DOCSLIB.ORG

A Primer on Infectious Disease Bacterial Genomics

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Primer on Infectious Disease Bacterial Genomics crossmark A Primer on Infectious Disease Bacterial Genomics Tarah Lynch,a,b Aaron Petkau,c Natalie Knox,c Morag Graham,c,d Gary Van Domselaarc,d Division of Microbiology, Calgary Laboratory Services, Calgary, Alberta, Canadaa; Department of Pathology and Laboratory Medicine, University of Calgary, Calgary, Alberta, Canadab; National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, Manitoba, Canadac; Department of Medical Microbiology, University of Manitoba, Winnipeg, Manitoba, Canadad SUMMARY ..................................................................................................................................................882 INTRODUCTION ............................................................................................................................................882 PREPARATION ..............................................................................................................................................882 Project Management .....................................................................................................................................883 Experimental Design .....................................................................................................................................883 Computational infrastructure resources ...............................................................................................................884 (i) Estimating computational resources .............................................................................................................885 (ii) Data storage requirements ......................................................................................................................885 (iii) Cloud-based computing ........................................................................................................................885 Software and workflow management .................................................................................................................886 (i) Data analysis reproducibility......................................................................................................................887 Laboratory resources: choosing an HTS platform......................................................................................................888 (i) Read length.......................................................................................................................................888 (ii) Read type ........................................................................................................................................888 (iii) Error types and rates.............................................................................................................................888 (iv) Coverage ........................................................................................................................................889 SAMPLE PROCESSING AND DATA GENERATION ..........................................................................................................889 DNA Extraction and Template Assessment...............................................................................................................889 HTS Library Preparation and Sequencing.................................................................................................................889 PRIMARY ANALYSIS ........................................................................................................................................889 SECONDARY ANALYSIS ....................................................................................................................................890 Reference Mapping and Variant Calling ..................................................................................................................890 Reference mapping issues.............................................................................................................................891 Selecting a reference genome.........................................................................................................................892 Quality control of input data...........................................................................................................................892 Generating a read pileup ..............................................................................................................................892 Quality control of a read alignment pileup ............................................................................................................892 Variant calling, filtering, and annotation ...............................................................................................................892 De Novo Assembly........................................................................................................................................893 Choosing de novo assembly software..................................................................................................................893 Evaluating de novo assemblies.........................................................................................................................893 TERTIARY ANALYSIS ........................................................................................................................................893 Bacterial Genome Annotation............................................................................................................................893 Recombination and Mobile Elements ....................................................................................................................896 Recombination ........................................................................................................................................896 Mobile genetic elements ..............................................................................................................................896 (i) Transposons ......................................................................................................................................896 (ii) Plasmids..........................................................................................................................................897 (iii) Prophage ........................................................................................................................................897 Phylogenetics to Phylogenomics.........................................................................................................................897 General phylogenetic concepts .......................................................................................................................897 Inferring phylogenetic trees ...........................................................................................................................898 Phylogenomics ........................................................................................................................................898 (i) Alignment-based phylogenies ...................................................................................................................899 (ii) Alignment-free phylogenies .....................................................................................................................900 (iii) Gene-by-gene phylogenies .....................................................................................................................901 (iv) Choosing a method for phylogeny generation. .................................................................................................901 (continued) Published 24 August 2016 Citation Lynch T, Petkau A, Knox N, Graham M, Van Domselaar G. 2016. A primer on infectious disease bacterial genomics. Clin Microbiol Rev 29:881–913. doi:10.1128/CMR.00001-16. Address correspondence to Tarah Lynch, [email protected]. Copyright © 2016, American Society for Microbiology. All Rights Reserved. October 2016 Volume 29 Number 4 Clinical Microbiology Reviews cmr.asm.org 881 Lynch et al. HTS IN THE CONTEXT OF SPECIFIC APPLICATIONS........................................................................................................901 Bacterial Typing ..........................................................................................................................................902 Molecular Epidemiology .................................................................................................................................902 Bacterial Pathogenomics .................................................................................................................................903 GLOBAL ACCESSIBILITY OF GENOMICS DATA.............................................................................................................904 CONCLUSIONS .............................................................................................................................................904 APPENDIX ..................................................................................................................................................904 Glossary ..................................................................................................................................................904 REFERENCES ................................................................................................................................................905
Load more

Recommended publications
  • De Bruijn Graph Based De Novo Genome Assembly
    2160 JOURNAL OF SOFTWARE, VOL. 9, NO. 8, AUGUST 2014 De Bruijn Graph based De novo Genome Assembly Mohammad Ibrahim Khan Computer Science and Engineering, Chittagong University of Engineering and Technology Chittagong, Bangladesh [email protected] Md. Sarwar Kamal Computer Science and Engineering, Chittagong University of Engineering and Technology Chittagong, Bangladesh [email protected] Abstract—The Next Generation Sequencing (NGS) is an and microorganism. Now –a-days, numbers of unique important process which assures inexpensive organization idea and vocational attempt have been established on the of vast size of raw sequence data set over any traditional road to the evolution of new techniques to overcome the sequencing systems or methods. Various aspects of NGS like problems of Sanger. The continuing innovation of DNA, template preparation, sequencing imaging and genome RNA and Proteins sequencing techniques have alignment and assembly outlines the genome sequencing and accompanied the development of sequencing system alignment .Consequently, deBruijn Graph (dBG) is an important mathematical tool that graphically analyzes how under the environment of sudden reduced expenditures the orientations are constructed in groups of nucleotides. and better outcomes in performance comparing with the Basically, de Bruijn graph describe the formation of the systems of tow three years back. Various sequencers genome segments in a circular iterative fashions. Some from some established methods like 454 Life Science or pivotal de Bruijn graph based de novo algorithms and Roche or Illumina and Applied Biosystems are in software package like T-IDBA, Oases, IDBA-tran, Euler, developments and Helicos have appeared in application. Velvet, ABySS, AllPaths, SOAPdenovo and SOAPdenovo2 All these sequencers will produce more and more data have illustrated here.
    [Show full text]
  • What Can the Miseq & NGS Core Do for Your Research?
    What Can the MiSeq & NGS Core Do for Your Research? Grant Hill Library Prep Specialist [email protected] © 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, NuPCR, SeqMonitor, Solexa, TruSeq, TruSight, VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners. Agenda ! Into/basic principles of NGS (terms & technology) ! Small genome sequencing ! Targeted resequencing (custom panels) ! 16s metagenomics & amplicon sequencing ! Small RNA & targeted rna expression ! Experimental design & local resources 2 Enhanced Focus on the Sample to Answer Integration From library prep to downstream informatics & knowledge generation Library Prep Sequence Answer 3 For Research Use Only. Not for use in diagnostic procedures. The Flow Cell Where the magic happens ! Everything except sample preparation is completed on the flow cell •" Template annealing (1 - 384 samples) •" Template amplification •" Sequencing primer hybridization •" Sequencing-by-synthesis reaction •" Generation of fluorescent signal MiSeq NextSeq HiSeq 4 Flow Cell Surface 8 channels Simplified workflow Surface of flow cell ! Clusters in a coated with a lawn of oligo pairs contained environment (no need for clean rooms) !
