of importance in mathematical biology. The n 44np − coupled BE has been studied in the context of −bnpA B{( np −− 1)( np 2)( np − 3)tanh τ aneurysm [9]. Another area where BE with dual ++(np 1)( np + 2)( np + 3)tanhnp +−4ττ − 2(n 22 p + ( np − 2) 2 )( np − 1)tanhnp 2 nonlinearity is studied is neurosciences. The BE in this context describes the dynamics of solitons in −2(n22 p++ ( np 2) 2 )( np + 1)tanhnp +2τ biomembranes [3, 8]. Thus BE is gaining profound +(4n33 p +− ( np 1) 2 ( np −++ 2) ( np 1)2 ( np + 2)tanhnp τ } = 0 (3) popularity in the area of mathematical biosciences. Hence it is imperative to take a deeper look at generalized form of BE that will shed some light on The analysis of this equation will be split into the the applicable areas especially in the context of Life following four cases depending on the structure of the sciences. This form of BE is referred to as the B(m, n) equality of the exponents equation with generalized evolution. The B(m, n) 2.1. Case I: l= nmn, ≠ equation with generalized evolution term that is going In (3) equating the exponents of mp + 2 and to be studied in this paper is given by [2] + , we get np 4 lm n 2 (q )tt +− aq ( )xx bq ( ) xxxx = 0 (1) p = (4) Here, the first term is the generalized evolution term, mn− while the second term represents the nonlinear term Equating the coefficients of the function pairs mp +2 np +4 mp and the third term is the dispersion term. Also, tanh τ , tanh τ and tanh τ , + ab, ∈ R and are constants, while l, m and n ∈Z . np +2 tanh τ This equation is the generalized form of Boussinesq

3002 Life Science Journal 2013;10(1) http://www.lifesciencesite.com am( mp+− 1) Amn np ( np ++ 1)( np 2)( np + 3) A B 2 = 0 (5) 1 −4nv ln− +mm2 − 2 − 22 ++ 2 +n2 = A =  (13) n( np 1) A v 2 am A 2( n p ( np 2) )( np 1) A B 0 al()+ n (6) ln−− a Solving (5) and (6) leads B = (14) 1 22nb −+vm() n mn− which imposes ab<0 A = (7) 4an Thus the topological soliton solution of (1) is mn−− v B = (8) 2 22nb q( x , t )= A tanhln− B ( x− vt ) (15) Thus the solution of (1) is Figure 2 describes the topological 1- soliton solution 2 of qxt( ,) with the constants ab=1, = − 1 and the q( x , t )= A tanhmn− B ( x− vt ) (9) parameters m=2, nv = 1, = 0.3 Figure 1 describes the topological soliton solution of . qxt( ,) with the constants ab=1, = − 1 and the parameter values are m=2, nv = 1, = 0.3.

Figure 2: Topological 1-soliton solution with l=2, m=2, n=1, a=1, b=-1, v=0.3 Figure 1: Topological 1-soliton solution with m=2, n=1, a=1, b=-1, v=0.3 2.3. Case III: l= mm, ≠ n

2.2. Case II: l≠= nmn, In (3) equating the exponents of lp + 2 and In (3) equating the exponents of lp + 2 and np + 4 , yields 2 np + 4 , implies p = (16) 2 ln− p = (10) Equating the coefficients of the function pairs ln− lp +2 np +4 lp Equating the coefficients of the function pairs tanh τ , tanh τ and tanh τ , lp +2 np +4 lp np +2 tanh τ , tanh τ and tanh τ , tanh τ np +2 tanh τ l( lp+ 1) v22 All + al ( lp +− 1) A nb ( np + 1)( np + 2)( np + 3) An B = 0

(17) l( lp+ 1) Aln v22 − nb ( np ++ 1)( np 2)( np + 3) A B = 0 (11) 2 2ll 2 22 2n 2 l pv A+ al pA +2 nb { n p ++ ( np 2) } A B = 0 (18) −2lv2 All + an ( np + 1) A + 2 nb { n22 p ++ ( np 2) 2 } An B 2 = 0 Solving (17) and (18) there exists a zero solution only, (12) that is

Solving (11) and (12) implies qxt( ,)= 0 (19)

3003 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

2.4. Case IV: lmn≠≠ m( mp+ 1) aAmn − np ( np ++ 1)( np 2)( np + 3) bA B 2 = 0 (29) n( np+ 1) Amm v2 + m 2 paA + nb( np + 1)( n22 p ++ ( np 2) 2 ) An B 2 = 0 In (3) equating the exponents of lp + 2 and np + 4 , we get (30) 2 Solving (29) and (30) leads to p = (20) 1 ln− vm()+ n mn− where A = (31) 2an ≠ (21) ln ()m− nv B = (32) In (3) equating the exponents of mp + 2 and 2nb np + 4 , leads to Thus the singular 1-soliton solution of (1) is 2 2 p = (22) q( x , t )= A cschmn− B ( x− vt ) (33) − mn where ≠= mn≠ (23) 3.2. Case II: l nmn, From (20) and (22) it follows that lm= (24) In (27) equating the exponents of lp + 2 and From (21) and (23) it follows that np + 4 yields lmn≠≠ (25) 2 p = (34) Thus (24) and (25) are contradiction and there is no ln− solution in this case. Equating the coefficients of the function pairs lp +2 np +4 lp τ , τ and τ , 3. Singular soliton solution csch csch csch np +2 csch τ We assume the singular soliton solution to be of the form l( lp+ 1) v22 Aln −++ n ( np 1)( np 2)( np + 3) bA B = 0 (35) q( x , t )= A cschp B ( x− vt ) (26) l2 pv 2 Aln+ n( np + 1) aA − n ( np + 1){ n22 p ++ ( np 2) 2 } bAn B 2 where A And B Are free parameters of the soliton And v represents the velocity of the soliton. The exponent p = 0 (36) will be determined as a function of l, m and n. Solving (35) and (36) implies Substituting this hypothesis into (1) gives 1 22l lp +2 lp al()+ n nl− lpv A B{( lp ++ 1)cschττlp csch } = A 2 , (37) 2nv +m 22 ++mp+ ττmp ampA B{( mp 1)cschmp csc h } lna− B = (38) −bnpAn B44{( np ++ 1)( np 2)( np + 3)cschnp + τ 2nb Thus the singular 1-soliton solution of (1) is + +(n22 p ++ ( np 2)2 )cschnp 2ττ +n 33 p cschnp } = 0 (27) 2 ln− q( x , t )= A csch B ( x− vt ) (39) 3.1. Case I: l= nmn, ≠ 3.3. Case III: l= mm, ≠ n

In (27) equating the exponents of mp + 2 and In (27) equating the exponents of lp + 2 and np + 4 , leads to np + 4 , we get 2 2 p = (28) p = (40) mn− ln− Equating the coefficients of the function pairs Equating the coefficients of the function pairs mp +2 np +4 mp lp +2 np +4 lp csch τ , csch τ and csch τ , csch τ , csch τ and csch τ , np +2 np +2 csch τ we get csch τ

3004 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

l( lp+ 1) v22 All ++ l ( lp 1) aA − n ( np + 1)( np + 2)( np + 3) bAn B = 0 extended F-expansion Method". Life Science Journal, Volume 9, Issue 4, 1154-1162. (2012). (41) [2] A. Biswas ."1-soliton solution of the B(m, n) l2 pv 2 All+ l 2 paA − n( np + 1){ n22 p ++ ( np 2) 2 } bAn B 2 = 0 equation with generalized evolution". (42) Communications In Nonlinear Science And Numerical Simulation.Volume 14, Issue 8, August Solving (41) and (42) there exists a zero solution only 2009, Pages 3226-3229.

qxt( , )= 0 (43) [3] A. Biswas, A. H. Kara, M. Savescu, A. Bokhari & F. Z. Zaman. "Solitons and conservation laws in

neurosciences". Submitted. 3.4. Case IV: lmn≠≠ [4] A. Biswas, A. Moran, D. Milovic, F. Majid & K. There is no solution in this case as in the case Biswas. "An exact solution of the modified of the topological soliton solution. nonlinear Schrodinger's equation for Davydov solitons In alpha-helix proteins". Mathematical 4. Conclusions Biosciences. Volume 227, Issue 1, 68-71. (2010). This paper addressed the B(m, n) equation with [5] A. Biswas, Chaudry Masood Khalique. "Stationary generalized evolution in the context of topological and solutions of the modified nonlinear Schrodinger's singular soliton solutions. The results in this paper, equation in alpha-helix proteins". Advanced although eerie similar to a previously published paper, Studies In Biology, Volume 2, Number 3, 99-103. will make sense in several other areas of study such as (2010) life sciences or other branches of biological or clinical [6] A. Biswas, D. Milovic & D. Milic. "Solitons in sciences [2]. The numerical simulations, of this paper, alpha-helix proteins by He's variational principle". support the analytical results that are obtained and International Journal Of Biomathematics. Volume hence the numeric makes a lot of sense. 4, Number 4, 423-429. (2011). These results will be further analyzed in future. [7] A. Biswas, P. Suarez, J. Gillispie & F. M For example B(m, n) equation with time-dependent "Simulations of solitons in alpha-helix proteins". coefficients or rather stochastic coefficients will be Annals of Biological Research. Volume 2, Issue 1, dealt with. These situations will be a much closer to 156-161. (2011). reality, especially in the context of biosciences. [8] B. Lautrup, R. Appali, A. D. Jackson & T. Furthermore, several perturbation terms will be added Heimburg. "The stability of solitons in and the corresponding perturbed B(m, n) equation will biomembranes and nerves". The European be studied from an integrability stand point. These just Physical Journal E. Volume 34, Issue 6, Article-57. form a foot in the door. (2011). [9] S. Noubissie, R. A. Kraenkel & P. Woafo. Corresponding author "Disturbance and repair of solitary waves in blood Bouthina S. Ahmed vessel with aneurysm". Communications in Department of Mathematics, College of Girls, Ain Nonlinear Science and Numerical Simulation. Shams University, P. O. Box 11566, Cairo, Egypt Volume 14, Issue 1, 51-60. (2009). [email protected] [10] Y. Shang. "New exact special solutions with solitary patterns For Boussiensq-like B(m, n) References equations with fully nonlinear dispersion". Applied [1] A. Bhrawy and Mustafa Obaid ."New exact Mathematics and Computation 2006;173: 1137– solutions for the Zhiber-Shabat equation using the 1148.

2/2/2013

3005 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Genotypic characterization of Giardia duodenalis in children in Menoufiya and Sharkiya governorates, Egypt

Gehan S. Sadek1, Magda A. El-Settawy2 and Soha A. Nasr3

Parasitology Department1'2, Faculty of Medicine, Menoufiya University1 and Zagazig University2 and Clinical Pathology Department3, National Research Center [email protected]

Abstract: Giardia duodenalis is among the most common intestinal protozoa and is the most frequent parasitic agent of gastroenteritis worldwide. Chronic or recurrent giardiasis in children have been associated with malnutrition, wasting and stunting, most likely due to malabsorption caused by the parasites. Also, this parasite could cause reduced cognitive functions at later age. Genotypic characterization of Giardia duodenalis has been shown to be a useful tool in epidemiological studies and outbreak investigations. Molecular techniques based on polymerase chain reaction (PCR) in combination with techniques such as restriction fragment length polymorphism (RFLP) have been successfully used for differentiation of Giardia duodenalis genotypes. Considering the molecular differences and diversity of the prevalence of Giardia duodenalis assemblages in different regions of the world, and in view of probable correlation between Giardia duodenalis assemblage and clinical symptoms, this study was aimed to assess the genotypes of Giardia duodenalis isolates from patients with giardiasis in two governorates of Egypt namely Menoufiya and Sharkiya and its relation to clinical manifestations of the disease. Eighty samples were collected from Menoufiya Governorate and eighty one samples from Sharkiya Governorate. Samples were collected from children aged 5-12 years of both sexes. Samples were examined as wet smear after staining with Lugol's iodine. Negative samples were further examined by Trichrome stain. All positive samples were subjected to examination by PCR-RFLP to detect Giardia duodenalis genotypes. Prevalence of giardiasis in Menoufiya Governorate was 30% and it was 28.4% in Sharkiya Governorate. Assemblage AII represents 83.33% of Menoufiya samples and 70.59% of Sharkiya samples while assemblage BIII represents 16.67% of Menoufiya samples and 29.41% of Sharkiya samples. There was a high statistical significant association between assemblage AII and clinical manifestations of the disease, also between assemblage AII and age group 5-8 years. It was concluded that determination of the genetic grouping of Giardia duodenalis is a useful way to understand the infection route, to prevent infection effectively, to reveal the critical issues in the molecular epidemiology of this parasite, and finally to address important questions related to human health in Egypt. PCR-RFLP is a sensitive and powerful analytical tool that allows effective genotype discrimination within and between assemblages. [Gehan S. Sadek, Magda A. El-Settawy and Soha A. Nasr.. Genotypic characterization of Giardia duodenalis in children in Menoufiya and Sharkiya governorates, Egypt. Life Sci J 2013;10(1):3006-3015]. (ISSN: 1097- 8135). http://www.lifesciencesite.com. 369

Key words: Giardia duodenalis, gdh gene, PCR-RFLP, Menoufiya Governorate, Sharkiya Governorate, Egypt.

1. Introduction infection, for example, the infective dose in human Giardia duodenalis (Synonyms: Giardia is about 10 to 100 cysts, also cysts are immediately intestinalis, Giardia lamblia) is among the most infectious when excreted in feces. Moreover, cysts common intestinal protozoa and is the most are remarkably stable and can survive for weeks to frequent parasitic agent of gastroenteritis months in the environment (Smith et al., 2006 and worldwide. The regional prevalence of infection Almeida et al., 2010). differs enormously and may be >30% in children in The parasite can cause gastrointestinal the African and Eastern Mediterranean region infections ranging from mild to severe as well as (Thompson & Smith, 2011 and Ignatius et al., chronic disease. Both host factors (e.g. nutrition, 2012). Prevalence of Giardia duodenalis is found immunity, co-infection with other agents) and in all age groups, but children are at the greatest pathogen factors (e.g. strain, infectious dose) are risk for contracting clinical giardiasis, especially thought to contribute to the clinical severity of those attending day care centers (Boontanom et al., giardiasis (Johnston et al., 2010). However, the 2011). Infection occurs by ingestion of viable cysts, majority of cases are asymptomatic or minimally which are transmitted through feco-oral symptomatic in immunocompetent individuals contamination by direct person- to- person (Helmy et al., 2009). In symptomatic cases, transmission, water-borne transmission, food-borne symptoms usually occur in six to fifteen days after transmission, and animal-to-person transmission or infection. In the acute stage, symptoms can last by autoinfection (Helmy et al., 2009 and from two to four days, and after that a chronic Boontanom et al., 2011). General characteristics of phase can appear and can last from few weeks to Giardia duodenalis influence the epidemiology of several years (Jaros et al., 2011). Clinical

3006

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

manifestations of symptomatic giardiasis include isolates have been further grouped into subgroups I diarrhea, greasy stools, flatulence, abdominal and II. The assemblage B isolates have been cramps, epigastric tenderness as well as steatorrhea divided into subgroups III and IV accompanied by full-blown malabsorption (Siripattanapipong et al., 2011 and Sarkari et al., syndrome (Bertrand et al., 2005 and Helmy et al., 2012). These assemblages also infect a wide range 2009). Chronic or recurrent infections in children of other hosts, including livestock, cats, dogs and have been associated with malnutrition, wasting wild mammals (Babaei et al., 2008 and Sarkari et and stunting, most likely due to malabsorption al., 2012). Some researchers believe that Giardia caused by the parasites. Also, reduced cognitive duodenalis presents as a risk of zoonosis from these functions may occur at later age (Berkman et al., animals (O'Handley et al., 2000; Traub et al., 2004 2002 and Ignatius et al., 2012). and Eligio-Garcia et al., 2005). The prevalence of Diagnosis of Giardia duodenalis is each assemblage varies considerably from country traditionally based on the detection of the parasites to country; assemblage B seems more common by light microscopy in direct stool smears or overall, but no strong conclusions can be drawn following concentration techniques, e.g. by from current data (Almeida et al., 2010). formalin-ethyl acetate centrifugation. Multiple Assemblages have inconsistently been linked with rather than single sample testing is recommended to symptoms: assemblage A parasites have been improve sensitivity but this is often difficult to associated with more severe clinical symptoms as implement. Antigen detection immunoassays are of compared to assemblage B parasites in many areas superior sensitivity but also more expensive (Read et al., 2002 and Breathnach et al., 2010), but (Regnath et al., 2006). Highly sensitive molecular the opposite has been reported from other areas methods based on polymerase chain reaction (PCR) (Homan & Mank, 2001 and Gelnew et al., 2007) have been developed to detect Giardia duodenalis and no association in other areas (Kohli et al., cysts in stool. The sensitivity of these methods was 2008). proved to be superior to microscopic examination Considering the molecular differences and in detecting low number of cysts in stool. diversity of the prevalence of Giardia duodenalis Unfortunately, these methods are rarely applied in assemblages in different regions of the world, and developing countries so far (Amar et al., 2002; in view of probable correlation between Giardia McGlade et al., 2003 and Verweij et al., 2004). duodenalis assemblage and clinical symptoms, this Although Giardia duodenalis isolates are study was aimed to assess the genotypes of Giardia morphologically identical, they vary significantly in duodenalis isolates from patients with giardiasis in their biology, virulence and genetics (Thompson et two governorates of Egypt namely Menoufiya and al., 2000 and Sarkari et al., 2012). Genotypic Sharkiya and its relation to clinical manifestations characterization of Giardia duodenalis has been of the disease. shown to be a useful tool in epidemiological studies and outbreak investigations (Robertson et al., 2006). 2.Materials and Methods Molecular techniques based on polymerase chain Study design and study population: reaction (PCR) in combination with techniques From January 2012 to October 2012, fresh such as restriction fragment length polymorphism stool samples were collected in two governorates in (RFLP) have been successfully used for Egypt namely Menoufiya Governorate and differentiation of Giardia duodenalis genotypes Sharkiya Governorate. Eighty samples were (Bialek et al., 2002; Amar et al., 2003; McGlade et collected from Menoufiya Governorate and eighty al., 2003 and Aydin et al., 2004). Isolates of one samples from Sharkiya Governorate. Samples Giardia duodenalis are classified into seven were collected from children aged 5-12 years. They assemblages based on the characterization of the were classified according to age into two groups: glutamate dehydrogenase (gdh), small-subunit (ssu) group 1 including children between 5-8 years and rRNA and triosephosphate isomerase (tpi) genes group 2 including children between 9-12 years. (Van Keulen et al., 2002; Read et al., 2004; Caccio Children were both males and females. Each child et al., 2005; Papini et al., 2007; Caccio & Ryan, was asked about the presence of some clinical 2008 and Sarkari et al., 2012). These assemblages manifestations namely diarrhea, flatulence and can infect different hosts. The analysis of human abdominal cramps, also mothers were asked about isolates from different geographical locations, presence of greasy stool. examined by PCR amplification of DNA extracted Microscopic examination of stool samples: from stool samples demonstrated that in almost all Each stool sample was divided into two parts. cases only Giardia duodenalis assemblages A and The first part was concentrated by using zinc B are associated with human infections (Lasek- sulfate floatation technique according to the method Nesselquist et al., 2010 and Siripattanapipong et al., of Sloss et al. (1999) and washed with phosphate 2011). Genetic assemblages C, D, E, F and G seem buffer saline, then examined as wet smear after to be restricted to domestic animals, livestock and staining with Lugol's iodine to detect trophozoites wild animals (Adam, 2001). The assemblage A and cysts of Giardia duodenalis by using x40

3007

Life Science Journal 2013;10(1) http://www.lifesciencesite.com objective and then x100 objective. Negative •P value < 0.001 was considered statistically highly samples were further examined by Trichrome significant. staining after fixation in Shaudinn's fixative 3. Results according to method of Wheatley (1951).The By examination of stool samples of children second part was kept at -20°C until use. in Menoufiya and Sharkiya governorates, it was DNA extraction: found that there were 24 positive cases out of 80 Stool samples which were proved to be (30%) in Menoufiya Governorate and 23 positive positive by microscopic examination were cases out of 81 (28.4%) in Sharkiya Governorate. subjected to DNA extraction using QIAamp DNA However, the difference between the prevalence in Stool Mini Kit (QIAGEN, Hilden, Germany) the two governorates was not significant (p>0.05) following the manufacturer's instructions. {Table 1, Figures 1& 2}. Extraction was done on the frozen parts of the Out of the 24 microscopically positive samples. samples in Menoufiya Governorate, gdh gene was PCR amplification of the gdh gene: successfully amplified in 18 samples by PCR (75%) A DNA fragment (about 432 bp) of the gdh and out of the 23 microscopically positive samples gene was amplified using a single PCR protocol by in Sharkiya Governorate, gdh gene was using the forward primer (GDHiF) 5'- successfully amplified in 17 samples by PCR CAGTACAACTCTGCTCTCGG-' 3 and the (73.9%). However, the difference between them reverse primer (GDHiR) was not significant (p>0.05) {Table 2 & Figure 3}. 5'GTTGTCCTTGCACATCTCC-'3 (Leonhard et In Menoufiya Governorate, RFLP analysis al., 2007 and Qader & Bakir, 2011). Amplification showed that 15 samples out of the total 18 samples was done on the PCR mix which consisted of 2 ul with successful amplification of the gdh gene by of each primer, 5 ul of template DNA, and 20 ul of PCR were proved to be classified as assemblage Dream Taq Green PCR Master Mix (Product No. AII (83.33%) while the remaining 3 samples were K1081, Thermo Scientific, USA). Amplification proved to be classified as assemblage BIII consisted of one cycle of 94°C for 10 minutes (16.67%). No samples examined by RFLP analysis (Initial heat inactivation step), 50 cycles of 35 were found to be related to either assemblage AI or seconds at 94°C, 35 seconds at 61°C and 50 BIV. In Sharkiya Governorate, RFLP analysis seconds at 72°C, with a final extension of 7 minutes showed that 12 samples out of the total 17 samples at 72°C. PCR products were separated by with successful amplification of the gdh gene by electrophoresis on 1.5% agarose gel and visualized PCR were proved to be classified as assemblage under a transilluminator after staining with AII (70.59%) while the remaining 5 samples were ethidium bromide (Qader and Bakir, 2011). PCR proved to be classified as assemblage BIII was conducted in Clinical Pathology Department at (29.41%). No samples examined by RFLP analysis National Research Center. were found to be related to either group A1 or BIV. RFLP analysis: Statistical analysis showed that there was no The restriction fragment length polymorphism significant statistical difference between the two (RFLP) analysis was performed by digesting 10 ul governorates as regards distribution of Giardia of PCR product (432 bp) with 2 ul of RsaI (product duodenalis assemblages in positive stool samples No. ER1121, Thermo Scientific, USA) or 2 ul of (p>0.05) {Table 3 and Figure 4}. Expected N1a IV (product No. ER1151, Thermo Scientific, fragment sizes were taken according to Qader & USA) in 1X enzyme buffer in a final volume of 25 Bakir (2011) {Table 4}. ul for 3 hours at 37°C (Qader and Bakir, 2011). From the above mentioned data, total cases Statistical analysis: which were proved to be related to assemblage AII Data were collected, tabulated, statistically in both two governorates were 27 cases; also total analyzed by computer using SPSS version 16, two cases which were proved to be related to types of statistics were done: assemblage BIII in both two governorates were 8 1- Descriptive statistics: cases. It was found that out of 27 assemblage AII *Qualitative data expressed in number and cases, 25 were positive for one or more clinical percentage. manifestations (92.6%) while the remaining 2 cases *Z test was used to compare between two were negative for any clinical manifestations proportions. (7.4%). Also, it was found that out of the 8 2- Analytic statistics: assemblage BIII cases, 2 were positive for one or Fischer exact test and Chi-square (x2) tests were more clinical manifestations (25%) while the used to compare categorical outcomes. remaining 6 cases were negative for any clinical • P value > 0.05 was considered statistically non manifestations (75%). Difference between significant. assemblage AII and BIII regarding correlation to • P value < 0.05 was considered statistically clinical manifestations was highly statistically significant. significant (p<0.001) {Table 5}.

3008

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

By analysis of the correlation between age of found to be related to assemblage AII (50%) and infected children and Giardia duodenalis the other 8 cases were found to be related to assemblage, it was found that all 19 cases related to assemblage BIII (50%). There was a high group 1 (5-8 years) were proved to be related to significant statistical difference between groups assemblage AII (100%) while no cases were related 1&2 regarding distribution of Giardia duodenalis to assemblage BIII (0%). In group 2, 8 cases were assemblage AII & BIII (p<0.001) {Table 6}.

Table 1: Prevalence of giardiasis in children in Menoufiya and Sharkiya governorates as detected by microscopic examination. Prevalence of giardiasis Menoufiya Governorate Sharkiya Z test P value (n=80) Governorate (n=81) Total number infected 24 23 0.05 >0.05* % 30% 28.4%

*p>0.05= not significant.

Table 2: Results of PCR amplification of the gdh gene in microscopically positive samples in Menoufiya and Sharkiya governorates. Results of PCR amplification Menoufiya Sharkiya Z test P value of gdh gene Governorate Governorate No. of microscopically positive samples 24 23 0.25 >0.05* No. of samples with successful amplification of gdh gene by PCR 18 17 % 75% 73.9%

*p>0.05= not significant.

Table 3: Giardia duodenalis assemblages in positive stool samples with successful amplification of gdh gene in both Menoufiya and Sharkiya governorates as detected by PCR- RFLP. Menoufiya Sharkiya Chi Assemblage P value Governorate Governorate square test (Total samples=18) (Total samples= 17) (x2 ) No. % No. % AI 0 0.00% 0 0.00% 0.81 >0.05* AII 15 (83.33%) 12 (70.59%) BIII 3 (16.67%) 5 (29.41%) 0 0.00% 0 0.00% BIV *p>0.05= not significant.

Table 4: The RFLP profiles of Giardia duodenalis assemblages after digesting with N1aIV and RsaI. Assemblage Restriction enzymes Expected fragment sizes (bp) Diagnostic fragment sizes (bp) AII N1aIV 20, 40, 50, 70, 80, 90, 120 80, 90, 120 BIII N1aIV 50, 120, 290 120, 290 BIII RsaI 30, 130 300 130, 300

Table 5: Correlation between Giardia duodenalis assemblage and clinical manifestations in patients with successfully amplified gdh gene in stool samples (Total= 35 samples). Assemblage No. of positive cases No. of negative cases Fischer exact test P value for one or more for any clinical clinical manifestations manifestations No % No % AII (27 samples) 25 92.6% 2 7.4% 15.99 <0.001* 2 25% 6 75% BIII (8 samples) *p<0.001=highly significant.

Table 6: Correlation between Giardia duodenalis assemblage and age of patients with successfully amplified gdh gene in stool samples (group1=19 cases, group 2=16 cases). Age Fischer exact test P value Positive cases in group 1 Positive cases in group 2 (5-8 years) (9-12 years) Assemblage AII No. % No. % 12.31 <0.001* 19 100% 8 50% Assemblage BIII 0 0% 8 50%

* p<0.001=highly significant.

3009

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Figure 2: Giardia duodenalis cysts stained by Lugol's Figure 2: Giardia duodenalis cysts stained by Iodine (x1000). Trichrome stain (x1000).

Figure 4: Restriction analysis of amplified gdh Figure 3: Agarose electrophoresis of PCR amplification gene by PCR using N1aIV on an ethidium for the gdh gene using GDHiF and GDHiR primers. bromide-stained 1.5% gel. Lanes 2, 3 & 5 Giardia Lanes 2, 4, 5 and 6 represent PCR product. Lane 1 lamblia assemblage A II, lanes 4 & 6 assemblage represents 100 bp ladder. BIII and lane 1 represents 100 bp ladder.

4.Discussion assemblages by targeting some loci such as gdh and Giardia duodenalis is a universal and well- tpi, making it possible to identify the presence of known enteric protozoan that is found in the mixed genotypes ( Cedillo- Rivera et al., 2003; intestines of mammalian hosts, including both Sulaiman et al., 2003 and Itagaki et al., 2005). It is domestic & wild animals and humans. It is one of important to note that all loci enable successful the most common gastrointestinal pathogens in grouping at level assemblage of Giardia duodenalis children, causing severe intestinal disorder and isolates, and could characterize the sub- growth retardation (Thompson and Monis, 2004). assemblages AI and AII, whereas only a few loci This protozoan was recently taken into the World allow sub-assemblages differentiation within the B Health Organization's (WHO's) " Neglected assemblage. Besides, markers like the small- Diseases Initiative" (Savioli et al., 2006). subunit rRNA, the elongation factor 1α gene can Human giardiasis is caused by two genetically only be used to discriminate major assemblages, very distinct assemblages (A and B) of Giardia whereas the gdh, tpi and β giardin genes allow us to duodenalis, and a number of molecular assays have distinguish between the subgroups of the been developed for their specific detection in stool assemblages A and B (Wielinga and Thompson, and environmental samples (Almeida et al., 2010). 2007). All those assays are based on the in vitro Although the genotypic separation of Giardia amplification of specific gene fragments, but the duodenalis assemblages is relatively well detection formats differ, ranging from the simple established, the clinical or epidemiological analysis of restriction patterns to sequence analysis significance of infection with assemblage A versus or to more versatile platforms, like microarrays and B is poorly understood (Helmy et al., 2009). Hence, quantitative PCR (qPCR) {Guy et al., 2003 and the present work was aimed to assess the genotypes Guerden et al., 2009}. of Giardia duodenalis isolates from patients with PCR-RFLP is a sensitive and powerful giardiasis in two governorates in Egypt, namely analytical tool that is capable of providing the level Menoufiya Governorate and Sharkiya Governorate of genotype discrimination between and within and their relation to age of patients and clinical

3010

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

manifestations of the disease that mentioned by Sharkiya Governorate. AII assemblage was found those patients. in 83.33% of Menoufiya samples and in 70.59% of In the present work, it was found that the Sharkiya samples. Also, BIII assemblage was found prevalence of Giardia duodenalis in Menoufiya in 16.67% of Menoufiya samples and in 29.41% of Governorate was 30% and in Sharkiya governorate Sharkiya samples. However, difference between the was 28.4%. However, difference between them was two governorates regarding distribution of Giardia not significant. These ratios support the ratios duodenalis assemblages was not significant. previously reported in many studies in Egypt. For Regarding absence of assemblage AI, our result is example, Shukry et al. (1986) reported a prevalence consistent with those of Amar et al. (2002) in the of 33% in Cairo residents. Curtale et al. (1998) United Kingdom and Bertrand et al. (2005) in detected Giardia duodenalis in 24.7% of fecal France. samples in Behera Governorate. On the other hand, Concerning the distribution of assemblage AII Fawzi et al. (2004) found Giardia duodenalis in & BIII, results of the present work found that the 10.4% in El-Prince (Alexandria) in Egypt. The low prevalence of assemblage AII is far higher than that prevalence in this area may be attributed to the fact of BIII. These results are in agreement with the that the examined patients might have better living results of Babaei et al. (2008) who reported that the conditions. majority (87%) of the samples belonged to Giardia In the current work, gdh gene was successfully duodenalis assemblage AII in Tehran. Also, our amplified in 75% of samples in Menoufiya results are in accordance with results of an Italian Governorate and in 73.9% of samples in Sharkiya study that reported 80% of samples to be Governorate, however difference between them assemblage A by sequencing or PCR-RFLP was not significant. Our results are in agreement analysis of β giardin gene (Caccio et al., 2002). with the finding of El-Shazly et al. (2004) who Moreover, our results are consistent with those reported an amplification percentage of 73.3% obtained by Sarkari et al. (2012) who mentioned when working with fresh feces. However, our that the main assemblage of the isolates was AII results exceed those of Van der Giessen et al. (2006) followed by BIII. The same authors added that who reported amplification percentage of 52.9% in genotype A, especially AII is the frequent genotype human fecal samples when they worked on the in human isolates in various areas of the world. On same gene with fresh feces. Moreover, our results the other hand, our results are contradictory with exceed those reported by Qader and Bakir (2011) those obtained by Amar et al. (2002) in the United who found amplification percentage of 56.6% when Kingdom who reported assemblage B in 64% of working with the same primers and on the same samples, Solaiman et al. (2003) in Peru who found gene. On the contrary, some researchers reported assemblage B in 76% of samples, Guy et al. (2004) higher percentages, for example, Read et al. (2002) in the United States who mentioned that prevalence and Babaei et al. (2008) reported amplification of assemblage B in the examined samples was 80%. percentages of 100% and 98% respectively when Besides, our results contradict those obtained by they worked on the gdh gene. The failure in the Bertrand et al. (2005) in France who found that amplification of some fecal smears could derive assemblage B prevalence was 61.5%. Moreover, from the quantity of samples DNA, either due to results of the present work disagree those stated by their degradation by time or may be due to presence Ignatius et al. (2012) who found that the majority of some of PCR inhibitors such as lipids, of samples (85.9%) were assemblage B and only hemoglobin, bile salts, polysaccharides from mucus, 12.7% were assemblage AII. bacteria & food degradation products From the above mentioned results, it seems that (Abbaszadegan et al., 2007). PCR inhibitors may the prevalence of assemblage AII versus B act in 3 levels: interference in cellular lysis, especially BIII differs greatly according to the degradation or uptake of nucleic acids or examined locality. Results of the present work inactivation of thermostable polymerases (Molina concerning higher prevalence of assemblage AII et al., 2007). However, it was proved that QIA amp than assemblage BIII in Menoufiya and Sharkiya DNA Stool Mini Kit is able to remove these governorates are consistent with an anthroponotic inhibitors by absorbing them in the inhibitex matrix origin of infection and ensure the fact that for (Molina et al., 2007 and Babaei et al., 2008). Also, human infection to occur, other humans are the fecal samples used for molecular method diagnosis main reservoirs while zoonotic source plays a must be collected without preservatives since these minor role in the examined areas. reduce the sensitivity of the techniques due to DNA Several authors reported that origin of infection degradation. Therefore, the use of fresh feces would by assemblage AII is anthroponotic like Read et al. prevent the false negative results (Molina et al., (2002) and Sprong et al. (2009). Also, Babaei et al. 2007). (2008) added that assemblage AI and genotype B By RFLP, it was found that no stool samples have a more zoonotic potential than subgroup AII were related to Giardia duodenalis assemblage AI and have a more host range. or BIV in both Menoufiya Governorate and

3011

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

In our opinion, high prevalence of assemblage to address important questions related to human AII in the examined areas may be attributed to health in Egypt. PCR-RFLP is a sensitive and contamination of the drinking water especially by powerful analytical tool that allows effective residential activities (e.g. sewage discharge). genotype discrimination within and between Several authors reported that contamination of assemblages at targeting gdh gene. Our data drinking water is an important source of infection. suggests that there is an anthroponotic origin of the Hilber (1988) analyzed 4,423 water samples from infection route, so it seems that the main reservoir 301 municipalities in 28 states in the United States of Giardia duodenalis infection in the two studied and cysts of Giardia duodenalis were detected in areas is human. Finally, effective isolation and lysis 26% of source water samples and in 11% of method of cysts from stool samples and purification finished water samples. Besides, Wallis et al. (1996) of genetic materials are needed to obtain results detected Giardia duodenalis cysts in 18% of treated with a higher sensitivity. water samples from 72 Canadian cities. Moreover, Liang et al. (2012) stated that assemblage A Author contribution: isolates were obtained from 4 out 22 water samples Gehan S. Sadek and Magda A. El-Settawy and added that their results suggest that the risk of proposed the research idea, proposed the study Giardia duodenalis transmission is greater from design, shared in collecting the samples & water borne than animal transmission in the study performing the laboratory work and wrote the area. manuscript. Soha A. Nasr shared in performing the In the current work, it was found that 92.6% of laboratory work, interpreted the results of PCR and cases with assemblage AII were complaining of one shared in reviewing the manuscript. or more clinical manifestations while only 25% of cases with assemblage BIII were complaining of Corresponding author: one or more clinical manifestations. Difference Gehan S. Sadek, between them was highly statistically significant Parasitology Department, Faculty of Medicine, ( p<0.001). These results are in agreement with Menoufiya University, Egypt. those of Homan & Mank (2001) who found that email: [email protected] children infected with genotype A had a 26 folds greater risk of having diarrhea. Haque et al. (2005) References stated that diarrhea was more associated with 1) Abbaszadegan M.R., Velayati A., Tavasoil assemblage A than with assemblage B in A. and Dadkhah E. (2007): Rapid DNA Bangladesh. On the other hand, other studies have extraction protocol from stool, suitable for found a connection between symptomatic infection molecular genetics diagnosis of colon cancer. and assemblage B; also a connection between I.B.J., 11(3): 203-208. asymptomatic infection and assemblage A (Aydin 2) Adam R.D. (2001): Biology of Giardia et al., 2004). The correlation between clinical lamblia. Clin. Microbiol. Rev., 14: 447-475. symptoms of Giardia duodenalis and assemblage is 3) Almeida A., Pozio E. and Caccio S.M. controversial and some authors like Eligio-Garcia (2010): Genotyping of Giardia duodenalis et al.(2002) stated that there was no correlation cysts by new real-time PCR assays for between clinical manifestations and genotypes. detection of mixed infections in human Anyhow, difference between results of the current samples. Appl. Environ. Microbiol., 76(6): work and other works may be attributed to 1895-1901. difference in the age of patients or the level of their 4) Amar C.F., Dear P.H. and McLauchlin J. immunity. (2003): Detection and genotyping by real- The present work has found that 100% of time PCR/RFLP analyses of Giardia children between 5-8 years (Group 1) were proved duodenalis from human faeces. J. Med. to be related to assemblage AII while 50% of Microbiol.; 52(8): 681-683. children between 9-12 years (Group 2) were proved 5) Amar C.F., Dear P.H., Pedaza-Diaz S., to be related to assemblage AII and the rest were Looker N., Linnane E. and McLauchlin J. related to assemblage BIII. Difference between (2002): Sensitive PCR-RFLP assay for them was highly statistically significant ( p<0.001). detection and genotyping of Giardia These results are not unexpected as children of duodenalis in human feces. Clin. Microbiol. J., lower age (Group 1) have a lower immunity than 40(2): 446-452. older children (Group 2) so, it is a normal sequel to 6) Aydin A.F., Besirbellioglu B.A., Avci I.Y., have the symptomatizing AII assemblage. Tanyuksel M., Araz E. and Pahsa A. (2004): In conclusion, determination of the genetic Classification of Giardia duodenalis parasites grouping of Giardia duodenalis is a useful way to in Turkey into groups A and B using understand the infection route, to prevent infection restriction fragment length polymorphism. effectively, to reveal the critical issues in the Diagn. Microbiol. Infect. Dis., 50: 147-151. molecular epidemiology of this parasite, and finally

3012

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

7) Babaei Z., Oormazdi H., Akhlaghi L., in Behera Governorate, Egypt. J.Trop. Pediatr., Rezaie S., Razmjou E., Soltani-Arabshahi 44: 323-328. S.K., Meamar A.R. and Hadighi R. (2008): 18) Eligio-Garcia L., Cortes-Campos A., Molecular characterization of the Iranian Jimenez-Cardosoe E. (2005): Genotype of isolates of Giardia lamblia: application of the Giardia intestinalis isolates from children and glutamate dehydrogenase gene. Iranian J. dogs and its relationship to host origin. Publ. Health, 37(2): 75-82. Parasitol. Res., 97(1): 1-6. 8) Berkman D.S., Lescano A.G., Gilman R.H., 19) Eligio-Garcia L., Galvan S. and Jimenez- Lopez S.L. and Black M.M. (2002): Effects Cardoso E. (2002): Detection of symptomatic of stunting diarrheal diseases and parasitic and asymptomatic Giardia duodenalis infection during infancy on cognition in late genotypes. Rev. Invest. Clin., 54: 113-118. childhood; a follow up study. Lancet, 359: 20) El-Shazly A.M., Mowafy N., Soliman M., 564-571. El-Bendary M., Morsy T.A., Ramadan N.I. 9) Bertrand I., Albertini L. and Schwartzbord and Arafa W.A. (2004): Egyptian genotyping (2005): Comparison of two target genes for of Giardia lamblia. Egypt. Soc. Parasitol., 34: detection and genotyping of Giardia lamblia 265-280. in human feces by PCR and PCR-Restriction 21) Fawzi M., El-Sahn A.A., Ibrahim H.F. and Fragment Length Polymorphism. J. Clin. Shehata A.I. (2004): Vegetable-transmitted Microbiol., 43(12): 5940-5944. parasites among inhabitants of El-Prince, 10) Bialek R., Binder N., Dietz K., Joachim A., Alexandria and its relation to housewives' Knobloch J. and Zelck U.E. (2002): knowledge and practices. J. Egypt. Publ. Comparison of fluorescence antigen and PCR Health Assoc., 79: 13-29. assays to detect Cryptosporidium parvum in 22) Gelanew T., Lalle M., Hailu A., Pozio E. fecal specimens. Diagn. Microbiol. Infect. and Caccio S.M. (2007): Molecular Dis., 43: 283-288. characterization of human isolates of Giardia 11) Boontanom P., Mungthin M., Tan-ariya P., duodenalis from Ethiopia. Acta. Trop., 102: Naaglor T. and Leelayoova S. (2011): 92-99. Epidemiology of giardiasis and genotypic 23) Geurden T., Levecke B., Caccio S.M., characterization of Giardia duodenalis in Visser A., De Groote G., Casaert S., preschool children of a rural community, Vercruysse J. and Claerebout E. (2009): central Thailand. Trop. Biomed., 28(1): 32-39. Multilocus genotyping of Cryptosporidium 12) Breathnach A.S., Mcltugh T.D. and and Giardia in non-outbreak related cases of Butcher P.D. (2010): Prevalence and clinical diarrhea in human patients in Belgium. correlations of genetic subtype of Giardia Parasitology, 136: 1161-1168. lamblia in an urban setting. Epidemiol. Infect., 24) Guy R.A., Payment P., Krull U.J. and 138: 1459-1467. Horgen P.A. (2003): Real-time PCR for 13) Caccio S.M. and Ryan U. (2008): Molecular quantification of Giardia and epidemiology of giardiasis. Mol. Biochem. Cryptosporidium in environmental water Parasitol., 160: 75-80. samples and sewage. Appl. Environ. 14) Caccio S.M., De Giacomo M. and Pozio E. Microbiol., 69: 5178-5185. (2002): Sequence analysis of the p giardin 25) Guy R.A., Xiao C. and Horgen P.A. (2004): gene and development of a polymerase chain Real-time PCR assay for detection and reaction-restriction fragment length genotype differentiation of Giardia lamblia in polymorphism assay to genotype Giardia stool specimens. J. Clin. Microbiol., 42: 3317- duodenalis cysts from human fecal samples. 3320. Int. J. Parasitol., 32: 1023-1030. 26) Haque R., Roy S., Kabir M., Stroup S.E., 15) Caccio S. M., Thompson R.C.A.; Mondal D. and Houpt E.R. (2005): Giardia McLaughlin J. and Smith H.V. (2005): assemblage A infection & diarrhea in Unraveling Cryptosporidium and Giardia Bangladesh. J. Infect. Dis., 192: 2171-2173. epidemiology. Tends Parasitol., 21: 430-437. 27) Helmy M.M.F., Abdel-Fattah H.S. and 16) Cedillo-Rivera R., Darby J.M., Enciso- Rashed L. (2009): Realtime PCR-RFLP Moreno J.A., Ortega-Pierres G. and Ey P.L. assay to detect Giardia intestinalis genotypes (2003): Genetic homogeneity of axenic in human isolates with diarrhea in Egypt. J. isolates of Giardia intestinalis derived from Parasitol., 95(4): 1-5. acute and chronically infected individuals in 28) Hilber C.P. (1998): Analysis of municipal Mexico. Parasitol. Res., 90(2): 119-123. water samples for cysts of Giardia. In: 17) Cutrale F., Nabil M., El-Wakeel A. and Advances in Giardia Research, Wallis P.M. Shamy M.Y. (1998): Anaemia and intestinal and Hammond B.R., eds., University of parasitic infections among school age children Calgray Press, Calgray, pp. 237245.

