What Can the MiSeq & NGS Core
Do for Your Research?
Grant Hill Library Prep Specialist
© 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, NuPCR, SeqMonitor, Solexa, TruSeq, TruSight, VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners. Agenda
Into/basic principles of NGS (terms & technology)
Small genome sequencing
Targeted resequencing (custom panels)
16s metagenomics & amplicon sequencing
Small RNA & targeted rna expression
Experimental design & local resources
2 Enhanced Focus on the Sample to Answer Integration From library prep to downstream informatics & knowledge generation
Library Prep Sequence Answer
3 For Research Use Only. Not for use in diagnostic procedures. The Flow Cell Where the magic happens
Everything except sample preparation is completed on the flow cell
• Template annealing (1 - 384 samples)
• Template amplification
• Sequencing primer hybridization
• Sequencing-by-synthesis reaction
• Generation of fluorescent signal
MiSeq NextSeq HiSeq
4 Flow Cell Surface
8 channels Simplified workflow
Surface of flow cell Clusters in a coated with a lawn of oligo pairs contained environment (no need for clean rooms)
Sequencing performed in the flow cell on the clusters
5 Sequencing by synthesis
3’ 5’
DNA (0.1-1.0 ug) A G T C A G C T T A C C G G A T A A C T C C C G G A T T C Sample G A preparation SingleCluster molecule growth array T 5’ Sequencing 1 2 3 4 5 6 7 8 9 T G C T A C G A T …
Image acquisition Base calling
6 Illumina Paired End Sequencing Overview of automated process on the flowcell
Cluster amplification 1st Read 1 cut
FLOWCELL Normal sequencing FLOWCELL process Linearize DNA Sequence 1st strand
Because we amplify on the flowcell surface, we can resynthesize the DNA in the
cluster, and regenerate both FLOWCELL strands again Strand re-synthesis
2nd Read 2 cut
FLOWCELL FLOWCELL
Linearize Sequence 2nd strand
7 de novo Sequencing
gap
contig contig
long read
mate pair
8 Re-Sequencing
Alignment 3X 2X
reference
Variant Calling G/A SNV
GCTATGCATTGGCATGGCATGCTAGCTACGGGATGCTGATCGATTTCGAAACTGACT! CTATGCATTGGCATGGCATGCTAGCTACAGGATGCTGATCGATTTCGAAACTGACTG! random TATGCATTGGCATGGCATGCTAGCTACGGGATGCTGATCGATTTCGAAACTGACTGT! errors ATGCATTGGCATGTCATGCTAGCTACAGGATGCTGATCGATTTCGAAACTGACTGTT! TGCATTGGCATGGCATGCTAGCTACGGGATGCTGATCGATTTCGAAACTGACTGTTA! GCATTGGCATGGCATGCTAGCTACGGGATGCTGATCGATTTCGAAACTGACTGTTAG! CATTGGCATGGCATGCTAGCTACAGGATGCTGATCGATTTCGAAACTGACTGTTAGC! ATTGGCATGGCATGCTAGCTACGGGATGCTGATCGATATCGAAACTGACTGTTAGCC! TTGGCATGGCATGCTAGCTACAGGATGCTGATCGATTTCGAAACTGACTGTTAGCCA! TGGCATGGCATGCTAGCTACAGGATGCTGATCGATTTCGAAACTGACTGTTAGCCAT! reference GCTATGCATTGGCATGGCATGCTAGCTACAGGATGCTGATCGATTTCGAAACTGACTGTTAGCCAT!
9 Paired-End Sequencing Extends the Power of the Technology
Known sequence
Sequence reads (single-end)
New sequence 80-90%
10 Paired-End Sequencing Extends the Power of the Technology
Known sequence
Sequence reads (paired-end)
Unique placement of one end can resolve ambiguous placement of other New sequence 95 to >99%
11 Indexing pooling samples
DNA/RNA samples unique sequence “barcode” create library & add index increase throughput
indexed maximize capacity libraries TAAGGCGAGTA….. CGTACTAGTGG….. informatic AGGCAGAAAGT….. pool de-multiplex TCCTGAGCTGC….. GGACTCCTGTG….. TAGGCATGTAG….. CTCTCTACGCA….. FASTQ CAGAGAGGAGT….. GCTACGCTGTG….. CGAGGCTGTAG….. AAGAGGCAGCA….. GTAGAGGAAGT…..
