DOCSLIB.ORG

Identification of Rice Endophytes and Effect of Their Cultural Filtrates on Host Cultivars

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Rice Endophytes and Effect of Their Cultural Filtrates on Host Cultivars Oryza Vol. 48 No. 3, 2011 (244-249) Identification of rice endophytes and effect of their cultural filtrates on host cultivars Urmila Dhua*, Sudhiranjan Dhua, Apurba Chhotaray Central Rice Research Institute, Cuttack - 753 006 (Odisha) ABSTRACT Six endophytes were isolated from seeds of three long duration high yielding rice cultivars namely, Mayurkantha, Utkalprabha and Lunishree suitable for cultivation in rainfed lowland ecosystem of coastal Odisha. The six isolates included in this study were ascomycota fungi, Dendryphiella, Cladosporium, Acremonium, Valsa ambiens and Aspergillus oryzae have NCBI GenBank accession numbers viz. HM572292, HM572293, HM572295, HM572296. Isolate EN 18, isolated from the salt tolerant rice cultivar Lunishree was identified as Dendryphiella sp. which is a marine fungus.The germination percentage was not affected by the treatment with cultural filtrate of these endophytes and their metabolites present in cultural filtrates significantly enhanced length and weight of root and shoot of the rice genotypes. Key words : rice, seed, endophytes, cultural filtrates, effect Endophytes are fungi or bacteria which live within plant successfully for phylogenetic placement and segregation tissues, for entire or part of their life cycle and cause of endophytic mycelia sterilia (Promputtha et al., 2002). no apparent infection or symptoms. Colonization and Internal Transcribed Spacer (ITS) region of Ribosomal propagation of endophytes and their secondary DNA is now perhaps the most widely sequenced DNA metabolites inside the plants may enhance host- region in fungi and was found to be useful for the productivity and also may confer host the ability to identification of non sporulating endophytes. Hence, the adapt or resist abiotic and biotic stresses. An “inducible present investigation was carried out to identify the endophyte” was inoculated into rice which established fungus isolate EN18 by these molecular techniques and a symbiotic relationship with the rice plant and promoted study the effect of these six fungal endophytes on growth, antioxidant enzyme activity, and photosynthesis growth of respective rice cultivars. (Guo et al., 2004). The endophytes associated with seeds of various rice cultivars were isolated and MATERIALS AND METHODS identified (Dhua et al., 2010). Six endophytes were The EN18 culture was maintained on MS broth isolated from seeds of three long duration high yielding (Murashige and Skoog, 1962). DNA of this isolate was rice cultivars viz. Mayurkantha, Utkalprabha, and extracted (Dhua et al., 2008, 2011). Internal Lunisree. Four fungal cultures (GenBank accession Transcribed Spacer (ITS) region of Ribosomal DNA numbers: HM572292, HM572293, HM572295, was amplified (White et al., 1990) and sequenced for HM572296) were isolated from the seeds of rice variety its identification. Primers used for PCR amplification Mayurkantha. One fungal endophyte (NCBI-GenBank were ITS-1 (TCCGTAGGTGAACCTGCGG); ITS-4 accession number HM572294) was isolated from rice (TCCTCCGCTTATTGATATGC). Sequencing was cv. Utkalprabha. outsourced to Chromous Biotech. Pvt. Ltd., Kolkata. Sequence alignment was done for identifying the The endophyte associated with Lunishree was microbes. The sequences were analyzed with the a non-sporulating isolate that belonged to ‘mycelia algorithms afforded by Blast algorithms for nucleotide sterilia’. Molecular techniques have been used rr244 PDF created with pdfFactory Pro trial version www.pdffactory.com Oryza Vol. 48 No. 3, 2011 (244-249) or polypeptide homologous sequence analysis in NCBI Evolutionary relationships of 5 taxa with isolate (Zhang et al., 2000) BLAST. Phylogenetic analyses EN18 was studied (Fig.1). The evolutionary history was were conducted in MEGA4 (Tamura et al., 2007) inferred using the Maximum Parsimony method (Eck and Dayhoff 1966).Tree #1 out of 4 most parsimonious Six endophytes included in this study were trees (length = 24) is shown. The consistency index is grown in MS broth (Murashige and Skoog, 1962). Seeds (0.833333), the retention index is (0.625000), and the of above mentioned rice cultivars (Mayurkantha, composite index is 0.546875 (0.520833) for all sites and Utkalprabha and Lunishree) were soaked for twelve