3013

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

29) Homan W.L. and Mank T. G. (2001): lamblia in formalin-fixed feces. Rev. Human giardiasis: genotype like differences Latinoam. Microbiol., 49(1-2):6-11. in clinical symptomatology. Int. J. Parasitol., 40) O'Handley R.M., Olson M.E., Fraser D., 31: 822-826. Adams P. and Thompson R.C. (2000): 30) Ignatius R., Gahutu J.B., Klotz C., Prevalence and genotypic characterization of Steininger C., Shyirambere C., Lyng M., Giardia in dairy claves from Western Musemakweri A., Aebischer T., Martus P., Australia and Western Canada. Vet. Parasitol., Harms G. and Mockenhaupt F.P. (2012): 90: 193-200. High prevalence of Giardia duodenalis 41) Papini R., Cardini G., Paoletti B. and assemblage B infection and association with Giangaspero A. (2007): Detection of Giardia underweight in Rwandan children. PLoS Negl. assemblage A in cats in Florence, Italy. Trop. Dis., 6(6): 1-9. Parasitol. Res., 100: 653-656. 31) Itagaki T., Kinoshita S., Aoki M., Itoh N., 42) Qader A.M. and Bakir T.Y. (2011): Saeki H. and Sato N. (2005): Genotyping of Molecular identification of Giardia Giardia intestinalis from domestic and wild duodenalis parasite isolates from human by animals in Japan using glutamate polymerase chain reaction-restriction fragment dehydrogenase gene sequencing. Vet. length polymorphism technique (PCR-RFLP) Parasitol., 133(4): 283-287. in Baghdad Province. Diyala J. Pure Sci., 7(4): 32) Jaros D., Zygner W., Jaros S. and 54-66. Wedrychowicz H. (2011): Detection of 43) Read C.M., Monis P.T. and Thompson Giardia intestinalis assemblages A, B and D R.C.A. (2004):Discrimination of all in domestic cats from Warsaw, Poland. Polish genotypes of Giardia duodenalis at the J. Microbiol., 60(3): 259-263. glutamate dehydrogenase locus using PCR- 33) Johnston A.R., Gillespie T.R., Rwego I.B., RFLP. Infect. Genet. Evol., 4: 125-130. Tanby McLachlan T.L., Kent A.D. and 44) Read C. M., Walters J., Robertson I.D. Goldberg T.L. (2010): Molecular and Thompson R.C. (2002): Correlation epidemiology of cross-species Giardia between genotype of Giardia duodenalis and duodenalis transmission in Western Uganda. diarrhea. Int. J. Parasitol., 32: 229-231. PLoS Negl. Trop. Dis., 4(5): 1-7. 45) Regnath T., Klemm T. and Ignatius R. 34) Kohli A., Bushen O.Y., Pinkerton R.C., (2006): Rapid and accurate detection of Houpt E. and Newman R.D. (2008): Giardia Giardia lamblia and Cryptosporidium spp. duodenalis assemblage, clinical presentation antigens in human faecal specimens by new and markers of intestinal inflammation in commercially available qualitative immuno- Brazilian children. Trans. R. Soc. Trop. Med. chromatographic assays. Eur. J. Clin. Hyg., 102: 718-725. Microbiol. Infect. Dis., 25:807-809. 35) Lasek-Nesselquist E., Welch D.M. and 46) Robertson L.J., Hermansen L., Gjerde B. Sogin M.L. (2010): The identification of a K., Strand E., Alvsvag J.O. and Langeland new Giardia duodenalis assemblage in marine N. (2006): Application of genotyping during vertebrates and a preliminary analysis of G. an extensive outbreak of waterborne giardiasis duodenalis population in biology in marine in Bergeb, Norway during autumn and winter system. Int. J. Parasitol., 40(9): 1063-1064. 2004. Appl. Environ. Microbiol., 72: 2212- 36) Leonhard S., Pfister K., Beelitz P., Wielinga 2217. C. and Thompson, R.C.A. (2007): The 47) Sarkari B., Ashraf Mansori A., Hatam molecular characterization of Giardia from G.R., Motazedian M.H., Asgari Q. and dogs in Southern Germany. Vet. Parasitol., Mohammad Pour I. (2012): Genotyping of 150(1-2): 33-38. Giardia lamblia isolates from human in 37) Liang C.H., Tsaihong J.C., Cheng Y.Y. and Southern Iran. Trop. Biomed., 29(3): 366-371. Peng S.Y. (2012): Occurrence & genotype of 48) Savioli L., Smith H. and Thompson A. Giardia cysts isolated from faecal samples of (2006): Giardia and Cryptosporidium join the children and dogs and from drinking water "Neglected Diseases Initiative". Trends in samples in an aboriginal area of central Parasitology, 22(5): 203-208. Taiwan. Exp. Parasitol., 131(2): 204-209. 49) Shukry S., Zaki A.M., DuPont H.L., 38) McGlade T.R., Robertson I.D., Elliott A.D. Shoukry I., El Tagi M. and Hamed Z. and Thompson R.C.A. (2003): High (1986): Detection of enteropathogens in fatal prevalence of Giardia detected in cats by PCR. and potentially fatal diarrhea in Cairo, Egypt. Vet. Parasitol., 110: 197-205. J. Clin. Microbiol., 24: 959962. 39) Molina N., Polverino D., Minvielle M. and 50) Siripattanapipong S., Leelayoova S., Basualdo J. (2007): PCR amplification of Mungthin M., Thompson R.C.A., triosephosphate isomerase gene of Giardia Boontanom P., Saksirisampant W. and Tan-ariya P. (2011): Clonal diversity of the

3014

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

glutamate dehydrogenase gene in Giardia Giardia among humans and dogs living in the duodenalis from Thai isolates: evidence of same community. Parasitology, 128(3): 253- genetic exchange or mixed infection? BMC 262. Microbiol., 11: 206. 59) Van der Giessen J.W.B., De Vries A, Roos 51) Sloss M.W., Zajac A.N. and Kemp R.L. M., Wielinga P., Kortbeek L.M. and Mank (1999): Parasitologia Clinica Veterinaria. 6th T.G. (2006): Genotyping of Giardia in Dutch ed. Sao Paulo: Manole; p. 198. patients and animals: A phylogenetic analysis 52) Smith H.V., Caccio S.M., Tait A., of human and animal isolates. Int. J. Parasitol., McLauchlin J. and Thompson R.C. (2006): 36(7): 849-858. Tools for investigating the environmental 60) Van Keulen H., Macechko P.T., Wade S., transmission of Cryptosporidium and Giardia Schaaf S., Wallis P.M. and Erlandsen S.L. infections in humans. Trends Parasitol., 22: (2002): Presence of human Giardia in 160-167. domestic, farm and wild animals, and 53) Sprong H., Caccio S.M. and Van der environmental samples suggests a zoonotic Giessen W.B. (2009): Identification of potential for giardiasis. Vet. Parasitol., 108: zoonotic genotypes of Giardia duodenalis. 97-107. PLoS Negl. Tropical Dis., 3(12): e558. 61) Verweij J.J., Blange R.A., Templeton K., 54) Sulaiman I.M., Fayer R., Bern C., Gilman Schinkel J. and Brienen E.A. (2004): R.H., Trout J.M. and Schantz P.M. (2003): Simultaneous detection of Entamoeba Triosephosphate isomerase gene histolytica, Giardia lamblia and characterization and potential zoonotic Cryptosporidium parvum in fecal samples by transmission of Giardia duodenalis. Emerg. using multiplex real-time PCR. J. Clin. Infect. Dis., 9(11): 1444-1452. Microbiol., 42: 1220-1223. 55) Thompson R.C. A. and Monis P.T. (2004): 62) Wallis P.M., Erlandsen S.L, Isacc-Renton Variation in Giardia implication for taxonomy J.L., Olson M.E., Robertson W.J. and Van and epidemiology. Adv. Parasitol.; 58: 69137. Keulen H. (1996): Prevalence of Giardia 56) Thompson R.C.A. and Smith A. (2011): cysts and Cryptosporidium oocysts and Zoonotic enteric protozoa. Vet. Parasitol., 182: characterization of Giardia spp. isolated from 70-78. drinking water in Canada. Appl. Environ. 57) Thompson R.C.A., Hopkins R.M. and Microbiol., 62(8): 2789-2797. Homan W.L. (2000): Nomenclature and 63) Wielinga C.M. and Thompson R.C. (2007): genetic groupings of Giardia infecting Comparative evaluation of Giardia mammals. Parasitol. Today, 16(5): 210-213. duodenalis sequence data. Parasitology, 58) Traub R.J., Monis. P. T., Robertson I., 134(12): 1795-1821. Irwin P., Mencke N. and Thompson R.C. 64) Wheatley W.B. (1951): A rapid staining (2004): Epidemiological and molecular procedure for intestinal amoebae and evidence support the zoonotic transmission of flagellates. Am. J. Clin. Pathol., 21:990- 992.

2/22/2013

3015

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Comparative Study of Radioactive Content in Soils from Different Countries

Abdel-Baset Abbady, Zain Al-Amoudi

Science Faculty of Girls, King Abdulaziz University, Saudi Arabia [email protected]

Abstract: The article presents the specific activities of natural radioactive nuclides in soil samples from Upper Egypt. The samples had been measured within the last ten years and the results were compared with others from some countries. The mean activity level of the natural radionuclides 226Ra, 232Th and 40k is 21.4, 14.6 and 663.1 Bqkg-1, respectively. These values agree with values reported elsewhere in the country and other countries. The paper includes available results of hazard indices values which indicate that there are no excessive exposures for inhabitants. These data are important for radiation protection purposes. [Abdel-Baset Abbady, Zain Al-Amoudi. Comparative Study of Radioactive Content in Soils from Different Countries. Life Sci J 2013;10(1):3016-3020]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 370

Keywords: Natural radioactivity, soil; gamma spectrometry; gamma absorbed dose rate.

1. Introduction of each region in the world [Anagnostakis et al, Since soil is one of the main contributors to 1996; Shender 1997 and Iqubal et al, 2000]. background radiation, it is very interest to know the Abnormal occurrences of uranium and its decay radioactivity content of the soil over the world.The products in rocks and soils and thorium in monazite natural radionuclides have been an essential sands have been identified in several areas of the constituent of the earth during its creation. Many world [Al-Jundi et al 2003]. radioactive elements goes back to the formation of In the present investigation, the level of our world, while the others are continuously specific activities of 226 Ra, 232 Th and 40 K in soil produced through different human activities. samples, collected from different places in Egypt, Determination of naturally occurring radionuclides in measured by radiation protection laboratory in soil have been performed in many parts of the world, Faculty of Science Qena, have been compared with mostly for assessment of the dose due to gamma those in other countries. In addition, these data will radiation and the risk resulting from them (Nellis be useful for sub-sequent evaluations of possible 1990; Rudge et al., 1993; Clouras et al. 2001. future environmental contamination due to any future Copplestone et al. 2001; Dowdall et al,2004 and activities. El-Bahi et al. 2005). It was observed that most of Samples Classification and Preparation natural radioactive elements present in soil are The samples presented in this article were primordial radinuclides from the uranium series, collected from different locations in Upper Egypt thorium series and potassium-40. Several along the last few years. Preparations and collections radionuclides in the radioactive decay chains starting had been done by the search group of radiation from 238 U and 232 Th are highly radiotoxic, in protection laboratory in physics department, Faculty particular 228 Ra and 226 Ra. The radon gas produces of Science Qena. The sampling locations are from the disintegration of 228 Ra and 226 Ra in the classified as follows: earth’s crust is considered the main source of 30 samples from Aswan governorate, 52 exposure to ionizing radiation for humans samples from W. Daeeb, W. Sarara and W. Hodein representing 40% of the annual accumulated dose and 13 from different farms in Armant near Luxor. (UNSCEAR, 1993). All soil- samples taken from 0-30cm depth were Measurements of 210Pb in air and surface dried up to 105co to eliminate any traces of water. soils can help in uranium exploration and monitoring Afterwards, the samples were ground to a fine grain transfers of radionuclides of uranium series in soils size powder. Then the ground samples were shaked and aquatic systems.Furthermore, 210Pb and its grand- by electrical shaker to homogenize the samples and daughter radionuclides 210 Po are included in the filled in 1000 ml marinelli beakers. group of most highly toxic radioisotopes and provide The prepared samples should be sealed the major internal natural radiation doses to humans. tightly and were stored for one month at least to Natural environmental radioactivity and the allow daughter products to come into radioactive associated external exposure due to gamma radiation equilibrium with their parents 226Ra and 232Th. The depend primarily on the geological and geographical counting time ranged from 10 to 15 hours depending conditions, and appear at different levels in the soils on the concentration of the radionuclidies.

3016 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Experimental Setup: Maestro (EG G ORTEC) or manually with the use of This method is based on the assessment of a spread sheet (Microsoft Excel) to calculate the gamma rays emanated from radioactive nuclides in natural radioactivity. 226 Ra activity of the samples each sample under investigation for 10 hours at least was determined via its daughters (214Bi and 214Pb) with a gamma-ray spectrometer. The applied through the intensity of 295.22 and 351.93 kev for spectrometer consists basically of high pure 214Pb and 609.3, 1120 and 1764.5 kev for 214Bi germanium detector with 8192 multichannel analyzer gamma lines. 232Th activity of the sample was housed inside a specific chamber with 4 layers :10 determined from the daughters (228Ac,212Pb and 208Tl). mm thick plexiglass; 30 mm copper,100 mm lead and The 228Ac gamma lines are 338.3,911.2 and 968.9 finally 3 mm thick cadmium. This shield serves to kev and 583.19 and 2614.5 kev for 208Tl while one eliminate different background radiations. The gamma line at 238.6 kev for 212Pb.The gamma line of detector is coupling with pre-amplifier, linerar am 40K is 1460.7kev. plifier and the multichannel analyzer composed of 3.Results and Discussion 8192 channels. The specifications of detector were The results for 95 soil samples collected described in details elsewhere in publiched article by from different locations in Upper Egypt are presented Abd el-Mageed et al 2011. The spectra were in table (1). evaluated either with the computer software program

Table 1 specific activities of radionuclides in soil samples at different locations in the area of Upper Egypt. Specific activity of radionuclides (Bq/kg) Location 226 Ra 232Th 40K W. Daeeb 20.9 13.5 477.0 Ref. Hashem2009 W. Sarara 27.8 17.8 735.3 W. Hodein 20.3 12.0 664.2 Armant 17.1 11.8 538.6 Ref.Maha 2007 Aswan 18.5 12.1 564.4 Ref.Rashed 2013 Mean 20.9 13.4 595.6

From the data, there is no obvious Table 2 presents comparison of the average differences can be observed for the specific activity values of the specific activity of the radionuclides in values in samples under investigation. These values some countries as given in UNSCEAR 2000. The are in the same range with the data listed in concentrations of the radionuclides in soil is ranging table2,except for potassium the value is twice higher. from country to another.

Table 2 comparison of specific activity of radionuclides in soil samples in different countries as given by UNSCEAR 2000 Specific activity of radionuclides (Bq/kg) Samples 226 Ra 232 Th 40K Egypt 17 18 320 United States 40 35 370 Argentina - - 650 Bangladesh 34 - 350 China 32 41 440 Hong Kong SAR 59 95 530 India 29 64 400 Japan 33 28 310 Islamic Rep. Iran 28 22 640 Denmark 17 19 460 Belgium 26 27 380 Luxemburg 35 50 620 Switzerland 40 25 370 Bulgaria 45 30 400 Poland 26 21 410 Romania 32 38 490 Greece 25 21 360 Portugal 44 51 840 Spain 32 33 470 Thailand 48 40 400 OAP data 172 211 511 Thailand 68 54 213

3017 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

226 232 40 The distribution of Ra, Th and k in Where C Ra, C Th and Ck are the activity soil is not uniform. Uniformity with respect to concentrations of 226 Ra, 232 Th and 40k in Bq/kg exposure to radiation has been defined in terms of respectively. While defining Ra eq activity, it has 226 radium equivalent activity (Ra eq) in Bq/Kg to been assumed that 370 Bq/kg of Ra or 259 Bq/kg compare the specific activity of materials containing of 232 Th or 4810 of 40 K produce the same gamma different amounts of 226 Ra, 232 Th and 40 K. It is dose rate.The average values obtained for radium calculated using the following relation [Beretka and equivalent activity for soil samples from different Mathew 1985]. countries are listed in table (3) and plotted as Ra eq=CRa + 1.43 CTh +0.07 Ck ……(1) histogram fig1.

Table (3) Average Raeq for soils in different countries Ra Country eq References kg/Bq China (Xiazhuang) 266 Zhuo et al 2001 Pakistan 173.6 Abdul, Ahad 2004 India (Yelagiri Hills) 168.9 Ravisankara et al 2012 Yemen (Sanaa) 160.97 Abd El-Mageed et al 2011 Brazil 150.3 Malanca et al.1996 Thailand 146.9 Prasong. et al 2008 Upper Egypt 92.7 Hashem 2009, Maha 2007 and Rashed 2012 Nigeria 76 Agbalagba and Onoja 2011 Saudi Arabia 47.8 Alaamer 2008

Ra eq 300 200 100 0 Ra eq

Fig.1 Radium equivalent activity in soils from different countries.

From the available data, it is clear that all according to the following formula (Kohshi et al values are less than the recommended limiting values 2001): of radium equivalent activity as 370 Bq/kg, which are D=AE× CF ……………………. (2) acceptable for safe use. The maximum values is that Where AE is the activity concentrations in -1 of China soils while the minimum is the results of BqKg and CF is the dose conversion factor Saudi Arabia. (absorbed dose rate in air per unite mass in units of n Air absorbed gamma radiation does rate Gy h-1 per Bq kg -1). The dose rate conversion factors Effects of gamma radiation are normally are listed in UNSCEAR2000 WHERE CRa = 0.462, expressed in terms of the absorbed dose rate in air, CTh=0.604 and Ck=0.042. which originate from radioactive sources in the soil. The acceptable value for external absorbed The absorbed dose rate is mainly due to the natural dose rate must be less than 59nGyh-1 (UNSCEAR radionuclides 226 Ra, 232 Th and 40 K in soil while the 2000). contribution due to other radinuclides is very little Annual effective dose and can be neglected. To estimate the annual effective dose, The absorbed dose rates D in outdoor air at account must be taken of: (a) the conversion 1m above the ground level to the population can be coefficient from absorbed dose in air to effective dose calculated from activities of terrestrial radionuclidies and (b) the indoor occupancy factor. The average

3018 Life Science Journal 2013;10(1) http://www.lifesciencesite.com numerical values of those parameters vary with the annual effective outdoors dose received by adults can age of population, according to UNSCEAR 2000, the be estimated as follows: conversion coefficient from absorbed dose in air to Annual effective dose = Dx24x356x0.7x0.2 ………(3) effective dose received by adults is 0.7 Sv Gy-1 and The average dose rate and annual effective the fraction of time spent outdoors is 0.2. Then, the dose for soils in different countries are listed in table (4).

Table (4) Average dose rate and annual effective dose in soils from different countries Annual effective dose Country Dose rate References msvy-1 China 124 0.15 Yang et al 2005 Vietnam 124 0.15 Huy and Luyen 2006 Sana’a 78.6 0.0963 Shaban Harb 2012 Brazil 72.6 0.088 Malanca et al. 1996 Thailand 68 0.083 Prasong and Susaira 2008 Spain 53.3 0.065 Ajayi,2008 Mexico 44.9 0.055 India 43.3 0.053 Patra et al 2006 Upper Egypt 42.8 0.052 Rashed 2013, Hashem 2009 and Maha 2007 Nigeria 37.2 0.045 Saudi Arabia 23.3 0.028 Alaamer 2008 Cyprus 8.7 0.010 Tzortzis et al 2004

The comparison in table (4) reveals that the 4. Ajayi OS, Ibikunle SB, Ojo TJ.Health Phys.; average dose rate as well as the annual effective dose 94(6) 2008. of soils are less than the recommended worldwide 5. Alaamer A.s., Turkish J. Eng. Env. Sci32, 2008. values (59 nGy-1 and0.07mSvy-1 )respectively in most 6. Al-Jundi J., Al-Bataina B.A, Abu-Rukah Y., countries.In some countries,the values are higher than and Shehadeh H.M, Radiation Measurement the recommended value and precise analysis must be 36(1-6), 2003. carried for these soils. 7. Anagnostakis, M.J, Henis E.P., Simopoulos S.E, and Angelopoulos M.G. Environmental Conclusion: International 22(1), 1996. Natural radioactivity levels in soils of Upper 8. Beretka. J., Mathew. P.J., Health Physics Egypt have been measured using Gamma 48,1985. spectrometer. The obtained specific activities of 226 9. Clouras A., Xanthos S., Antonopoulos-Domis Ra, 232 Th and 40 k were in good agreement with the M., Radiat. Prot. Dosim., 94,2001. values of Egypt listed in UNSCEAR 2000 except the 10. Copplestone D., Johnson M.S. and Jones S.R., average value of potassium. Journal of Environmental Radioactivity 55,2001. The mean values of radium equivalent 11. Dowdall M., Vicat K., Frearson I., Gerland activities are less than worldwide value for all soil S.,Lind B. and Shaw G., Journal of samples under consideration. Environmental Radioactivity 71,2004. The average absorbed dose rate and 12. El-Bahi, S.m., El-Dine N.W., Ahmed F., consequently the annual effective dose are higher in Sroor A. and Abdel Salaam M.M., Isotopes in soils of some countries than the acceptable levels Environmental and Health Studies 41.2005. reported by UNSCEAR (1988). 13. Hashem M., M.sc Thesis, Faculty of Science Qena,2009. References: 14. Huy, N.Q. and T.V. Luyen, Radiation 1. Abd El-mageed A.I, El-Kamel A.H, bbady A., Protection Dosimetry, 118,2006. Harb S., Youssef A.M.M., Saleh I.I., 15. Iqubal, M., Tufail M., and Mirza S.M., Radiation Physics and Chemistry 80,2011. Journal of Environmental Radioactivity 51(2), 2. Abdul, Ahad, PhD Thesis, Islamia University, 2000. Bahawal 2004. 16. Kohshi C, journal of health science 47(4) 2001 3. Agbalagba EO and Onoja RA., Journal of 17. Maha M., M.sc Thesis, Faculty of sciences Environmental Radioactivity 102(7),2011. Qena,2007.

3019 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

18. Malanca, A. Gaidolif, L., Pessina, V. and 26. Rudge S.A., Jhonson M.S., Leah R.T., and Dallave, G., Journal of Environmental Johnes S.R., Journal of Environmental Radioactivity 30, 1996. Radioactivity 19,1993. 19. Mireles, F., J.I. Davila, L.L. Quirino, J.F. 27. Shaban Harb, El-Kamel AH, Abbady A, Abd Lugo, J.L. Pinedo and C. Rios, Health Physics, El-Mageed and Imran Saleh, Journal of Medical 84,2003. Physics 37(1),2012. 20. Nellis P.M “ The Transfer of Radionuclides 28. Shender M.A., Applied Radiation and Isotopes from Sea to Land in Sea Spray”, Ph.D Thesis. 48(1), 1997. University of Edinburgh,1990. 29. Tzortzis M., and Tsertos H., Journal of 21. Patra AK, Sudhakar J, Ravi PM, James JP, Environmental Radioactivity 77, 2004. Hedge AG,Joshi ML. J. Radio Nucl. 30. UNSCEAR, United Nations Scientific Chem.13,2006. Committee on the Effects of Atomic Radiation, 22. Prasong K. and Susaira A, KMTL Sci.J.8(2), United Nations, New York,1988. 2008. 31. UNSCEAR, United Nations Scientific 23. Quindos, L.S., P.L. Fernadez, J. Soto, C. Committee on the Effects of Atomic Radiation, Rodenas and J. Gomez, Health Physics, United Nations, New York,1993. 66,1994. 32. UNSCEAR, United Nations Scientific 24. Rashed W., Ph.D Thesis, Faculty of Science Committee on the Effects of Atomic Radiation, Assiut, 2013. United Nations, New York, 2000. 25. Ravisankara R. Chandrasekaraub A., 33. Yang, Y.X., "Radioactivity concentrations in Vijayagopalc P., Venkatramanc B., soils of the Xiazhuang granite area, China," Senthilumard G., Eswarane P. and Appl. Radiat. Isotopes. vol 63, pp. 255–259, Rajalakshmif A., Radiation Physics and 2005 Chemistry 81(12),2012. 34. Zhou, W., Lida, T., Yang, X., Journal of Environmental Radioactivity 53,2001.

2013/12/2

3020 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Decolonization in Beecher Stowe’s Uncle Tom Cabin, Life among the Lowly

Hajiali Sepahvand

English Department, Faculty of Arts, Khorramabad Branch, Islamic Azad University, Khorramabad, Iran [email protected]

Abstract: The study tries to explore decolonization, which is a process to achieve cultural independence, in Beecher Stowe’s Uncle Tom Cabin, Life among the Lowly. As an autonomous American author, Stowe applies the techniques to declare the American independent themes; namely decolonization through literature, which is a component of a national culture. She, purposely, depicts the consciously imagination of American archetypal tendency of sacrifice and heroism to instruct the members of her society, like other nation’s autonomous authors, abrogation of the legitimized Master/Slave discourse. Moreover, she undermines this hierarchical classification through the dialectic encounter between characters and introduces Uncle Tom as American Jesus who presents the unpresentable notion of Master/Slave in the Bible. This new American interpretation, unlike traditional Biblical notion of Master/Slave, announces that it is impossible to be a true Christian and also a slave owner; therefore, the article explores an America theme in the novel, that is, decolonization. [Hajiali Sepahvand. Decolonization in Beecher Stowe’s Uncle Tom Cabin, Life among the Lowly. Life Sci J 2013;10(1):3021-3029] (ISSN:1097-8135). http://www.lifesciencesite.com. 371

Keywords- abrogation, decolonization, master/slave, undermining, unpresentable

1. Introduction productive power is already, and will continue to be, a Episteme and discourse as introduction to the major- perhaps the major-stake in the worldview colonialism, post-colonialism and decolonization, competition for power. The most powerful people and which are followed by analysis of Beecher Stowe’s societies are the ones who have the greatest knowledge Uncle Tom’s Cabin, will be presented at first. Then, resources: those with the best technology, the most decolonization, its strategies and elements will be the advanced communications and weapons systems, the central concern of the study. most highly developed medicines and the means to 2. Episteme and Discourse collect the most detailed information about their Everybody meets the question of what is good competitors (Ibid). The global competition for power, or bad. But this question is followed by more essential according to Lyotard, has thus become a battle for and radical question of how we know what is good or knowledge, and the goal is efficiency. bad. In other words, what is the criterion and standard Therefore, for Lyotard, knowledge and power are by which we can recognize goodness and badness? Or simply two sides of the same questions: who decides what rules allow or legitimize the construction of a what knowledge is, and who knows what needs to be model, literature, social conduct or classification? This decided? In the computer age, the question of is the knowledge which determines the above mentions knowledge is now more than ever question of categories as legitimized or not. But knowledge is government (Ibid). Meanwhile, Foucault says “we transformed into instruments by which authorities cannot exercise power except through the production determine legitimization and classification of of truth (Foucault, 1977b).” Therefore, we can everything. The transformation of knowledge (to the recognize the power (knowledge) in relation to criterion of how we know what is good or bad) is language and the truth. Truth is what taken into resulted in distinguishing the different episteme which account as true within the system of rules for a are, in Julian Wolfreys’ words, “constellation of particular discourse; power is that which defines, discourses that come together in a particular historical determines, and verifies truth. period as the knowledge peculiar to that epoch Discourse, is perhaps the central motif in (Wolfreys, 2006).” Myth and Metanarratives are the Foucault’s thinking. Discourse is a way of describing, best examples of such episteme. Therefore, defining, and classifying, and thinking about people, paradoxically, knowledge is power and power is things and even knowledge and abstract systems of knowledge. Lyotard puts it so: “knowledge and power thought. In other words, discourses are the various are simply two sides of the same questions: who ways: artistic, social, political … in which people think decides what knowledge is, and who knows what and talk about their world. needs to be decided? (Lyotard, 1984)” Discourse in Michel Foucoult’s words is: Correspondingly, he argues that Knowledge in the “…something as an individualizable group of form of an information commodity indispensable to statements, and sometimes as a regulated practice that

3021 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

accounts for a number of statements (Foucault, 1972).” which he challenges notions of identity, culture, and Therefore, according to Michel Foucault, discourse is a nation as a coherent and unified entity that exhibits a group of statements or meaningful passages of linear historical development. language (spoken or written) which are in interaction In “Can the Subaltern Speak?” (1983), Spivak with other group of statements as reflection of social focused on the structures of colonialism, the and epistemological practices of a group in a historical postcolonial subject and the possibility of postcolonial epoch. This passage reflects the rhetorical practices, discourse which draws on deconstructive practices, the and social epistemological of a group. In other words, feminist movement, and Marxism. it is the power of language to constrain, reflect, and 4. Decolonization influence those practices in a group. Foucault in his Weather implicit or explicit, decolonization, empirical works, such as Madness and Civilization in general, is a revolt, against imperial domination. In (1967), the Birth of the Clinic (1973), Discipline and other words, it is a kind of awareness against Punishment (1991), and Will to Knowing (1971), oppression and inferiority like what was done in examined the ways that experts and professionals like Marxist movement against master class by slaves doctors, psychiatrists, and criminologist had increased (working class) or by Feminist against male-centered their authority through the rise of the new discourses. societies. Being different in early and present 3. Discourses of Colonialism and Post-colonialism involvement and engagement, like them, According to the mentioned before decolonization can be divided into two phases: first or argumentation, the twentieth and twenty first centuries early phase, which was started by African decolonizers, experienced two great episteme: Modernity and post- derived from the works of political theorists like modernity. Naturally, both episteme consisted of some Frantz Fanon (1952, 1961, 1967) and Albert Memmi discourses. The first one, for example, includes (1965) who located its principal characteristic in the structuralism, modernism, colonialism…. notion of the imperial–colonial (colonizer-colonized) Among the analysts and critics of colonialism, we dialectic itself. In this respect, the early involvement can mention Kant who in his theory of “cosmopolitan and engagement of decolonization as Ashcroft puts, is right,” (1724-1804), discussed the issue of justice and ‘a profound complicity with the imperial powers from criticized European imperialism and defended non- which they sought to emerge as free agents’ (Ashcroft, European peoples (Muthu, 2000). 2007), that is, freedom and emancipation as free Moreover, Albert Memmi, and Amie Cesaire subject. Fanon, writing in the 1950s during the similarly were the critics of colonialism. Another critic, Algerian struggle for independence from French who had a role in shaping the discourse of colonialism, colonial rule, through psychoanalysis of colonial was Amie Cesaire. In his work (1991), he makes a subject produced the ways in which the colonial systematic defense of the societies destroyed by subject’s identity is constructed by the colonist. In his imperialism. He asserts: famous and influential essay (Fanon, 1986), Fanon Between the colonizers and colonized there is shows the effects of racism on the construction of the room only for forced labor , intimidation, subject and the production of identity. In this essay pressure, the police taxation, theft, rape, which is an interior monologue, Fanon uses the compulsory crops, contempt, mistrust, self- constructed identity of the oppressed narrator by the complacency, swinishness, brainless elites, racist oppressors as:‘ “Dirty nigger!”, “Negro!”’ and and degraded classes. No human contact, but eventually he puts this construction as the construction relations of domination and submission of an object among the other objects not a subject: which turn the colonizing man into a class- ‘I came into the world imbued with the will to room monitor, an army sergeant, a prison find a meaning in things, my spirit filled with guard, a slave driver, and the indigenous man the desire to attain to the source of the world, into an instrument of production (p.26) . and then I found I was an object in the midst of The second episteme, Post-modernity, presented other objects. Sealed into this crushing some unpresentable discourses including post- objecthood, I turned beseechingly to others. structuralism, racism, slavery…and post-colonialism. I stumbled, and the movements, the The latest one was proposed by Edward Said (1977), attitudes, the glances of the other fixed me there, publication of Frantz Fanon (1952) and Chinua in the sense in which a chemical solution is Achebe (1963a) as the influential practical critic of fixed by a dye. I was indignant; I demanded an binary opposition or Manichean duality of white/black explanation. Nothing happened. I burst apart. in which the first sign axiomatically has been Now the fragments have been put together privileged. In addition, Homi k. Bhabha in his work again by another self (Fanon, 1986). (1994) emphasized the concerns of the colonized On the whole, early decolonization seeks to nations and introduced the notion of “hybridity” in invert the structures of domination and

3022 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

substituting the tradition of the colonized nations This decolonization which was the concern of early in place of imperial-dominated canon. Therefore, decolonizers can be observed in H.M. Green (1961); the early decolonization is dialectic of Carl F. Klinck (1965), a large body of text in the subject/object, self/other which is resulted in a United State (Russell Reising, 1978), and many others. national revolt and in Parry term ‘nationalist Thus, the early stage of decolonization is a kind of liberationist narratives’…( Parry,1987). consciousness through which settler colonized people But in the present or advanced phase, perceive themselves as individuals who can freely and decolonization criticism is extended by Edward autonomously initiate action and construct their own Said into the area of challenging and undermining identity, that is, Agency, which in Ashcroft’s view absolute and axiomatic principles upon which the refers to the ability to act or perform an action. world classification into superiority of the In contemporary theory, it hinges on the occident and inferiority of the orient is established. question of whether individuals can freely and Such classifications in Said’s view are man-made, autonomously initiate action, or whether the not absolute (Said, 1977); therefore, they are used things they do are in some sense determined for domination by Europe. Thus, decolonization by the ways in which their identity has been has turned away from simple inversions towards a constructed. Agency is particularly important questioning of forms and modes, to unmasking the in post-colonial theory because it refers to the assumptions upon which such canonical ability of post-colonial subjects to initiate constructions are founded in a way that it moves action in engaging or resisting imperial power first to make their cryptic bases visible and then (Ashcroft, 2007). destabilizes them as Ashcroft puts it : In the later stages some decolonizers try to Decolonization is the process of revealing develop their self-assertion through independent and dismantling colonialist power in all its national literature in a controversial way like L. forms. This includes dismantling the Kramer (1981), W.H. New (1989) and Charles hidden aspects of those institutional and Brockden Brown’s (1799) work in America. But, the cultural forces that had maintained the problem to which they meet is lake of a national and colonialist power and that remain even local language as their own language. In other words, after political independence is achieved. the language through which they want to establish and Initially, in many places in the colonized express a separated independent national cultural world, the process of resistance was identity is metropolitan language: conducted in terms or institutions The colonial writer does not have appropriated from the colonizing culture words of his own….Try to speak the itself… (Ashcroft et al. 2007). words of your home and you will 5. Decolonization in the Setter colonies: discover – if you are a colonial – that In the settler colonies like the United States, you do not know them . . . perhaps Canada, New Zealand, and Australia, the land was our job was not to fake a space of occupied by European colonists who dispossessed and our own and write it up, but rather to overwhelmed the Indigenous populations. Therefore, find words for our space-lessness . . . in these colonies, decolonization, which is possible Instead of pushing against the grain through Agency, Nationalism, Appropriation and of an external, uncharged language, Abrogation, is different from the invaded colonies. In perhaps we should finally come to such colonies, according to Ashcroft et al., writing with that grain’ (Lee, 1974). the first task seems to be to establish Therefore, the real concern is the control over that the texts can be shown to constitute a the means of communication, that is, power of writing literature separate from that of the in the colonial situation as has been discussed in The metropolitan centre. A vast and Conquest of America by Tzvetan Todorov (1974). But impressive body of literary histories, how is it possible while the only dominant language as thematic studies, and studies of the medium of power is the language of the centre? In individual literary traditions has accrued other words, post-colonial writing only can defines over the last one hundred and fifty years itself by seizing the language of the centre: ‘The or so in the white cultures of settler crucial function of language as a medium of power colonies. The task of compiling a demands that post-colonial writing defines itself by national literary history has usually been seizing the language of the centre and re-placing it in a an important element in the discourse fully adapted to the colonized establishment of an independent cultural place’(Ashcroft et al., 2004). It is because language is identity (Ashcroft et al., 2004). the medium through which a hierarchical structure of

3023 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

power is perpetuated, and conceptions of truth, order, adventures, growing out of the condition of their own and reality become established. Post-colonial writing is country in which, as explicitly Renata Wasserman going to reject such power and; therefore, post- (1984) puts it, they try to legitimize the Americanhood colonial writing is the process by which the language, as well as differentiate it from the European, through with its power, and the writing, with its signification of stressing ‘the difference in nature and equivalence in authority, has been seized from the dominant European value’ (Wasserman, 1984) between the New World culture. Post-colonial writing does this through two and the Old. For doing so, they have taken the English process of language, transformed it into english to ‘bear the “the abrogation or denial of the privilege of burden’ of their ‘own cultural experience’ as well as ‘English’ involves a rejection of the application, for example, of some fascinated American metropolitan power over the means of subjects which match those of the post-colonial theory communication” and ‘the appropriation and of decolonization-namely exploring the dialectic clash reconstitution of the language of the centre, the between cultures in the texts-including the dialectic process of capturing and remoulding the clash between civilization (White) and nature (Black language to new usages, marks a separation or Indian), drawing American myth (Edenic Dream from the site of colonial privilege. Abrogation Land), Initiation of Americanhood, so that they could is a refusal of the categories of the imperial compete, undermine and abrogate the axiomatically culture, its aesthetic, its illusory standard of superiority of Europe or white and declare their own normative or ‘correct’ usage, and its culture as the melting pot (Dream Land) in which, assumption of a traditional and fixed meaning unlike European tradition, both the white and black ‘inscribed’ in the words. It is a vital moment in must be regarded as human equally. Americans’ the de-colonizing of the language and the decolonization, therefore, is their straggle to express writing of ‘english’, but without the process of themselves in their literatures, destabilizing colonial appropriation the moment of abrogation may assumptions by identifying their cultures, proving not extend beyond a reversal of the there is no superiority for other cultures, and making a assumptions of privilege, the ‘normal’, and space for their voice to be heard throughout the world, correct inscription, all of which can be simply that is, Ashcroft the theme of the celebration of the taken over and maintained by the new usage struggle towards independence in community (Ashcroft et al., 2004). (Ashcroft et al., 2004) or what “which makes them Therefore, post-colonial text is itself a site of distinctively postcolonial (Ibid).” As the concern of struggle for linguistic control which is resulted in the this research, therefore, the following up materials will appropriating discourse. This struggle extends to the be traced through analyzing the novel in this part. disputes concerning theme, form, and genre definition, 6. Decolonization in H. Beecher Stowe’s Uncle implicit systems of manner, custom, and value. Tom’s Cabin, Life among the Lowely: Now, the question is that may we say that To analyze the novel as decolonization, it is language constitutes reality? Paradoxically, the answer necessary to trace American Dream, Americanhood as is yes! But where is the center of reality, that is, its well as American Adam in Uncle Tom’s innocent and axiomatic center according which the other realities by purity whom Stowe exaggeratedly portraits to other languages are constructed? The answer is that challenge, undermine, and abrogate the axiomatically there is not any centre of reality just as there is not any justified and legitimized Slavery by society, state and pre-given unmediated reality and control over the Christian as the prevailing illusion of European which means of communication determines the center of spread into America by the white. In other words, the reality; therefore, the colonized nations through research is going to show Stowe’s challenging the plot appropriation of language of metropolitan centre-- ‘to of American dream as a partial dream land to modify it convey in a language that is not one’s own the spirit and propose the alternative and design of the real that is one’s own’ (Rao, 1938), or makes it ‘bear the perfect American Dream Land which is lack of such burden’ of one’s own cultural experience (Achebe, oppression and cruel slavery. For doing so, she puts 1975)-- and self-assertion abrogate its centrality and the words in the mouth of Mrs. St. Clare “all I want is they define themselves as the centre and they may that different things be kept in different boxes. The reconstruct reality according to their own pattern of whole frame-work of society, both in Europe and conventions, expectations, and experiences, that is, America, is made up of various things which will not establishment of the link between the received English stand the scrutiny of any very ideal standard of and place or in Emerson’s phrase, , their ‘original morality (p.24o-1).”Therefore, Uncle Tom is relation with the universe’ (Emerson, 1836). American Archetypal tendency of sacrificial heroism- On the whole, American decolonization by its namely American Jesus-and the novel as a didactic early writers is through exhibition of a series of document is that part of the Bible which, unlike