12 Coverage
4X 2X 3X average (read length) x (# of clusters) = coverage genome size (target)
Examples
Human on HiSeq 2500 (Rapid)
(2x150bp) x (600 Million clusters) = 200 X average coverage 3 Billion bp (human)
E. coli on MiSeq – 96 samples
(2x300bp) x (25 Million clusters) = 52 X average coverage 96 samples x 3 Million bp (E. coli)
13 Coverage Optimizing Sequence Capacity
High Performers Consume Unnecessary Coverage
Low Performers Need More Coverage
Minimum Coverage
14 Applications Guidelines Whole Human Genome
ChIP seq
Exomes
Shotgun Metagenomics
RNA seq
Targeted Panels
Microbial & 16S Metagenomics
Focused Power Flexible Power Production Power Population Power
MiSeq Series NextSeq HiSeq Series HiSeq X Series
1-25M 130-400M 300-2,500M 3,000M
15 MiSeq Desktop Sequencer- Speed and Simplicity
Economical personal sequencer
Easy to use workflow
Rapid turnaround time
Proven sequencing chemistry
Multiple applications
16 MiSeq Offers Scalable Sequencing
MiSeq Core Consumables Version 3 25 • 600 cycles Million Reads • 150 cycles
MiSeq Core Consumables Version 2 • 500 cycles 15 • 300 cycles Million Reads • 150 cycles
MiSeq Core Consumables Version 2 Micro 4 • 300 cycles (Micro) Million Reads MiSeq Core Consumables Version 2 Nano 1 • 500 cycles (Nano) Million Reads • 300 cycles (Nano)
17 Multiple Kits Available to Maximize Utility
Chemistry Number of Sequencing Cycles Output (Gb) Version Reads (mil) Time (hrs) 3 25 600 15 56
3 25 150 3.8 21
2 15 500 8.5 39
2 15 300 5.1 24
2 15 50 0.85 5.5
2 4 (Micro) 300 1.2 28
2 1 (Nano) 500 0.5 19
2 1 (Nano) 300 0.3 19
18 MiSeq Applications Portfolio Integrated. Optimized. Simplified.
Amplicon Custom Targeted Custom Small RNA Clone Sequencing Amplicon Resequencing Enrichment sequencing checking
ChIP-Seq Library QC Plasmid Regulation RNA-Seq Resequencing
Small RNA De novo 16S genome sequencing sequencing Metagenomics
19 For Research Use Only. Not for use in diagnostic procedures MiSeq Reporter (MSR) Apps
De Novo Enrichment Generate LibraryQC PCR Metagenomics Small Resequencing TruSeq Assembly FASTQ Amplicon RNA Amplicon
Streamlined on-board analysis workflows
Most workflows also available on BaseSpace
No user intervention from sample loading to report generation
Accessible from any computer on the same local network as instrument
rd All workflows generate FASTQ files that can be analyzed by most 3 party apps
20 For Research Use Only. Not for use in diagnostic procedures BaseSpace Core Apps BaseSpace Labs Apps
16S TopHat Cufflinks RNA VariantStudio FastQC Kraken NextBio VCAT Metagenomics Alignment Assembly Express Metagenomics Annotates & DE
BWA Isaac Broad IGV TruSeq Amplicon DS NextBio SRST2 FASTQ Velvet Enrichment Enrichment Amplicon Transporter Toolkit Assembly
BWA Isaac Tumor Long Read Long Read PicardSpace SRA Prokka WGS WGS Normal Assembly Phasing Import Annotation
Third-Party Apps
SPAdes Novoalign Advaita DNASTAR SCIEX SCIEX SCIEX EDGC SWATHAtlas Pipeline Annotator
MetaPhlAn N-of-One MyFLQ LoFreq eGB Genomatix Genome OncoMD GeneTalk Profiler
PathGEN Melanoma Tute DeepChek® PEDANT CosmosID Dx PathSEQ Profiler HIV, HBV, HCV
21 For Research Use Only. Not for use in diagnostic procedures. Nextera XT workflow and applications
22 For Research Use Only. Not for use in diagnostic procedures Library Prep Approaches
Shotgun – random fragmentation
– mechanical shearing
– enzymatic shearing (Nextera)
Considerations
– fragment length
– uniformity of coverage
– workflow
23 A Typical MiSeq DNA Workflow
Nextera XT MiSeq MSR or BaseSpace BaseSpace
Prep Sequence Analyze Share 15 minutes hands-on 20 minutes hands-on Fully automated Secure and store
Rapid library preparation – Complete library prep in as little as 90 minutes with only 15 minutes of hands-on time
Optimized for small genomes, PCR amplicons and plasmids – One library prep kit for many applications
Ultra low input – Only a single nanogram of input DNA needed
Innovative sample normalization – Eliminates the need for library quantification before sample pooling and sequencing
