Genomics Tutorial 2019
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
De Bruijn Graph Based De Novo Genome Assembly
2160 JOURNAL OF SOFTWARE, VOL. 9, NO. 8, AUGUST 2014 De Bruijn Graph based De novo Genome Assembly Mohammad Ibrahim Khan Computer Science and Engineering, Chittagong University of Engineering and Technology Chittagong, Bangladesh [email protected] Md. Sarwar Kamal Computer Science and Engineering, Chittagong University of Engineering and Technology Chittagong, Bangladesh [email protected] Abstract—The Next Generation Sequencing (NGS) is an and microorganism. Now –a-days, numbers of unique important process which assures inexpensive organization idea and vocational attempt have been established on the of vast size of raw sequence data set over any traditional road to the evolution of new techniques to overcome the sequencing systems or methods. Various aspects of NGS like problems of Sanger. The continuing innovation of DNA, template preparation, sequencing imaging and genome RNA and Proteins sequencing techniques have alignment and assembly outlines the genome sequencing and accompanied the development of sequencing system alignment .Consequently, deBruijn Graph (dBG) is an important mathematical tool that graphically analyzes how under the environment of sudden reduced expenditures the orientations are constructed in groups of nucleotides. and better outcomes in performance comparing with the Basically, de Bruijn graph describe the formation of the systems of tow three years back. Various sequencers genome segments in a circular iterative fashions. Some from some established methods like 454 Life Science or pivotal de Bruijn graph based de novo algorithms and Roche or Illumina and Applied Biosystems are in software package like T-IDBA, Oases, IDBA-tran, Euler, developments and Helicos have appeared in application. Velvet, ABySS, AllPaths, SOAPdenovo and SOAPdenovo2 All these sequencers will produce more and more data have illustrated here. -
De Novo Genomic Analyses for Non-Model Organisms: an Evaluation of Methods Across a Multi-Species Data Set
De novo genomic analyses for non-model organisms: an evaluation of methods across a multi-species data set Sonal Singhal [email protected] Museum of Vertebrate Zoology University of California, Berkeley 3101 Valley Life Sciences Building Berkeley, California 94720-3160 Department of Integrative Biology University of California, Berkeley 1005 Valley Life Sciences Building Berkeley, California 94720-3140 June 5, 2018 Abstract High-throughput sequencing (HTS) is revolutionizing biological research by enabling sci- entists to quickly and cheaply query variation at a genomic scale. Despite the increasing ease of obtaining such data, using these data effectively still poses notable challenges, especially for those working with organisms without a high-quality reference genome. For every stage of analysis – from assembly to annotation to variant discovery – researchers have to distinguish technical artifacts from the biological realities of their data before they can make inference. In this work, I explore these challenges by generating a large de novo comparative transcriptomic dataset data for a clade of lizards and constructing a pipeline to analyze these data. Then, using a combination of novel metrics and an externally validated variant data set, I test the efficacy of my approach, identify areas of improvement, and propose ways to minimize these errors. I arXiv:1211.1737v1 [q-bio.GN] 8 Nov 2012 find that with careful data curation, HTS can be a powerful tool for generating genomic data for non-model organisms. Keywords: de novo assembly, transcriptomes, suture zones, variant discovery, annotation Running Title: De novo genomic analyses for non-model organisms 1 Introduction High-throughput sequencing (HTS) is poised to revolutionize the field of evolutionary genetics by enabling researchers to assay thousands of loci for organisms across the tree of life. -
What Can the Miseq & NGS Core Do for Your Research?