3024 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

European Bible, contains new message of Slavery Tom and Little Eva become great friends and she eradication, that is, American Biblical Identity or decorates him with wreaths of roses around his neck; decolonization. thus, Stowe violates the gap between the white and How Uncle Tom is the self-reliance American black or depicts Tom who knows no borders, namely character or Adam? Despite of the cruel White masters beyond the prevail limitations. Moreover, when Legree as Simon Legree, he is honest to every body as well as rages at him, “Do you know I’ve made up my mind to even Legree; thus, Stowe’s decolonization is through KILL you?” Tom does not fear Legree; instead, he undermining the very axiomatically superiority of the senses only that “the hour of release” is at hand (p. white (Europe) and inferiority of the black because 537). Consequently, he, like American Adam, is… Tom is, actually, the uncorrupted, innocent and non- “the hero of the new [spiritual] adventure,…standing hypocritical Adam before and after Fall who like alone, ready to confront whatever awaited him with the Christ accepts and loves both friends and enemies. In aid of his own unique and inherent resources (Lewis, other words, Stowe's Uncle Tom is American character 1908).” who contains boundless goodness, innocence, moral Tom, like Christ, quotes from the Bible: “Pray for purity, and social innocence which posit him as overt them that spitefully use you,” (p.75) and practically version of Adam before the Fall, love for all (white says “I forgive ye, with all my heart!” when Quimbo and black) people, determination to better himself, said “O, Tom!”, “we’s been awful wicked to ye!” non-hypocrisy - “no civilized hypocrisies and bland (P.540). Thus, Stowe is clearly emphasizing his deceits” (Melville, 1963) - faith and loyalty to God, goodness and his belief in the tenets of Jesus, namely Christ and his cruel master, that is, a boundless forgiving and compassionating every body. He is a universal character who is beyond the regional criteria. Christian and to him, “the Lord’s grace is stronger” In his unyielding struggle and tendency towards than vengeance (p. 75); therefore, he is imitating his goodness, Tom, as we see in different parts of the God. He says Haley, the white cruel master, will have novel, is laboriously practicing his penmanship, just as to answer to God for his wickedness. Tom says that he he read and re-read, with difficulty, his Bible, because would rather be sold “ten thousand times over” than he wants to become not only a better man, but a better “have all that ar poor crittur’s got to answer for.” He Christian man. Among the other slaves on the Shelby understands that “Mas’r couldn’t help hisself.” This is plantation, Tom serves as a kind of spiritual father who Christian intuition and exceptional understanding on “has, naturally, an organization in which the morality the part of a man who has just been “sold” for money was strongly predominant (pp.42-3).” They gather to to another man, a stranger, who will, in turn, sell Tom his cabin for prayer. According to Stowe, “but it was to whomever he wishes (p. 75). Ironically, his vision in prayer that he especially excelled. Nothing could of Christianity is that of Christ’s, while his white exceed the touching simplicity, the childlike masters’ vision of Christianity is satanic because of earnestness of his prayers (P.43).” It is this child-like their belief in the concept of slavery as a right and earnestness that causes Tom to be uncompromisingly natural one. On the whole, this deliberatively spiritual loyal to his “Mas'r”. Tom recognizes the terrible superiority of Tom or the black and inferiority and injustices that are inflicted on him and his fellow cruelty of the white is the very abrogation of the blacks, but his firm belief in the Bible will not allow current system of Master/Slave or declaration of him to rebel. His models are the saints and Christ, who Americanization and mythical dream land which also suffered and died for their beliefs. Tom is reading rejects the injustice and its inhabitants contain, like in the Bible that “I'm in the Lord’s hands (P. 125).” Tom as the symbol of American Adam, boundless We are told that if Tom were not a Christian, he could goodness, love for all people, determination to better be dishonest. Tom is flogged to death, but before he themselves, non-hypocrisy, faith and loyalty to God, dies, he tells young George Shelby that he is “going Christ and their cruel master, that is, a boundless into glory and that despite everything, “I loves ‘em all! universal character who is beyond the regional criteria. I loves every creature, every whar!—it’s nothing but Uncle Tom, in Stowe’s novel, is her Archetypal love! O Mas’r George! What a thing ‘tis to be a tendency of sacrificial heroism in which she Christian!(P.545).” As a result, Tom is the American imaginatively and, in Jung’s term, (Jung, 1968) Adam who transcends the limitation of racism and “consciously” applies her tendency and draws the color as well as proposing the modification of the American myth of how to sacrifice the lamb to save society in which the dominant white masters are lack the community or, in Rosenberg’s term, “instruct of any true conscience. members of the community in the attitudes and Expectedly, in a scene (p.194) in which Eva slips behavior necessary to function successfully in that overboard into the river that is Tom who dives in and particular culture (Rosenberg 1986)”; therefore, her saves her life. In gratitude, Eva’s father, Augustine St. novel is a book that was clearly written to be a didactic Clare, a kindly, dreamy man, buys Uncle Tom (p.198). document to show her readers that Christianity and

3025 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

slavery were antithetical and because of her While watching a society which is illusively ruled dramatically effective depiction of Tom’s unjust by the justified Christian master/slave system, Stowe murder and his unyielding goodness, her novel became symbolically and exaggeratedly sacrifices Tom to a sort of American Bible for the Abolitionists. Uncle awaken the society, express her own firm belief and Tom’s death served as the graphic epitome of her save the oppressed black slaves. Stowe has portrayed indictment against slavery. This American Bible says this sacrificial heroism in Uncle Tom in a way that he that it is impossible to be a true Christian and also a reflects some features of self-reliance American Adam slave owner. whose high capacity solves (melting pot) every kinds Dialectic encounter between axiomatically good, of behavior in it, that is, a prototype character who is normal and “civilized Southern Masters of plantations different from the narrow-minded white (Europe) and evil and abnormal barbarous Black Northern” or people. African Slaves is the central theme of the novel which After St. Clare died his wife Marie, a Christian, is the Manichean delirium of Master/Slave and emerges as a thoroughly bitter, wicked woman and the White/Black by Fanon as well as Said’s “Us and servants immediately sense her “unfeeling, tyrannical Them”. Therefore, it is to say that Americans are, character (p. 418).” She believes that “these creatures paradoxically, both spiritual and physical colonizers of [slaves] get used to it [punishment]; it’s the only way the black; consequently, we can analyze the novel as they can be kept in order (p.420).” We are informed by Stowe’s Decolonization against the white American the novel that she impulsively decides to sell the slaves colonizers who were colonized before by the white at auction, disregarding her late husband who European as well as modification and reformation of promised to give Tom his “emancipation” (p. 398). As American Dream, Americanhood, and American Jesus Miss Ophelia reminds her that “Augustine promised as the follower of Brown, Cooper, Melville…, that is, Tom his liberty, she says no “Tom is one of the most disillusionment of the white American illusion or valuable servants on the place (p. 423)” and she sells absolute decolonization. Tom to Simon Legree. Thus, Tom encounters Simon Stowe’s undermining and abrogating Legree, one of the most infamous villains and their axiomatically superiority of the white masters encounter is resulted in undermining the axiomatically (civilization) and inferiority of the slaves (wilderness) superiority of the civilized white slave and glory of is in the dialectic encounter between Tom (American Tom, that is, Legree's cruelty to Tom, and Tom's Jesus) and Mr. Legree (Satan-evil) which is not only strong faith and sacrificial heroism. Stowe points out the misery, nobility and greatness of Tom (wilderness) that the first thing that Legree does is that he puts and ugliness of the white as Legree (civilization) but chains on Tom’s wrists and ankles. She says that Tom also Stowe’s perception of the need for a Christ like and other blacks are treated like chairs and tables and figure who loves both his friends and enemies. they should not be treated like “a man [who] can feel Notwithstanding his exaggerated torture and tragic (pp. 439-40).” Interestingly, this is what Fanon, in his death; symbolically, he saves the slaves because the famous and influential essay, shows as the effects of novel is resulted in the civil war against slavery; racism and he puts this exploitation as “I found I was therefore, this is the satisfaction of the archetypal an object in the midst of other objects …. Sealed into tendency of sacrifice and heroism (scapegoat) which is this crushing objecthood….” Then, Legree smashes his done by Stowe to save the slaves as Christ did for “great, heavy fist” on Tom’s hands: “I never see the human being. In other words, Tom is the American nigger, yet, I couldn’t bring down with one crack (p. Christ (Jesus) who has a new message and 442).” As we are tolled in the novel, while Legee finds interpretation of the Bible about Master/Slave which is the Bible in Tom’s pocket, seizes him, and proudly different from the current Bible- that is, Lyotard’s introduces himself that he’ll have no “bawling, praying, “unpresentable” (Lyotard, 1984) in the Bible which singing niggers on [his] place.” He shouts that on his “can be presented” or undermining the legitimized plantation, “I’m your church …you’ve got to be as I Christian Master/Slave. It is portrayed in the scene in say (p. 441).” He prides himself on “knocking down which Stowe parallels Christ and Uncle Tom and says niggers” with one single blow of his mighty fist (p. besides Tom, there has already been “One whose 442) as well as calling Tom “best” (p. 446), “cussed” suffering changed an instrument of torture, degradation, (466) and declares that “Ye won’t find no soft spot in and shame, into a symbol of glory, honor, and me, nowhere. So, now, mind yerselves; for I don’t immortal life (p.538).” Thus, rejection of slavery show no mercy (p. 443)!” After about one century, which is “unpresenable,” in the traditional European Fanon in his essay (1986) in a similar way uses the Bible, “can be presented” by Tom (American Christ) constructed identity of the oppressed narrator by the through his sacrificial death because of not flogging a racist oppressors as:‘ “Dirty nigger!”, “Negro!”’ which slave woman in Legree’s order. is continuation of this literary war against Master/Slave system or early decolonization of mind.

3026 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

There is the scene in the novel in which Tom is that there is Eternity waiting for him.” He speaks the toiling in the cotton fields and he sees a woman who is word, and it “thrilled the black man’s soul.” Then kicked in the head; he tries to help her by filling her “Tom faces Legree and says that he’s not afraid to die; sack with some of his cotton, but she fearlessly the Lord Almighty is beside him (p. 494).” When protests. Legree hears about the incident, and he orders Legree says “Tom that yor God doesn’t help you, hold Tom to flog the woman. Tom says that he cannot, “no on me, I am somebody; and can do something,” Tom way possible.” Legree strikes him across the face and says, “The Lord may help me, or not help; but I’ll hold says that Tom must flog the woman. Axiomatically to Him, and believe Him to the last (p. 509).” superiority of Master which is claimed by Legree has One night, as the novel informs us, Cassy calls to been betrayed in the novel so: Tom that she has drugged Legree, and she and What! ye blasted black beast! tell me ye Emmeline are going to escape. But Tom says that he don’t think it right to do what I tell ye! What cannot go. He feels that he “must” stay with the rest of have any of you cussed cattle to do with these “poor souls” and “bear my cross” with them “till thinking what’s right? I’ll put a stop to it! Why, the end.” He urges Cassy to try and escape, however. what do ye think ye are? May be think ye’r a “I’ll pray with all my might for you.” Then Cassy gentleman master, Tom, to be a telling your agrees to go. “Amen!” says Tom. “The Lord help ye! master what’s right, and what an’t! So you (pp. 517-18).” pretend it’s wrong to flog the gal! (p. 466). After their escape, Legree finds Tom and asks Tom refuses again and says “I think so, him “Do you know anything?” Tom says “I know, Mas’r,” “the poor crittur ’s sick and feeble; ’t would be Mas’r; but I can’t tell anything. I can die! (p.537)”Like downright cruel, and it’s what I never will do, nor Jesus, he is ready to give his soul to save the others begin to (p. 466).” Undermining the axiomatically and he does so because in spite of knowing their plot superiority of Master is declared by Tom’s volunteer he does not betray them and he is kicked until his readiness for sacrifice which is the real mastery: death. Stowe says us that, “like his Master, he knew “Mas’r, if you mean to kill me, kill me; but, as to my that, if he saved others, himself he could Not save; nor raising my hand agin any one here, I never shall,—I’ll could utmost extremity wring from him words, save of die first!” Tom spoke in a mild voice, but with a prayers and holy trust (p.539).” Cassy “learned the decision that could not be mistaken (p. 466).” sacrifice that had been made for her and Emmeline Stowe, overtly, overthrows this legitimized (544).” mastery when she portrays Legree as a “ferocious In the last moments, Tom, amazingly says that beast, that plays with its victim before he devours it” Legree “’s a poor mis’able critter! it’s awful to think and links this cruelty to traditional Christian when she on ’t! O, if he only could repent, the Lord would declares Legree’s answer that “didn’t you never hear, forgive him now; but I’m ’feared he never will!” “I out of yer Bible, ‘Servants, obey yer masters’? An’t I hope he won’t!” said George; “I never want to see him yer master? Didn’t I pay down twelve hundred dollars, in heaven!” “Hush, Mas’r George!—it worries me! cash, for all there is inside yer old cussed black shell? Don’t feel so! He an’t done me no real harm,—only An’t yer mine, now, body and soul? (p. 466).” opened the gate of the kingdom for me; that’s all! (pp. Although Legree has flogged Tom and in the depth of 545-6).” Stowe does not tell us, in detail, the degree of physical suffering, he looks earnestly to heaven and Legree’s final cruelty to Tom. She only says that exclaims: “No! no! no! my soul an’t yours, Mas’r! Legree “smote his victim to the ground,” and then she You haven’t bought it,—ye can’t buy it! It’s been comments that “what man has nerve to do, man has not bought and paid for, by one that is able to keep it;—no nerve to hear (538).” Eventually, although Stowe does matter, no matter, you can’t harm me! (p. 466).”Stowe not say so, we feel that Tom must be a counterpart of puts these words in the mouth the American Christ-he Christ in this scene and that the two of them are has a Bible in his pocket- who can “present, victims of gross injustice. unpresentable” in the Bible which rejects absolute George, Mr. and Mrs. Shelby’s young son, who ownership of master on slave and proclaims the taught Uncle Tom how to read and write, is going to freedom of his soul, that is, symbolic declaration of find Tom and finally finds him who is dying. When independence. sees him, Tom sobs: “Now I shall die content.” Clearly, Next day, Legree says if Tom “begs his pardon,” Tom knows that he is dying, and he is prepared for his Legree will ease up on him (p. 493). Cassy, one of the death. He says “The Lord’s bought me,” using a most slaves says that is impossible; Tom will never do so. natural analogy of master and slave and the only Then Legree turns on her savagely: “He’ll beg like a choice for slaves and, he says further, “I long to go. dog.” Legree “taunts the old black man, kicking him, Heaven is better than Kintuck (p. 545).” George calls and calling him a beast” and “Tom says that he knows him ‘Poor, poor fellow,” and Tom chides him for Legree can do terrible things to him, but he also knows doing so: “Don’t call me poor fellow. . . . I have been a

3027 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

poor fellow; but that’s all past and gone, now. I’m paradoxically, both spiritual and physical colonizers of right in the door going to glory! . . . I’ve got the the black; consequently, we can analyze the novel as victory (p. 545).” Stowe’s Decolonization against the white American George offers to buy Tom’s body, for he feels that colonizers who were colonized before by the white Tom is surely dead, but Legree refuses. George European as well as modification and reformation of ignores him and he has loaded Tom’s body in the American Dream, which was proposed by Brown, wagon then he turns to Legree, “I will proclaim this Cooper, Melville…, that is, disillusionment of the murder. I will go to the very first magistrate and white American illusion or absolute decolonization. expose you (p. 547),” but Legree answers “What a fuss, Another point is that deliberatively spiritual for a dead nigger (p. 547).” Uncle Tom is buried superiority of Tom or the black and inferiority and quietly on a dry, sandy knoll, shaded by a few trees cruelty of the white is the very abrogation of the (p.548). The blacks who have accompanied George current system of Master/Slave or declaration of beg him to buy them. George cannot do it but he vows Americanization and mythical dream land which to do “what one man can [do] to drive out this curse of rejects the injustice and its inhabitants contain, like slavery from [his] land! (p. 548).” George Shelby frees Tom as the symbol of American Adam, boundless his slaves, in the name of Uncle Tom, for he vowed on goodness, love for all people, determination to better Tom’s grave never to own another slave. “Rejoice, in themselves, non-hypocrisy, faith and loyalty to God, your freedom and be as honest and as faithful a Christ and their cruel master, that is, a boundless Christian as Tom was (p. 572)”; thus, Tom, as universal character who is beyond the regional criteria. American Christ, saved others by his death. As we Eventually Tom, as American Christ, saved others know, this is the literary war and introduction for great by his death. As we know, this is the literary war and American war against slavery by Lincoln because introduction for great American war against slavery by American Dream Land is the only place for this Lincoln because American Dream Land is the only humanist operation to add another element to the place for this humanist operation to add another component of this unique independent identity, that is, element to the component of this unique independent American Decolonization. identity, that is, American Decolonization. 7. Conclusion Corresponding Author A number of decolonization techniques in this Hajiali Sepahvand, PhD candidate, Literary Criticism: article were applied to Beecher Stowe’s Uncle Tom Post-colonial studies. Cabin, Life among the Lowly to see how References decolonization can be accounted for in terms of 1. Achebe, Chinua. (1975). Morning Yet on literary development. Creation Day. New York: Doubleday. Uncle Tom can be analyzed as Stowe’s Archetypal 2. Achebe, Chinua. (1963a). No Longer at Ease. tendency of sacrificial heroism in which she London: Heinemann. imaginatively and, in Jung’s term, “consciously” 3. Ashcroft, W.D., Griffiths, Gareth and Tiffin, applies her tendency and draws the American myth of Helen (2004) The Empire Writes Back. how to sacrifice the lamb to save the community or, in London: Routledgep. Rosenberg’s term, “instruct members of the 4. Ashcroft et al. (2007). Post-colonial Studies, community in the attitudes and behavior necessary to The Key Concepts, Routledge,Taylor& function successfully in that particular culture” as Francis e-Library,p. 3,4, 12,57, 56, . hero myth and epics; therefore, her novel is a book 5. Bhabha, Homi K. (1994). The Location of that was clearly written to be a didactic document to Culture. London and New York: Routledge. show her readers that Christianity and slavery were 6. Brockden Brown, Charles. (1973). Edgar antithetical and because of her dramatically effective Huntly. Ed. David Stineback. New Haven: depiction of Tom’s unjust murder and his unyielding College and University. goodness, her novel became a sort of American Bible 7. Cesaire, Aime. (1991). Discourse on for the Abolitionists. This American Bible says that it Colonialism. Boston: Beacon Press,. is impossible to be a true Christian and also a slave 8. Emerson, Ralph, Waldo .(1836). ‘Nature’ in owner. Stephen E. Whicher (ed.). Selections from Dialectic encounter between axiomatically good, Ralph Waldo Emerson. Boston, MS: normal and “civilized Southern Masters of plantations Houghton Mifflin. 1956. and evil and abnormal barbarous Black Northern” or 9. Fanon, Frantz. (1959). Studies in a Dying African Slaves is the focal point in the novel which is Colonialism. Trans. H.Chevalier. the Manichean delirium of Master/Slave and Harmondsworth: Penguin, 1970. White/Black by Fanon as well as Said’s “Us and 10. Fanon, Frantz. (1961). The Wretched of the Them”. Therefore, it is to say that Americans are, Earth. Harmondsworth: Penguin.

3028 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

11. Fanon, Frantz. (1967). Black Skin. White 29. Melville Herman. (1936). Moby Dick or Masks. New York: Grove Press. the White Whale, Spenser press. P.40. 12. Fanon, Frantz. (1986). Black Skin, White 30. Memmi, Albert. (1965). The Colonizer Masks, trans. Charles Lam Markmann, and the Colonized (trans Howard London:Pluto Press. Greenfield).Boston, MA: Beacon Press 13. Fanon, Frantz. (1952). Black Skin White 31. Memmi, Albert. (1965). The Coloniser Masks (trans. Charles Lam Markmann). and the Colonised. New York: Orion London: Paladin [1968]. Press. 14. Foucault, Michel. The Political Function of 32. New, W.H. (1989). A History of the Intellectual, Radical Philosophy. Canadian Literature. London: Harvester. 1977b. Macmillan. 15. Foucault, Michel. Archaeology of Knowledge, 33. Parry, Benita. (1987). ‘Problems in trans. A. M. Sheridan Smith. London: current theories of colonial discourse’, Tavistock (first published 1969). 1972. P.80. Oxford Literary Review, 9, nos 1 & 2. 16. Green, H.M. (1961). A History of Australian 34. Rao, Raja. (1938). Kanthapura. New Literature, 2 vols., Sydney: Angus and York: New Directions. Robertson 35. Reising, Russell. (1987). The Unusable 17. Jung, C. G. (1968). Man and his Symbols, 36. Past: Theory and the Study of American London: Adus. Literature. New York and London: 18. Klinck, Carl F. (1965). Literary History of Methuen (New Accents). Canada: Canadian Literature in English, 3vols, 37. Roosenberg Donna. (1986). World Toronto/London: University of Toronto Press. Mythology, NTC Publishing Group, 19. Kramer, L. (ed.). (1981). The Oxford History Lincolnwood, Illinois USA. p. xvi of Australian Literature. Melbourne: Oxford 38. Said, Edward. (1978). Orientalism. New University Press. York: Pantheon. 20. Lee, Dennis. (1974). ‘Cadence, country, 39. Spivak, Gayatri Chakravorti. (1999). A silence: writing in colonial space’, Boundary Critique of Postcolonial Reason. 2,3, 1 (Fall). Cambridge and London: Harvard 21. Lewis, R. W.B. (1908). The American Adam. University Press.". (1983). Chicago: University of Chicago Press. P.5. 40. Can The Subaltern Speak?". London: 22. Lyotard, Jean-François. (1984). The Methuen. Postmodern Condition: A Report on 41. Stowe H. Beecher. (2009). Uncle Tom’s Knowledge, trans. Geoffrey Bennington and Cabin or, Life Among the Lowly. The Brian Massumi, Manchester: Manchester Cambridge, Manchusetts, and London, University Press. p.81) Belknap Press of Harvard University 23. Lyotard, Jean-François .The Postmodern University, England, Condition: A Report on Knowledge, trans. 42. Todorov, Tzvetan. (1974). The Conquest Geoffrey Bennington and Brian Massumi, of America: The Question of the Other. Manchester: Manchester University Press. Trans. Richard Howard. New York: 1984. P. 8. Harper and Row 1982. 24. . Ibid. P. 5. 43. Wasserman, Renata. (1984). ‘Re- 25. . Ibid. P. 9. inventing the New World: Cooper and 26. Muthu, Sankar. Kant's "Cosmopolitan Alencar’,Comparative Literature, 36, 27. Right": Global Justice, Foreigners, no. 2 (Spring). and Anti – Imperialism in the Age of 44. Wolfreyes, Julian. Key Concept in Enlightenment. Vol. 7, no. 1, New Literary Theory. Second edition, London York: Ny10003- Constellations, 2000. and Losangeles: Edinburgh 28. Maxwell, D.E.S. (1965). ‘Landscape and University Press. 2006. P. 36. Theme’ in Press 1965.

2/22/2013

3029 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Significance of Urinary Monocyte Chemoattractant Protein-1 in Early Detection of Nephropathy in Type 2 Diabetic Patients

Mona I Nabih1, Ahmed El-Mazny1, Nadia A Mohamed1 and Amal R El-Shehaby2

Departments of Internal Medicine1 and Medical Biochemistry2, Faculty of Medicine Cairo University [email protected]

Abstract: Objective: Monocyte Chemoattractant Protein-1 (MCP-1) is the strongest known monocytes chemotactic factor and has been implicated in the development and progression of diabetic nephropathy. So, measuring urinary MCP-1 would be of great significance in the diagnosis and intervention of diabetic nephropathy. This study aimed at determining the levels of urinary MCP-1 (uMCP-1) at different stages of diabetic nephropathy and to study its correlation with other clinical and laboratory parameters in Egyptian type 2 diabetic subjects. Materials and methods: A total of 45 type 2 diabetic subjects were classified into three groups based on their urinary albumin excretion and were compared with non-diabetic controls (Group IV) (n=15). The groups of diabetic subjects were Group I (normoalbuminuria) (n=15), Group II (microalbuminuria) (n=15) and Group III (macroalbuminuria) (n=15). The four groups were age and sex matched. Medical history, clinical examination, anthropometric and biochemical details were recorded for all the subjects. Urinary MCP-1 levels were measured by using solid phase ELISA method. Results: The mean level of uMCP-1 in patients with type 2 diabetes was significantly higher than in control subjects (p<0.0001) and the mean level of uMCP-1 in the normoalbuminuric group was significantly higher than in the controls (p<0.0001). Compared with the normoalbuminuric group, the mean levels of uMCP-1 in the microalbuminuric and macroalbuminuric groups were significantly higher (p<0.0001). Also, the mean level of uMCP-1 in the macroalbuminuric group was significantly higher than that in the microalbuminuric group (P<0.0001). The levels of uMCP-1 were positively correlated with the levels of albuminuria in all diabetics (p< 0.0001) and in the macroalbuminuric group (p<0.05). The levels of uMCP-1 were significantly negatively correlated with eGFR in the microalbumnuric group (p< 0.05). The levels of uMCP-1 correlated positively with HbA1C in all diabetics (r=0.6, p<0.0001) and in the macroalbuminuric group (r = 0.6, p < 0.05) and correlated positively with serum total cholesterol (r=0.7, p<0.0001) and LDL-C in diabetic patients (r=0.7, p<0.0001). Conclusion: Our study demonstrated that urinary MCP-1 levels increased gradually in type 2 diabetic subjects with increased albuminuria. It is significantly associated with the same risk factors of diabetic nephropathy. [Mona I Nabih, Ahmed El-Mazny, Nadia A Mohamed and Amal R El-Shehaby. Significance of Urinary Monocyte Chemoattractant Protein-1 in Early Detection of Nephropathy in Type 2 Diabetic Patients. Life Sci J 2013; 10(1)3030-3039]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 372

Key words: Diabetes mellitus, diabetic nephropathy, cytokines, monocyte chemoattractant protein 1.

1. Introduction highlighted the production of MCP-1 by diabetic The development of diabetes involves metabolic, kidneys as a major factor influencing macrophage endocrine, and hemodynamic abnormalities which can accumulation. MCP-1 is a secreted protein which promote a state of chronic inflammation and vascular specifically attracts blood monocytes and tissue dysfunction in many tissues. In the kidney, this can lead macrophages to its source, via interaction with its cell to the development of an innate immune response which surface receptor CCR2 (4). is predominantly characterized by the accumulation of The importance of kidney MCP-1 in the early kidney macrophages (1). Studies in human and development of diabetic nephropathy has been experimental diabetic nephropathy have shown that determined using both animal and human studies (5, 6, 7). kidney macrophage accumulation is associated with the In a model of streptozotocin-induced type 1 diabetic progression of diabetes, the development of renal injury nephropathy, mice genetically deficient in MCP-1 were (tissue damage and albuminuria), kidney fibrosis and found to have reduced renal injury compared with wild- decline in renal function, suggesting that it is an type mice with equivalent hyperglycemia (5). Elements inflammatory mediated disease (1,2,3). of the diabetic milieu induce renal parenchymal cells to Monocyte chemoattractant protein-1 (MCP-1) is secrete MCP-1, which attracts monocytes into the a member of the CC chemokine family which is kidney and stimulates myofibroblast-like properties in produced by endothelial cells, vascular smooth cells, mesangial cells. Further exposure of kidney keratinocytes, fibroblasts, mesangial cells, tubular macrophages to MCP-1 and the diabetic milieu epithelial cells, lymphocytes and promotes macrophage activation, resulting in the release monocytes/macrophages in response to a variety of of reactive oxygen species (ROS), proinflammatory proinflammatory stimuli. Recent evidence has cytokines (e.g. IL-1, TNF-α, MCP-1) and profibrotic

3030

Life Science Journal 2013;10(1) http://www.lifesciencesite.com growth factors (e.g. PDGF, TGF-β).The self-amplifying arterial blood pressure and estimation of Body Mass inflammatory response causes injury and death to Index (BMI) (weight (kg)/ height (m2) as well as fundus parenchymal cells resulting in the development of renal examination. failure (8). Patients were also subjected to laboratory Increased amounts of MCP-1 are detected in the investigations which included kidney function tests renal biopsies and urine from patients with diabetic (Serum creatinine, blood urea nitrogen and Glomerular nephropathy (9,10,11). It was also suggested that increased filtration rate estimated by Cockroft-Gault equation). urinary MCP-1 expression appears earlier than Estimated creatinine clearance (ml/min) = microalbuminuria in diabetes (12). These findings suggest 140-age ×body weight (kg) that urine MCP-1 may have significant diagnostic value 72×PCr (mg/dl) in evaluating the renal inflammatory response in (N.B. Multiplied by 0.85 for women) (13) patients with diabetic nephropathy and provide a strong Also, Serum albumin, Lipid profile including total rationale for developing specific therapies against MCP- cholesterol (TC), low density lipoprotein cholesterol 1 and inflammation in diabetic nephropathy. (LDL-C), high density lipoprotein cholesterol (HDL-C), The aim of this work was to evaluate the levels and triglyceride (TG) and glycosylated hemoglobin of urinary MCP-1 in different stages of diabetic (HbA1C), urinary MCP-1 and levels of urinary albumin nephropathy and to correlate the findings with other were assessed in all patients. clinical and laboratory parameters in type 2 diabetes Estimation of lipid profile: mellitus. Estimation of serum cholesterol and triglycerides were done by cholesterol enzyme colorimetric assay on 2. Subjects and Methods a Ciba Corning Express Plus analyzer using Subjects: commercially available Kit (Boehringer Mannheim, This study was conducted on 45 patients with type Germany). Estimation of serum HDL was done by 2 diabetes mellitus attending the Clinic of precipitation with dextran sulphate Ciba Corning Endocrinology, Internal Medicine department, Kasr El Diagnostics, Frenwald,Germany (14). LDL-C was Ainy Cairo University Hospital (Diagnosis based on the calculated according to the Fridwald formula as follows: World Health Organization criteria), as well as 15 LDL-C= Total cholesterol-TG/5-HDLC (15). healthy volunteers as a control group. Patients were categorized into 3 groups according to urinary albumin Quantitative colorimetric determination of glycated excretion (UAE) as following: Group I: which included hemoglobin (HbA1C) in blood: fifteen patients with normoalbuminuria (urinary Estimation of glycated hemoglobin was done by albumin levels <30 mg/g Cr), Group II: which glycohemoglobin reagent set from Pionte Scientific Inc. included 15 patients with microalbuminuria (urinary Normal range of HbA1C= 4.2- 6.2% (16). albumin levels from 30 to 300 mg/g Cr) and Group III: which included fifteen patients with macroalbuminuria Estimation of urinary MCP-1: (urinary albumin levels >300 mg/g Cr). In addition to Methods of the assay: Urine samples were drawn Group IV, which included fifteen healthy subjects from each subject and frozen at -80°C for later analysis taken as a control group, who were age and sex matched of urine albumin/creatinine ratio and urinary MCP-1 by with the patients (urinary albumin levels less than 30 ELISA technique. mg/ g Cr) Principles of the method: Freshly voided urine samples were collected and centrifuged at 2000 Exclusion criteria: rpm/min for 10 min. Two milliliters supernatant was Patients with other kidney, hepatic or taken for the estimation of uMCP-1 levels and stored at- rheumatologic disease, current acute illness (including 80°C until tested. Urinary MCP-1 levels were measured infections), immunologic or neoplastic diseases, or with a solid phase enzyme linked immunosorbent assay other endocrine diseases. Also, patients with a history of (Quantikine MCP-1 ELISA; R&D Systems Inc., diabetic ketoacidosis or hypoglycemic coma during the Minneapolis, USA). The coefficient of mean variations last 3 months preceding the study and those with current in the samples were <5%. The minimum detectable use of immunomodulatory medications or statins were MCP-1 level with this kit was less than5 pg/ml. No excluded from the study to avoid potential confounding significant cross-reactivity or interference was observed factors. with this assay kit. Levels of uMCP-1 were expressed as values corrected by the urinary creatinine concentration Methods: (mg of creatinine/dl). (17) All subjects gave informed consent to participate in the study. All patients were subjected to complete history taking including duration of diabetes and medications, complete physical examinations including Estimation of degree of albumin in urine:

3031

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Urine Albumin Creatinine Ratio (UACR) and macroalbuminuric groups were significantly higher measures albumin excretion in mg albumin/g creatinine. (P<0.0001). Also, levels of uMCP-1 in the The test is run on a spot urine sample. Urine ACR, macroalbuminuric group were significantly higher than which is commonly used in clinical practice, not only those in microalbuminuric group (P<0.0001) (table 1 & correlates with 24-hour urine protein but also is figure. 2). clinically relevant for predicting progression. The There was a highly significant positive correlation normoalbuminuric subjects have urinary albumin by between uMCP-1 and albuminuria (r=0.9) (P<0.0001) creatinine ratio (ACR) of <30 mg/gm creatinine. The when all diabetic patients were considered (table 2 & microalbuminuric subjects having urinary albumin by figure 3) and in the macroalbuminuric group (r=0.6) creatinine ratio of 30–300 mg/gm creatinine and the (P<0.05) (Figure 4). However, no correlation was found macroalbuminuric subjects have urinary albumin by in the normoalbuminuric or the microalbuminuric group. creatinine ratio of >300 mg/gm creatinine (18). When all the diabetic patients were considered, there was a highly significant positive correlation Statistical analysis of the results: between uMCP-1 and serum creatinine (r=0.48) Correlations between urinary MCP-1 were done (P<0.001), HbA1C (r=0.6) (P<0.0001), total cholesterol with different clinical and laboratory data (Age, (r=0.7) (P<0.0001) and LDL-C (r=0.7) (P<0.0001). On duration of diabetes, systolic blood pressure (SBP), the other hand, there was a highly significant negative diastolic blood pressure (DBP), estimated GFR, correlation between uMCP-1 and serum albumin (r=- albuminuria, creatinine in urine, serum albumin, serum 0.54) (P<0.0001). There was no significant correlation creatinine, urea, HbA1C, total cholesterol, HDL-C, between uMCP-1 and age, duration of disease, SBP, LDL-C, and TG) of each group (normoalbuminuric DBP, BMI, e GFR, creatinine in urine, urea, triglyceride patients, microalbuminuric patients and or HDL-C. macroalbuminuric patients). Comparisons were done In normoalbuminuric patients, the correlation between clinical and laboratory data of diabetic groups study between uMCP-1 and clinical and laboratory data, (I, II, III) and control group (IV), as well as between showed no significant correlation with any of the clinical and laboratory data of the three diabetic groups studied parameters. (I, II, III). Data was analyzed using Statistical Package In microalbuminuric patients, uMCP-1 showed a of social science (SPSS) version 9.0. Data was highly significant negative correlation with eGFR (r=- summarized as mean and SD. t test was used for 0.7) (p<0.05) (Figure 5) and a significant positive analysis of two quantitative data. One way ANOVA correlation with serum creatinine (r=0.6) (p<0.05). was used for analysis of more than two variable There was no significant correlation with age, duration followed by post HOCC test for detection of of disease, BMI, SBP, DBP, albuminuria, creatinine in significance. urine, serum albumin, urea, HbA1C, total cholesterol, Simple linear correlation (person's correlation) was triglyceride, HDL-C or LDL-C. done. "r" value was considered weak if <0.25, mild if In macroalbuminuric patients, uMCP-1 showed a ≥0.25-<0.5, moderate if ≥0.5-<0.75 and strong if ≥0,75. significant positive correlation with HbA1C (r=0.6) P value is considered significant if < 0.05. (P<0.05). Also, there was a highly significant negative correlation with creatinine in urine (r=-0.8) (P<0.001), 3. Results but no significant correlation was found with age, Our study showed there was a high statistically duration of disease, BMI, SBP, DBP, eGFR, serum significant difference in u-MCP1 levels between the albumin, serum creatinine, urea, HbA1C, total diabetic group and the control group (P<0.0001) cholesterol, triglyceride, HDL-C, or LDL-C. (figure.1). Also, there was a high statistically significant Comparison between uMCP-1 in all diabetic difference in u-MCP1 levels between the diabetic patients in relation to retinopathy showed that there was normoalbuminuric group and the control group no statistically significant difference between the mean (P<0.0001). Compared with the normoalbuminuric uMCP-1 values in patient with and without retinopathy. group, the levels of uMCP-1 in the microalbuminuric

3032

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

80 73.1

uMCP-1 40 ng/mg creatinine

20 4.3

0 Control Patients

Figure 1: Comparison between uMCP-1 in control subjects and all diabetic patients

129.5 140 120 100 uMCP-1 80 55.7 ng/mg creatinine 60 34.2 40 20 4.3 0

Figure 2: Comparison between uMCP-1 levels in control subjects and the three studied patients groups

Table 1: Comparison between clinical and laboratory data of control subjects, normoalbuminuric, microalbuminuric and macroalbuminuric patients groups Variables Control subjects Normoalbuminuric Microalbuminuric Macroalbuminuric p-value Mean ± SD patients patients patients Mean ± SD Mean ± SD Mean ± SD Age (yrs) 55.1±7.4 56.5 ± 3.3 55.1 ± 8.5 54 ± 6.0 0.07 Duration of disease (yrs) - 5.5 ± 3.3 5.1 3.9 4.1 ± 2.5 0.5 BMI (Kg / m2) 31.8± 6.4 30.7 ± 5.5 32.2 ± 7.6 31.9 ± 3.9 0.08 Systolic blood pressure (mmhg) 121±10.9 129.3 ± 14.4 128.0 ± 12.6 126.0 ± 17.2 0.8 Diastolic blood pressure (mmHg) 75.7± 26.2 77.3 ± 5.9 79.7 ± 7.4 78.7 ± 7.2 0.7 eGFR (ml/min) - 74.2 ± 21.8a 95.2 ± 24.4b 71.9 ± 10.2a <0.05* UACR (mg/g creatinine) 17.7± 4.6a 18.3± 6.4a 92.7 ± 51.6b 460.3 ± 77.8c <0.0001* Creatinine in urine (mg/dl) 121.1 ± 56.2 154.3 ± 67.7 123.1 ± 67.3 164.8 ± 26.4 0.2 Serum albumin (mg/dl) 4.1 ± 0.3a 4.0 ± 0.2a 4.0 ± 0.2a 3.5 ± 0.5b <0.0001* Serum creatinine (mg/dl) 0.9 ± 0.2 1.0 ± 0.2 1.0 ± 0.2 1.1 ± 0.1 0.09 Urea (mg/dl) 23.4 ± 3.3a 29.7 ± 4.3a 34.5 ± 7.6b 39.2 ± 6.3c <0.001* HbA1C (%) 6.3 ± 1.2a 6.7 ± 1.9a 6.5 ± 1.4a 9.2 ± 1.9b <0.0001* Total cholesterol (mg/dl) 193.7± 20.2 a 183.7 ± 23.7a 192.1 ± 32.0a 254.7 ± 30.1b <0.0001* Triglyceride (mg/dl) 117.6±26.2 190.5 ± 81.3 136.7 ± 64.3 181.3 ± 45.5 0.07 HDL-C (mg/dl) 51.3±5.3 44.3 ± 5.5 45.0 ± 4.8 45.6 ± 3.1 0.8 LDL-C (mg/dl) 118.9±18.3 a 102.9 ± 30.3a 115.1 ± 37.0a 171.9 ± 33.2b <0.0001* uMCP-1 (ng/mg creatinine) 4.3±1.5 a 34.2 ± 18.7b 55.7 ± 16.5c 129.5 ± 19.4d <0.0001* *Different symbols indicate statistical significance UACR = Urine Albumin Creatinine Ratio

3033

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table 2: Correlation between uMCP-1 and clinical and laboratory data in diabetic patients Variables r p-value Age (yrs) -0.25 0.06 Duration of disease (yrs) -0.2 0.2 BMI (Kg / m2) -0.16 0.29 Systolic blood pressure (mmhg) -0.14 0.37 Diastolic blood pressure (mmHg) 0.01 0.9 eGFR -0.27 0.068 UACR 0.9 <0.0001* Creatinine in urine (mg/dl) -0.03 0.8 Serum albumin (mg/dl) -0.54 <0.0001* Serum creatinine (mg/dl) 0.48 <0.001* Urea (mg/dl) 0.02 0.91 HbA1C (%) 0.6 <0.0001* Total cholesterol (mg/dl) 0.69 <0.0001* Triglyceride (mg/dl) -0.02 0.9 HDL-C (mg/dl) 0.06 0.6 LDL-C (mg/dl) 0.67 <0.0001* UACR = Urine Albumin Creatinine Ratio *Statistically significant

uMCP-1(ng/mg creatinine)

r =0.9, P < 0.0001* 160 140

120 . 100 80

60 40

0 100 200 300 400 500 600

Albuminuria (m g/g creatinine)

Figure 3: Correlation of u MCP-1 with albuminuria in all patients

3034

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

uMCP-1 (ng/mg creatinine) r =0.6, P < 0.05*

180

170 160

150 140

130 120

110

100

300 350 400 450 500 550 600 Figure 4: 4: Correlation Correlation of of uM uMCPCP-1-1 with with albuminuria albuminuria in in macroalbuminuric macroalbuminuric patients patients UACR (mg/g creatinine)

r = - 0.7, P < 0.05* uMCP-1 (ng/mg creatinine) 90

20 40 60 80 100 120 140 160

eGFR ( ml/min)

Figure 5: Correlation of u MCP-1 and eGFR in microalbuminuric patients.