24 For Research Use Only. Not for use in diagnostic procedures Nextera XT, how does it work?
25 Nextera XT, how does it work?
FLEXIBLE:
Genomic DNA
Environmental sample (metagenomics)
Long range PCR amplicon
Plasmid
ds-cDNA
26 Nextera XT, how does it work?
FAST:
5 minutes
27 Nextera XT, how does it work?
COST EFFECTIVE:
Under $35
28 Nextera XT workflow applications
Assemble and compare genomes of bacterial isolates – Develop and infection control program
Perform whole genome metagenomics – Monitor evolution of bacterial populations under specific conditions
Single cell RNA-seq analysis – Sequence amplified ds-cDNA from single cells from different tissue compartments
Resequence long range PCR products to detect variation between samples – Manage highly similar genes by leveraging the LR PCR specificity
29 Using NGS to Assess Food Pathogen Outbreak Samples First example: FDA/CDC Listeria whole genome sequencing project
Compared with pulsed-field gel electrophoresis (PFGE), WGS provides clearer distinction between cases and foods that are likely part of a given outbreak and those that are not.
Whole-genome sequences of the Listeria First time EVER that microbial whole strains isolated from Roos Foods cheese genome sequencing was used by the products were available after the recall and US Federal Government in real time were found to be highly related to sequences to link an outbreak to a company and of the Listeria strains isolated from the affect legal action. patients.
30 PFGE Protocol
31 CDC Protocol, PulseNet Application: Bacterial WGS from culture Displacing PFGE
MiSeq & Nextera Sample Prep Primary Library Prep Analysis
• Grow • Lyse cells from • Nextera XT • MiSeq workflow: culture cultured • 16 samples per • 2x 250 isolate run • Generate FASTQ • Genomic DNA • ~100x • Data sent to CDC extraction coverage or BaseSpace for storage and sharing with CDC and upload to NCBI SRA database. • Analysis thru BioNumerics (Applied Maths) as WGS-MLST
32 Targeted Resequencing
33 For Research Use Only. Not for use in diagnostic procedures Coverage vs. Depth it’s a trade off
75X WGS TruSeq PCR Free
Exome 200X Nextera Rapid Capture
Amplicon Panel TruSight Myeloid 5,000X
34 Library Prep Approaches
Targeted – re-sequencing
– Amplicon - PCR
– Enrichment – oligo hyb probes
region of interest
35 Variants Can Cause Mismatches!
Amplicon
Enrichment
36 TSCA or Enrichment? Factors to consider
Feature TSCA/Low- Enrichment (NRC) Input Content up to 500kb 500kb-15mb Insert size 150-450bp 250-300bp* Targets/Probes 1536+ 2,000-60,000+ Input 50ng/10ng 50-100ng Types of variants Indel/SNV Indel/SNV/CNVs* FFPE compatible Yes Yes/No Discover breakpoints No Yes Tolerate Mismatches Yes/no Yes, 10% - low level
37 Advantages Disadvantages
• Simple, Fast workflow • Complex primer design • Low sample input • Multiplex limit (10-50ng) • Novel fusions difficult Amplicon • “Good” with damaged • Duplicates DNA (FFPE) • Off target PCR artifacts
• Simple probe design • Longer run time • No upper limit to total • Higher sample input regions size (≥50ng) Enrichment • Novel fusions possible • Nextera LP not “good” • Remove duplicates with FFPE
38 Targeted Sequencing gene panels & custom
TruSeq Custom Fixed panels Custom Amplicon Nextera Rapid Capture
up to 500kb 500kb to 15 Mb
39 TruSeq Custom Amplicon Assay Overview Begin with 250ng genomic DNA
>10ng Genomic DNA
Hybridization
40 TruSeq Custom Amplicon Assay Overview Using a pair of custom PCR primers, each targeted region is amplified in each sample
Genomic DNA
Hybridization
Extension- Ligation
41 TruSeq Custom Amplicon Assay Overview Incorporation of indexed primers followed by sample pooling
Genomic DNA
Hybridization
Extension- Ligation
Amplification
42 TruSeq Custom Amplicon Assay Time Go from DNA to called variants in ~2 days
Day 1 Day 1 Day 1-2 Day 2 Start at 8:00AM Complete at 2:00PM ~27 hrs Finished at 5:00PM Receive custom Assay Cluster gen and Real-time oligos; biochemistry sequencing analysis Hybridization setup on MiSeq
Oligos, Extension & Ligation, Automated Simple, efficient, universal reagents PCR with index, sequencing automatic data analysis normalization & pooling and variant calling
43 TruSeq Custom Amplicon Data Analysis Illumina-developed and supported analysis tools
Illumina Experiment Manager – Wizard-driven tool to set up and manage sample preparation plates – Generation of sample sheet for the sequencing of pooled samples
MiSeq Reporter – On-instrument software – Demultiplex indices/samples – Perform read alignment – Report on detected variants
Illumina Amplicon Viewer – Offline viewer for visualization of data from multiple runs – Custom report generation
44 MiSeq Reporter Performs on-instrument secondary analysis
