Investigation for Novel Schizophrenia Candidate
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Comparative Analysis of Transcribed Genes in the Mouse Hypothalamus and Neocortex Reveals Chromosomal Clustering
A comparative analysis of transcribed genes in the mouse hypothalamus and neocortex reveals chromosomal clustering Wee-Ming Boon*, Tim Beissbarth†, Lavinia Hyde†, Gordon Smyth†, Jenny Gunnersen*, Derek A. Denton*‡, Hamish Scott†, and Seong-Seng Tan* *Howard Florey Institute, University of Melbourne, Parkville 3052, Australia; and †Genetics and Bioinfomatics Division, Walter and Eliza Hall Institute of Medical Research, Royal Parade, Parkville 3050, Australia Contributed by Derek A. Denton, August 26, 2004 The hypothalamus and neocortex are subdivisions of the mamma- representing all of the genes that are expressed (qualitative and lian forebrain, and yet, they have vastly different evolutionary quantitative) in the hypothalamus and neocortex under standard histories, cytoarchitecture, and biological functions. In an attempt conditions. to define these attributes in terms of their genetic activity, we have In the current study, we describe the use of the Serial Analysis compared their genetic repertoires by using the Serial Analysis of of Gene Expression (SAGE) database, which allows simulta- Gene Expression database. From a comparison of 78,784 hypothal- neous detection of the expression levels of the entire genome amus tags with 125,296 neocortical tags, we demonstrate that each without a priori knowledge of gene sequences (13). SAGE takes structure possesses a different transcriptional profile in terms of advantage of the fact that a small sequence tag taken from a gene ontological characteristics and expression levels. Despite its defined position within the transcript is sufficient to identify the more recent evolutionary history, the neocortex has a more com- gene (from known cDNA or EST sequences), and up to 40 tags plex pattern of gene activity. -
Supplemental Figure 1. Vimentin
Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672 -
PDF Datasheet
Product Datasheet C9orf85 Overexpression Lysate NBL1-08604 Unit Size: 0.1 mg Store at -80C. Avoid freeze-thaw cycles. Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/NBL1-08604 Updated 3/17/2020 v.20.1 Earn rewards for product reviews and publications. Submit a publication at www.novusbio.com/publications Submit a review at www.novusbio.com/reviews/destination/NBL1-08604 Page 1 of 2 v.20.1 Updated 3/17/2020 NBL1-08604 C9orf85 Overexpression Lysate Product Information Unit Size 0.1 mg Concentration The exact concentration of the protein of interest cannot be determined for overexpression lysates. Please contact technical support for more information. Storage Store at -80C. Avoid freeze-thaw cycles. Buffer RIPA buffer Target Molecular Weight 18.1 kDa Product Description Description Transient overexpression lysate of chromosome 9 open reading frame 85 (C9orf85) The lysate was created in HEK293T cells, using Plasmid ID RC208807 and based on accession number NM_182505. The protein contains a C- MYC/DDK Tag. Gene ID 138241 Gene Symbol C9ORF85 Species Human Notes HEK293T cells in 10-cm dishes were transiently transfected with a non-lipid polymer transfection reagent specially designed and manufactured for large volume DNA transfection. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix, 1mM PMSF and 1mM Na3VO4, and then centrifuged to clarify the lysate. Protein concentration was measured by BCA protein assay kit.This product is manufactured by and sold under license from OriGene Technologies and its use is limited solely for research purposes. -
Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. -
Transcriptional Control of Tissue-Resident Memory T Cell Generation
Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells. -
Ryanodine Receptors Are Part of the Myospryn Complex in Cardiac Muscle Received: 10 March 2017 Matthew A
www.nature.com/scientificreports OPEN Ryanodine receptors are part of the myospryn complex in cardiac muscle Received: 10 March 2017 Matthew A. Benson1, Caroline L. Tinsley2, Adrian J. Waite 2, Francesca A. Carlisle2, Steve M. Accepted: 12 June 2017 M. Sweet3, Elisabeth Ehler4, Christopher H. George5, F. Anthony Lai5,6, Enca Martin-Rendon7 Published online: 24 July 2017 & Derek J. Blake 2 The Cardiomyopathy–associated gene 5 (Cmya5) encodes myospryn, a large tripartite motif (TRIM)- related protein found predominantly in cardiac and skeletal muscle. Cmya5 is an expression biomarker for a number of diseases afecting striated muscle and may also be a schizophrenia risk gene. To further understand the function of myospryn in striated muscle, we searched for additional myospryn paralogs. Here we identify a novel muscle-expressed TRIM-related protein minispryn, encoded by Fsd2, that has extensive sequence similarity with the C-terminus of myospryn. Cmya5 and Fsd2 appear to have originated by a chromosomal duplication and are found within evolutionarily-conserved gene clusters on diferent chromosomes. Using immunoafnity purifcation and mass spectrometry we show that minispryn co-purifes with myospryn and the major cardiac ryanodine receptor (RyR2) from heart. Accordingly, myospryn, minispryn and RyR2 co-localise at the junctional sarcoplasmic reticulum of isolated cardiomyocytes. Myospryn redistributes RyR2 into clusters when co-expressed in heterologous cells whereas minispryn lacks this activity. Together these data suggest a novel role for the myospryn complex in the assembly of ryanodine receptor clusters in striated muscle. Te unique cytoskeletal organisation of striated muscle is dependent upon the formation of specialised interac- tions between proteins that have both structural and signalling functions1. -
ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed
ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Comprehensive Identification of Genes Driven by ERV9-Ltrs Reveals TNFRSF10B As a Re-Activatable Mediator of Testicular Cancer Cell Death
Cell Death and Differentiation (2016) 23, 64–75 & 2016 Macmillan Publishers Limited All rights reserved 1350-9047/16 www.nature.com/cdd Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death U Beyer1,2,5, SK Krönung1,5, A Leha3, L Walter4 and M Dobbelstein*,1 The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3’RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase -
The Discovery and Regulation of Modes of Exocytosis Through the Lens of Computer Vision
THE DISCOVERY AND REGULATION OF MODES OF EXOCYTOSIS THROUGH THE LENS OF COMPUTER VISION Fabio Urbina A thesis submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the department of Cell Biology and Physiology in the School of Medicine. Chapel Hill 2020 Approved by: Stephanie Gupton Patrick Brennwald Doug Cyr Keith Burridge Shawn Gomez © 2020 Fabio Urbina ALL RIGHTS RESERVED ii ABSTRACT Fabio Urbina: Discovery and Regulation of the Modes of Exocytosis through the lens of computer vision (Under the direction of Stephanie Gupton) The formation of the nervous system involves establishing complex networks of synaptic connections between proper partners, which requires the rapid expansion of the plasma membrane surface area as neurons grow. Critical to the expansion of the plasma membrane is exocytic vesicle fusion, a regulated mechanism driven by soluble N-ethylmaleimide-sensitive factor attachment proteins receptors (SNAREs). Multiple modes of exocytosis have been proposed, with full-vesicle fusion (FVF) and kiss-and-run (KNR) being the best described. The basis of SNARE-mediated fusion, the opening of a fusion pore, and its contribution to plasma membrane expansion remains enigmatic, as vesicle fusion is spatially small and temporally fast. We exploited TIRF microscopy to image VAMP-pHluorin mediated exocytosis in murine embryonic cortical neurons and developed computer-vision software and statistical tools to perform unbiased, efficient identification of exocytic events and uncover spatiotemporal aspects of exocytosis during neuron development. We further developed novel classification algorithms to describe. and classify individual exocytic events.