4. Discussion laboratory parameters in Egyptian type 2 diabetic Monocyte Chemoattractant Protein-1 (MCP-1) patients. is the strongest known monocytes chemotactic factor The results of the study showed that and is upregulated in diabetic nephropathy. So, concentrations of uMCP-1 are enhanced in diabetic measuring urinary MCP-1 would be of great subjects when compared to control subjects and its significance in the diagnosis and intervention of early level is correlated with the level of albuminuria. diabetic nephropathy. This study aimed at Compared with normoalbuminuric group, levels of determining the levels of urinary MCP-1 (uMCP-1) uMCP-1 in microalbuminuric group and at different stages of diabetic nephropathy and to macroalbuminuric group were significantly higher. study its correlation with other clinical and Also, levels of uMCP-1 in macroalbuminuric group were significantly higher than those in

3035

Life Science Journal 2013;10(1) http://www.lifesciencesite.com microalbuminuric group. There was also increased than normoalbuminuric patients and a significant level of uMCP-1 in normoalbuminuric patients when difference was seen in the uMCP-1 levels between the compared to control subjects. normoalbuminuric patients and healthy subjects. The A significant positive correlation of uMCP-1 levels of uMCP-1 in type 2 diabetic subjects were with urine albumin excretion was found in all positively correlated with UAE (12,26). diabetic patients and in the macroalbuminuric group Eardley et al. (2006) studied 215 patients and but not in the normoalbuminuric or quantified albumin–creatinine ratio (ACR), urinary microalbuminuric groups. MCP-1/CCL2, interstitial macrophage numbers, and These results suggest that uMCP-1 may play in situ damage. ACR correlated with urinary MCP- an important role in progression and development of 1/CCL2, interstitial macrophage numbers, and index diabetic nephropathy. Previous studies showed that of chronic damage (27). serum levels of MCP-1 are sometimes elevated in However, Morii et al. (2003) showed that diabetic patients. However, this is not associated with uMCP-1 excretion levels were not significantly the development of albuminuria, kidney macrophage different between the normoalbuminuric group and accumulation or nephropathy (9, 19, 20). In contrast, the microalbuminuric group (11). urine levels of MCP-1 closely reflect kidney MCP-1 In another study, uMCP-1 level was production and correlate significantly with levels of significantly higher in the microalbuminuric and albuminuria, serum glycated albumin and kidney macroalbuminuric patients compared to the CD68+ macrophages in human and experimental normoalbuminuric patients and healthy controls. diabetic nephropathy (5,6,9,11, 20) . Patients with macroalbuminuria had significantly It has been suggested that proteinuria during higher urinary MCP-1 than microalbuminuric patients. diabetes may itself aggravate tubular injury and However, normoalbuminuric diabetic patients had accelerate nephropathy by increasing tubular MCP-1 normal urinary MCP-1 which is not consistent with production and the inflammatory response (21, 22). our results. The authers assumed that hyperglycemia However, during diabetes, it appears more likely that per se, is necessary but not sufficient in determining tubular MCP-1 is initially induced by the diabetic increased MCP-1 expression (28). It is possible that milieu, since increases in tubular MCP-1 and prolonged hyperglycemia, advanced glycation end interstitial macrophages coincide with the products (AGE), high oxidative burden and local development of hyperglycemia and precede a rise in activation of renin-angiotensin acting together can albuminuria in type 1 diabetic nephropathy in mice (5). induce MCP-1 expression in genetically predisposed In comparison, a rat albumin overload model, which patients (5). develops instant proteinuria, takes 2 weeks to induce In diabetic patients, usually an occurrence of an increase in kidney MCP-1 mRNA levels, metabolic disorder of lipids is observed. In diabetic suggesting that excreted forms of albumin cannot nephropathy LDL-C is easily oxidized to oxidized independently promote rapid tubular production of LDL (ox-LDL). Both of them, especially the later MCP-1 in vivo (23). may stimulate the expression of MCP-1 through Although circulating MCP-1 appears earlier mesangial cells (12). than microalbuminuria in diabetes mellitus (24), levels In our study, diabetic patients had significantly of uMCP-1 are increased in experimental models and higher TG and lower HDL-C than the control group. patients with inflammatory renal diseases and There was no significant difference between the two diabetic nephropathy while serum MCP-1 levels are groups regarding total cholesterol and LDL-C. Our normal (19,25). results showed a significant positive correlation of u The increased level of uMCP-1 in the MCP-1 with serum total cholesterol and LDL-C, but normoalbuminuric group compared to the control no significant correlation of uMCP-1 with TG or group, in our study, suggests that some changes HDL-C levels was found in diabetic patients. When could have occurred early in the pathogenesis of the three subgroups were considered, no correlation diabetic nephropathy and that uMCP-1 may be of between uMCP-1 and total cholesterol, LDL-C, TG or high clinical significance in the early diagnosis and HDL-C was found in either group. Similar results intervention of diabetic nephropathy. were obtained by Wang and Chen (2009) (12). On the In agreement with our results, previous studies contrary, Priyanka et al. (2009) showed that uMCP-1 have also shown that the mean levels of uMCP-1 in levels correlated positively with serum triglyceride subjects with type 2 diabetes were significantly and VLDL–C and no significant correlation was higher than healthy subjects. Levels of uMCP-1 were found between uMCP-1 and either total cholesterol or higher in patients with macroalbuminuria as LDL-C (26). compared with microalbuminuric, normoalbuminuric Ha et al. (2002) observed that high glucose patients and healthy controls. Levels of uMCP-1 in induced mesangial cells and that high glucose could microalbuminuric patients were significantly higher upregulate the expression of uMCP-1 directly or

3036

Life Science Journal 2013;10(1) http://www.lifesciencesite.com through stimulating the generation of ROS which patients over a median follow up of 6 years and u could upregulate the expression of uMCP-1 by MCP-1 levels were better correlated with the rate of activating NF-KB (29). deterioration of eGFR than urinary protein /creatinine As high glucose level leads to progression of ratio in the macroalbuminuric group of patients (31). diabetic nephropathy, we investigated the relation Our study showed that creatinine level in urine between uMCP-1 and HbA1C in all diabetics and in was inversely related to uMCP-1 levels which were of the three subgroups of diabetes. Levels of uMCP-1 statistical significance only in the macroalbuminuric showed a significant positive correlation with group. HbA1C levels in all diabetic patients and in the Heerspink et al. (2010) observed that lower macroalbuminuric group, but no significant urine creatinine concentration or 24-h urine creatinine correlation was found in either the microalbuminuric excretion independently associates with renal or normoalbuminuric group. progression. They suggest that a lower urine Our results are in agreement with Banba et al.; creatinine concentration reflects muscle wasting or 2000 who found that urinary levels but not serum poor overall health (32). levels of MCP-1 increased in accordance with the In the present study, no significant correlation extent of HbA1C and albuminuria (9). Also, Kiyici et was found between uMCP-1 and age, duration of al. (2006) found that uMCP-1 is positively correlated diabetes, BMI, systolic BP or diastolic BP. Multiple with HbA1C and fasting blood glucose in type 1 previous studies showed no significant correlation diabetic patients with nephropathy (20). El-Shafey et between uMCP-1 and age, duration of diabetes, BMI, al. (2008) found a positive correlation between systolic or diastolic blood pressure (26, 28, 31, 33). HbA1C and both microalbuminuria and u-MCP-1, so Kim et al. (2011) assessed serum MCP-1 levels that poor glycemic control is correlated with the in a case controlled study group of a gender-matched, development of early diabetic nephropathy (30). healthy cohort of 55 patients over the age of 65 and On the other hand, Priyanka et al.; 2009 found 55 patients under the age of 45. MCP-1 levels were no significant correlation between uMCP-1 and significantly lower in the elderly patients. The partial HbA1C (26). Also, Wang and Chen, 2009, failed to correlation analysis demonstrating the correlation find any significant correlation between uMCP-1 and between cytokine levels when controlled for gender, HbA1C (12). systolic blood pressure, total cholesterol, HDL In our study, microalbuminuric patients had cholesterol, triglyceride, and serum creatinine levels higher eGFR than macroalbuminuric and further demonstrated that MCP-1 had a significant normoalbuminuric patients. This may be due to the negative correlation with age (34). The significant hyperfiltration in early stages of diabetic inverse correlation found between uMCP-1 and age, nephropathy. Although uMCP-1 levels were may be explained by age related reduction of inversely correlated to eGFR values when all diabetic circulating monocytes and other leukocytes often patients were considered and in the observed in aged populations (35). microalbuminuric and macroalbuminuric groups, Shuhei et al. (2010), studied serum MCP-1 in statistical significance was found only in the type 2 diabetic patients and found that serum MCP-1 microalbuminuric group. The inverse correlation level was higher in proliferative retinopathy patients between uMCP-1 and eGFR in the microalbuminuric than in non-retinopathy patients. Multiple regression group defines the use of uMCP-1 as a marker which analysis revealed that serum MCP-1 level was reflects the degree of kidney damage as estimated by correlated with diabetic retinopathy (36). glomerular filtration rate and proves that u MCP-1 is Our results showed no significant difference in not a simple filtration from serum, but secreted the mean values of uMCP-1 between diabetic patients locally. with and without retinopathy, which could be Ibrahim and Rashed (2008) showed an inverse explained by that uMCP-1 is not a simple outfiltration correlation between uMCP-1 and eGFR in diabetic of serum MCP-1and that increased uMCP-1 observed patients (28). Also, Priyanka et al. (2009) found that in patients with diabetic retinopathy is caused by the uMCP-1 levels correlated negatively with eGFR in presence of nephropathy which may or may not diabetic patients. The levels of uMCP-1 were associate it. significantly higher in subjects with eGFR value of Prakash et al. (2007) conducted a study on 28 <60 ml/min compared to the subjects with eGFR proteinuric type 2 diabetic patients, and found that values of >60 ml/min (26). presence or absence of diabetic retinopathy (DR) was In a study on 40 diabetic nephropathy patients, a poor predictor of diabetic nephropathy because DN followed up for 6 years, uMCP-1/Creatinine ratio did was noted in 50% of patients without DR and 40% of not have a significant correlation with baseline eGFR patients with DR had non-diabetic nephropathy either in all patients, but uMCP-1/Creatinine ratio at entry alone or in combination with DN (37). of study correlated with rate of eGFR decline for all

3037

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

From the results of our study, we can conclude nephropathy. Biochem Biophys Res Commun that increased concentration of uMCP-1 may 360: 772–777, 2007. represent the start of the inflammatory process of 8. Tesch GH. MCP-1/CCL2: a new diagnostic marker diabetic nephropathy. So, it can be used as an early and therapeutic target for progressive renal marker that predicts future nephropathy risk in injury in diabetic nephropathy. AJP-Renal diabetic patients before the appearance of Physiol 294 (4) 697-701, 2008. albuminuria. Also, uMCP-1 may be used in the 9. Banba N, Nakamura T, Matsumura M, Kuroda H, follow up of diabetic patients with nephropathy and Hattori Y, Kasai K. Possible relationship of to assess the efficacy of treatment in reducing monocyte chemoattractant protein-1 with diabetic renal inflammation. New therapeutic diabetic nephropathy. Kidney Int 58: 684–690, approaches targeting uMCP-1 or its receptor may 2000. prevent and delay the progression of diabetic 10.Mezzano S, Aros C, Droguett A, Burgos ME, nephropathy. Ardiles L, Flores C. NF kappa B activation and overexpression of regulated genes in human Corresponding author diabetic nephropathy. Nephrol Dial Transplant Ahmed El-Mazny 21:299-313, 2006 Departments of Internal Medicine1 and Medical 11. Morii T, Fujita H, Narita T, Shimotomai T, Biochemistry2, Faculty of Medicine Cairo University Fujishima H, Yoshioka N, Imai H, Kakei M, Ito [email protected] S. Association of monocyte chemoattractant protein-1 with renal tubular damage in diabetic References: nephropathy. J Diabetes Complications 17: 11– 1. Chow FY, Ozols E, Nikolic-Paterson DJ, Atkins 15, 2003. RC, Tesch GH. Macrophages in mouse type 2 12. Wang Qui-yue, Chen Fen-qin: Clinical diabetic nephropathy: correlation with diabetic significance and different levels of urinary state and progressive renal injury. Kidney Int 65: monocyte chemoattractant protein-1 in type 2 116–128, 2004. diabetes mellitus. Diab Res Clin Prac.83:215–219, 2. Chow FY, Nikolic-Paterson DJ, Atkins RC, Tesch 2009. GH. Macrophages in streptozotocin-induced 13. Sokoll LJ, Russell RM, Sadowski JA, Morrow FD: diabetic nephropathy: potential role in renal Establishment of creatinine clearance reference fibrosis. Nephrol Dial Transplant 19: 2987– values for older women. Clin Chem; 40:2276- 2996, 2004. 2281, 1994. 3. Nguyen D, Ping F, Mu W, Hill P, Atkins RC, 14. Lopez-Virella MF: Strategies for the prevention of Chadban SJ. Macrophage accumulation in coronary heart disease: A policy statement of human progressive diabetic nephropathy. European Atherosclerosis Society. Eur Heart J. Nephrology (Carlton) 11: 226–231, 2006. 8:77, 1977. 4. Boring L, Gosling J, Chensue SW, Kunkel SL, 15. Fridwald WT: Calculation of LDL Farese RV, Broxmeyer HE, Charo IF. Impaired cholesterol.Clin. Chem. 18:499, 1972. monocyte migration and reduced type 1 (Th1) 16.Krolewski AS, Laffel LM, Krolewski MJ: cytokine responses in C-C chemokine receptor Glycosylated hemoglobin and risk of 2 knockout mice. J Clin Invest 100: 2552–2561, microalbuminuria in patients with IDDM. N Eng 1997. J Med. 332: 1251-1255, 1995. 5. Chow FY, Nikolic-Paterson DJ, Ozols E, Atkins 17. Amann B, Tinzmann R, Angelkort B: ACE RC, Rollins BJ, Tesch GH. Monocyte inhibitors improve diabetic nephropathy through chemoattractant protein-1 promotes diabetic suppression of renal MCP-1. Diabetes Care. 26: renal injury in streptozotocin-treated mice. 2421-5, 2003. Kidney Int 69: 73–80, 2006. 18. Kestenbaum, B. and Ian H. de Boer: Urine 6. Chow FY, Nikolic-Paterson DJ, Ma FY, Ozols E, Albumin-to-Creatinine Ratio: What’s in a Rollins BJ, Tesch GH. Monocyte Number? J Am Soc Nephrol 21, 2010. chemoattractant protein-1 induced tissue 19. Wada T, Furuichi K, Sakai N, Iwata Y, inflammation is critical for the development of Yoshimoto K, Shimizu M, Takeda SI, Takasawa renal injury but not type 2 diabetes in obese K, Yoshimura M, Kida H, Kobayashi KI, db/db mice. Diabetologia 50: 471–80, 2007. Mukaida N, Naito T, Matsushima K, Yokoyama 7. Kanamori H, Matsubara T, Mima A, Sumi E, H. Up-regulation of monocyte chemoattractant Nagai K, Takahashi T, Abe H, Iehara N, protein-1 in tubulointerstitial lesions of human Fukatsu A, Okamoto H, Kita T, Doi T, Arai H. diabetic nephropathy. Kidney Int 58: 1492–1499, Inhibition of MCP-1/CCR2 pathway 2000. ameliorates the development of diabetic

3038

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

20. Kiyici S, Erturk E, Budak F, Ersoy C, Tuncel E, mellitus. Saudi J Kidney Dis Transpl. 19 (6): Duran C, Oral B, Sigirci D, Imamoglu S. Serum 911-7, 2008. monocyte chemoattractant protein-1 and 29. Ha H, Yu MR, Choi YJ, Kitamura M, Lee HB. monocyte adhesion molecules in type 1 diabetic Role of high glucose-induced nuclear factor- patients with nephropathy. Arch Med Res 37: kappa B activation in monocyte chemoattractant 998–1003, 2006. protein-1 expression by mesangial cells. J Am 21. Eddy AA, Giachelli CM. Renal expression of Soc Nephrol 13: 894–902, 2002. genes that promote interstitial inflammation and 30. El-Shafey E, El-Nagar GF, Abu Hatab H, Sabry A, fibrosis in rats with protein-overload proteinuria. and Elbaz H :Upregulation of Monocyte Kidney Int 47: 1546–1557, 1995. Chemoattractant Protein-1(MCP-1) in Early 22. Takaya K, Koya D, Isono M, Sugimoto T, Diabetic Nephropathy in Patients with Type-1 Sugaya T, Kashiwagi A, Haneda M. Diabetes Mellitus. Scholarly Research Exchange. Involvement of ERK pathway in albumin- (Article ID 467264):10.3814, 2008. induced MCP-1 expression in mouse proximal 31. Frederick WK , Bruce LR, Karim M, JoAnn R, tubular cells. Am J Physiol Renal Physiol 284: Charles DP, Andrew H: Urinary monocyte 1037–1045, 2003. chemoattractant protein-1 (MCP-1) and 23. Hasegawa H, Kohno M, Sasaki M, Inoue A, Ito connective tissue growth factor (CCN2) as MR, Terada M, Hieshima K, Maruyama H, prognostic markers for progression of diabetic Miyazaki J, Yoshie O, Nose M, Fujita S. nephropathy. Cytokine 47: 37–42, 2009. Antagonist of monocyte chemoattractant 32. Heerspink H, Gansevoort R, Brenner B, Shahinfar protein 1 ameliorates the initiation and S, de Zeeuw D: Comparison of different progression of lupus nephritis and renal measures of urinary protein excretion for vasculitis in MRL/lpr mice. Arthritis Rheum 48: prediction of renal events. J Am Soc Nephrol 2555–2566, 2003. 21(8): 1355–1360, 2010. 24. Takebayashi K, Sachiko M, Yoshimasa A, and 33. Jing-fang L, Bing-yin S, Zhen-jun Z, Mark DP, Toshihiko I: Aldosterone Blockade Attenuates Bang-lao XU: Urinary excretion of MCP-1, IP- Urinary Monocyte Chemoattractant Protein-1 10 and PDGF-BB in type 2 diabetic patients and Oxidative Stress in Patients with Type 2 with normo-and microalbuminuria. Journal of Diabetes Complicated by Diabetic Nephropathy. Chinese Clinical Medicine 5 (9):1562-90, 2010. J Metab, 91(6):2214–221, 2006. 34. Kim Hyun O, Han-Soo K, Jong-Chan Y, Eui- 25. Rovin BH, Yoshimura T, Tan L: Cytokine- Cheol S and Sungha P: Serum cytokine profiles induced production of monocyte in healthy young and elderly population assessed chemoattractant protein-1 by cultured human using multiplexed bead-based immunoassay. mesangial cells. J Immunol 148:2148–2153, Journal of Translational Medicine 9:113, 2011. 1992. 35. De Martinis M, Modesti M, Ginaldi L: Phenotypic 26. Priyanka T, Zenith K, Satyavani K, Mary B, and functional changes of circulating monocytes Vijay V: Clinical significance of urinary and polymorphonuclear leucocytes from elderly Monocyte Chemoattractant Protein-1 (uMCP-1) persons. Immunol Cell Biol 82:415-420, 2004. in Indian type 2 diabetic patients at different 36. Shuhei M, Minoru U, Yoshinori S, Akiko Y, stages of diabetic nephropathy. International Machi F and Tokio S: Circulating monocyte Journal of Diabetes Mellitus 2: 15–19, 2009. chemoattractant protein-1 links to diabetic 27. Eardley S, Zehnder D, Quinkler M, Lepenies retinopathy in type 2 diabetic patients without J, Bates RL, Savage CO, Howie AJ, Adu D and renal dysfunction. Diabetology International 2: Cockwell P: The relationship between 78-82, 2010. albuminuria, MCP-1/CCL2, and interstitial 37. Prakash J, Lodha M, Singh SK, Rubina V, Raja R: macrophages in chronic kidney disease. Kidney Diabetic Retinopathy is A Poor Predictor of Int .69: 1189–1197, 2006. Type of Nephropathy in Proteinuric Type 2 28. Ibrahim S, Rashed L: Correlation of urinary Diabetic Patients. J Assoc Physicians India monocyte chemo-attractant protein-1 with other 55:412-416, 2007. parameters of renal injury in type-II diabetes

2/20/2013

3039

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

In Vitro Activity of nano-silver against Pulmonary Pathogenic Fungi

Chao Xu1, Chuanwen Gao2, Hua Zhang1, Jianli Chen1

1Zhengzhou Central Hospital affiliated to Zhengzhou University, Zhengzhou, 450007, China. 2 Zhengzhou second hospital, Zhengzhou 450006, China. [email protected]

Abstract: The in vitro activity of nano-silver versus those of amphotericin B was assessed against 37 plmonary aspergillosis isolates. The activity of nano-silver against Aspergillus spp. is 2 times greater than that of amphotericin B. Nano-silver’s antifungalactivity was superior to hose of amphotericin B against plmonary pathogenic fungi in vitro. [Chao Xu, Chuanwen Gao, Hua Zhang, Jianli Chen. In Vitro Activity of nano-silver against Pulmonary Pathogenic Fungi. Life Sci J 2013;10(1):3040-3043] (ISSN:1097-8135). http://www.lifesciencesite.com. 373

Keywords: nano-silver; Pulmonary aspergillosis; drug susceptibility testing; antifungal

1. Introduction efficient than silver ions (23). Nano-sliver is available Pulmonary aspergillosis is a severe disease. as an antimicrobial gel formulation for conventional Heretofore considered to be an unusual cause of topical antimicrobial agents, treatment (24). Some infection, Aspergillus species have emerged as studies show that nano-sliver has the antimicrobial important causes of morbidity and mortality in activity against bacteria and virus (25-27).Our immunocompromised patients (1-4). Invasive experiments have demonstrated that Nano sliver aspergillosis currently constitutes the most common exhibited potent antifungal activity against Aspergillus cause of infectious pneumonic mortality in patients in vitro (28,29). The Aspergillus in our experiments undergoing HSCT(hematopoietic stem cell such as Aspergillus flavus, Aspergillus fumigatus, transplantation) and is an important cause of Aspergillus niger are also the most common pathogens opportunistic respiratory and disseminated infection in of Pulmonary aspergillosis(13).In this study we want other immunocompromised patients(4-11).Many risk to determine the Activity of nano-silver against factors are associated with Invasive aspergillosis, a Pulmonary Pathogenic Fungi. serious fungal infection that affects 2. Material and Methods immunocompromised patients, particularly those with Thirty-seven strains of Aspergillus isolated were hematological malignancies and those who have obtained from patients with Pulmonary aspergillosis undergone hematopoietic stem cell or solid organ from the Zhengzhou Central Hospital affiliated to transplantation.(12) Invasive fungus infections caused Zhengzhou University, China, were investigated. by aspergillus spp. occur most frequently in These isolates were identified based on morphology immunocompromised patients. A high by standard methods (30-33). Three species were infection-associated death rate of up to and over 50% studied, they included 16 Aspergillus fumigatus, 10 is attributed even today to these fungi. The disease in Aspergillus flavus, and 8 Aspergillus niger. Candida humans is caused mainly by Aspergillus fumigatus, parapsilosis ATCC 22019 was used as quality control Aspergillus flavus and Aspergillus niger. Other species, for each test. The antifungal agents tested in this study for example, Aspergillus terreus or Aspergillus were nano-sliver (Nanux, korea; 2000ppm) and nidulans are quantitatively less prevalent. (13,14). amphotericin B (Bristol-Myers Squibb,Princeton, NJ) Amphotericin B, a polyene macrolide, has long been They were all dissolved in 100% dimethyl sulfoxide. used as the first-line agent for systemic fungal The stock solutions were prepared at concentrations of infection because of its broad spectrum. (15) 800μg/ml for nano-sliver, 1,600 μg/ml for The silver ion is well known for its broad amphotericin B .Drug dilutions were made in RPMI spectrum Antimicrobial at very low 1640 (with L-glutamine, without sodium bicarbonate; concentrations(16)，And it has been used for centuries GIBCO-BRL, Grand Island, NY) medium buffered to in health care delivery due to its antimicrobial and pH 7.0 with 0.165 M morpholinepropanesulfonic acid wound healing (anti-inflammatory) properties (17,18). (MOPS; Serva, Feinbochemica GmbH, Germany). Recently there is an increasing use of silver as an Final concentrations ranged from 0.0313 to 16μg/ml efficacious antibacterial and antifungalagent in wound for nano-sliver, from 0.0625 to 32μg/ml for care products and medical devices (10-22), and the amphotericin B. Then they were stored at -65°C until advances in nanotechnology have enabled us to tested. A broth microdilution method was performed produce pure silver, as nanoparticles, which are more following the Clinical and Laboratory Standards

3040

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Institute (CLSI) M38-A document (34), which amphotericin B against the Aspergillus spp. are describes a standard method for testing the summarized in Table 1. The MIC50 and MIC90 of susceptibility of conidium-forming filamentous fungi nano-sliver were 0.5μg /ml, 0.5μg /ml, 0.25μg /ml, that cause invasive fungal infections, including respectively, and were 0.5μg /ml, 1μg /ml, 0. 5μg /ml, Aspergillus species, Fusarium species, etc., to respectively, for Aspergillus fumigatus，Aspergillus antifungal agents. Inocula were prepared in flavus and Aspergillus niger. The MIC50 and MIC90 accordance with the CLSI M38-A document. The final of amphotericin B were 1μg /ml, 2μg /ml, 1μg /ml, 4 4 inoculum was 0.4×10 to 5×10 4CFU/ml. respectively, and were all 2μg /ml for Aspergillus Following incubation at 35°C for 48 h, the MIC fumigates, Aspergillus flavus and Aspergillus niger. was determined according to the CLSI M38-A When comparing the MIC90s of nano-sliver and document. For both agents tested, the MIC was amphotericin B, the activity of nano-sliver against defined as the lowest drug concentration that Aspergillus spp. is 2 times greater than that of prevented any discernible growth. amphotericin B. And as shown in Tables 1, nano-sliver The MIC range and mode, the MIC50 (MIC for has activity against Aspergillus complexes. For each 50% of the strains tested), and the MIC90 (MIC for of these genera, this activity remains consistent and 90% of the strains tested) were provided for the does not show significant interspecies variability. isolates with the SPSS statistical package (version Therefore, nano-sliver was effective against main 13.0). For calculation, any high off-scale MIC was Pulmonary pathogenic fungi in vitro. And it’s effect converted to the next higher concentration. was superior to those of amphotericin B. 3. Results The in vitro activities of nano-sliver and

Tables 1. In vitro susceptibilities of Pulmonary Aspergillus isolates to Nano-sliver and amphotericin B. Organism (no. of isolates) and antifungal agent MIC range MIC mode MIC50 MIC90 (μg /ml) (μg /ml) (μg /ml) (μg /ml) Aspergillus fumigatus species complex (16) Nano-silver 0.25-1 0.5 0.5 0.5 amphotericin B 0.5-4 1 1 2 Aspergillus flavus species complex (10) Nano-silver 0.5-1 0.5 0.5 1 amphotericin B 1-32 2 2 2 Aspergillus niger species complex (8) Nano-silver 0.125-0.5 0.5 0.25 0.5 amphotericin B 0.25-2 1 1 2 Aspergillus spp.(34) Nano-silver 0.125-1 0.5 0.5 1 amphotericin B 0.25-32 1 1 2

4. Discussions Corresponding Author: The scientific literature points that Nano-sliver is Chao Xu widely used in medical devices and supplies as a Zhengzhou Central Hospital affiliated to Zhengzhou potent antibacterial, antifungal, antiviral, and University, 195 Tongbai Road Zhengzhou, 450007, anti-inflammatory agent. (35,36). Coatings generally China. E-mail: [email protected] comprised of nanoparticles have been used to prevent bacterial infections associated with medical devices, References such as wound dressings, catheters, and orthopedic 1. Patterson TF, Kirkpatrick WR, White M, et al. and cardiovascular implants, with different degrees of Invasive aspergillosis: disease spectrum, clinical efficacy (37,38). The findings from our study treatment practices, and outcomes. I3 Aspergillus indicate that nano-sliver is active against main Study Group. Medicine (Baltimore) 2000; Pulmonary pathogenic fungi. The results suggest that 79:250-260. a prospective evaluation of efficacy and safety to 2. Denning DW. Invasive aspergillosis. Clin Infect develop the nano-sliver’s clinical applications such as Dis 1998; 26:781-803. Fiberoptic bronchoscopy. 3. Marr KA, Patterson T, Denning D. Aspergillosis: pathogenesis, clinical manifestations, and therapy. Infect Dis Clin North Am 2002; 16:875-894.

3041

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

4. Walsh TJ, Anaissie EJ, Denning DW, Herbrecht R, biomedical applications. Trends Biotechnol. 2010; Kontoyiannis DP, Marr KA, Morrison VA, Segal 28:580-588. BH, Steinbach WJ, Stevens DA, van Burik JA, 18. Lansdown ABG. A pharmacological and Wingard JR, Patterson TF. Treatment of toxicological profile of silver as an antimicrobial aspergillosis: clinical practice guidelines of the agent in medical devices. Adv. Pharmacol. Sci. Infectious Diseases Society of America.Clin 2010; 2010:1-16. Infect Dis. 2008 Feb 1; 46(3):327-360. 19. Kim JS, Kuk E, Yu KN, Kim JH, Park SJ, Lee HJ, 5. Cornet M, Fleury L, Maslo C, Bernard JF, Kim SH, Park YK, Park YH, Hwang CY, Kim YK, Brucker G. Epidemiology of invasive aspergillosis Lee YS, Jeong DH, Cho MH. Antimicrobial in France: a six-year multicentric survey in the effects of silver nanoparticles. Nanomedicine. greater Paris area. J Hosp Infect 2002;51:288-296 2007; 3:95-101. 6. Benjamin DK Jr, Miller WC, Bayliff S, Martel L, 20. Lara HH, Ayala-Nu?ez NV, Ixtepan-Turrent L, Alexander KA, Martin PL. Infections diagnosed Rodriguez-Padilla C. Bactericidal effect of silver in the first year after pediatric stem cell nanoparticles against multidrug-resistant bacteria. transplantation. Pediatr Infect Dis J 2002; World Journal of Microbiology and 21:227-234. Biotechnology. 2010; 26:615-621. 7. Grow WB, Moreb JS, Roque D, et al. Late onset 21. Salata O. Applications of nanoparticles in biology of invasive aspergillus infection in bone marrow and medicine. J Nanobiotechnology. 2004 Apr 30; transplant patients at a university hospital. Bone 2(1):3. Marrow Transplant 2002;29:15-19 22. Shahverdi AR, Fakhimi A, Shahverdi HR, 8. Marr KA, Carter RA, Boeckh M, Martin P, Corey Minaian S.Synthesis and effect of silver L. Invasive aspergillosis in allogeneic stem cell nanoparticles on the antibacterial activity of transplant recipients: changes in epidemiology different antibiotics against Staphylococcus and risk factors. Blood 2002; 100:4358-4366. aureus and Escherichia coli.Nanomedicine. 2007; 9. Montoya JG, Chaparro SV, Celis D, et al. Invasive 3:168-171. aspergillosis in the setting of cardiac 23. Lara HH, Ayala-Nunez NV, Ixtepan-Turrent L, transplantation. Clin Infect Dis 2003;37 (Suppl Rodriguez-Padilla C. Mode of antiviral action of 3):281-292 silver nanoparticles against HIV-1. J 10. Paterson DL, Singh N. Invasive aspergillosis in Nanobiotechnology. 2010 Jan 20; 8:1. transplant recipients. Medicine (Baltimore) 1999; 24. Muangman P, Chuntrasakul C, Silthram S, 78:123-138. Suvanchote S, Benjathanung R, Kittidacha S, 11. Wald A, Leisenring W, van Burik J-A, Bowden Rueksomtawin S.Comparison of efficacy of 1% RA. Epidemiology of Aspergillus infections in a silver sulfadiazine and Acticoat for treatment of large cohort of patients undergoing bone marrow partial-thickness burn wounds. J Med Assoc Thai. transplantation. J Infect Dis 1997; 2006; 89(7):953-958. 175:1459-1466. 25. Chen M, Yang Z, Wu H, Pan X, Xie X, Wu 12. Denning DW. Invasive aspergillosis.Clin Infect C.Antimicrobial activity and the mechanism of Dis 1998; 26:781-803. silver nanoparticle thermosensitive gel. Int J 13. Karthaus M.Guideline based treatment of invasive Nanomedicine. 2011; 6: 2873-2877. aspergillosis Mycoses. 2010 May; 53 Suppl 26. Galdiero S, Falanga A, Vitiello M, Cantisani M, 1:36-43. Marra V, Galdiero M, Silver nanoparticles as 14. Jeannina A. Smith And Carol A. Kauffman. potential antiviral agents. 2011 Oct 24; 16(10): Pulmonary fungal infections. Respirology. 8894- 8918. Volume 17, Issue 6, August 2012.913-926 27. Nanda A, Saravanan M. Biosynthesis of silver 15. Nagasaki Y, Eriguchi Y, Uchida Y, Miyake N, nanoparticles from Staphylococcus aureus and its Maehara Y, Kadowaki M, Harada M, Akashi K, antimicrobial activityagainst MRSA and MRSE. Shimono N. Combination therapy with Nanomedicine. 2009 Dec; 5(4):452-456. micafungin and amphotericin B for invasive 28. Yan Xu, Guangren Pang, Chuanwen Gao, pulmonary aspergillosis in an Dongqing Zhao, Lutan Zhou, Shengtao Sun,and immunocompromised mouse model. J Antimicrob Bingliang Wang.In Vitro Comparison of the Chemother. 2009 Aug; 64(2):379-382. Efficacies of Natamycin and Silver Nitrate against 16. Melaiye A, Youngs WJ. Silver and its application Ocular Fungi. Antimicrob Agents Chemother. as an antimicrobial agent. Expert Opin. 2005; 2009 Apr; 53(4):1636-1638. 15:125–130. 29. Chuanwen Gao, Yan Xu, Chao Xu. In Vitro 17. Chaloupka K, Malam Y, Seifalian AM. Activity of nano-silver against Ocular Pathogenic Nanosilver as a new generation of nanoproduct in Fungi. Life Science Journal. 2012; 9(4):750-753.

3042

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

30. Wang LY, Sun ST, Zhu L, Zhang YQ, Wang YQ, Standards, Wayne, PA. Li JC, and Xu J. The pathogenic spectrum 35. Carmen Steluta Ciobanu, Florian Massuyeau, investigation of fungal keratitis in 1996_2002 of Liliana Violeta Constantin, and Daniela Predoi Henan. Chin. J. Pract. Ophthalmol. 2003; Structural and physical properties of antibacterial 21:224-225. Ag-doped nano-hydroxyapatite synthesized at 31. Wang LY, Zhang YQ, Wang YQ, Wang GS, Lu 100°C Nanoscale Res Lett. 2011; 6(1): 613. JB,and Deng JH. Spectrum of mycotic keratitis in 36. Pankhurst QA, Connolly J, Jones SK, Dobson J. China. Chin. J. Ophthalmol. 2000; 36:138-140. Applications of magnetic nanoparticles in 32. Wei JC. Identification manual of fungi. Scientific biomedicine. J Phys D: Appl Phys. 2003; & Technologic Press, Shanghai, China. 1977. 36:R167. Aspergillus Micheli ex Fr., p. 495–500. In J. C. 37. Wijnhoven SWP, Peijnenburg WJGM, Herberts Wei (ed.) CA, Hagens WI, Oomen AG, Heugens EHW, 33. Sun ST, Wang LY, Wang GS, Zhou Y, Zhang YQ, Roszek B, Bisschops J, Gosens I, Van De Meent Zhu L, and Deng JH. Spectrum of 90 cases with D. Nano-silver—a review of available data and mycotic keratitis. Chin. Ophthalmic Res. 2002; knowledge gaps in human and environmental risk 20:247-248. assessment. Nanotoxicology 2009;3:109-138. 34. National Committee for Clinical Laboratory 38. Choi J, Reipa V, Hitchins VM, Goering PL, Standards.2002. Reference method for broth Malinauskas RA. Physicochemical dilution antifungal susceptibility testing of characterization and in vitro hemolysis evaluation filamentous fungi. Approved standard M38-A. of silver nanoparticles. Toxicol Sci.2011 Sep; National Committee for Clinical Laboratory 123(1):133-143.

2/25/2013

3043

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Expression and clinical significance of NF-κB and VEGF-C in esophageal squamous cell carcinoma

Zheng Tang, Yongxia Wang, Aihong Yang, Xinlai Qian Yu Wang

1. Department of Forensic Pathology, Xinxiang Medical University; 2. Department of Pathology, Xinxiang Medical University; 3. Third Teaching Hospital of Xinxiang Medical University, Xinxiang, 453003, China; 4. The first people’s hospital of Zhengzhou.

Abstract AIM: To detect the expression of Nuclear transcription factor-kB(NF-κB) and vascular endothelial growth factor-C(VEGF-C) protein in esophageal squamous cell carcinoma (ESCC) and explore their relationship with the prognosis of ESCC. Methods: SP immunohistochemical method was used to detect the expression of NF-κB and VEGF-C protein in 124 cases of ESCC and 62 cases of normal esophageal mucosa. Results: The positive expression rates of NF-κB and VEGF-C protein in specimens of ESCC were 53.2% and 69.4%, in normal esophageal mucosa were 17.7% and 3.2%, respectively. Both of them had the significant differences between ESCC and normal mucosa (P < 0.05). The positive expression of NF-κB and VEGF-C protein were closely correlated with the infiltration and lymph node metastasis of ESCC (P < 0.05), but were not correlated with the tumor grade, age or gender of the patients (P > 0.05). Moreover, the expression of NF-κB protein was positively correlated with VEGF-C (P<0.05). Conclusion: The expression of NF-κB and VEGF-C protein is closely correlated with the clinic pathological characteristics of ESCC. The genes of NF-κB and VEGF-C may play important roles in the infiltration and metastasis ESCC. United detection of them may be used as important prognostic predictors in ESCC. [Zheng Tang , Yongxia Wang , Aihong Yang, Xinlai Qian Yu Wang. Expression and clinical significance of NF-κB and VEGF-C in esophageal squamous cell carcinoma. Life Sci J 2013;10(1):3044-3047] (ISSN:1097-8135). http://www.lifesciencesite.com. 374

Key words: esophageal squamous cell carcinoma; nuclear transcription factor-κB; vascular endothelial growth factor-C; invasion; metastasis; prognosis

Introduction confirmed that all the cases belongs to squamous cell Esophageal cancer is a significant health carcinoma, with 30 cases in level Ⅰ, 50 cases in Le problem worldwide due to the aggressive nature of Ⅱ and 44 cases in level Ⅲ.Lymphatic me invasion and metastasis of this disease; these patients found in 84 cases, but was not found in other 40 cases. undergo systemic and local recurrences even after Low infiltration was found in 18 cases, which lied in radical surgery, and the survival rate remains or under mucous layer. Deep infiltration was found in dismal.Nuclear transcription factor-kB (NF- kB) is a 106 cases, which was in muscular layer or theca kind of significant pleiotropic nuclear transcription externa. Besides, 62 cases of normal mucosa of factor, which can regulate the transcription of a variety oesophagus were taken in this study for the control of cancer-related genes . Vascular endothelial growth group. factor C (VEGF-C) is a critical activator of tumor Main Agent and Method lymphangiogenesis that recently has been strongly Immunohistochemistry SP was used in the implicated in the tumor metastasis proces. Expression research. Monoclonal mouse anti-human NF-κB of VEGF-C is correlated with progression in a number antibody was the product of American Santa Cruz, of different cancers. The present study tends to purchased from Beijing Zhong Shan Jin Qiao explore the expression of NF-κB and VEGF-C protein Biological Company Limited, with working in ESCC and normal mucosa tissues, and determine concentration of 1:50; Rabbit anti-human VEGF-C the correlation between these data with polyclonal antibody fluid was purchased from Wu clinicopathologic and prognostic features. Han Bo Shi De Biological Company, at a 1:100 Material and Methods dilution. The experiment was conducted according to General material the kit introduction. Diaminlbenzidin (DAB) was used All the samples were taken from the stored for colour development, and PBS was used to replace paraffin blocks of esophageal specimens by surgical monoclonal antibody as negative contrast. resection in the Third Teaching Hospital of Xinxiang Result Judgment Standard Medical University. Preoperatively, all the cases had NF-κB protein showed positive expression no chemotherapy, radiotherapy and immunotherapy when the nucleus or endochylema was yellowish history. The age of 124 patients with esophageal brown or brown. VEGF-C positive staining was carcinoma, 66 males and 58 females, varied from 38 mainly in endochylema. Each slice was randomly to 75 (average age 60.6±9.5). The HE staining had observed in 10 visual fields and counted the positive

3044

Life Science Journal 2013;10(1) http://www.lifesciencesite.com cells. It was grouped as positive cases when the Expression of NF-κB and VEGF-C in esophageal number of positive cells ≥10% and negative ones ECC and normal mucosa when the number of positive cells < 10%. The positive expression of NF-κB showed Statistical Analysis yellowish brown or brown colouring in nucleus or Statistical analysis was performed with SPSS endochylema（fig. A, fig. B）. The positive expression software (version 10.0). The comparation of rate used of VEGF-C protein mainly demonstrates strong χ2 test. Associations for NF-κB and VEGF-C colouring in endochylema (fig.C, fig.D). And the expression were assessed using Spearman’s rank positive expression rates of NF-κB and VEGF-C correlation test. Differences were considered increased in ESCC than in normal esophageal mucosa significant at P < 0.05. (table 1). Results

Table 1. Expression of NF-κB and VEGF-C in esophageal ECC and normal mucosa Tissue types NF-κB VEGF-C

Positive number（%） χ2 P Positive number（%） χ2 P ECC 124 66（53.2） 86（69.4） 21.452 0.000 72.511 0.000 Normal 62 11（17.7） 2（3.2）

A B

C D Figure 1. Immunohistochemical staining of NF-κB and VEGF-C. Expression of NF-κB in A esophageal squamous cell carcinoma (ESCC) (400×) and B normal mucoma (400×); Expression of VEGF-C in C ESCC (400×) and D normal mucoma (400×)

Expression of NF-κB and VEGF-C in esophageal protein in ESCC was closely correlated with the squamous cell carcinoma and its relationship with infiltration and lymph metastasis (P<0.05), but had no clinicopathologic features correlation with the differentiation degree and patients’ The positive expression of NF-κB and VEGF-C age or sex (p>0.05) (table 2).

3045

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table 2. Relationship between the expression of NF-κB, VEGF-C and the clinicopathologic features of esophageal SCC Expression of NF-κB Expression of VEGF-C Clinicopathologi-cal features Positive number χ2 P Positive number χ2 P Gender Male 66 36 46 0.099 0.753 0.008 0.930 Female 58 30 40 Age ≥60 72 40 50 0.374 0.541 0.001 0.980 ＜60 52 26 36 Differentiation degree Ⅰ 30 14 22 Ⅱ 50 24 2.982 0.225 29 5.406 0.067 Ⅲ 44 28 35 Infiltration depth Superficial layer 18 4 5 8.130 0.004 17.126 0.000 Deep layer 106 62 81 Lymph node metastasis Positive 84 50 64 4.149 0.042 5.725 0.017 Negative 40 16 22 Correlation between NF-κB and VEGF-C in esophageal squamous cell carcinoma According to the spearman analysis. The expression of NF-κB and VEGF-C shows positive correlation in ESCC (p<0.01) (table 3).

