Oryza Vol. 48 No. 3, 2011 (244-249) Identification of rice endophytes and effect of their cultural filtrates on host cultivars Urmila Dhua*, Sudhiranjan Dhua, Apurba Chhotaray Central Rice Research Institute, Cuttack - 753 006 (Odisha) ABSTRACT Six endophytes were isolated from seeds of three long duration high yielding rice cultivars namely, Mayurkantha, Utkalprabha and Lunishree suitable for cultivation in rainfed lowland ecosystem of coastal Odisha. The six isolates included in this study were ascomycota fungi, Dendryphiella, Cladosporium, Acremonium, Valsa ambiens and Aspergillus oryzae have NCBI GenBank accession numbers viz. HM572292, HM572293, HM572295, HM572296. Isolate EN 18, isolated from the salt tolerant rice cultivar Lunishree was identified as Dendryphiella sp. which is a marine fungus.The germination percentage was not affected by the treatment with cultural filtrate of these endophytes and their metabolites present in cultural filtrates significantly enhanced length and weight of root and shoot of the rice genotypes. Key words : rice, seed, endophytes, cultural filtrates, effect Endophytes are fungi or bacteria which live within plant successfully for phylogenetic placement and segregation tissues, for entire or part of their life cycle and cause of endophytic mycelia sterilia (Promputtha et al., 2002). no apparent infection or symptoms. Colonization and Internal Transcribed Spacer (ITS) region of Ribosomal propagation of endophytes and their secondary DNA is now perhaps the most widely sequenced DNA metabolites inside the plants may enhance host- region in fungi and was found to be useful for the productivity and also may confer host the ability to identification of non sporulating endophytes. Hence, the adapt or resist abiotic and biotic stresses. An “inducible present investigation was carried out to identify the endophyte” was inoculated into rice which established fungus isolate EN18 by these molecular techniques and a symbiotic relationship with the rice plant and promoted study the effect of these six fungal endophytes on growth, antioxidant enzyme activity, and photosynthesis growth of respective rice cultivars. (Guo et al., 2004). The endophytes associated with seeds of various rice cultivars were isolated and MATERIALS AND METHODS identified (Dhua et al., 2010). Six endophytes were The EN18 culture was maintained on MS broth isolated from seeds of three long duration high yielding (Murashige and Skoog, 1962). DNA of this isolate was rice cultivars viz. Mayurkantha, Utkalprabha, and extracted (Dhua et al., 2008, 2011). Internal Lunisree. Four fungal cultures (GenBank accession Transcribed Spacer (ITS) region of Ribosomal DNA numbers: HM572292, HM572293, HM572295, was amplified (White et al., 1990) and sequenced for HM572296) were isolated from the seeds of rice variety its identification. Primers used for PCR amplification Mayurkantha. One fungal endophyte (NCBI-GenBank were ITS-1 (TCCGTAGGTGAACCTGCGG); ITS-4 accession number HM572294) was isolated from rice (TCCTCCGCTTATTGATATGC). Sequencing was cv. Utkalprabha. outsourced to Chromous Biotech. Pvt. Ltd., Kolkata. Sequence alignment was done for identifying the The endophyte associated with Lunishree was microbes. The sequences were analyzed with the a non-sporulating isolate that belonged to ‘mycelia algorithms afforded by Blast algorithms for nucleotide sterilia’. Molecular techniques have been used rr244 PDF created with pdfFactory Pro trial version www.pdffactory.com Oryza Vol. 48 No. 3, 2011 (244-249) or polypeptide homologous sequence analysis in NCBI Evolutionary relationships of 5 taxa with isolate (Zhang et al., 2000) BLAST. Phylogenetic analyses EN18 was studied (Fig.1). The evolutionary history was were conducted in MEGA4 (Tamura et al., 2007) inferred using the Maximum Parsimony method (Eck and Dayhoff 1966).Tree #1 out of 4 most parsimonious Six endophytes included in this study were trees (length = 24) is shown. The consistency index is grown in MS broth (Murashige and Skoog, 1962). Seeds (0.833333), the retention index is (0.625000), and the of above mentioned rice cultivars (Mayurkantha, composite index is 0.546875 (0.520833) for all sites and Utkalprabha and Lunishree) were soaked for twelve parsimony-informative sites. The percentage of hours in various concentrations (undiluted; 50% dilution; replicate trees in which the associated taxa clustered 25% dilution) of cultural-filtrate of fifteen days old together in the bootstrap test (500 replicates) are shown culture of respective endophytes. next to the branches (Felsenstein,1985) The MP tree Seeds of the rice variety Lunishree were was obtained using the Close-Neighbor-Interchange treated with EN18; Seeds of Utkalprabha were treated algorithm with search level 3 (Felsenstein,1985; Nei with HM572294; and the seeds of Mayukantha were M and Kumar, 2000) in which the initial trees were treated with HM572292, HM572293, HM572295, obtained with the random addition of sequences (10 HM572296. replicates). The codon positions included were Treated and untreated seeds were kept at 520C 1st+2nd+3rd+Noncoding. All positions containing gaps in a water bath for 10 minutes followed by shifting to and missing data were eliminated from the dataset ice cold water. Hot water treated seeds of all the (Complete Deletion option). There were a total of 10 treatments were transferred to Hoagland and Snyder positions in the final dataset, out of which 7 were (1934) culture solution.Germination percentage, root parsimony informative. Phylogenetic analyses were length, shoot length of 15 days old seedlings was conducted in MEGA4 (Tamura et al., 2007). measured and average length per seedling was Pairwise distance and number of base calculated. Root and shoot weight of seedlings in all substitutions per site were minimum with the treatments and replications was recorded. Dendryphiella (Table 2). All results are based on the pairwise analysis of 6 sequences. Analyses were RESULTS AND DISCUSSION conducted using the Maximum Composite Likelihood Database sequences were searched by Mega BLAST. method in MEGA4 [(Tamura et al., 2004) and (Tamura Sequences of Dendryphiella (HM572292), et al., 2007)]. Codon positions included were 1st +2nd Cladosporium (HM572295), Alternaria padwickii +3rd + Non coding. All positions containing gaps and (GU373650), Alternaria longissima (FJ971842) and missing data were eliminated from the dataset uncultured Ascomycota (AM901799) had shown pair- (Complete deletion option). There were a total of 10 wise similarities with fungal isolate EN18. positions in the final dataset. On the basis of above Dendryphiella and Cladosporium both had 99% mentioned analysis the isolate EN 18 was identified as similarity as well as E value zero with sequence of Dendryphiella sp.Isolate EN12, EN13, EN15 & EN19 EN18 (Table1). were from local rice cultivar Mayurkantha, EN14 was Table 1.Database sequences searched by Mega BLAST and showing pair-wise similarities with fungal isolate EN18 Database sequences withMax.Max.QueryE-value max. score showing similarityIdentityscorecoverage AccessionDescription HM572292 Dendryphiella 99%93199%0 HM572295 Cladosporium 99%92699%0 GU373650 Alternaria padwickii 98%85090%0 FJ971842 Alternaria longissima 92%64385%0 AM901799uncultured Ascomycota 92%65185%0 rr245 PDF created with pdfFactory Pro trial version www.pdffactory.com Rice endophytes Urmila Dhua et al Fig. 1. Evolutionary relationships of 5 taxa with isolate EN18 from high yielding rice variety Utkalprabha. Table 2 .Estimates of Evolutionary Divergence between Dendryphiella (EN12 and EN18) was associated with Sequences salt tolerant rice genotype Lunisree as well as local cultivar of coastal Odisha. EN 18 Dendryphiella9 The six isolates included in this study were Cladosporium14 ascomycota fungi. Dendryphiella(EN12, EN18) and Alternaria padwickii153 Cladosporium(EN15) both belonged to Alternaria longissima201 Pezizomycotina, Dothideomycetes but Dendryphiella Uncultured Ascomycota16 was from order Pleosporales and Cladosporium in Capnodiale(Table 3). Acremonium (EN13) and Valsa ambiens (EN14) both were in Sordariomtcetes. increase in root weight of rice cultivars Mayurkantha However Acremonium was placed in and Lunisree (Table 4, Fig 2, Fig.3 ). The cultural Hypocreomycetidae, Hypocreales and Valsa ambiens filtrates of undiluted Cladosporium (EN15) was included in order Diaporthales of Acremonium (EN13) and Aspergillus oryzae (EN19) Sordariomycetidae. Aspergillus oryzae (EN19) promoted shoot growth more than the root growth belonged to Eurotiomycetes, Eurotiomycetidae, (Table 4). Cladosporium (EN15) treated seedlings had Eurotiales (Table 3) almost double root weight than control though root length was at par with the untreated control. The The germination percentage of rice cultivars endophytic Valsa enhanced the root length of rice was not affected by the treatments with cultural filtrate cultivar Utkalprabha about 2.4 times and shoot length of all the endophytes included in this study. The was doubled . Diluted cultural filtrate was found to be metabolites of these endophytes present in the cultural more effective for enhancement of root length (Table5), filtrates significantly enhanced seedling length and although there was reduction in the root weight. weight of all the cultivars studied. Length and weight of Mayurkantha seedlings treated with endophyte The six isolates included in this study were cultural filtrate (EN12, EN13, EN15, EN19 isolated from endophytic ascomycota fungi associated with rice seeds. Mayurkantha)