What Can the MiSeq & NGS Core Do for Your Research? Grant Hill Library Prep Specialist [email protected] © 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, NuPCR, SeqMonitor, Solexa, TruSeq, TruSight, VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners. Agenda ! Into/basic principles of NGS (terms & technology) ! Small genome sequencing ! Targeted resequencing (custom panels) ! 16s metagenomics & amplicon sequencing ! Small RNA & targeted rna expression ! Experimental design & local resources 2 Enhanced Focus on the Sample to Answer Integration From library prep to downstream informatics & knowledge generation Library Prep Sequence Answer 3 For Research Use Only. Not for use in diagnostic procedures. The Flow Cell Where the magic happens ! Everything except sample preparation is completed on the flow cell •" Template annealing (1 - 384 samples) •" Template amplification •" Sequencing primer hybridization •" Sequencing-by-synthesis reaction •" Generation of fluorescent signal MiSeq NextSeq HiSeq 4 Flow Cell Surface 8 channels Simplified workflow Surface of flow cell ! Clusters in a coated with a lawn of oligo pairs contained environment (no need for clean rooms) ! -
MATCH-G Program
MATCH-G Program The MATCH-G toolset MATCH-G (Mutational Analysis Toolset Comparing wHole Genomes) Download the Toolset The toolset is prepared for use with pombe genomes and a sample genome from Sanger is included. However, it is written in such a way as to allow it to utilize any set or number of chromosomes. Simply follow the naming convention "chromosomeX.contig.embl" where X=1,2,3 etc. For use in terminal windows in Mac OSX or Unix-like environments where Perl is present by default. Toolset Description Version History 2.0 – Bug fixes related to scaling to other genomes. First version of GUI interface. 1.0 – Initial Release. Includes build, alignment, snp, copy, and gap resolution routines in original form. Please note this project in under development and will undergo significant changes. Project Description The MATCH-G toolset has been developed to facilitate the evaluation of whole genome sequencing data from yeasts. Currently, the toolset is written for pombe strains, however the toolset is easily scalable to other yeasts or other sequenced genomes. The included tools assist in the identification of SNP mutations, short (and long) insertion/deletions, and changes in gene/region copy number between a parent strain and mutant or revertant strain. Currently, the toolset is run from the command line in a unix or similar terminal and requires a few additional programs to run noted below. Installation It is suggested that a separate folder be generated for the toolset and generated files. Free disk space proportional to the original read datasets is recommended. The toolset utilizes and requires a few additional free programs: Bowtie rapid alignment software: http://bowtie-bio.sourceforge.net/index.shtml (Langmead B, Trapnell C, Pop M, Salzberg SL. -
Bioinformatics Study of Lectins: New Classification and Prediction In
Bioinformatics study of lectins : new classification and prediction in genomes François Bonnardel To cite this version: François Bonnardel. Bioinformatics study of lectins : new classification and prediction in genomes. Structural Biology [q-bio.BM]. Université Grenoble Alpes [2020-..]; Université de Genève, 2021. En- glish. NNT : 2021GRALV010. tel-03331649 HAL Id: tel-03331649 https://tel.archives-ouvertes.fr/tel-03331649 Submitted on 2 Sep 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITE GRENOBLE ALPES préparée dans le cadre d’une cotutelle entre la Communauté Université Grenoble Alpes et l’Université de Genève Spécialités: Chimie Biologie Arrêté ministériel : le 6 janvier 2005 – 25 mai 2016 Présentée par François Bonnardel Thèse dirigée par la Dr. Anne Imberty codirigée par la Dr/Prof. Frédérique Lisacek préparée au sein du laboratoire CERMAV, CNRS et du Computer Science Department, UNIGE et de l’équipe PIG, SIB Dans les Écoles Doctorales EDCSV et UNIGE Etude bioinformatique des lectines: nouvelle classification et prédiction dans les génomes Thèse soutenue publiquement le 8 Février 2021, devant le jury composé de : Dr. Alexandre de Brevern UMR S1134, Inserm, Université Paris Diderot, Paris, France, Rapporteur Dr. -
To Find Information About Arabidopsis Genes Leonore Reiser1, Shabari
UNIT 1.11 Using The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes Leonore Reiser1, Shabari Subramaniam1, Donghui Li1, and Eva Huala1 1Phoenix Bioinformatics, Redwood City, CA USA ABSTRACT The Arabidopsis Information Resource (TAIR; http://arabidopsis.org) is a comprehensive Web resource of Arabidopsis biology for plant scientists. TAIR curates and integrates information about genes, proteins, gene function, orthologs gene expression, mutant phenotypes, biological materials such as clones and seed stocks, genetic markers, genetic and physical maps, genome organization, images of mutant plants, protein sub-cellular localizations, publications, and the research community. The various data types are extensively interconnected and can be accessed through a variety of Web-based search and display tools. This unit primarily focuses on some basic methods for searching, browsing, visualizing, and analyzing information about Arabidopsis genes and genome, Additionally we describe how members of the community can share data using TAIR’s Online Annotation Submission Tool (TOAST), in order to make their published research more accessible and visible. Keywords: Arabidopsis ● databases ● bioinformatics ● data mining ● genomics INTRODUCTION The Arabidopsis Information Resource (TAIR; http://arabidopsis.org) is a comprehensive Web resource for the biology of Arabidopsis thaliana (Huala et al., 2001; Garcia-Hernandez et al., 2002; Rhee et al., 2003; Weems et al., 2004; Swarbreck et al., 2008, Lamesch, et al., 2010, Berardini et al., 2016). The TAIR database contains information about genes, proteins, gene expression, mutant phenotypes, germplasms, clones, genetic markers, genetic and physical maps, genome organization, publications, and the research community. In addition, seed and DNA stocks from the Arabidopsis Biological Resource Center (ABRC; Scholl et al., 2003) are integrated with genomic data, and can be ordered through TAIR. -
