The Complete Genome Sequence and Analysis of the Human Pathogen Campylobacter Ian
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Studies on the Detection Methods of Campylobacter and Faecal Indicator Bacteria in Drinking Water
Tarja Pitkänen Tarja Pitkänen Tarja Studies on the Detection Tarja Pitkänen Methods of Campylobacter RESEARCH Studies on the Detection Methods of RESEARCH Campylobacter and Faecal Indicator Bacteria and Faecal Indicator in Drinking Water Bacteria in Drinking Water Indicator Bacteria in Drinking Water Drinking in Bacteria Indicator Methods Detection the on Studies Faecal contamination of drinking water and subsequent waterborne gastrointestinal infection outbreaks are a major public health concern. In this study, faecal indicator bacteria were detected in 10% of the groundwater samples analysed. The main on-site hazards to water safety at small community water supplies included inadequate well construction and maintenance, an insufficient depth of the protective soil layer and bank filtration. As a preventive measure, the upgrading of the water treatment processes and utilization of disinfection at small Finnish groundwater supplies are recommended. More efficient and specific and less time-consuming methods for enumeration and typing of E. coli and coliform bacteria from non-disinfected water as well as for cultivation and molecular detection and typing of Campylobacter were found in the study. These improvements in methodology for the analysis of the faecal bacteria from water might promote public health protection as they Campylobacter could be anticipated to result in very important time savings and improve the tracking of faecal contamination source in waterborne outbreak investigations. and Faecal Faecal and .!7BC5<2"HIGEML! National Institute for Health and Welfare P.O. Box 30 (Mannerheimintie 166) FI-00271 Helsinki, Finland Telephone: +358 20 610 6000 39 ISBN 978-952-245-319-8 39 2010 39 www.thl.fi Tarja Pitkänen Studies on the Detection Methods of Campylobacter and Faecal Indicator Bacteria in Drinking Water ACADEMIC DISSERTATION To be presented with the permission of the Faculty of Science and Forestry of the University of Eastern Finland for public examination in auditorium, MediTeknia Building, on October 1st, 2010 at 12 o’clock noon. -
Campylobacteriosis: a Global Threat
ISSN: 2574-1241 Volume 5- Issue 4: 2018 DOI: 10.26717/BJSTR.2018.11.002165 Muhammad Hanif Mughal. Biomed J Sci & Tech Res Review Article Open Access Campylobacteriosis: A Global Threat Muhammad Hanif Mughal* Homeopathic Clinic, Rawalpindi, Islamabad, Pakistan Received: : November 30, 2018; Published: : December 10, 2018 *Corresponding author: Muhammad Hanif Mughal, Homeopathic Clinic, Rawalpindi-Islamabad, Pakistan Abstract Campylobacter species account for most cases of human gastrointestinal infections worldwide. In humans, Campylobacter bacteria cause illness called campylobacteriosis. It is a common problem in the developing and industrialized world in human population. Campylobacter species extensive research in many developed countries yielded over 7500 peer reviewed articles. In humans, most frequently isolated species had been Campylobacter jejuni, followed by Campylobactercoli Campylobacterlari, and lastly Campylobacter fetus. C. jejuni colonizes important food animals besides chicken, which also includes cattle. The spread of the disease is allied to a wide range of livestock which include sheep, pigs, birds and turkeys. The organism (5-18.6 has% of been all Campylobacter responsible for cases) diarrhoea, in an estimated 400 - 500 million people globally each year. The most important Campylobacter species associated with human infections are C. jejuni, C. coli, C. lari and C. upsaliensis. Campylobacter colonize the lower intestinal tract, including the jejunum, ileum, and colon. The main sources of these microorganisms have been traced in unpasteurized milk, contaminated drinking water, raw or uncooked meat; especially poultry meat and contact with animals. Keywords: Campylobacteriosis; Gasteritis; Campylobacter jejuni; Developing countries; Emerging infections; Climate change Introduction of which C. jejuni and 12 species of C. coli have been associated with Campylobacter cause an illness known as campylobacteriosis is a common infectious problem of the developing and industrialized world. -