    [Show full text]
  • Basys: a Web Server for Automated Bacterial Genome Annotation Gary H
    Nucleic Acids Research, 2005, Vol. 33, Web Server issue W455–W459 doi:10.1093/nar/gki593 BASys: a web server for automated bacterial genome annotation Gary H. Van Domselaar, Paul Stothard, Savita Shrivastava, Joseph A. Cruz, AnChi Guo, Xiaoli Dong, Paul Lu, Duane Szafron, Russ Greiner and David S. Wishart* Departments of Biological Sciences and Computing Science, University of Alberta, Edmonton, AB, T6G 2E8, Canada Received February 13, 2005; Revised April 14, 2005; Accepted May 6, 2005 ABSTRACT life; to develop novel vaccines, to discover new antimicrobial compounds or therapeutics; and to develop effective strategies Downloaded from BASys (Bacterial Annotation System) is a web for re-engineering bacteria for such applications as biore- server that supports automated, in-depth annotation mediation. However, distilling useful knowledge from the of bacterial genomic (chromosomal and plasmid) enormous volume of data is a growing challenge for both sequences. It accepts raw DNA sequence data and bioinformaticians and microbiologists alike. To assist with an optional list of gene identification information the interpretation of genomic data, a number of automated http://nar.oxfordjournals.org/ and provides extensive textual annotation and hyper- genome annotation tools have been created, including Gene- linked image output. BASys uses .30 programs to Quiz (1), PEDANT (2), Genotator (3), MAGPIE/BLUEJAY determine 60 annotation subfields for each gene, (4,5), GenDB (6) and the TIGR CMR (7). In order for these including gene/protein name, GO function, COG func- systems to perform at a high level of quality and throughput, tion, possible paralogues and orthologues, molecular these annotation systems are quite sophisticated that require a high degree of skill to implement and maintain, and also weight, isoelectric point, operon structure, sub- require considerable computing power to operate.
    [Show full text]
  • Computational Methods for De Novo Assembly of Next-Generation Genome Sequencing Data Rayan Chikhi
    Computational methods for de novo assembly of next-generation genome sequencing data Rayan Chikhi To cite this version: Rayan Chikhi. Computational methods for de novo assembly of next-generation genome sequencing data. Other [cs.OH]. École normale supérieure de Cachan - ENS Cachan, 2012. English. NNT : 2012DENS0033. tel-00752033 HAL Id: tel-00752033 https://tel.archives-ouvertes.fr/tel-00752033 Submitted on 14 Nov 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE / ENS CACHAN - BRETAGNE présentée par sous le sceau de l’Université européenne de Bretagne Rayan Chikhi pour obtenir le titre de Préparée à l’Unité Mixte de Recherche 6074 DOCTEUR DE L’école norMALE suPÉRIEURE de CACHAN Institut de recherche en informatique Mention : Informatique École doctorale MATISSE et systèmes aléatoires Thèse soutenue le 2 juillet 2012 Computational Methods devant le jury composé de : Éric RIVALS, for de novo Assembly of DR, LIRMM / rapporteur Sante GNERRE, Next-Generation Genome Group leader, Broad Institute of MIT and Harvard / rapporteur Marie-France SAGOT,
    [Show full text]
  • Whole-Genome Sequencing of Bacterial Pathogens
    REVIEW crossm Whole-Genome Sequencing of Bacterial Downloaded from Pathogens: the Future of Nosocomial Outbreak Analysis Scott Quainoo,a Jordy P. M. Coolen,b Sacha A. F. T. van Hijum,c,d Martijn A. Huynen,c Willem J. G. Melchers,b Willem van Schaik,e http://cmr.asm.org/ Heiman F. L. Wertheimb Department of Microbiology, Radboud University, Nijmegen, The Netherlandsa; Department of Medical Microbiology, Radboud University Medical Centre, Nijmegen, The Netherlandsb; Centre for Molecular and Biomolecular Informatics, Radboud University Medical Centre, Nijmegen, The Netherlandsc; NIZO, Ede, The Netherlandsd; Institute of Microbiology and Infection, University of Birmingham, Birmingham, United Kingdome SUMMARY ...................................................................................1016 Published 30 August 2017 on August 31, 