Table 3. Relationship between between NF-κB and VEGF-C in tumor tissues VEGF-C Immunohistochemical index R P + — + 54 12 NF-κB 0.288 0.001 — 32 26

Discussion and to promote angiogenesis; increase in vascular Tumor progression and metastasis rely permeability to provide a favorable local environment mainly on both vascular and lymphatic systems by for tumor cell invasion and metastasis [11, 12]. In the which cancer cells can spread widely into regional or past decades, many subsets of molecules have been distant tissues. The high tumor metastasis is strongly reported to be critically involved in regulating the associated with short disease-free survival periods blood microvessel formation in tumor development and poor prognosis in cancer patients. It is important [13]. Little is known about how cancer cells can to identify the activity of the tumor proteins to better migrate to regional lymph nodes or promote the understand the complexity of invasion and metastasis. proliferation of lymphatic vessel. Recent evidence In the present study, we investigated the expression showed that VEGF1-C and VEGF-D, two members of NF-κB and VEGF-C proteins in ESCC and of the VEGF family, are the ligands for VEGF esophageal normal mucosa. receptor(R)-3, which can stimulate the lymphatic NF-κB is an important type of nuclear vessel growth (lymphangiogenesis) and also enhance transcription factor. The main form of NF-κB is a lymphatic metastasis in animal model [14]. The former dimmer composed of p50 and p65 protein, the former study had shown that knockdown of VEGF-C is the part where NF-κB is linked with DNA, and the expression suppressed ESCC viability in vitro and latter takes part in the primary regulation of gene's tumor formation and growth in nude mouse transcription and enhances the linkage between p50 xenografts [15]. Other impressive studies showed that and DNA. So, this study mainly detected the VEGF-C expression was associated with lymph node expression p65 to represent the activity of NF-κB. metastasis and poor prognosis in patients with Recent studies found that NF-κB can be expressed in resected esophageal cancer [16, 17]. many tumors and was closely linked with the Our study showed that NK-κB and invasion and metastasis of various tumors [9, 10]. VEGF-C proteins were highly expressed in ESCC VEGF-C possesses two different functions: than in esophageal normal mucous (P<0.05) and stimulate the proliferation of vascular endothelial cell associated with the infiltration depth and lymph node

3046

Life Science Journal 2013;10(1) http://www.lifesciencesite.com metastasis of ESCC (P<0.05). The study also showed STAT3 in breast cancer with lymph node there was positive correlation between NF-κB and metastasis and estrogen receptor expression [J]. Ai VEGF-C. It indicates that over expression of NF-κB Zheng, 2007, 26(9): 929-936. can up regulate the expression of VEGF-C which is 10. Sethi G, Sung B, Aggarwal BB. Nuclear coincided with the previous finding [18]. The results factor-kappaB activation: from bench to bedside suggested that NK-κB and VEGF-C may be useful [J]. Exp Biol Med (Maywood), 2008, biomarkers for the prognosis prediction in ESCC. 233(1):21-31. In conclusion, we demonstrated in this 11. Wang F, Wei L, Chen L.The relationship between study that the expression of NF-κB and VEGF-C was vascular endothelial growth factor, microvascular significantly associated with the clinicopathologic density, lymph node metastasis and prognosis of characteristics of ESCC patients. That is to say breast carcinoma[J]. Zhonghua Binglixue Zazhi, patients with high expression of NF-κB and VEGF-C 2000, 29(3):172–175. may have a poorer prognosis. 12. Adams J, Carder PJ, Downey S, et a1.Vascular endothelial growth factor (VEGF) in breast cancer: References comparison of plasma, serum, and tissue VEGF 1. Hanahan D, Weinberg RA. The hallmarks of and microvessel density and effects of cancer [J].Cell, 2000, 100:57–70. tamoxifen[J]. Cancer Res, 2000, 60 （ 11): 2. Morales CP, Souza RF, Spechler SJ. Hallmarks of 2898–2905. cancer progression in Barrett’s oesophagus[J]. 13. Wang F, Wei L, Chen L. The relationship between Lancet, 2002, 360:1587–1589. vascular endothelial growth factor, microvascular 3. A.C. Berger, J. Farma, W.J. Scott, et a1.Complete density, lymph node metastasis and prognosis of response to neoadjuvant chemoradiotherapy in breast carcinoma [J]. Zhonghua Binglixue Zazhi esophageal carcinoma is associated with 2000, 29(3):172–175. significantly improved survival [J]. J. Clin. Oncol. 14. Adams J, Carder PJ, Downey S, Forbes MA, et 2005, 23(7):4330–4337. a1.Vascular endothelial growth factor (VEGF) in 4. Sethi G, Sung B, Aggarwal BB. Nuclear breast cancer: comparison of plasma, serum, and factor-kappaB activation: from bench to bedside tissue VEGF and microvessel density and effects [J]. Exp Biol Med, 2008, 233(1):21-31. of tamoxifen[J]. Cancer Res 2000, 60(11): 5. Jenny B, Harrison JA, Baetens D, et a1. 2898–2905. Expression and localization of VEGF-C and 15. Zhang H, Yin Y, Zhang L, et a1.The effects of VEGFR-3 in glioblastomas and vascular r endothelial growth factor C knockdown haemangioblastomas[J]. J Pathol 2006, in esophageal squamous cell carcinoma[J]. J 209(1):34–43. Cancer Res Clin Oncol, 2012, 138(1):133–139. 6. Li R, Younes M, Wheeler TM, Scardino P, et 16. Kozlowski M, Naumnik W, Niklinski J, et a1.Expression of vascular endothelial growth a1.Vascular endothelial growth factor C and D factor receptor-3 (VEGFR-3)in human prostate[J]. expression correlates with lymph node metastasis Prostate, 2004, 58(2):193–199. and poor prognosis in patients with resected 7. Juttner S, Wissmann C, Jons T, et a1.Vascular esophageal cancer[J]. Neoplasma, 2011, endothelial growth factor-D and its receptor 58(4):311-319. VEGFR-3: two novel independent prognostic 17. Tanaka T, Ishiguro H, Kuwabara Y, et a1.Vascular markers in gastric adenocarcinoma[J]. J Clin endothelial growth factor C (VEGF-C) in Oncol, 2006, 24(2):228–240. esophageal cancer correlates with lymph node 8. Van Trappen PO, Steele D, Lowe DG, et a1. metastasis and poor patient prognosis[J]. J Exp Expression of vascular endothelial growth factor Clin Cancer Res, 2010, 29:83. (VEGF)-C and VEGF-D, and their receptor 18. Yang MH, Lee KT, Yang S, et a1. Guggulsterone VEGFR-3, during different stages of cervical enhances antitumor activity of gemcitabine in carcinogenesis[J]. J Pathol, 2003, gallbladder cancer cells through suppression of 201(4):544–554. NF-κB[J]. J Cancer Res Clin Oncol, 2012, 9. Liu C, Zhou S, Ke CS, et al. Activation and 138(10):1743-1751. prognostic significance of AKT, NF-kappaB and

2/25/2013

3047

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The nurse-patient relationship cognitive differences: Revelation for continuing nursing education

Wanhong Wei, Qiaofang Yang, Weihua Liu, Yulan Chang

Henan Provincal People’s Hospital [email protected], [email protected], Tel: 13938583757

Abstract: Objects: The study is aim to understand the cognitive differences of nurse-patient relationship between nurses and patients, and provide the basis for the implementation of targeted continuing nursing education. Methods: The self-designed questionnaire was used, which included the current characteristics, development trends and future expectations of nurse-patient relationship, and the responsible subject and reasons of discordant nurse-patient relationship. Results: There were significant cognitive differences between nurses and patients about the current characteristics, development trends and future expectations of the nurse-patient relationship. Revelation: It’s necessary to set up the continuing education content to meet the needs of clinical nurses and patients, to increase nurses’ skills training about the knowledge of Psychology and etiquette, to strengthen nurse-patient communication, to eliminate both asymmetric information, so as to establish harmonious nurse-patient relationship-oriented nursing continuing education system. [Wanhong Wei, Qiaofang Yang, Weihua Liu, Yulan Chang. The nurse-patient relationship cognitive differences: Revelation for continuing nursing education. Life Sci J 2013;10(1):3048-3051] (ISSN:1097-8135). http://www.lifesciencesite.com. 375

Key words: nurse-patient relationship, cognitive differences, continuing education, revelation

The development of the doctor-patient form depth interviews of nurses. The questionnaire relationship depends on the awareness of the disease had 11 items including the cognitive of the dispute and the mutual understanding of the doctor-patient reasons and resolving options, the characteristics of relations both doctors and patients[1]. Understanding current nurse-patient relationship, the harmonious and analyzing the differences in the perception of the degree, the development trends and expectative nurse-patient relationship between nurses and patients, relationship. Per item has 3-4 options(1-4points). we can carry out targeted training for nurses to reduce According to the expert advice and the pre-survey nurse-patient cognitive differences and build benign results[2], the content validity of the nurse-patient nurse-patient relationship. relationship cognitive questionnaire for patient and 1. Study population and methods nurse was respectively 0.852 and 0.864, and the 1.1 Study population reliability was respectively 0.715 and 0.724. The survey study enrolled 150 inpatients (83 1.2.2 Methods males and 67 females) and 150 nursing staff (150 The cross-sectional study was used in this females) who met the criteria, they were selected from study. The nurses on duty and inpatients were medicine, surgery, pediatrics, gynecology and randomly selected from the 20 wards of the internal obstetrics wards of a tertiary hospital. Nurse inclusion medicine, surgery, gynecology, pediatrics were criteria included registered nurses who engaged in randomly selected. The investigators were trained to clinical work for more than one year. Patient inclusion use unified guidance language. The questionnaire was criteria included cooperative and conscious inpatients filled out by respondents personally. But if who can properly express the semantics, and had been respondents were not capable to fill, the investigators in hospital more than one week. Patient exclusion should give explanation one by one, and the criteria included primary school education, severe questionnaire was filled out by investigators cognitive dysfunction, mental disorders. The study depending on the oral answers of the respondents. The was approved by the hospital Ethics Committee. questionnaires were sent and retrieved through site. Written informed consent was obtained from all The returned questionnaires which was incomplete or nurses and patients who participate in the study not filled more than two items, and couldn't be added, voluntarily. is considered invalid. 1.2. Methods 1.3 Statistical analysis 1.2.1 Research tools Baseline demographic and clinical The self-designed nurse-patient relationship characteristics were generated by descriptive analysis. cognitive questionnaire was used in the research, Count data was described using frequency and which was designed on the basis of literature percentage. Categorical variables were compared reviewing, expert consultation and the information using the Chi-square. A two-tailed level of statistical

3048

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

significance of 5% (p ＜ 0.05) was established. titles: nurse-in-charge (n=31), nurse practitioners Calculations were carried out using the IBM SPSS (n=52), nurses (n=58). The average age of the statistical software, version 19. inpatients was 58.11±1.2 years (range: 18–72 years). 2. Results The education degree includes university or higher 2.1 Questionnaire recovery and respondents education (n=67), secondary schools (n=61), primary There were "nurse-patient relationship schools (n=22). cognitive questionnaire for patients" and "nurse-patient 2.2 The cognitive of dispute responsible subject and relationship cognitive questionnaire for nurses", dispute reasons between nurses and patients respectively 150 copies. As a result, 150 valid The cognition of dispute reasons and resolving questionnaires of patient and 141 of nurse were options in nurses and patients are not statistically retrieved, the efficiency is 100% and 94% respectively. different (P＞0.05). Nurse, patient and the hospital are The average age of the nurses in this studay was the responsible subject of the nurse-patient disputes, 31.14±2.28 years old (range:22–48 years old). The the different cognitive of medical results is the main education degree includes bachelor (n=74), college reason for the discordant nurse-patient relationship (n=61), technical secondary school (n=6). Professional (Table 1).

Table 1. The cognitive compare of dispute responsible subject and dispute reasons between nurses and patients Item Classification Patients Nurses χ2 P Nurses 6(4.00) 3(2.13) Responsible Patients 7(4.67) 2(1.42) 3.686 0.297 subject Nurses and patients 71(47.33) 67(47.52) Hospital 66(44.00) 69(48.94) Nurses technology 5(3.33) 3(2.13) Nurses attitude 17(11.33) 7(4.96) Dispute reasons Hospitalization costs 34(22.67) 41(29.08) 5.134 0.162 Different cognitive of 94(62.67) 90(63.83) medical results

2.3 The cognitive of the characteristics of current relationship as relatives (40.00%) or friends (32.67%), nurse-patient relationship and expected relationship and that the nurses considered the relationship mainly between nurses and patients as a service relationship (63.12%). The study also There were differences between nurses and showed that 60.67% of the patients expected kinship patients about the characteristics of current with nurses, while 58.87% of nurses expected being nurse-patient relationship and expectations (P＜0.05). friends with patients (Table 2). The patients considered the current nurse-patient

Table 2. The cognitive comparison of the characteristics of current nurse-patient relationship and expected relationship between nurses and patients Item Classification Patients Nurses χ2 P Relatives 60 3 Characteristics of the Friends 49 31 101.210 <0.001 relationship Service 19 89 Others 22 18 Relatives 91 26 Friends 44 83 Expected relationship 59.392 <0.001 Service 6 3 Others 9 29

2.3 The cognitive of the harmonious extent of current of patients felt it good, and 66.67% of nurses felt it nurse-patient relationship and development trends general. In the development trends cognitive, 96% of between nurses and patients patients believed it would be improved continuously, There are different cognitive between nurses and no patients believed it would be worsen, while 65.25% patients about the harmonious extent of current of the nurses believed it would be improved nurse-patient relationship and development trends (P continuously, and 14.18% of the nurses believed it ＜0.05). In the currentrelationship cognitive, 84.11% would be worsen (Table 3).

3049

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table 3: The cognitive comparison of current nurse-patient relationship and development trends between nurses and patients Item Classification Patients Nurses χ2 P Harmonious extent of Well 127(84.11) 36(25.53) current nurse-patient General 22(14.67) 94(66.67) 103.647 0.000 relationship Poor 6(4.00) 11(7.80) Continuous 144(96.00) 92(65.25) improvement Development trends 46.338 0.000 Uncertainty 6(4.00) 29(20.57) Worsening 0(0.00) 20(14.18)

3. Discussion Patients learn about the care and medical knowledge 3.1 In group bias leads to nurse-patient cognitive through friends or relatives during hospitalization, and differences. from the news media, networks, or other ways, The survey shows that (Table 1), 47.33% of therefore there is a certain amount of bias and nurses and 47.52% of patients believed that the nurses possibility to be induced. Yet nurses gain medical and patients both were responsible subject of the knowledge mainly through medical education and nurse-patient disputes, while 44.00% of nurses and continuing education, and get experience about 48.94% of the patients believed that the hospital was spending with patients from work. In order to get a responsible subject. It indicates that the nurses and good feeling in clinic, patients or their relatives expect patients treated the nurse-patient relationship more that nurses would pay attention to them like relatives rational with the rapid development of society and the or friends, and they are eager to learn about the rapid transmission of information, increasing of prognosis of their disease. The nurses have heavy nurse-patient communication. Therefore, they have the workload and tight working hours because each nurse same cognitive, but they have a different view about takes care of 6-8 patients per shift. Regardless of the relationship characteristics and expected effort and time, they can not do the full exchange with relationship (Table 2). About the characteristics of the patients or their families, or pay careful attention current nurse-patient relationship, 63.1% of the nurses to everything. The lack of awareness about this in considered the relationship as service relationship, patients lead to cognitive differences[1]. The survey while 72.7% of the patients considered the results also show that 62.67% of nurses and 63.83% of relationship as relatives or friends relationship. In patients think that the different cognitive of medical expectations relationship, 90% of patients expect to results is the main reason of nurse-patient disputes become relatives or friends with nurses, while only (Table 1). Patients need medical information, and hope 77% of the nurses has the same expectation as patients. to get the same one with nurses. So we can conclusion This is due to the social identity[3],which make that health education for patients can reduce cognitive mankind automatically affix a group’s label to differences which due to the information asymmetry. themselves to seek a sense of pride in the group, 4. Revelation generate attachment for this group, and compare with 4.1 It is necessary to design of continuing nursing other groups, thereby exaggerating ingroups similarity education courses scientifically under the needs. and differences between groups. Nurses and patients Nurses gain expertise, cultural knowledge and in the hospital were automatically classified in skills by continuing nursing education, and dominate different groups, ingroup bias makes defferent the development of the nurse-patient relationship in positioning of the nurse-patient relationship both in clinic. Continuing education should meet the nurses and patients, its cognitive differences was individual needs (perceived needs and the real needs produced inevitably. of the educate) and organizational needs (career 3.2 The asymmetric sources of information leads to development needs, the hospital needs et al.)[4]. In cognitive differences. most hospitals, continuing education curriculum is The results in Table 2 show significant still "three bases" in the main, which can't meet the differences that 84.7% of patients and 25.5% of nurses clinical needs[5-6].While the demand survey shows that believed that the current nurse-patient relationship is 93.22% of the nurses believe that Humanity Education very good, 96% of patients and 65.3% of nurses is necessary during nursing continuing education [7]. maintain a positive attitude for the future development Thus, continuing education content should be set of nurse-patient relationship. This is due to the based on the needs of clinical nurses. In addition to deferent information sources and channels between the professional knowledge and skills, it is necessary nurses and patients, leading to information asymmetry. to strengthen the psychological knowledge of the

3050

Life Science Journal 2013;10(1) http://www.lifesciencesite.com nursing staff, such as behavioral and cognitive, [email protected], Tel:13938583757. The Nursing emotional control, as well as communication skills, College Of Zhengzhou University. empathy and other human knowledge training ,to Qiaofang Yang, female, born in April 1968, improve nurses' awareness of the patient population bachelor's degree, a bachelor's degree，Director Nurse. and strengthen communication between the two sides Faculty matron Clinical care and care management. to enhance the humanistic qualities of nurses to meet E-mail: [email protected] Tel: 13603712699 Henan patients' expectations of affection, to dilute group Provincal People's Hospital. consciousness of caregivers and patients. Weihua Liu, female, postgraduate, master's In addition to the professional knowledge and degree, clinical care, Henan Provincal People's skills, it is necessary to strengthen the psychological Hospital. knowledge of the nursing staff, give training of communication skills and humanistic qualities include References empathy, to improve nurses' awareness of the patient [1] Zhai XP,Ye XC. Stereotypes of different groups population and strengthen communication between the about the role cognitive of doctors, two sides, to enhance the humanistic qualities of nurses,patients. Nursing Journal Of Chinese nurses to meet patients' expectations of affection, to Peoples Liberation Army.2012，29（7A）： 1-5. dilute group consciousness of caregivers and patients. [2]Yang QF, Cao XY, Chang YL. The survey of 4.2 Emphasis on the effect, various forms of nurse-patient relationship cognitive differences continuing nursing education should be carried out. while implementation of quality care. Chinese In china, continuing nursing education method Journal of Practical Nursing. 2012，28（10）： is mainly confined to the traditional classroom [8] 26-27. lectures and self-study , it is difficult to meet the [3] Myers, D. G. Social Psychology.[M] Eighth needs of clinical nurses. Actually, centralized training, Edition. 2006，01：4-21 ；243-271． stratified training and case studies, nursing rounds, [4] Wang ZJ, Liang T. Reference foreign experience multimedia, networks, and other forms can be in Continuing Nursing Education. Chinese considered. Meanwhile, the health education can ，（）： become a way of continuing education[4], to improve Journal of Practical Nursing. 2006 22 3A health education capacity of nurses. The nurses can 62-63. take targeted health education to patients, guide [5]Yang X. The overview of the development of patients to get the disease knowledge and information Chinese continuing nursing education. Health through medical institutions, medical books, and other must-read magazine. 2012，1（1）： 235-236. ways. So patient compliance will be improved. By [6] Sun YX, Sun NN, Zhu YH. The investigation of which, it can not only eliminate the concerns of continuing nursing education needs status among patients, but also enhance the confidence of patients, our hospital nurses. Journal of Qilu Nursing. result in shorten cognitive differences of disease 2012，18（21）： 55-56. expectation and medical procedures between nurses [7] Ni CP Xu SS, Dou WX, etc. Investigation and and patients, and establish harmonious nurse-patient analysis on 10 General Hospitals' clinical nurses relationship oriented continuing nursing education humanistic quality continuing education needs system. [J]. Journal of Nursing .2011,18 (7A) :7-9. [8] Zhu LL, Jiang AL. Discussion on status of About the authors continuing nursing education in china, Journal of Wanhong Wei, male, born in October 1965, Nursing 2005,20 (4) :333-334. master's degree, an associate professor. Hospital management and nursing management. E-mail:

2/28/2013

3051

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The effect of audit quality on stock valuation in initial public offering

Mosaieb Akrami Shahrasbi1. Asghar Karimi Khorami2.

MA in Accounting. Payam-e Noor University, Yazd, Iran1. MA in Accounting, Islamic Azad University, Abarkouh, Iran2.

Abstract: Main goal of this research is to check the effect of audit quality on stock valuation in initial public offering. In this research valuation below cost is considered as dependent variable and the size of accounting firm considered as independent variable.This study addresses this issue that we can say if in firms with higher audit prices in below in initial public offering is less?The statistical results of datarelated to 102 companies which؛ quality share initial offering in Tehran stock exchange between years 1380 to 1390, shows that at 0.95 confidence level there is significant negative relationship between valuation below price and audit quality criterions (size of company, audit tenure) in companies under review. Results of this analyze proves that in companies with higher audit quality rate of valuation below price is significantly less than other companies. [Mosaieb Akrami Shahrasbi. Asghar Karimi Khorami. The effect of audit quality on stock valuation in initial public offering. Life Sci J 2013;10(1):3052-3056] (ISSN:1097-8135). http://www.lifesciencesite.com. 376

Keywords: valuation below price, initial public offering, audit quality, size of accounting institution, auditor tenure

1.Introduction because of decrease in information asymmetry and In developed countries …public offering and decrease in agency cost due to more efficient corporate Converting certain property to public ownership Often governance mechanisms it’s expected that underpricing has been welcomed by many because of its benefits be less(mashayekhi,beyrami,1391). One of the most like Capital increase, Business tax breaks, Access to important mechanisms is independent audit.companies finance affordable,…. According to article 44 of that are audited by large firms, due to high quality of constitution and spread privatization in our country, audit, have more transparent of accounting information public offerings have been receivedin last decade. But and accounting processes so managers have less One of the issues facing is how to valuation the prices opportunity for earning manipulation, and this makes in initial offering. With respect toimportance of this agency cost and information asymmetry less. So it’s issue, lots of research has been done in this area. The expected to less underpricing in these companies company activity may have been continued before (chahini, filatotcho, 2011). according to the above and public offering then because of information asymmetry given that there is no research in iran that respect effect valuation of assets is based on incomplete and of audit quality on stock valuation in initial public inadequate information. From other hand the prices are offering, so the main problem in this research is to depend to some complex and interrelated variable, this check effect of audit quality on underpricing in initial makes the problem more difficult and cause public offering. Abnormalities in initial public 2. Background research offering(IPO)( arabmazaryazdi, ghasemi,1388).the 2.1 external research: most important abnormality that exist in initial price Chang et.al(2012) they survey the pricing in offerings(IPO) are price dropping in long term, initial public offering in korea between 2000 to valuation below price and hot initial public 2002.they results that underpricing is 19 percent in offerings(haghbin zeinab,1387). Through these korea stock exchange. abnormalities with respect to more prevalence of Heren(2011) studied the relation between valuation below price, this them is more researched. number of irresponsible executives and level of Because of this, we concentrate on valuation below underpricing. he results that there is a significant direct price. According to signaling theory, because of relationship between irresponsible executives and level valuation below price, the company issued new shares, of underpricing. give positive mark to people and use this to overcome Eminoil et. al (2010) they compared information asymmetry between new stock and underpricing level of Bangladesh stock exchange with investors. So whatever the stock is better, initial other countries markets. according to their study, offering of that stock is more below price than the bad underpricing level in Bangladesh stock exchange is stock because offering below price is a cost for fine 480.71 % with standard deviation 1217.compared to company and this cost will compensate with higher other countries(singapour 31%, malezia 44% price of stock in next offering in secondary Market unitedstate 22% ) its significant. Based on their Investors (zeinab haghbin,1387).on the other hand regression analysis, age and size of company have

3052

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

positive and significant relationship and type of and less information asymmetry. So underpricing in industry and trading volume, have negative and these companies is expected (chahini,filatotcho,2011). significant relationship with underpricing. They didn’t So according to above hypothesis are the obtain an important relationship among time of initial following: public offering and underpricing. First hypothesis: There is a meaningful and inverse 2.2 internal researches relationship between size of audit institute and Abbasi, balavard(1388) they test underpricing underpricing in initial public offering (IPO). in initial public offering. Results of adjusted returns on Second hypothesis:there is a meaningful and inverse the market index in short time by using t test relationship between audit tenure and underpricing in demonstrated that there is underpricing in Tehran stock initial public offering (IPO). exchange. Method of research: This research is placing in proof Ebrahimikordlar,hasaniazardariani(1385) by researches and due to the use of historical data it places doing research on 30 offering companies in Tehran in quasi experimental researches. the present method of stock exchange between 1378 to 1380 result that research is deductive and after the event, and the reason of underpricing and IPO is poor invest market statistical method is sectional correlation that means performance information. Because it’s difficult to check if there is relationship between variables with access information, therefore, investors may not have regression. Analyze of data from this research consist the knowledge and insight for data analysis; these of two parts: researchers confine that the base of these problems in 4.1)model used to test hypotheses invest market of country is existence of major Illative analyzes will produce by the data from shareholders like organizations dependent on (tehran stock exchange website), softwares(rah government and banks. avardnovin) (tadbirprdaz), spss,eviews and with Abdohtabrizi ,demori(1382) after study of 104 appropriate statistical tests due to research hypothesis. company which are accepted in Tehran stock exchange The following regression model to test the research thorough 1369 to 1374 related to IPO they show high hypotheses are: efficiency in short term and low efficiency in long term. Underpricing it = β0+β1(Size-Auditor)i,t+β2(Tenure- 3. Research hypotheses Auditor)i,t+β3LnAsset i,t+ β4Agei,t + β5Debt-ratioi,t In stock market, one of the things that we are +β6Loss-dummyi,t + β7Founder Ownership i,t+ witnessing the greatest information asymmetry and β8Current Asset i,t+ β9Internet dummy i,t+ ԑi,t(1) thus problem of adverse selection, is related to the time Dependent variable: of initial public offering. High quality companies Underpricing= calculate from this formula: which have offer in initial public, to distinguish Underpricing= (the closing price of the stock-the themselves from low quality suppliers, for fix this closing price of first day of offering)/the closing price problem can use various methods like signaling (jane, of the stock 2007). According to the signaling theory, one of the Independent variables: exist solutions for reduce information asymmetry for Size –Auditor= it’s a dummy variable, if the audit high quality company is to sale its stocks with lower institute is useful this variable is 1 otherwise it’s 0. than the real value of money. Indeed this lost revenue, Tenure-Auditor :the period of auditor activity is the cost for signaling in high quality companies. Control variables: Furthermore, if the firm has more efficient corporate Ln Asset= natural logarithm of total assets governance mechanisms, because of reduction of Age= age of company(difference between date of information asymmetry and reduction of agency cost, establishment and date of first initial offering) it’s expected to have less underpricing. One of these Debt ratio=Long-term debt to total assets ratio mechanisms is an independent audit. Torenton says Loss dummy= dummy variable if the company had that quality of accounting and reporting information is losses in last year its =1 otherwise =0 the joint product of at least 4 products that one of them Founder Ownership=ownership Percentage of is audit quality. diangelo(1981) discussed that size of institutional shareholders audit agency can be agent of audit quality. He believes Current Assets=Ratio of current assets to total assets that the elder audit agencies, have more efficient audit Internet dummy= if the company has internet website services because they tend to find better reputation in it’s =1 otherwise it’s= 0 labor market and since their employers are a lot they 5.Community subjects don’t worry about losing them. Companies that are Community subject in consist of all of audited by large firms tend to showtheir accounting companies in Tehran stock exchange thorough 1380- with higher quality and implement more transparent 1390which for the first time offer their stock in Tehran accounting processes. So managers have less time to stock exchange. For statistical sample we choose those manipulate profit and this cause less cost in agencies companies which didn’t belong to investment

3053

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

companies. We disregard initial offerings which their from 102 mentioned company, thorough (1380-1390). information were not available. due to this, finally 102 And involve mean, middle, standard deviation, initial public offering selected. minimum and maximum that shown in picture (1). As 6.method of sampling shown in pic (1) through test period, variable of Required data for test hypothesis extracted underpricing has mean:0.721, middle:0.542, standard from various resources such as (rahavardnovin deviation:0.871 .maximum underpricing is 3.124 and software)……and financial statements were second minimum is: 0.578. in the case of independent and information of sample companies. Obtained control variable mean, middle, standard deviation, min information related to research variables entered in and max shown in pic (1). For instance they are like excel and then analyze by eviews and spss. In this this: 0.245, 0.314, 0.531, 0, 1. With respect to amount research spss used for descriptive statistics study. And of mean and middle (middle is more than mean), for inferential statistics we use Eviews. skewness is negative (left). Independent variable size 7.findings of audit institute has mean, middle, standard deviation, 7.1 Descriptive statistics min and max as follows 2.73, 3, 8.021, 1, 5 and regard Descriptive statistics of independent, to amount of middle and mean(middle is more than dependent and control variables have done with data mean) the skewness is negative too.

Picture 1. max min Standard deviation middle mean variable 3/124 -0/578 0/871 0/542 0/721 Underpricing 1 0 0/531 0/314 0/245 Size-Auditor 5 1 8/021 3 2/73 Tenure- Auditor 22/26 0/459 32/02 10/11 13/97 Ln Asset 32 7 42/21 21 14/23 Age 0/721 0/211 0/342 0/482 0/529 Debt ratio 1 0 0/324 0/236 0/148 Loss dummy 0/867 0/078 0/345 0/623 0/467 Founder Ownership 1/23 0/045 0/782 0/327 0/426 Current Asset 1 0 0/711 0/513 0/621 Internet dummy Picture 2. jar co bra test for dependent variable result Level of significance Jar co bra statistic variable Distribution is normal 0.2311020 14.3833 Underpricing

Correlation coefficient between independent According to above table and (ja co bra) variables, dependent variables and control are shown statistic since the significance level (0.041102) is in picture (2). As shown in this picture most of more than 0.05 null hypothesis accepted so with 0.95 independent and control variables except age variable confidence can be said discretionary accruals have meaning full correlation at 95% confidence level (dependent variable) has normal distribution with dependent variables. Dependent variable, 7.2.2. test of errors independence underpricing, have meaning full negative correlation Serial correlation will be tested with durbin with the variables, audit tenure, size of audit institute, Watson statistic between residuals of regression. If institutional investors, rate of debt and current assets. this statistic places between 1.5, 2.5the null hypothesis And with other variables has positive meaning full will be accepted, otherwise alternative hypothesis will correlation. Briefly, considering correlation coefficient be proved. In this regression model amount of durbin of dependent variables independent variables and Watson statistic is 1.625 and between 1.5 and 2.5. so control variables in research can expect that results null hypothesis, that there is serial correlation between from regression have high validity to have good residuals, is proved. responses for questions and research hypothesis. 7.2.3. Study normality of residuals distribution 7.2. Study the assumption of classic regression One assumption of regression is that the 7.2.1. Normality test of dependent variable residuals have normal distribution with mean at 0. For For checking the normality of dependent study the normality of residuals the curve components variable distribution, we use (jar co bra) test. This test of residuals plotted in this diagram. Results of jar performed for total discretionary accruals (dependent cobera statistic says that in regression model(1) mean variable). and resulted that dependent variable of residuals is almost (0) and standard deviation is distribution is normal. The results table is shown in near to (0.994).with respect to results of jacobera test picture (3). and that, significance level (0.564) is more than 5%, as a result, residuals of regression model are normal.

3054

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

. Picture 3. The normality of dependent variable distribution

7.2.4.variance homogeneity test Underpricing it = β0+β1(Size-Auditor)i,t+β2(Tenure- This assumption checked by white test. Since Auditor)i,t +β3LnAsset i,t + β4Agei,t + significant level is more than 5% in output, so there β5Debt-ratioi,t +β6Loss-dummyi,t + isn’t variance homogeneity. Output is shown in β7Founder Ownership i,t+ β8Current Asset i,t picture (4). + β9Internet dummy i,t+ ԑi,t Results of regression and relative statistics are shown in picture (5). According to figure (5), F statistic (15.436) implies that model is significant at significance level of 95%. Coefficient of determination and adjusted coeficieant determination are (38.21%) and (34.6%). Coefficient of determination is a criterion which describes strength of relation between independent variable,dependent variable and control variable. indeed amount of this Picture 4. Homogeneity of variance coefficients, describe how much of dependent variable is explained by independent and control variables. In 7.3 The results of the regression model this regression, adjusted determination coefficient is In this research we use this regression model (38.9%) that shows, (38.9%) of dependent variables which based on statistical sample (102 company in change is described by independent variable (audit initial public offering). tenure, size of audit institute) and control variables (age of company).

Underpricing i,t= β0+β1(Size-Auditor)i,t+β2(Tenure-Auditor)i,t + β3LnAsset i,t+ β4Agei,t + β5Debt-ratioi,t +β6Loss-dummyi,t + β7Founder Ownershipi,t+ β8Current Asset i,t + β9Internet dummy i,t+ ԑi,t Level of significance Statistics t Variable coefficient variable 0/0001 9/886 2/11 Fix number 0/0001 5/507 -0/221 Size-Auditor independent 0/036 2/108 -0/189 Tenure- Auditor 0/004 2/871 0/105 Ln Asset 0/443* -0/768 -0/078 Age 0/0001 9/810 -0/097 Debt ratio 0/007 2/727 0/121 Loss dummy control 0/0001 8/540 -0/141 Founder Ownership 0/194* 1/31 -0/061 Current Asset 0/0086 2/6327 -0/071 Internet dummy Coefficient of determination 382/0 آﻣﺎره F 15/436 0/00 (P-Value) 0/346 Adjusted coefficient of determination 1/625 Durbin watson Picture (5)

3055

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

After significant test, every coefficient of test Initial public offering is one of the subjects has to be checked with T statistics of significant. In that we see in stock market, it’s the problem of significant level of (95%), if significant level of T information asymmetry and then adverse selection. statistics is below 5%, it means related coefficient are Base on sign theory, one of existing solutions for significant and if it’s more than 5% it means reduce information asymmetry is underpricing by high coefficients are not significant. In the case of fixed quality companies. The lost revenue is actually the cost value (2.11), T statistic is (9.886) and significant level which high quality companies have to pay for signaling. is (0.0001), this value is less than 5% thus significant Companies which are audited by large audit institute, of fixed value (2.11) in significant level (95%) is tend to show accounting information quality high and proved. Coefficient (size of audit institute), (-0.221), implement more transparent accounting process. Thus have T statistic about (5.507) and significant level of managers have less time to manipulate profits which (0.001), and significant of this coefficient is proved. cause less agency cost and less information asymmetry. Coefficient (audit tenure),(-0.189), have T statistics So underpricing is expected. about (2.108) and significant level of (0.036), and Checking effect of audit institute size and significant hypothesis of this coefficient is proved too. audit tenure, on stock valuation in initial public Results are shown in figure (5). Except variable of offering, is the main aim of this research. Statistical current asset and age of company, at significant level results from analyze of (102) companies, which began of 95%, other variables are significant. to initial public offering in Tehran stock exchange, 7.5 Testing of hypothesis shows that there is a significantnegative relationship in 7.5.1 First hypothesis test significant level of (95%), between underpricing and First hypothesis:there is a significant and audit quality(size of audit institute and audit tenure), in inverse relationship between size of audit institute and considered companies. Results show, in companies underpricing in initial public offering (IPO). with high quality audit, underpricing was significantly According to fig (5), significant level of less. independent variable (size of audit institute) is (0.0001). this value is less than considered significant level (in REFERENCES this research it is 5%); also absolute value of T statistic, 1. Aminul, Islam, Ruhani Ali and Zamri, Ahmad.( 2010). related to this variable (5.507), is more than T statistic “AnEmpirical Investigation of the Underpricing of IPOs in the ChittagongStock Exchange”, International Journal of results from table with the same degree of freedom. On Economies and Finance, Vol.2, No. 4. the other hand, this variable is a positive number (- 2. Abbasi, E. Balavrd, M. (2005). "The initial public offering price 0.221) which explains that there is a negative less expensive testing process yield long-term dividends in significant relationship between dependent variable Tehran Stock Exchange ", Accounting Research, No. 3. 3. Abdoh Tabrizi, H. Damvary, D. (2003) Spring and Summer (underpricing) and size of audit institute in considered "identify the factors influencing the long-term efficiency newly companies. Thus in significant level of 95%, first listed stocks in Tehran Stock Exchange." Financial Research hypothesis is proved. No. 15. 7.5.2 second hypothesis test: there is a meaningful and 4. Chahine, Salim; Filatotchev, Igor .( 2011). “The effects of corporate governance and audit and non-audit fees on IPO inverse relationship between audit tenure and Value”, The British Accounting Review, No. 43. underpricing in initial public offering (IPO). 5. Ebrahimi Kordlar, A. Hasani AZrdaryany, E. (2006). "Earnings According to fig (5), significant level of management at the time of initial shares to the public within the independent variable (audit tenure) is equal to (0.036), accepted in Stock Exchange" Studies. Accounting and Auditing Review, No. 45. this value is less considered significant level in this 6. Haghbin,Z. (2008), "The initial public offering of shares of research (5%); also absolute value of T statistic related malformations in Tehran Stock Exchange", Master's to this variable (2.108) is more than T statistic results thesis,Alzahra university.Tehran.Iran. from table with same degree of freedom. On the other 7. Hearn, Bruce. (2011). “The impact of corporate governancemeasures on the performance of West African IPO hand this variable is a positive number (-0.189), which firms”, EmergingMarket Review, No. 130. explains that there is negative significant relationship 8. Jain, B.A. (2007). “Test of Adverse Selection Models in the between dependent variable (underpricing) and audit NewIssues Market”.Elsevier Information Learning tenure in considered companies. Thus in significant Company,Vol 25, No 3,Great Britain. 9. Mashayekhi, B. Bayrami, H. (2012), " signaling and valuation level of (95%) second hypothesis is proved. of shares", Empirical Research in Accounting, Volume 1, 8. Conclusions and recommendations Number 4.

2/28/2013

3056

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Unilateral Versus Bilateral Laparoscopic Ovarian Drilling in Clomiphene Citrate Resistant Polycystic Ovary Syndrome

Abdelhafeez M.A.1, Ali M. S.1, Sayed S. N.2

1 Department of Obstetrics and Gynecology, Faculty of Medicine, Ain Shams University 2 Research Fellow, Ain Shams University Maternity Hospital [email protected]

Abstract: Objective: The aim of the current trial was to compare the efficacy of unilateral versus bilateral LOD in women with CC-resistant PCOS as regard regularity of menses and successful ovulation within 3 months following laparoscopy. Methods: The study included women who had a diagnosis of clomiphene-citrate-resistant polycystic ovarian syndrome (CC-resistant PCOS) and planned for laparoscopic ovarian drilling (LOD). In all included cases, a three-puncture laparoscopy was performed under general anesthesia. Ovarian drilling was performed using unipolar diathermy needle. The primary outcome was documented ovulation through a midluteal serum progesterone > 3 ng/ml three months after laparoscopy. Results: A total of 60 women were included in the study; and randomized equally into one of the two groups: unilateral versus bilateral ovarian drilling. There was no significant difference between women of both groups regarding regularity of menses within 3 months following LOD. In each group, individually, there was a significant rise in basal serum FSH, a significant reduction in basal serum LH and a significant rise in midluteal serum progesterone when 3-month post-LOD levels were compared to pre-LOD levels. These significant changes were comparable in both groups. Conclusion: Unilateral LOD seems to be as effective as bilateral LOD in terms of restoration of regular menstrual pattern and ovulation, as evident by the midluteal serum progesterone. [Abdelhafeez M.A., Ali M.S., Sayed S. N. Unilateral Versus Bilateral Laparoscopic Ovarian Drilling in Clomiphene Citrate Resistant Polycystic Ovary Syndrome. Life Sci J 2013;10(1):3057-3060]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 377

Keywords: Polycystic ovarian syndrome – clomiphene citrate – clomiphene citrate resistance – laparoscopic ovarian drilling

1. Introduction: ovaries. It has been suggested by some authors that Polycystic ovary Syndrome (PCOS) is the unilateral rather than bilateral ovarian drilling would most common cause of anovular infertility being have similar benefits, with lower risk of adhesions and responsible for almost 70% of such cases [1]. Medical POF [7]. The aim of the current trial was to compare the induction of ovulation with clomiphene citrate (CC), efficacy of unilateral versus bilateral LOD in women despite being the drug of choice in induction of with CC-resistant PCOS as regard regularity of menses ovulation in those cases, is not always successful, with and successful ovulation within 3 months following an approximate 20% rate of the so-called CC resistance. laparoscopy. One treatment option for women who are CC-resistant is induction of ovulation using gonadotropins. 2. Patient and Methods: Gonadotropin therapy is often characterized by over- The current study was conducted at Ain production of follicles and is, therefore, associated with Shams University Maternity Hospital during the period higher risk of ovarian hyperstimulation syndrome between February 2010 and September 2010. The (OHSS) and multiple pregnancies [2]. The second study included women attending the outpatient alternative to gonadotropin therapy is the laparoscopic infertility clinic with a diagnosis of clomiphene-citrate- ovarian drilling (LOD) [3]. A recent study [4] even resistant polycystic ovarian syndrome (CC-resistant suggested that LOD could be recommended as a first PCOS) and planned for laparoscopic ovarian drilling line if laparoscopy is indicated for other reasons in (LOD). PCOS was diagnosed according to the these women and as an adjunct to CC treatment. It has Rotterdam criteria [8], by presence of two of the been shown that LOD both induces ovulation and following three criteria (after exclusion of related remarkably improves responsiveness of the ovaries to disorders of hyperandrogenism like congenital adrenal the CC in previously-labeled CC-resistant women [5.6]. hyperplasia): oligomenorrhea and/or anovulation; Benefits of LOD include the eliminated need for cycle clinical and/or biochemical signs of hyperandrogenism; monitoring and the low risk of multiple pregnancies and transvaginal sonographic appearance of polycystic and OHSS [3]. LOD is not without hazards, however. ovaries. Oligomenorrhea was defined as cycle intervals Tubo-ovarian adhesions and theoretical risk of of more than 35 days. Anovulation was defined if mid- premature ovarian failure (POF) following LOD are of luteal serum progesterone was less than 3 ng/ml. The concern. The standard LOD includes drilling of both presence of polycystic ovaries is established when at

3057

Life Science Journal 2013;10(1) http://www.lifesciencesite.com least one ovary has either ≥ 12 follicles measuring 2–9 groups was estimated using paired student’s t-test. mm in diameter tightly spaced along the periphery of Significance level was set at 0.05. the ovary and/or an ovarian volume of >10 cm3 by 3. Results transvaginal ultrasonography [9]. CC resistance was A total of 60 women were included in the identified when the patient failed to respond in terms of study; and randomized equally into one of the two ovulation to an incremental dose of clomiphene citrate groups: unilateral versus bilateral ovarian drilling. The up to 150 mg per day [7]. Basal serum levels of follicle mean age of included women was 27.23 ± 2.11 years stimulating hormone (FSH) and luteinizing hormone (range: 24 – 32 years). The mean duration of infertility (LH) and midluteal serum progesterone were assayed was 3.01 ± 0.94 years (range: 2 – 5 years). Of the in included women prior to laparoscopy. In all included included 60 women, 14 (23.3%) had amenorrhea, while cases, a three-puncture laparoscopy was performed 46 (76.7%) had oligomenorrhea. The mean body mass under general anesthesia. Ovarian drilling was index (BMI) was 29.8 ± 2.8 Kg/m2 (range: 26 – 40 performed using unipolar diathermy needle (Karl Kg/m2). There were no significant differences between Storz®, ND, Germany). The drilling needle was used to women of both groups regarding age, duration of penetrate the ovarian capsule at right angle to a infertility, irregularity of menses and BMI. There were standard depth of 8 mm at 4 points with an initial 60-W no significant differences between women of both cutting current to allow penetration of the ovarian groups regarding initial (pre-laparoscopy) serum levels surface followed by a 40-W coagulation current for 4 of basal FSH, basal LH and midluteal progesterone seconds. The included 60 women were randomized into (Table-1). There was no significant difference between one of two groups: group I, in who unilateral ovarian women of both groups regarding regularity of menses drilling was performed; and group-II, in whom bilateral within 3 months following LOD [21/30 (70%) vs. ovarian drilling was performed. The primary outcome 23/30 (76.7%), respectively, p=0.826] (Table-2). The was documented ovulation through a midluteal serum rate of documented ovulation (through a midluteal progesterone > 3 ng/ml three months after laparoscopy. progesterone > 3 ng/ml) 3 months following LOD was Secondary outcomes included regularity of menstrual slightly lower in women who had unilateral LOD when cycles and basal levels of serum FSH and LH within compared to those who had bilateral LOD [20/30 three months after laparoscopy. (66.7%) vs. 22/30 (73.3%), respectively]; this Statistical Analysis difference was, however, not significant (p=0.573) Statistical analysis was performed using (Figure-1). There were no significant differences Microsoft® Excel® version 2010 and Statistical between women of both groups regarding serum levels Package for Social Sciences (SPSS®, Inc., Chicago, IL, of basal FSH, basal LH and midluteal progesterone USA) for Windows version 15.0. Data were described measured 3 months post-LOD (Table-2). In each group, as range, mean and standard deviation (for numeric individually, there was a significant rise in basal serum variables); or number and percentage (for categorical FSH, a significant reduction in basal serum LH and a variables). Difference between two unrelated groups significant rise in midluteal serum progesterone when was estimated using independent student’s t-test (for 3-month post-LOD levels were compared to pre-LOD numeric variables) or chi-squared test (for categorical levels. These significant changes were comparable in variables). Difference between two related numeric both groups (Table-2). Table-1 Post-Laparoscopic Ovarian Drilling Hormonal Profile in Included Women Group I Group II [Unilateral Ovarian Drilling] [Bilateral Ovarian Drilling] P* (n=30) (n=30) 2.6 – 11 2.8 – 9.4 0.719 Pre-LOD 6.02 ± 2.35 6.2 ± 1.4 NS 4.8 – 10.8 3.8 – 9.9 0.751 Basal serum FSH (mIU/ml) Post-LOD 6.89 ± 1.3 7.01 ± 1.6 NS 0.032 0.008 P** S S 3.3 – 10.1 3.7 – 10.3 0.671 Pre-LOD 7.2 ± 1.92 7.01 ± 1.5 NS Basal Serum LH 3.1 – 8.4 2.8 – 8.1 0.820 Post-LOD (mIU/ml) 5.8 ± 1.69 5.7 ± 1.7 NS <0.001 <0.001 P** HS HS 0.58 – 1.8 0.65 – 1.79 0.259 Pre-LOD 1.1 ± 0.33 1.2 ± 0.35 NS Midluteal Serum 1.1 – 5.9 1.5 – 5.9 0.329 Post-LOD Progesterone (ng/ml) 4.6 ± 1.2 4.3 ± 1.16 NS <0.001 <0.001 P** HS HS Data presented as range, mean ± SD * Difference between Groups I and II – Analysis using independent student’s t-test