Basys: a Web Server for Automated Bacterial Genome Annotation Gary H
Nucleic Acids Research, 2005, Vol. 33, Web Server issue W455–W459 doi:10.1093/nar/gki593 BASys: a web server for automated bacterial genome annotation Gary H. Van Domselaar, Paul Stothard, Savita Shrivastava, Joseph A. Cruz, AnChi Guo, Xiaoli Dong, Paul Lu, Duane Szafron, Russ Greiner and David S. Wishart* Departments of Biological Sciences and Computing Science, University of Alberta, Edmonton, AB, T6G 2E8, Canada Received February 13, 2005; Revised April 14, 2005; Accepted May 6, 2005 ABSTRACT life; to develop novel vaccines, to discover new antimicrobial compounds or therapeutics; and to develop effective strategies Downloaded from BASys (Bacterial Annotation System) is a web for re-engineering bacteria for such applications as biore- server that supports automated, in-depth annotation mediation. However, distilling useful knowledge from the of bacterial genomic (chromosomal and plasmid) enormous volume of data is a growing challenge for both sequences. It accepts raw DNA sequence data and bioinformaticians and microbiologists alike. To assist with an optional list of gene identification information the interpretation of genomic data, a number of automated http://nar.oxfordjournals.org/ and provides extensive textual annotation and hyper- genome annotation tools have been created, including Gene- linked image output. BASys uses .30 programs to Quiz (1), PEDANT (2), Genotator (3), MAGPIE/BLUEJAY determine 60 annotation subfields for each gene, (4,5), GenDB (6) and the TIGR CMR (7). In order for these including gene/protein name, GO function, COG func- systems to perform at a high level of quality and throughput, tion, possible paralogues and orthologues, molecular these annotation systems are quite sophisticated that require a high degree of skill to implement and maintain, and also weight, isoelectric point, operon structure, sub- require considerable computing power to operate. -
Review Campylobacter As a Major Foodborne Pathogen
REVIEW CAMPYLOBACTER AS A MAJOR FOODBORNE PATHOGEN: A REVIEW OF ITS CHARACTERISTICS, PATHOGENESIS, ANTIMICROBIAL RESISTANCE AND CONTROL Ahmed M. Ammar1, El-Sayed Y. El-Naenaeey1, Marwa I. Abd El-Hamid1, Attia A. El-Gedawy2 and Rania M. S. El- Malt*3 Address: Rania Mohamed Saied El-Malt 1 Zagazig University, Faculty of Veterinary Medicine, Department of Microbiology, 19th Saleh Abo Rahil Street, El-Nahal, 44519, Zagazig, Sharkia, Egypt 2 Animal health Research Institute, Department of Bacteriology, Tuberculosis unit, Nadi El-Seid Street,12618 Dokki, Giza, Egypt 3 Animal health Research Institute, Department of Microbiology, El-Mohafza Street, 44516, Zagazig, Sharkia, Egypt, +201061463064 *Corresponding author: [email protected] ABSTRACT Campylobacter, mainly Campylobacter jejuni is viewed as one of the most well-known reasons of foodborne bacterial diarrheal sickness in people around the globe. The genus Campylobacter contains 39 species (spp.) and 16 sub spp. Campylobacter is microaerophilic, Gram negative, spiral- shaped rod with characteristic cork screw motility. It is colonizing the digestive system of numerous wild and household animals and birds, particularly chickens. Intestinal colonization brings about transporter/carrier healthy animals. Consequently, the utilization of contaminated meat, especially chicken meat is the primary source of campylobacteriosis in humans and chickens are responsible for an expected 80% of human campylobacter infection. Interestingly, in contrast with the most recent published reviews that cover specific aspects of campylobacter/campylobacteriosis, this review targets the taxonomy, biological characteristics, identification and habitat of Campylobacter spp. Moreover, it discusses the pathogenesis, resistance to antimicrobial agents and public health significance of Campylobacter spp. Finally, it focuses on the phytochemicals as intervention strategies used to reduce Campylobacter spp.in poultry production. -
Genomic Insights from Monoglobus Pectinilyticus: a Pectin-Degrading Specialist Bacterium in the Human Colon