Large Scale Genomic Rearrangements in Selected Arabidopsis Thaliana T
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Large scale genomic rearrangements in selected 2 Arabidopsis thaliana T-DNA lines are caused by T-DNA 3 insertion mutagenesis 4 5 Boas Pucker1,2+, Nils Kleinbölting3+, and Bernd Weisshaar1* 6 1 Genetics and Genomics of Plants, Center for Biotechnology (CeBiTec), Bielefeld University, 7 Sequenz 1, 33615 Bielefeld, Germany 8 2 Evolution and Diversity, Department of Plant Sciences, University of Cambridge, Cambridge, 9 United Kingdom 10 3 Bioinformatics Resource Facility, Center for Biotechnology (CeBiTec, Bielefeld University, 11 Sequenz 1, 33615 Bielefeld, Germany 12 + authors contributed equally 13 * corresponding author: Bernd Weisshaar 14 15 BP: [email protected], ORCID: 0000-0002-3321-7471 16 NK: [email protected], ORCID: 0000-0001-9124-5203 17 BW: [email protected], ORCID: 0000-0002-7635-3473 18 19 20 21 22 23 24 25 26 27 28 29 30 page 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. -
An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identification and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging field of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Homology & Alignment
Protein Bioinformatics Johns Hopkins Bloomberg School of Public Health 260.655 Thursday, April 1, 2010 Jonathan Pevsner Outline for today 1. Homology and pairwise alignment 2. BLAST 3. Multiple sequence alignment 4. Phylogeny and evolution Learning objectives: homology & alignment 1. You should know the definitions of homologs, orthologs, and paralogs 2. You should know how to determine whether two genes (or proteins) are homologous 3. You should know what a scoring matrix is 4. You should know how alignments are performed 5. You should know how to align two sequences using the BLAST tool at NCBI 1 Pairwise sequence alignment is the most fundamental operation of bioinformatics • It is used to decide if two proteins (or genes) are related structurally or functionally • It is used to identify domains or motifs that are shared between proteins • It is the basis of BLAST searching (next topic) • It is used in the analysis of genomes myoglobin Beta globin (NP_005359) (NP_000509) 2MM1 2HHB Page 49 Pairwise alignment: protein sequences can be more informative than DNA • protein is more informative (20 vs 4 characters); many amino acids share related biophysical properties • codons are degenerate: changes in the third position often do not alter the amino acid that is specified • protein sequences offer a longer “look-back” time • DNA sequences can be translated into protein, and then used in pairwise alignments 2 Find BLAST from the home page of NCBI and select protein BLAST… Page 52 Choose align two or more sequences… Page 52 Enter the two sequences (as accession numbers or in the fasta format) and click BLAST. -
Assembly Exercise
Assembly Exercise Turning reads into genomes Where we are • 13:30-14:00 – Primer Design to Amplify Microbial Genomes for Sequencing • 14:00-14:15 – Primer Design Exercise • 14:15-14:45 – Molecular Barcoding to Allow Multiplexed NGS • 14:45-15:15 – Processing NGS Data – de novo and mapping assembly • 15:15-15:30 – Break • 15:30-15:45 – Assembly Exercise • 15:45-16:15 – Annotation • 16:15-16:30 – Annotation Exercise • 16:30-17:00 – Submitting Data to GenBank Log onto ILRI cluster • Log in to HPC using ILRI instructions • NOTE: All the commands here are also in the file - assembly_hands_on_steps.txt • If you are like me, it may be easier to cut and paste Linux commands from this file instead of typing them in from the slides Start an interactive session on larger servers • The interactive command will start a session on a server better equipped to do genome assembly $ interactive • Switch to csh (I use some csh features) $ csh • Set up Newbler software that will be used $ module load 454 A norovirus sample sequenced on both 454 and Illumina • The vendors use different file formats unknown_norovirus_454.GACT.sff unknown_norovirus_illumina.fastq • I have converted these files to additional formats for use with the assembly tools unknown_norovirus_454_convert.fasta unknown_norovirus_454_convert.fastq unknown_norovirus_illumina_convert.fasta Set up and run the Newbler de novo assembler • Create a new de novo assembly project $ newAssembly de_novo_assembly • Add read data to the project $ addRun de_novo_assembly unknown_norovirus_454.GACT.sff -
Computational Methods for De Novo Assembly of Next-Generation Genome Sequencing Data Rayan Chikhi
Computational methods for de novo assembly of next-generation genome sequencing data Rayan Chikhi To cite this version: Rayan Chikhi. Computational methods for de novo assembly of next-generation genome sequencing data. Other [cs.OH]. École normale supérieure de Cachan - ENS Cachan, 2012. English. NNT : 2012DENS0033. tel-00752033 HAL Id: tel-00752033 https://tel.archives-ouvertes.fr/tel-00752033 Submitted on 14 Nov 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE / ENS CACHAN - BRETAGNE présentée par sous le sceau de l’Université européenne de Bretagne Rayan Chikhi pour obtenir le titre de Préparée à l’Unité Mixte de Recherche 6074 DOCTEUR DE L’école norMALE suPÉRIEURE de CACHAN Institut de recherche en informatique Mention : Informatique École doctorale MATISSE et systèmes aléatoires Thèse soutenue le 2 juillet 2012 Computational Methods devant le jury composé de : Éric RIVALS, for de novo Assembly of DR, LIRMM / rapporteur Sante GNERRE, Next-Generation Genome Group leader, Broad Institute of MIT and Harvard / rapporteur Marie-France SAGOT,