2017 by TECH KNOWLEDGE CTR OF DENMARK INTRODUCTION .............................................................................1017 Citation Quainoo S, Coolen JPM, van Hijum OUTBREAK DEFINITION ....................................................................1018 SAFT, Huynen MA, Melchers WJG, van Schaik CONVENTIONAL MOLECULAR CHARACTERIZATION METHODS ......................1018 W, Wertheim HFL. 2017. Whole-genome Non-Amplification-Based Typing Technologies ..........................................1018 sequencing of bacterial pathogens: the future Restriction fragment length polymorphism methods ................................1018 of nosocomial outbreak analysis. Clin Microbiol Matrix-assisted laser desorption
    [Show full text]
  • De Novo Transcriptome Assembly of Cucurbita Pepo L. Leaf Tissue Infested by Aphis Gossypii
    data Data Descriptor De Novo Transcriptome Assembly of Cucurbita Pepo L. Leaf Tissue Infested by Aphis Gossypii Alessia Vitiello 1, Rosa Rao 1 , Giandomenico Corrado 1, Pasquale Chiaiese 1, Maria Cristina Digilio 1, Riccardo Aiese Cigliano 2 and Nunzio D’Agostino 3,* 1 Department of Agricultural Sciences, University of Naples Federico II, Via Università 100, 80055 Portici, Italy; [email protected] (A.V.); [email protected] (R.R.); [email protected] (G.C.); [email protected] (P.C.); [email protected] (M.C.D.) 2 Sequentia Biotech SL, Campus UAB, Av. de Can Domènech s/n, 08193 Bellaterra, Barcelona, Spain; [email protected] 3 CREA Research Centre for Vegetable and Ornamental Crops, via dei Cavalleggeri 25, 84098 Pontecagnano Faiano, Italy * Correspondence: [email protected]; Tel.: +39-89-386243 Received: 24 July 2018; Accepted: 14 September 2018; Published: 16 September 2018 Abstract: Zucchini (Cucurbita pepo L.), extensively cultivated in temperate areas, belongs to the Cucurbitaceae family and it is a species with great economic value. One major threat related to zucchini cultivation is the damage imposed by the cotton/melon aphid Aphis gossypii Glover (Homoptera: Aphididae). We performed RNA-sequencing on cultivar “San Pasquale” leaves, uninfested and infested by A. gossypii, that were collected at three time points (24, 48, and 96 h post infestation). Then, we combined all high-quality reads for de novo assembly of the transcriptome. This resource was primarily established to be used as a reference for gene expression studies in order to investigate the transcriptome reprogramming of zucchini plants following aphid infestation. In addition, raw reads will be valuable for new experiments based on the latest bioinformatic tools and analytical approaches.
    [Show full text]
  • Metaspades: a New Versatile Metagenomics Assembler
    metaSPAdes: a new versatile metagenomics assembler Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Abstract While metagenomics has emerged as a technology of choice for analyzing bacterial populations, as- sembly of metagenomic data remains challenging thus stifling biological discoveries. Moreover, re- cent studies revealed that complex bacterial populations may be composed from dozens of related strains thus further amplifying the challenge metagenomics assembly. metaSPAdes addresses various challenges of metagenomics assembly by capitalizing on computational ideas that proved to be useful in assemblies of single cells and highly polymorphic diploid genomes. We benchmark metaSPAdes against other state-of-the-art metagenome assemblers and demonstrate that it results in high-quality assemblies across diverse datasets. Introduction Metagenome sequencing has emerged as a technology of choice for analyzing bacterial popula- tions and discovery of novel organisms and genes (Venter et al. 2004; Tyson et al. 2004; Yooseph et al. 2007; Arumugam et al. 2011). In one of the early metagenomics studies, Venter et al. (2004) at- tempted to assemble the complex Sargasso Sea microbial community but, as the paper stated, failed. On the other side of the spectrum of metagenomics studies, Tyson et al. (2004) succeeded in assem- bling a simple metagenomic community from a biofilm consisting of a few species.
