Species Diversity and Biological Activities of Some Lichens of District Mansehra Department of Botany Hazara University Mansehra

SPECIES DIVERSITY AND BIOLOGICAL ACTIVITIES OF SOME LICHENS OF DISTRICT MANSEHRA

ASMAT ULLAH

DEPARTMENT OF BOTANY HAZARA UNIVERSITY MANSEHRA 2019

HAZARA UNIVERSITY MANSEHRA

Department of Botany

SPECIES DIVERSITY AND BIOLOGICAL ACTIVITIES OF SOME SELECTED LICHENS OF DISTRICT MANSEHRA By Asmat Ullah

This research study has been conducted and reported as partial fulfulment of the requirements of Ph.D degree in Botany awarded by Hazara University Mansehra, Pakistan

Date: 30 August, 2019

SPECIES DIVERSITY AND BIOLOGICAL ACTIVITIES OF SOME LICHENS OF DISTRICT MANSEHRA

Submitted by ASMAT ULLAH PhD Scholar

Supervisor DR. ZAFAR IQBAL Assistant Professor Department of Botany Hazara University Mansehra

Co-Supervisor DR. MUHAMMAD FIAZ Assistant Professor Department of Botany Hazara University Mansehra

DEPARTMENT OF BOTANY HAZARA UNIVERSITY MANSEHRA 2019

iii

Plagiarism Undertaking

I solemnly declare that research work presented in the thesis titled “Species Diversity and Biological Activities of Some Lichens of District Mansehra” is solely my research work with no significant contribution from any other person. Small contribution/help where taken has been duly acknowledged and that complete thesis has been written by me.

I understand the zero tolerance policy of the HEC and Hazara University towards plagiarism. Therefore, I as an Author of the above titled thesis declare that no portion of my thesis has been plagiarized and any material used as reference is properly referred/cited.

I undertake that if I am found guilty of any formal plagiarism in the above titled thesis even after award of Ph.D. degree, the University reserves the rights to withdraw/revoke my Ph.D. degree and that HEC and the University has the right to publish my name on the HEC/University Website on which names of students are placed who submitted plagiarized thesis.

Student Signature: ______

Student Name: Asmat Ullah

AUTHOR’S DECLARATION

I Asmat Ullah hereby state that my PhD thesis titled “Species Diversity and Biological Activities of Some Lichens of District Mansehra” is my own work and has not been submitted previously by me for taking any degree from this University (Hazara University Mansehra Pakistan) Or anywhere else in the country/world.

At any time if my statement is found to be incorrect even after my

Graduate the university has the right to withdraw my PhD degree.

Asmat Ullah Date: 30-08-2019

vii

DEDICATION

To my parents

viii

ACKNOWLEDGEMENTS

All praises be to Almighty Allah Who is The Creater of the universe and knows whatever is in it, hidden or evident, and Who bestowed upon me the intellectual ability and wisdom to look for its secrets.

First, I would like to thank my Supervisor Dr. Zafar Iqbal, Department of Botany and Co-supervisor Dr. Muhammad Faiz, Department of Botany for their guidance, encouragement, and patience throughout this tenure.

I also express my heartiest and sincerest gratitude to Dr. Fakhr-e-Abbas BRC Islamabad for his support and for giving me the opportunity to carry out my research work and thesis at Bioresource Research Center (BRC) Islamabad. I would like to thank Safia Janjua, Madeeha Manzoor, Kainat Willaim, Abdur Raziq, Fida Muhammad Khan and other BRC staff for their assistance in my research work.

I would also like to thank my fellow graduate students Mazhar-ul-Islam, Rashid Ahmad, Ashfaq Ahmad, Amir Khan Afridi and Saeed Muhammad for all their time and help as their assistance, cooperation, and experience proved essential for the completion of the field work.

My deep appreciation goes out to Syed Junaid Shah and Syed Mushrraf Shah, the locals of District Mansehra. Their excellent help during field surveys and collection of data made an invaluable contribution to my Ph.D work.

I would like to thank various staff members and Ph.D students of the Senckenberg World of Biodiversity Frankfurt, Germany, with whom I had the opportunity to work; Dr. Christian Printzen, Viola Zilller, Heike Kappes, Tetiana Lutsak, Elisa Lagostina. They provided cooperative and a friendly atmosphere at work and also insightful comments on my work.

I express my special thanks to Andre Aptroot Curator, ABL Herbarium, Soest, Netherlands, for his support in identification of lichen specimens.

I would like to say special thanks to my special friends Muhammad Umar, Muhammad Khalil, Imran Khan and Salman Shahzad in Germany for their assistance and cooperation during my stay in Germany on IRSIP fellowship of Higher Education Commission, Pakistan. Finally, I also thank my mother and other family members who encouraged me and prayed for me throughout the time of my research.

May the Almighty Allah richly bless all of you?

ASMAT ULLAH

TABLE OF CONTENTS

Title Page No.

ACKNOWLEDGEMENTS ...... ix

LIST OF TABLES ...... xiv

LIST OF FIGURES ...... xvi

LIST OF PLATES ...... xx

LIST OF SYMBOLS/ABBREVIATIONS ...... xxiii

ABSTRACT ...... xxv

Chapter 1 INTRODUCTION...... 1

1.1 Study Area ...... 1

1.1.1 Geography ...... 1

1.1.2 Climate ...... 1

1.1.3 Rivers ...... 3

1.1.4 Lakes ...... 3

1.1.5 Forests Types ...... 3

1.2 Lichens ...... 7

1.2.1 General Structure ...... 7

1.2.2 Occurrence and Distribution ...... 8

1.2.3 Climate ...... 8

1.2.4 Morphology and Growth Form ...... 9

1.2.5 Chemistry ...... 10

1.2.6 DNA Barcoding ...... 10

1.2.7 Economic Importance ...... 11

1.2.8 Biological Activities ...... 12

1.2.8.1 Antibacterial Activity ...... 13

1.2.8.2 Antifungal Activity ...... 13

1.2.8.3 Plants Cell Carcinogensis ...... 13

1.3 Study Objectives ...... 14

Chapter 2 REVIEW OF LITERATURE ...... 15

2.1 Species Diversity and Distribution ...... 15

2.2 Biological Activities of Lichens ...... 21

Chapter 3 MATERIALS AND METHODS...... 32

3.1 Field Survey ...... 32

3.2 Characterization ...... 32

3.2.1 Morphological Characters ...... 32

3.2.2 Anatomical Characters ...... 33

3.2.3 Chemical Characters ...... 33

3.2.3.1 Spot Tests ...... 33

3.2.3.2 Thin Layer Chromatography ...... 34

3.2.4 DNA Barcoding ...... 35

3.2.4.1 Genomic DNA Extraction ...... 35

3.2.4.2 Gel Electrophoresis ...... 36

3.2.4.3 Polymerase Chain Reaction (PCR) ...... 37

3.3 Identification and Documentation ...... 39

3.4 Distribution Pattern Studies ...... 40

3.5 Biological Activities ...... 40

3.5.1 Preparation of Lichen Extracts ...... 40

3.5.1.1 Antimicrobial Assays ...... 41

xii

3.5.1.2 Cytotoxicity Assay ...... 41

3.5.1.3 Anticarcinogenic Assay ...... 42

3.5.1.4 Antioxidant Assay ...... 42

Chapter 4 RESULTS ...... 44

4.1 Lichen Biodiversity ...... 44

4.1.1 Species Recorded as New to Pakistan ...... 58

4.1.2 Species Recorded as New to District Mansehra ...... 59

4.1.3 Distribution Pattern ...... 63

4.1.3.1 Growth Form ...... 63

4.1.3.2 Substrate ...... 63

4.1.3.3 Locality-Wise Distribution...... 65

4.2 Taxonomic Description ...... 70

4.2 Lichen Species Identified by DNA Barcoding ...... 262

4.3 Biological Activities ...... 264

4.3.1 Antibacterial Activity ...... 264

4.3.2 Antifungal Activity ...... 267

4.3.3 Cytotoxcity Assay ...... 270

4.3.4 Anticarcinogenic Activity on Plants ...... 274

4.3.5 Antioxidant Activity ...... 277

Chapter 5 DISSCUSSION ...... 281

CONCLUSION ...... 291

RECOMMENDATIONS ...... 292

REFFRENCES ...... 293

xiii

LIST OF TABLES

Table Page No.

Table 3.1: List of Primer used for PCR Amplification...... 37

Table 3.2: Thermoprofile of PCR reaction, showing each step with number of cycles and corresponding temperature for each step...... 38

Table 4.1: List of species from District Mansehra, Pakistan ...... 45

Table 4.2: List of families with genera and number of species from District Mansehra ...... 54

Table 4.3: Number of families and genera in District Mansehra ...... 56

Table 4.4: List of dominant families by number of species in District Mansehra...... 57

Table 4.5: The new record of species to Pakistan from District Mansehra ...... 59

Table 4.6: List of species with families new to District Mansehra ...... 60

Table 4.7: List of taxa found at more than one locality in District Mansehra ...... 65

Table 4.8: List of taxa recorded from single locality in District Mansehra...... 69

Table 4.9: List of species identified by DNA barcoding...... 263

Table 4.10: Antibacterial activity of acetone extracts of selected lichen species from District Mansehra ...... 265

Table 4.11: Antibacterial activity of methanol extracts of selected lichen species from District Mansehra ...... 266

xiv

Table 4.12: Antifungal activity of acetone extracts of selected lichen species from District Mansehra...... 268

Table 4.13: Antifungal activity of methanol extracts of selected lichen species from District Mansehra ...... 269

Table 4.14: Percentage mortality of acetone extracts in different concentration of selected lichen species from District Mansehra ...... 271

Table 4.15: Percentage mortality of methanol extracts in different concentration of selected lichen species from District Mansehra ...... 272

Table 4.16: Anticarcinogenic activity of acetone and methanol extracts of selected lichen species from District Mansehra ...... 275

Table 4.17: Antioxidant activity of acetone extracts of selected lichen species from District Mansehra ...... 278

Table 4.18: Antioxidant activity of methanol extracts of selected species from District Mansehra ...... 279

LIST OF FIGURES

Figure Page No.

Fig. 1.1: Administrative Map of the District Mansehra, Pakistan...... 2

Fig. 4.1: Lichen families having more than two genera in District Mansehra...... 58

Fig. 4.2: Families with number of genera of species new to District Mansehra ...... 62

Fig. 4.3: Dominant families by number of genus of species new to District Mansehra ...... 62

Fig. 4.4: Relative (%) of different growth forms of species in District Mansehra...... 63

Fig. 4.5: Realtive (%) of species in different habitat in District Mansehra...... 64

Fig. 4.6: Relative (%) of lichens on basis of hosted substrate in District Mansehra...... 64

Fig. 4.7: Distribution of Acarosporaceae in District Mansehra; 1. Jalkhad 2. Lalazar, 3. On the the way to Saif-ul-Maluk, 4. Manoor Valley, 5. Paras, 6. Mahandri, 7. Balakot, 8. Daader, 9. Ghari Habibullah, 10. Khaki, 11. Oghi top...... 74

Fig. 4.8: Distribution of Arthoniaceae in District Mansehra; 1. Mandagucha. 2. Shogran, 3. Paras...... 78

Fig. 4.9: Distribution of Arthopyreniaceae in District Mansehra; 1. On way to Naran from Paras, 2. Mahandri (Kaghan), 3. Kiwai, 4. Shogran, 5. Mandagucha...... 81

Fig. 4.10: Distribution of Candelariaceae in District Mansehra; 1. Behsal, 2. Jalkhad, 3. Lalazar, 4. Lake Saif-ul-Maluk, 5.

xvi

Manoor Valley, 6. Paras, 7. Sharan, 8. Shogran, 9. Mandaghucha, 10. Dader, 11. Batal, 12. Oghi top...... 90

Fig. 4.11: Distribution of Catillariaceae in District Mansehra; 1. Ghari Habibullah, 2. Dader...... 94

Fig. 4.12: Distribution of Cladoniaceae in District Mansehra: 1. Lulusar lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan...... 102

Fig. 4.13: Distribution of Collemataceae in District Mansehra: 1. Lalazar, 2. Naran, 3. Manoor Valley near forest rest house, 4. Kaghan on way Naran, 5. Paras, 6. Shogran on track to Saripya, 7. Dader, Ooghi top...... 113

Fig. 4.14: Distribution of Graphidacea in District Mansehra; 1. Jalkhad. 2. Barhawai, 3. On way to lake Saif-ul-Maluk, 4. Manoor Valley, 5. On track to Saripaya, 6. Dader, 7. Mandagucha, 8. Oghi, 9. Parehna...... 118

Fig. 4.15: Distribution of Lecanoraceae in District Mansehra; 1. Jalkhad, 2. near Batakundi, 3. Lalazar, 4. Barawai, 5. Naran, 6. Manoor Valley, 7. Kaghan, 8. Shogran, 9. Kiwai, 10. Hasa Balakot, 11. Dader, 12. Mandagucha, 13. Oghi...... 137

Fig. 4.16: Distribution of Lecidaceae in District Mansehra; 1. Jalkhad, 2. above Lake Saif-ul-Maluk...... 143

Fig. 4.17: Distribution of Megasporaceae in District Mansehra; 1. JalKhad, 2. Lake Saif-ul -Maluk, 3. Paras near the side of Kunhar river, 4. Shogran, 5. Balakot, 6. Dader near Siran river, 7. Mandaghucha, 8. Oghi top. 9. Kathai Oghi...... 151

Fig. 4.18: Distribution of Mycoblastaceae in District Mansehra; 1. Manoor Valley, 2. on way to lake Saif-ul-Maluk...... 153

xvii

Fig. 4.19: Distribution of Nephromataceae in District Mansehra; 1. Batakundi, 2. Manoor Valley near forest rest house, 3.Shogran...... 157

Fig. 4.20: Distribution of Parmeliaceae in District Mansehra: 1. Behsal, 2. Jalkhad, 3. Lalazar, 4. lake Saif-ul-Maluk, 5. Manoor Valley, 6. Paras, 7. Sharan, 8. Shogran, 9. Managhucha, 10. Dader, 11. Batal, 12.Oghi top...... 181

Fig. 4.21: Distribution of Peltigeraceae in District Mansehra; 1. Batakundi, 2. Manoor Valley near forest rest house, 3. Shogran...... 188

Fig. 4.22: Distribution of Peltulaceae in District Mansehra. 1. Dader...... 191

Fig. 4.23: Distribution of Pertusariaceae in District Mansehra; 1. Shogran, 2. Mandagucha...... 193

Fig. 4.24: Distribution of Physciaceae in District Mansehra: 1. Lulusar lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan...... 211

Fig. 4.25: Distribution of Psoraceae in District Mansehra; 1. Lalazar...... 216

Fig. 4.26: Distribution of Ramalinaceae in District Mansehra; 1. Lalzar, 2. Naran,3. Manoor Valley, 4. Sharan , 5. on way to Saripaya. ... 226

Fig. 4.27: Distribution of Rhizocarpaceae in District Mansehra: 1. Jalkhad, 2. Naran, 3. lake Saif -ul- Maluk, 4. Manoor Valley...... 231

Fig. 4.28: Distribution of Stereocaulaceae in District Mansehra; 1. Shogran, 2. Mandagucha...... 234

Fig. 4.29: Distribution of Teloschistaceae in District Mansehra; 1. Lulusar lake, 2. Lalazar, 3. Kaghan, 4. near forest rest house Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan...... 243

xviii

Fig. 4.30: Distribution of Thelotremataceae in District Mansehra; 1. Jalkhad. 2. Barhawai, 3. on way to lake Saif-ul-Maluk, 4. Manoor Valley, 6. Dader, 7. Mandagucha, 8. Oghi, 9. Parehna...... 248

Fig. 4.31: Distribution of Trapeliaceae in District Mansehra: 1. Kaghan, 2. Mandaghucha...... 251

Fig. 4.32: Distribution of Umbilicariaceae in District Mansehra. 1. Dader...... 253

Fig. 4.33: Distribution of Verrucariaceae in District Mansehra; 1. Jalkhad, 2. Dader...... 260

Fig. 4.34: Percentage mortality of acetone extracts of selected lichen species from District Mansehra...... 273

Fig. 4.35: Percentage mortality of methanol extracts of selected lichen species from District Mansehra...... 273

Fig. 4.36: Percentage tumor-inhibition of acetone extracts of selected lichen species from District Mansehra...... 276 Fig. 4.37: Percentage tumor-inhibition of Mathanol extracts of selected lichen species from District Mansehra. 276

Fig. 4.38: Antioxidant activity of acetone extracts of selected lichen species from District Mansehra...... 280

Fig. 4.39: Antioxidant activity of methanol extracts of selected lichen species from District Mansehra...... 280

xix

LIST OF PLATES

Plate Page No.

Plate 1.1a: A. Sub-mountain forests, Trappi B. Mountain sub-tropical forests, C. Moist Temperate Forest Dhor, District Mansehra...... 5

Plate 1.1b: D. Sub- alpine forest, Paya E. Sub-alpine pasture, Khori (Musa ka Musalla) F. Cold desert, Malika Parbat, District Mansehra...... 6

Plate 3.1: A. Acarospora heufleriana, B. Acarospora impressula, C. Acarospora veronensis (scale= 1 cm) in District Mansehra...... 75

Plate 3.2: Arthonia radiata (scale= 1 cm) in District Mansehra...... 78

Plate 3.3: A. Arthopyrenia cinereopruinosa, B. Arthopyrenia punctiformis (scale= 1 cm) in District Mansehra...... 82

Plate 3.4: Candelaria concolor (scale= 2 cm) in District Mansehra...... 90

Plate 3.5: A. Candelariella aurella (scale= 1 cm), B Candelariella efflorescens, C. Candelariella reflexa (scale= 2 cm) in District Mansehra...... 91

Plate 3.6: A. Candelariella vitellina (scale= 1 cm) , B Candelariella xanthostigma (scale= 2 cm) in District Mansehra...... 92

Plate 3.7: Catillaria lenticularis (scale= 2 cm) in District Mansehra...... 95

Plate 3.8: A. Cladonia caespiticia, B. Cladonia fimbriata, C. Cladonia floerkeana (scale= 2 cm) in District Mansehra...... 103

Plate 3.9: A. Cladonia pocillum, B. Cladonia pyxidata (scale= 2 cm) in District Mansehra...... 104

Plate 3.10: A. Collema flaccidum B. Collema furfuraceum, C. Collema subflaccidum (scale= 2 cm) in District Mansehra...... 114

Plate 3.11: A. Leptogium burnetiae, B. Leptogium cyanescens, C. Leptogium hildenbrandii, D. Leptogium saturninum (scale= 2 cm) in District Mansehra...... 115

Plate 3.12: A. Graphis elegans, B. Graphis scripta (scale= 2 cm) in District Mansehra...... 119

Plate 3.13: A. Lecanora albella, B. Lecanora argentata, C. Lecanora cenisia (scale= 2 cm) in District Mansehra...... 138

Plate 3.14: A. Lecanora pseudistera, B. Lecanora pulicaris, C. Lecanora rupicola (scale= 2 cm) in District Mansehra...... 139

Plate 3.15: A. Lecidella euphoria, B. Lecidella stigmatea (scale= 0.5 cm) in District Mansehra...... 140

Plate 3.16: A. Rhizoplaca chrysoleuca, B. Rhizoplaca melanophthalma C. Rhizoplaca peltata (scale= 0.5 cm) in District Mansehra...... 141

Plate 3.17: Porpidia crustulata (scale= 2 cm) in District Mansehra...... 144

Plate 3.18: Tephromela atra (scale= 0.5 cm) in District Mansehra...... 154

Plate 3.19: Nephroma parile(scale= 1 cm) in District Mansehra...... 157

Plate 3.20: Canoparmelia texana (scale= 2 cm) in District Mansehra...... 181

Plate 3.21: Flavoparmelia caperata (scale= 2 cm) in District Mansehra...... 182

Plate 3.22: A. Flavopunctelia flaventior, B. Flavopunctelia soredica (scale= 2 cm) in District Mansehra...... 182

Plate 3.23: Parmelia sulcuta (scale= 2 cm) in District Mansehra...... 183

Plate 3.24: A. Peltigera horizontalis, B. Peltigera polydactylon, C. Peltigera rufescens (scale= 2 cm) in District Mansehra...... 189

Plate 3.25: Peltula obscurans (scale= 2 cm) in District Mansehra...... 191

xxi

Plate 3.26: Pertusaria leioplaca (scale= 2 cm) in District Mansehra...... 194

Plate 3.27: Amandinea punctate (scale= 1 cm) in District Mansehra...... 211

Plate 3.28: A. Anaptychia crinalis, B. Anaptychia runcinata (scale= 1 cm) in District Mansehra...... 212

Plate 3.29: Buellia stellulata (scale= 0.5 cm) in District Mansehra...... 212

Plate 3.30; A. Phaeophyscia ciliate, B. Phaeophyscia endococcina C. Phaeophyscia orbicularis (scale= 0.5 cm) in District Mansehra. .. 213

Plate 3.31: Physconia muscigena (scale= 1 cm) in District Mansehra...... 214

Plate 3.32: Psora decipiens (scale= 2 cm) in District Mansehra...... 217

Plate 3.33: Ramalina sinensis (scale= 2 cm) in District Mansehra...... 226

Plate 3.34: A. Bacidia laurocerasi, B. Bacidia rosella, C. Bacidia rosella (scale= 2 cm) in District Mansehra...... 227

Plate 3.35: A. Rhizocarpon geographicum (scale= 2 cm), B. Rhizocarpon lecanorinum (scale= 0.5 cm), C. Rhizocarpon viridiatrum (scale= 2 cm) in District Mansehra...... 232

Plate 3.36: Lepraria elobata (scale= 2 cm) in District Mansehra...... 234

Plate 3.37: A. Caloplaca cirrochroa, B. Caloplaca decipiens, C.Caloplaca teicholyta. (scale= 0.05 cm) in District Mansehra...... 244

Plate 3.38: A. Diploschistes diacapsis, B. Diploschistes muscorum, C. Diploschistes scruposus (scale= 1 cm) in District Mansehra...... 249

Plate 3.39: Lasallia papulosa. (scale= 0.5 cm) in District Mansehra...... 254

Plate 3.40: A. Catapyrenium cinereum, B. Dermatocarpon miniatum, C. Endocarpon pusillum (scale= 0.5 cm) in District Mansehra...... 261

Plate 3.41: Verrucaria muralis (scale= 2 cm) in District Mansehra...... 262

xxii

LIST OF SYMBOLS/ABBREVIATIONS

% Percentage + Positive _ Negative ℃ Degree centigrade µg Micro-gram µL Micro-liter Aa Ascorbic acid Aca Acarosporaceae Alt Altitude Art Arthoniaceae Can Candelariaceae Cat Catillariaceae Cd Caloplaca decipines Cf Collema flaccidum Cld Cladoniaceae Col Collemataceae Cort Corticolous Cp Cladonia pyxidata Crus Crustose Dm Dermatocarpon miniatum DMSO Di methyl Sulfoxide DPPH 2,2-diphenyl-1-picrylhydrazyl. Fc Flavoparmelia caperata Ff Flavopunctelia flaventior Fig Figure Foli Foliose Frut Fruticose Gra Graphidaceae

xxiii

Gra Graphidaceae HUP Hazara University Pakistan KPK Khyber Pakthunkhwa La Lecanora allophana Lec Lecanoraceae Lepr Leprose Meg Megasporaceae Musc Muscicolous Myc Mycoblastaceae Min Minute Par Parmeliaceae Pel Peltigeraceae Per Pertusariaceae Phy Physciaceae Pp Peltigera polydactylon Ram Ramalinaceae Rhi Rhizocarpaceae Rv Rhizocarpon viridiatrum Saxi Saxicolous Squa Squamulose Tel Teloschistaceae Teri Tericolous Uf Usnea fulvoreagens Ver Verrucariacea

xxiv

ABSTRACT

The present study was designed to explore the biodiversity of lichen species in District Mansehra, Khyber Pakhtunkhwa, and hunt potential extracts with high biological activities. For this purpose, species diversity of lichens in the study area was explored from January 2012 to July 2015. The study recorded 110 lichen species distributed within 27 families and 56 genera from research area. Twelve novel lichens species were also identified as new to Pakistan including Acarospora veronensis A. Massal., Anaptychia crinalis (Schleich.) Vezda, Candelariella efflorescens R.C. Harris & W.R. Buck, Cladonia caespiticia (Pers.) Flörke, Cladonia floerkeana (Fr.) Flörke, Lecanora chlarotera Nyl., Lecanora pulicaris (Pers.) Ach., Lepraria elobata Tønsberg, Nephroma parile (Ach.) Ach., Punctelia subrudecta (Nyl.) Krog, Rhizocarpon lecanorinum Anders and Trapeliopsis granulosa (Hoffm.) Lumbsch. Additionally, another remarkable milestone was the identification of 59 lichen species belonging to 17 families and 35 genera for the first time in District Mansehra, Khyber Paktoonkhawa. Most abundant were crustose lichens consisting of 51 species (46.36%) while foliose lichens comprised 11 species (42.72%). On the basis of hosted substrate, 43 species (39.09%) were found on bark followed by 42 species (38.18%) on rocks and 12 species (10.9%) on soil. The distribution percentage of lichen species in various habitats showed that 55 lichen species (50%) were Corticolous followed by saxicolous with 42 species (38.18%), tericolous with 12 species (10.9%) and muscicolous having only one species (0.9%). The leading lichen family was Parmeliaceae with 12 genera (10.90%) followed by Physciacea with 7 genera (6%), Teloschistaceae and Verrucariaceae with 4 genera (3.63%) each. In present study, among the 110 identified lichens species, 63 lichen species (57.27%) were macro-lichens while remaining 47 species (42.72%) were micro-lichens. For biological assays, antibacterial potential of crude acetonic and methanolic extracts of ten lichen species was assessed

xxv against Gram+ve and Gram-ve bacteria. The maximum zone of inhibition (12.66 mm) for acetone extracts were shown by Flavoparmelia caperata, Lecanora allophana and Cladonia pyxidata against Escherichia coli (ATCC_39111), Enterococcus faecalis (ATCC-19433) and Staphylococcus aureus (ATCC_33591). However, crude methanol extracts exhibited a slightly lower action of lichen species Flavoparmelia caperata and Rhizocarpon viridiatrum (inhibition= 12.33 mm) against E. coli. Similarly, the maximum antifungal activity for crude acetone extracts of ten lichen species were shown by Caloplaca decipine and Flavoparmelia caperata (11.66 mm) against Aspergillus niger (ATCC_16888) and A. fumigatus (ATCC_16424) while for methanol extract, maximum activity were shown by Flavoparmelia caperata and Lecanora allophana (10.66 mm) against A. fumigatus and A. niger. Cytotoxicity of crude acetone and methanol extracts of the tested lichen species were evaluated by Brine Shrimp lethality assay. The maximum cytotoxic effect of crude acetone extract was recorded for Flavopunctelia flaventior (60%) while maximum cytotoxic effect in crude methanol extract was shown by Flavoparmelia caperata (53%). Antitumor activity of crude aetone and methanol extracts of ten selected lichen species were determined by potato disc bioassay. The highest tumor inhibition in crude acetone extract was shown by Flavoparmelia caperata (40%) while in crude methanolic extracts maximum tumor inhibition was shown by Flavopunctelia flaventior (38%). The highest free radical scavenging activity for crude acetone extract was manifested by Cladonia pyxidata (66%) while in crude methanol extract; maximum activity was shown by Rhizocarpon viridiatrum (57%). The present research will be helpful in the documentation of lichen flora of District Mansehra. It is expected that the present work on diversity and biological activities of lichens of District Mansehra will be helpful not only for identification of lichen species but also in opening up Pakistan unique lichen flora for further study.

xxvi

Chapter 1

INTRODUCTION

1.1 Study Area

District Mansehra, also known as Takht-e-Hazara, is the northeastern district of Khyber Pakhtunkhwa, Pakistan.