parsimony-informative sites. The percentage of hours in various concentrations (undiluted; 50% dilution; replicate trees in which the associated taxa clustered 25% dilution) of cultural-filtrate of fifteen days old together in the bootstrap test (500 replicates) are shown culture of respective endophytes. next to the branches (Felsenstein,1985) The MP tree Seeds of the rice variety Lunishree were was obtained using the Close-Neighbor-Interchange treated with EN18; Seeds of Utkalprabha were treated algorithm with search level 3 (Felsenstein,1985; Nei with HM572294; and the seeds of Mayukantha were M and Kumar, 2000) in which the initial trees were treated with HM572292, HM572293, HM572295, obtained with the random addition of sequences (10 HM572296. replicates). The codon positions included were Treated and untreated seeds were kept at 520C 1st+2nd+3rd+Noncoding. All positions containing gaps in a water bath for 10 minutes followed by shifting to and missing data were eliminated from the dataset ice cold water. Hot water treated seeds of all the (Complete Deletion option). There were a total of 10 treatments were transferred to Hoagland and Snyder positions in the final dataset, out of which 7 were (1934) culture solution.Germination percentage, root parsimony informative. Phylogenetic analyses were length, shoot length of 15 days old seedlings was conducted in MEGA4 (Tamura et al., 2007). measured and average length per seedling was Pairwise distance and number of base calculated. Root and shoot weight of seedlings in all substitutions per site were minimum with the treatments and replications was recorded. Dendryphiella (Table 2). All results are based on the pairwise analysis of 6 sequences. Analyses were RESULTS AND DISCUSSION conducted using the Maximum Composite Likelihood Database sequences were searched by Mega BLAST. method in MEGA4 [(Tamura et al., 2004) and (Tamura Sequences of Dendryphiella (HM572292), et al., 2007)]. Codon positions included were 1st +2nd Cladosporium (HM572295), Alternaria padwickii +3rd + Non coding. All positions containing gaps and (GU373650), Alternaria longissima (FJ971842) and missing data were eliminated from the dataset uncultured Ascomycota (AM901799) had shown pair- (Complete deletion option). There were a total of 10 wise similarities with fungal isolate EN18. positions in the final dataset. On the basis of above Dendryphiella and Cladosporium both had 99% mentioned analysis the isolate EN 18 was identified as similarity as well as E value zero with sequence of Dendryphiella sp.Isolate EN12, EN13, EN15 & EN19 EN18 (Table1). were from local rice cultivar Mayurkantha, EN14 was Table 1.Database sequences searched by Mega BLAST and showing pair-wise similarities with fungal isolate EN18 Database sequences withMax.Max.QueryE-value max. score showing similarityIdentityscorecoverage AccessionDescription HM572292 Dendryphiella 99%93199%0 HM572295 Cladosporium 99%92699%0 GU373650 Alternaria padwickii 98%85090%0 FJ971842 Alternaria longissima 92%64385%0 AM901799uncultured Ascomycota 92%65185%0 rr245 PDF created with pdfFactory Pro trial version www.pdffactory.com Rice endophytes Urmila Dhua et al Fig. 1. Evolutionary relationships of 5 taxa with isolate EN18 from high yielding rice variety Utkalprabha. Table 2 .Estimates of Evolutionary Divergence between Dendryphiella (EN12 and EN18) was associated with Sequences salt tolerant rice genotype Lunisree as well as local cultivar of coastal Odisha. EN 18 Dendryphiella9 The six isolates included in this study were Cladosporium14 ascomycota fungi. Dendryphiella(EN12, EN18) and Alternaria padwickii153 Cladosporium(EN15) both belonged to Alternaria longissima201 Pezizomycotina, Dothideomycetes but Dendryphiella Uncultured Ascomycota16 was from order Pleosporales and Cladosporium in Capnodiale(Table 3). Acremonium (EN13) and Valsa ambiens (EN14) both were in Sordariomtcetes. increase in root weight of rice cultivars Mayurkantha However Acremonium was placed in and Lunisree (Table 4, Fig 2, Fig.3 ). The cultural Hypocreomycetidae, Hypocreales and Valsa ambiens filtrates of undiluted Cladosporium (EN15) was included in order Diaporthales of Acremonium (EN13) and Aspergillus oryzae (EN19) Sordariomycetidae. Aspergillus oryzae (EN19) promoted shoot growth more than the root growth belonged to Eurotiomycetes, Eurotiomycetidae, (Table 4). Cladosporium (EN15) treated seedlings had Eurotiales (Table 3) almost double root weight than control though root length