The ISME Journal (2019) 13:1437–1456 https://doi.org/10.1038/s41396-019-0363-6 ARTICLE Genomic insights from Monoglobus pectinilyticus: a pectin-degrading specialist bacterium in the human colon 1,2 1,3 4 2 2 5 Caroline C. Kim ● Genelle R. Healey ● William J. Kelly ● Mark L. Patchett ● Zoe Jordens ● Gerald W. Tannock ● 6 6 1 7,8,9 1 Ian M. Sims ● Tracey J. Bell ● Duncan Hedderley ● Bernard Henrissat ● Douglas I. Rosendale Received: 19 April 2018 / Revised: 7 January 2019 / Accepted: 19 January 2019 / Published online: 6 February 2019 © International Society for Microbial Ecology 2019 Abstract Pectin is abundant in modern day diets, as it comprises the middle lamellae and one-third of the dry carbohydrate weight of fruit and vegetable cell walls. Currently there is no specialized model organism for studying pectin fermentation in the human colon, as our collective understanding is informed by versatile glycan-degrading bacteria rather than by specialist pectin degraders. Here we show that the genome of Monoglobus pectinilyticus possesses a highly specialized glycobiome for pectin degradation, unique amongst Firmicutes known to be in the human gut. Its genome encodes a simple set of metabolic pathways relevant to pectin sugar utilization, and its predicted glycobiome comprises an unusual distribution of carbohydrate- 1234567890();,: 1234567890();,: active enzymes (CAZymes) with numerous extracellular methyl/acetyl esterases and pectate lyases. We predict the M. pectinilyticus degradative process is facilitated by cell-surface S-layer homology (SLH) domain-containing proteins, which proteomics analysis shows are differentially expressed in response to pectin. Some of these abundant cell surface proteins of M. -
Basys: a Web Server for Automated Bacterial Genome Annotation Gary Van Domselaar†, Paul Stothard, Savita Shrivastava, Joseph A
BASys: A Web Server for Automated Bacterial Genome Annotation Gary Van Domselaar†, Paul Stothard, Savita Shrivastava, Joseph A. Cruz, AnChi Guo, Xiaoli Dong, Paul Lu, Duane Szafron, Russ Greiner, and David S. Wishart‡ Departments of Computing Science and Biological Sciences University of Alberta Edmonton AB T6E 2E9 †[email protected] ‡[email protected] Abstract Head Node Annotation Reports BASys uses CGView [3] to generate BASys (Bacterial Annotation System) is a web server that clickable genome maps for navigating supports automated, in- depth annotation of bacterial the genome data. An HTML- formatted tabular summary is also provided. The genomic (chromosomal, plasmid, and contig) sequences. Genomic Annotation genome maps are prerendered as a It accepts raw DNA sequence data and an optional list of Sequence Data Reports series of hyperlinked PNG image files. gene identification information and provides extensive Each gene label is hyperlinked to its textual and hyperlinked image output. BASys uses more corresponding HTML- formatted “gene card”. The card is hyperlinked where than 30 programs to determine nearly 60 annotation applicable to external references. Text- subfields for each gene, including gene/ protein name, only gene cards are also provided. BASys GO function, COG function, possible paralogues and also supplies an 'evidence card' (Optional) Data Scheduling describing how each annotation was orthologues, molecular weight, isoelectric point, operon generated. The gene cards, evidence Gene BASys is implemented as a distributed structure, subcellular localization, signal peptides, Identification cards, and graphical genome maps are system. The head node monitors and downloadable for offline viewing. transmembrane regions, secondary structure, 3- D Data manages the job scheduling. -
Genome Annotation
Genome Annotation! Bioinformatics 301! David Wishart! [email protected]! Notes at: http://wishartlab.com! Objectives*! • To demonstrate the growing importance of gene and genome annotation in biology and the role bioinformatics plays! • To make students aware of new trends in gene and genome annotation (i.e. “deep” annotation)! • To make students aware of the methods, algorithms and tools used for gene and genome annotation! Genome Sequence! >P12345 Yeast chromosome1! GATTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGATTACAGAT! TACAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATTAC! AGATTACAGATTACAGATTACAGATTACAGATTACA! GATTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGATTACAGAT! Predict Genes! The Result…! >P12346 Sequence 1! ATGTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGAT! ! >P12347 Sequence 2! ATGAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATT! ! >P12348 Sequence 3! ATGTTACAGATTACAGATTACAGATTACAGATTACA! GATTACAGATTACAGATTACAGATTACA...! ! Is This Annotated?! >P12346 Sequence 1! ATGTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGAT! ! >P12347 Sequence 2! ATGAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATT! ! >P12348 Sequence 3! ATGTTACAGATTACAGATTACAGATTACAGATTACA! -