1.1.1 Geography

Mansehra District covers an area of 4,579 km2 and lies from 34°-14´ to 35°- 11´ north latitude and 72°- 49´ to 74°- 08´ east longitude in Hazara Division. Kohistan and Batagram Districts are located in the north, Muzaffarabad District in the east, Abbottabad and Haripur Districts in the south and Shangla and Buner Districts in the northwest. District Mansehra is administratively divided in to five tehsils viz., Mansehra, Oghi, Balakot, Bafa Phakal and Darband (Fig. 1.1) (Anonymous, 1998, 2005, 2011; Mazari et al., 2012; Syed et al., 2012).

1.1.2 Climate

There are two distinct seasons, summer and winter season in Mansehra District. For the most part of District Mansehra, climate is pleasant warm in the summer (April-September) and very cold in the winter (October-March). The northern parts of district, like Kaghan Valley, face severe winters, receiving heavy snowfall. Average temperatures in the district ranges from 2 °C to 36 °C; November-February being the coldest months (Anonymous, 2005, 2011; Awan et al., 2011).

Fig. 1.1: Administrative Map of the District Mansehra, Pakistan.

1.1.3 Rivers

Siran and Kunhar are the two main rivers of District Mansehra (Syed et al., 2012). River Siran starts in the north of Bhogarmang and flows through Bhogarmang and Pakhli plain and runs for some 130 km when it falls in to river Indus at Tarballa (Anonymous, 2005; Shah and Khan, 2006). River Kunhar starts from Lulusar Lake of the Kaghan Valley at 3,455 m above sea line and after flowing through 180 km falls into river Jehlum (Anonymous, 2005; Khan et al., 2011).

1.1.4 Lakes

District is famous for its nine beautiful lakes located at different point in Kaghan Valley, also known as “Land of Lakes”. Saif-ul-Maluk, Ansoo lake, Dhodipatsar lake and Lulusar lake being prominent (Anonymous, 2005).

1.1.5 Forests Types

District Mansehra is famous for its natural beauty and natural forests (Shabaz et al., 2012); covering an area of 332,252 ha. Forests in district are generally categorized as sub-mountain forest, mountain subtropical forests, mountain temperate forests, sub-alpine forests, alpine scrubs and pastures and Cold deserts (Husain and Ilahi, 1991).

Sub-mountain forests are located in Mansehra, Tanawal and Darband area with Accacia, Periploca, Olea, Dodonea, Justicia and Otostegia being key plant species. Mountain Sub-tropical forests are distributed at 1000 - 1900 m and are located in Shinkiari, Tanawal, Oghi, Dhodial, Balakot and Garhi Habib Ullah areas. The main plant species in this type of forest include, Accacia, Dodonea, Olea and Pinus roxbergii.

Mountain temperate forests are distributed at 1450 - 3500 m mainly in Kaghan, Naran, Shogran, Mandagucha, Batal and Manoor areas. Pinus willichiana, Querqus, Juglans, Prunus, Rhododendron, Papulus, Cedurs, Ulnus, Cornus and Pyrus are the major plant species in this forest type.

Sub-alpine forests are distributed at 3182 - 3788 m and are fall in Musa Ka Musala, Lalazar, Paya and Shogran upper areas, Batakundi and Kaghan areas. Key plants are Rhododendron, Vibernum, Juniper, Ephedra Salix and Betula.

Alpine scrubs and pastures are located at 3789 - 4546 m in Musa ka Musala, Makra Peak and Batakundi areas. Key plants are Salix, Rhododendron, Junipers and Polygonum.

Cold deserts are located in the north-eastern parts of Mansehra, falling at > 4546 m and fall in Manoor Gali, Malika Parbat, above Ansoo lake, Ratti Gali areas. Major plant species are Sedum, Oxyria, Sibaldia, Primila, Oxytropis, Potentila and Thilaspia (Plate 1.1 a, b).

Plate 1.1a: A. Sub-mountain forests, Trappi B. Mountain sub-tropical forests, C. Moist Temperate Forest Dhor, District Mansehra.

Plate 1.1b: D. Sub- alpine forest, Paya E. Sub-alpine pasture, Khori (Musa ka Musalla) F. Cold desert, Malika Parbat, District Mansehra.

1.2 Lichens

1.2.1 General Structure

Symbiotic association between photobionts and mycobionts form important group of non-vascular cryptogams, called Lichens. Lichens get attention because of their position in evolutionary history of land plants and pioneer colonizer of terrestrial and inhospitable environment (Matsunage et al., 2013). This symbiotic association between algae and fungi individuals to survive desiccation and oxidative stress with increased reproductive success (Killmann, 2005). Both organisms in this association undergo different structural, physiological and biochemical changes, which prominently occurs, in the reduction of cell size, reproduction mode and in the structure of different cell organelles (Paksa and Skaloud, 2008). Some lichens are composed of green photobiont and cynobionts which are called tripartite or cynolichens (Caldiz, 2005). The cynolichens contain nitrogen fixing bacteria which provide important source of nitrogen to nitrogen deficient ecosystem (Green et al., 1980). Lichens are quite different from their associated organism and normally these are classified based on their fungal partner (Karunaratne, 2005; Honegger, 2008). The fungal partner of lichen develops the main plant body (thallus) and other fruiting structure of lichen and that are nearly 20% of all known fungi (Sanders, 2001; Kirk et al., 2008). Only about 100 photobiont species have been recorded in this association with more than 13,500 lichens forming fungal species, so many mycobiont share the same photobiont. More than 99% of these highly diverse groups of lichen forming fungi belong to Ascomycota while less than 1% of the species recorded within Basidomycota. Large majority of lichen species reported from world have photobiont in the form of green algae and some 10% belong to cyanobacteria (Negi, 2003; Temina et al., 2005). The most important cynobacterial species of lichen photobionts include representative of Nostocales, Chroococcales, Pleurocapsales and

Stigonematales (Friedl and Budel, 2008). Trebouxia and Trentepohila of green algae and cynobacteria are common photobiont that take part in this assoaction (Lutzoni and Miadlikowsk, 2009).

1.2.2 Occurrence and Distribution

Lichens are cosmopolitan in distribution and grow in harsh environmental condition where other organisms are not able to grow (Halcomb, 2010). They are widely distributed in all climatic zones of the earth surface and dominate more than 8% of terrestrial habitat (Muggia et al., 2010). Geographic location, distance to sea, wooded meadow area and average tree circumference are important determinants of lichen species composition (Jansson et al., 2011). This unique group is able to grow on rocks, soil, bark, leaves of trees and also on the shells of many insects and turtles (Kumar, 2010). They have ability to survive in extreme environmental conditions of temperature, moisture and low availability of nutrient (Armstrong and Welch, 2007). Lichens also have the ability to utilize fog and dew as source of water. About 20,000 species of lichen have been reported from the world and distributed in wide range of habitat dominant terrestrial ecosystem (Kumar et al., 2010). Aptroot and Iqbal (2012) reported 368 lichen species from Pakistan.

1.2.3 Climate

Lichens are slow growing organism with an average rate of 1-5 mm per year (Negi, 2003). These are able to grow on almost any undisturbed surface and in climatic condition ranging from top of mountains to low tide sea shores and from arctic to tropical regions (Ahmadjian, 1993; Desbenoit et al., 2004). Climatic conditions along with several other variables affect the distribution of lichen on large scale (Marmor et al., 2011). In temperate region their growth strongly depends upon air humidity and seasonal variation (Caldiz, 2005). As poikilohydric in nature lichens directly absorb

water from atmosphere and higher fungal content of thallus are limiting factor responsible for slow growth rate of lichens (Green et al., 1980). Lichens are highly sensitive to microclimatic changes and any man-made and natural disturbance affect the population of lichens (Kumar, 2010). During unfavorable climatic condition lichen are able to shut down their metabolic activities and withstand extreme condition of heat, cold and drought (Desbenoit et al., 2004). On the availability of favorable condition lichens absorbed water from surrounding environment and become active within few minutes (Negi, 2003).

1.2.4 Morphology and Growth Form

The main plant body of lichens is known as thallus which comparable to vegetative portion of other cryptogams, like mosses and liverworts. The fungal component of this symbiotic association forms the main thallus of lichen while algal part sandwich between the upper and lower fungal layers (Gilbert, 2004). Lichen Ascomycetes often exhibit complex morphology of vegetative thallus that are usually not found in non lichenzoid fungi. These include the thallus organization and other structure associated with main thallus, like cilia and rhizines. These characters are widely used in taxanomy at generic level (Divakar et al., 2006). Lichens are able to grow on various substrates in diverse climatic conditions include rocks, soil, wood, branches, tree trunk, animal bones, insects shells, plastic and building materials (Wolseley and Hudson, 1995; Negi, 2003). On the basis of thallus morphology, lichens are divided into three main forms viz., crustose (closely attached to substrate), foliose (loosely attached to substratum by holdfast like rhizines and hapter), and fruticose (attached to substratum by single hold fast) (Nayaka, 2007; Kumar, 2010).

Lichens are also characterized on the variety of vegetative structures i.e. on upper and lower surfaces of the thallus such as presence of finger like projections (isidia), granular powder in groups (soredia), fine powder (pruina), black dots (pycnidia) and whitish decorticated areas (pseudocyphellae), presence or absence of rihizines (root like structures).

1.2.5 Chemistry

Lichen produces different metabolites viz., primary metabolites and secondary metabolites. Primary metabolites included carbohydrate, lipid, protein and other organic compounds. Secondary metabolites are in amorphous and crystalline forms, produced by the fungus partner (Mitrovic et al., 2011 a, b). Secondary metabolites are the compound of relative low molecular weight, insoluble in water and usually extracted in organic solvent. Lichens produce various types of secondary metabolites that are unique to lichens. These compounds are produced by three major metabolic pathways and have important role in chemotaxonomy of lichen species (Wolseley and Hudson, 1995; Huneck, 1999). These secondary metabolites are phenolic compound, usnic acid, quinins, depsidones, deposones and pulvinic acid derivatives etc. Their amount ranges from 0.1 to 1% of the dry weight of the thallus and sometime reaches upto 30% (Galun, 1988; Rankovic et al., 2011). These compounds protect lichens from harmful irradiation and from microorganism, as source of minerals in stress condition and increase cell wall permeability of algae (Huneck, 1999). Over 1050 lichen compounds have been isloted from differet lichen species having important role in chemotaxonomy and systematic studies of lichens (Molnar and Farkas, 2010).

1.2.6 DNA Barcoding

Identification of lichen on the basis of morphological and chemical characterization is time consuming and also requires training and

experience for accurate identification. Furthermore, phenotypic basis of identification of species in some case misrepresent the species diversity. DNA barcode may be used as effective alternative tool to phenotype based identification of species. This technique provides correct identity of the specimens that lack morphological and chemical characters needed for taxonomic identification (Begerow et al., 2010).

DNA barcoding uses specified DNA sequence for taxonomic identification of specimen at cellular level (Blaxter et al., 2005). The usability of DNA barcoding, as major tool for identification, largely depends on the development of high quality sequence database, thoroughly curated by taxonomist and systematists (Kelly et al., 2011). The molecular based species identification has been shown to be highly effective in cases where taxonomy is well studied and reference database has been generated. The reference DNA barcoding of lichens is not avialble for for most taxa and geographic regions of lichens. The application of DNA identification may be particular important in case where user may not have access to expertise or reference materials necessary to make accurate identification. Despite the potential limitation and challenges to DNA based identification of lichenized fungi, molecular sequence data will most likely play important role in accelerating the inventory and analysis of species diversity in lichen communities

1.2.7 Economic Importance

Lichens are economically very important and are used in many industries, like cosmetic, perfume and as dyeing in textile industry (Negi 2003; Muggia et al., 2009). Their dye produces musky odour and giving insect proofing quality to the fiber (Shukla et al., 2014). Due to shortage of food, lichens are used as important source of food during winter seasons (Redzic et al., 2010). In Yunnan Province (China) people use lichen as food

and health promoting tea (Wang et al., 2001). Compound from lichens, such as pulvinic acid derivatives, contain relatively high nitrogen content, making them a valuable source of food (Karunaratne et al., 2005). In southern part of India local people use lichen as fodder for their livestock. Lichen species with cynobacterial algae as primary symbiont extensively contribute for forest nitrogen fixation (Slack, 1988). These lichens are also used as green organic manure (Negi, 2003). Lichens are highly sensitive to air pollution and therefore extensively used as tool to monitor level of pollution in area (Negi, 2003; Shah, 2013). Lichens are important part of traditional medicines and used for treatment of many human and animal diseases (Mitrovic et al., 2011 a, b). In Asia, Europe and Africa species of Usnea are used for fever control and pain relief while decoction of Usnea barbata are used for the treatment of wound in South Africa (Okuyama et al., 1995; Madamombe and Afolayan, 2003). Many lichen species have reportedly shown antibacterial, antifungal and anticancer activities in-vitro (Kosanic and Rankovic, 2010; Mitrovic et al., 2011 a, b).

1.2.8 Biological Activities

Secondary metabolites of lichens have remarkable antibacterial, antiviral, antifungal, antioxidant and antitumor activities (Esimone and Adikwu, 1999; Mitrovic et al., 2011 a, b). These bioactive compounds of natural origin are different from synthetic drugs and have no side effects. Various studies conducted in different parts of the world recorded the biological activities of the lichens secondary compounds (Hara et al., 2011). Due to their biological activity many Native American, Indian and European use lichens in their traditional medicines for treatment of many animals diseases (Karthikaidevi et al., 2009). Slow growth rate, identification of species and collection of enough material are the problems due to which little work have been done on biological activities of lichens (Boustie and Grube, 2005).

1.2.8.1 Antibacterial Activity

Infectious diseases caused by bacteria remain a major threat to public health, despite tremendous progress in human medicine (Kumar et al., 2010). Lichens represent powerful source of bioactive compound but pharmaceutical industries has given little attention to these because of their slow growth. Lichen metabolites have manifold biological activity. A few decades after the introduction of antibiotics in clinical practice, resistance by pathogenic bacteria has become a major health concern (Tabarez, 2004). According to wide screening of antimicrobial activities it seem that bacterial inhibition can vary within lichen species, solvent used and bacteria tested (Mitrovic et al., 2011 a, b).

1.2.8.2 Antifungal Activity

Fungi are ubiquitous in the environment, and infection due to fungal pathogens has become common. In plants many pathogenic fungi are main infectious agents responsible for alterations during developmental stages including post-harvest (Ribera and Zuniga, 2012). Many pathogenic fungi are responsible for causing infectious diseases, both in human and animal (Shahi et al., 2012). Several antifungal agents can be used to manage these infections (Blazekovic et al., 2011).

1.2.8.3 Plants Cell Carcinogenesis

Plant Cancer, a disease of uncontrolled growth and spread of abnormal cells, is one of the main diseases caused by the bacterium Agrobacterium. That disease can affect a wide range of plant including woody ornamentals, tree fruits, and small fruits. Plant Cancer also occasionally affects few herbaceous ornamentals and vegetable crops is one of the most dangerous diseases for nursery production of these and many other plants. In some previous studies secondary metabolites of many lichen species were assessed against cancer cell in humans and animal.

Most of these secondary metabolites have reportedly shown anticancer activity. (Rezanka et al., 2006; Trigiani et al., 2009; Nguyen et al., 2014)

1.3 Study Objectives

Lichen flora of Pakistan is little known and available literature provides casually prepared checklists for some localities of Pakistan (Hawksworth and Mahmood 1971; Shaheen and Iqbal, 1978; Aptroot and Iqbal, 2011). In order to assess lichens resource of Pakistan detail documentation is eminently required. The objectives of the present study therefore include:

 To explore the lichen diversity of District Mansehra

 To study the distribution of lichen in study area

 To test the potential species for antibacterial, antifungal, antioxidant and anticarcinogenic activities

Chapter 2

REVIEW OF LITERATURE

2.1 Species Diversity and Distribution

Lichens grow on wide variety of natural and manmade substrates, obtaining nutrients and water directly from the atmosphere. Lichens and mosses are dominating component of terrestrial ecosystem but their study is still neglected throughout the world. Linnaeus (1753) first published a list of 80 lichen species in “Species Plantarum under 24th class of cryptogamie-algae”. The extensive exploration of lichens flora in the 19th and the 20th century from different parts of Asia, America and Africa caught attention of lichenogisted.

Various studies recorded the occurrence of lichen species from different parts of Africa. Almborn (1989) listed nine lichen species distributed within genus Teloschists from central and southern parts of Africa, of which four species were endemic to Africa. Similarly, a study listed the occurrence of 27 lichen species from Gambia as new to the country while Caloplaca gambiensis were reported as new to science. Another study described 69 lichen species as new to Rwanda and Catillaria alba, Chaenotheca stemonea and Parmotrema neotropicum listed as new to Africa (Aptroot, 2001; Killmann and Fischer, 2005). Zedda et al. (2009) listed 37 taxa of epiphytic lichens from Savannh biome of Namibia, of which 24 species were recorded as new to Namibia while two species were new to Africa.

The lichens diversity of Europe was explored through various studies conducted in different parts of the continent. A study listed 262 lichen species from Swiss plateau and Pre-Alps area, of which 14 species were reported as new to Switzerland (Dietrich and Scheidegger, 1997).

Anne (1998) described the occurrence of 170 lichen species belonging to more than 70 genera from northeast Olympic and north Cascade regions. Sipmaned and Raus (2002) reported 209 lichen species from Greece, of which 12 species were new to Greece and four species were new to science. Another study listed 232 epiphytic lichen species from Estonia natural forest, of which 10 species were included in the list of Estonia red data book (Jurido et al., 2003). Similarly, 170 lichen species were recorded from islands in the Russian part of the Gulf of Finland (Alexeeva, 2005). Blinkova and Urbanavichus (2005) listed 389 lichen species from Teberda State Biosphere Reserve of the Great Caucasus mountain range, of which three species viz., Aspicilia szechenyi, Bacidina delicate and Rhizocarpon carpaticum were reported as new to Russia. Marmor et al. (2011) recorded the distribution and diversity of 151 epiphytic lichen species from spruce and pine trees in old coniferous forests of Estonia.

Like other parts of the world, lichen diversity in Asia was explored and described through various studies in different regions. A study listed the occurrence of 110 lichen species from Tibetan plateau, of which some were recorded as new to the area. In another study 21 lichen species were reported as new to Khorasan Province of Iran, of which two genera and nine species were new to Iran (Obermayer, 2004; Moniri et al., 2005).

Studies on lichen flora of Turkey listed the occurrence and distribution of lichen species from different localities of the country. An inventory listed 215 lichen species and eight lichenicolous fungi distributed within 63 genera from Erciyes mountain, of which six taxa were reported for the first time from Turkey. Another study listed 73 species of saxicolous and terricolous lichens distributed within 27 genera from Sirvan Mountain Kayseri, of which 3 taxa were reported for the first time from Turkey. Similarly, 161 lichen species were listed from Termesses National Park, southern Turkey, of which Collema conlomeratum, Lecania inundata,

Leptogium furfuraceum, Peltigera monticola and Physconia servitii were reported as new to Turkey (Halici et al., 2005; Halici and Aksoy, 2006; Tufan et al., 2006).

Altitude is one of the main factors effecting the diversity and distribution of epiphytic lichens. Various studies listed the occurrence and distribution of epiphytic lichen species at different altitude ranges from Turkey. A study described the occurrence of 24 species of epiphytic lichen at 900-1400 m from Bursa. An inventory listed 52 epiphytic lichen species growing on Cedrus libani trees at 1300-1900 m from Elmali research forest. Occurrence of 48 epiphytic lichen species were reported, distributed at 1500-1900 m in Bursa (Cobanoglu and Sevgi, 2009; Ozturk et al., 2010; Ozturk and Guvence, 2010).

Different studies were conducted to explore the lichen diversity from different parts of North and South America. An inventory listed 288 foliicolous lichens species from Mexican lowland and montane rainforest, of which 238 were reported for the first time from the study area, and some 6% of reported lichen species were recorded as new to the country (Herrera et al., 2004).

Some other studies explored the occurrence and distribution of lichen species from Greenland. An inventory described the occurrence of 117 lichen species from Uummannaq area, of which Aspicilia myrinii recorded as new to Greenland. Similarly, another study listed 189 lichen species from two localities of Nuussuag Peninsula. Another inventory described 42 lichen species and two genera viz., Lepraria and Leprocaulon, from Greenland (Hansen, 2007; Saag et al., 2007; Hansen, 2009).

Rosato (2006) described 33 lichen species growing on mortars and concert from Buenos Aires Province, one species reported as new to Argentina. Twenty one (21) species of epiphytic lichen, growing on tree

trunks were listed from rainforest of Gran Piedra, of which three were recorded as new to Cuba (Rosabal et al., 2010). Quilhot et al. (2012) described 319 lichen species belonging to 87 genera from oceanic to steppe area of Aisen, southern Chile. Occurrence of 145 species of lichen were recorded from Joshua Tree National Park, California, of which four were reported for the first time to California and Sarlogyne mitziae as new record to science (Knudsen et al., 2013). An inventory described 193 epiphytic lichen species during investigation of epiphytic lichen diversity in riparian forest of Brazil (Kaffer et al., 2016).

The documentation of lichens flora of South Sister, Northeastern Tasmania, reported 234 lichen species from Tasmania, of which 16 were reported for the first time from the area. Occurrence of 15 species of lichens belonging to genus Peltigera were recorded from Papua New Guinea, of which six were recorded as new to science (Kantvilas et al., 2008; Serusiaux et al., 2009).

During pre-independence period European doctors, botanists and other defense persons initiated lichens exploration in Indian Subcontinent. Awasti (1965, 1988 and 1990) published catalogue consisting of 1,310 species belonging to 150 genera from India, Pakistan and Sri Lanka and prepared keys of macro-lichens and micro-lichens of the area. Nayaka et al. (2001) listed 99 lichen species, of which 74 species were corticolous, from Meghamalai Wildlife Sanctuary, Tamil Nadu, India. Folicolous lichens are special group of lichens that usually colonized leaves of trees. Folicolus lichens are widely distributed in wet or moist, humid and foggy tropical and subtropical forests (Pinokiyo and Singh, 2006; Singh et al., 2006). Some studies on folicolous lichens of India described the occurrence of 21 species of lichens genera Porina and 91 species of folicolous lichens from Arunachal Pradesh, India (Pinokiyo et al., 2004), while two new species and two new varieties were reported from Eastren India (Pinokiyo et al., 2008).

Rout et al. (2010) described 55 lichen species and 15 families from Reserve forests of southern Assam, of which Graphidacea and Pyrenulaceae were dominant families comprising more than 50% of the total lichens population. Another study listed 48 lichen species, belonging to 23 genera and 12 families, from Tamil Nadu, of which three genera viz., Heterdermia, Parmotrema and Pertusaria, dominated (Kumar et al., 2011). Similarly, 111 lichen species belonging to 41 genera and 22 families were recorded from Western Ghats, of which 101 species were corticolous. Another study recorded six macrolichen species from Karnataka as new to lichens flora of India (Vinayaka, 2011; Vinayaka et al., 2012).