Installed on MiSeq
For the Amplicon workflow, MiSeq Reporter will: – Create an assembly for each amplicon per sample – Identify variants – Create graphs and reports, including coverage per amplicon, quality and variant scores
45 Illumina Amplicon Viewer View of ~8kb contiguous region with 53 tiled amplicons
Coverage
Q Scores
Variant Scores
46 MiSeq Amplicon Workflow
DesignStudio TruSeq Custom Amplicon MiSeq MSR or BaseSpace
Order Prep Sequence Analyze Intuitive web- Simple plate- 20 minutes hands-on Fully automated based design tool based format
Simple Assay Customization – Include up to 1,536 amplicons across a range of amplicon sizes and reference genomes
Optimized reagents – Achieve high performance from as little as 10 ng of DNA
Rapid sample processing – Prepare up to 96 reactions simultaneously using simple plate-based format
Easy, integrated analysis – Access automated, design-specific variant calling, and data analysis with pre-configured MiSeq software
47 For Research Use Only. Not for use in diagnostic procedures Compared 63 samples run on Miseq vs PGM for 54 genes
Used TruSeq Amplicon Cancer panel with 7 additional amplicons
Ran 10 samples per miseq V2 2 x 150bp for 1400x mean coverage
110 variants identified on Miseq and 102 on PGM
48 For ResearchFor Use Research Only. Use Not Only. for Not usefor use in in diagnostic diagnostic procedures. procedures. How Many Samples Can I Run with my Panel?
49 For ResearchFor Use Research Only. Use Not Only. for Not usefor use in in diagnostic diagnostic procedures. procedures. DesignStudio™ Tool Easy custom probe design tool
Let the DesignStudio Tool guide you with the new assay selector tool ✔ ︎ Help me choose
Move rapidly from design to order in 5 easy steps
1 2
50 For Research Use Only. Not for use in diagnostic procedures. DesignStudio Tool 1. Select assay
51 For Research Use Only. Not for use in diagnostic procedures. DesignStudio Tool 2. Configure design
52 For Research Use Only. Not for use in diagnostic procedures. DesignStudio Tool 3. Add targets
53 For Research Use Only. Not for use in diagnostic procedures. DesignStudio Tool 4. Review design
54 For Research Use Only. Not for use in diagnostic procedures. Illumina Concierge Service Product content service
Tier 1 Tier 2 Design optimization Product optimization Dedicated design expert 2 - 4 weeks In-silico design optimization Extended product capabilities 6 - 8 weeks Dedicated project manager Functional testing with controls Iterative product enhancements Shipment coordination Customer engagement Design creation Probe pool creation
Requirements gathering Tier 1 Expert in-silico optimization Tier 2 Iterative enhancement Delivery § Content § Design optimization § Manufacture § Performance § Design review and acceptance § Functional QC § Timing § Order § Enhancement
55 For Research Use Only. Not for use in diagnostic procedures. Extended Capabilities Through the Illumina Concierge Service
TruSeq® Custom Amplicon v1.5 Nextera® Rapid Capture Custom
16–10,000 amplicons Any alternate genomes (2‒67K probe maximum) Unique molecular identifiers
Dual strand for FFPE
Add-on to existing panels
Smaller amplicons
Targeting of single nucleotide polymorphism (SNPs)
Any alternate genomes
56 For Research Use Only. Not for use in diagnostic procedures. 16S metagenomics
57 For Research Use Only. Not for use in diagnostic procedures Metagenomic Studies
16S rRNA gene sequencing Shotgun Sequencing Ø relative abundance of the Ø gene expression analysis and classification functional annotation within microbial Ø High resolution phylogeny Communities Ø make functional predictions
Metagenomic Project
Meta-transcriptomics Long-reads Scaffolding Ø establishment of a signature Ø Confidently match sequences to profile for a specific environment. databases Ø screen microbiomes for enzymes of interest such as proteases or polymerases
58 16S Metagenomics
16S ribosomal RNA: ~ 1.5kb long
Expressed from 1 or more rDNA genes
Highly conserved regions to amplify targets via degenerate primers
Species-specific variable areas to phylogene cally classify bacteria
Classifica on specificity and sensi vity: - Amplifica on primers - Reads per sample - Database (related strains or species can not be dis nguished) - Length of amplicon (# of variable regions covered by reads)
Chimeric amplicons and sequence errors falsely increase diversity es mates
59 Targe ng V3-V4 of 16S gene Illumina demonstrated 16S Sequencing protocol
Degenerated primer pairs for ~460 bp amplicon covering V3 and V4 regions of the 16S gene
Amplicon
S tch 2x250 and 2x300 PE reads for full con nuous sequence (add to databases)
Ashelford et al. (2005) Appl. Environ. Microbiol. & * Klindworth et al. (2013) Nucleic Acids Res.