was at par with the untreated control. The The germination percentage of rice cultivars endophytic Valsa enhanced the root length of rice was not affected by the treatments with cultural filtrate cultivar Utkalprabha about 2.4 times and shoot length of all the endophytes included in this study. The was doubled . Diluted cultural filtrate was found to be metabolites of these endophytes present in the cultural more effective for enhancement of root length (Table5), filtrates significantly enhanced seedling length and although there was reduction in the root weight. weight of all the cultivars studied. Length and weight of Mayurkantha seedlings treated with endophyte The six isolates included in this study were cultural filtrate (EN12, EN13, EN15, EN19 isolated from endophytic ascomycota fungi associated with rice seeds. Mayurkantha)
Load more

Recommended publications
  • Characterization of Sheath Rot Pathogens from Major Rice-Growing
    Promotor: Prof. Dr. Ir. Monica Höfte Laboratory of Phytopathology Department of Crop Protection Faculty of Bioscience Engineering Ghent University Co-Promoter: Dr. Ir. Obedi I. Nyamangyoku Department of Crop Science School of agriculture, Rural Development and Agricultural Economics College of Agriculture, Animal Science and Veterinary Medicine University of Rwanda, RWANDA Dean : Prof. Dr. Ir. Marc Van Meirvenne Rector : Prof. Dr. Anne De Paepe ii Ir. Vincent de Paul Bigirimana Characterization of sheath rot pathogens from major rice- growing areas in Rwanda Thesis submitted in fulfilment of the requirements for the degree of Doctor (PhD) in Applied Biological Sciences iii Dutch translation of the title: Karakterisatie van pathogenen die “sheath rot” veroorzaken in de belangrijkste rijstgebieden in Rwanda Cover illustration: Some sheath rot disease features: - Left upper side: microscopic picture of the reverse side of Fusarium andiyazi isolate RFNG10 on PDA medium; - Left lower side: microscopic picture of the front side of Fusarium andiyazi isolate RFNG10 isolate on PDA medium; - Center: illustration of rice sheath rot symptoms on a rice plant; - Right side: illustration of a phylogenetic tree of Pseudomonas isolates associated with rice sheath rot symptoms in Rwanda and the Philippines. This work was financially supported by a PhD grant from the Belgian Technical Cooperation (BTC) (reference number: 10RWA/0018). Additional funding was provided by the Ghent University. Cite as: BIGIRIMANA V.P. 2016. Characterisation of sheath rot pathogens from major rice-growing areas in Rwanda. PhD thesis, Ghent University, Belgium. ISBN Number: 978-90-5989-904-9 The author and the Promoters give the authorization to consult and to copy parts of this work for personal use only.
    [Show full text]
  • Fungal Flora of Korea
    Fungal Flora of Korea Volume 1, Number 2 Ascomycota: Dothideomycetes: Pleosporales: Pleosporaceae Alternaria and Allied Genera 2015 National Institute of Biological Resources Ministry of Environment Fungal Flora of Korea Volume 1, Number 2 Ascomycota: Dothideomycetes: Pleosporales: Pleosporaceae Alternaria and Allied Genera Seung Hun Yu Chungnam National University Fungal Flora of Korea Volume 1, Number 2 Ascomycota: Dothideomycetes: Pleosporales: Pleosporaceae Alternaria and Allied Genera Copyright ⓒ 2015 by the National Institute of Biological Resources Published by the National Institute of Biological Resources Environmental Research Complex, Hwangyeong-ro 42, Seo-gu Incheon, 404-708, Republic of Korea www.nibr.go.kr All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of the National Institute of Biological Resources. ISBN : 9788968111259-96470 Government Publications Registration Number 11-1480592-000905-01 Printed by Junghaengsa, Inc. in Korea on acid-free paper Publisher : Kim, Sang-Bae Author : Seung Hun Yu Project Staff : Youn-Bong Ku, Ga Youn Cho, Eun-Young Lee Published on March 1, 2015 The Flora and Fauna of Korea logo was designed to represent six major target groups of the project including vertebrates, invertebrates, insects, algae, fungi, and bacteria. The book cover and the logo were designed by Jee-Yeon Koo. Preface The biological resources represent all the composition of organisms and genetic resources which possess the practical and potential values essential for human lives, and occupies a firm position in producing highly value-added products such as new breeds, new materials and new drugs as a means of boosting the national competitiveness.