Shetty et al. (2012) described 29 lichen species occurring on mangrove plants from Andaman Islands, of which 14 were reported as new to the study area and five species were recorded for the first time from India. Similarly, 37 epiphytic lichen species belonging to 16 genera and 10 families were recorded on Areca catechu trees from pristine habitats in southern Assam, of which Graphidacea was recorded as dominant family representing 13 species followed by Trypetheliaceae comprising six species (Rout et al., 2012).

The occurrence of 137 lichen species was reported from different vegetations within Bolampatti II Forest range in Tamil Nadu, of which 58 lichen species were listed for the first time in the study area (Balaji and Hareharan, 2013). Similarly, 106 lichen species were described from Western Himalaya, while Parmeliacaea were reported as dominant in the study area (Gupta et al., 2014). Rana et al. (2015) listed 22 species of fruticose lichens belonging to four genera Usnea, Cladonia, Ramalina and Teloschistes from Arunachal Pradesh, of which 10 species were reported as new in the investigated area. Similarly, another survey listed 404 species of lichens distributed within 105 genera and 39 families from Arunachal Pradesh. During this investigation, 12 species were reported as new to

India (Singh et al., 2015). An inventory on lichens diversity listed a total 159 lichen species from Mizoram state, while 14 species were recorded for the first time in India (Logesh et al., 2015).

Dey et al. (2015) described the occurrence of 31 lichen species distributed within 16 genera and 11 families while Physciaceae was recorded as dominate family consisting of 9 species followed by Parmeliaceae family. Nine species of lichens belonging to six families were reported as new to Uttarkhand (Gupta et al., 2016). A survey conducted by Vinayaka et al. (2016) described 40 lichen species distributed within 18 genera and 15 families within an altitude range of 1100-1300 m in southern Western Ghats. Mishra et al. (2016) listed the occurrence of 246 lichen species distributed within 45 genera and 13 families from Uttarakhand, India. Similarly, 28 lichen species belonging to 9 families were listed from Madhya Pradesh, of which Physciaceae, Teloschistaceae and Verrucariaceae were recorded as dominant families (Uppadhyay et al., 2016).

A survey on lichen flora of Jammu and Kashmir listed 31 lichen species distributed within 19 genera and 13 families for the first time in Poonch. In another study, 279 lichen species comprising 79 genera and 33 families, of which Parmeliaceae and Physiaceae were reported as dominant families and Xanthoria, Cladonia, Lecanora and Caloplaca were the genera consisting of higher number of species (Khan et al., 2010; Haq et al., 2012). Kumar et al. (2014 a) listed the occurrence of four lichens species within 12 genera and 10 families from Ladakh, of which Endocarpon pallidum were reported as new record in the study area. Similarly, 44 species of lichens were listed as new addition to lichen flora of Jammu and Kashmir, of which corticolous lichens consisting of 25 species dominated the study area (Goni and Sharma, 2015).

Various studies were conducted on exploration of lichens from Nepal. Baral (2015), described the occurrence of 32 lichen species within 9 families and 10 genera from Phulchowki hills (Kathmandu Valley) in which Parmeliaceaea family was recorded as dominant family consisting of ten species. Another study conducted by Devkota (2008) listed the occurrence of 13 lichen species distributed within four families from Manaslu conservation area and 69 lichen species distributed within 15 families from Sagarmatha National Park, Nepal.

Similarly, explorations of lichens from Sri Lanka were also carried out in different parts of the country. Nayanakantha and Gajameragedara (2003) described the occurrence of 50 species distributed in 32 genera and 18 families from Kandy Municipal Region, Sri Lanka. In this study, crustose were recorded as dominate growth form followed by foliose and fruticose. Similarly, another study conducted by Silva and Senanayake (2015) listed 19 epiphytic species from Peacock hill, Pussellawa, Sri Lanka, of which 16 species were crustose and three species were foliose. Aptroot and Feijen (2002) listed 287 lichens and lichenicolous fungi from Bhutan, of which 225 species were reported as new to country.

So far, no prominant study on the diversity and distributom of lichen species has been reported from Pakistan. A survey conducted by Aptroot and Iqbal (2012) listed the occurrence of 368 lichen species from Pakistan.

2.2 Biological Activities of Lichens

In traditional medicines, many plant extracts having biologically active compounds are used. These compounds in extracts are evaluated for their biological activities through simple methods, like brine shrimp lethality assay (Pisutthanan et al. 2004). Large numbers of antibiotics are used in the treatment of bacterial infections, but due to their excessive use,

microorganism became resistance to these drugs. Investigation on natural antibiotic can help us to fight antibiotic resistant bacteria.

Generally, most of explored lichens have relatively strong antimicrobial activity which can be very important in treatment of various disease caused by microorganism. Manojlovic et al. (2002) evaluated the antimicrobial activity of lichen Caloplaca schaereri collected from Durmitor Mountain, Yugoslavia. The crude extract and anthraquinones of tested lichen were investigated against eight strains of bacteria and fungi. A study to investigate the antimicrobial properties of the extracts of Usnea barbata against fifteen different strains of fungi and bacteria, the acetone extract of the investigated lichen specie was recorded to have stronger inhibitory effect ranging from 51.60% to 100% on the growth of S. commune and A. alternaria at 10 mg/mL (Madamombe and Afolayan, 2003). Another study reported the antimicrobial activities of lichen Cetraria aculeate extracts in various solvents against different strains of bacteria and fungi. The acetone extract of the tested lichen showed highest activity against bacterial strains (Turk et al., 2003). Halama and Haluwin (2004) evaluated antifungal activity of lichen species Evernia prunastri, Cladonia portentosa and Hypogymnia physodes against eight plant pathogenic fungi. The extracts of E. prunastri and H. physodes showed strong effect on growth of P. ultimum, U. maydis and P. infestans while the extract of Cladonia showed less effect on growth of these fungi.

Balaji et al. (2006) conducted a study to on the antimicrobial properties of lichen species Roccella montagnei. Extracts of this species in different solvent were tested against six bacterial strains and one strain of fungi. The extract prepared in methanol showed maximum effect (zone of inhibition= 15-18 mm) on the growth of tested organism while no activity was recorded for acetone extract. Candana et al. (2006) investigated antimicrobial activity of Xanthoparmelia pokornyi against foodborne

bacterial strains. The extracts prepared in acetone, chloroform, diethyl ether, ethanol and petroleum ether were recorded active against the tested bacteria.

Karagoz et al. (2009) investigated the antimicrobial activity of aqueous and ethanol extracts of lichen species against eight bacterial strains. Both extracts of investigating lichen showed variable range of antimicrobial activity against the tested bacteria (zone of inhibition= 7-16 mm). The aqueous extract of lichen species Peltigera polydactyla (zone of inhibition= 14 mm) and ethanol extract of Ramalina farinacea, Rhizoplaca melanophthalma (zone of inhibition= 16 mm) were shown strong effect on growth of tested bacteria. The antibacterial activity of lichen species Roccella belangeriana was evaluated against 12 different strains of bacteria. The chloroform extract of the investigated lichens showed maximum (zone of inhibition= 29 mm) effect on the growth of Enterococci while minimum (zone of inhibition= 2 mm) activity were recorded for ethyl acetate extract against Klebsiella pneumonia (Karthikaidevi et al., 2009). Rankovic et al. (2009) evaluated the antimicrobial activity of acetone, methanol and aqueous extract of five lichen species against different strain of bacteria and fungi. The acetone and methanol extracts of three lichens; Hypogymnia physodes, Parmelia pertusa and Umbilicaria polyphylla were reported active and effect the growth of all tested organism.

Kumar et al. (2010) investigated the antibacterial activity of lichen Collema auriforme collected from Tamil Nadu, India. Acetone and alcohol extracts of the tested lichen species were evaluated against four bacterial strains. The study recorded zone of inhibition within range of 15 – 22 mm against E. coli, Staphylococcus sp. and Klebsiella. Similarly, another study conducted by Cobanoglu et al. (2010) on the antimicrobial activity of five lichen species against three bacterial strains by paper disc assay. The extract prepared in acetone showed slightly stronger effect (zone of

inhibition= 10.30 mm) on the growth of tested bacteria than chloroform (zone of inhibition= 10.20 mm). Similarly, another study recorded the antibacterial activity of lichen specimens collected from Luzon Island, Philippines. Extract of these specimen were evaluated against different strain of gram positive and gram negative bacteria. The study recorded that out of a total of 45 investigating extracts, only 38 extracts showed strong effect on growth of Gram-positive bacteria (Santiago et al., 2010). Baral and Maharjan (2011) investigated antimicrobial activities of lichen species Usnea longifolia, Cetraria sp., Parmotrema reticulatum and Evernastrium nepalense collected from Nepal. The extracts of investigating lichens were evaluated against eight human pathogen and five plants pathogenic. The study recorded that ethyl acetate extracts of E. nepalense and U. longifolia showed strong effect on growth of tested bacteria and fungi. Neeraj et al. (2011) recorded the antibacterial activity of seven secondary metabolites isolated from three different species of lichen. The extracts prepared in methanol, acetone, ethyl acetate and n-hexane solvent were tested against 11 different strains of bacteria. The investigation observed that ethyl acetate extract of lichen species in concentration of 10 µg/mL showed promised antibacterial activity. Another study conducted by Rankovic et al. (2011) on the acetone extracts of three lichen species for their antifungal, antibacterial and antioxidant properties. The study recorded stronger effect on growth of tested bacteria and fungi for lichen species Cladonia furcata while highest antioxidant activity was shown by the extract of Lecanora atra. The antimicrobial activity of lichen Roccella belangeriana collected from Gulf of Mannar, were tested against 14 bacterial and 3 fungal strains. The study reported maximum antibacterial activity for methanol extract against Vibrio cholera while stronger effects on fungal growth were recorded for chloroform extract against Aspergillus niger (Devi et al., 2011).

Sati and Joshi (2011) evaluated the antibacterial activity of Himalayan lichen Parmotrema nilgherrense against five different strains of bacteria. The chloroform extract of investigated lichen was reported active against all tested bacteria followed by methanol and ethanol extracts. A study was conducted by Sina and Biswas, (2011) to test the antibacterial activity of five lichen species collected at altitude range of 2438 m from Sikkim, India. The extracts of investigated lichens species were evaluated against five different strains of bacteria and reported that all lichens species show considerable effect on growth of tested bacteria. Maximum activity was recorded for methanol extract while aqueous extract of all evaluated lichens show no effect on growth of tested bacteria. Tiwari et al. (2011a) evaluated the acetone, methanol and chloroform extracts of five lichen species against various fungal strains. The study recorded that acetone and methanol extracts have strong inhibitory effect on growth of tested strains. Kekuda et al. (2012) conducted study on Antifungal and cytotoxic activity of Everniastrum cirrhatum (fr) Hale. Highest mortality of shrimps (100%) was observed in case of extract concentration 1,000 μg/mL.

Sharma et al. (2012) evaluated the antibacterial activity of five lichen species collected from Darjeeling hills in Eastern Himalaya of India. The extracts prepared in different solvents were tested against four bacterial strains. Methanol extract of the studied lichen was shown maximum effect on growth tested bacteria while a minimum growth effect was recorded for aqueous extract. Vidyalakshmi and Kruthika (2012) evaluated the potential effects of various extract of lichen Parmelia perlata against bacterial strain causing wound infections. Their study recorded that acetone, methanol and ethyl acetate extract of the investigated lichen species had significant inhibitory effects against Staphylococcus aureus. Shahi et al. (2012) investigated the antifungal activity of lichen Peltigera

practextata against different fungal strains causing infectious diseases. The study recorded that extract effected the growth of tested fungal strains. Rankovic et al. (2012) investigated the biological activities of two lichen species Toninia candida and Usnea barbata and their norstictic and usnic acid constituents. In this study, stronger antimicrobial activity was recorded for usnic acid.

Idamokoro et al. (2013) in their study investigated the methanolic and ethyle-acetate extracts of lichen Usnea barbata against 13 bacterial strains of Staphylococcus species. Both lichen extracts were recorded active and inhibited the growth (zone of inhibition= 10–34 mm) of most tested bacteria. Aydin and Kinalioglu (2013) collected Flavoparmelia caperata and Roccella phycopsis from Black Sea Region. The ethanol and methanol extract of these species were evaluated against sixteen strains of gram positive and gram negative bacteria by disc diffusion assay. The methanol extract of Flavoparmelia caperata showed stronger effect on growth of Bacillus cereus (zone of inhibition= 24.5 mm) while minimum activity was recorded for ethanol extract of Roccella phycopsis against Bacillus megaterium (zone of inhibition= 6 mm). Javeria et al. (2013) investigated antimicrobial activity of lichen species Parmotrema nilgherrense against some drugs resistance pathogen. The extracts within acetone, methanol, benzene and ethyl acetate were tested against six stains of drugs resistance bacteria. The study recorded that ethyl acetate extract of investigating lichen had highest (100%) antibacterial activity against Pseudomonas aeruginosa. Similarly, another study on antibacterial activity of some lichen species was conducted by Srivastava et al. (2013) in India. The acetone, ethanol and methanol extracts of investigating lichens were tested against six pathogenic bacteria.

Dorszynska et al. (2014) recorded the mechanism of antibacterial activity of lichen metabolite usnic acid against four different strains of

gram positive and gram negative bacteria. The tested extract of investigated metabolite was found to inhibit the synthesis of RNA and DNA in gram positive bacteria.

Basile et al. (2015) investigated the extract of lichen Xanthoria pariethina and its metabolite parietin for their antibacterial and antifungal activity. The extract and parietin from investigated lichen were recorded having strong antibacterial activity against tested bacteria. Similarly, another study conducted by Karabulut and Ozturk (2015) on antifungal activity of three lichen species Evernia prunastri, Pseudoevernia furfuracea var. furfuracea and Parmelia sulcata against plant pathogens. The extracts of investigating lichen were reported having variations in level of inhibition against tested organism. The study of Anjalli et al. (2015) recorded the antimicrobial activity of lichen Parmotrema tinctorum against ten bacterial and fungal strains in Eastern Ghats, India. The crude extract of investigating lichens showed maximum zones of inhibition against bacterial strains Escherichia coli (14.66 ± 0.57) and Bacillus subtilis (13.0 ± 2.99). Another study conducted by Prabhu and Sudha (2015) on antibacterial activity of acetone, methanol, chloroform and petroleum ether extracts of lichens against human pathogenic bacteria. All the investigated extracts were recorded to have strong effects on the growth of all tested microorganism.

Chahra et al. (2016) investigated the antibacterial activity of essential oil isolated from two lichen species Evernia prunastri and Ramalina frinacea against four different strains of bacteria. The investigated oil of lichen showed moderate activity against gram positive while lethal activity was reported against gram negative bacteria.

Antioxidants play an important role in prevention of human disease. The methanol and aqueous extracts of three lichen species were

investigated by Odabasoglu et al. (2004) for their antioxidant properties. Methanol extracts of lichen species Lobaria pulmonaria and Usnea longissima were recorded having strong antioxidant activity. Luo et al. (2006) investigated antioxidant activities of lichen Thamnolia vermicularis, collected at altitude of 4500 m from Yunnan province, China. Methanol extract of tested lichen were reported having higher free radical scavenging activity.

Mitrovic et al. (2011b) investigated lichen species Parmelia sulcata, Flavoparmelia caperata, Evernia prunastri, Hypogymnia physodes and cladonia faliacea for their antioxidant, antimicrobial and antiproliferative activities. The study recorded that the extract of Hypogymnia physodes had stronger DPPH radical scavenging effect. Similarly, another study by Hara et al. (2011) evaluated the antioxidant activity of 85 lichen species. The study recorded significant activities for species of Peltigera. Susithra et al. (2011) isolated antioxidant compounds from lichen species Usnea undulata. An effective radical scavenging activity by the extracts of SU-I was recorded at 80 µg/mL concentration. Kosanic and Rankovic (2011) prepared the extracts of five lichen species in acetone, methanol and aqueous solvents. Antioxidant activity was investigated by five different methods and strong activity was recorded for all the tested extracts.

Aydin and Turkez (2011) collected four lichen species from Erzurum and Artvin provinces, Turkey. The aqueous extracts of lichen Aspicilia calcerea, Cetraria chlorophylla, Dermetacarpon intestiniforme and Physcia aipolia were recorded to exhibited antioxidant activity. Melo et al. (2011) evaluated the toxicological activity of atranorin isolated from Cladonia kalbii lichen collected from northeastern Brazil which showed no significant acute toxicity or cytotoxicity. Kusumaningrum et al. (2011) screened bioactive compounds from the extract of Parmotrema tinctorum and toxicity was recorded by brine shrimp toxicity assay. Di-chloromethane extract of tested lichen in different concentration were recorded toxic to Artemia salina.

Ramamoorthy et al. (2012) evaluated the extract of Everniastrum cirrhatum in different concentration to record their cytotoxic effect. The investigated extract in concentration of 1000 μg/mL showed highest mortality rate (100%). Paudel et al. (2012) evaluated cytoxcity of 24 lichen species collected from Nepal. The toxicity of the investigated lichen in methanol was evaluated through brine shrimp lethality assay. The methanol extracts of Ramalina sp and Heterodermia sp. showed toxic effect comparable with standard berberine chloride. Manojlovic et al. (2012) investigated the methanol, chloroform and petrol ether extracts of lichen Toninia candida for their antioxidant activities, both extracts showed strong activities. Sharma and Kalikotay (2012) collected two lichen species, Parmotrema reticulatum and Usnea sp. from Darjeeling hills, India. Both of investigated lichen species showed significant antioxidant activity while 31% free radical scavenging activity was recorded for the extract of lichen Parmotrema reticulatum.

Kosanic et al. (2013a) investigated the antioxidant, anticancer and antimicrobial activities of some selected lichens from Serbian region. The extract of lichen Parmelopsis ambigua was recorded having highest free radical scavenging activity.

Ravaglia et al. (2014) collected six lichen species from Brazil and Antarctica to investigate the toxicity and antioxidant activities. The study reported that crude extracts of S. alpinum, P. mesotropum and P. cetratum showed most toxic effect against A. salina. Similarly, another study conducted by Jesus et al. (2016) on antioxidant, cytotoxic and antimicrobial activities of three lichens collected from Quezon, Philippines. The acetone extract of lichens Canoparmelia aptata, Parmotrema gardneri and Parmotrema sp. were recorded for low radical scavenging activity.

Lichen contain unique chemical compounds, some of these are already reported to be effective against various cancer (Backorova et al., 2011; Mahamuni et al., 2012). A study was conducted by Rankovic et al. (2011) to investigate the extracts of three lichen Cladonia furcate, Lecanora atra and L. muralis for their anticancer, antioxidant and antimicrobial activities. The methanol extracts of all tested was recorded having strong anticancer effect.

Kosanic et al. (2012) investigated three species of Parmelia for their anticancer, antioxidant and antimicrobial activities. One of tested lichen, P. saxatiles showed highest antioxidant activity while extract of all lichen species were recorded having strong anticancer activity.

Kosanic et al. (2013 b) investigated acetone extracts of two lichen species Evernia prunastri and Pseudoevernia furfuraceae and some of their metabolites for their anticancer, antimicrobial and antioxidant activities. The study recorded that investigated lichen species have significant cytotoxic effect on cancer cell.

Grujicic et al. (2014) and Rankovic et al. (2014) evaluated the extracts of lichen Cetraria islandica and Stereocaulon passchale, respectively. The genotoxic, antioxidant, anticancer and antimicrobial potentials of the extracts were evaluated and strong anticancer activities in the methanolic extracts were observed. Kumar et al. (2014 b) collected fourteen species of saxicolous lichen from Ladakh. The methanol extracts of two species L. alphoplaca and M. disjuncta were recorded for strong cytotoxic effect against the growth of cancer cell. Nguyen et al. (2014) investigated the cytotoxic effects of 17 species of lichens against human cancer cells. One lichen Flavocetraria cucullata among these tested lichen species was recorded to exhibited strong cytotoxic effect against several cancer cells. Similarly, Kasimogullari et al. (2014) investigated the anticancer activity of lichen

Usnea filipendula by evaluation of cytotoxic effect of the lichen extract against breast cancer cell.

Emsen et al. (2015) investigatied antitumor activity of different lichens compound isolated from two lichen species Pseudoevernia furfuraceae and Rhizoplaca melanopthalma. The study reported positive activity in investigated lichen metabolites.

Chapter 3

MATERIALS AND METHODS

3.1 Field Survey

For the collection of lichen specimens and field observation, regular field visits were conducted in Mansehra District on monthly basis between October 2012 and July 2015. Lichen specimens were collected from different altitudes and from various substrates or habitats/micro habitats. Field collected lichen samples were carefully collected alongwith some part of substrate (part of rock in rock dwelling, part of twig/bark in epiphytic lichens) and placed in separate papers bags, alloted a separate collection number and recorded attributes of the taxa; habitat/ substrate and altitude as field notes. Habitat /substrate and altitude of each collected specimen were recorded as field notes.

Samples were dried under normal room temperature by changing the papers at suitable intervals (1-3 days). The dried specimens along with their substrate were mounted on a cardboard paper (4x6) and covered with thick brown packets. The basic data related to each specimen was typed and pasted on each specimen packets (Butler, 1950).

3.2 Characterization

All specimens were studied in the laboratory for morphological, anatomical, chemical and molecular (DNA barcoding) characterization.

3.2.1 Morphological Characters

Morphological characters (upper and lower surface) of the lichen specimen were examined under dissection microscope (make, magnification: e.g. Olympus, 40X). The colour of thallus, texture, presence or absence of apothecia or other vegetative structures such as isidia,

soredia, pruina and pseudocyphellae were noted. In case of foliose lichen, branching pattern, length/ width of lobes, and presence/ absence of cilia were recorded. For fruticose lichen length of thallus and branching pattern were recorded. Morphology of lower surface, like colour and presence/absence of rihizines (colour, branching and distribution) was recorded.

3.2.2 Anatomical Characters

A thin section of apothecia was prepared by sharp blade and was mounted in distilled water and examined under microscope (40x, 100x). Colour of epihymenium, hymenium, hypothecium, asci; ascospore shape/ numbers/ ascus and ascospore size were recorded in notebook for proper further documentation.

3.2.3 Chemical Characters

The chemical studies of collected lichen specimens were carried out by spot tests and thin layer chromatography by following Culberson and Kristinsson (1970) and Culberson (1972).

3.2.3.1 Spot Tests

Spot test or chemical colour tests were carried out by direct application of different reagents for different tests (K-test: 10-25% aqueous solution of potassium hydroxide; C-test: freshly prepared aqueous solution of bleaching powder or calcium hypochloride; KC-test: K solution applied on thallus immediately flowed by C solution; Pd-test: paraphenylene- diamine in ethanol used the same day) on the lichen thallus and apothecia under microscope and each specimen categorized as test positive or negative (Orange et al., 2001; Vinayaka, 2011).

3.2.3.2 Thin Layer Chromatography

Thin layer chromatography (TLC) was used for identification of lichen compounds and lichen species identified with the help of tables (Culberson and Kristinsson, 1970; Culberson, 1972; Orange et al., 2001; Elix 2014); using Parmelia sulcata as reference material.

3.2.3.2.1 Extraction of Lichen Substance

Lichen substances were extracted by taking small fragment of lichen thallus (specimens and reference material) in small test tubes to which 2-4 drops of acetone were added and tubes left for 30 min at room temperature.

3.2.3.2.2 Preparation of Solvent Mixtures

Lichen substances were separated in three different organic solvent systems i.e., Solvent mixture A {toluene 180 mL, 1,4 dioxan 45 mL, glacial acetic acid 5 mL), solvent B (cyclohexane 117 mL, tert-butyl methyl ether 90 mL, formic acid 18 mL) and solvent C (toluene 85 mL, glacial acetic acid 15 mL). TLC plates that were used in solvents B and solvent System C were first treated with pre B (distilled water 38 mL, formic acid 60 mL) and pre C (distilled water 50 mL, glacial acetic acid 50 mL) solvents for 5 and 10 min respectively in horizontal pre B and pre C chambers.

3.2.3.2.3 Load TLC Plates

Eight acetone lichen extracts and a reference sample were applied to on each TLC plates using capillary.

First pre-chamber was used before putting the TLC plates in chamber B and C. The pre-chambered were filled with 4 mL of the relevent solvent. TLC plate B kept in pre-chambered B for 5 min and in TLC plate C sin in pre-chamber C for 10 min. Then 12 mL of solvent mixtures (A, B and

C) was loaded with the help of pipette in middle of the chambers (A, B and C) and closed the chambers with big glass for 5 min. TLC plates were run in chambers A, B and C and in 20-30 min solvent almost reached the end of TLC the plates.

3.2.3.2.4 View of the TLC Plates under UV Light

TLC plates were then studied under UV light at two different wave lengths. Under 365 nm wavelengths, all visible dots were marked as dotted line with soft pencil and colour were recorded on top right-hand of the spot. Then TLC plates were visualized at 254 nm UV light and bordered additional appearing spot with continuous line.

3.2.3.2.5 Spraying with Dilute Sulfuric Acid and Baking on Heating Plate

To visualize lichen substance, dilute sulfuric acid (10%) was sprayed on plates and marked the spot which have not turned into a wet grey and remained white. Then plats were heated at 120 ºC for 5 min until strongly coloured dot are visible.