60 16S amplicons Applicable to other amplicons <550bp
Overhang adapter sequence used in Step 2 F Locus-specific sequence rDNA or cDNA of rRNA 460bp target sequence
Locus-specific sequence R Overhang adapter sequence used in Step 2
cleanup
Index adapter oligos from ILMN P5 adapter and Index 2
cleanup Index adapter oligos from ILMN P7 adapter and Index 1
250-300bp Read1 Index1 Final Library Index2 250-300bp Read2
61 Metagenomic Analysis: 16S rRNA Sequencing
BaseSpace Apps: 16S Metagenomics 1.01 – Demonstrated Protocol – Taxonomic classifica on of 16S rRNA targeted amplicon reads using an Illumina- curated version of the GreenGenes database.
Kraken Metagenomics – ccb.jhu.edu/so ware/kraken – Taxonomic classifica on of short reads from bacteria, archaea & viruses
Selec on of publicly available alterna ves: QIMME – h p://qiime.org/ – Open source so ware package for comparison and analysis of microbial communi es, primarily based on amplicon data.
Mothur – h p://www.mothur.org/ – Open Source so ware suite to analyze and visualize 16S rRNA gene sequences.
metagenomeSeq – h ps://github.com/HCBravoLab/metagenomeSeq – Differen al abundance analysis for microbial marker-gene surveys
STAMP – h p://kiwi.cs.dal.ca/So ware/STAMP – Iden fying biologically relevant differences between metagenomic communi es.
62 Jack Gilbert’s Paper from 2012
For anyone who wants to start to do metagenomic studies this paper is the best guide out there.
It gives guidance on: – Sampling – DNA Extraction – Sequencing – Statistical analysis – Assemblies and annotation
His Conclusion: “ Metagenomics will be employed as commonly and frequently as any other laboratory method.”
Link: http://www.microbialinformaticsj.com/ content/pdf/2042-5783-2-3.pdf
63 Gut microbiome response to short- term macronutrient change
Plant vs animal based diet
16s on HiSeq then QIIME
RNA-seq
Regulatory & taxonomical shifts
64 60 families including children & dogs
Fecal, oral, & skin
Household members shared more microbiota vs different households
Dog ownership increased shared skin microbiota
65 Sampled their oral and gut microbiome daily for one year Wrote an iOS app to chronicle daily activities
66 doi:10.1128/mBio.01012-14
► Compared OTUs of oral microbiota of healthy and periodontal disease samples.
► OTUs present varied across all samples.
► Transcriptome analysis revealed enzyme expression was found to be well conserved among disease samples.
67 microRNA workflow
68 For Research Use Only. Not for use in diagnostic procedures microRNA biology
Daniel Ramsköld - Wikipedia
69 miR-seq, how it works
70 Targeted RNA Expression workflow
71 For Research Use Only. Not for use in diagnostic procedures Introducing TruSeq Targeted RNA Expression Rapid and economical RNA profiling and validation for MiSeq
Quantitative analysis of RNA targets in high throughput – Assay 12 to 1,000 targets across 10s to 100s of samples – Enables higher density validation experiments
Lower price per sample than RT-PCR and Taqman Arrays – Significantly reduces initial start up costs
Rapid workflow and fast turn around time – Sample to answer in <2 days
Low sample input requirement – 50 ng or less total RNA
Simplest analysis of any NGS
72 Rapid, High Throughput Workflow
Modified from existing TSCA Sample Prep Chemistry
Sample to answer in 1.5 days with < 4hrs hands-on time
Sample prep for 48-384 samples per run
Single MiSeq run equivalent to 15,000 qPCR reactions or 40 384-well plates
Requires only 50 bp Single Reads =
73 Region of interest is small, but the assay can be used to target splice junctions, fusion transcripts, cSNPs, RNA editing sites, in/dels….