Insights Into the Role of the Flagellar Glycosylation System in Campylobacter Jejuni Phage-Host Interactions by Jessica Christia
Insights into the role of the flagellar glycosylation system in Campylobacter jejuni phage-host interactions by Jessica Christiane Sacher A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology and Biotechnology Department of Biological Sciences University of Alberta © Jessica Christiane Sacher, 2018 Abstract Bacteriophages (phages) are the viruses that infect bacteria. Studying how phages interact with their hosts can inspire new ways of controlling bacterial pathogens and can highlight important facets of the biology of both organisms. Furthermore, phage-host characterization can inform exploitation of phages for therapeutics, diagnostics and research tools. Campylobacter jejuni is a deadly foodborne pathogen of humans, and its extensive surface structure glycosylation plays an important role in its virulence. In particular, C. jejuni flagella are required for colonization of its niche in the gastrointestinal tract of birds, and are also required for virulence in humans. C. jejuni devotes a substantial proportion of its genetic repertoire to flagellar biogenesis, which requires glycosylation with sialic acid-like sugars for assembly. Campylobacter phages tend to target either capsular polysaccharides or flagella, but little more than this is known about the factors governing Campylobacter phage-host interactions. My thesis describes the study of C. jejuni interactions with phages in the context of flagellar glycobiology. I found that C. jejuni phage NCTC 12673 interacts with host flagella and flagellar glycans in ways not previously described for other phage-host systems. Furthermore, this phage encodes a protein of unknown function (Gp047) with specific binding affinity for host flagellar glycans. I sought to determine how the C. -
Shape Dependent Physical Mutilation and Lethal Effects of Silver
www.nature.com/scientificreports OPEN Shape dependent physical mutilation and lethal efects of silver nanoparticles on bacteria Received: 1 February 2017 Debashish Acharya1, K. Malabika Singha2, Piyush Pandey2, Bidhan Mohanta1, Jina Rajkumari2 Accepted: 14 December 2017 & L. Paikhomba Singha2 Published: xx xx xxxx In this report, spherical silver nanoparticle (AgNP-sp) and rod-shaped silver nanoparticle (AgNR) were prepared by chemical reduction method and their antibacterial activity against various Gram-positive and Gram-negative bacteria had been evaluated for their efciency. Minimal inhibitory concentration (MIC) tests were conducted to study the antibacterial properties, and substantiated with killing kinetics of silver nanoparticles (AgNPs). The study revealed that both AgNP-sp and AgNRs are good antibacterial candidates. Bacterial sensitivity to nanoparticles (NPs) was found to vary depending on microbial species. Disc difusion studies revealed the greater efectiveness of AgNP-sp and AgNR against Klebsiella pneumoniae AWD5 at the doses of 249 and 392 µg. The dose dependent activities of prepared NPs were also observed on the batch studies of disc difusion and MIC with various strains. The optical and morphological structures of NPs were analyzed by UV-visible, XRD, FE-SEM and TEM. Further, FESEM of bacterial culture treated with AgNPs confrmed antibacterial activity of NPs by showing rupture of bacterial cell wall. Also, the genome of test organism was found to have CusCFBA and CusRS operons. The killing kinetics confrmed that the death rate of K. pneumoniae was higher against AgNP-sp as compared to AgNR. Te metal nanoparticles such as silver, gold are becoming indispensable in various felds because of their vast applications against various diseases and environmental applications. -
The Complete Genome Sequence of the Nitrile