3.2.3.2.6 View of TLC Plates under UV Light

Under 365 nm UV light, newly appearing spot were marked with central, X, and colour (new/changed) were labeled on lower right side of the dots.

3.2.4 DNA Barcoding

3.2.4.1 Genomic DNA Extraction

A small fragment of fungal tissue was grinded in liquid nitrogen to a fine powder using a mortar and pestle. The tissue powder and liquid nitrogen were transfered to an appropriately sized tube and allowed the liquid nitrogen to evaporate. Then added 400 μL of Buffer AP1 and 4 μL of RNase to the sample, vortexed vigorously and incubated the mixture for 10

min at 65 °C and the samples was mixed by inverting the tube 2-3 times. To precipitate detergent, proteins and polysaccharides, 130 μL of buffer AP2 was added to the lysate, mixed and incubated for 5 min on ice. Then lysate was centrifuged for 5 min at 14000 rpm. After that the lysate was pipette into QIA shredder mini spin column in a 2 mL collection tubes and then centrifuged for 2 min at 14000 rpm. Then added 1.5 volumes of buffer AP3/E to the lysate and mixed by pipetting. 650 µm of mixture were pipette from the lysate into the DNeasy mini spin column placed in a 2 mL collection tube, centrifuged at 8000 rpm for 1 min and discarded the flow through. The collection tubes were reused for remaining sample by repeating the step. Then DNeasy column were placed in a new 2 mL collection tube and added 500 μL of Buffer AW. The flow-through was discarded after centrfigutaion at 8000 rpm for 1 min and added 500 μL more buffer AW to the DNeasy column and again centrifuged for 2 min at maximum speed to dry the membrane. Then DNeasy column were transfer to 1.5 mL microcentrifuge tube and pipette 50 μL of preheated (65 °C) Buffer AE directly onto the DNeasy membrane. Incubated the tubes for 5 min at room temperature and then centrifuged for 1 min at 8000 rpm to elute the genomic DNA.

3.2.4.2 Gel Electrophoresis

The extracted DNA was confirmed by gel electrophoresis and for this purpose 1% agarose gel was used. Stock solution of 5X TBE buffer (tris- base 44.5 mM, boric acid 44.5 mM, EDTA 1mM) was prepared and then 1g agarose was dissolved in 100 mL of 0.5X Tris-Borate EDTA buffer diluted from stock solution. This solution was heated in oven until it started boiling and agarose powder was completely dissolved and then cooled at room temperature. In the next step, ethidium bromide (8 µL of 10 mg/mL; Serva Electrophoresis, Germany) was added to the agarose gel as staining dye. After cooling to about 50-55 °C, the gel was poured into gel casting

tray having already inserted comb into it and then solidified at room temperature. When the gel completely solidified, comb was removed and then loaded the gel into gel tank containing 0.5X TBE buffer. Each extracted DNA sample (5 µL) was mixed with 3 µL of 6X loading dye (bromophenol blue 0.25%, glycerol 30%, cyanol 0.25%) and loaded into wells of agarose gel. Horizontal electrophoresis apparatus (Labnet International, Inc. USA) at 110 volts were used for running the gel. After 35-40 min the band of DNA were visualized under UV trans-illuminator using Gel Documentation System (Alpha Innotech, Taiwan).

3.2.4.3 Polymerase Chain Reaction (PCR)

The PCR was performed to amplify the Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA).

3.2.4.3.1 Primer Selection

The ITS region has been used extensively in the study of lichenized fungi. This gene was amplified with the specific pair of fungal‐ specific primers (Tabl 3.1).

Table 3.1: List of Primer used for PCR Amplification. Primer Ta Primer Sequence (5-3) Refferences Name (°C) ITS 1F CTTGGTCATTTAGAGGAAGTAA 55 Gardes and Bruns, 1993; ITS4 TCCTCCGCTTATTGATATGC 53 White et al., 1990

3.2.4.3.2 Primers Dilution

Stock solution of lyophilized form of primers was prepared by adding appropriate amount of deionized (double distilled) water (Serva Electrophoresis, Germany) according the manufacturer’s protocols. The

primers were thoroughly mixed by shaking the tubes and giving short spin.

3.2.4.3.3 Reaction Mixture

In PCR reaction 0.2 mL hinged tube with cap PuReTaq Ready-To-Go PCR Beads (GE Healthcare Life Sciences, UK) were used. To obtain a final volume of 25 µL, addeded 1 µL of each forward and reverse primers, 18 µL deionized water (Serva Electrophoresis, Germany) and 5µL of DNA sample in PCR tube.

3.2.4.3.4 Amplification Process

The amplification process was completed in 35 cycles of denaturation, annealing and extension step. Thermoprofile of whole amplification process has been shown in Table 3.2.

Table 3.2: Thermoprofile of PCR reaction, showing each step with number of cycles and corresponding temperature for each step. Temperature Cycle condition Stages Time No of Cycle (°C) Initial 1 94 1 min 1 Denaturation Denaturation 94 1 min Anealing 2 51 1 min 35 Extension 72 1 min Final Extension 3 72 8 min 1 Final Hold 4

3.2.4.3.5 Analysis of PCR Product

Gel electrophoresis was used to analyze the PCR product by staining with 10 µL ethidium bromide and running it on agarose (1.5%) gel. DNA ladder (4 µL) was run with PCR product for comparison of size on

agarose gel at 110 volts for 45 min in gel electroporation chamber. The gel was then analyzed under UV florescence in gel documentation system.

3.2.4.3.6 Extraction of PCR Products

QIAquick gel extraction kit was used for extraction of PCR product in the following steps; in first step DNA fragment from agarose gel were excised by sharp and clean scalpel and gel slice was weighed in colourless tube and then added 3 volume of QG buffer to 1 volume of gel. The tube was then incubated for 10 min or until the gel has completely dissolved at 50 °C. After that added isopropanol in same quantity as gel and mixed thoroughly. To bind DNA, the sample was applied to QIAquik column and centrifuged for min at 8000 rpm. Then the flow through was discarded and QIAquik column was placed back into same collecting tube. QG buffer (0.5 mL) was added to the column and centrifuged for 1 min at 8000 rpm. For washing of QIAquik column, added 0.75 mL of PE buffer and centrifuged for 1 min at 8000 rpm, discarded the flow through and again centrifuged for 1 min. To elute DNA, QIAquik column was placed in a clean 1.5 mL micro centrifuge tube and added 50 µL of EB buffer in the center of QIAquik membrane and then centrifuged for 1 min.

3.2.4.3.7 Squencing of PCR Products

The PCR products were sequenced in Bik-F Labortry Frankfurt, Germany. The sequence was then aligned using NCBI’s BLAST at http://www.ncbinlmnih.gov/ and compared with other lichenized fungi sequence in the nucleotide database in order to find out the similarity and differences with lichens.

3.3 Identification and Documentation

Each lichen specimen was identified using keys /diagnostic charactersfollowing Flora of India, Flora of Turkey, Flora of China, Flora of

Iran, Flora of Australia and Flora of Great Sonoran Desert, and dodtful cases confirmed by international experts in relevant families.

3.4 Distribution Pattern Studies

Distribution pattern (s) of the particular taxa was analyzed in relevance to habitat/substrate, altitude, number of localities, and distribution for proper mapping GPS coordinates obtained during field surveys were arranged using Microsoft Excel and and GPS coordinates of each species were plotted using Arc GIS software (Esri). A separate map was developed for each family. Different taxa were arranged on the basis of substrate and growth form.

Voucher specimens were deposited in Hazara University Herbarium (HUP), Hazara University.

3.5 Biological Activities

Biological activities like antibacterial, antifungal, antioxidant, anticancer and cyototoxicty of ten selected lichens were studied at Bioresource Reserarch Center (BRC), Islamabad (Pakistan).

3.5.1 Preparation of Lichen Extracts

The lichen extracts were prepared in conical flasks using solvents acetone and methanol. The weighed quantity (10 g) of lichen thallus powder was homogenized with 50 mL of respective solvents. The top of conical flasks was covered by aluminum foil and kept in orbital shaker for 3-4 days at room temperature. The supernatant, containing the lichen extract was filtered through Whattman filter paper No. 1 and the extract obtained by evaporating the solvent at room temperture. The crude extract was weighed and dissolved in a known volume of DMSO to obtain final concentrations (0.05 mg/mL, 0.01 mg/mL, and 0.001 mg/mL).

3.5.1.1 Antimicrobial Assays

Six bacterial strains, Escherichia coli (ATCC_39111), Enterococcus faecalis (ATCC-19433), Bacillus subtilis (ACTT 6633), Pseudomonas aeroginosa, (ATCC_10145), S. aureus (ATCC_33591), S. epidermidis (ATCC -700587) and four fungal strains Aspergillus niger (ATCC_16888), A. fumigatus (ATCC_16424), Fusarium solani (ATCC_46492) and F. oxysporium (ATCC_10913), were used in antimicrobial assays. For each tests 24 hour old culture were used.

Antimicrobial activities of the lichen extracts were tested by disc diffusion assay. For this purpose Muller Hinton agar (for bacteria) and Sabourad dextrose agar (for fungi) were seeded with appropriate inoculums. Paper discs (6 mm diameter) were impregnated with different concentrations of lichen extract and placed on organism seeded petri dish. Blank disc was impregnated with dimethyl sulphoxide (DMSO) and used as negative control while roxithromycin (for bacteria) and ketoconazole (for fungi) were used as positive controls. The petri dish were incubated for 24 hour at 37 ℃ and for 48 hour at 35 ℃ for bacteria and fungi, respectively and the zones of inhibition around each disc were measured (Karthikaidevic et al., 2009; Cobanoglu et al., 2010; Kumar et al., 2010; Sati and Joshi, 2011;Tiwari et al., 2011 a.b; Sharma et al., 2012; Prabhu and Sudha, 2015).

3.5.1.2 Cytotoxicity Assay

Cytotoxicity of lichen extracts were tested by Brine shrimp cytotoxicity assay, most widely used tool for detection of bioactive compound. A container filled with Brine solution was used for hatching of Brine shrimps eggs. Brine solution was prepared by dissolving 32 g of sea salt and 1.5% agar in distilled water. Ten shrimps were transferred to each tube containing brine solution (4.5 mL/tube) and different concentration of

lichen extracts prepared in acetone and methanol (0.05 mg/mL, 0.01mg/mL and 0.001mg/mL). After 24 hour of incubation the number of surviving shrimps was counted by magnifying glass. The lethal concentrations (LC50) were calculated by plotting percentage of shrimp killed against the logarithm of sample concentrations (Pisuthanan et al., 2004; Paudel et al., 2012; Thadhani et al., 2012).

3.5.1.3 Anticarcinogenic Activity on Plants

Potatoes taken from local market were surface sterilized with 20% bleach solution. The experiments were performed in two groups, extract of lichen species and positive control. Stock solution of 0.05 mg/mL in DMSO was further diluted with sterilized water to achieve 0.01mg/mL and 0.001mg/mL concentration. Same concentration of positive control (Vincrystien) was also prepared. Potato disc were made by cork borer and placed on 2% agar petri dish (6 disc/ petri dish). Agrobacterium tumefacien (PTA-5577) culture of 48 hours was transfered on the surface of each potato disc (50 µL). Same concentration (0.05 mg/mL, 0.01 mg/mL and 0.001 mg/mL) of the lichen extract and positive control were applied to each disc. The discs were then stained with lugol’s solutions (10% KI, 50% I) after 21 days of incubation at 28 C.̊ Number of tumors were counted under dissecting microscope and magnifying glass. Percentage inhibition was counted by following formula.

100 – No of tumor per sample Percentage inhibition: x 1000 Number of tumor per control

3.5.1.4 Antioxidant Assay

DPPH radical scavenging assays were used to investigate antioxidant activity of lichen extracts. DPPH solution was prepared by dissolving 24 mg of DPPH in 100 mL of methanol. Stock solutions of lichen samples having concentrations of 1 mg/mL were prepared in methanol and then diluted to the concentrations of 500 μg/mL, 250 μg/mL, 125

μg/mL. Diluted solutions of each concentration were mixed with 3 mL of DPPH solution in methanol. The solutions were incubated for 30 min at 23°C and then the absorbance was measured at 517 nm. For positive control ascorbic acid was used. Each concentration was taken in triplicate (Rankovic et al., 2014).

The percent radical scavenging activity was calculated using the following equation:

Control absorbance−Sample absorbance Percent scavenging effect: x 1000 Control absorbance

Chapter 4

RESULTS

4.1 Lichen Biodiversity

We identified 110 lichen species, belonging to 27 families and 56 genera (Table 4.1 and 4.2). Parmeliaceae was recorded as dominant family consisting of 12 genera, followed by Physciaceae (7 genera), Verrucariaceae (4 genera), Lecanoraceae, Ramalinaceae and Teloschistaceae (3 genera each), Candelariaceae, Collemataceae and Megasporaceae (2 genera each). The remaining families; Acarosporaceae, Arthoniaceae, Arthopyreniaceae, Catillariaceae, Cladoniaceae, Graphidaceae, Hymeneliaceae, Lecidaceae, Mycoblastaceae, Nephromataceae, Peltigeraceae, Peltulaceae, Pertusariaceae, Psoraceae, Rhizocarpaceae, Stereocaulaceae, Thelotremataceae, Trapeliaceae and Umbilicariaceae were represented by a single genus (Table 4.3). The maximum number of species was recorded for Parmeliaceae (17 species) followed by Lecanoraceae (15 species), Physciaceae (13 species), Teloschistaceae and Collemataceae (7 species each), Candelariaceae (6 species), Cladoniaceae and Megasporaceae (5 species each), Verrucariaceae (4 species), Acarosporaceae, Peltigeraceae, Ramalinaceae, Rhizocarpaceae and Thelotremataceae (3 species each), Arthopyreniaceae, Graphidaceae and Hymeneliaceae (2 species each) and Arthoniaceae, Catillariaceae, Lecidaceae, Nephromataceae, Peltulaceae, Pertusariaceae, Psoraceae, Stereocaulaceae, Trapeliaceae and Umbilicariaceae having single species (Table 4.4).

Table 4.1. List of lichen species from District Mansehra, Pakistan. Sr. Growth Species Specimen Collection No. Families Substrate Host No. Form 1 Acarospora heufleriana Korb., HUP 15,199, 289 Acarosporaceae Crustose Saxicolous Rock

2 Acarospora impressula Th. Fr HUP 71, 236, 294, 327, 758 Acarosporaceae Crustose Saxicolous Rock

3 Acarospora veronensis A. Massal., HUP 396, 465, 505, 556 Acarosporaceae Crustose Saxicolous Rock Amandinea punctata (Hoffm.) Coppins 4 HUP 389, 489, 684 Physciaceae Crustose Corticolous Bark & Scheid 5 Anaptychia crinalis (Schaer.) Veˇzda HUP 467, 689, 737 Physciaceae Foliose Corticolous Bark Anaptychia runcinata (With.) J.R. 6 HUP 48 Physciaceae Foliose Saxicolous Rock Laundon 7 Arthonia radiata (Pers.) Ach HUP 104, 352, 701 Arthoniaceae Crustose Corticolous Bark Arthopyrenia cinereopruinosa (Schaerer) 8 HUP 130, 765 Arthopyreniaceae Crustose Corticolous Bark A. Massal. Arthopyrenia punctiformis (Pers.) A. 9 HUP 373 Arthopyreniaceae Crustose Corticolous Bark Massal., 10 Aspicilia cinerea (L.) Korber HUP 110, 433, 504, 527 Megasporaceae Crustose Saxicolous Rock Aspicilia desertorum (Krempelh.) 11 HUP 05, 108, 225, 283, 326 Megasporaceae Crustose Saxicolous Rock Mereschk

Bacidia laurocerasi (Delise ex Duby) 12 HUP 13, 673 Ramalinaceae Crustose Corticolous Bark Zahlbr 13 Bacidia rosella (Pers.) De Not. HUP 22, 143, 296, 674 Ramalinaceae Crustose Corticolous Bark

14 Bacidia rubella (Hoffm.) A. Massal. HUP77, 258, 361, 708 Ramalinaceae Crustose Corticolous Bark

15 Buellia stellulata (Taylor) Mudd HUP 19 Physciaceae Crustose Saxicolous Rock

16 Caloplaca cirrochroa (Ach.) Th. Fr. HUP 85 Teloschistaceae Crustose Saxicolous Rock Caloplaca decipiens (Arnold) Blomb. & 17 HUP 498, 530 Teloschistaceae Crustose Saxicolous Rock Forss. 18 Caloplaca teicholyta (Ach.) J. Steiner HUP 595 Teloschistaceae Crustose Saxicolous Rock

19 Candelaria concolor (Dicks) B. Stein., HUP 36, 135, 354, 474, 665 Candelariaceae Foliose Corticolous Bark

20 Candelariella aurella (Hoffm.) Zahlber., HUP 402, 446, 525, 583 Candelariaceae Crustose Saxicolous Rock Candelariella efflorescens R.C. Harris & 21 HUP 133, 355, 442, 644, 707 Candelariaceae Crustose Corticolous Bark W.R. Buck, 22 Candelariella reflexa (Nyl.) Lettau, HUP 138, 178, 229, 439 Candelariaceae Crustose Corticolous Bark Candelariella vitellina (Hoffim.) Mull. 23 HUP 480, 507, 526, 580 Candelariaceae Crustose Saxicolous Rock Arg., Candelariella xanthostigma (Ach.) 24 HUP 444, 696 Candelariaceae Crustose Corticolous Bark Lettau,

25 Canoparmelia texana (Tuck.) Elix & Hale HUP 382, 457, 675, 718 Parmeliaceae Foliose Corticolous Bark

26 Catapyrenium cinereum (Pers.) Korber HUP 31 Verrucariaceae Squamulose Tericolous Soil

27 Catillaria lenticularis (Ach.) Th. Fr., HUP 76, 206 Catillariaceae Crustose Saxicolous Rock

28 Cladonia caespiticia (Pers.) Florke HUP 74, 358, 448, 553 Cladoniaceae Fruticose Tericolous Soil

29 Cladonia fimbriata (L.) Fr., HUP 10, 450, 551, 585 Cladoniaceae Fruticose Corticolous Wood

30 Cladonia floerkeana (Fr.) Florke HUP 79, 375, 478, 588, 714 Cladoniaceae Fruticose Tericolous Soil

31 Cladonia pocillum (Ach.) Grognot, HUP 84, 495, 546, 587 Cladoniaceae Fruticose Tericolous Soil

32 Cladonia pyxidata (L.) Hoffm. HUP 29, 58, 360,540, 650 Cladoniaceae Fruticose Tericolous Soil

33 Collema flaccidum (Ach.) Ach HUP 356, 370, 440, 700 Collemataceae Foliose Corticolous Bark

34 Collema furfuraceum (Arnold) Du Rietz, HUP 351, 379, 451, 661, 702 Collemataceae Foliose Corticolous Bark

35 Collema subflaccidum Degel., HUP 21, 98, 221, 329, 441 Collemataceae Foliose Corticolous Bark

36 Dermatocarpon miniatum (L.) W. Mann HUP 01, 99, 403, 515 Verrucariaceae Foliose Saxicolous Rock

37 Diploschistes diacapsis (Ach.) Lumbsch HUP 73, 404 Thelotremataceae Crustose Tericolous Soil

38 Diploschistes muscorum (Scop.) R. Sant. HUP 07, 155, 223 Thelotremataceae Crustose Tericolous Soil Diploschistes scruposus (Schreber) 39 HUP 139, 475, 502, 601 Thelotremataceae Crustose Saxicolous Rock Norman 40 Endocarpon pusillum Hedwig HUP 40 Verrucariaceae Squamulose Tericolous Soil

41 Flavoparmelia caperata (L.) Hale HUP 38, 458, 586, 677 Parmeliaceae Foliose Corticolous Bark

42 Flavopunctelia flaventior (Stirton) Hale HUP 80, 141, 487 Parmeliaceae Foliose Saxicolous Rock

43 Flavopunctelia soredica (Nyl.) Hale HUP 301, 384, 476, 668 Parmeliaceae Foliose Corticolous Bark

44 Graphis elegans (Borrer ex Sm.) Ach. HUP 453 Graphidaceae Crustose Corticolous Bark

45 Graphis scripta (L.) Ach. HUP 443, 705 Graphidaceae Crustose Corticolous Bark Heterodermia japonica (Sato) Swinscow 46 HUP 390, 407, 490, 685 Physciaceae Foliose Corticolous Trunk & Krog 47 Heterodermia obscurata (Nyl.) Trevisan HUP467, 707 Physciaceae Foliose Corticolous Trunk

48 Hypogymnia tubulosa (Schaerer) Hav. HUP 142, 331, 459, 645 Parmeliaceae Foliose Corticolous Bark

49 Lasallia papulosa (Ach.) Llano HUP 06 Umbilicariaceae Foliose Saxicolous Rock

50 Lecania cyrtella (Ach.) Th. Fr. HUP 653, 742 Ramalinaceae Crustose Corticolous Bark

Lecania naegelii (Hepp) Diederich & v. 51 HUP 746 Ramalinaceae Crustose Corticolous Bark d. Boom 52 Lecanora albella (Pers.) Ach. HUP 179, 449, 667 Lecanoraceae Crustose Corticolous Bark

53 Lecanora allophana Nyl. HUP 97, 180, 377, 481, 669 Lecanoraceae Crustose Corticolous Bark

54 Lecanora argentata (Ach.) Malme HUP 378, 455, 752 Lecanoraceae Crustose Corticolous Bark

55 Lecanora cenisia Ach. HUP 37, 106, 231, 281 Lecanoraceae Crustose Saxicolous Rock

56 Lecanora chlarotera Nyl. HUP 380, 497, 626, 674 Lecanoraceae Crustose Corticolous Bark

57 Lecanora dispersa (Pers.) Sommerf. HUP 295, 350 Lecanoraceae Crustose Saxicolous Rock

58 Lecanora polytropa (Hoffm.) Rabenh. HUP 23, 256, 405, 501, 591 Lecanoraceae Crustose Saxicolous Rock

59 Lecanora pseudistera Nyl. HUP 11, 140, 257 Lecanoraceae Crustose Saxicolous Rock

60 Lecanora pulicaris (Pers.) Ach. HUP 454, 671, 709 Lecanoraceae Crustose Corticolous Bark

61 Lecanora rupicola (L.) Zahlbr. HUP 406, 484, 605, 766 Lecanoraceae Crustose Saxicolous Rock

62 Lecidella euphorea (Florke) Hertel HUP 381, 672 Lecanoraceae Crustose Corticolous Bark Lecidella stigmatea (Ach.) Hertel & 63 HUP 08, 332 Lecanoraceae Crustose Saxicolous Rock Leuckert

64 Lepraria elobata Toensberg HUP 1750, 700 Stereocaulaceae Leprose Corticolous Wood

65 Leptogium burnetiae C. W. Dodge, HUP 371, 443, 582, 662, 710 Collemataceae Foliose Corticolous Bark

66 Leptogium cyanescens (Rabenh.) Korb., HUP 445, 663, 713 Collemataceae Foliose Corticolous Bark

67 Leptogium hildenbrandii (Garov.) Nyl. HUP 75, 330, 375, 509, 589 Collemataceae Foliose Corticolous Trunk

68 Leptogium saturninum (Dicks.) Nyl., HUP 376, 452, 715 Collemataceae Foliose Corticolous Bark Lobothallia alphoplaca (Wahlenb.) 69 HUP 205, 509, 666 Megasporaceae Crustose Saxicolous Rock Hafellner 70 Lobothallia praeradiosa (Nyl.) Hafellner HUP 374, 409, 711 Megasporaceae Crustose Saxicolous Rock

71 Melanelia disjuncta (Erichsen) Essl., HUP 508 Parmeliaceae Foliose Saxicolous Rock Melanohalea elegantula (Zahlbr.) O. 72 HUP 725 Parmeliaceae Foliose Corticolous Bark Blanco et al. 73 Nephroma parile (Ach.) Ach. HUP 464, 628, 682, 739 Peltigeraceae Foliose Saxicolous Rock

74 Parmelia sulcata Taylor HUP 385, 460, 482, 731 Parmeliaceae Foliose Corticolous Trunk

75 Parmelina quercina (Willd.) Hale HUP 144, 461, 679 Parmeliaceae Foliose Corticolous Bark

76 Parmelina tiliacea (Hoffm.) Hale HUP 386, 415, 462, 734 Parmeliaceae Foliose Corticolous Bark

77 Parmeliopsis ambigua (Wulfen) Nyl HUP 81, 145, 260, 297 . Parmeliaceae Foliose Corticolous Bark

78 Peltigera horizontalis (Hudson) Baumg. HUP 466 Peltigeraceae Foliose Tericolous Soil

79 Peltigera polydactylon (Necker) Hoffm. HUP 488 Peltigeraceae Foliose Tericolous Soil

80 Peltigera rufescens (Weiss) Humb. HUP 727 Peltigeraceae Foliose Tericolous Soil

81 Peltula obscurans (Nyl.) Gyelnik HUP 18 Peltulaceae Squamulose Saxicolous Rock

82 Pertusaria leioplaca DC. HUP 147, 728 Pertusariaceae Crustose Corticolous Bark

83 Phaeophyscia ciliata (Hoffm.) Moberg HUP 20, 410, 593, 733 Physciaceae Foliose Corticolous Bark Phaeophyscia endococcina (Korber) 84 HUP 388, 483, 712 Physciaceae Foliose Saxicolous Rock Moberg Phaeophyscia orbicularis (Necker) 85 HUP 362, 510 Physciaceae Foliose Corticolous Bark Moberg 86 Physcia aipolia (Ehrh. ex Humb.) Furnr. HUP 392, 412, 599 Physciaceae Foliose Corticolous Trunk