74 Case Study: SLC25A3
A
B
C
A 6795825 6795824 A 6795812 B+C A+B+C 6795822 6795816 A+B+C
Two assays that detect transcript A
One assay that detects transcript B+C
Two assays that detect all isoforms
75 TREx
TruSeq Targeted RNA Expression assays represent an entirely new way to profile Gene Expression
This is a new sequencing application for MiSeq
The assay gives data that is very accurate and reproducible across a large dynamic range
The system allows researchers to study up to 15,000 gene expression results in a short 50 bp run on MiSeq
76 How many samples can I run?
Depends on:
Coverage Output
Desired coverage #Samples Sample Index Output (number of reads & read length)
77 Estimating Coverage and Cost
[MiSeq 15M reads X (PE 2x150)] X 85% on target X 90% PF – Divide by the target length (50,000 bases or 200 amplicons) – Divide by the number of samples (48)
Est 1400x mean coverage
78 How do I find what I need for my application? Sample Prep Selector
79 For Research Use Only. Not for use in diagnostic procedures. THANK YOU
MiSeq MiSeqDx NextSeq HiSeq HiSeq X Ten
In vitro diagnostic
80 For Research Use Only. Not for use in diagnostic procedures. APPENDIX
81 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: De Novo Assembly
Common applications: – De novo assembly of small genomes
Process: 1. Uses Velvet assembler to reconstruct small genomes through use of contigs, without the need for a reference 2. Can compare with known reference if available to generate dot-plot
Outputs: – FASTA file containing contigs – Dot plot png
82 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: Generate FASTQ
Common applications: – Most flexible intermediate output for any downstream analysis outside of MSR – Analogous to the “BCL to FASTQ Converter” utility
Process: 1. Reads are assembled from base call files and written to FASTQ 2. FASTQ is ready for additional processing, such as alignment
Outputs: – FASTQ
83 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: Enrichment
Common applications: – Large, targeted panels using pulldown enrichment/capture – Nextera Rapid Capture Custom, Nextera Rapid Capture Exome (8 rxn x 1 plex)
Process: 1. Reads are aligned against whole genome reference (BWA) 2. Variants are called using the standard variant caller (GATK), or the somatic variant caller if specified in the sample sheet (particularly useful on cancer samples)
Outputs: – FASTQ – BAM – VCF – gVCF
84 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: Metagenomics
Common application: – Bacteria population analysis based on 16S rRNA amplicons – Generate taxonomic classification data down to species level – Integrates seamlessly with Illumina’s 16S Demonstrated Protocol (V3-V4 amplicons)
Process: 1. Reads are classified by sorting against 16S database, GreenGenes (V1-V9 regions) 2. Per sample statistics written to report files and plots
Outputs: – FASTQ – BAM – GUI Plots – HTML report
85 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: Amplicon
Common applications: – Analysis of PCR amplicons fragmented with Nextera tagmentation
Process: 1. Reads are aligned (BWA) against a custom built manifest file from IEM 2. Variant analysis in regions of interest (GATK)
Outputs: – FASTQ, BAM, VCF, gVCF
86 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: Resequencing
Common applications: – Small genome analysis (~20mb or smaller)
Process: 1. Reads are aligned against reference genomes (BWA) 2. Variant analysis in regions of interest (GATK)
Outputs: – FASTQ – BAM – VCF – gVCF
87 For Research Use Only. Not for use in diagnostic procedures MSR Workflows: Small RNA
Common applications: – Small RNA abundance measurements typically important in transcription regulation – Often important for cancer research
Process: 1. Reads are aligned against databases for mature miRNA (miRBase), small RNA, and a genomic reference using Bowtie (flexible reference storage) 2. Small RNA hits and relative species abundance is reported
Outputs: – FASTQ – BAM – TXT reports – Charts
88 For Research Use Only. Not for use in diagnostic procedures