3058

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

** Difference between Pre-LOD and Post-LOD Levels – Analysis using paired student’s t-test FSH follicle stimulating hormone LH luteinizing hormone LOD laparoscopic ovarian drilling NS non- significant – S significant – HS highly significant

Table-2 Post-Laparoscopic Ovarian Drilling Menstrual Regularity in Included Women Group I Group II Post-LOD [Unilateral Ovarian Drilling] [Bilateral Ovarian Drilling] P (n=30) (n=30) Menstrual Pattern Regular 21 (70%) 23 (76.7%) Oligomenorrhea 6 (20%) 5 (16.7%) 0.826 Amenorrhea 3 (10%) 2 (6.7%) NS Analysis using chi-squared test LOD laparoscopic ovarian drilling NS non-significant

Figure-1 Bar-Chart showing Difference between Groups regarding Documented Ovulation through Midluteal Serum Progesterone

4. Discussion studies [7,11-13]. LOD has been associated with reduction In the current trial, 21 (70%) women of those in basal serum LH level in women with PCOS; a who had unilateral LOD restored their regular finding of the previous and current studies [7,11,13-14]. menstrual cycles after unilateral ovarian drilling, in High basal serum LH has been linked to CC resistance contrast to 23 (76.7%) women of those who had in women with PCOS. Reduction in basal serum LH bilateral LOD; an obviously non-significant difference. was known to be a marker of good response to LOD LOD has been evidently shown to clinically improve [7,13,15]. One of the possible major drawbacks of LOD is outcomes in women with PCOS in terms of regular the risk of diminished ovarian reserve and premature menstrual cycles. In a study conducted on 66 women ovarian failure (POF) [16]. In the current study, despite with oligo/amenorrhea due to PCOS, 53 (80.3%) being short-term, LOD was associated with significant showed a regular menstrual cycle post-laparoscopy [10]. rise in basal serum FSH; the rise was no significantly In a study similar to the current one, Roy et al. different between women who underwent unilateral randomized 44 women into either unilateral or bilateral and those who underwent bilateral ovarian drilling. ovarian drilling. The rates of regular menstrual cycles However, again, the results regarding ovarian reserve following LOD were 72.7% and 81.8%, respectively cannot be deduced from such short-term evaluation. (p=0.760) [7]. Restoration of regular menstrual cycles is Longer follow-up over years is needed to explore such a good clinical indicator of resumption of normal a risk. Indeed, the impact of LOD on ovarian reserve ovulatory function. This has been biochemically has been revised by more recent work and was found to proven through a significant rise in midluteal serum be just theoretical. Api conducted a systematic review progesterone 3 months post-LOD in both women who in 2009 on this issue and concluded that no solid underwent unilateral or bilateral drilling. The evidence of a diminished ovarian reserve or POF was difference between both groups regarding the midluteal associated with LOD over years [17]. In conclusion, serum progesterone was not significant, denoting, unilateral LOD seems to be as effective as bilateral along with the close rates of regular menstrual cycles LOD in terms of restoration of regular menstrual following LOD, a comparable efficacy of unilateral and pattern and ovulation, as evident by the midluteal bilateral drilling regarding induction of ovulation. serum progesterone. Nevertheless, impact on ongoing Similar conclusions were reached by similar previous pregnancy rates is needed to be explored. Moreover, 3059

Life Science Journal 2013;10(1) http://www.lifesciencesite.com long-term follow-up is needed to explore the difference 8. The Rotterdam ESHRE/ASRM. Sponsored between both approaches regarding the risks of tubo- PCOS consensus workshop group. Revised 2003 ovarian adhesions and diminished ovarian reserve. consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Correspondence Author: Fertil Steril 2004; 81: 19–25. Dr. Mohamed Sayed Ali 9. Jonard S, Robert Y, Dewailly D. Revising the Associated Prof. of Obstetrics and Gynecology, Ain ovarian volume as a diagnostic criterion for Shams University Maternity Hospital, Abbasyia, Cairo, polycystic ovaries. Hum Reprod 2005; 20: 2893– Egypt 2898. Email: [email protected] 10. Kriplani R, Manchanda N, Agarwal. Laparoscopic Ovarian Drilling in Clomiphene References Citrate-Resistant Women with Polycystic Ovary 1. Fleming R, Hopkinson Z, Wallace A. Ovarian Syndrome. J Am Assoc Gynecol Laparosc 2001; 8 function and metabolic factors in women with (4): 511-518. oligomenorrhoea treated with metformin in a 11. Balen AH, Braat DDM, West C. Cumulative randomized double blind placebo-controlled trial. J conception and live birth rates after the treatment Clin Endocrinol Metabol 2002; 87: 569–574. of anovulatory infertility. An analysis of the safety 2. Imani B, Eijkemans MJC, te Velde ET. and efficacy of ovulation induction in 200 patients. Predictors of patients remaining anovulatory Hum Reprod 1994; 9:1563–1570. during clomiphene citrate induction of ovulation in 12. Al-Mizyen E. Unilateral !aparoseopic ovarian normogonadotropic oligoamenorrheic infertility. J diathermy in infertile women with clomiphene Clin Endocrinol Metabol 1998;83 (7):2361–2365. citrate-resistant polycystic ovary syndrome. Fertil 3. Farquhar CM, Williamson K, Brown PM. An Steril 2007; 88 (6): 1678-1680. economic evaluation of laparoscopic ovarian 13. Sharma M, Kriplani A And Agarwal N. diathermy versus gonadotophin therapy for women Laparoscopic bipolar versus unipolar OD in with clomiphene citrate resistant polycystic ovary women with PCOS. J Gynaecol Surg 2006; 22: syndrome. Hum Reprod 2005; 19: 1110-1115. 105-111. 4. Amer SA, Li TC, Metwally M, Emarh M, 14. Van Wely M, Westergaard LG, Bossuyt PM. Ledger WL. Randomized controlled trial Human menopausal gonadotropin versus comparing laparoscopic ovarian diathermy with recombinant follicle stimulation hormone for clomiphene citrate as a first-line method of ovarian stimulation in assisted cycles. Cochrane ovulation induction in women with polycystic Database Syst Rev; 2003 (1):CD003973. ovary syndrome. Hum Reprod 2009; 24 (1): 219- 15. Ott J, Wirth S, Nouri K, Kurz C, Mayerhofer K, 225. Huber JC, Tempfer CB. Luteinizing hormone 5. Bayram N, van Wely M, Kaaijk EM. Using an and androstendione are independent predictors of electrocautery strategy or recombinant FSH to ovulation after laparoscopic ovarian drilling: a induce ovulation in polycystic ovary syndrome: a retrospective cohort study. Reprod Biol Endocrinol randomised controlled trial. BMJ 2004; 328:192–5. 2009; 7: 153-159. 6. Farquhar C, Lilford RJ, Marjoribanks J. 16. Amer SAK, Banu ZT and Cooke ID. Long-term Laparoscopic drilling by diathermy or lader for follow-up of patients with polycystic ovary ovulation induction in anovulatory polycystic syndrome after laparoscopic ovarian drilling: ovary syndrome. Cochrane Database Syst Rev endocrine and ultrasonographic outcomes. Hum 2007; 3: CD001122. Reprod 2002; 17 (11): 2851–2857. 7. Roy KK, Baruah J, Moda N. Evaluation of 17. Api M. Is ovarian reserve diminished after unilateral versus bilateral ovarian drilling in laparoscopic ovarian drilling? Gynecol Endocrinol clomiphene citrate resistant cases of polycystic 2009; 25 (3): 159-165. ovarian syndrome. Arch Gynecol Obstet 2009; 2009; 280 (4): 573-578.

3/5/2013

3060

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Antibodies to Cyclic Citrullinated Peptides (Anti-CCP) as a Marker of Association between Type 1 Diabetes Mellitus (T1DM) and Rheumatoid Arthritis (RA) in Children and Adolescent

Doaa Shahin 1, Rawia A. Swelam2, Abeer Fathy 3, Dina A. Shahin4*, Mohamed Attiya5

1. Clinical Pathology Department, Faculty of Medicine, Mansoura University, Mansoura, Egypt. 2. Department of Pediatric, Faculty of Medicine, Al Azhar University, Cairo, Egypt. 3. Department of Pediatric, Faculty of Medicine,, Mansoura University , Mansoura , Egypt . 4. Department of Internal Medicine, Rheumatology and Immunolology unit, Faculty of Medicine, Mansoura University, Mansoura , Egypt. 5. Department of Internal medicine, Faculty of Medicine, Mansoura University, Mansoura, Egypt. [email protected]

Abstract: Aims/Introduction: The association between Type 1 diabetes mellitus (T1DM) and rheumatoid arthritis (RA) remains controversial. The aim of this work was to find out the prevalence of anti-CCP in children and adolescences with T 1 DM and to determine whether anti-CCP could serve as marker for the development of RA in these patients. Material and Methods: We studied 42 children and adolescents with T1DM, 20 patients with RA, and 40 healthy age and sex matched controls. The studied groups were investigated for anti-CCP and RF and the result were statistically analyzed. Results: The number of anti-CCP positive patients in the diabetic group was not statistically different when compared with the healthy control group (1 vs. 0, P = 1) but was statistically lower than in the RA group (1 vs. 9, P< 0.0001). Family history of RA was detected in only two of the diabetic patients with no significant difference than the control group. Family history of first degree relative with type 1 DM was not statistically significant different between the RA group and the control population (p= 0.4). Conclusions: No significant difference in anti-CCP antibodies expression in patients with T1DM than the healthy control. Screening of anti-CCP antibodies may not appear to be useful in the follow-up of patients with type 1DM unless there are joint abnormalities. [Doaa Shahin, Rawia A. Swelam, Abeer Fathy, Dina A. Shahin and Mohamed Attiya. Antibodies to Cyclic Citrullinated Peptides (Anti-CCP) as a Marker of Association between Type 1 Diabetes Mellitus (T1DM) and Rheumatoid Arthritis (RA) in Children and Adolescent. Life Sci J 2013;10(1):3061-3065]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 378

Key words: anti-CCP, Type 1 diabetes mellitus, rheumatoid arthritis.

1. Introduction: comparison with control subjects, but specific excess The co-occurrence of autoimmune diseases such of T 1 DM remains to be confirmed (4). Moreover, in as rheumatoid arthritis (RA) and type 1 diabetes the last years, several studies showed that anti-CCP mellitus (Type 1 DM) has been reported in individuals represent a sensitive and specific serologic marker for and families. (1). Although the exact etiologies of RA RA. Moreover, a large body of evidence has shown and T 1 DM are unknown, they are likely attributable that anti-CCP may also serve as an early and to a combination of genetic susceptibility and prognostic marker in RA (5). Liao et al. (1). had interactions between environmental risk factors and shown that the odd ratios of co-existing T1DM in RA genes. RA and T1DM are associated with the same patients was only significantly increased in individuals human leukocyte antigen (HLA) specificity; HLA- with antibodies against anti-CCP. DR4. Thus, T1DM and the Auto immune connective The anti-CCP antibodies had found to exhibit tissue diseases are considered to be in the same better specificity than IgM rheumatoid factor (IgM-RF) immunologic cluster. (2) In addition, both diseases (6) in diagnosing RA. However, high titres of anti-CCP were associated with the 620W allele of the protein can occasionally be found in patients with tyrosine phosphatase N22 (PTPN22) gene, prompting inflammatory myopathy (7), and psoriasis (8) the researchers to suggest that this gene variant might Furthermore, Anti-CCP antibodies are found in "represent a common pathway for the pathogenesis of the sera of RA patients a median of 4.5 years before these two diseases." (3) . the overt disease .The importance of such a notion lies Few studies addressed the question of an not only in the ability to prevent life-threatening association between prevalent RA and T1 DM. A manifestations but also in the ability to treat and even systematic review examining the prevalence of organ- prevent overt autoimmune diseases. (9). specific autoimmune diseases in patients with RA and So, the aim of this work was to find out the their relatives found an excess of such disease in prevalence of anti-CCP in children and adolescences

3061

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

with type 1 DM and to determine whether anti-CCP RF: RF was measured using immunoturbidimetric could serve as marker for the development of RA in technique on the Cobas Integra 400 analyser (Roche these patients. Diagnostics, Indianapolis, IN, USA), using reagents and calibrators from Roche (13) 2. Patients and methods Statistical analysis I. Study design and study population: Data were analyzed using SPSS (version 17). A case control study was conducted and Data were expressed as mean reanalyz frequencies. approved by the local ethical committee. The studied Differences between continuous variables were population was divided into three categories: analyzed by t-test, Dichotomous variables were 1. Forty two children and adolescents who fulfilled analyzed by Fishermous variables, were analyzed by t- the American Diabetes association diagnostic test mean <0.05 were considered significant. criteria (10). These patients were randomly selected independently to their RA status. 3. Results: 2. Twenty patients fulfilled the International Overall population and TIDM: League of Associations for Rheumatology Table 1 shows the clinical data and the (ILAR) criteria for diagnosis of juvenile laboratory parameters of the studied groups. Anti idiopathic arthritis (JIA) (11). All patients were CCP antibodies were found to be positive in only one under eighteen and the diagnosis of JIA had been diabetic patient and in 9 of the RA group. The number confirmed for at least six months. of anti-CCP+ patients in the diabetic group was not 3. Both the DM and JIA patients groups were statistically different when compared with the healthy studied in comparison with 40 healthy age and control group (1 vs. 0, P = 1) but was statistically sex matched controls. lower than in the RA group (1 vs. 9, P< 0.0001). The All the guardians of study participants gave their only Anti CCP positive diabetic patient was 12 years informed consent. The clinical data were assessed at old male with no joint abnormalities. He had negative the time of blood donation, and all the demographic, rheumatoid factor and no family history of RA. clinical and serological characteristics of the studied Family history of RA was detected in only two of the subjects were evaluated and recorded by a pediatrician diabetic patients with no significant difference than and a rheumatologist. the control group. Family history of first degree II. Exclusion criteria: relative with type 1 DM was not statistically Individuals with a personal history of significant different between the RA group and the malignancy, systemic lupus erythematosus or control population (p 0.4). autoimmune connective tissue disease (other than RA), JIA patients: viral hepatitis or treatment with interferon-α were not Positive anti-CCP was found in 9/20(45% ) of eligible for the present study. JIA cases while 11/20(55%) were negative for anti- III. Laboratorial analysis: CCP . Out of 9 JIA cases with positive anti-CCP ,9 Anti-CCP: was measured by patients had positive RF, versus only one out the 11 electrochemiluminescence immunoassay (ECLIA) JIA cases with negative anti-CCP with statistically using COBAS INTEGTRA 400 machine (Roche significant difference between them (P< 0.001). of note Diagnostics, Indianapolis, Ind) with a titre most the patient with polyarticular disease (72.7%) had of >17 U/ml considered as positive. (12) positive anti-CCP (P= 0.01) as shown in table (2).

Table 1. Demographic, laboratorial and serological characteristics of the studied groups. Rheumatoid arthritis P* Diabetic group Control group group (n = 42) (n =40) (n = 20) Age (years) (mean ± SD) 8.6± 2.9 7.9± 3.4 7.4± 3.1 ns Gender( male /female) 14/6 8/7 23/19 ns Duration of diabetic state in years (mean ± 4.2 ± 2.1 - SD) - Family history of type 1 DM 6(14.4%) 1(5%) 2 (5%) ns Associated other autoimmune diseases** 3 (7.2%) 0 0 Family history of rheumatoid arthritis 2 (4.8%) 4 (20%) 3 (7.5%) ns +ve rheumatoid factor 0 7 (35%) 0 <0.0001 +ve anti-CCP 1 (2.4%) 9 (45%) 0 <0.0001 * P for fisher's exact test for 2X3 contingency table. ** Two patients had associated autoimmune thyroiditis, one patient had vitiligo

3062 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table (2): Demographic and clinical and laboratorial characteristics of anti-CCP positive and anti-CCP negative RA patients Anti-CCP-ve Anti-CCP P value (n = 11) +ve (n = 9) Age (years) 7.4± 3.1 10.4± 3.1 ns# Gender female/male 4/7 7/2 ns* Tender joint count 2.6± 3.0 5.2 ± 5.7 (ns)# ESR mm/hr 33.6 ± 21.3 37.9 ± 26.8 ns# CRP mg/L 29.16± 15.6 30.51± 25.6 ns# +ve rheumatoid factor 1 9 0.0001* Polyarticular disease 3(27.3%) 8(72.7%) Oligoarticular disease 7(87.5%) 1(12.5%) 0.01** Systemic onset disease 1 0 *p<0.05, NS: Nonsignificant *= Fisher's exact test **= Fisher's exact test for a 2x3 contingency table. #= t test. 4. Discussion: A There are numerous genetic factors associated with increased risk for autoimmunity including HLA alleles containing the shared epitope (SE), PTPN22 polymorphism, and others (3, 14- 16). The association between Type 1 diabetes mellitus and rheumatoid arthritis remains controversial. In the current study, no significant difference in anti - CCP antibodies expression was found in patients with T 1 DM compared with the healthy control. This comes in agreement with the finding of Desplat-Je´go et al. (17) who reported rare prevalence of anti- CCP antibodies in patients with type 1 DM. They suggested weak association between type 1 DM and immune B processes leading to RA. Furthermore, Simards and coworkers (18) suggested a non-significant association between diabetes and RA (despite differences in their study design, race and age of the population studied compared with our study) . On the other hand, Liao, et al. (1) have found that T1DM was associated with an increased risk of anti-CCP positive RA (OR 7.3). This controversy in results might be attributed to different age of the population studied. In our study, the age is under 18 however Liao et al. (1) Studied cases aged 18- 70. Therefore, our cases might develop RA later in life. In the present study, non of the RA patients had C type 1 DM and the family history did not differ than that of the controls. In accordance with this, the findings of Hakala et al.(19) that the prevalence of type 1 DM in the RA cohort was similar to that in the general population. On the other hand, Thomas et al. (20) ,in their study conducted on 295 RA patients found that 13% of the studied patients had a first-degree relative with type 1 diabetes. Epidemiologic studies have identified - several potential risk factors for the disease, but it is not known at what point during disease evolution Figure 1: Interaction box plot representing the (21,22) Anti-CCP, RBS, and HBA1c in DM patients and these factors are important . However, elevated control groups (A,B,C respectively) autoantibodies, cytokines, and inflammatory markers occur years prior to clinical onset of joint symptoms,

3063 Life Science Journal 2013;10(1) http://www.lifesciencesite.com suggesting that epidemiologic factors may play an References: early role in the development of RA (23-25). In our 1. Liao KP, Gunnarsson M, Källberg H, Ding B, study anti-CCP measurement identified only one Plenge RM, Padyukov L et al. Specific diabetic patient with high titre without clinical signs association of type 1 diabetes mellitus with anti- suggestive of RA. this patient must be followed up for cyclic citrullinated peptide-positive rheumatoid several years since anti- CCP might predict RA. arthritis. Arthritis Rheum 2009; 60: 653–60. In the current study, anti-CCP antibodies were 2. Torfs CP, King M, Huey B, Malmgren J, detected in 45% of patients with JIA most of them Grumet FC. Genetic Interrelationship between have polyarticular disease. This was consistent with Insulin-Dependent Diabetes Mellitus, the the findings of Habib et al. (26 ) and Van Rossum and Autoimmune Thyroid Diseases, and Rheumatoid colleagues (27 ) however, much less figures(2%) were Arthritis. Am J Hum Genet.1986; 38: 170-187 reported by Avcin and coworkers ( 28) and Sandra and 3. Chelala C, Duchatelet S, Joffret ML, associates. (29 ) It seems that Anti- CCP can be detected Bergholdt R, Dubois-Laforgue D, Ghandil P, in children and adolescents with JIA but are less et al. PTPN22 R620W functional variant in type frequently present than in adults with RA. However it 1 diabetes and autoimmunity related traits. still remains to be determined whether anti-CCP could Diabetes. 2007;56(2):522–526. identify a subset of JIA with the potential to progress 4. Somers EC, Thomas SL, Smeeth L, Hall AJ. to adult RA. Autoimmune diseases co-occurring within This study was limited by the cross-sectional individuals and within families: a systematic design which does not enable follow up of review. Epidemiology 2006; 17: 202–217 longitudinal changes that evolve over time for further 5. Alessandri C, Priori R, Modesti M, Mancini interpretation of the significant association between R, Valesini G. The role of anti-cyclic TIDM and anti-CCP in predicting those individuals cytrullinate antibodies testing in rheumatoid who evolve into the full clinical RA. arthritis. Clin Rev Allergy Immunol. Furthermore, the relatively small sample size 2008;34(1):45-9 of the studied groups does not enable adequate power 6. Avouac J, Gossec L, Dougados M. Diagnostic to pick up a moderate association between these two and predictive value of anti-cyclic citrullinated conditions and these findings need to be confirmed in protein antibodies in rheumatoid arthritis: a a larger cohort. systematic literature review. Ann Rheum Dis 2006; 65: 845–851. Conclusion: 7. Labrador-Horrillo M, Martinez MA, The association between RA and DM could not yet O’Callaghan AS, Delgado JF, Go´mez XM, been ruled out, despite the lack of a significant Aragua´s ET, et al. Anti-cyclic citrullinated association noted in our study. Screening of anti-CCP peptide and anti-keratin antibodies in patients antibodies may not appear to be useful in the follow- with idiopathic inflammatory myopathy. up of patients with type 1DM unless there are joint Rheumatology 2009; 48:676–679. abnormalities. 8. Vander Cruyssen B, Hoffman IEA, Zmierczak H, Van den Berghe M, Kruithof Author's contributions E, et al. Anti-citrullinated peptide antibodies All the authors shared the study design, data may occur in patients with psoriatic arthritis.Ann collection and literature research. DS was responsible Rheum Dis 2005;64:1145–1149. for performing the biochemical analyses and helped in 9. Harel & Shoenfeld2006: Predicting and writing the initial version of the manuscript and in the preventing autoimmunity . Ann. N.Y. Acad. Sci. statistical analysis. RAS and AF assembled the 2006;1069: 322–345. patients’ cohorts, helped in writing the initial version 10. Diagnosis and Classification of of the manuscript. DAS coordinated clinical data DiabetesMellitus American Diabetes collection, critically revised the statistical analysis of Association .Diabetes care 2010;33 (1):S62- the clinical results and wrote the final version of the S69. manuscript. MA helped in data collection and 11. Petty RE, Southwood TR, Baum J, Bhettay E, literature research. Glass DN, Manners P, Maldonado-Cocco J, et al. Revision of the proposed classification Disclosure criteria for juvenile idiopathic arthritis: Durban, All the authors of this paper report no conflicts of 1997. J Rheumatol. 1998;25:1991-10. interest. 12. Nishimura K, Sugiyama D, Kogata Y, et al. (2007). "Meta-analysis: diagnostic accuracy of anti-cyclic citrullinated peptide antibody and

3064 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

rheumatoid factor for rheumatoid arthritis". 21. Pedersen M, Jacobsen S, Klarlund M, Annals of Internal Medicine 146 (11): 797–808. Pedersen BV, Wiik A, Wohlfahrt J, et al. 13. Guder, WG, Narayanan S, Wisser H, Zawta Environmental risk factors differ between B. Samples from the patient to the laboratory. rheumatoid arthritis with and without auto- The impact of preanalytical variables on the antibodies against cyclic citrullinated peptides. quality of laboratory results. Darmstadt, Arthritis Research & Therapy. 2006; 8(4):R133 Germany: GIT Verlag, 1996. 22. Aho K, Heliovaara M. Risk factors for 14. Plenge RM, Padyukov L, Remmers EF, rheumatoid arthritis. Ann Med. 2004; 36(4):242– Purcell S, Lee AT, Karlson EW, et al. 51 Replication of putative candidate-gene 23. Majka DS, Deane KD, Parrish LA, Lazar AA, associations with rheumatoid arthritis in >4,000 Baron AE, Walker CW, et al. Duration of samples from North America and Sweden: preclinical rheumatoid arthritis-related association of susceptibility with PTPN22, autoantibody positivity increases in subjects with CTLA4, and PADI4. Am J Hum Genet. 2005; older age at time of disease diagnosis. Annals of 77(6):1044–1060. the Rheumatic Diseases. 2008 Jun; 67(6):801–7. 15. Pedersen M, Jacobsen S, Klarlund M, 24. Rantapaa-Dahlqvist S, de Jong BA, Berglin E, Pedersen BV, Wiik A, Wohlfahrt J, et al. Hallmans G, Wadell G, Stenlund H, et al. Environmental risk factors differ between Antibodies against cyclic citrullinated peptide rheumatoid arthritis with and without auto- and IgA rheumatoid factor predict the antibodies against cyclic citrullinated peptides. development of rheumatoid arthritis. Arthritis Arthritis Research & Therapy. 2006; 8(4):R133. Rheum. 2003 Oct; 48(10):2741–9. 16. Karlson EW, Chibnik LB, Cui J, Plenge RM, 25. Nielen MM, van Schaardenburg D, Reesink Glass RJ, Maher NE, et al. Associations HW, Twisk JW, van de Stadt RJ, van der between human leukocyte antigen, PTPN22, Horst- Bruinsma IE, et al. Simultaneous CTLA4 genotypes and rheumatoid arthritis development of acute phase response and phenotypes of autoantibody status, age at autoantibodies in preclinical rheumatoid arthritis. diagnosis and erosions in a large cohort study. Ann Rheum Dis. 2006 Apr; 65(4):535–7. Ann Rheum Dis. 2008; 67(3):358–63. 26. Habib HM, Mosaad YM, Youssef HM. Anti- 17. Desplat-Je´ go S, Deharveng I, Baronne R, cyclic citrullinated peptide antibodies in patients Valero R, Be´ gu-Le Corroller A, Vialettes B. with juvenile idiopathic arthritis. Immunol Antibodies to cyclic citrullinated peptides (anti- Invest. 2008;37(8):849-57. CCP) in Type 1 diabetes mellitus. Diabetic 27. van Rossum M, van Soesbergen R, de Kort S, Medicine, 2010: 27, 723–727 ten Cate R, Zwinderman AH, de Jong B, 18. Simard JF, Mittleman MA. Prevalent Dijkmans B, van Venrooij WJ. Anti-cyclic rheumatoid arthritis and diabetes among citrullinated peptide (anti-CCP) antibodies in NHANES III participants aged 60 and older. J children with juvenile idiopathic arthritis. J Rheumatol. 2007; 34(3):469–473. Rheumatol. 2003 Apr;30(4):825-8. 19. Hakala M, Vahlberg T, Niemi PM, et al. No 28. Avcˇin T, CimazR, Falcini F, Zulian F, association between rheumatoid arthritis and Martini G, Simonini G, et al. citrullinated insulin dependent diabetes mellitus: an peptide antibodies in juvenile idiopathic Arthritis. epidemiologic and immunogenetic study. J Ann Rheum Dis 2002;61:608–611 Rheumatol 1992;19:856-8. 29. Machado S H, von Mühlen C A, Brenol JCT, 20. Thomas DJ, Young A, Gorsuch AN, Bottazzo Bisotto L, Xavier R M . The prevalence of anti- GF, Cudworth AG. Evidence for an association cyclic citrullinated peptide antibodies in juvenile between rheumatoid arthritis and autoimmune idiopathic arthritisJ Pediatr (Rio J). endocrine disease. Ann Rheum Dis 2005;81(6):491-4. 1983;42:297-300

3/5/2013

3065 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The use of microarrays to reveal the probabilistic gene network associated with the response of rice to low- energy ion beam bombardment

Xiangli Yu, Yonghui Li and Huiyuan Ya*

Life Science Department, Luoyang Normal University, Luoyang, Henan, China [email protected]

Abstract：Bombardment with low-energy ion beams can induce various biological effects in plants including stimulation, damage, and mutation. However, the interactions in genes in plants in response to this stressor are not fully understood. We use a Rice Gene Expression Microarray to investigate the overlap differentially expressed genes (DEGs) in two independent bombardment experiments involving three ion fluences. The results show that 26 up- and 6 down-regulated overlap genes were observed. A RiceNet co-expressed network analysis of the overlap DEGs showed the direct and indirect co-expressed linkages, which suggests some signal transduction pathways should be involved in this response but the situation remains unclear. Our microarray data reveals the general and key genes responding to the stress of bombardment with low-energy ion beams during rice germination, and provides information on the candidate genes for further elucidation of the molecular mechanisms biological effects underlying the of ion-beam bombardment. [Xiangli Yu, Yonghui Li and Huiyuan Ya. The use of microarrays to reveal the probabilistic gene network associated with the response of rice to low-energy ion beam bombardment. Life Sci J 2013;10(1):3066-3069] (ISSN:1097-8135). http://www.lifesciencesite.com. 379

Key words：Low-energy ion beam bombardment; biological effect; microarray; gene network; rice

1 Introduction function together in Oryza sativa. Each interaction in Bombardment with low-energy ion beams RiceNet has an associated log-likelihood score (LLS) causes, directly or indirectly, severe cellular damage that measures the probability of an interaction and stress in plants[1]. It seems likely that there are representing a true functional linkage between two stress response elements in cells which are responsible genes [5]. for tolerance to bombardment with such low-energy In this study, we propose a strategy to ion beams. Researchers and scientists are interested in discover the overlap differentially expressed genes abiotic stress response sensing and the associated (DEGs) in rice among multiple microarrays in two genetic and metabolic response pathways in plants[2,3]. independent bombardment experiments using three ion However, the key genes and the network responding to fluences. Subsequently, we obtain the interaction bombardment with low-energy ion beams remain to be network of these genes. The results shed light on the fully elucidated and few of these genes have been molecular mechanisms of the biological effects identified and recognized in plants. Recently, genome induced by ion-beam bombardment and enable expression analysis has been used to identify the key identification of the genes regulating the response to functional genes involved in the response to abiotic bombardment with low-energy ion beams. stress because of its high throughput detection, especially the use of whole-genome microarrays. 2 Materials and Methods Rice (Oryza sativa) is the most important 2.1 Rice seed and culture staple food crop. As one of the best studied grasses, Dry seeds of rice cultivar Xindao-18 there is a wealth of accumulated knowledge about rice (Oryza sativa L. ssp. japonica) were used in the ion which makes it an attractive candidate as a reference bombardment experiments. After bombardment with for other important staple crops and emerging biofuel the ion beam, all seeds were planted on sterile medium grasses. In previous (extensive) studies, many research with 0.8% agar (Sigma) in a climate chamber in the groups have examined the effects of a wide variety of dark at 28°C. After the seeds had been incubated for [4] abiotic and biotic stresses in rice . Thus, we selected 96 h, they were collected for RNA extraction. rice seed as the experimental material in this study. 2.2 RNA extraction RiceNet is a probabilistic functional gene In this study, in order to accurately network for 41,203 non-TE related genes of Oryza investigate the commonly expressed DEGs responsive sativa. It was constructed using modified Bayesian to the stress of ion-beam bombardment of rice, mixed integration of many different data types from several RNA from the rice seedling populations is tested. Thus, different organisms, with each data type weighted 30 uniformed rice seedlings from each ion fluence according to how well it links genes that are known to

3066 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

were mixed to prepare a mixed RNA sample and The gene identifiers (geneIDs) of the DEGs construct the RNA pool from three biological were input into the web service RiceNet v.1 to find out replicates. Total mixed RNA was isolated using RNA their interactions with others plant reagents (Tiangen Biotech) and purified by use (www.functionalnet.org/ricenet). of the RNeasy Plant Kit (Qiagen). The yield and purity of the RNA was determined spectrophotometrically 3 Results and Discussion (Nanodrop ND1000). 3.1 Profiles of the DEGs 2.3 Agilent microarray hybridization and data The DEGs were detected by comparing the analysis expression signal values of the genes of the implanted Agilent microarray hybridization (Agilent- samples and the blank controls. The microarray 015241 Rice Gene Expression Microarray) and raw analysis showed that there are 821 DEGs underlying data analysis were carried out by the ShanghaiBio the ion-beam fluence at 6 × 1017 N+/cm2 in the first Company Ltd. A transcript was considered bombardment experiment, 1256 DEGs underlying the significantly up- or down-regulated if it met all of the ion-beam fluence at 2 × 1017 N+/cm2, and 1136 DEGs following criteria: (1) it showed a statistically underlying the ion-beam fluence at 8 × 1017 N+/cm2 in significant differential expression at the adjusted p the second bombardment experiment. value, p < 0.05; (2) it had a cut-off value at a 2-fold The number of DEGs differs greatly change; and (3) it had “present” calls on all of the three between the samples subjected to different ion fluences. replicate samples for the controls and/or the This suggests that a single independent microarray bombarded sample. cannot reflect the comprehensive and general key 2.4 Bioinformatics analysis genes responsive to the stress of ion-beam Annotation of the transcripts represented by bombardment. Therefore, we considered the genes that the microarray was described according to the were differentially expressed in all microarrays following databases: Agilent probe name underlying the three ion fluence bombardment (http://www.ebi.ac.uk/microarray- experiments to date as the comprehensive and general as/aer/lob?Name= adss&id=2375208716), DEGs associated with the response to the ion-beam SAS web server, and the RAP database bombardment stress in rice. By comparing the microarray data between the two independent ( ). http://rapdb.dna.affrc.go.jp/ bombardment experiments resulting in different 2.5 Detection of the key DEGs biological effects, we obtained 26 up- (Table 1) and 6 The overlapping DEGs in multi- down-regulated overlap general-key DEGs (Table 2) microarrays from the samples with different ion related to the response to ion-beam bombardment in fluences and different experimental replicates were rice. The short descriptions show that genes related to collected. The analysis reveals the key genes in rice + kinase, transporters, signals, resistance, etc. are responding to the bombardment with low-energy N involved in the response to ion-beam bombardment. ion beams and is used for further validation. 2.6 RiceNet analysis

TABLE 1. The up-regulated general-key DEGs. FC (p-value) Gene ID Short Description 2 × 1017 6 × 1017 8 × 1017 Os01g0959100 Similar to abscisic stress ripening protein 1 4.02 4.51 4.68 Os01g0723000 Elongation factor 2 (EF-2) 24.26 10.34 51.10 Os01g0155000 Esterase/lipase/thioesterase 6.04 3.22 3.28 Os01g0311800 Pectin methylesterase isoform alpha 2.67 2.0 2.44 Os01g0660200 (Chitinase) (EC 3.2.1.14) 15.74 2.95 2.67 Os01g0959200 Similar to abscisic stress ripening protein 1 3.54 6.60 5.31 Os02g0787600 Ionotropic glutamate receptor 3.63 2.06 2.10 Os03g0575200 K+ potassium transporter family protein 4.86 2.42 3.0 Os03g0830500 PGPS/D12 19.74 2.77 2.23 Os04g0339400 Aldo/keto reductase family protein 6.34 3.47 9.50 Os04g0368000 Serine/threonine protein kinase 2.18 2.35 3.16 Os04g0524500 Oligopeptide transporter 2.47 2.03 2.16 Os05g0276500 Expansin Os-EXPA3 2.04 4.61 2.72 Os06g0147300 Conserved hypothetical protein 3.30 3.0 2.42 Os06g0521500 Haem peroxidase 5.02 2.40 3.0 Os07g0493800 Protein kinase domain containing protein 3.65 2.24 2.20 Os07g0638400 Peroxiredoxin (B15C) 4.31 5.63 3.53 Os07g0690900 Hytochelatin synthetase-like protein 4.54 2.71 3.56

3067

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Os08g0136700 Protein of unknown function DUF26 7.11 2.48 14.05 Os08g0190100 Germin-like protein (Germin-like 8) 10.17 4.38 2.80 Os09g0367700 GST6 protein (EC 2.5.1.18) 3.50 7.15 3.08 Os09g0483200 Ubiquitin domain containing protein 2.45 18.18 32.52 Os10g0452300 Eggshell protein family protein 4.07 6.26 3.11 Os11g0227200 NBS-LRR disease resistance protein homologue；nucleotide binding /protein binding 6.68 2.32 3.11 Os11g0482200 Pathogenic type III effector avirulence factor 5.43 2.31 2.73 Os11g0669100 Calmodulin binding protein 5.91 2.94 2.14 Short descriptions were annotated according to the RAP-DB (Rice Annotation Project Database). Fold change (FC) in each gene is not expressed as log2. The p-value threshold of 0.05 was used for significant differential expression.

TABLE 2. The down-regulated general-key DEGs. Fold changes Gene ID Short Description 2 × 1017 6 × 1017 8 × 1017 Os01g0800800 Hypothetical protein 2.13 2.23 5.26 Os06g0654600 Protein kinase 2.10 2.0 2.60 Os07g0543300 Glycoside hydrolase, family 14B 2.83 3.35 10.0 Os12g0140700 Zn-finger, RING protein 2.26 2.10 2.30 Os12g0640500 Na+/H+ antiporter-like protein 2.01 4.53 6.76 Os12g0427600 P69F protein 11.50 2.83 5.84

Short descriptions were annotated according expression and sequence data together with Mapman to the RAP-DB (Rice Annotation Project Database). ontology analysis (http://aranet.mpimp- Fold change (FC) in each gene is not expressed as log2. golm.mpg.de/ricenet), constructed using modified The p-value threshold of 0.05 was used for significant Bayesian integration of many different data types from differential expression. several different organisms. Each data type is weighted Microarray technology has been used with according to how well it links genes that are known to many plants, and functions as a powerful tool for high- function together in Oryza sativa thoughput screening of genes responsive to different (www.functionalnet.org/ricenet). abiotic stresses including salt, ABA (abscise acid ), A cold, heat, and drought [6,7]. In the present study, a total of 32 overlap DEGs (26 up- and 6 down-regulated) are observed. These comprise 3.90% (32/821), 2.55% (32/1256), and 2.81% (32/1136) of the total DEGs underlying the three independent ion-fluence bombardment experiments, respectively. This observation means that less than 10% of the transcripts were overlap differentially expressed. These 32 overlap DEGs represent target genes for the study of the molecular mechanism for the biological effects induced by bombardment with low-energy ion-beams.

Stress-regulated proteins can be classified B into two groups, namely, those that take part in signal transduction and those that directly play a role in plant survival under stress conditions. Proteins of the first group include transcription factors, RNA-binding [8] proteins, protein kinases, and phosphatases . It is seen that 10 out of 26 of the overlap up-regulated transcripts were involved in the response process. Further, out of the 26 up-regulated DEGs 5, 4, and 4 are related to transport, signaling, and protein modification (including protein kinases and phosphatases), respectively. This finding suggests that rice responds to the bombardment with ion FIG. 1. Partial co-expressed linkages in Ricent beams through unknown signal pathways. Networks, or graphs, consisting of nodes and 3.2 RiceNet analysis edges. The colors of the edges indicate the strength of RiceNet is a platform of web-tools dedicated the co-expression, wherein green, orange, and red to visualization of the transcriptomic co-expression edges indicate that the HRR value between any two networks in rice. The platform combines the available genes is HRR ≤ 10, 10 < HRR ≤ 20, and 20 < HRR ≤

3068

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

30, respectively. The colors of the nodes indicate the Foundation item: the Key Technology description of the knock-out of a given gene, wherein Projects of Henan Province (no.10210110108, red, yellow, green, and gray nodes represent embryo no.102102310345), Young Teachers in Universities of lethal, gametophytic lethal, described non-lethal Henan Province (no. 2010ggjs-168) and National phenotype, and no available phenotype, respectively. Natural Science Fund of China (grant no.30800204). (A) shows the partial co-expressed network in cluster Corresponding Author: 364 showing the direct linkage of three up-regulated Huiyuan Ya genes: Os01g0959200, Os01g0959100, and Life science Department, Luoyang Normal University Os06g0147300. LOC_Os01g72910.1 is the gene 71# Longmen Road, Luoyang 471022, China. identifier in RiceNet representing the gene with ID in E-mail: [email protected] RAP-DB: Os01g0959200. Similarly, References LOC_Os06g05470.1 represents Os06g0147300 and 1. Atsushi TANAKA, Naoya SHIKAZONO and LOC_Os01g72900.1 represents Os01g0959100. (B) Yoshihiro HASE. Studies on Biological Effects of shows the partial co-expressed network in cluster 462 Ion Beams on Lethality,Molecular Nature of showing the indirect linkage of three up-regulated Mutation, Mutation Rate,and Spectrum of genes: Os02g0787600, Os06g0521500, and Mutation Phenotype forMutation Breeding in Os11g0482200. LOC_Os02g54640.1 represents Higher Plants. J. Radiat. Res., 2010; (51) : 223– Os02g0787600, LOC_Os06g32990.1 represents 233 . Os06g0521500, and LOC_Os11g29210.1 represents 2. Satoru MONZEN, Kenji TAKAHASHI, Hironori Os11g0482200. YOSHINO, Kiyomi KASAI-EGUCHI,Yoshinao RiceNet analysis (Fig. 1) shows that three ABE, Atsushi MARUYAMA, Ken ITOHand Ikuo genes including Os01g0959200, Os01g0959100, and KASHIWAKURA. Heavy Ion Beam Irradiation Os06g0147300 present the direct co-expressed Regulates the mRNA Expressionin network (Fig. 1-A) in cluster 364 which is involved in Megakaryocytopoiesis from Human the secondary metabolism of flavonoids and flavonols HematopoieticStem/Progenitor Cells. J. Radiat. and signaling (http://aranet.mpimp- Res., 2009; (50) : 477–486. golm.mpg.de/ricenet/rc364). Also, there is a direct co- 3. Hao CHEN, Fanghua LI, Hang YUAN, Xiang expressed network linkage between Os11g0482200 XIAO,Gen YANG and Lijun WU. Abscopal and Os06g0521500 (Fig. 1-B) in cluster 462 which is Signals Mediated Bio-Effects in Low-EnergyIon involved in lipid metabolism, abiotic stress, and Irradiated Medicago truncatula Seeds. Regular signaling, but an indirect co-expressed network linkage Paper J. Radiat. Res., 2010; (51) : 651–656 . between Os02g0787600, Os11g0482200, and 4. Jwa, N.-S., G. K. Agrawal, et al., Role Os06g0521500 (http://aranet.mpimp- of defense/stress-related marker genes, proteins golm.mpg.de/ricenet/rc462). These findings suggest and secondary metabolites in defining rice self- there are complicated biological processes occurring in defense mechanisms. Plant Physiology and response to bombardment with low-energy ion beams Biochemistry, 2006;(44) : 261-73. in the plants. 5. Lee, I., Y.-S. Seo, et al., Genetic dissection of the Our microarray data on the different biotic stress response using a genome-scale gene biological effects occurring in the low-energy ion network for rice. Proceedings of the National beam bombardment experiments reveals the general Academy of Sciences, 2011; (108) :18548-53. and key genes responsive to the stress of bombardment 6. Kawaura, K., K. Mochida, et al., Genome-wide during rice germination. It suggests that the analysis for identification of salt-responsive genes differentially expressed transcripts clustered into many in common wheat. Functional & Integrative groups and were associated with the requirements of Genomics, 2008; (8) : 277-86 the different events occurring while adapting to ion 7. Zhou, J., X. Wang, et al., Global genome bombardment. The data provides information on the expression analysis of rice in response to drought candidate genes for further elucidation of the and high-salinity stresses in shoot, flag leaf, and molecular mechanisms for the biological effects panicle. Plant Molecular Biology, 2007; (63) 591- caused by ion-beam bombardment and for its use 608 regarding the improvement of corn yield. 8. Xiong, L. and J.-K. Zhu, Abiotic stress signal transduction in plants: Molecular and genetic Acknowledgements: perspectives. Physiologia Plantarum, 2001; (112) : 152-66. 3/19/2013

3069

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Anesthetic Induction with Propofol versus Ketamine Pre and Post Lower Pole Nephrectomy in Dogs

Shekidef, M. H1.; Helal, I. E2 and Ramadan, Taha3

Department of Surgery, Anesthesiology and Radiology, Faculty of Veterinary Medicine, Suez Canal University1, Experimental Surgery Unit, King Fahd Medical Research Center, King Abdul Aziz University2& Department of Clinical Pathology, Faculty of Veterinary Medicine, Suez Canal University3. [email protected]

Abstract: This study was performed on fourteen Mongrel dogs to compare anesthetic induction in healthy, as well as, partially nephrectomized dogs using bolus intravenous administration of either propofol 4 mg/kg b.wt. in group I (before nephrectomy) and group II (one month after lower pole nephrectomy) or ketamine 10 mg/kg b.wt. in group III (before nephrectomy) and group IV (one month after lower pole nephrectomy). The quality of induction and recovery, the occurrence of cardiovascular and respiratory side effects and serum biochemical parameters were investigated. The results revealed that, anesthetic induction time did not change significantly in dogs before and after nephrectomy under the effect of either propofol or ketamine. Meanwhile, ketamine induced significantly longer weak time and down time than did propofol in corresponding groups. RRF was significantly longer in nephrectomized than non nephrectomized dogs under the effect of both agents while, recovery time was significantly longer in nephrectomized than non nephrectomized dogs under the effect of propofol. Ketamine caused significantly longer recovery time than did propofol in corresponding groups. There were no significant differences in induction and recovery scores before and after nephrectomy in dogs anesthetized with either propofol or ketamine. However, propofol caused significantly better induction and recovery than did ketamine in corresponding groups. Propofol caused significant decrease but ketamine caused significant increase in heart rate and respiratory rate in both nephrectomized and non nephrectomized dogs. Meanwhile, they did not significantly alter rectal temperature. ECG tracings showed only change in heart rate without arrhythmias. Significant increases in AST, LDH, CPK, urea and creatinine were observed in all groups with minor disparity from one to another group. It could be concluded that ketamine had better cardiopulmonary effect than propofol but the later was superior in the quality of induction and recovery. Lower pole nephrectomy in dogs had minimal impact on the modality of the effect of either agent. [Shekidef, M. H.;Helal, I. E. and Ramadan, Taha. Anesthetic Induction with Propofol versus Ketamine Pre and Post Lower Pole Nephrectomy in Dogs. Life Sci J 2013;10(1):3070-3080]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 380

Key words: Dog – ketamine – nephrectomy - propofol

1. Introduction being excreted in the urine. In man, liver disease and Induction of short-term anesthesia can be renal failure have little effect on pharmacokinetic accomplished by use of intravenous (IV) anesthetic parameters and it seems likely that extrahepatic drugs such as propofol and dissociative agents. mechanisms contribute to the metabolism of propofol, Propofol (2,6-di-isopropylphenol) is a nonbarbiturate but this has not been investigated in any detail in sedative/hypnotic drug that is rapidly metabolized in other animals (Hall et al., 2001). the animal. The best features of this drug include the Ketamine is a phencyclidine derivative. It is an N- rapid induction of anesthesia, short duration of action, methyl-D-aspartate receptor antagonist with analgesic lack of excitatory side effects on induction and and anesthetic properties. Unlike many anesthetics, recovery, and no significant cumulative effects on ketamine usually causes an increase in heart rate and repeated administration (Muir and Gadawski, 1998). arterial blood pressure as a result of increased However, the induction of anesthesia with propofol is sympathetic efferent activity (Wong and Jenkins, often associated with a marked decrease in systemic 1974). However, these cardiovascular effects may be arterial blood pressure in dogs (Brüssel et al., 1989). unacceptable in some circumstances leading to the Respiratory depression and apnea are reported to be development of hypertension and tachycardia the most consistent and important side effects in (Karapinar et al., 2006). Ketamine also has been animals receiving IV propofol (Muir and Gadawski, associated with violent recoveries, muscle 1998). However, the drug is a suitable choice in hypertonicity and convulsions in dogs (Haskins et al., patients with preexisting liver or kidney disease 1985). Rapid recovery following intravenous bolus (Glowaski and Wetmore, 1999). Propofol is highly ketamine administration is by rapid redistribution of lipophilic and rapidly metabolized primarily to ketamine from the CNS to other tissues, primarily fat, inactive glucuronide conjugates, the metabolites lung, liver, and kidney (Lanning and Harmel, 1975).