87 Physcia dubia (Hoffm.) Lettau HUP 399. 688 Physciaceae Foliose Saxicolous Rock

88 Physcia stellaris (L.) Nyl. HUP 391, 717 Physciaceae Foliose Corticolous Trunk

89 Physconia muscigena (Ach.) Poelt HUP 560 Physciaceae Foliose Muscicolous Mosses

Porpidia crustulata (Ach.) Hertel & 90 HUP 438, 511 Lecidaceae Crustose Saxicolous Rock Knoph 91 Psora decipiens (Hedwig) Hoffm. HUP 594 Psoraceae Squamulose Tericolous Soil

92 Punctelia subrudecta (Nyl.) Krog HUP 16, 387, 417, 680, 736 Parmeliaceae Foliose Corticolous Trunk

93 Ramalina sinensis Jatta HUP 393, 468, 554, 683, 722 Ramalinaceae Foliose Corticolous Bark

94 Rhizocarpon geographicum (L.) DC. HUP 394, 423, 494, 512 Rhizocarpaceae Crustose Saxicolous Rock

95 Rhizocarpon lecanorinum Anders HUP 435, 528 Rhizocarpaceae Crustose Saxicolous Rock Rhizocarpon viridiatrum (Wulfen) 96 HUP 434 Rhizocarpaceae Crustose Saxicolous Rock Korber 97 Rhizoplaca chrysoleuca (Sm.) Zopf HUP 486, 535 Lecanoraceae Foliose Saxicolous Rock Rhizoplaca melanophthalma (DC.) 98 HUP 456, 506 Lecanoraceae Foliose Saxicolous Rock Leuckert & Poelt Rhizoplaca peltata (Ramond) Leuckert & 99 HUP 592 Lecanoraceae Foliose Saxicolous Rock Poelt 100 Tephromela atra (Hudson) Hafellner HUP 413, 493 Mycoblastaceae Crustose Saxicolous Rock Trapeliopsis granulosa (Hoffm.) 101 HUP 151, 395 Trapeliaceae Crustose Corticolous Wood Lumbsch 102 Usnea florida (L.) F. H. Wigg. HUP 463 Parmeliaceae Fruticose Corticolous Bark

103 Usnea fulvoreagens (Rasanen) Rasanen HUP 730 Parmeliaceae Fruticose Corticolous Trunk

104 Verrucaria muralis Ach. HUP 597 Verrucariaceae Crustose Saxicolous Rock Xanthomendoza fallax (Hepp ex Arn.) 105 HUP 398, 459 Teloschistaceae Foliose Corticolous Bark Soechting, KSrnefelt & S. Kondratyuk Xanthomendoza fulva (Hoffm.) 106 HUP 408, 732 Teloschistaceae Foliose Corticolous Tree Søchting, Kärnefelt & S. Kondr Xanthoparmelia conspersa (Ehrh. ex 107 HUP 82, 584, 598 Parmeliaceae Foliose Saxicolous Rock Ach.) Hale Xanthoparmelia tinctina (Maheu & A. 108 HUP 04, 419 Parmeliaceae Foliose Saxicolous Rock Gillet) Hale 109 Xanthoria parietina (L.) Th. Fr. HUP 499, 600, 691, 745 Teloschistaceae Foliose Corticolous Twings

110 Xanthoria sorediata (Vainio) Poelt HUP 514, 609 Teloschistaceae Foliose Saxicolous Rock

Table 4.2: List of families with genera and number of species from District Mansehra. Sr. No. Familes Genus No. of species 1 Acarosporaceae Acarospora 3 2 Arthoniaceae Arthonia 1 3 Arthopyreniaceae Arthopyrenia 2 Candelaria 1 4 Candelariaceae Candelariella 5 5 Catillariaceae Catillaria 1 6 Cladoniaceae Cladonia 5 Collema 3 7 Collemataceae Leptogium 4 8 Graphidaceae Graphis 2 Lecanora 10 9 Lecanoraceae Lecidella 2 Rhizoplaca 3 10 Lecidaceae Porpidia 1 Aspicilia 2 11 Megasporaceae Lobothallia 2 12 Mycoblastaceae Tephomela 1 13 Nephromataceae Nephroma 1 Canoparmelia 1 Flavoparmelia 1 Flavopunctelia 2 Hypogymnia 1 14 Parmeliaceae Melanelia 1 Melanohalea 1 Parmelia 1 Parmelina 2 Parmeliopsis 1

Punctelia 1 Usnea 2 Xanthoparmelia 2 15 Peltigeraceae Peltigera 3 16 Peltulaceae Peltula 1 17 Pertusariaceae Pertusaria 1 Amandinea 1 Anaptychia 2 Buellia 1 18 Physciaceae Heterodermia 2 Phaeophyscia 3 Physcia 3 Physconia 1 19 Psoraceae Psora 1 Bacidia 3 20 Ramalinaceae Lecania 2 Ramalina 1 21 Rhizocarpaceae Rhizocarpon 3 22 Stereocaulaceae Lepraria 1 Caloplaca 3 23 Teloschistaceae Xanthomendoza 2 Xanthoria 2 24 Thelotremataceae Diploschistes 3 25 Trapeliaceae Trapeliopsis 1 26 Umbilicariaceae Lasallia 1 Catapyrenium 1 Dermatocarpon 1 27 Verrucariaceae Endocarpon 1 Verrucaria 1

Table 4.3: Number of families and genera in District Mansehra.

Sr. No. Families No. of Genera 1 Parmeliaceae 12 2 Physciaceae 7 3 Verrucariaceae 4 4 Teloschistaceae 3 5 Ramalinaceae 3 6 Lecanoraceae 3 7 Candelariaceae 2 8 Collemataceae 2 9 Megasporaceae 2 10 Acarosporaceae 1 11 Arthoniaceae 1 12 Arthopyreniaceae 1 13 Catillariaceae 1 14 Cladoniaceae 1 15 Graphidaceae 1 16 Lecidaceae 1 17 Mycoblastaceae 1 18 Peltigeraceae 1 19 Peltulaceae 1 21 Pertusariaceae 1 22 Psoraceae 1 23 Rhizocarpaceae 1 24 Stereocaulaceae 1 25 Thelotremataceae 1 26 Trapeliaceae 1 27 Umbilicariaceae 1

Table 4.4: List of dominant families by number of species in District Mansehra.

Sr. No. Families No. of species 1 Parmeliaceae 17 2 Lecanoraceae 15 3 Physciaceae 13 4 Teloschistaceae 7 5 Collemataceae 7 6 Candelariaceae 6 7 Cladoniaceae 5 8 Ramalinaceae 5 9 Megasporaceae 4 10 Verrucariaceae 4 11 Peltigeraceae 3 12 Acarosporaceae 3 13 Rhizocarpaceae 3 14 Theltremataceae 3 15 Arthopyreniaceae 2 16 Graphidaceae 2 17 Arthoniaceae 1 18 Catillariaceae 1 19 Lecidaceae 1 20 Mycoblastaceae 1 21 Nephromataceae 1 22 Peltulaceae 1 23 Pertusariaceae 1 24 Psoraceae 1 25 Stereocaulaceae 1 26 Trapeliaceae 1 27 Umbilicariaceae 1

14 12 12

8 7

6 4 4 3 3 3 2 2 2 2

Fig. 4.1: Families having more than two genera in District Mansehra.

4.1.1 Lichens Species Recorded as New to Pakistan

Among total recognized species, 12 species belong to 10 genera and 10 families were new records to Pakistan. These species include Acarospora veronensis A. Massal., Anaptychia crinalis (Schleich.) Vezda, Candelariella efflorescens R.C. Harris & W.R. Buck, Cladonia caespiticia (Pers.) Flörke, Cladonia floerkeana (Fr.) Flörke, Lecanora chlarotera Nyl., Lecanora pulicaris (Pers.) Ach., Lepraria elobata Tønsberg, Nephroma parile (Ach.) Ach., Punctelia subrudecta (Nyl.) Krog, Rhizocarpon lecanorinum Anders and Trapeliopsis granulosa (Hoffm.) Lumbsch (Table 4.5).

Table 4.5: The new record of species to Pakistan from District Mansehra. Sr. No. Lichen species Family 1 Acarospora veronensis A. Massal. Acarosporaceae 2 Anaptychia crinalis (Schleich.) Vezda Physciaceae Candelariella efflorescens R.C. Harris & W.R. 3 Candelariaceae Buck 4 Cladonia caespiticia (Pers.) Flörke Cladoniaceae 5 Cladonia floerkeana (Fr.) Flörke Cladoniaceae 6 Lecanora chlarotera Nyl. Lecanoraceae 7 Lecanora pulicaris (Pers.) Ach. Lecanoraceae 8 Lepraria elobata Tønsberg Stereocaulaceae 9 Nephroma parile (Ach.) Ach. Nephromataceae 10 Punctelia subrudecta (Nyl.) Krog Parmeliaceae 11 Rhizocarpon lecanorinum Anders Rhizocarpaceae 12 Trapeliopsis granulosa (Hoffm.) Lumbsch Trapeliaceae

4.1.2 Species Recorded as New to District Mansehra

Fifty nine lichen species belong to 35 genera and 17 families were reported first time for District Mansehra (Table 4.6). The maximum number of genera was recorded in family Parmeliaceae (8 genera) followed by Lecanoraceae, Physciaceae and Teloschistaceae (3 genera each), Candelariaceae, Collemataceae, Graphidaceae, Megasporaceae and Verrucariaceae (2 genera each) while the remaining families have single genus (Fig. 4.2). By number of species, Lecanoraceae (10 species) was recorded as dominant family followed by Parmeliaceae (8 species), Teloschistaceae (7 species), Candelariaceae, (5 species), Physciaceae and Collemataceae (4 species each), Megasporaceae and Theloremataceae (3 species each), Acarosporaceae, Cladoniaceae, Graphidaceae, Rhizocarpaceae and Verrucariaceae (2 species each) and Arthoniaceae, Catillariaceae, Pertusariaceae, Ramalinaceae and Mycoblastaceae all having single species (Fig. 4.3).

Table 4.6: List of species with families new to District Mansehra.

Sr. No. Families Lichen species 1 Acarospora heufleriana Korb. Acarosporaceae Acarospora impressula Th. Fr. 2 Arthoniaceae Arthonia radiata (Pers.) Ach. Candelaria concolor (Dicks.) Arnold Candelariella aurella (Hoffm.) Zahlbr.

Candelariaceae Candelariella reflexa (Nyl.) Lettau

Candelariella vitellina (Hoffm.) Müll. Arg. Candelariella xanthostigma (Pers. ex Ach.) Lettau 3 Catillariaceae Catillaria lenticularis (Ach.) Th. Fr. Cladonia fimbriata (L.) Fr. 4 Cladoniaceae Cladonia pocillum (Ach.) O.J. Rich. Collema flaccidum (Ach.) Ach. Collema furfuraceum (Schaer.) Du Rietz 5 Collemataceae Collema subflaccidum Degel. Leptogium burnetiae C.W. Dodge Graphis elegans (Borrer ex Sm.) Ach. 6 Graphidaceae Graphis scripta (L.) Ach. Lecanora albella (Pers.) Ach.

Lecanora cenisia Ach. Lecanora polytropa (Ehrh.) Rabenh. Lecanora pseudistera Nyl. Lecanora rupicola (L.) Zahlbr. Lecidella euphorea (Flörke) Hertel 7 Lecanoraceae Lecidella stigmatea (Ach.) Hertel & Leuckert Rhizoplaca chrysoleuca (Sm.) Zopf Rhizoplaca melanophthalma (DC.) Leuckert Rhizoplaca peltata (Ramond) Leuckert & Poelt 8 Megasporaceae Aspicilia desertorum (Kremp.) Mereschk. 9 Mycoblastaceae Tephromela atra (Huds.) Hafellner Canoparmelia texana (Tuck.) Elix & Hale 10 Parmeliaceae Flavoparmelia caperata (L.) Hale

Flavopunctelia flaventior (Stirt.) Hale Hypogymnia tubulosa (Schaer.) Hav. Melanelia disjuncta (Erichsen) Essl. Melanohalea elegantula (Zahlbr.) O. Blanco, A. Crespo, Divakar, Essl., D. Hawksw. & Lumbsch Usnea fulvoreagens (Räsänen) Räsänen Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale 11 Pertusariaceae Pertusaria leioplaca DC. Amandinea punctate (Hoffm.) Coppins & Scheid. Heterodermia japonica (M. Satô) Swinscow & 12 Physciaceae Krog Heterodermia obscurata (Nyl.) Trevis. Physcia aipolia (Ehrh. ex Humb.) Fürnr. 13 Ramalinaceae Bacidia laurocerasi (Delise ex Duby) Zahlbr. Bacidia rosella (Pers.) De Not. Ramalina sinensis Jatta

Rhizocarpaceae Rhizocarpon geographicum (L.) DC. 14 Rhizocarpon viridiatrum (Wulfen) Körb. Caloplaca cirrochroa (Ach.) Th. Fr. Caloplaca decipiens (Arnold) Blomb. & Forssell Caloplaca teicholyta (Ach.) J. Steiner Xanthomendoza fallax Søchting, Kärnefelt & 15 Teloschistaceae S.Y. Kondr. Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr. Xanthoria parietina (L.) Th. Fr. Xanthoria sorediata (Vain.) Poelt Diploschistes diacapsis (Ach.) Lumbsch 16 Thelotremataceae Diploschistes muscorum (Scop.) R. Sant. Diploschistes scruposus (Schreb.) Norman Catapyrenium cinereum (Pers.) Körb. 17 Verrucariaceae Dermatocarpon miniatum (L.) W. Mann

9 8 8 7 6 5 4 3 3 3 3 2 2 2 2 2 1 1 1 1 1 1 1 1 1 1 1 0

Genera

Fig. 4.2: Families with number of genera of species new to District Mansehra.

12 10 10 8 8 7

6 5 4 4 4 3 3 2 2 2 2 2 2 1 1 1 1 1

Fig. 4.3: Dominant families by number of genus of species new to District Mansehra.

4.1.3 Distribution Pattern

4.1.3.1 Growth Form

The data on growth forms of different lichentaxa has been presented in Fig 4.4. Crustose (46.36%) was the dominant growth form followed by Foliose (42.72%), Fruticose (6.36%), Squamulose (3.63%) and Leprose (0.9%).

50.00% 46.36% 45.00% 42.72% 40.00% 35.00% 30.00% 25.00% 20.00% 15.00%

Percentage Speciesof 10.00% 6.36% 3.63% 5.00% 0.90% 0.00% Crustose Foliose Fruticose Squamulose Leprose Lichen Growth Form

Fig. 4.4: Relative (%) of different growth forms of species in District Mansehra.

4.1.3.2 Substrate

Relative distribution of lichen on different substrates has been summarized in Fig. 7.1. Four types of associations were recognized viz., on trees, rocks, soil and mosses. The maximumt number of species was recorded on bark (39.09%), followed by rock (38.18%), soil (10.9%), trunks (7.27%), wood (2.72%) and mosses and twinges (0.9%) (Fig. 4.6).

Tericolous, Muscicolous, 10.90% 0.90%

Saxicolous, Corticolous, 38.18% 50%

Fig. 4.5: Realtive (%) of species in different habitat in District Mansehra.

45.00%

40.00%

35.00%

30.00%

25.00%

20.00% Series1

15.00%

10.00%

5.00%

0.00% Rocks Bark Soil Wood Trunk Mosses Twings

Fig. 4.6: Relative (%) of lichens on basis of hosted substrate in District Mansehra.

4.1.3.3 Locality-Wise Distribution

Distribution of lichen species at different localities (Table 4.7) suggest that Candelaria concolor was recorded from maximum number of localities (6 localities) followed by Acarospora impressula, Candelariella efflorescens, Cladonia floerkeana, Collema furfuraceum, Collema subflaccidum, Leptogium burnetiae, Leptogium hildenbrandii, Lecanora allophana, Lecanora polytropa, Aspicilia desertorum, Parmelia sulcata, Punctelia subrudecta, Phaeophyscia ciliate, Bacidia rosella and Ramalina sinensis (5 localities each). Twenty three (23) taxa were recorded from a single locality (Table 4.8).

Table 4.7: List of taxa found at more than one locality in District Mansehra. Sr. No. of Lichen Species No. localities 1 Candelaria concolor (Dicks.) Arnold 6 2 Acarospora impressula Th. Fr. 5 3 Candelariella efflorescens R.C. Harris & W.R. Buck 5 4 Cladonia floerkeana (Fr.) Flörke 5 5 Collema furfuraceum (Schaer.) Du Rietz 5 6 Collema subflaccidum Degel. 5 7 Leptogium burnetiae C.W. Dodge 5 8 Leptogium hildenbrandii (Garov.) Nyl. 5 9 Lecanora allophana (Ach.) Nyl. 5 10 Lecanora polytropa (Ehrh.) Rabenh. 5 11 Aspicilia desertorum (Kremp.) Mereschk. 5 12 Parmelia sulcata Taylor 5 13 Punctelia subrudecta (Nyl.) Krog 5 14 Phaeophyscia ciliata (Hoffm.) Moberg 5 15 Bacidia rosella (Pers.) De Not. 5 16 Ramalina sinensis Jatta 5 17 Acarospora heufleriana Korb. 4

18 Acarospora veronensis A. Massal. 4 19 Candelariella aurella (Hoffm.) Zahlbr. 4 20 Candelariella reflexa (Nyl.) Lettau 4 21 Candelariella vitellina (Hoffm.) Müll. Arg. 4 22 Cladonia caespiticia (Pers.) Flörke 4 23 Cladonia fimbriata (L.) Fr. 4 24 Cladonia pocillum (Ach.) O.J. Rich. 4 25 Cladonia pyxidata (L.) Hoffm. 4 26 Collema flaccidum (Ach.) Ach. 4 27 Lecanora argentata (Ach.) Röhl. 4 28 Lecanora cenisia Ach. 4 29 Lecanora chlarotera Nyl. 4 30 Aspicilia cinerea (L.) Körb. 4 31 Nephroma parile (Ach.) Ach. 4 32 Canoparmelia texana (Tuck.) Elix & Hale 4 33 Flavoparmelia caperata (L.) Hale 4 34 Flavopunctelia soredica (Nyl.) Hale 4 35 Hypogymnia tubulosa (Schaer.) Hav. 4 36 Parmelina tiliacea (Hoffm.) Hale 4 37 Parmeliopsis ambigua (Wulfen) Nyl. 4 Heterodermia japonica (M. Satô) Swinscow & 38 4 Krog 39 Bacidia rubella (Hoffm.) A. Massal. 4 40 Rhizocarpon geographicum (L.) DC. 4 41 Xanthoria parietina (L.) Th. Fr. 4 42 Diploschistes scruposus (Schreb.) Norman 4 43 Dermatocarpon miniatum (L.) W. Mann 4 44 Arthonia radiata (Pers.) Ach. 3 45 Leptogium cyanescens (Rabenh.) Körb. 3 46 Leptogium saturninum (Dicks.) Nyl. 3

47 Lecanora albella (Pers.) Ach. 3 48 Lecanora pseudistera Nyl. 3 49 Lecanora pulicaris (Pers.) Ach. 3 50 Lecanora rupicola (L.) Zahlbr. 3 51 Lecidella stigmatea (Ach.) Hertel & Leuckert 3 52 Rhizoplaca chrysoleuca (Sm.) Zopf 3 53 Lobothallia alphoplaca (Wahlenb.) Hafellner 3 54 Lobothallia praeradiosa (Nyl.) Hafellner 3 55 Flavopunctelia flaventior (Stirt.) Hale 3 56 Parmelina quercina (Willd.) Hale 3 57 Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale 3 58 Amandinea punctate (Hoffm.) Coppins & Scheid. 3 59 Anaptychia crinalis (Schleich.) Vezda 3 60 Phaeophyscia endococcina (Körb.) Moberg 3 61 Physcia aipolia (Ehrh. ex Humb.) Fürnr. 3 62 Diploschistes muscorum (Scop.) R. Sant. 3 Arthopyrenia cinereopruinosa (Schaerer) A. 63 2 Massal. 64 Candelariella xanthostigma (Pers. ex Ach.) Lettau 2 65 Catillaria lenticularis (Ach.) Th. Fr. 2 66 Graphis scripta (L.) Ach. 2 67 Lecanora dispersa (Pers.) Röhl. 2 68 Lecidella euphorea (Flörke) Hertel 2 69 Rhizoplaca melanophthalma (DC.) Leuckert 2 70 Porpidia crustulata (Ach.) Hertel & Knoph 2 71 Tephromela atra (Huds.) Hafellner 2 72 Xanthoparmelia tinctina (Maheu & A. Gillet) Hale 2 73 Pertusaria leioplaca DC. 2 74 Heterodermia obscurata (Nyl.) Trevis. 2 75 Phaeophyscia orbicularis (Neck.) Moberg 2

76 Physcia dubia (Hoffm.) Lettau 2 77 Physcia stellaris (L.) Nyl. 2 78 Bacidia laurocerasi (Delise ex Duby) Zahlbr. 2 79 Lecania cyrtella (Ach.) Th. Fr. 2 80 Rhizocarpon lecanorinum Anders 2 81 Lepraria elobata Tønsberg 2 82 Caloplaca decipiens (Arnold) Blomb. & Forssell 2 Xanthomendoza fallax Søchting, Kärnefelt & S.Y. 83 2 Kondr. Xanthomendoza fulva (Hoffm.) Søchting, 84 2 Kärnefelt & S.Y. Kondr. 85 Xanthoria sorediata (Vain.) Poelt 2 86 Diploschistes diacapsis (Ach.) Lumbsch 2 87 Trapeliopsis granulosa (Hoffm.) Lumbsch 2

Table 4.8: List of taxa recorded from single locality in District Mansehra. Altitude Sr. No. Lichen Species Locality (m) Anaptychia runcinata (With.) J.R. 1 Mandagucha 1866 Laundon Arthopyrenia punctiformis (Pers.) A. 2 Naran 2242 Massal. 3 Buellia stellulata (Taylor) Mudd Dader 1223 4 Caloplaca cirrochroa (Ach.) Th. Fr. Dader 1343 5 Caloplaca teicholyta (Ach.) J. Steiner Lalazar 2855 6 Catapyrenium cinereum (Pers.) Körb. Dader 1215 7 Endocarpon pusillum Hedw. Dader 1209 Manoor 8 Graphis elegans (Borrer ex Sm.) Ach. 2552 Valley 9 Lasallia papulosa (Ach.) Llano Dader 1215 Lecania naegelii (Hepp) Diederich & 10 Paras 1994 van den Boom 11 Melanelia disjuncta (Erichsen) Essl. Jalkhad 2700 Melanohalea elegantula (Zahlbr.) O. 12 Blanco, A. Crespo, Divakar, Essl., D. Shogran 2350 Hawksw. & Lumbsch Manoor 13 Peltigera horizontalis (Huds.) Baumg. 2560 Valley Manoor 14 Peltigera polydactylon (Neck.) Hoffm. 2700 Valley 15 Peltigera rufescens (Weiss) Humb. Shogran 2610 16 Peltula obscurans (Nyl.) Gyeln. Dader 1205 17 Physconia muscigena (Ach.) Poelt Lalazar 2913 18 Psora decipiens (Hedw.) Hoffm. Lalazar 3089 Rhizocarpon viridiatrum (Wulfen) Lake Saif-ul- 19 2740 Körb. Maluk Rhizoplaca peltata (Ramond) Leuckert 20 Lalazar 2600 & Poelt Usnea florida (L.) Weber ex F.H. Manoor 21 2505 Wigg. Valley Usnea fulvoreagens (Räsänen) 22 Shogran 2438 Räsänen 23 Verrucaria muralis Ach. Lalazar 2600

4.2 Taxonomic Description

Details about families and taxonomic description of genera and species are given below:

1. Acarosporaceae

Thallus crustose, foliose or squamulose, developed sometimes scarcely. Algal cells: Protococcaceae. Apothecia with or without thalline margin; asci many spored; spores simple or septate. Habitat: soil, rocks. Distribution: arctic to temperate.

Genera in Study Area: The present study recorded one genus from District Mansehra (Fig. 4.1)

Acarospora A. Massal

Thallus: crustose, areolate, verruculos or placodioid; areoles scattered to contiguous, angular to rounded; upper surface yellow or blackish, brown, pale, dull or glossy, pruinose or epruinose, smooth to wrinkled, often developing fissure; lower surface ecorticate, subcorticate or eucorticate, white or pigmented; attachment, rhizohyphae and pseudorhizines; apothecia aspiciliod, usually immersed, rarely sessile, one or more per areole; disc red brown to brown black, round, pruinose or epruinose, smooth or rough; hymenium 75-195 µm; epihymenium; hyaline, paraphyses; usually not branched; subhymenium hyaline or pale yellow; asci more than 100-ascospores/ascus, narrow or clavate; ascospores simple, hyaline globose to ellipsoid, sometimes contains oil drops. Secondary metabolites: mostly none detected. Substrate: on rocks, soil or on other lichens. World distribution: cosmopolitan.