    [Show full text]
  • Scaling Metagenome Sequence Assembly with Probabilistic De Bruijn Graphs
    Scaling metagenome sequence assembly with probabilistic de Bruijn graphs Jason Pella, Arend Hintzea, Rosangela Canino-Koninga, Adina Howeb, James M. Tiedjeb,c, and C. Titus Browna,b,1 aComputer Science and Engineering, Michigan State University, East Lansing, MI 48824; bMicrobiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824; and cCrop and Soil Sciences, Michigan State University, East Lansing, MI 48824 Edited by Dan Gusfield, UC Davis, and accepted by the Editorial Board June 26, 2012 (received for review December 27, 2011) Deep sequencing has enabled the investigation of a wide range of more complex samples such as soil metagenomes, which may environmental microbial ecosystems, but the high memory require- possess millions or more species, terabytes of memory would be ments for de novo assembly of short-read shotgun sequencing required to store the graph. Moreover, the wide variation in spe- data from these complex populations are an increasingly large cies abundance limits the utility of standard memory-reduction practical barrier. Here we introduce a memory-efficient graph re- practices such as abundance-based error-correction (15). presentation with which we can analyze the k-mer connectivity In this work, we describe a simple probabilistic representation of metagenomic samples. The graph representation is based on for storing de Bruijn graphs in memory, based on Bloom filters a probabilistic data structure, a Bloom filter, that allows us to effi- (16). Bloom filters are fixed-memory probabilistic data structures ciently store assembly graphs in as little as 4 bits per k-mer, albeit for storing sparse sets; essentially hash tables without collision inexactly.
    [Show full text]
  • Genomic Insights from Monoglobus Pectinilyticus: a Pectin-Degrading Specialist Bacterium in the Human Colon
    The ISME Journal (2019) 13:1437–1456 https://doi.org/10.1038/s41396-019-0363-6 ARTICLE Genomic insights from Monoglobus pectinilyticus: a pectin-degrading specialist bacterium in the human colon 1,2 1,3 4 2 2 5 Caroline C. Kim ● Genelle R. Healey ● William J. Kelly ● Mark L. Patchett ● Zoe Jordens ● Gerald W. Tannock ● 6 6 1 7,8,9 1 Ian M. Sims ● Tracey J. Bell ● Duncan Hedderley ● Bernard Henrissat ● Douglas I. Rosendale Received: 19 April 2018 / Revised: 7 January 2019 / Accepted: 19 January 2019 / Published online: 6 February 2019 © International Society for Microbial Ecology 2019 Abstract Pectin is abundant in modern day diets, as it comprises the middle lamellae and one-third of the dry carbohydrate weight of fruit and vegetable cell walls. Currently there is no specialized model organism for studying pectin fermentation in the human colon, as our collective understanding is informed by versatile glycan-degrading bacteria rather than by specialist pectin degraders. Here we show that the genome of Monoglobus pectinilyticus possesses a highly specialized glycobiome for pectin degradation, unique amongst Firmicutes known to be in the human gut. Its genome encodes a simple set of metabolic pathways relevant to pectin sugar utilization, and its predicted glycobiome comprises an unusual distribution of carbohydrate- 1234567890();,: 1234567890();,: active enzymes (CAZymes) with numerous extracellular methyl/acetyl esterases and pectate lyases. We predict the M. pectinilyticus degradative process is facilitated by cell-surface S-layer homology (SLH) domain-containing proteins, which proteomics analysis shows are differentially expressed in response to pectin. Some of these abundant cell surface proteins of M.