3070

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Clinically, animals with renal dysfunction or 14:00 o'clock. The assigned induction drug was obstruction to urine flow also have prolonged sleep injected intravenously by hand at a rate of 10% of the times when larger doses of ketamine are given (Short, total volume given as a bolus every 6 seconds until 1987). Generally speaking, dissociative anesthetics the total volume was injected (Sams et al., 2008). should be given cautiously to animals that have Loss of jaw tone and ability to intubate the trachea significant hepatic or renal dysfunction (Lin, 2007). without resistance was assessed and marked to Few, if any, studies were performed to assess estimate induction score by a single, blinded observer. intravenous anesthetic induction in nephrectomized The dog’s tracheas were intubated and they were or partially nephrectomized dogs. However, no data allowed to breathe spontaneously on room air. were available about the effect of propofol or Pulse rate, respiratory rate, and rectal temperature ketamine in nephrectomized dogs. were recorded before injection (baseline), and then The aim of this study was to compare anesthetic every 5 minutes after injection for an hour even after induction in healthy, as well as, partially the dogs began to swallow and the trachea was nephrectomized dogs using bolus intravenous extubated. ECG tracings, lead II with paper speed 25 administration of either propofol or ketamine. The mm/seconds, were recorded at 5 and 10 minutes after quality of induction and recovery, the occurrence of injection of both induction agents to evaluate the cardiovascular and respiratory side effects and serum electrical function of the heart. biochemical parameters were investigated to Blood samples were taken from cephalic vein determine whether either agent might be suitable for through the canula immediately before induction, and use as part of an induction technique in healthy or at 30, and 120 minutes as well as 24 and 48 hours partially nephrectomized dogs. In addition, this study after injection in clean dry tubes for serum also aimed at evaluating the influence of partial biochemical analysis. Serum was collected and (lower pole) nephrectomy on the effect of both agents marked for later biochemical estimation. Serum in dogs. biochemical analyses that included serum aspartate transferrase (AST) serum lactate dehydrogenase 2. Material and Methods (LDH), creatine phosphokinase (CPK), serum urea This study was performed on 14 Mongrel dogs and creatinine were estimated using a before and one month after being used for an spectrophotometric method. advanced experimental surgical technique Weak time (the time in seconds elapsed from the (Permanent renal tourniquet for lower pole end of injection of the induction agent to the time nephrectomy). Dogs were deemed to be healthy on when the animal showed ptosis of the head) and the basis of physical examination and serum induction time or down time (the time, in seconds, biochemical analysis. from the end of injection to sternal/lateral Dogs were randomly assigned into two sets each recumbency) were exactly recorded. In addition, of seven dogs. Each set received one treatment in two return of righting reflex, RRF time, (the time, in occasions. The first animal set received propofol minutes, elapsed from the end of injection to the (Diprivan®, AstraZeneca UK Limited, United ability of the animal to raise the head) and recovery Kingdom, 1% emulsion) as bolus intravenous time (the time, in minutes, from the end of injection induction agent before (Group I), as well as, one to the time when the dog was able to walk unassisted) month after partial nephrectomy (Group II), while the were also recorded. Quality of induction and second animal set received ketamine (Ketamine® 100, recovery scoring (Table, 1), and the incidence Pantex, Holland, 10% solution) as bolus intravenous of side effects, e.g. muscle twitching, apnea (no induction agent before (Group III), as well as, one spontaneous breathing for more than 20 seconds) and month after partial nephrectomy (Group IV). Dogs in salivation, were also recorded. the propofol set weighed 14.2 ± 3.7 kg (mean ± SD) Statistical analysis: and dogs in the ketamine set weighed 13.3 ± 3.1 kg. Values of HR, RR and RT, as well as, serum This protocol was approved by local research biochemical values were analyzed using one-way ethics committee of Faculty of Veterinary Medicine, analysis of variance (ANOVA) for comparison of Suez Canal University. Food was withheld at least 8 means between the groups and Dunnet multiple range hours prior to each animal being anesthetized. The test was used to compare the means at different dogs were weighed individually on the same scale. intervals, within the group, to the baseline values. Thereafter, they were assigned for induction of The data were presented as the mean ± SD. Induction anesthesia with propofol 4 mg/kg IV or ketamine 10 and recovery scores were analyzed primarily using mg/kg IV. Kruskal-Wallis test to estimate the mean ranks and to An IV catheter was placed in the cephalic vein. test the significance between groups; thereafter, All the dogs were anesthetized between 9:00 and Mann-Whitney U test was used to calculate the P

3071

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

value and test the differences between each two Cochran, 1967). The statistical analysis was groups. The data were presented as the mean ranks. performed using IBM SPSS 19.0.0 for windows. Significance was accepted at p < 0.05 (Snedecor and

Table (1): Criteria used to evaluate the quality of induction and recovery in non nephrectomized as well as, nephrectomized dogs induced with propofol and ketamine. Induction quality scoring* (1) Good = smooth induction, rapidly assumes recumbency, no signs of excitement, easy tracheal intubation (2) Fair = slightly prolonged, mild excitement, reflex response to tracheal intubation (3) Poor = obvious excitement, jumps or attempts to stand after recumbency, inability to intubate trachea Recovery quality scoring* (1) Good = smooth, easy transition to alertness, resumes sternal position, stands in a reasonable amount of time and is able to walk with minimal ataxia (2) Fair = transient excitement or whole body movements, some struggling, hyper-responsiveness that disappears once dog stands unassisted but with moderate ataxia (3) Poor = stereotypical behavior, e.g. circling, premature attempts to stand, prolonged struggling *Modified by Prasinos et al. (2005) after Lin et al. (1997) and Carroll et al. (1998).

3. Results longer in group II and group IV than those in group I Weak time and down time showed non significant and group III respectively. Recovery time in group I difference between group I and group II. There was was significantly shorter than that of group II, while, also non significant difference between group III and there was non significant difference between groups group IV. On the other hands, ketamine in group III III and group IV. Ketamine in group III and group IV and group IV induced significantly longer weak time induced significantly longer recovery time than did and down time than did propofol in groups I and propofol in group I and Group II respectively (Fig. 1). group II respectively. RRF times were significantly

Induction score, mean ranks, showed non between group III and group IV. Propofol in non- significant differences between group I and group II, nephrectomized (group I) and nephrectomized (group as well as, between group III and group IV. On the II) dogs caused significantly higher recovery score other hands, propofol in non nephrectomized dogs than did ketamine in non- nephrectomized (group III) (group I) and nephrectomized ones (group II) caused and nephrectomized (group IV) dogs respectively significantly better induction than did ketamine in (Fig. 2). Three dogs, after ketamine injection (2 in non nephrectomized dogs (group III) and group III and 1 in group IV), showed abnormal nephrectomized ones (group IV). Recovery score behavior during recovery. They showed a state of showed non significant difference between group I delirium and abnormal voice. After recovery, the and group II, between group II and group III and also

3072

Life Science Journal 2013;10(1) http://www.lifesciencesite.com former two dogs in group III had moderate ataxia for 15 minutes.

Group I and group II showed significant decrease ECG tracings (Fig. 5) showed no arrhythmias. in heart rate (Fig. 3) and respiratory rate (Fig. 4), Only, there were changes in heart rate which was compared to their baseline values, allover the follow- higher after ketamine injection than that after up period (60 min.). Group III showed significant propofol in both nephrectomized and non increase in HR from 5 min. to 40 min. post injection nephrectomized dogs. Rectal temperature (Fig. 6) compared to the baseline values. RR showed also showed non significant difference in all groups significant increase from 5 min. to 35 min. post allover the study period compared to the baseline injection. Group IV showed significant increase in values. HR and RR from 5 min. to 40 min. post injection compared to the baseline values.

5 minutes after injection 10 minutes after injection

3073

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Group I Group

Group II Group

GroupIII

GroupIV

Fig. (5): ECG tracings, lead II with paper speed 25 mm/seconds in dogs at 5 and 10 minutes after propofol in group1 (non nephrectomized) and group II (nephrectomized) as well as ketamine in group III (non nephrectomized) and group IV (nephrectomized) showing only differences in heart rates without arrhythmias.

Muscle twitching during anesthetic duration was and 4 out of 7 dogs in group II at the period between observed in 1 out of 7 dogs in group III and 1 out of 7 10 and 16 minutes after propofol injection, while dogs in group IV, while propofol did not induce ketamine did not induce apnea in group III and group muscle twitching in group I or group II. Apnea was IV. Salivation was observed in 3 dogs in group III recorded in 3 out of 7 dogs in group I at the period and 2 dogs in group IV. between 7 and 11 minutes after propofol injection

3074

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

There were significant increases in AST values Serum urea (Fig. 10) increased significantly at 30, (Fig. 7) in all groups at 30, 120 min. and 24 hrs after 120 min and 24 hrs after injection in group I, II and injection, while non significant difference was group III, while group IV showed significant increase observed at 48 hrs after injection compared to at 30, 120 min and 24, 48 hrs after injection baseline values. LDH (Fig. 8) increased significantly compared to the baseline values. Serum creatinine at 30, 120 min and 24 hrs after injection in group I (Fig. 11) increased significantly at 30, 120 min and and group III, while group II and group IV showed 24 hrs after injection in group I and group III, while only significant increase at 30 and 120 min after group II and group IV showed significant increase injection compared to the baseline values. Serum only at 30 min after injection compared to the CPK (Fig. 9) increased significantly at 30, 120 min baseline values. In all serum biochemical parameters, and 24 hrs after injection in group I, III and group IV, baseline values were significantly higher in group II while group II showed only significant increase at 30 and group IV (nephrectomized dogs) than those in min after injection compared to the baseline values. group I and group III (non nephrectomized dogs).

3075

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

4. Discussion anesthetic that has a rapid onset, short duration of In our study, anesthetic induction (weak time and action, rapid metabolism and does not result in down time) did not change significantly in dogs biologically active metabolites. Zoran et al. (1993) before and after nephrectomy under the effect of reported that, rapid onset of propofol action is caused either propofol or ketamine. On the other hands, by rapid uptake into the CNS. Meanwhile, Lin (2007) ketamine induced significantly longer weak time than stated that, because of its small molecular weight, a did propofol in corresponding groups. Similarly, pKa near the physiological pH (7.5), and high lipid Short and Bufalari, (1999) and Wagner and Hellyer, solubility, ketamine has a rapid onset of action, with (2000) stated that, propofol is an intravenous maximal effect occurring in approximately 1 minute.

3076

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

In this study, partial nephrectomy could not alter the from the bolus injection of propofol were excellent, common feature of the rapid anesthetic induction and all horses stood on their first attempt (Rezende et with either propofol or ketamine. al., 2010). On the other hands, abnormal behavior, RRF was significantly longer in nephrectomized which may progress to delirium, may occur during than non nephrectomized dogs under the effect of emergence from ketamine Lin (2007). Depression of both agents. Recovery time was significantly longer the inferior colliculus and medial geniculate nucleus in nephrectomized than non nephrectomized dogs leading to misperception of auditory and visual under the effect of propofol but not ketamine. stimuli may be responsible for this reaction (White et Ketamine caused significantly longer recovery time al., 1982). Emergence reactions are characterized by than did propofol in corresponding groups. Zoran et ataxia, increased motor activity, hyperreflexia, al. (1993) explained that, the short action and rapid sensitivity to touch, and sometimes violent recovery smooth emergence of propofol result from rapid (Beck, 1976; Wright, 1982 and Velisek and Mares, redistribution from the brain to other tissues and 1990). These reactions usually disappear within efficient elimination from plasma by metabolism. several hours without recurrence. Abnormal behavior, Guitton et al. (1998) explained that, the excretion in this study, was observed in three dogs and ataxia rates of propofol glucuronide and of both glucuronide was also observed in two dogs after ketamine conjugates of the metabolite 1,4-di-isopropylquinol injection. paralleled the corresponding plasma concentrations, Bleeker et al. (2008) hypothesized that but only for the first 15 hrs after induction of reabsorption of propofol and its metabolites by the anesthesia. Thereafter, the water-soluble glucuronides kidney is a major process in the overall elimination are excreted via the kidney by the process of and that the resulting compounds are gradually glomerular filtration. Meanwhile, termination of conjugated and excreted in the urine. This may effect after a single bolus of ketamine is caused by support our result that recovery not induction times rapid redistribution of the drug from brain to other were significantly longer in nephrectomized than non tissues (Lin, 2007). White et al. (1982) had nephrectomized dogs under the effect of propofol. interpreted formerly that, the α-elimination phase of Conversely Hall et al.(2001) reported that, in man, ketamine lasts only a few minutes, and the β- liver disease and renal failure have little effect on elimination half life is 2 to 3 hours. The compound is pharmacokinetic parameters and it seems likely that metabolized extensively by the hepatic cytochrome extrahepatic mechanisms contribute to the P450 system, by N-demethylation; its primary metabolism of propofol, but they admitted that, these metabolite, norketamine, is only one third to one fifth findings had not been investigated in any detail in as potent as the original compound. Aroni et al. other animals timely. On the other hand, clinically, (2009) added that, the metabolites of norketamine animals with significant hepatic dysfunction do not undergo renal excretion. Partial nephrectomy, in this metabolize ketamine as rapidly as do healthy animals study, had a noticeable effect on RRF and recovery (Short, 1987). He added that, animals with renal times. It prolonged RRF time after injection of both dysfunction or obstruction to urine flow also have propofol and ketamine, while it prolonged recovery prolonged sleep times when larger doses of ketamine time after propofol injection. are given. In our study a bolus intravenous ketamine In this study, there were no significant dose was used and the resulted RRF time was longer differences in induction and recovery scores before but recovery time was not significantly longer in and after nephrectomy in dogs anesthetized with nephrectomized than non nephrectomized dogs. either propofol or ketamine. However, propofol Generally speaking, Lin (2007) advised that, caused significantly better induction and recovery dissociative anesthetics should be given cautiously to than did ketamine in corresponding groups. Similarly, animals that have significant hepatic or renal Muir and Gadawski, (1998) reported that, the best dysfunction. features of propofol include the rapid induction of In this study, propofol caused significant anesthesia, short duration of action, lack of excitatory decrease but ketamine caused significant increase in side effects on induction and recovery, and no heart rate and respiratory rate in both nephrectomized significant cumulative effects on repeated and non nephrectomized dogs. They both did not administration. In addition, propofol has been significantly alter rectal temperature. Partial associated with high quality anesthetic recoveries in nephrectomy did not affect these common features of horses (Mama et al., 1996; Oku et al., 2003 and both drugs. Similarly, Smith et al. (1993) reported Boscan et al., 2006). They added that, recoveries that adverse cardiovascular and respiratory side from short anesthetic periods have been described to effects have been reported after propofol injection, be smooth and calm, and with few attempts to stand. including hypotension, hypoventilation and apnea. Both standing quality and overall recovery quality Goodchild and Serrao (1989) explained that the

3077

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

decrease in arterial blood pressure is believed to nephrectomized ones. The influence of lower pole result from the combined effects of impaired nephrectomy on the action of either propofol or myocardial contractility and a decrease in systemic ketamine was minimum and could be neglected. vascular resistance. In this study, propofol caused Lucia and Jacqueline (2009) reported that, AST is apnea in 3 out of 7 non nephrectomized dogs and 4 not an organ-specific and skeletal muscle contains the out of nephrectomized ones. Kashiwagi et al. (2004) highest concentration followed by liver and cardiac reported that, hypoventilation and apnea are mediated muscle. The enzyme half life is about 22 hours in centrally via depression of central inspiratory drive dogs and may increase due to muscle trauma and and the ventilatory response to carbon dioxide. There muscle diseases. They added that, LDH is an enzyme is evidence that the incidence and severity of these that catalyzes the conversion of lactate to pyruvate. It adverse effects are increased when propofol is is found in variety of tissues including liver, heart administered as a rapid bolus (Stokes and Hutton, and skeletal muscles. It increases in muscle and heart 1991) and this may be of concern if propofol is to be diseases. Madej and Stańczyk (1975) stated that, used to achieve rapid anesthetic induction and CPK is a leakage enzyme present in high endotracheal intubation in dogs. On the other hand, concentration in the cytoplasm of myocytes. It has a unlike many anesthetics, ketamine usually causes an very short half life about 1 hour. They found also that increase in heart rate and arterial blood pressure as a ketamine anesthesia in dogs and cats causes a slight result of increased sympathetic efferent activity reversible damage to the liver and kidneys and (Wong and Jenkins, 1974). Hall et al. (2001) increases the activity or reticuloendothelial cells in suggested that, this effect is probably due to an the organism. increase in circulating catecholamines caused by We hypothesized that, elevation of AST, LDH ketamine blocking the reuptake of noradrenaline by and CPK, in this study, might be due to muscle adrenergic nerve terminals. However, these twitching and liver action after ketamine injection as cardiovascular effects may be unacceptable in some well as, due to liver and myocardial action after circumstances leading to the development of propofol injection. These findings were supported by hypertension and tachycardia (Karapinar et al., Chen, et al. (2000) who reported that, there are 2006). On the other side, Booth (1988) reported that several lines of evidence indicating that propofol dissociative anesthetics, when given alone, differ induces subclinical and reversible disturbance in from most other anesthetics in that they do not hepatocellular integrity in human by affecting the depress ventilatory responses to hypoxia. In dogs serum level of hepatic enzymes in vivo after long anesthetized with ketamine, respiratory rate and term infusion. Our findings also were in agreement minute volume decrease initially, but both return to with Franco et al. (2004) who stated that, the baseline values within 15 minutes (Haskins et al., increased CPK and AST serum activity in ketamine- 1985). treated group imply that anesthesia induced alteration In this study, ECG tracings showed no in skeletal and cardiac muscles. They added that, arrhythmias, only change in heart rate which was such alterations were considered transient and higher after ketamine injection than that after returned to baseline values rapidly. Generally, propofol in both nephrectomized and non Corssen et al. (1968) and Dundee et al. (1978) nephrectomized dogs. Partial nephrectomy did not reported that, hepatic dysfunction following clinical affect the figure of the tracing under the effect of both use of ketamine, and other dissociatives, is not agents. These findings were in accordance with evident in either people or dogs. They added that, a Branson and Gross (1994) who reported that, significant increase in serum concentrations of liver propofol is not inherently arrhythmogenic, but may enzymes has been observed in people anesthetized enhance the arrhythmogenic effects of epinephrine. with a ketamine infusion and dogs given higher Propofol, in our study was used with a small bolus intramuscular doses. dose that could not enhance epinephrine induced Burkholder (2000) suggested that 15-20% of arrhythmia. Similarly, Hall et al. (2001) reported that, dogs have renal insufficiency as renal blood flow and cardiac arrhythmias are uncommon in animals under glomerular filtration rate reduced under the effect of ketamine anesthesia and the minimal arterial blood anesthesia. He added that, even if anesthesia pressure is always similar to and rarely less than the increases sympathetic stimulation as in case of preanesthetic level. dissociative anesthesia, renal blood flow also reduced. Significant increases in AST, LDH, CPK, urea Pre-anesthetic fasting caused uremia which might and creatinine were observed in all groups in this affect the drug activity and toxicity. It affects the study with minor disparity from one to another group. ability of albumin to bind to drugs and increase the Baseline values were significantly higher in proportion of free drug in plasma (Fishman, 1970). nephrectomized dogs than those in non

3078

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

It could be concluded that, although ketamine Brüssel, T.; Theissen, J. L.; Vigfusson, G.; had better cardiopulmonary effect than propofol, the Lunkenheimer, P. P.; Van Aken, H. and Lawin, later was superior in the quality of induction and P. (1989): Hemodynamic and cardio dynamic recovery. Lower pole nephrectomy in dogs had effects of propofol and etomidate: negative minimal impact on the modality of the effect of either inotropic properties of propofol. Anesth. Analg. agent. The only evident alteration was the relatively 69, 35–40. prolonged recovery times especially after propofol Burkholder, W. J. (2000): Dietary considerations for injection. Further investigations are needed to dogs and cats with renal disease. J. Am. Vet. Med. discover the effect of the variation in the size and/or Assoc. 216: 1730-1734. location of the nephrectomized portion of the dogs' Carroll, G. L.; Hooper, R. N. and Slater, M. R. kidney on the anesthetic effect. (1998): Detomidine-butorphanol-propofol for carotid artery translocation and castration 5. Acknowledgement and Correspondence or ovariectomy in goats. Vet. Surg., 27, Dr. Hatim A. Al Abbadi, MD, Director of 75–82. Experimental Surgery Unit at King Fahd Medical Chen, T. L.; Wu, C. H.; Chen, T. G.; Tai, Y. T.; Research Center, Consultant General Surgeon at Chang, H. C. and Lin, C. J. (2000): Effect of King Abdulaziz University Hospital, King Abdulaziz propofol on functional activities of hepatic and University – Jeddah, Saudi Arabia extrahepatic conjugation enzyme systems. Br. J. Address: King Abdulaziz University Hospital Anesth. 84 (6) 771-776. Building 10, Surgical Department Corssen, G.; Miyasaka, M. and Domino, E. F. PO Box 80215, Jeddah 21589 (1968): Changing concepts in pain control Jeddah, Saudi Arabia during surgery: Dissociative anesthesia with CI- Mobile: +966 (0) 505759150 581—A progress report. Anesth. Analg., 47 (6): Email: [email protected] 746-759. Dundee, J. W.; Fee, J. P. H.; Moore, J.; McIlroy, P. 6. References D. and Wilson, D. B. (1978): Liver function Aroni, F.; Iacovidou, N.; Dontas, I.; Pourzitaki, C. studies after ketamine infusions. Br. J. Clin. and Xanthos, T. (2009): Pharmacological Pharmacol. 6 (5): 450-451. aspects and potential new clinical applications of Fishman, R. A. (1970): Permeability changes in ketamine: reevaluation of an old drug. J. Clin. experimental uremic encephalopathy.Archives of Pharmacol., 49 (8): 957-964. Internal Medicine 126: 835-837. Beck, C. C. (1976): Vetalar (ketamine hydrochloride): Franco L. G.; Fioravanti, M. C. S.; Damasceno, A. A unique cataleptoid anesthetic agent for D.; Borges, A. C.; Soares, L. K.; Rabelo, R. E. multispecies usage. J. Zoo Anim. Med., 7: 11-38. and da Silva, L. A. F. (2004): Assessment of Bleeker, C.; Vree, T.; Lagerwerf, A. and Willems- serum enzymatic markers of cardiomyocytes van Bree, E. (2008): Recovery and long-term injury in female dogs submitted to ketamine S(+), renal excretion of propofol, its glucuronide, and atropin and xylazine association. Acta Cirurgica two di-isopropyl quinol glucuronides after Brasileria 24(1): 36-42. propofol infusion during surgery. British Journal Glowaski, M. M. and Wetmore, L. A. (1999): of Anaesthesia, 101 (2): 207–212. Propofol: application in veterinary sedation and Booth, N. H. (1988): Intravenous and other anesthesia. Clin. Tech. Small Anim. Pract. 14, 1– parenteral anesthetics. In: Booth, N, H., 9. McDonald, L. E, eds. Veterinary Pharmacology Goodchild, C. S. and Serrao, J. M. (1989): and Therapeutics. Ames, IA: Iowa State Cardiovascular effects of propofol in the University Press, 212. anaesthetized dog. Br. J. Anaesth., 63(1):87-92. Boscan, P.; Steffey, E. P.; Farver, T. B.; Mama, K. Guitton, J.; Buronfosse, T.; Desage, M.; Flinois, J. R.; Huang, N. J. and Harris, S. B. (2006): P.; Perdrix, J. P.; Brazier, J. L. and Beaune, P. Comparison of a high (5%) and low (1%) (1998): Possible involvement of multiple human concentrations of micellar microemulsion of cytochrome P450 isoforms in the liver propofol formulation with a standard (1%) metabolism of propofol. Br. J. Anaesth., 80 (6): emulsion in horses. Am. J. Vet. Res., 67(9):1476- 788–795. 1483. Hall, L. W.; Clarke, K. W. and Trim, C. M.(2001): Branson, K. E. and Gross, M. E. (1994): Propofol in Veterinary Anesthesia (10thed.). W. B. Saunders, veterinary medicine. J. Am. Vet. Med. Assoc. 204: London, UK, pp.123–124. 1888-1890. Haskins, S. C.;Farver, Т. В. and Patz, J. D. (1985): Ketamine in dogs. Am. J. Vet. Res. 46:1855-1860.

3079

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Karapinar, B.; Yilmaz, D.; Demirag, K. and Kantar, micellar micro emulsion propofol formulation. M. (2006): Sedation with intravenous ketamine Vet. Anaesth. Analg., 37, 440–450. and midazolam for painful procedures in Sams, L.; Braun, C.; Allman, D. and Hofmeister, E. children. Pediatr. Int. 48, 146–151. (2008): A comparison of the effects of propofol Kashiwagi, M.; Okada, Y.; Kuwana, S.; Sakuraba, and etomidate on the induction of anesthesia and S.; Ochiai, R. and Takeda, J. (2004): A on cardiopulmonary parameters in dogs. neuronal mechanism of propofol-induced central Veterinary Anaesthesia and Analgesia, 35, 488– respiratory depression in newborn rats. Anesth. 494 Analg., 99, 49-55. Short, C. E. (1987): Dissociative anesthesia. In: Lanning, C. F. and Harmel, M. H. (1975): Short, C. E., ed. Principles and Practice of Ketamine anesthesia. Annu. Rev. Med. 26: 137- Veterinary Anesthesia. Baltimore: Williams and 141. Wilkins, 158. Lin, H. C. (2007): Dissociative anesthetics. Short, C. E. and Bufalari, A. (1999): Propofol InTranquilli W. J., Thurmon J. C. Grimm K. A. anesthesia. Vet. Clin. North. Am. Small Anim. eds. Lumb & Jones' Veterinary Anesthesia and Pract. 29 (3):747-778. Analgesia, 4th ed. Blackwell Publishing, Ames. Smith, J. A.; Gaynor, J. S.; Bednarski, R. M. and Iowa. p. 301. Muir, W. W. (1993): Adverse effects of Lin, H.C.; Purohit, R. C. and Powe, T. A. (1997): administration of propofol with various Anesthesia in sheep with propofol or with preanesthetic regimens in dogs. J. Am. Vet. Med. xylazine-ketamine followed by halothane. Vet. Assoc., 202, 1111–1115. Surg., 26, 247–252. Snedecor, G. W. and Cochran, W. G. (1967): Lucia, A. and Jacqueline, C. W. (2009): Liver Statistical Methods, 6th edn, (Oxford and TBH, enzyme elevations in dogs: Physiology and New Delhi). Pathophysiology. Compendium Vet. Com. CE Stokes, D. N. and Hutton, P. (1991):Rate-dependent Article 1, 408-414. induction phenomena with propofol: Madej, J. A. and Stańczyk, J. F. (1975): Effect of implications for the relative potency of ketamine anesthesia on enzyme activity in intravenous anesthetics. Anesth. Analg., 72(5): organs of dogs and cats. Anaesth Resusc 578-583. Intensive Ther., 3(4): 297-303. Velisek, L. and Mares, P. (1990): Anticonvulsant Mama, K. R.; Steffey, E. P. and Pascoe, P. J. (1996): action of ketamine in laboratory animals. In: Evaluation of propofol for general anesthesia in Domino EF, ed. Status of Ketamine in premedicated horses. Am. J. Vet. Res. 57, 512– Anesthesiology. Ann Arbor, MI: NPP: 541. 516. Wagner, A. E. and Hellyer, P. W. (2000): Survey of Muir, W. W. and Gadawski, J. E. (1998): anesthesia techniques and concerns in private Respiratory depression and apnea induced by veterinary practice. J. Am. Vet. Med. Assoc., propofol in dogs. Am. J. Vet. Res. 59, 157–161. 217:1652–1657. Oku, K.; Yamanaka, T.; Ashihara, N.; Kawasaki, K.; White, P. F.; Way, W. L. and Trevor, A. J. (1982): Mizuno, Y. and Fujinaga T. (2003): Clinical Ketamine- Its pharmacology and therapeutic uses. observations during induction and recovery of Anesthesiology. 56 (2):119-136. xylazine-midazolam-propofol anesthesia in Wong, D. H. W. and Jenkins, L. C. (1974): An horses. J. Vet. Med. Sci., 65 (7): 805-808. experimental study of the mechanism of action Prassinos, N. N.; Galatos, A. D. and Raptopoulos, D. of ketamine on the central nervous system. Can. (2005): A comparison of propofol, thiopental or Anaesth. Soc. J., 21, 57-67. ketamine as induction agents in goats. Vet. Wright, M. (1982): Pharmacologic effects of Anesth. Analg. 32, 289-296. ketamine and its use in veterinary medicine. J. Rezende, M. L.; Boscan, P.; Stanley, S. D.; Mama, Am. Vet. Med. Assoc., 180 (12):1462-1471. K. R. and Steffey, E. P. (2010): Evaluation of Zoran, D. L.; Riedesel, D. H. and Dyer, D. C. (1993): cardiovascular, respiratory and biochemical Pharmacokinetics of propofol in mixed breed effects, and anesthetic induction and recovery dogs and greyhounds. Am. J. Vet. Res., 54 (5): behavior in horses anesthetized with a 5% 755-760.

3/15/2013

3080

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Electrogastrographic (EGG) and Gastric Emptying Changes in Patients with Duodenal Ulcer .The Effect of H. Pylori Eradication

Samia A. Abdo1, HishamS. Abdel Fattah2, Uomna Kamel3

1Gastroenterology unit, Faculty of Medicine, Ain shams University, Cairo, Egypt 2Faculty of Medicine, Misr University For Science And Technology 3Faculty of Medicine, 6 October University , Cairo, Egypt [email protected]

Abstract: Helicobacter pylori infection and the use of non-steroidal anti-inflammatory drugs (NSAIDs) are now generally accepted as critical factors in the pathogenesis of peptic ulcer (PU). Helicobacter pylori(H. Pylori) infection is associated with over 90% of duodenal ulcer. Helicobacter Pylori infection may result in several alternation of gastro-duodenal physiology. Aim of the work: was to study the possible gastric myo-electrical activity changes in patients with H. Pyloriassociated duodenal ulcer and their relation to gastric emptying, as well as the effect of H. Pylorieradication on such changes. Patients and methods: 60 subjects were enrolled in this study and classified into three groups: Group I: Twenty patients with H. Pyloriinfection associated with duodenal ulcer Group II: Twenty patients with H. Pylorinegative duodenal ulcer. Grouplll: Twenty age and sex matched "healthy" asymptomatic volunteers; ten positive and (llla) ten negative (lllb) for H. Pylori. For all patients; complete history and physical examination, upper endoscopy and pyloric antral biopsy for H. Pyloridetection, abdominal ultrasound, and electro-gastrogram were performed. Results: in group I patients mean of power ratio (PR) was lower than that of group IIIa (1.42±0.74 versus 2.94±1.9 (P<0.01), while, gastric emptying parameters showed insignificant difference. No significant difference was found between group II and group IIIb as regards EGG parameters, while full time and ½ empting time in-group II was significant by lower than group IIIb. (13±2.8min, 15.7±2.8min. respectively P<0.05, and 4.89±2.2min, versus 6.7±2.48min for ½ empting time P<0.05). After eradication therapy 87% of our patients became negative for H. Pylori, EGG repeated for group 1 patients after eradication. The mean of % power at rest, The mean of %CPM at meal, and The mean of PR was significantly lower before than after treatment(P<0.05, <0.05. &<0.01). The mean of power at rest of DF was statistically significant higher before than after treatment P<0.01. Mean of 1/2 in-group I patients was higher before than after eradication therapy). Conclusion: Helicobacter pylori infection can affect gastric motility, especially in duodenal ulcer infected patients. Eradication therapy improved not only EGG abnormalities but also aids in restoration of abnormal water gastric emptying. [Samia A. Abdo, HishamS. Abdel Fattah and Uomna Kamel. Electrogastrographic (EGG) and Gastric Emptying Changes in Patients with Duodenal Ulcer. The Effect of H. Pylori Eradication. Life Sci. J 2013;10(1):3081- 3088]. (ISSN: 1097-8135). http://www.lifesciencesite.com. 381

Keywords: Electrogastrography (EGG), gastric motility, Helicobacter Pylori, duodenal ulcer.

1. Introduction somatoststin, gastrin and cholecystokinin in the gastric Duodenal ulcer is one of the most common mucosa. Somatoststin is the major inhibitory hormone gastrointestinal disorders, with a lifetime prevalence of of gastrointestinal secretion andmotility (4) Kontureket 4–15%. Helicobacter pylori (H. pylori) isa spiral al., found that H. pyloriinfection in DU patients is bacterium that infects the lining of the stomach and accompanied by enhanced gastric emptying that can be predisposes the patient to gastritis and ulcer. H. reversed by the eradication of H. pylori. They pyloriinfection is observed in 70–90% of individuals concluded that both CCK and somatostatinmight with duodenal ulcer (1). H. Pyloriinfection may result contribute to normalization of gastric emptying in several alternation of gastro duodenal physiology (2) following H. pylorieradication in DU patients (2). and have been proposed as the main mechanisms Gastric myoelectrical activity can be recorded by leading to duodenal ulcer using electrgatrography, a non- invasive way by means Various pathogenic factors originating from H. of electrodes attached to the abdominal skin. pylori have been implicated in the effect of this Electrogastrography (EGG) is a reliable and accurate bacterium on the gastric mucosa (3). H. pylori infected technique for the measurement of gastric myoelectrical patients had decreased in the antralsomatostatin activity. It provides information about the frequency concentrations as well as in the somatostatin levels of and regularity of the gastric slow wave (5). Unlike the gastric fluid. H. pylori infection changes the electrocardiogram with which a physician can perform concentration of regulatory peptides such as diagnosis by examining the tracing, the EGG must be

3081

Life Science Journal 2013;10(1) http://www.lifesciencesite.com subjected to computerized spectral analysis. This is macrolides, dopaminergic agonists, adrenergic because the EGG signal is weighted summation of all agents, morphine, contraceptive pills). gastric slow waves presented in the stomach. 6. Patients with previous abdominal surgery. EGG recordings were analyzed to derive the 7. Patients with systemic illness. following parameters: (1) percentage of normal gastric waves (2.0-4.0 cpm), bradygastric waves (1.0-2.0 cpm), All participants were subjected to the following: and tachygastric waves (4.0-10.0 cpm); (2) dominant Patients and volunteers gave informed consent frequency (DF); (3) dominant power (DP); (4) The prior to the investigations early postprandial frequency dip and (6) the ratio of post-prandial to fasting in DP. A percentage of normal 1. Upper gastrointestinal endoscopy: slow wave frequency of more than 70% was defined as The endoscopy was done in Ain Shams normal (5). The EGG power ratio is believed to be University Hospital and Misr University For Science associated with gastric contractility; the increase in the And Technology Hospital in the endoscopy theater by EGG power ratio reflected an increase in gastric Olympus GIF Type 2 T 200 and GIF 180 video scope contractions. gastroduodenoscope. H. pylorieradication was highly efficient using The endoscopy was cleaned mechanically and by eradication therapy. Eradication treatment using detergent, disinfectant glutaraldehyde and rinse in tap various regimens is a standard measure for H. water after each examination for elimination of H. pyloriinfected duodenal ulcer patients (6)Eradication pyloriand other bacterial transmission through the of infection provides a long term cure of duodenal endoscope. ulcers in more than 80% of patients whose H. The patients were fasting for at least 6 hours pyloriwas positive.If H. pyloricolonization indeed before the endoscopic examination. Two biopsies from disturbs gastric emptying, the restored gastric the antrum and corpus were taken and were prepared emptying will be obtained after effective H. for histopathological examination after being kept in pylorieradication.(7). formaldehyde 10%. Aim of the workwas to assess the possible gastric myoelectrical activity changes in patients with H. 2.Histopathological examination: pyloripositive duodenal ulcer and their relation to Gastric biopsies were routinely processed to gastric emptying, as well as the effect of H. paraffin block and 3mm sections were cut. One of the pylorieradication on such changes. two biopsies kept in formaldehyde 10% stained with haematoxylin and eosin stain and was subjected to 2.Patientsand Methods histopathological examination. Grading of gastritis Sixty subjects attending Ain Shams University was carried out, the mucosa designated as being Hospital and Misr University for Science and normal unless inflammatory cells were present in Technology Hospital were enrolled in this study, and greater than usual numbers. Identification of H. classified into three groups: pyloriin all specimens was made by viewing the Group I: Twenty patients with H. pyloripositive ulcer. haematoxylin and eosin (8). Group II: Twenty patients with H. pylori– A subject was considered infected with H. negativeduodenal ulcer. Pylori only, if typical curved or S shaped bacilli Grouplll: Twenty age and sex matched "healthy" approximately 1 to 3mm long and 0.5mm wide were asymptomatic volunteers; divided into two subgroups; observed with a rose colored with haematoxylin and group llla, ten H. pyloripositive and group lllb, ten H. eosin stain. pylorinegative subjects. H. pyloristatus in the control 3. Assessment of gastric emptying by ultrasonography: group III was assessed by absence of H. pyloriantigen All subjects were fasting for at least 6 hours in the stool by using: The Femto Lab H. pylori Cnx before examination; abdominal U/S was performed enzyme immunoassay (EIA) The detection of the with 3.5 array transducer. antigen is based on the principle of enzyme linked Technique: immunosorbent assay (ELISA). Gastric examination was performed by a Exclusion criteria: curvilinear array, low-frequency (3.5-MHz) transducer 1. Patients with diabetes mellitus. Toshiba system. Patients were scanned in the supine 2. Patients with end-organ failure position. The antrum is usually best visualized in a 3. Patients with calculargall bladder. parasagittal plane just right of the midline, surrounded 4. Pregnant females. by the left lobe and caudate lobe of the liver anteriorly 5. Patients taking drugs affecting gastric motility (e.g. and the head or neck of the pancreas posteriorly. prokinetics, anticholinergics, antibiotics like

3082

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Fig. (1): Histopathology of H. Pylorigastritis.