This genus is cosmopolitan; there are 200 species of the genus distributed worldwide. Previously ten species were recorded from Pakistan and two

from District Mansehra. Present study reported three species; two species new to District Mansehra and one to Pakistan (Plat 3.1).

Key to species

1a. Thallus K+ red, norstictic acid present………………….. A. heufleriana

1b. Thallus K- , norstictic acid absent ……………………………………...2

2a. Thallus pale brown, apothecia with thalline margin...... Acarospora veronensis

2b. Thallus brown to black, apothecia without thalline margin…...... 3

3a. Thallus wide spreading, areoles subsquamulose...... Acarospora sp.

3b. Thallus forming discrete patches, aerole plane, smooth……………………………………………………….A. impressula

1. Acarospora heufleriana Körb., Parerga lichenol. (Breslau) 1: 57 (1859)

Thallus areolate; areoles angular, dispersed to contiguous, up to 1.7 mm in diameter, up to 0.6 mm thick, rim down turned, concolorus with thallus, corticated, concolorous; upper surface plane to convex, yellow, smooth to rough, epruinose or pruinose; attachment broad, thick, elevating the areoles, without stipe; lower surface outer edge corticated and yellow, inner edge ecorticated and white pale brown; apothecia immersed, punctiform to dilate; disc round to irregular, reddish brown; epihymenium 11-14 µm thick, yellow; hymenium 85-105 µm tall, pale yellow above to hyaline below; subhymenium up to 40 µm thick, pale yellow; asci clavate, 12-16 µm wide; ascospores simple, hyaline, ellipsoid.

Habitat: Rocks (Saxicolous)

Spot tests: Medulla K+ red

Secondary Metabolites (TLC): Norstictic acid, rhizocarpic acid.

Specimen Examined: Dader, alt. 1,184 m, 10.10.13, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 15 (HUP), Ghari Habib Ullah, 986 m, 25.3.14, Asmat Ullah and Amir Khan Afridi 199 (HUP), Oghi top, alt. 1,564 m, 14.4.14, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 226 (HUP), Balakot, alt. 1,051 m, 25.04.14, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 286 (HUP).

World Distribution: Asia (Pakistan), North America, Europe.

Note: New record to the study area.

2. Acarospora impressula Th. Fr., Lich. Scand. (Upsaliae) 1(1): 214 (1871)

Thallus crustose, form small patches or areolate, up to 2 cm in diameter; areoles 0.5.5 - 1.5 mm in diameter, contiguous, red brown to black brown, smaller at edge of thallus, epruinose; apothecia present, dark, 0.2-0.5 mm in diameter, punctiform, immersed and concave; disc concolorous with thallus, margin darker, angular to circular; hymenium 60-75 µm tall; asci 100-spored; ascospores ellipsoid, 2.5- 4.5 X 1.5 2.0-2.5 µm in diameter.

Habitat: Rock (Saxicolous)

Spot tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Near Dadar, alt. 1,331 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 71 (HUP), Oghi top, alt. 1,465 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 236 (HUP), Balakot, alt. 1,100 m, 26.04.15, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 294 (HUP), Paras, alt. 2,232 m, 27.07.15, Asmat Ullah, Amir

Khan Afridi and Syed Mushraf Shah 327 (HUP), Khaki, 1,166 m, 20.08.15, Asmat Ullah and Amir Khan Afridi 758 (HUP).

World Distribution: Asia, Europe, North America, Africa (Egypt, Morocco).

Note: New record to the study area.

3. Acarospora veronensis A. Massal., Ric. auton. lich. crost. (Verona): 29, tab. 48 (1852)

Thallus crustose, dispersed areolate, overall up to 4 cm wide; areoles 0.2-0.5 mm in diameter, dispersed or contiguous, rounded or angular, matt or shiny, flat or slightly convex, light brown or black when dry; lower surface narrow, corticated, white, sometimes dark or light brown; apothecia numerous, immersed, 1-3 per areoles, rounded to angular, 0.1-0.4 mm in diameter; disc concolorous, or dull reddish brown to blackish brown, smooth to rough; hymenium colourless; epihymenium yellow or reddish browm; asci 100+ spore , cylindrical, 70-85 x 15-23 µm; ascospores colourless, simple, ellipsoid, 3.0 -5.0 x 1.0-2.0 µm.

Habitat: Rock (Saxicolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: On way to lake Saif-ul-Maluk, alt. 2,970 m, 27.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 396 (HUP), Manoor Valley, alt. 3,380 m, 03.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 465 (HUP), Jalkhad, alt. 3,358 m, 10.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 505 (HUP) Lalazar, alt. 2,909 m, 10.09.2014, Asmat ullah, Amir Khan and Syed Juneed Shah 556 (HUP).

World Distribution: Asia, Europe, N. America, C. America (Mexico), Australasia (New Zealand), Africa (Morocco).

Note: A new recorded to Pakistan.

Plate 3.1: A. Acarospora heufleriana, B. Acarospora impressula, C. Acarospora veronensis (scale= 1 cm) in District Mansehra.

2. Arthoniaceae

Thallus crustose poorly differentiated to parasymbiotic; spores colorless or brownish, septate to muriform. Habitat: trees Distribution: temperate to tropical.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.8). (Plat 3.2).

Arthonia Ach.

Thallus crustose, immersed or superficial, rudimentary but sometimes well developed; ascomata apothecia-like, rounded, elongate or branched, flat to convex; disc red-brown to black, occasionally with white or pale red pruina; epihymenium conspicuous; hymenium with densely to widely spaced asci, usually I+ red or blue; subhymenium indistinct to distinct in structure and color; asci clavate, subglobose to globose, semi-fissitunicate, usually 8-spored; ascospores colourless to brown, smooth, transversely septate to muriform, ovoid to oblong- ovoid; seconday metabolites no lichen metabolites detected; substrate on bark, wood, leaves, rocks or lichens.

There are 500 species of above genus distributed worldwide; previously one species and one variety have been reported from Pakistan. The present study recorded one species as new to District Mansehra (Plate 3.2).

1. Arthonia radiata (Pers.) Ach., K. Vetensk-Acad. Nya Handl. 29: 131 (1808)

Thallus crustose, inconspicuous, immersed; upper surface pale grey, occasionally with a brown or olive tinge, specific structures absent; ascomata apothecia, black, variable shaped, rounded to substellate, flat or

slightly convex, 0.15-0.75 mm in diameter; disc black, epruinose; epihymenium brown; hymenium hyaline, 35-50 µm tall; paraphyses with dark apical cell; asci fissitunicate – bitunicate; ascospores oblong-ovoid to oblong, 3-septate, 16-20 x 4.5-5 µm in diameter.

Habitat: On bark (Tericolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Mandagucha alt. 1,840 m 14.11.2014, Asmat Ullah and Mazhar-ul-Islam 104 (HUP), Paras, alt. 1,677 m, 28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 352 (HUP), Shogran, alt. 1,900 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 701 (HUP).

World Distribution: Asia, Europe, Africa (Guinea, Morocco), C. America (Mexico), N. America, S. America (Colombia, Chile), Australisia (Australia, New Zealand), Pacific (Hawaii).

Note: New to the study area.

Fig. 4.8: Distribution of Arthoniaceae in District Mansehra; 1. Mandagucha. 2. Shogran, 3. Paras.

Plate 3.2: Arthonia radiata (scale= 1 cm) in District Mansehra.

3. Arthopyreniaceae

Thallus crustose, poorly differentiated, perithecia sessile or immersed, simple or rarely grouped, asci 1-8 spored, ovate or cylindrical, spores colourless or sometimes brown, 1-many septate or muriform. Habitat: trees, rocks. Distribution: temperate to tropical.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.9).

Arthopyrenia A. Massal.

Thallus crustose, immersed; ascomata circular to ellipsoid, perithecial; involucrellum: dark brown, clypeate, composed of bark cell and compact hyphae; exciple colorless, thin; asci 8-spored, bitunicate, pyriform to clavate; ascospores hyaline or brownish, pyriform, 1-2 septate, 5-14 x 14-45 µm; secondary metabolites absent; substrate bark or sometimes on non- calcareous rocks.

The genus has a total of 50 species reported world and two species from Pakistan and study area. The present study also recorded two species from Distrcit Mansehra (Plate 3.3).

Key to species

1a. Mature spores with distinct contriction at center of cell……………...………………………………………..A. cinereopriunosa 1b. Mature spores cells slightly or not constricted…………...... 2 2a. Spores with distinct perispore, paraphyses persistent ……………………………………………………………....A. punctiformis 2b. Spores with no perispore, paraphysis disappearing…………………………………………………Arthopyrenia sp.

1. Arthopyrenia cinereopruinosa (Schaer.) A. Massal., Symmict. Lich: 117 (1855)

Thallus inconspicuous; ascomata perthecia, circular or ellipsoid, 0.3-0.4 x 0.2-0.3 mm in diameter, white pruinose; involucrellum brown; pseudoparaphysis slender; asci cylindrical clavate, 60-75 x 11-18 µm; ascospores:1-sepatate, clavate, apices rounded, 14-21 x 5.5-8 µm.

Habitat: Bark (Corticolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Mandagucha, alt. 1,872 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 130 (HUP), Kiwai, alt. 1,770 m, 22.08.2015, Asmat Ullah and Amir Khan Afridi 765 (HUP).

World Distribution: Asia (Pakistan, Taiwan); Europe (Britain and Ireland); Australisia (Australia).

2. Arthopyrenia punctiformis A. Massal., Ric. auton. lich. crost. (Verona): 168, fig. 335 (1852)

Thallus absent; upper surface smooth, gray; ascomata perithecia, black, hemispherical; asci dark brown or black, 0.1-0.3 mm in diameter, 8-spored, irregularly arranged; ascospores hyaline, elongated-ellipsoid, 1-septate, 16- 21 x 4.4-6 µm.

Habitat: Bark (Corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: On way to Naran from Paras, alt. 2,242 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 373 (HUP).

World Distribution: Asia (Pakistan, Palestine, Taiwan, Russia), Europe, Africa (Morocco), C. America (Mexico), N. America, S. America (Argentina, Chile), Australasia (Australia, New Zealand), Pacific (Hawaii).

Fig. 4.9: Distribution of Arthopyreniaceae in District Mansehra; 1. On way to Naran from Paras, 2. Mahandri (Kaghan), 3. Kiwai, 4. Shogran, 5. Mandagucha.

Plate 3.3: A. Arthopyrenia cinereopruinosa, B. Arthopyrenia punctiformis (scale= 2 cm) in District Mansehra.

4. Candelariaceae

Thallus crustose, foliose rarely fruticose, yellow; apothecia lecanorine type; asci 8 or many spored; ascospores colourless, 1-2 celled. Habitat: rocks and trees. Distribution: Boreal, subtropical.

Genera in study area: In the present study two genus of the family were recorded from District Mansehra (Fig. 4.10).

Key to genera

1a. Thallus Fruticose or small foliose, lower surface white to yellow…………………………………………………………....Candelaria

1b. Thallus Crustose to Squamulose………………………………………..2

2a. Epihymenium granular, yellow brown, hymenium, 50-75µm tall…...………………………………………………………...Candelariella

2b. Not as above

Candelaria A. Massal.

Thallus fruticose or small foliose, loosely adnate to adnate, circular to irregular in outline, lobate; lobes flat to convex, apices: horizontal, eciliate; upper surface yellow green to chrome yellow, corticated, dull to somewhat shiny, isidia or soredia present or absent, with or without pruina; lower surface white to yellow, corticated, smooth to wrinkled, rhizinate; rhizines simple or branched; apothecia laminal, sessile; disc dark yellow than Thallus; epihymenium granular, yellow brown; hymenium colorless below; asci clavate, Candelaria-type; ascospores: ellipsoid, colorless, simple or thinly 1-septate. Substrate: on bark, rocks, mosses or soil. Secondary metabolites: pulvinic acid derivatives.

A total of seven species of the genus are reported from the world and previously one species from Pakistan. The present study recorded one species as new to District Mansehra (Plate 3.4)

1. Candelaria concolor (Dicks.) Arnold, Flora, Regensburg 62: 364 (187

Thallus small foliose, up to 1cm wide, closely appressed, lobate; lobes 0.1 - 0.4 mm wide, dorsiventral, flattened, finely divided, loosely imbricate, narrow, 0.2 -0.5 mm wide; upper surface bright yellow green, smooth, sorediate; soredia: granular; lower surface white, rhizinate; rhizine white, simple, scattered; apothecia rare, sessile; disc greenish orange; hymenium 65-90 µm tall; paraphysis simple; asci clavate; ascospores colourless, biguttulate, 6.5 – 14 x 4-6 µm.

Habitat: On bark (Corticolous)

Spot Tests: K- or K+ deep yellow

Secondary Metabolites (TLC): Calycin

Specimens Examined: Dader, alt. 1,221 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Malik Zahir 36 (HUP), Mandagucha, 1,827 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 135 (HUP), Paras, alt. 1,477 m, 28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 354 (HUP), Manoor Valley, alt. 2,560 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 474 (HUP), Lalazar, 2,980 m, 11.09.2014, Asmat Ullah, Juneed Khan and Amir Khan Afridi 581 (HUP), Shogran, alt. 2,322 m, 26.07.2015, Asmat Ullah, Syed Juneed Shan and Amir Afridi 665 (HUP).

World Distribution: Asia, Europe, Africa, C. America (Guatemala, Mexico), N. America; S. America; Australasia; Pacific (Hawaii).

Note: New to the study area.

Candelariella Mull. Arg., Bull. Herb. Boissier 2, app. 1: 11 (1894).

Thallus crustose to squamulose, areolate, granular, pulvinate, rosulate to placodioid, lobate; upper surface yellow, yellow-orange, yellow-green; ascomata apothecia, sessile; disc bright yellow, rounded, flat to convex; epihymenium yellow-brown, granular; hymenium hyaline, 50-75 µm tall; hypothecium colourless; asci 8-32 spored, clavate, Candelaria-type; ascospores hyaline, ellipsoid, oblong, ovoid, straight or curved, simple’ Secondary metabolites: calycin and pulvinic dilacton. Distribution: worldwide. Substrate: on wood, bark, soil, rocks, other lichens or mosses.

The above genus has a total of 50 species reported from world. Previously four species were reported from Pakistan while the present study recorded five species, one species as new to Pakistan and four species are new District Mansehra (Plate 3.5 and Plate 3. 6)

Key to species

1. Thallus sorediate………………………………………………...C. reflexa

1. Thallus esorediate………………………………………………………...2

2. Thallus inconspicuous, apothecia scattered……………….….C. aurella

2. Thallus distinct, granular, apothecia absent…………………………...3

3. Thallus granule spherical………………………………..C. xanthostigma

3. Thallus granules flattened……………………………………….………4

4. Upper surface bright golden yellow…………………...Candelariella sp.

4. Upper surface dull yellow orange………………………..…..C. vitellina

1. Candelariella aurella (Hoffm.) Zahlbr., Cat. Lich. Univers. 5: 790 (1928)

Thallus crustose, thin, composed of small scattered areoles, 0.5-1.5 mm in diameter; areoles convex, rounded to somewhat elongated, convex, 0.1-0.3 mm long, occasionally becoming lobe like; upper surface yellow, smooth; apothecia lecanorine, abundant, 0.25-0.9 mm wide; disc round, flat or more slightly convex, occasionally strongly convex, concolourous or dark yellow than thallus; epihymenium yellow-brown; hymenium colourless, 60-75 µm tall; hypothecium colourless, 65 µm tall; paraphyses simple or branched near tips, cylindrical or apically swollen; asci: 8-spored, clavate; ascospores: hyaline, ellipsoid, 12.5-16.5 x 4-5 µm.

Habitat: On rocks (saxicolous)

Spot Tests: K- to K+ reddish, C-, KC-

Secondary Metabolites (TLC): Calycin, pulvinic acid. Pulvinic dilacton

Specimen Examined: Lake Saif-ul-Maluk, alt. 3,293 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 402 (HUP), Manoor Valley, alt. 3,513 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 446 (HUP), Behsal, alt. 3,368 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 525 (HUP), Lalazar, alt. 3,001 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 583 (HUP).

World Distribution: Asia, Europe, Africa (Egypt, Morocco), C. America (Mexico), N. America, S. America (Argentina), Australasia (New Zealand, Australia) and Antarcatica.

Note: New to the study area.

2. Candelariella efflorescens R.C. Harris & W.R. Buck, Michigan Bot. 17(4): 155 (1978)

Thallus crustose, areolate to minutely Squamulose; areoles up to 0.4 mm wide, convex, rounded to elongated, occasionally somewhat raised from substrate; upper surface green to green yellow, sorediate; soredia 0.02-0.05 mm wide, yellow, powdery, on areoles margin and spreading inwards; ascomata apothecia, lcanorine, upto 0.65 mm wide; disc flate, dark yellow; epihymenium yellow-brown; hymenium 50-60 µm tall, colourless; hypothecium hyaline; paraphyses simple; asci 16-spored, clavate; ascospores colourless, simple, ellipsoid, 11-14 x 4-5 µm.

Habitat: On bark (Corticolous)

Spot Tests: K- to K+ reddish, C-, KC-,

Secondary Metabolites (TLC): Calycin, pulvinic acid, and pulvinic dilactone.

Specimen Examined: Mandaghucha, alt. 1,961 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 133 (HUP), Paras, alt. 1,615 m, 28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 355 (HUP), Manoor Valley near forest rest house, alt. 2,566 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 442 (HUP), Paras, alt. 1,768 m, 05.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 644 (HUMP), On track to Saripya Shogran, alt. 2,528 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 707 (HUP).

World Distribution: North America, Europe.

Note: A new record to Pakistan.

3. Candelariella reflexa (Nyl.) Lettau, Hedwigia 52: 196 (1912)

Thallus: dispersed, contiguous granules or small Squamulose; squamules smaller, up to 1 mm in diameter, rounded or lobed, flattened; upper surface dull yellow green, sorrediate; soredia spherical, bright yellow, 0.04- 0.06mm in diameter; apothecia rare, 0.5-1.00 mm in diameter, margin

smooth or sorediate; asci 8-spored; ascospores simple, oblong ellipsoid, 9- 14.5 x 4-5 µm.

Habitat: On bark (Corticolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Mandagucha, alt. 1,859 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 138 (HUP), Batal, alt. 1,810 m, 02.02.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 178 (HUP) Oghi top, alt. 1,360 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 229 (HUP), On way to Manoor Valley, alt. 2,157 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 439 (HUP).

World Distribution: Asia, Europe, Africa (Algeria), Australasia (Tasmania, New Zealand).

Note: New to the study area.

4. Candelariella vitellina (Hoffm.) Müll. Arg., Bull. Herb. Boissier 2(app. 1): 47 (1894)

Thallus areolate to subsquamulose; areoles flat to convex, granular to irregular; upper surface yellow, orange to brown orange, smooth to uneven; apothecia frequent, lecanorine, 0.5-1.5 mm in diameter; disc flat to convex, rounded, dark yellow than thallus; epihymenium yellow-brown; hymenium colourless, 55-70 µm tall; hypotheicum colourless, 55-110 µm tall; paraphyses cylindrical or with swollen tip, simple or branched; asci 16- 24 spored, clavate; ascospores hyaline, oblong to ellipsoid, simple to 1- septate, 8.5-11.5 x 3-4.5 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Thallus K- or K+ reddish, C-, KC-

Secondary Metabolites (TLC): Calycin, pulvinic acid, and pulvinic dilactone.

Specimen Examined: Manoor Valley near Ansoo lake, alt. 3,198 m, 4.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 480 (HUP), Jalkhad, alt. 3,199 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 507 (HUP), Bahsal, alt. 3,359m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 526 (HUP), Lalazar, alt. 3,316 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 580 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco, Algeria), C. America (Mexico), S. America, N. America, Australasia and Antarctica.

Note: New to the study area.

5. Candelariella xanthostigma (Pers. ex Ach.) Lettau, Hedwigia 52: 196 (1912)

Thallus crustose, granules, dispersed evenly on substrate, occasionally aggregate into thicker crust; granules 0.05-0.1 mm in diameter, rounded, sometimes becomes elongate; upper surface smooth, green to yellow; apothecia lecanorine, 0.4-0.7 mm wide; disc flat, dark yellow than thallus; epihymenium yellow-brown; hymenium colourless, 60-70 µm tall; hypothecium colourless; paraphyses cylindrical or swollen apically, simple; asci: 16-24 spored, clavate; ascospores hyaline, ovoid to oblong, simple to 1-septate, 7-11 x 3.0-4.0 µm.

Habitat: On bark (corticolous)

Spot Tests: K+ reddish, C-, KC-,

Secondary Metabolites (TLC): Calycin, pulvinic acid, and pulvinic dilactone.

Specimen Examined: Manoor Valley near forest rest house, alt. 3,399 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 444 (HUP), Shogran, alt. 2,118 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 696 (HUP).

World Distribution: Asia (Iran, Turkey, Mongolia), Europe (Spain and Greece).

Note: New to the study area.

Fig. 4.10: Distribution of Candelariaceae in District Mansehra; 1. Behsal, 2. Jalkhad, 3. Lalazar, 4. Lake Saif-ul-Maluk, 5. Manoor Valley, 6. Paras, 7. Sharan, 8. Shogran, 9. Mandaghucha, 10. Dader, 11. Batal, 12. Ooghi top.

Plate 3.4: Candelaria concolor (scale= 2 cm) in District Mansehra.

Plate 3.5: A. Candelariella aurella (scale= 1 cm), B Candelariella efflorescens, C. Candelariella reflexa (scale= 2 cm) in District Mansehra.

Plate 3.6: A. Candelariella vitellina (scale= 1 cm), B. Candelariella xanthostigma (scale= 2 cm) in District Mansehra.

5. Catilariaceae

Thallus Crustose; ascomata sessile, dark, with no thalline margin; asci 8 or

16 spored; ascospore colourless, aseptate or transversely septate. Habitat: bark or rocks.

Genus in study area: The present study recorded single genus of the family from District Mansehra (Fig. 4.11)

Catillaria A. Massal.

Thallus crustose, immersed, rimose, warted, areolate, or granular; upper surface white, gray, green, or black, isidia and soredia absent; ascomata apothecia, immersed to sessile, small, solitary or clustered; disc variously coloured, round, concave to plane or convex, usually epruinose; epihymenium colourless to black; hymenium colourless, 35-70 µm tall; paraphyses simple or sparingly branched, septate; asci 8-spored, in some species multispores, calvate to cylindrical, unitunicate, rather thick walled; ascospores colourless, oblong-ellipsoid, ovoid or bean-shaped, 1-septate, thin walled. Secondary metabolites: not detected. Substrate: on bark, rocks or soil.

A total of 150 species of above genus was reported from the world. Previously one species was reported from Pakistan while the present study recorded one species as new to District Mansehra (Plate 3.7).

1. Catillaria lenticularis (Ach.) Th. Fr., Lich. Scand.: 567 1874

Thallus crustose, inconspicuous, thin to immersed; upper surface white, or white gray, occasionally dark brown or olivaceous; apothecia numerous, scattered or in small groups, sessile, 0.15-0.4mm in diameter; disc reddish to dark brown, rarely black, flat to convex, usually epruinose; epihymenium: pale to dark brown, granular, 6-15 µm thick; hymenium

colourless, 35-65 µm tall; hypothecium colourless; paraphyses simple, rarely forked, apices capitate with dark brown cap; asci Catillaria type, subcylindrical, 8-spored; ascospores hyaline, oblong or oblong-ellipsoid, 1- septate, 7.5-10.5 x 2-3.5 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Thallus K-, C-, KC-, P,

Secondary Metabolites (TLC): None detected

Specimen examined: Dader, alt. 1,335 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 76 (HUP), Ghari Habibullah, alt. 932 m, 26.03 2014, Asmat Ullah and Amir Khan Afridi 206 (HUP).

World Distribution: Asia (Turkey, Palestine), Europe, Africa (S. Africa, Algeria, Morocco), N. America (USA) S. America (Argentina), Australasia (Australia).

Note: New to the study area.

Fig. 4.11: Distribution of Catillariaceae in District Mansehra; 1. Ghari Habibullah, 2. Dader.

Plate 3.7: Catillaria lenticularis (scale= 2 cm) in District Mansehra.

6. Cladoniaceae

Thallus crustose to squamulose (primary thallus), podetia hollow, erect (secondary thallus); apothecia biatorine; ascospores colourless, unicellular. Habitat: soil, wood, rocks Distribution: cosmopolitan in distribution.

Genus in study area: The present study recorded single genus Cladonia from District Mansehra (Fig. 4.12).

Cladonia P.Browne

Thallus squamulose, or fruticose with inconspicuous squamules or foliose with large squamules; squamules conspicuous to inconspicuous; upper surface of squamules green, gray green or brown, not pruinose; lower surface of squamules white, decaticate, smooth, without rhizines; ascomata apothecia, at the apices of podetia, or on rims of cups, larger than supporting stalk, red, pale or dark brown; hymenium red or dark brown,30-70 µm tall; hypothecium pale to reddish; paraphysis slender, simple or branched; asci 8-spored, cylindrical to clavate; ascospores hyaline, simple, fusiform, oblong or ovoid. Secondary metabolites: depsides, depsidones, dibenzofurans, aliphatic acid. Substrate: on soil, wood, bark, over mosses.

The genus has a total of 450 species from world; previously eight species are reported from Pakistan and four species from study area. The present study recorded five species from District Mansehra (Plate 3.8 and Palte 3.9).