    [Show full text]
  • Characterising Plant Pathogen Communities and Their Environmental Drivers at a National Scale
    Lincoln University Digital Thesis Copyright Statement The digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand). This thesis may be consulted by you, provided you comply with the provisions of the Act and the following conditions of use: you will use the copy only for the purposes of research or private study you will recognise the author's right to be identified as the author of the thesis and due acknowledgement will be made to the author where appropriate you will obtain the author's permission before publishing any material from the thesis. Characterising plant pathogen communities and their environmental drivers at a national scale A thesis submitted in partial fulfilment of the requirements for the Degree of Doctor of Philosophy at Lincoln University by Andreas Makiola Lincoln University, New Zealand 2019 General abstract Plant pathogens play a critical role for global food security, conservation of natural ecosystems and future resilience and sustainability of ecosystem services in general. Thus, it is crucial to understand the large-scale processes that shape plant pathogen communities. The recent drop in DNA sequencing costs offers, for the first time, the opportunity to study multiple plant pathogens simultaneously in their naturally occurring environment effectively at large scale. In this thesis, my aims were (1) to employ next-generation sequencing (NGS) based metabarcoding for the detection and identification of plant pathogens at the ecosystem scale in New Zealand, (2) to characterise plant pathogen communities, and (3) to determine the environmental drivers of these communities. First, I investigated the suitability of NGS for the detection, identification and quantification of plant pathogens using rust fungi as a model system.
    [Show full text]
  • Rice Sheath Rot: an Emerging Ubiquitous Destructive Disease Complex
    REVIEW published: 11 December 2015 doi: 10.3389/fpls.2015.01066 Rice Sheath Rot: An Emerging Ubiquitous Destructive Disease Complex Vincent de P. Bigirimana1,2, Gia K. H. Hua1, Obedi I. Nyamangyoku2 and Monica Höfte1* 1 Laboratory of Phytopathology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium, 2 Department of Crop Science, School of Agriculture, Rural Development and Agricultural Economics, College of Agriculture, Animal Science and Veterinary Medicine, University of Rwanda, Musanze, Rwanda Around one century ago, a rice disease characterized mainly by rotting of sheaths was reported in Taiwan. The causal agent was identified as Acrocylindrium oryzae, later known as Sarocladium oryzae. Since then it has become clear that various other organisms can cause similar disease symptoms, including Fusarium sp. and fluorescent pseudomonads. These organisms have in common that they produce a range of phytotoxins that induce necrosis in plants. The same agents also cause grain discoloration, chaffiness, and sterility and are all seed-transmitted. Rice sheath rot disease symptoms are found in all rice-growing areas of the world. The disease is Edited by: now getting momentum and is considered as an important emerging rice production Brigitte Mauch-Mani, Université de Neuchâtel, Switzerland threat. The disease can lead to variable yield losses, which can be as high as 85%. This Reviewed by: review aims at improving our understanding of the disease etiology of rice sheath rot Choong-Min Ryu, and mainly deals with the three most reported rice sheath rot pathogens: S. oryzae, Korea Research Institute the Fusarium fujikuroi complex, and Pseudomonas fuscovaginae. Causal agents, of Bioscience and Biotechnology, South Korea pathogenicity determinants, interactions among the various pathogens, epidemiology, Javier Plasencia, geographical distribution, and control options will be discussed.