Frederick et al. BMC Genomics (2020) 21:3 https://doi.org/10.1186/s12864-019-6405-7 RESEARCH ARTICLE Open Access The complete genome sequence of the nitrile biocatalyst Rhodococcus rhodochrous ATCC BAA-870 Joni Frederick1,2,3, Fritha Hennessy1, Uli Horn4, Pilar de la Torre Cortés5, Marcel van den Broek5, Ulrich Strych6,7, Richard Willson6,8, Charles A. Hefer9,10, Jean-Marc G. Daran5, Trevor Sewell2, Linda G. Otten11* and Dean Brady1,12* Abstract Background: Rhodococci are industrially important soil-dwelling Gram-positive bacteria that are well known for both nitrile hydrolysis and oxidative metabolism of aromatics. Rhodococcus rhodochrous ATCC BAA-870 is capable of metabolising a wide range of aliphatic and aromatic nitriles and amides. The genome of the organism was sequenced and analysed in order to better understand this whole cell biocatalyst. Results: The genome of R. rhodochrous ATCC BAA-870 is the first Rhodococcus genome fully sequenced using Nanopore sequencing. The circular genome contains 5.9 megabase pairs (Mbp) and includes a 0.53 Mbp linear plasmid, that together encode 7548 predicted protein sequences according to BASys annotation, and 5535 predicted protein sequences according to RAST annotation. The genome contains numerous oxidoreductases, 15 identified antibiotic and secondary metabolite gene clusters, several terpene and nonribosomal peptide synthetase clusters, as well as 6 putative clusters of unknown type. The 0.53 Mbp plasmid encodes 677 predicted genes and contains the nitrile converting gene cluster, including a nitrilase, a low molecular weight nitrile hydratase, and an enantioselective amidase. Although there are fewer biotechnologically relevant enzymes compared to those found in rhodococci with larger genomes, such as the well-known Rhodococcus jostii RHA1, the abundance of transporters in combination with the myriad of enzymes found in strain BAA-870 might make it more suitable for use in industrially relevant processes than other rhodococci. -
A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data
BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data Pablo Pareja-Tobes, Marina Manrique, Eduardo Pareja-Tobes, Eduardo Pareja, Raquel Tobes* Oh no sequences! Research group, Era7 Bioinformatics, Granada, Spain Abstract BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. -
Deep-Sea Hydrothermal Vent Epsilonproteobacteria Encode a Conserved and Widespread Nitrate Reduction Pathway (Nap)
The ISME Journal (2014) 8, 1510–1521 & 2014 International Society for Microbial Ecology All rights reserved 1751-7362/14 www.nature.com/ismej ORIGINAL ARTICLE Deep-sea hydrothermal vent Epsilonproteobacteria encode a conserved and widespread nitrate reduction pathway (Nap) Costantino Vetriani1,2,4, James W Voordeckers1,2,4,5, Melitza Crespo-Medina1,2,6, Charles E O’Brien1,2, Donato Giovannelli1,2,3 and Richard A Lutz2 1Department of Biochemistry and Microbiology, Rutgers University, New Brunswick, NJ, USA; 2Institute of Marine and Coastal Sciences, Rutgers University, New Brunswick, NJ, USA and 3Institute of Marine Science - ISMAR, National Research Council of Italy, CNR, Ancona, Italy Despite the frequent isolation of nitrate-respiring Epsilonproteobacteria from deep-sea hydro- thermal vents, the genes coding for the nitrate reduction pathway in these organisms have not been investigated in depth. In this study we have shown that the gene cluster coding for the periplasmic nitrate reductase complex (nap) is highly conserved in chemolithoautotrophic, nitrate-reducing Epsilonproteobacteria from deep-sea hydrothermal vents. Furthermore, we have shown that the napA gene is expressed in pure cultures of vent Epsilonproteobacteria and it is highly conserved in microbial communities collected from deep-sea vents characterized by different temperature and redox regimes. The diversity of nitrate-reducing Epsilonproteobacteria was found to be higher in moderate temperature, diffuse flow vents than in high temperature black smokers or in low temperatures, substrate-associated communities. As NapA has a high affinity for nitrate compared with the membrane-bound enzyme, its occurrence in vent Epsilonproteobacteria may represent an adaptation of these organisms to the low nitrate concentrations typically found in vent fluids.