Key to species

1a. Podetia absent, only basal squamules present………………………...2

1a. Podetia present like erect points, branching or cup like……………...3

2a. Squamules, cushion forming, K-, Pd + red...... C. caespiticia

2b Squamules tiny, P+ yellow, Pd+ orange...... Cladonia sp.

3a. Upper urface covered in granules, poditia with squamules………………………………………………...…..C. floerkeana

3b. upper Surface covered in flour like powder, podetia without squamules…………………………………………………..…Cladonia sp.

4a. Podetia Cups simple, rarely proliferating,...... 5

4b. Podetia Cups tapering, proliferating...... 6

5a. Cups often taller, up to 15mm in diameter…………………C. fimbriata

5b. Cup small, up to 5-7mm in diameter...... Cladonia sp.

6a. Basal squamules small, separate, rounded often erect...... C. pyxidata

6b. Basal squamules, spreading, overlapping, to form a rosett………………………………………………………………..C. pocillum

1. Cladonia caespiticia (Pers.) Flörke, Clad. Comm.: 8 (1828)

Primary Thallus squamulose, 2-6.5 mm long, often irregularly incised and erect; upper surface gray or brownish green; lower surface; white, esorediate; podetia colourless or with a yellowish tinge, to 0.25 cm tall, decorticate; apothecia inconspicuous, single, brown, sessile or on short pale stalks, rounded or tuberculate, sessile or on short, broad pale stalks.

Habitat: On soil (tericolous)

Spot Tests: Thallus Pd+ red,

Secondary Metabolites (TLC): Fumarprotocetraric acid,

Specimen Examined: Dader, alt. 1,229 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 74 (HUP), Paras, alt. 1,467 m, 28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 358 (HUP), Manoor Valley near forest rest, alt. 2,600 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 448 (HUP), Lalazar, alt. 3,162 m, 10.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 553 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco, Tanzania, Uganda), C. America (Mexico), N. America (Canada, USA) S. America (Brazil, Guyana).

Note: A new record to Pakistan.

2. Cladonia fimbriata (L.) Fr., Lich. eur. reform. (Lund): 222 (1831)

Primary Thallus, squamulose, persistent, irregularly lobed, crenate to sinuate; upper surface olive green; lower surface esorediate, or granular sorediate, white; podetia green to whitish gray, 10-20 mm tall, unbranched, at apices forming trumpet-shaped cup; cup 2-5 mm wide, surface ecorticate or corticated at the base, soredia abundant, farinose; apothecia uncommon, upto 1.5 mm diameter, brown; ascospores oblong, 7.5-13.5 x 3-4 µm.

Habitat: Rotten wood and tree (Corticolous)

Spot Tests: Cortex Pd+ red.

Secondary Metabolites (TLC): Fumarprotocetraric acid

Specimens Examined: Dader; alt. 1,200 m, 10.10.2013, Asmat Ullah, Syed Muhammad and Amir Khan Afridi 10 (HUP), Manoor Valley near Forest rest house, alt. 2,568 m, 03.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 450 (HUP), Lulusar lake, alt. 3,575 m, 11.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 541 (HUP), Lalazar Naran, alt. 3,100 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 585 (HUP).

World Distribution: Asia, Europe, Africa (Morocco, S. Africa), C. America (Mexico), N. America, S. America, Australasia, Pacific (Hawaii), Caribbean (Bahamas, Bermuda, Guadeloupe), Antarctica.

Note: New to the study area.

3. Cladonia floerkeana (Fr.) Flörke, De Cladonia's uit de sectie Cocciferae in België (morfologie, chemie, ecologie, sociologie, verspreiding en systematiek) 2. Ph.D. Thesis (Wilrijk): 99 (1828)

Primary thallus squamulose, persistent, small to 1.8 mm long; upper surface olive gray, lower surface white, esorediate; podetia pale to dark grey, to 2 cm tall, often shorter, simple or sometimes sparingly branched near apices, completely corticated or becoming partially decorticate particularly toward apices; apothecia abundant.

Habitat: On soil (Tericolous)

Spot Test: Thallus K-, P-,

Secondary Metabolites (TLC): Barbatic acid

Specimen Examined: Dader, alt. 1,233 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 79 (HUP), Kaghan, alt. 2,509 m, 29.07. 2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 375 (HUP), Manoor Valley, alt. 2,605 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 478 (HUP), Lalazar, alt. 3,053 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 588 (HUP), Shogran, alt. 2,540 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 714 (HUP).

World Distribution: Asia, Europe (Denmark, Finland, Greenland, Iceland), Africa, Australasia (Australia, New Zealand) N. America, S. America.

Note: A new to Pakistan.

4. Cladonia pocillum (Ach.) O.J. Rich., Catal. Lich. Deux-Sèvres: 8 (1877)

Primary thallus squamulose; squamules well developed, imbricate or contiguous, rosette; upper surface green, green brown sometimes dark brown; lower surface white, not sorediate; podetia to 20 mm tall, cup forming, at the center of thallus, simple not proliferating; cups wider than podetia, 0.8-4.5 mm in diameter; apothecia on margin of cups, brown.

Habitat: On thin soil (Tericolous)

Spot Tests: Cortex Pd + red

Secondary Metabolites (TLC): Fumarprotocetraric acid, atranorine

Specimen Examined: Dader, alt. 1,221 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 84 (HUP), Manoor valley near Bahari guset house, alt. 2,572 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 495 (HUP), Lolosar lake, alt. 3,544 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 546 (HUP), Lalazar Naran, alt.

100

3,042 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 587 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Algeria, Morocco), C. America (Mexico, Guatemala), N. America, S. America, Australasia (New Zealand), Antarctica.

Note: New to the study area.

5. Cladonia pyxidata (L.) Hoffm., Deutschl. Fl., Zweiter Theil (Erlangen): 121 (1796) [1795]

Primary thallus squamulose, persistent, up to 2-4.5 mm long, irregularly lobed or incised, lobes, mostly ascending; upper surface pale olive green; lower surface white, esorediate; podetia gray toolive green or brown, 2.5 - 22 mm tall, forming cup; cup 8-11.5 mm wide, usually simple, surface corticated or ecorticate; apothecia common, brown, up to 8 mm wide, on 3 mm long stalk; ascospores oblong-ellipsoid, 12-16 x 3-4 µm.

Habitat: On soil (Tericolous).

Spot Test: Cortex K-, KC-, Pd+ red.

Secondary Metabolites (TLC): Fumarprotocetraric acid

Specimens Examined: Dader, alt. 1,210 m, 10.10.13, Asmat Ullah, Syed Muhammad and Amir Khan Afridi 29 (HUP), Paras, alt. 1,838 m, 28.07.2014, Asmat Ullah, Syed Mushraf Shah and Amir Khan Afridi 360 (HUP), Lulusar Lake, alt. 3,487 m, 11.08.2014, AsmatUllah, Mazhar-ul-Islam and Ashfaq Ahmad 540 (HUP), Lalazar Naran, alt. 2,983 m, 10. 09. 2014, Asmat Ullah, Syed Juneed Shah, Amir Khan Afridi 58 (HUP), Paras (other side of river Kunhar), alt. 1,765 m, 08.07.2015, Asmat Ullah, Syed Juneed Shah and Amir Afridi 650 (HUP).

101

World Distribution: Asia, Europe, Africa, C. America (Guatemala, Mexico), N. America, A. America, Australasia (Australia, New Zealand), Pacific (Marquesas) Antarctica.

Fig. 4.12: Distribution of Cladoniaceae in District Mansehra: 1. Lulusar lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan.

102

Plate 3.8: A. Cladonia caespiticia, B. Cladonia fimbriata, C. Cladonia floerkeana (scale= 2 cm) in District Mansehra.

103

Plate 3.9: A. Cladonia pocillum, B. Cladonia pyxidata (scale= 2cm) in District Mansehra.

104

7. Collemataceae

Thallus foliose or squamulose, rarely shrubby or crustose, gelatinous when wet, corticated or pseudo-corticated, sometime with rhizine; apothecia, immersed or sessile, partly closed or open, thalline margin present sometimes; ascus usually 4-8 spores; spores muriform, septate or rarely simple. Secondary metabolites not detected. Habitat: rocks, bark and soil. Didtribution: widespread.

Genus in study area: The present study recorded two genus; Collema and Leptogium from District Mansehra (Fig. 4.13).

Key to genera

1a. Thallus with true cortex, not swells much when moist………...Leptogium

1b. Thallus with pseudocortex, swell much …………………………...Collema

Collema F. H. Wigg.

Thallus gelatinous, mainly foliose or squamulose lobate; lobes rounded, branched to elongated, deeply divided or indistinct; upper surface dark olive to brown black, smooth, or wrinkled to pustulose, occasionally pruinose, isidia: present or absent, soredia absent; lower surface olive or paler than upper surface, smooth, attached to substratum by hapters or rarely by white rhizines; ascomata absent or present; apothecia, immersed, laminal or marginal, orbicular; disc red brown, pale brown or black brown; hymenium hyaline; paraphyses straight, simple or branched, clavate to globose, apical cell usually thickened, occasionally yellow to reddish brown; asci 4-8 spored, narrowly clavate to clavate; ascospores hyaline, submuriform or muriform, sometimes spirally, ellipsoid, broad ellipsoid, globose. Secondary metabolites none detected. Substrate: bark, wood, rocks, plant debris, soil and mosses.

105

The genus has a total of 82 species recorded from world. Previously seven species are reported from Pakistan while the present study recorded three species as new to District Mansehra (Plate 3.10).

Keys to species

1a. Thallus ridged and/or postulate………………………………………..2

1b. Thallus not ridged, not postulate……………………………………….3

2a. Isidia rounded scale like, thallus ridged………………..….C. flaccidum

2b. Isidia cylindrical, thallus ridged and postulate………...C. furfuraceum

3a. Thallus lobes appressed, spreading, slightly or not ascending, isidia small…………………………………………………….….C. subflaccidum

3b. Thallus lobes ascending, crowded, isidia large…………….Collema sp.

1. Collema flaccidum (Ach.) Ach., Lich. univ.: 647 (1810)

Thallus foliose, 2.5-5.5 cm wide, loosely attached, thin, membrane like, lobate; lobes rounded, few, thin, not swollen, imbricate, radially or irregularly folded, 0.5-1.5 cm wide; upper surface black, usually dull, not pruinose, smooth to slightly postulate, isidia numerous, crowded on surface and margins, concolourous, flattened or scale; lower surface brown black, without rhizines or hairs; apothecia rare, sessile, laminal, 1.5-2.0 mm diameter; disc flat, brown; hymenium colourless, 95-130 µm tall; asci 8- spored, clavate; ascospores colourless, ellipsoid to fusiform, 23-32 x 5-6 µm.

Habitat: On bark (Corticolous)

Spot Tests: All negative.

Secondary Metabolites (TLC): None detected

106

Specimens Examined: Paras, alt. 1,655 m, 28.07.2014, Asmat Ullah, Syed, Mushraf Shah and Amir Khan Afridi 356 (HUP), Kaghan on way Naran, alt. 2,081 m, 29.07.2014, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 370 (HUP), Manoor Valley near forest rest house, alt. 2,564 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 440 (HUP), Shogran on track to Saripya, alt. 2,617 m, 27.07.2015, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 700 (HUP).

World Distribution: Asia, Europe, Africa (Mozambique, Socota), N. America (USA, Canada), S. America, Caribbean, Pacific (Tahiti, Hawaii), Australia and Antarctica.

Note: New to the study area.

2. Collema furfuraceum (Arnold) Du Rietz, Ark. Bot. 22A, 13: 3 (1929).

Thallus foliose, spreading, closely adnate, thin, membrane like, 3-7 mm in diameter, deeply and broadly lobate; lobes 0.3-0.7 cm broad, thin, 65-95 µm thick, rounded or extended, overlapping; upper surface dark olivaceous to brownish black, markedly ridged; isidia cylindrical, 0.05-0.1 mm broad, up to 0.3 mm long, simple or branched; lower surface paler than upper surface or dark olive green to black, smooth; apothecia rare, 0.5-1.5 mm in diameter, laminal; disc brown, flat; hymenium; asci 8-spored, clavate; ascospores 4-5 sepatate, colourless, fusiform to acicular, 40-75- x 3-5.5 µm.

Habitat: On bark (Corticolous)

Spot Tests: All negative.

Secondary Metabolites (TLC): None detected

Specimens Examined: Paras, alt. 1,622 m, 28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 351 (HUP), Naran, alt. 2,565 m, 29.07.2014, Asmat Ullah, Amir Afridi and Syed Juneed Shah 379 (HUP),

107

Manoor Valley near forest rest house, alt. 2,696 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam, 451 (HUP), Shogran, alt. 2,316 m, 26.07.2015, Asmat Ullah, Amir Afridi and Syed Juneed Shah, 661 (HUP); on track to Saripaya, alt. 2,600 m, 27.07.2015, Asmat Ullah, Amir Afridi and Syed Juneed Shah 702 (HUP).

World Distribution: Asia, Europe, Africa (E. Africa, Morocco), N. America, S. America (Chile, Brazil), Hawaii.

Note: New to the study area.

3. Collema subflaccidum Degel., Symb. bot. upsal. 20(no. 2): 140 (1974)

Thallus foliose, loosely attached, 3.0-5.5 cm wide, thick, lobate; lobes few, rounded, imbricate, 0.7-1.5 cm wide, thin; upper surface dark olive-green, black, dull, smooth, epruinose; isidia spreading over lobes, numerous, laminal, simple, globose to cylindrical; lower surface grey to black; apothecia rare, scattered, laminal, upto 2mm in diameter; disc reddish brown, flat; hymenium colourless, 85-125 µm tall; asci: 8-spored, clavate; ascospores colourless, fusiform, 5-7-septate, 40-60 x 4-6 µm.

Habitat: Mostly on bark (Corticolous)

Spot Tests: All negative.

Secondary Metabolites (TLC): None detected

Specimens Examined: Dader, alt. 1,233 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 21 (HUP), Shinkiari, alt. 1,121 m, 10.11.2013, Asmat Ullah Shinkiari Amir Khan Afridi 98 (HUP), Oghi top, alt. 1,574 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 221 (HUP), Near Paras, alt. 1,610 m, 28.07.2014, Asmat Ullah, Amir Afridi and Syed Mushraf Shah 329 (HUP), on way to Manoor Valley, 1,823 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 441 (HUP).

108

World Distribution: Asia (India), Europe, Africa, C. America (Mexico). N. America, Australasia (Australia, New Zealand), Hawaii

Note: New to the study area.

Leptogium Gray,

Thallus foliose to squamulose, rarely shrubby, gelatinous, lobate; lobes variable, separate or occasionally imbricate, elongate or short, 3-15 mm wide; apices rotund to oblong; upper surface blue gray to brown or black, dull or shiny, smooth or often strongly wrinkled, occasionally with isidia, phyllidia or lobules, but pseudocyphellae and soredia absent; lower surface smooth or wrinkled, hair present, sometimes with scattered tufts of rhizines or hapters; ascomata apothecia, laminal, sessile to shortly stalked; disc brown or red brown, concave to flat, not pruinose; epihymenium colourless to reddish brown; hymenium colourless; hypothecium colourless or pale yellowish. Secondary metabolites: none. Substrate: on bark, rocks sometimes on soil, often among mosses.

The genus has a total of 180 species from world while previously seven species are reported from Pakistan and five species from study area. The present study recorded four species from District Mansehra (Plate 3.11).

Key to species

1a. Thallus isidiate……………………………………………………...... 2

1b. Thallus not isidiate……………………………………………..……...…4

2a. Lobes lower surface without white gray tomentum…….L. cyanescens

2b. Lobes lower surface with white gray tomentum………………...……3

3a. Isidia granular, thallus oliveoues black…………………...L. saturnium

3b. Isidia cylindrical coroliod, thallus blue gray…………….....L. burnetiae

109

4a. Spores ellipsoid, thallus slightly wrinkled…………...…L. hildenbrandi

4b. Spores fusiform, thallus strongly wrinkled…………...…Leptogium sp.

1. Leptogium burnetiae C.W. Dodge, Beih. Nova Hedwigia 12: 120 (1964)

Thallus foliose, loosely adnate, lobate, 3-9.5 cm in diameter; lobes 3-12 mm wide, elongate, plane, separate, apices rotund; upper surface gray to bluish gray, dull to shiny, isidiate; isidia usually laminal to marginal, scattered to dense, concolourous or darker than thallus, simple or branched, often clustered; lower surface smooth, with dense white tomentum of cylindrical hairs; apothecia rare, 0.5-2.0 mm in diameter, laminal; disc brown, plane to convex; hymenium 95-130 µm tall; paraphysis unbranched; asci 8-spored, clavate; ascospores colourless, ellipsoid to subfusiform, 28.5-43.5 x 11-17.5 µm in diameter.

Habitat: On bark (Corticolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimens Examined: Naran, alt. 2,815 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 371 (HUP), Manoor Valley, alt. 2,488 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Isalam 443 (HUP), Lalazar, alt. 2,863 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah, 582 (HUP), Shogran, alt. 2,390 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 662 (HUP), on way to Saripaya, alt. 2,568 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 710 (HUP).

World Distribution: Europe, Africa, Asia, North America.

Note: New to the study area.

110

2. Leptogium cyanescens (Rabenh.) Körb., Syst. lich. germ. (Breslau): 420 (1855)

Thallus foliose, adnate, 2.5-7.0 cm in diameter, lobate; lobes irregular, elongate, surface smooth, separate, 2-3.5 mm wide, apices: rotund, entire, occasionally upturned;, upper surface pale bluish gray, smooth to somewhat wrinkled, isidia abundant, laminal to marginal, cylindrical or flattened, concolourous with thallus; lower surface pale gray, smooth, with scattered tuft of white hairs; apothecia rare, sessile or shortly stalked; disc brown, concave to plane; hymenium 90-120 µm tall; asci 8-spored, clavate; ascospores colourless, ellipsoid to fusiform, 17-22 x 6.5-9.5 µm. not seen in study specimen.

Habitat: On bark (Corticolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimens Examined: On way to Manoor Valley, alt. 2,568 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 445 (HUP), Shogran, alt. 2,319 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 663 (HUP), on way to Saripaya, alt. 2,520 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah, 713 (HUP).

World Distribution: Asia, Europe, Africa, N. America, C. America (Panama, Mexico, Guatemala), N. America, Australasia, Pacific.

3. Leptogium hildenbrandii (Garov.) Nyl., Act. Soc. linn. Bordeaux 21: 272 (1856)

Thallus foliose, 5-8.5 cm in diameter, rosette-forming, lobate; lobes to 0.5 mm, more or less imbricate, partly overlapping rather thick, apices round; upper surface deep blue or black gray, irregularly wrinkled and striate; lower surface white, tomentose with thick rhizine tufts; apothecia 2-2.5 mm

111

in diameter, abundant, laminal, immersed when young, become emergent; disc red brown; exciple: thin, brown-grayish; ascospores 15-23.5 x 8-10 µm, muriform.

Habitat: On trees trunk (Corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Dader, alt. 1,257 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad, 75 (HUP), Near Paras, alt. 1,543 m, 27.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 330 (HUP), Naran, alt. 2,791 m, 29.07.2014, Asmat Ullah, Amir Afridi and Syed Juneed Shah 375 (HUP), on way from Naran to Jalkhad, alt. 2,547 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 509 (HUP), Lalazar, alt. 2,922 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 589 (HUP).

World Distribution: Asia, Europe (Scotland), North America, Africa

4. Leptogium saturninum (Dicks.) Nyl., Act. Soc. linn. Bordeaux 21: 272 (1856)

Thallus foliose, orbicular, 2-7.5 cm in diameter, lobate; lobes 2-8.5 mm wide, regularly rounded; upper surface dark olive-black, usually dull, isidia: laminal scattered to dense, usually granular; lower surface paler, with white tomental hairs; apothecia rare, to 1.5-2.0 mm diameter; ascospores ellipsoid, colourless, muriform, 19-23.5 x 8-10 µm.

Habitat: On bark (Corticolus)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

112

Specimen Examined: Naran, alt. 2,550 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 376 (HUP), Manoor Valley, alt. 2,572 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 452 (HUP), on way to Saripya, alt. 2,622 m, 02.04.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 715 (HUP).

World Distribution: Asia, Europe (Scotland), N. America, Africa (S. Africa, Morocco), C. America (Mexico), N. America, S. America (Chile), Caribbean, Australasia, Pacific (Hawaii).

113

Plate 3.10: A. Collema flaccidum B. Collema furfuraceum, C. Collema subflaccidum (scale= 2 cm) in District Mansehra.

114

Plate 3.11: A. Leptogium burnetiae, B. Leptogium cyanescens, C. Leptogium hildenbrandii, D. Leptogium saturninum (Scale= 2cm) in District Mansehra.

115

8. Graphidaceae

Thallus crustose, cortex absent or amorphous, attached to the substratum by hyphae. Apothecia simple or branched, usually more or less immersed, lirellifom or roundish, single or aggregate, spores colourless or brown, septate to muriform. Habitat: trees, Distribution: Temperate to tropical.

Genus in study area: The present study reported single genus of family from District Mansehra (Fig. 4.14).

Graphis Adans.

Thallus crustose, continuous, immersed, rimose to areolate; upper surface white, pale gray, dull, occasionally pale yellow to olive green, without isidia or soralia; ascomata apothecia, immersed, lirellate, simple, branched or stellate; disc dark brown, smooth, often with whitish pruina true exciple usually black, opaque, prominent and well developed; hymenium colourless, 55-285 µm tall; paraphyses parallel, tip pale brown, weakly branched, rarely hyaline; asci clavate to subcylindrical, 1-8-spored; ascospores colourless but sometimes pale brown, submuriform or muriform, oblong with rounded end. Secondary metabolites: none detected. Substrate: On bark but sometimes on rocks or other substrats.

The genus has a total of 320 species from world and previously three species are reported from Pakistan. The present study recorded two species as new to District Mansehra (Plat 3.12).

Keys to species

1a. Thallus K+ red, spore thin walled…………………………...G. eleganas

1b. Thallus K-, spore thin walled……………………………………………2

2a. Lirellate black, disc narrow…………………………………….G. scripta

116

2b. Lirellat white, disc slit like……………………………………Graphis sp.

1. Graphis elegans (Borrer ex Sm.) Ach., Syn. meth. lich. (Lund): 85 (1814)

Thallus crustose, continuous; surface whitish green to green gray, dull or slightly shiny, smooth to uneven, without isidia and soralia; apothecia lirellate, raised from thallus, simple or branched, straight or curved; lirellae 1-3.5 x 0.25-5; disc slit like, mostly narrow and not visible; epihymenium brown, 5-8.5µm high; hymenium colourless, not inspersed, 90-110 µm thick; asci clavate, 8-spored, 90-125 x 20-30 µm; ascospores colourless, fusiform-cylindrical, transversel septate, 10-13 locular, 32-65 x 8- 15 µm in diameter.

Habitat: On bark (Corticolous)

Spot test: Thallus K+ red, Pd+ orange,

Secondary metabolites (TLC): Connorstictic acid, Norstictic acid,

Specimen examined: Manoor Valley, alt. 2,552 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Isalm 453 (HUP).

World Distribution: Asia (Pakistan), Europe, Papa New Guinea

Note: New to study area

2. Graphis scripta (L.) Ach., K. Vetensk-Acad. Nya Handl. 30: 145 (1809)

Thallus crustose, smooth or slightly uneven; upper surface whitish green to green-gray, dull; apothecia lirellate, raised from the thallus; lirellae 1-2.5 x 0.1-0.3 mm, oblong, flexuous and branched; disc narrow, dark gray to brown, whitish pruinose; exciple: poorly developed; epihymenium brown, 4-9 µm thick; hymenium 80-95 µm tall, not inspersed; paraphyses 1.0-1.5

117

thick, tip brown or yellowish brown; asci clavate, 8-spored, 80-90 x 15-20 µm; ascospores fusiform-cylindrical, 25-55 x 6.5-10 µm, 7-10 septate.

Habitat: On bark (Corticolous)

Spot tests: K-, C-, KC-, Pd-,

Secondary metabolites (TLC): None detected,

Specimen examined: Manoor Valley, alt. 2,659 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 447 (HUP); On track to Saripaya, alt. 2,708 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 705 (HUP).

World distribution: Asia, Europe, N. America, S. America, Africa,

Note: New to study area.

Fig. 4.14: Distribution of Graphidacea in District Mansehra; 1.Manoor Valley, 2. On track to Saripaya.

118

Plate 3.12: A. Graphis elegans, B. Graphis scripta (Scale= 2 cm) in District Mansehra.

119

9. Lecanoraceae

Thallus crustose or squamulose, corticated or non-corticated, attached to substratum by hyphae; apothecia lecanorine; asci 8-spored; spores colourless, unicellular or septate. Habitat: rocks, soil and trees. Distribution: cosmopolitan.

Genera in study area: In the present study three genus of family were recorded from District Mansehra (Fig. 4.15).

Key to Genera

1a. Thallus Squamulose, apothecia rounded to irregular, immersed to sessile……………………………………………………………Rhizoplaca

1b. Thallus Crustose or Leprose…………………………………………….2

2a. Apothecia sessile or rarely immersed, disc variously colored, pruinose or epruinose…………………………………………....Lecanora

2b. apothecia sessile, constricted at base, disc brown-black, plane to strongly convex…………………………………………………...Lecidella

Lecanora Ach.