The left lobe of the liver, the Inferior vena cava, done after the skin has been carefully abraded to and the superior mesenteric vein were used as decrease resistance to obtain a good signal to noise internal landmarks. The two vessels are usually ratio. One hour recording while the patient is fasting visualized slightly to the right of the abdominal was done, then given a standardized test meal (pastes midline. Once these vessels were identiﬁed, the and 250ml milk) and postprandial recording for one transducer was rotated slightly clockwise or hour was done. After the recording session The EGG counterclockwise to best obtain a true cross-sectional signals were subjected to spectral analysis (Fast Fo) view of the antrum (the smallest possible cross- The mean of the power spectra for the entire sectional view). The anteroposterior and craniocaudal recording period was calculated. The EGG signal, the diameters were measured in this view (9). highest power in the 3 cpm band, was then selected The antrum has a characteristic multilayered for further analysis. The mean frequency of the wall. The antrum was judged to be empty if it normal 3 cpm component, and its standard deviation appeared flat, with anterior and posterior walls and its power content was calculated for the fasting juxtaposed. The antrum was judged to contain fluid if and postprandial period. The early postprandial it appeared to have an endocavitary lumen with frequency dip of the normal 3 cpm gastric component hypoechoic content and distended walls. was identified. The frequency minimum and the Patient’s sitting position and small volume subsequent frequency maximum of the dip were of liquid meal (<300ml water) are safe factors against calculated by means of line-to-line analysis of the floating of gastric contents in the corpus and fundus. first 10 running spectra after the meal. The power The following markers of gastric motility were ratio (the ratio of the power of the mean spectrum of measured: the postprandial state to the power of the mean a) Basal antral area: was the mean of two spectrum of the fasting state), indicative of the measurements taken 0 and 5 min. before the meal. postprandial increase in gastric motor activity, was b) Maximal postprandial antral area: was calculated for the first hour of the postprandial period. measured after maximal widening of the antrum Dysrhythmia was defined as follows: A had occurred, usually within 2 min. postprandial. tachygastria was considered to be present when the c) Minimal postprandial antral area: was the power spectrum contained a sharp-peaked component smallest area measured at any time with a frequency >3.7 cpm and <10.8 cpm, which postprandially. was not of respiratory origin. For a definite diagnosis d) Half emptying time: was the time in minutes to of tachygastria it was required that at the same time observe a 50% decrease in maximal antral area (t the normal gastric signal (2.6-3.7 cpm) was absent in ½ time). Calculated by linear regression analysis all four EGG signals and that the abnormal rhythm from the linear part of antral emptying curve. was present for at least 2min.A so-called bradygastria Antral emptying curves were obtained by was defined as presence of a sharp peak at a plotting antral area vs. time(10). frequency less than 2.6 cpm, in the absence of a 4. Elecrogastrography: normal 3 cpm component in all four EGG leads(5). Gastric electrical activity was recorded from Postprandial dip was defined as transient frequency five disposal pregelled silver/silver chloride surface decrease after the food intake. electrodes placed on the upper abdomen. This was

3083 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Fig. 1): Running Fourier Transformation at rest and meal in a patient showing normal 3 cpm gastric signal.

. Fig. 3): Running fourier transformation at rest and meal of a patient showing tachygastria with absence of normal 3 cpm gastric signal.

Fig. 5): Running Fourier Transformation at rest and meal of a patient showing bradygastria with absence of normal 3 cpm gastric signal.

5. Helicobacter H. pylori eradication therapy: every H. Pylori positive patient, followed by 20 days An eradication triple regimen for H. Pylori of omeprazole. Omeprazole alone (20mg bid) was (omeprazole® 20mg bid, amoxicillin 1g bid and given for H. Pylori negative duodenal ulcer patient. clarithromycin 500mg bid) was given for 10 days for

3084 Life Science Journal 2013;10(1) http://www.lifesciencesite.com

6.Endoscopy, electrogastrography, and measurement mean of full time was (13±2.8min) in-group II and of gastric emptying time using ultrasonography, were (15.7±2.8min.) in-group IIIb (P<0.05).The mean of 1/2 repeated one month after completion of therapy. emptying time was 4.89±2.2min among group II and 6.7±2.48min among group IIIb (P<0.05). The rest of 3. Results parameters showed no significant difference (Table 4). The number of males in the studied groups was After eradication therapy (triple therapy for H. 35, and that of females was 25.The percentage of pylori), 87% of our patients became negative for H. males in the study was averaged 75%, 70%, 50%, 80% pylori, according to eradication criteria of H. pylori. in groups I, II, IIIa and IIIb, respectively. The mean EGG repeated for group 1 patients before and after age of the subjects was; 47.7±19.53, 49.65±14.79, eradication therapy, it was found that: The mean of % 47±16.89, and 43.8±17.3 years in groups I, II, IIIa, and power at rest in-group I before treatment was IIIb, respectively statistically significant lower than after treatment Table1; was demonstrating the different EGG (16.9±4.48, and 19.24±5.7 respectively P<0.05).The parameters among group I patients and group IIIa. The mean of %CPM at meal was significantly lower than mean of power ratio (PR) in group I patients was after treatment, (74.01±25.2 and 87.65±22.5 significantly lower (P<0.01) than that of groupIIIa respectively P<0.05). The mean of PR before (1.42±0.74 versus 2.94±1.9). While the rest of treatment was significantly lower than after treatment parameters showed insignificant difference. (1.42±0.73 and 2.06±.09, respectively P<0.01). The Table 2; demonstrating high significant %CPM mean of power at rest of DF was statistically in group II patients than IIIb (86.84 ±17.97, and 68.8 significant higher before treatment than after treatment ±34.8 respectively P< 0.05). No significant difference (344 1.7±1970.5, 2222.5±1267.5 respectively P<0.01). was found between them asregardsother EGG The rest of parameters showed insignificant difference parameters. (Table 5). The comparison between group-I and group-IIIa The difference of various gastric emptying regarding gastric emptying parameters, all the parameters in group I patients before and after parameters showed insignificant difference. (Table 3) eradication therapy, there was increase in the mean of The comparison between groups II and IIIb 1/2 emptying time after eradication therapy regarding gastric emptying parameters shows that the (5.3±2.6min. before versus 5.8±2.4min. after full time and the ½ empting time in-group II was eradication therapy), but it was non-significant, the rest statistically significant lower than group IIIb. The of parameters showed no significant difference.

Table(1):Comparison between Group I, and control (Group llla) regarding EGG parameters expressed in mean±SD: Group Group I Group 111a t value P Statistical significance EGG % Power rest 16.9±4.47 15.88±3.6 0.64 >0.05 Non-significant % Power meal 18.3±7.3 21.67±6.9 1.3 >0.05 Non-significant DF (cpm) 2.80.73 2.78 ±0.39 0.28 >0.05 Non-significant %CPM rest 79.9±22.45 76.1±19.1 0.45 >0.05 Non-significant %CPM meal 74.02±25.15 71.9±18.5 0.23 >0.05 Non-significant Power rest DF 33441.6±1970.5 2309.8±1543 1.58 >0.05 Non-significant Power meal DF 4573.8±2637.3 5498.4±2751.3 0.89 >0.05 Non-significant PR 1.42±0.74 2.94±1.9 3.16 <0.01 Highly significant CPM; cycle per minute.DF; dominant frequency. PR; power ratio Table (2): Comparison between Group II and control (Group lllb) regarding EGG parameters are expressed in mean±SD: Group Statistical significance Group II Group III b t value P EGG % Power rest 19.07 ±4.48 16.78 ±2.4 1.5 >0.05 Non-significant % Power meal 24.11 ±8.37 24.2 ±7.08 0.03 >0.05 Non-significant DF (cpm) 3.33 ±0.9 2.9 ±0.35 1.26 >0.05 Non-significant %CPM rest 85.18 ±19.27 69.5 ±31.36 1.69 >0.05 Non-significant %CPM meal 86.84±17.97 68.8 ±34.8 1.88 <0.05 Significant Power rest DF 2755.4±1764.35 2142.8 ±1763.4 1.04 >0.05 Non-significant Power meal DF 5091.6±3528.98 4441.5±2124.3 0.53 >0.05 Non-significant PR 2.14 ±1.5 2.1 ±0.7 0.08 >0.05 Non-significant CPM; cycle per minute.DF; dominant frequency. PR; power ratio

3085

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Table (3) :Comparison between Group I and control (group llla) regarding gastric emptying parameters are expressed in mean ± SD: Group Group Statistical Group I t value P Emptying lll a significance Full emptying time (min.) 13.1 ±3.68 15.4 ±3.34 1.66 >0.05 Non-significant 1/2 emptying time(min.) 5.24 ±2.58 6.39 ±2.43 1.68 >0.05 Non-significant Full antrum (cm2) 6.35 ±2.86 8.44 ±3.8 1.68 >0.05 Non-significant Fasting antrum (cm2) 3.86 ±1.85 4.3 ±1.58 0.67 >0.05 Non-significant

Table(4): Comparison between Group II and control (group lllb) regarding gastric emptying parameters are expressed in mean ± SD: Group Statistical Group II Group lllb T value P G.emptying Significance Full emptying time (min.) 13 ±2.8 15.7 ±2.8 2.48 <0.05 Significant 1/2 emptying time (min.) 4.89 ±2.2 6.7 ±2.48 2.06 <0.05 Significant Full antrum (cm2) 7.05 ±2.34 8.86 ±2.44 1.96 >0.05 Non-signific Fasting antrum (cm2) 4.14 ±1.2 3.87 ±0.74 0.65 >0.05 Non-significant

Table (5) :Comparison between Group I patients before and after eradication therapy as regards EGG parameters are expressed in mean ± SD: Group Before eradication After eradication Statistical t value P EGG therapy therapy significance % Power rest 16.9 ±4.48 19.24 ±5.72 2.6 <0.05 Significant % Power meal 18.33 ±7.3 22.4 ±7.5 1.7 >0.05 Non-significant DF (cpm) 2.85 ±0.73 2.96 ±0.32 5.54 >0.05 Non-significant %%CPM rest 79.87 ±22.45 78.08 ±27.53 0.25 >0.05 Non-significant %CPM meal 74.01 ±25.15 87.65 ±22.46 2.07 <0.05 Significant Power rest DF 3441.65 ±1970.5 2222.45 ±1267.47 3.12 <0.01 Highly significant Power meal DF 4573.85 ±2637.33 4354.0±2355.37 0.52 >0.05 Non-significant PR 1.42 ±0.73 2.0 ±0.9 2.86 <0.01 Highly significant CPM; cycle per minute.DF; dominant frequency. PR; power ratio

Table (6): Comparison between group I patients regarding gastric emptying parameters before and after eradications therapy are expressed in mean ± SD: Group Before eradication After eradication t value P Statistical significant Emptying therapy therapy Full emptying time (min.) 13.1±3.68 13.1±1.9 0.0 >0.05 Non-significant 1/2 emptying time (min.) 5.25± 2.58 5.83±2.36 0.78 >0.05 Non-significant Full antrum (cm2) 6.35±2.86 8.35±4.55 1.53 >0.05 Non-significant Fasting antrum (cm2) 3.86±1.85 6.36±5.27 1.09 >0.05 Non-significant

4.Discussion waves are observed in the EGG (5). The percentage of Gastrointestinal motility has been attracting normal slow waves can be computed from the running attention as an important contributory factor in the power spectra of the EGG (Fig. 6).In our method, one pathogenesis of duodenal ulcer. However, the results of spectrum is derived from every 1 minute of EGG data; previous studies, which assessed gastric motility in the minute is considered normal if its EGG spectrum duodenal ulcers, are conflicting (11). It has been exhibits a dominant power in the range of 2-4 cpm. In suggested previously that unusual rapid gastric human, the normal percentage of gastric slow wave is emptying and resulting duodenal hyperacidity may defined as 70%. contribute to the pathogenesis of duodenal ulcer In the present study there was no significant formation (5). In contrast markedly deformed duodenal difference between the H. pylori positive patients with bulb with coexisting edema, fibrosis and scarring in or without peptic ulcer regarding neither the stomach chronic duodenal ulcer might be involved in emptying time, nor the EGG records, except in the mechanical obstruction in gastric emptying (12). power rate, where it was significantly lower in the first The percentage of normal slow waves is a group than the second. Power rate was indicative of the quantitative assessment of the regularity of the gastric postprandial lower gastric motor activity in H. slow wave measured from the EGG. It is defined as the pyloripositive patients with peptic ulcer disease percentage of time during which normal gastric slow (1.42±0.74 in group I and 2.94±1.9 in group IIIa,

3086

Life Science Journal 2013;10(1) http://www.lifesciencesite.com p<0.01). Power Ratio is a commonly used parameter during fasting the percentage of normogastria, and the that is associated with alteration in gastric postprandial amplitude of EGG in patients with active contractions(13). These results coincide with those of duodenal ulcer was slightly increased after Chang et al., who studied 64 H. pyloriinfected active eradicationH. pylori. This increase in the postprandial duodenal ulcer (DU) patients, and liquid gastric power was significantly small. This difference in EGG emptying was measured. They found that about 35% amplitude between patients with active ulcer infected manifested either enhanced or delayed gastric empty with H. Pyloriand those with eradicated H. Pylori or (7). healthy controls suggests disturbed myoelectrical Many studies have focused on the effect of activity by the presence of an ulcer. Also, they duodenal ulcer (especially with H. pyloriinfection) on observed the ratio of frequency of normogastria gastric emptying. In our study; comparing the H. increased after eradication, and this was coinciding pylorinegative duodenal ulcer patients with with those of the present study. They concluded that asymptomatic control group, full gastric empting time most changes in gastric myoelectical activity and its and ½ gastric emptying time were significant shorter in regulation observed in duodenal ulcer patients with the patients with peptic ulcer than asymptomatic active ulcer and H. Pylori infection abolished by a patients. This was coordinated with higher % cpmin- successful eradication of H. Pylori. After eradication, group II than group IIIb (p

3087

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

Increased gastric emptying rate has been proposed as symptomatic changes after prokinetic drug treatment for one of the factors responsible for duodenal ulcer functional dyspepsia World J Gastroenterol. 2012;18(41): formation (19). These data suggest that eradication 5948–5956. therapy for H. pylori infection could modify gastric 6. Javier P. Gisbert Rescue Therapy for Helicobacter pyloriInfection Gastroenterology Research and Practice motility. Volume 2012, Article ID 974594 The present study speculated that eradication 7. Chang F-Y, Lu C-L, Chen C-Y, et al.; Effect of therapy in duodenal ulcer patients with positive H. Helicobacter pylorieradicated therapy on water gastric Pylori infection (Group I) was associated with emptying in patients with active duodenal ulcer. J normalized gastric emptying. Although the full GastroenterolHepatol; (2003): 18: 1250-1256. emptying time was not changed after eradication 8. Lin MH, Cheng HT, Chuang WY, Yu LK, Tsou YK, Lee therapy, the mean of the 1/2 emptying time was mildly MS. Histological examination of ulcer margin for increased after eradication, which means slower diagnosing Helicobacter pyloriinfection in patients with emptying after eradication (but still did not reach the gastric ulcers. Ann DiagnPathol. 2012 Sep 13; 17(1):63-6. 9. Perlas A, Chan V, Lupu C, Mitsakakis N, Hanbidge A. significant value P>0.05). Ultrasound assessment of gastric content and volume. Anesthesiology 2009;111:82–9 Conclusion 10. Lawrence A. Szarka and Michael Camilleri , Methods for Helicobacter pylori infection can affect gastric measurement of gastric motility, Am J motility, especially in duodenal ulcer infected patients, PhysiolGastrointest Liver Physiol 2009; 296: G461– presented by disturbed gastric myoelectrical activity; G475, and accelerated liquid gastric emptying. Eradication 11. Kamiya T, Kobayashi Y, Misu N, et al., Gastric therapy improvednot only EGG abnormalitiesbut also myoelectrical activity in patients with recurrent gastric or aids in restoration of abnormal water gastric emptying. duodenal ulcers. J Smooth Muscl Res; (2003): 39(1-2): 1- 10. Multicenter studies are needed to document our results. 12. Paine P A, Rees W, Babbs C, Shaffer J L, A patient with impaired gastric motility; Gut. 2007; 56(11): 1635–1636. Corresponding author 13. Jieyun Yin and Jiande D Z Chen Electrogastrography: Dr. Samia Ali Abdo Methodology, Validation and Applications J Assistant consultant of general medicine, NeurogastroenterolMotil, 2013; 19(1): 5–17. Gastroenterology unit, Ain Shams, Faculty of Medicine, 14. Williams NS, Elschoff J and Meyer JH Gastric emptying Cairo, Egypt. of liquids in normal subjects and patients with healed E mail: [email protected] duodenal ulcer disease. Dig Dis Sci; (1986): 31: 943-52 15. Konturek JW, Stoll R, Menzel J, et al., Eradication of Helicobacter pyloriRestores the inhibitory effects of References; Cholecystokinin on gastric motility in duodenal ulcer 1. Schöttker B, Adamu MA, Weck MN, Brenner patients. Scand J Gastroenterol; 2001: 36 (3): 241-6. H.Helicobacter pylori infection is strongly associated 16. Zerbib F, Bicheler V, Leray V, et al.,H. pylori and with gastric and duodenal ulcers in a large prospective transient lower esophageal sphincter relaxations induced study. ClinGastroenterolHepatol. 2012; 10(5):487-93.e1. by gastric distension in healthy humans. Am J 2. Konturek JW, Stoll R, Menzel J, et al.: Eradication of PhysiolGastrointest Liver Physiol; 2001: 281: G350- Helicobacter pyloriRestores the inhibitory effects of G356 Cholecystokinin on gastric motility in duodenal ulcer 17. Budzynski A, Bobrzynski A, Lorens K, et al. The patients. Scand J Gastroenterol; (2001)36 (3): 241-6. influence of Cholecystokinin on gastric myoelectrical 3. AyhanHilmi Cekin,1 Muharrem activity in duodenal ulcer following Helicobacter Taskoparan,2 AdilDuman, Clinical Study The Role of pylorieradication- an electrogasatrographic study. J Helicobacter pyloriand NSAIDs in the Pathogenesis of Physiol Pharmacol; 2002: 53 (2): 171-182. Uncomplicated Duodenal Ulcer Gastroenterology 18. Kaneko H, Konagaya T, Kusugami K. Helicobacter Research and Practice 2012; 189,373, 6 pylori and gut hormones J Gastroenterol 2002;37(2):77- 4. Mustafa Güçlü1, Tolga Yakar1, Ali Pourbagher 86 Ultrasonographical Evaluation of Gallbladder Functions 19. Kamiya T, Kobayashi Y, Misu N, et al., Gastric in Helicobacter pylori-Positive and Negative Patients myoelectrical activity in patients with recurrent gastric or European Journal of General Medicine2009, Vol. 6, No. duodenal ulcers. J Smooth Muscl Res; 2003: 39(1-2): 1- 1, pp. 15-19 10. 5. Hyun Chul Lim, Sang In Lee, Jiande DZ Chen, and Hyojin ParkElectrogastrography associated with

3/15/2013

3088

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

The comparison of ambiguity, loneliness feeling and responsibility tolerance among the children of single child and multi child families

Hanie Shokri Mirhosseini1, Zahra Rafiee Javid2.

1 MA in Psychology. Islamic Azad University. Roodehen, Iran. 2 MA in Psychology, Vocational Junior College faculty member of sama. Babol, Iran. email:[email protected]

Abstract: The aim of this study was to compare the ambiguity tolerance and sense of loneliness with responsibility of children in single and multi child families. The research method of this study was casual – comparative method. Statistical population is consisted of all secondary school female students of Tehran and the sample size is determined as 281 cases. To select the desire sample of students a multi-stage cluster sampling was used. Data collecting tool was the scale of responsibility questionnaire of Sanaei et al (1381), Asher loneliness scale of tolerance and the McLean’s (1993) tolerance of ambiguity questionnaires, respectively. In this research, independent T and logistic regression was used to test the hypotheses. Results from T tests of a couple of independent groups showed that with 5 percent of confidence we can say that there is no significant difference between children tolerance of ambiguity components (role-taking complexity and unresolved issues) in single and multi child families. Also with 95 percent one can say that there is no significant difference between the loneliness feeling and responsibility scales in single and multi child families. And finally in response to the contribution of each variable to separate children of single and multi child families, logistic regression analysis showed that in the prediction equation only role taking among all other predictor variables is significant and is able to predict this issue. [Hanie Shokri Mirhosseini, Zahra Rafiee Javid. The comparison of ambiguity, loneliness feeling and responsibility tolerance among the children of single child and multi child families. Life Sci J 2013;10(1):3089- 3095] (ISSN:1097-8135). http://www.lifesciencesite.com. 382

Keywords: tolerance of ambiguity, loneliness feeling responsibility single and multi child families.

1- Introduction child families are often early maturing. Social Child development is affected by two major maturity o these children may also be useful. They factors which include present and absent factors. A encounter with problems sooner than the others, single child grows in a family where only adults live problems that are inevitable in adulthood. They and there is no other child to communicate with him / express their problems and ideas easily and are able to her. Both of these factors play an important role in help their parents. They start working and economical raising and developing a single child one (Mansouri, activity sooner than other children and do not 1385). Children in a single child family compared to a embarrass from working. These children begin multi child one are fully addressed and receive more maturity period with much experience and readiness affection. These factors cause the child to feel as an (Mansouri, 1385). One of the disadvantages of being important person. Benefits of growing up in single a single child is its impact on the child’s development. child families are so that the child can say: “I like to These children do not have anyone to compete or and be the only child in the family. There are no rival and fight with him. They have no friend or partner at home, no one to stimulate jealousy. There is no need to fight so do not experience some of the emotions and won’t with anyone to own what I want. “ those children who have any opportunity to control and manage them. A live in single child families feel more confident and child who lives in a single child family is less likely to enjoy more self-esteem (Sharifi Daramadi, 1386). face with problems and does not encounter with Peiro (2004) in a study on 5 years old children came failure, frustration and etc, and does not experience to this result that children who have brothers or sisters the necessary conditions of mental and psychological in comparison to children in the same age who are not maturation. If parents don’t allow their children to be single child have weaker social and communication confronted with uncomfortable and hard feeling or skills and this issue increased the concerns. Another don’t provide the possibility to show these kinds of factor which affects on a child of a single child family emotions, they will weaken his/her strength against is presence in a family that includes only the adults. these emotions. Parents’ tendency to protect their only These children begin to talk sooner that usual tie and child avoids their child to try his/her mistakes have a stronger community spirit. They imitate their consequences and be responsible for his/her actions. parents and behave like adults in a way that provokes They never put them in a position to criticize their admiration and surprise of others. Children of single children, they do not disagree with him and meet

3089

Life Science Journal 2013;10(1) http://www.lifesciencesite.com his/her demands always to keep him/her feel happy. Schwartz (2008) argues that unfulfilled desire for Several studies (styr, 2003, Hamasen, 2006) have emotional connection causes many people to feel proven the unlimited support of parents of single child alone. Ladrer and Jackson (2011) noted that the families and believe that these families bring up their strongest and most annoying loneliness feeling is that children in a sensitive and weak spirit. The more the loneliness which begins with another one. When parents support their only child the little is his power communication fails to fill the loneliness of a person, of ambiguity tolerance and so that are very fragile and anger, bitterness and rejection feelings occur that can vulnerable. cause a greater sense of emotional loneliness Ambiguity tolerance is the acceptance of (Ma’asoumi, 1390). Loneliness can cause to uncertainty as a part of life, the ability to survive with depression and self-destructive behaviours such as little knowledge about the environment and the substance abuse or lack of personal responsibility. tendency to start an independent activity without Karipo (2009, quoted by Sadeghi, 1389) believes that knowing whether an individual will be successful or the people lose only confidence in others and therefore not (Andrylip, 2011). it is hard to themselves to make friends so that lightly The purpose of ambiguity tolerance is that how fade from the social circle. This affects on the much an individual feel threat and hardship in his responsibility to fulfilling the tasks. On the other hand adaptation with the environment. When changes it must be said that trying to build family relationships occur rapidly and unpredictably, data are inefficient provides proper background for ethical health and and non-transparent. This is the point where the general welfare of a community. And one of the individual’s differences affect on their reactions. syndromes of this stabilization is the responsibility of Someone who has a high tolerance for ambiguity children in a family. And it is the reason of critical usually has a sophisticated understanding of events importance of responsibility to every individual. This and follows the perception cognitive style in his (responsibility) cannot be achieved at once but it is interpretations. They transmit information better and realized and fulfilled gradually and many factors generally are more sensitive than others in the involve in learning it. If it’s true that the lack of workplace (Andrylip and Hakan, 2010). Individuals pepper responsibility is interpreted as negligence it with high ambiguity tolerance are able to face can cause to annoy relatives and consequently will efficiently with vague, incomplete, inconsistent, lead to poor communication. The same can be said unorganized and opaque information and conditions that several satisfactions of human’s needs depend on and solve ambiguities in favour of themselves. Indeed, the person’s relationship and is rooted in the ambiguity leads to their incentive (Ma’asoumi, 1390). individual’s responsibility. Responsibility is the key The power of tolerance for ambiguity is the result of point of human’s growth and perfection. What we are features such as self-confidence, power of prediction, today and what we will be in the future, both are the hope and actively dealing with phenomena. Ultimately effect of responsibility (Sanaei, 1384). In most individuals tolerate ambiguity situation to achieve the research on children’s responsibility moderator desired results (Hassani, 1386). Ambiguity tolerance variables are assumed and tolerance ambiguity is one is composed of three basic variables: 1- renewability of them (Oskow, 2007). Therefore considering the which is related to the human’s tolerance amount for above argument and conducted research the researcher new information and circumstances. 2- Complexity sought to answer this basic question: how much which indicates the tolerance amount for multiple contribution do ambiguity tolerance and loneliness on distinct and irrelevant information. 3- Being children’s responsibility of single child families in unresolved that is related to the tolerance for difficult comparison with multi child families? problems, hidden strategies, lack of access to the 2- The aim of this research information and lack of association with each To compare the ambiguity tolerance component of the problem (Ma’asoumi, 1390). components (such as functionality, complexity and Between this idea and the result there is a ladder unresolved issues) and loneliness feeling with called ambiguity tolerance which consists of emotion children’s responsibility in single and multi child and excitement. Sometimes this ladder is affected by families. variables such as loneliness so that the owner of that 3- Research questions idea cannot reach to the consequence (Lambourn et al, 1- Is there any difference between the 2009). Katipo (2010) defines loneliness as follows: ambiguity tolerance components (newability, harrowing evidence which its target is to encourage complexity, and unresolved issues) of the children of someone to communicate. People who feel alone need single and multi child families? to pay attention to this sign and take action to rectify 2- Is there any difference between the this situation. If loneliness is not dealt with, it has the children’s loneliness of a single child family and a power to put a negative impact on your health. multi child family?

3090

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

3- Is there any difference between the 4-2: Asher’s loneliness scale children’s responsibility of a single child family and a This test consists of 24 questions or statements multi child family? and each part has a scale of 1 to 4 points. To answer 4- What is the contribution of variables such as each question, subjects can choose one of the four ambiguity tolerance, functionality, complexity, options of: great much (4), too much (3), somewhat unresolved issues, loneliness feeling and responsibility (2), and never (1). Using Cronbach’s alpha the on separating children of single and multi child reliability coefficient of this test has been found as families? 0.80. 4- Methodology 4-3: MacLean ambiguity tolerance scale Research method of the present study is casual This scale has been provided by MacLean and – comparative one. Statistical population consists of David El (1993) and consists of 22 statements. In all secondary school female student of Tehran. Sample 2002 Curie has found the internal reliability of this size is determined by the Morgan’s table and 281 scale as 0.83. To answer each question, subjects can individuals were chosen. To select the desired sample choose one of the five choices of strongly agree (5), from the female students a multi-stage cluster somewhat agree (4), uncertain (3), somewhat disagree sampling was used. Instruments of data gathering (2) and strongly disagree (1). The reliability were the following questionnaires: coefficient of this questionnaire using Cronbach’s 4-1: Responsibility questionnaire scale alpha is reported as 0.86. To analyze the obtained date This questionnaire is designed by Sanaei et al of this study, the independent T and logistic regression (1381) in Iran and is usable for adults and adolescents. have been used. This test can be executed in groups and there is no 5- Findings time limitation for its implementation. The test The results of T test for a couple of consists of 33 questions or statements. Grading independent groups between variables such as method of this scale is to assign zero or one for every responsibility, loneliness feeling and three true or false statement respectively. High scores on components in the scale of ambiguity tolerance this test indicate a good responsibility and low scores (functionality, complexity and unresolved issues) indicate poor responsibility. Using Kronbach’s alpha among the single and multi child families are as the reliability of this questionnaire has been reported follows: as 0/81 (Sanaei et al, 1381).

Table 1: independent T test for comparison of variables of single and multi child families N M SD SDE T DF SIG Functionality index Single child 121 27/661 4/452 0/404 -1/292 279 0/198 Multi child 160 28/375 4/686 0/370 total 281 Complexity index Single child 121 18/570 3/898 0/354 -0/583 279 0/560 Multi child 160 18/868 4/498 0/355 Total 281 Unresolved problems Single child 121 22/719 4/274 0/388 0/647 279 0/518 Multi child 160 22/375 4/512 0/356 total 281 Loneliness index Single child 121 53/900 12/117 1/101 -0/214 279 0/831 Multi child 160 54/218 12/488 0/987 total 281 Responsibility index Single child 121 47/115 3/958 0/359 -0/179 279 0/858 Multi child 160 47/200 3/871 0/306 total 281

First question: Is there any difference between t = −1.292 t = −0.583 the ambiguity tolerance components (functionality, ( 0b ), complexity, ( 0b ), complexity and unresolved issues) of children in t0b = 0.647 single and multi child families? Since the obtained T and unresolved issues ( )) is less than in the ambiguity tolerance components (functionality, the T from the table with 279 degree of freedom, the null hypothesis is confirmed and the opposite

3091

Life Science Journal 2013;10(1) http://www.lifesciencesite.com hypothesis stating there is a significant difference Third question: is there any significant between the ambiguity tolerance components of difference between the children’s responsibility of a children in single and multi child families is rejected. single child family with that in a multi child one? Thus, we can conclude with 95% confidence that t = −0.179 there is no significant difference between children’s Since the obtained T ( 0b ) is less ambiguity tolerance components (functionality, than the T value of the table with 279 degree of complexity and unresolved issues) in single and multi freedom, the null assumption is verified and the child families. opposite one stating that there is a significant Second question: is there any significant difference between children’s responsibility of a difference between children loneliness felling of a single child family with that in a multi child one is single child family with a multi child one? rejected. Thus, we can conclude with 95% confidence t = −0.214 that there is no significant difference between According to the obtained T ( 0b ) children’s responsibility of a Single child family with from the T table with 279 degree of freedom, the null that in a multi child one. hypothesis is verified and the opposite one stating Fourth question: what is the contribution of that there is a significant difference between the each variable including functionality, complexity, loneliness feeling of children of single child families unresolved issues, loneliness feeling and with that in multi child one is rejected. Thus, we can responsibility to separate children of a single child conclude with 95% confidence that there is no family from those in a multi child one? significant difference between the children’s Table 2: logistic regression to distinguish loneliness emotion of a single child family with that between contribution of each variable between the in a multi child one. children of a single child and multi child families.

Table 2. Classification a Observed Predicted child Single child Multi child Percentage Correct Single child Multi child 20 101 Overall Percentage 19 141 16.5 88.1 57.3 A. THE CUT VALUE IS. 50 B S.E. Wald Df Sig. Exp(B) Responsibility .014 .032 .186 1 .666 1.014 Loneliness .004 .011 .176 1 .675 1.004 Unresolved problem -.072 .041 3.044 1 .081 .930 Functionality .127 .059 4.598 1 .032 1.135 Complexity .109 .076 2.068 1 .150 1.115 Constant 1.197 1.964 .372 1 .542 .302

Using prediction table, based on these 5 several forms in the new psychology literature. In variables which include functionality, complexity, fact, this can be evaluated in a more specific manner. unresolved issues, loneliness feeling and In reality, functionality is defined as the way responsibility 16.5 percent can be seen to split into that someone or a group is faced with acceptance of two groups of single child family and a multi child a function in the circle of unfamiliar ways and one.In the prediction equation only functionality complex concepts. It is believed that a person with variable among all predictor variables is significant. low ability to function normally may experience 6- Conclusion more stress and sometimes react in bad moment and The findings of Hosseini (1384) showed that try to separate himself from a vague driving children’s responsibility in a single and three (Bavarsad, 1387). children families in both female and male sexes has Those who cannot tolerate ambiguity when no significant difference and are consistent with the faced with an ambiguous situation, they move results of this study. rapidly towards the close conceptual sense. The responsibility structure in the field of Conversely, people who have a high ambiguity tolerance is a personality variable that tolerance for ambiguity do not accomplish well in due to different understandings presented itself in ambiguous assignments and seek for ambiguity and enjoy it or at least overcome it. Ice and csaron (2001,

3092

Life Science Journal 2013;10(1) http://www.lifesciencesite.com cited by Bavarsad, 1387) reported that functionality being a single child or multi child children had no has a negative relation with anxiety difference in both groups. The important issue of In individuals and it has no difference in both unresolved problems is the concern of many sexes in single and multi child families. researchers. Among the factors that affect on children’s Researchers believe that people are supposed functionality are social factors. Social factors play to face with problems, troubles and bother in the life, an important role in the functionality of girl and son but they can be taught the proper way to act well in of a family. The most important of these factors the face of such situations. Some people are not include: social norms, teachers and schools, sisters even able to fix and solve their daily problems and and brothers, relatives and peers. In this context, become nervous, distress, upset and agitated against peers play a major role. the smallest problem or choice. Relationship with friends and peers provide In contrast, there are another groups of an adequate model for the functionality of a person. individuals that solving a variety of problems and People learn their role better from their peers.The dealing with challenging and unresolved situations child learns how to behave with the opposite sex or not only distract them but also bring them to the the same sex. level of self consciousness so to the can identify The mass media and mass communication their weakness and resolve them (Ma’asoumi, 1389). tools with proper and informative programs also The main reason for this success is that these serve as effective instruments to develop people when faced with unresolved problems and functionality in children and adolescents. Another making decision take a systematic and step wise important social factor is educators and educational approach while the first group lack this capability. organizations. Every problem or decision essentially creates This is so important since the primary school a stressful situation. As long as a person does not environment in the early years is the approximately solve the problem correctly or does not make a good same for both female and male sexes in single and decision the stress intensity is increased and finally multi child families. And therefore there is no leads to activate unpleasant excitements. difference between these two groups. Complexity is As it was mentioned above one of the a variable that a person can deal with a situation responsibilities of the school as a social factor is to successfully where its end is unclear. Those who identify and solve the children’s problems. Problems have less tolerance for ambiguity typically fail in with different forms ranging from simple to complicated assignments. While those with high complicated which appear constantly in an tolerance for ambiguity do well in complicated tasks individual’s life. In this method, school without a and enjoy it. Note that this component has no loss of confidence helps them to think about their difference in single and multi child families. problems, find several ways and choose the best Among the consistent research with this idea strategy to fix their problems. In addition, children are the investigations of Krine and Gutamir (2007). learn to deal with their unresolved problems in such They believe that when a person or group faces with a manner that no anxiety or distress may be occurred. non familiar, complex and obscure methods, the They learn to have a logical reaction against the ambiguity is overcome. Durhime and Fostrer (2008) possible failures and since this issue is related to the in a study found that the complexity is not a school periods the lack of difference between these generalized personality feature, but is a particular two groups can be explained on this hypothesis. content. Krine and Gutamir (2007) argue that the Wise (2003) believes that loneliness is related to the lack of complexity is a feature that is the basic human need for intimacy in interpersonal characteristic of psychological states in adolescents. relationships and arise from the painful awareness of They define complexity as the beliefs about the feeling of not having access to a good close worry, problem orientation and moving towards relations with others. Adolescent is the first stage in problem solving. And they believe that these three human development where the loneliness sense is factors are related to the difficulty intensity in an felt as acute and detectable phenomena. Loneliness individual and there is no difference in both groups resulted from social isolation is due to the lack of an (Hosseini, 1390). attractive and interesting social network. This Also previous researches (quoted by absence can be rectified only with the access of such Ma’asoumi, 1389) are focused on unresolved issues network and social support. of young children and found that the tolerance Contrary to popular belief, the peak of ambiguity amount play an important role in loneliness is not the old ages. This feeling is most effectiveness of different behavioral states on common in adolescence and reaches approximately people’s performance in unresolved situations. Also 80% (Ahadi, Gomhori, 1383). Loneliness reaches its

3093

Life Science Journal 2013;10(1) http://www.lifesciencesite.com peak in adolescence and decrease with aging. But it interested parents in their job, and social events is not clear that its increment is in which period of which are associated with low level classes (Today, adolescence. Regarding the third question of this Gibson, 2008) can impact on their accountability study Moore (2007) concluded that children who are role. responsible internally and are responsible for their actions feel less loneliness than those who believes Resources: that have less control over their lives. He pointed 1 - Ahadi, Hassan. Jomhury. F. (1383). Psychology out that when children reach to adolescent stage of adolescent development, Publications their social environment expands dramatically. Also, Arasbaran. due to their mental abilities growth involve more in 2 - Bavarsad, A. (1387). "Construction and environment and some of their personality validation of a scale to measure ambiguity components such as responsibility are affected. tolerance and its relationship with anxiety. They put new standard and face with new and Type A personality and academic performance complex problems each of which needs to accept of students in pre-university centers of responsibility for them. If he is prepared to tackle Khuzestan province", Azad university of and eventually overcome these problems his Shahid Chamran, the master-mail. personal meaning will be clearer, his self – esteem 4- Sanaei, Zaker, M.B (1384), standardization of will be increased and his responsibility domain will psychological tests, Tehran, Tarbiat Maoallem be expanded. If the environment demand from them university publication. is sever, sudden and incomprehensible or a person 5- Sanaei, Zaker, M.B (1384), a critique on does not prepare mentally, physically, socially and responsibility theories, Maoallem university intellectual to deal with conventiaonal forces some publication, third edition. crippling contradictions arise on the inside that 6- Hosseini, M.B (1384), examination of the prepare the context for the emergence of psychotic relationship between mothers employment symptoms (including reduction in responsibility). with loneliness and academic performance of And therefore regarding the environment impact on their children and the parental style in the this variable one can concluded that there is no primary schools in Sanandaj city. Master difference between single and multi child families thesis in Semnan university. for this variable because the environmental factors 6- Hasani, F (1386), Ambiguity tolerance and (school, peers,) are the same for both groups. Of social consistency of normal and smart consistent research with the fourth question of the students. Master thesis in Tabriz university. study one can refer to the study conducted by 7- Hosseini, M (1386), improvement of self esteem Hosseini (1384). In his research, he concluded that and responsibility in adolescents, Journal of the functionality of children is fulfilled according to developmental psychology: Iranian their education and their relationship with their psychologists, year IV, No. 15, pp. 245-252. parents. In this case, the social statues of the family 8- Hosseini, Karineh (1384), a survey on can be effective in the children functionality. The relationship between parenting style and social class factor is defined typically based on one responsibility in adolescents. Master thesis in or more criteria of the following criteria: Parent’s Shahid Beheshti University. income, their education and occupational level. 9- Saeidi, A. (1388), parenting style effects on Social class alone helps us to determine the more responsibility for the Azad university students specific causes of some effects that are associated in south Khorasan, master thesis in Kashan with it. It is important, because although University. psychologists cannot change the person’s social 10- Sharifi Daramadi, P. (1386), social psychology, statue, but if they know what specific features of the first publication, Tehran, Avaye Noor. environment play important role, they can find, 11- Sadeghi, H. (1387), children responsibility and modify and prevent problems associated with a ambiguity tolerance of students. Journal of particular class. Issues such as poor health care, social sciences, Tehran University, 30th year, poor nutrition, low parental education level, less No. 1, pp. 40-59. intellectual stimulation at home. 12- Ma’asoumi, M. (1389), a survey on the Issues such as poor health care, poor relationship of ambiguity tolerance on the nutrition, low parental education levels, less reduction of the separation anxiety disorder intellectual stimulation at home, the low value symptoms and increase of parental attached to education, more stereotypes about authoritative style, phd in clinical psychology, gender roles, poor educational resources, less University of Welfare and Rehabilitation opportunities for outdoor activities and school, less Sciences.

3094

Life Science Journal 2013;10(1) http://www.lifesciencesite.com

13- Ma'asoumi A. a survey of relationship between 20. Hamassen; S. (2006); ambiguity tolerance in parenting style, loneliness and depression in adulthood structure, dynamics, and change; the adults. master's thesis, Islamic Azad guilford press, newyork. University, Roodehen. 21. Lamboren, j. & Berlin, p.r. (2009); hand book 14- Mansouri S. correlation of dependency and of ambiguity tolerance, theory; research and loneliness of Jewish students, master thesis, clinical application london; routledge. Islamic Azad University, Roodehen. 22. Toudei, A. & Gibson, l.a. (2008); contribution 15- Mansouri, M. Sadat (1385), Evaluation of of ambiguity tolerance theory to development single-child relationship, parenting styles, newyork: wiley. Islamic Studies and Psychology, No. 7. Pp. 14- 23. Kerayn, L & Gootimer, J. C. (2007). The 30. relationship between parenting types and older 16. Anderlip, R. (2011), An investigation of adolescents' personality, academic ambiguity tolerance and subjective well-being, achievement, adjustment, and substance use. personality and individual differences, vol 44, Child Development, 67, 2101-2114. p. 588. 24. Satir, J.F (2003) on of loneliness.American 17. Anderlip, R. Hackan. L. (2010) An Journal of Psycho, Analysis. 24.153-166. investigation ambiguity tolerance and 25. Peiro, M, (2004) loneliness: theory, research subjective well-being, personality and and application, California: Journal of Psycho, individual differences, 44, p. 589. Analysis. 24. 414-425. 18. Oscko, d. (2007) College drinking behaviors: 26. Moor.G (2007) loneliness and life satisfactin in ambiguity tolerance links between parenting Japan and Australia. The Journul of styles parental bonds depression and alcohol Psychology, 127(1).65-71. problems, Psychology of addictive behaviors, 27. Ckachipo, L (2010) three loneliness scales: An 21, 3, pp. 297-298. assessment of their measurement properties. 19. Lader, A & Jackson, K (2011) Perceived Journal of personality assessment, 380-409. ambiguity tolerance and Training styles: 28. Schuwartes, N.R (2008). loneliness among the Exploring the socialization of student elderly. Journal of teaching in physical processing, Journal of adolescence, 31, p. 161- eduction, champain, I, 211-219. 180. 29. Asher, K. A (1998) sex difference in loneliness: The Role of masculinity and feminity. psychiatray, 22: 1,1959.

3/11/2013

3095

Life Science Journal ISSN: 1097-8135 http://www.lifesciencesite.com

Life Science Journal

Acta Zhengzhou University Overseas Edition

(Life Sci J)

ISSN: 1097-8135

Call for Papers

The academic journal “Life Science Journal” (ISSN: 1097-8135) is inviting you to publish your papers. Life Science Journal, the Acta Zhengzhou University Oversea Version registered in the United States, is an international journal with the purpose to enhance our natural and scientific knowledge dissemination in the world under the free publication principle. The journal is calling for papers from all of the world. Any valuable papers or reports that are related to life science - in their broadest sense - are welcome. Other academic articles that are less relevant but are of high quality will also be considered and published. Papers submitted could be reviews, objective descriptions, research reports, opinions/debates, news, letters, and other types of writings. Let's work together to disseminate our research results and our opinions.

Please send your manuscript to [email protected]; [email protected]

Address: Life Science Journal - Acta Zhengzhou University Overseas Edition Marsland Press PO Box 180432, Richmond Hill, New York 11418, USA Telephone: (347) 321-7172 Emails: [email protected]; [email protected]; [email protected] Websites: http://www.lifesciencesite.com; http://www.sciencepub.net

Volume 10, Number 1 (Cumulative No.32) Par t 17 March 25, 2013 ISSN:1097-8135

Life Science Journal Acta Zhengzhou University Overseas Edition

Marsland Press PO Box 180432 Richmond Hill, New York 11418, USA

Website: http://www.lifesciencesite.com

Emails: [email protected] [email protected]

Phone: (347) 321-7172

ISSN 1097-8135

9 771097 813002