    [Show full text]
  • Efficient De Novo Assembly of Large Genomes Using Compressed Data Structures
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Efficient de novo assembly of large genomes using compressed data structures Jared T. Simpson and Richard Durbin1 Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, United Kingdom De novo genome sequence assembly is important both to generate new sequence assemblies for previously uncharac- terized genomes and to identify the genome sequence of individuals in a reference-unbiased way. We present memory efficient data structures and algorithms for assembly using the FM-index derived from the compressed Burrows-Wheeler transform, and a new assembler based on these called SGA (String Graph Assembler). We describe algorithms to error- correct, assemble, and scaffold large sets of sequence data. SGA uses the overlap-based string graph model of assembly, unlike most de novo assemblers that rely on de Bruijn graphs, and is simply parallelizable. We demonstrate the error correction and assembly performance of SGA on 1.2 billion sequence reads from a human genome, which we are able to assemble using 54 GB of memory. The resulting contigs are highly accurate and contiguous, while covering 95% of the reference genome (excluding contigs <200 bp in length). Because of the low memory requirements and parallelization without requiring inter-process communication, SGA provides the first practical assembler to our knowledge for a mammalian-sized genome on a low-end computing cluster. [Supplemental material is available for this article.] The cost of DNA sequencing continues to fall rapidly, faster than Most short read assemblers rely on the de Bruijn graph model Moore’s law for computing costs (Stein 2010).
    [Show full text]
  • Basys: a Web Server for Automated Bacterial Genome Annotation Gary Van Domselaar†, Paul Stothard, Savita Shrivastava, Joseph A
    BASys: A Web Server for Automated Bacterial Genome Annotation Gary Van Domselaar†, Paul Stothard, Savita Shrivastava, Joseph A. Cruz, AnChi Guo, Xiaoli Dong, Paul Lu, Duane Szafron, Russ Greiner, and David S. Wishart‡ Departments of Computing Science and Biological Sciences University of Alberta Edmonton AB T6E 2E9 †[email protected] ‡[email protected] Abstract Head Node Annotation Reports BASys uses CGView [3] to generate BASys (Bacterial Annotation System) is a web server that clickable genome maps for navigating supports automated, in- depth annotation of bacterial the genome data. An HTML- formatted tabular summary is also provided. The genomic (chromosomal, plasmid, and contig) sequences. Genomic Annotation genome maps are prerendered as a It accepts raw DNA sequence data and an optional list of Sequence Data Reports series of hyperlinked PNG image files. gene identification information and provides extensive Each gene label is hyperlinked to its textual and hyperlinked image output. BASys uses more corresponding HTML- formatted “gene card”. The card is hyperlinked where than 30 programs to determine nearly 60 annotation applicable to external references. Text- subfields for each gene, including gene/ protein name, only gene cards are also provided. BASys GO function, COG function, possible paralogues and also supplies an 'evidence card' (Optional) Data Scheduling describing how each annotation was orthologues, molecular weight, isoelectric point, operon generated. The gene cards, evidence Gene BASys is implemented as a distributed structure, subcellular localization, signal peptides, Identification cards, and graphical genome maps are system. The head node monitors and downloadable for offline viewing. transmembrane regions, secondary structure, 3- D Data manages the job scheduling.
    [Show full text]
  • Genome Annotation
    Genome Annotation! Bioinformatics 301! David Wishart! [email protected]! Notes at: http://wishartlab.com! Objectives*! • To demonstrate the growing importance of gene and genome annotation in biology and the role bioinformatics plays! • To make students aware of new trends in gene and genome annotation (i.e. “deep” annotation)! • To make students aware of the methods, algorithms and tools used for gene and genome annotation! Genome Sequence! >P12345 Yeast chromosome1! GATTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGATTACAGAT! TACAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATTAC! AGATTACAGATTACAGATTACAGATTACAGATTACA! GATTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGATTACAGAT! Predict Genes! The Result…! >P12346 Sequence 1! ATGTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGAT! ! >P12347 Sequence 2! ATGAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATT! ! >P12348 Sequence 3! ATGTTACAGATTACAGATTACAGATTACAGATTACA! GATTACAGATTACAGATTACAGATTACA...! ! Is This Annotated?! >P12346 Sequence 1! ATGTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGAT! ! >P12347 Sequence 2! ATGAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATT! ! >P12348 Sequence 3! ATGTTACAGATTACAGATTACAGATTACAGATTACA!
    [Show full text]