    [Show full text]
  • Checklist of Microfungi on Grasses in Thailand (Excluding Bambusicolous Fungi)
    Asian Journal of Mycology 1(1): 88–105 (2018) ISSN 2651-1339 www.asianjournalofmycology.org Article Doi 10.5943/ajom/1/1/7 Checklist of microfungi on grasses in Thailand (excluding bambusicolous fungi) Goonasekara ID1,2,3, Jayawardene RS1,2, Saichana N3, Hyde KD1,2,3,4 1 Center of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai 57100, Thailand 2 School of Science, Mae Fah Luang University, Chiang Rai 57100, Thailand 3 Key Laboratory for Plant Biodiversity and Biogeography of East Asia (KLPB), Kunming Institute of Botany, Chinese Academy of Science, Kunming 650201, Yunnan, China 4 World Agroforestry Centre, East and Central Asia, 132 Lanhei Road, Kunming 650201, Yunnan, China Goonasekara ID, Jayawardene RS, Saichana N, Hyde KD 2018 – Checklist of microfungi on grasses in Thailand (excluding bambusicolous fungi). Asian Journal of Mycology 1(1), 88–105, Doi 10.5943/ajom/1/1/7 Abstract An updated checklist of microfungi, excluding bambusicolous fungi, recorded on grasses from Thailand is provided. The host plant(s) from which the fungi were recorded in Thailand is given. Those species for which molecular data is available is indicated. In total, 172 species and 35 unidentified taxa have been recorded. They belong to the main taxonomic groups Ascomycota: 98 species and 28 unidentified, in 15 orders, 37 families and 68 genera; Basidiomycota: 73 species and 7 unidentified, in 8 orders, 8 families and 18 genera; and Chytridiomycota: one identified species in Physodermatales, Physodermataceae. Key words – Ascomycota – Basidiomycota – Chytridiomycota – Poaceae – molecular data Introduction Grasses constitute the plant family Poaceae (formerly Gramineae), which includes over 10,000 species of herbaceous annuals, biennials or perennial flowering plants commonly known as true grains, pasture grasses, sugar cane and bamboo (Watson 1990, Kellogg 2001, Sharp & Simon 2002, Encyclopedia of Life 2018).
    [Show full text]
  • Trichoconiella Padwickii (Stackburn Disease) 1. Identity
    FACTSHEETS OF PESTS OF PHYTOSANITARY 17 SIGNIFICANCE TO KENYA Trichoconiella padwickii (Stackburn disease) 1. Identity: Alternaria padwickii Preferred Scientific Name: Trichoconiella padwickii (Ganguly) B.L. Jain 1976 Preferred Common Name: Stackburn disease Synonyms: Alternaria padwickii (Ganguly) M.B. Ellis 1971 Trichoconis padwickii Figure 1.Photo by Donald Groth, Louisiana State University AgCenter Ganguly 1948 Taxonomic Position:Class: Dothideomycetes Order: Pleosporales Family: Pleosporaceae 2. Hosts/species affected Axonopus compressus (carpet grass), Eucalyptus tereticornis (forest red gum), Marsilea quadrifolia, Oryza sativa (rice), Parthenium hysterophorus (parthenium weed) , Pennisetum glaucum (pearl millet), Sorghum bicolor (sorghum), Urochloa decumbens (signal grass) ( CABI,2016) Saccharum sp. (Poaceae) ( USDA,2010).Main host though is rice(Oryza sativa). 3. Growth stages affected Seeds, Glume, Seedling, Seedling stage, Leaves, stems, fruits (CABI, 2016). 4. Biology and Ecology Trichoconiella padwickii is an asexually reproducing fungus that infects seeds of rice. It is one of several fungi responsible for seed discoloration, seed rot and seedling blight, but has also been detected as a sheath-rotting pathogen (Naeimi et al., 2003). The recovery of T. padwickii conidia from the air in a rice [Oryza sativa] field (Sreeramulu and Vittal, 1966) supports the suggestion of Tisdale (1922) that the fungus survives in soil or crop debris, presumably as sclerotia and mycelium Trichoconiella padwickii Version 001 that are embedded within host tissues. Wild grasses have been found to be infected (Padwick, 1950; UK CAB International, 1984; Mendes et al., 1998) and may be another source of inoculum for the ripening rice. Numbers of airborne conidia released were highest between 6.00 and 12.00 h and, on a seasonal basis in India, greatest conidial densities occurred at the time when ears were ripening (Sreeramulu and Vittal, 1966).
    [Show full text]
  • 국가 생물종 목록집 「자낭균문, 글로메로균문, 접합균문, 점균문, 난균문」 National List of Species of Korea 「Ascomycota, Glomeromycota, Zygomycota, Myxomycota, Oomycota」
    발 간 등 록 번 호 11-1480592-000941-01 국가 생물종 목록집 「자낭균문, 글로메로균문, 접합균문, 점균문, 난균문」 National List of Species of Korea 「Ascomycota, Glomeromycota, Zygomycota, Myxomycota, Oomycota」 국가 생물종 목록 National List of Species of Korea 「자낭균문, 글로메로균문, 접합균문, 점균문, 난균문」 「Ascomycota, Glomeromycota, Zygomycota, Myxomycota, Oomycota」 이윤수(강원대학교 교수) 정희영(경북대학교 교수) 이향범(전남대학교 교수) 김성환(단국대학교 교수) 신광수(대전대학교 교수) 엄 안 흠 (한국교원대학교 교수) 김창무(국립생물자원관) 이승열(경북대학교 원생) (사) 한 국 균 학 회 환경부 국립생물자원관 National Institute of Biological Resources Ministry of Environment, Korea National List of Species of Korea 「Ascomycota, Glomeromycota, Zygomycota, Myxomycota, Oomycota」 Youn Su Lee1, Hee-Young Jung2, Hyang Burm Lee3, Seong Hwan Kim4, Kwang-Soo Shin5, Ahn-Heum Eom6, Changmu Kim7, Seung-Yeol Lee2, KSM8 1Division of Bioresource Sciences, Kangwon National University, 2School of Applied Biosciences, Kyungpook National University 3Division of Food Technology, Biotechnology and Agrochemistry, Chonnam National University, 4Department of Microbiology, Dankook University 5Division of Life Science, Daejeon University 6Department of Biology Education, Korea National University of Education 7Biological Resources Utilization Department, NIBR, Korea, 8Korean Society of Mycology National Institute of Biological Resources Ministry of Environment, Korea 발 간 사 지구상의 생물다양성은 우리 삶의 기초를 이루고 있으며, 최근에는 선진국뿐만 아니라 개발도상국에서도 산업의 초석입니다. 2010년 제 10차 생물다양성협약 총회에서 생물 자원을 활용하여 발생되는 이익을 공유하기 위한 국제적 지침인 나고야 의정서가 채택 되었고, 2014년 10월 의정서가 발효되었습니다. 이에 따라 생물자원을 둘러싼 국가 간의 경쟁에 대비하여 국가 생물주권 확보 및 효율적인 관리가 매우 중요합니다. 2013년에는 국가 차원에서 생물다양성을 체계적으로 보전하고 관리하며 아울러 지속 가능한 이용을 도모하기 위한 ‘생물다양성 보전 및 이용에 관한 법률’이 시행되고 있습 니다.
    [Show full text]
  • REFERENCES Acero, F.J. , Gonzalez, V., Sanchez–Ballesteros
    207 REFERENCES Acero, F.J. , Gonzalez, V., Sanchez–Ballesteros, J. , Rubio, V., Checa, J., Bills, G.F., Salazar, O., Platas, G., and Pelaez, F. 2004. Molecular phylogenetic studies on the Diatrypaceae based on rDNA–ITS sequences. Mycologia 96: 249–259. Adams, G.C., Wingfield, M.J., Common, R. and Roux, J. 2005. Phylogenetic relationships and morphology of Cytospora species and related teleomorphs (Ascomycota, Diaporthales, Valsaceae) from Eucalyptus. Studies in Mycology 52: 1–144. Adams, D.J. 2004. Fungal cell wall chitinases and glucanases. Microbiology 150: 2029–2035. Adhikari, R.S. (1990). Some new host records of fungi from India – IV. Indian Phytopathology 43: 593–594. Agapow, P.W., Bininda–Emonda, O.R.P., Crandall, K.A., Gittleman, J.L., Mace, G.M., Marshall, J.C. and Purvis, A. 2004. The impact of species concept on biodiversity studies. Qaurterly Review of Biology 79: 161–179. Aghayeva, D.N., Wingfield, M.J., Kirisits, T., and Wingfield, B.D. 2005. Ophiostoma dentifundum sp. nov. from oak in Europe, characterized using molecular phylogenetic data and morphology. Mycological Research 109: 1127–1136. Agrios, G.N. 2005. Plant Pathology. 5th ed. Department of Plant Pathology, University of Florida. Elsevier Academic Press. Ahmad, S., Iqbal, S.H., and Khalid, A.N. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society of Pakistan, 248 p. Alamouti, S. M., Tsui, C. K. M. and Breuil, C. 2009. Multigene phylogeny of filamentous ambrosia fungi associated with ambrosia and bark beetles. Mycological Research 113(8): 822–835. Alexopoulos, C.J., Mims, C.W. and Blackwell, M. 1996. Introductory Mycology. 4th ed. New York, John Wiley & Sons, Inc.
    [Show full text]