Thallus crustose, granular, areolate, or placodioid or peltate, rarely immersed; prothallus: blackish brown, whitish gray, or not visible; surface white, gray, yellow or brown, with or without soredia, isidia absent; ascomata apothecia, sessile or rarely immersed; disc variously coloured, pruinose or epruinose; hypothecium colourless or pigmented; epihymenium pigmented, with or without crystal; hymenium colourless; hypothecium colourless or pale; paraphyses simple or apically branched, apices slightly swollen to capitate; asci Lecanora-type, clavate, 8-spored; ascospores colorless, simple, ellipsoid to subglobose, rounded at apices.

120

Secondary metabolites: usnic acid, atranorin, xanthones. Substrate: rock, barks

This lichen genus is cosmopolition in distribution consisting of 600 member species from world. Previously 32 species are reported from Pakistan while the present study reported 10 species from District Mansehra (Plate 3.13 and Plate 3.14).

Key to species:

1a. Thallus K+ yellow, whitish gray or yellow green…………………...... 2

1b. Thallus K-, whitish or yellowish green ……………………………...... 7

2a. Apothecia disc pruinose…………………………………………………3

2b. Apothecia dis epruinose or slightly pruinose…………………..……..4

3a. Apothecia disc whitish or grayish pruinose, apothecia sessile………………………………………………………...…...L.rupicola

3b. Apothecia disc bluish pruinose, apothecia constricted at base………………………………………………………….…Lecanora sp.

4a. Epihymenium brown, crystal abundant…………..……...…..L. censisia

4b. Epihymenium red brown or dark brown ……………………...………5

5a. Apothecia disc dark brown, epihymenium with few crystals…………………..……………………………………..L. argentata

5b Apothecia sisc red brown, epihymenium lacking crystal…………….6

6a. Thallus dispersed areolate…………………………………L. pseudistera

6b. Thallus granular verrucose…………………………………Lecanora sp

7a. Apothecia lecanorine, sporee broadly ellipspoid…….……L. polytrapa

121

7b. Apothecia biatorine, spores narrowly ellipsoid……….….Lecanora sp.

8a. on calciferous rock………………………………………….……,………9

8b. On soil, bark or mosses……………………………………...……….…10

9a. Apothecia margin thick, often discontinuous……………Lecanora sp.

9b. Apothecia margin thin or thick, not discontioous……….….L. dispersa

10a. Apothecia Pd+ red orange…………………………………...…………11

10b. Apothecia Pd-…………………………………………………..………..12

11a. Apothecia 0.4-1.5 mm in diameter…………………………...... L. albella

11b. Apothecia 0.7-3.0 mm in diameter………………………….Lecanora sp.

12a. Epihymenium egranulose…………………………………...…………13

12b. Epihymenium granulose…………………………………….…………14

13a. Apothocia large, constricted at base………………………..L. allophana

13b. Apothecia small, adnate……………………………………..Lecanora sp.

14a. Epihymenium with fine granules……………………………...………15

14b. Epihymenium with coarse gtanules……………………………..……16

15a. Apothecia dark brown to red brown………………………...L. pulicaris

15b. Apothecia orange brown …………………………………....Lecanora sp.

16a. Thallus smooth to verrucose, apothecia margin smooth……………………………………….………………...L. chlarotera

16b. Thallus verrucose to granulose, apothecia margin verrucose………………………………………………………….Lecanora sp.

122

1. Lecanora albella (Pers.) Ach., Lich. univ.: 369 (1810)

Thallus crustose, continous or rimose-areolate; prothallus present, white; areoles flat, opaque, thin, ecorticate; upper surface pale to medium gray, smooth, epruinose, esorediate; apothecia lecanorine, sessile, dispersed to closely aggregate, 0.4-1.5 mm in diameter; disc yellowish brown or pale pink, flat to convex, pruinose; epihymenium brown to dark brown, interspersed with granules dissolving in K; hymenium colourless, clear, 60- 80 µm tall; paraphyses apically slightly thickened, not pigmented; hypothecium colourless, without oil droplets; asci 8-spored, clavate; ascospores colourless, ellipsoid, simple, 10-13.5 x 6.5-8.5 µm.

Habitat: On bark (Corticolous)

Spot Tests: K+ yellow, Pd+ orange to red,

Secondary Metabolites (TLC): Atranorine, Chloroatranorin, Norstictic acid, Protocetraric acid, Salazinic acid, Stictic acid,

Specimen Examined: Batal, alt. 1,700 m, 02.02.2014, Asmat Ullah and Mazhar ul Islam 179 (HUP), Manoor Valley near forest rest house, alt. 2,549 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-islam 449 (HUP), Shogran, alt. 2,289 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 667 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Algeria, Morocco), C. America (Mexico), N. America (USA), S. America (Chile, Brazil), Hawaii.

Note: New to the study area.

2. Lecanora allophana (Ach.) Nyl., Flora, Regensburg 55: 250 (1872)

123

Thallus crustose, continuous or verrucose-areolate; areoles flat or verruculose, opaque, thin or thick, ecorticate; surface yellowish white to yellowish gray, smooth or rough, epruinose; apothecia lecanorine, 0.6-2.5 mm in diameter; disc red brown, plane, epruinose; epihymenium red- brown to orange-brown, without crystals; hymenium colourless; paraphyses slightly thickened apically; hypothecium colourless, without oil droplets; asci 8-spored, clavate; ascospores colourless ellipsoid, simple, 15.5- 19.5 x 8.0-11.0 µm.

Habitat: On wood and bark (Corticolous)

Spot Tests: K+ yellow, Pd- or Pd+pale yellow

Secondary Metabolites (TLC): Atranorin, Chloroatranorin.

Specimens Examined: Shinkari near forest college rest house, alt. 1,352 m, 10.11.13, Asmat Ullah and Amir Khan Afridi 97 (HUP), near Batal, alt. 1,555 m, 02.02.2014, Asmat Ullah and Mazhar-ul-Islam 180 (HUP), Kaghan, alt. 2,339 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 377 (HUP), Manoor Valley, alt. 2,600 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam , 481 (HUP), Shogran, alt. 2,368 m, 26.07.2015, Asmat Ullah, Amir Afridi and Syed Juneed Shah 669 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco), C. America (Mexico), N. America (Canada, USA), S. America (Argentina), Pacific (Hawaii, Tuamotu)

3. Lecanora argentata (Ach.) Röhl., Deutschl. Fl. (Frankfurt) 3(2): 82 (1813)

Thallus crustose, continuous or rimose-areolate; prothallus white, well developed; areoles flat, thin, opaque, ecorticate; surface yellow-to green- white, smooth, epruinose; apothecia lecanorine, sessile, 0.5-1.5 mm in diameter; disc red brown, plane, epruinose; epihymenium red-brown to

124

orange-brown, without crystals; hymenium colourless, clear; paraphyses red-brown to orange-brown, thickened or capitate apically; hypothecium colourless, without oil droplets; asci 8-spored, clavate, 44-50 x 18-21 µm; ascospores colourless, ellipsoid, simple, 11-15 x 6.5-8.6 µm.

Habitat: On wood and bark (Corticolous)

Spot Test: Thallus K+ yellow, Pd+ yellow.

Secondary Metabolites (TLC): Atranorin, Chloroatranorin,

Specimens Examined: On way to Naran, alt. 2,478 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 378 (HUP), On way to Manoor Valley, alt. 2,395 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 455 (HUP), Shogran, alt. 2,313 m, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 670 (HUP), Saripaya, alt. 2,531 m, Asmat Ullah, Amir Afridi and Syed Juneed Shah 752 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Algeria), C. America (Mexico, Guatemala), N. America (USA), S. America (Brazil), Australasia (New Zealand, Australia).

4. Lecanora cenisia Ach., Lich. univ.: 361 (1810)

Thallus crustose, continous or verrucose-areolate; areoles flat or verrucose, thin or thick, ecorticate; upper surface yellowish whitish to yrllowish gray, smooth or rough, epruinose; apothecia lecanorine, sessile, strongly constricted below, 0.5-1.2 mm in diameter; disc red brown or dark brown to gray-brown, plane, sometimes white pruinose; epihymenium red-brown to orange-brown, with granules dissolving in K; hymenium clear, 60-90 µm tall; paraphyses apically slightly swollen, not pigmented; hypothecium colourless, without oil droplets; asci 8-spored, clavate; ascospores colourless, broadly ellipsoid, simple, 9-17 x 6.5-8.5 µm.

125

Habitat: On rocks (Saxicolous)

Spot Tests: K+ yellow, C-, KC-, Pd-

Secondary Metabolites (TLC): Atranorine, Chloroatranorine

Specimen Examined: Dader, alt. 1,360 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Malik Zahir 37 (HUP), Mandagucha, alt. 1,309 m, 13.11.2013, Asmat Ullah and Mazhar-ul-Islam, 106 (HUP), Oghi, alt. 1,586 m, 14.04.2014, Asmat Ullah, Amir Afridi and Kaleem Shah 231 (HUP), Hasa Balakot, alt. 1,152 m, 25.05.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 281 (HUP).

World Distribution: Asia, Europe, Africa (Morocco), C. America (Mexico), N. America, S. America (Argentina), C. America (Mexico) Hawaii.

Note: New to the study area

5. Lecanora chlarotera Nyl., Bull. Soc. linn. Normandie, sér. 2 6: 274 (1872)

Thallus crustose, continuous or rimose-areolate or verrucose-areolate; areoles flat, thin or thick, ecorticate; upper surface pale gray or sometimes yellow gray, smooth or rough, epruinose; apothecia lecanorine, often aggregated, sessile, 0.4-1.0 mm diameter; disc red-brown or orange-brown, flat, epruinose; epihymenium red-brown to orange-brown; hymenium colourless, clear; paraphyses simple or sparsely branched, thickened apically, not pigmented; hypothecium colourless, without oil droplets; asci: 8-spored, subcylindrical to elongate-clavate, 65-80 x 10-15 µm; ascospores colourless, ellipsoid or broadly ellipsoid, simple, 12.5-14.5 5.5-7 µm.

Habitat: On bark, wood (Corticolous)

126

Spot Tests: Thallus K+yellow, Pd- or Pd + orange to red

Secondary Metabolites (TLC): Atranorine, Chloroatranorin,

Specimen Examined: Kaghan, alt. 2,192 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 380 (HUP), On way to Ansoo Lake, alt. 2,914 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 497 (HUP), near Batakundi, alt. 2,866 m, 01.10.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 626 (HUP), Shogran, alt. 2,331 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 674 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco), C. America (Mexico), N. America, S. America, Caribbean, Hawaii.

Note: A new record to Pakistan.

6. Lecanora dispersa (Pers.) Röhl., Deutschl. Fl. (Frankfurt) 3(2): 96 (1813)

Thallus crustose, immersed or occasionally consisting of scattered granules; upper surface white to pale gray; apothecia scattered or aggregated into group, sessile, constricted below, 0.2-1.0 mm in diameter; disc pale brown, dark brown, smooth, epruinose; epihymenium yellow or brown, densely interspersed with granule; hymenium colourless, 65-95 µm tall; paraphyses branched, apices swollen, brownish; hypothecium colourless; asci 8- spored, clavate; ascospores colourless, ellipsoid, simple, 7.5-11.5 x 3.5-5.5 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Apothecial disc K-, C-, KC-, Pd-

Secondary Metabolites (TLC): 2, 7-dichlorlichexanthone

127

Specimen Examined: Balakot, alt. 1,183 m, 26.04.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 295 (HUP), Paras, alt. 1,600 m, 28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 350 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, N. Africa), C. America (Mexico), N. America, S. America (Chile, Bolivia, Argentina), Pacific, Antarctica.

7. Lecanora polytropa (Ehrh.) Rabenh., Deutschl. Krypt.-Fl. (Leipzig) 2: 37 (1845)

Thallus crustose, immersed or dispersed granules or areoles, occasionally forming a continuous areolate crust; prothallus black when present; areoles irregular, weakly convex, ecorticate, 0.1-0.3 mm in diameter; upper surface yellow-green, occasionally gray green, esorediate; apothecia scattered or often clustered, rounded to irregular, sessile, constricted below, 0.3-1.0 mm in diameter; disc pale yellow to pale yellow green, convex; epihymenium colourless to red-brown, with granular crystals; hymenium colourless to pale yellow, 45-60 µm tall; paraphyses colourless, weakly branched, apices slightly thickened; hypothecium pale yellow, 45-50 µm thick; asci 8-spored, clavate, 30-50 x 11.5-16 µm; ascospore colourless, ellipsoid, simple, 9.5-13.5 x 5-6.5 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Thallus KC+ yellow

Secondary Metabolites (TLC): Usnic acid and Zeorine

Specimen Examined: Dader, alt. 1,220 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Malik Zahir 23 (HUP), Oghi top, alt. 1,464 m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 256 (HUP), on way to lake Saif-ul-Maluk, alt. 2,795 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 405 (HUP), Jalkhad, alt. 3,171 m, 10.08.2014,

128

Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 501 (HUP), Lalazar, alt. 2,873 m 11.09.2014, Asmat Ullah, Amir Afridi and Syed Juneed Shah 591 (HUP).

World Distribution: Asia, Europe, C. America (Mexico), N. America, S. America, Australasia (Australia, New Zealand), Pacific (Hawaii), Antarctica.

Note: New to the study area.

8. Lecanora pseudistera Nyl., Flora, Regensburg 55: 354 (1872)

Thallus crustose, verrucose-areolate or dispersed-areolate; areoles thin or thick, ecorticate; upper surface whitish gray to gray, smooth, epruinose, esorediat; apothecia lecanorine, sessile, 0.5-1.5 mm in diameter; disc red brown, plane, epruinose; epihymenium red brown to orange-brown, without crystals; hymenium clear, colourless; paraphyses slightly thickened or capitate apically, red-brown to orange-brown; hypothecium colourless, without oil droplets; asci: 8-spored, clavate; ascospores: colourless, ellipsoid, simple, 9-13 x 6-7 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: C-, K+ yellow, KC-, Pd-,

Secondary Metabolites (TLC): Atranorin, Chloroatranorin

Specimens Examined: Dader, alt. 1,234 m, 10.10.2013, Asmat Ullah, Amir Afridi and Syed Muhammad 11 (HUP), Mandaguch, alt. 1,914 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 140 (HUP), Oghi top, alt. 1,527 m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 257 (HUP).

World Distribution: Asia, Europe, Africa, N. America, Australisia.

Note: New to the study area.

129

9. Lecanora pulicaris (Pers.) Ach., Syn. meth. lich. (Lund): 336 (1814)

Thallus crustose, verrucose-areolate; prothallus present, white; areoles thin, opaque, flat, ecorticate; upper surface yellowish white or whitish gray to gray, smooth or rough, epruinose, esorediate; apothecia lecanorine, 0.35-1.6 mm in diameter sessile or adnate; disc brown or dark brown, plane, epruinose; epihymenium red-brown to orange-brown; hymenium colourless; hypothecium without oil droplets colourless; asci 8-spored, clavate; ascospores simple, colourless ellipsoid or broadly ellipsoid, 10-14 x 6.5-9.0 µm.

Habitat: On bark or wood (Corticolous)

Spot Tests: K+ Pd+ orange to red or Pd-

Secondary Metabolites (TLC): Atranorin, Chloroatranorin,

Fumarprotocetraric acid

Specimen Examined: Manoor Valley, alt. 2,499 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 454 (HUP), Shogran, alt. 2,330 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 671 (HUP), On track to Saripya, alt. 2,544 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 709 (HUP).

World Distribution: Asia, Europe, Africa (N. Africa, S. Africa), N. America, Pacific.

Note: A new recode to Pakistan.

10. Lecanora rupicola (L.) Zahlbr., Cat. Lich. Univers. 5: 525 (1928)

Thallus crustose, continous, areolate to warted-areolate; prothallus ocassionally present, white; areoles opaque or glossy, thin or thick, flat, subrounded to angular, ecorticated; upper surface pale gray or pale yellow,

130

smooth, epruinose; apothecia present, 0.5-1.5 mm in diameter, subimmersed to sessile; disc brown or black, flat, sometimes convex, densely pruinose; epihymenium brown-gray; hypenium colourless, 55-60 µm tall; paraphysis simple, not capitate; hypothecium colourless, 95 µm tall, without oil droplets; asci: lecanora-type, 8-spored, clavate; ascospores colourless, ellipsoid, simple, 9-14 x 5-7 µm in diameter.

Habitat: On rocks (Saxicolous)

Spot tests: ThallusK+ yellow, C-, KC-, Pd-.

Secondary metabolites: (TLC): Atranorine, Chloroatranorine, Roccellic acid, Thiophanic acid

Specimen Examined: On way to lake Saif-ul-Maluk, alt. 2,892 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 406 (HUP), Manoor Valley, alt. 2,851 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 484 (HUP), Barhawai, alt. 2,989 m, 01.10.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 605 (HUP), Kiwai, alt. 1,378 m, 22.08.2015, Asmat Ullah and Amir Khan Afridi 766 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco), S. America (Argentina), N. America, New Zealand, Hawaii.

Note: New to the study area.

Lecidella Korb., Syst. Lich. Germ.: 233 (1855).

Thallus crustose, leprose or crustose, granulose or rimose; prothallus absent or present, black to blue black; upper surface white, gray, green, yellow, brownish yellow; ascomata apothecia, sessile, usually constricted at base; disc brown-black plane to strongly convex; exciple colourless, yellow, orange, green, gray, olivaceous; epihymenium green, bluish green, brown to black; hymenium colourless; hypothecium colourless, yellow, orange to

131

brown; asci Lecanora-type, clavate, 8-spored; ascospores colourless, broadly ellipsoid to ellipsoid, simple, lacking distinct perispore, 7-17 x 6-9 µm. Secondary metabolites: atranorine, chloroatranorin, zeorin, xanthones. Substrate: soil, wood, bark, rocks, bryophytes.

This genus represented 50 species from the world and previously five species are reported from Pakistan. The present study recorded two species from District Mansehra (Plate 3.15).

Key to Species

1a. On bark or wood…………………………………………………….…....2

1b. On rocks………………………………………………………………..….3

2a. Thallus K + yellow………………………………………..…...L. euphorea

2b. Thallus K-…………………………………………………...…Lecidella sp.

3a. On calcareous rocks, exciple blue green……………………L. stigmatea

3b. On siliceous rocks, exciple brown or green brown……….Lecidella sp.

1. Lecidella euphorea (Flörke) Hertel, in Hawksworth, James & Coppins, Lichenologist 12(1): 107 (1980)

Thallus crustose, granulose, rimose to areolate, 0.25-0.45 mm thick; upper surface yellowish to gray white, whitish to yellowish gray, smooth, without soredia or isidia; apothecia abundant, orbicular, sessile, slightly constricted at base, 0.7-1.0 mm in diameter; disc black, plane, epruinose; exciple bluish to greenish black; epihymenium: blackish green to bluish green, with or without crystals; hymenium colourless, 55-70 µm tall; paraphyses simple; hypothecium reddish brown; asci Lecanora-type, clavate, 8-spored; ascospores colourless, ellipsoid to ovoid, simple, 7.5-15.5 x 5-9.5 µm.

132

Habitat: On bark (Corticolous)

Spot Tests: Thallus KC+ yellow,

Secondary Metabolites (TLC): Usnic acid, Zeorin

Specimens Examined: On way to Kaghan, alt. 2,030 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 381 (HUP), Shogran, alt. 2,319 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 672 (HUP).

World Distribution: Asia, Europe, Africa, N. America (California, Arizona), S. America (Venezuela, Peru, Chile), C. America (Mexico), Australasia (Australia, New Zealand).

Note: New to the study area.

2. Lecidella stigmatea (Ach.) Hertel & Leuckert, Willdenowia 5: 375 (1969)

Thallus crustose, thin, strongly rimose to areolate; prothallus rarely present, grayish black; upper surface white to pale gray, finely granulose, without soredia or isidia; apothecia sessile, flat or rarely convex, 0.8-1.5 mm in diameter; disc black, plane, epruinose; exciple greenish black to blackish green; epihymenium bluish green, hymenium colourless, 60-80 µm tall; paraphyses simple, slightly thickened apically; hypothecium colourless or rarely brown; asci Lecanora-type, clavate, 8-spored; ascospores colourless, ellipsoid to ovoid, simple, 10.5-16.5 x 5.5-9.0 µm,

Habitat: On rocks (Saxicolous)

Spot tests: Thallus K+ yellow, K-

Secondary Metabolites (TLC): Atranorin, Zeorin

133

Specimen Examined: Dader, alt. 1,221 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 08 (HUP), Oghi top, alt. 1,485 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 232 (HUP), Naran, alt. 2,400 m, 29.07.2014, Asmat Ullah, Amir Afridi and Syed Juneed Shah 383 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco), N. America, S. America (Chile, Peru, Argentina, Venezuela), C. America (Mexico), Pacific (Hawaii), Antarctica.

Note: New to study area.

Rhizoplaca Zopf, Mitt.

Thallus squamulose, pulvinate, or peltate-umbilicate, monophyllous or polyphyllous, margins entire to lobed; upper surface pale greenish yellow, to slightly brownish, or white, soredia, isidia absent; lower surface greenish yellow brownish or white; ascomata apothecia, rounded to irregular, laminal to marginal, immersed to sessile; exciple colourless; hymenium: colourless or yellowish to orange; asci 8-spored, clavate, Lecanora-type; ascospores ellipsoid, non-septate. Secondary metabolites: usnic acid, aliphatic acid, β-orcinol depsidones, β-orcinol depsidones or triterpenoids. Substrate: rock but some species occur on soil.

This genus has eight species from the world and three species from Pakistan. The present study recorded three species from District Mansehra (Plate 3.16).

Key to Species

1a. Thallus yellowish gray, apothecia disc orange red…….R. Chrysoleuca

1b. Thallus brown gray or yellowish brown, apothecia disc dark brown to black or dark brown……………………………………..…………….2

134

2a. Thallus yellowish brown, apothecia disc blouish brown…...... R. melanophthalma

2b. Thallus brown gray, apothecia disc dark brown.…..………...R. peltata

1. Rhizoplaca chrysoleuca (Sm.) Zopf, Justus Liebigs Annln Chem. 340: 291 (1905)

Thallus upto 2.0-3.0 cm across, umblicate, monophyllous, deeply lobed or polyphylous; lobes plane to concave, crenate-incised; upper surface pale greenish or light gray to whitish, smooth or powdery; apothecia numerous, laminal or sub-marginal, adnate then sessile, constricted at base, 0.6-2.5 mm in diameter; disc reddish orange, plane to convex, weakly to densely pruinose; hymenium yellow or orange, 45-60 µm tall; ascospores 9.0-12.5 x 3.5-6 µm, ellipsoid to oblong-ellipsoid.

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla C-, C+ red, KC- or KC+ red, Pd- or Pd+ yellow, upper cortex: K- or K+ yellow, KC+ yellow

Secondary Metabolites (TLC): Usnic acid, Placodiolic acid or Aliphatic acid

Specimen Examined: Manoor Valley, alt. 2,682 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 486 (HUP), Jalkhad, alt. 3,233 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 503 (HUP), Behsal, alt. 3,293 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 535 (HUP).

World Distribution: Asia, Europe, N. America, C. America (Mexico).

Note: New to the study area.

135

2. Rhizoplaca melanophthalma (DC.) Leuckert, Nova Hedwigia 28: 72 (1977)

Thallus up to 0.5-2.0 cm wide, polyphyllous or rarely monophyllous, deeply lobed; lobes coarsely crenate-incised, thin, plane to concave, edges plane or turn down, upper surface greenish yellow, dull to shiny, occasionally pruinose; lower surface blue black near edges, smooth to uneven, umbilicus broad; apothecia 0.4-1.5 mm diameter, immersed then sessile; disc yellowish brown, olive, or greenish, concave to plane or undulate, epruinose or pruinose, hymenium: colourless, outermost parts often covered with granules; paraphyses greenish brown, capitate; ascospores 7.5-11 x 4.0-7.0 µm, ellipsoid to subglobose.

Habitat: On rocks (saxicolous)

Spot Tests: Medulla: C- or C+ red, Pd- or Pd+ yellow, cortex KC+ yellow

Secondary Metabolites (TLC): Usnic acid

Specimen Examined: Manoor Valley, alt. 2,584 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 456 (HUP), Jalkhad, alt. 3,173 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 506 (HUP).

World Distribution: Asia, Africa (Kenya, Morocco, Ethiopia), Europe, North America, South America (Argentina, Venezuela), C. America (Mexico), Antarctica.

Note: New to the study area.

3. Rhizoplaca peltata (Ramond) Leuckert & Poelt, Nova Hedwigia 28(1): 73 (1977)

Thallus upto 2.5 cm across, umbilicate, usually monophyllous, sometimes strongly lobed; lobes plane to slightly concave, edges: turn downward;

136

upper surface greenish yellow to yellow, epruinose to partly pruinose; apothecia usually common, upto 2-3 mm diameter, immersed to adnate; disc orange yellow or reddish brown, concave, plane sometime convex; hymenium colourless, inspersed with granules; paraphyses tips colourless, capitate; ascospores 8-10.5 x 5.5-8.5 µm, ellipsoid to subglobose.

Habitat: On rocks (Saxicolous)

Spot Tests: Upper cortex KC+ yellow, medulla P+ orange.

Secondary Metabolites (TLC): Usnic acid, Zeorine

Specimen Examined: Lalazar, alt. 2,600 m, 11.10.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 592 (HUP).

World Distribution: Asia, Africa, Europe, North America

Note: New to the study area.

137

Plate 3.13: A. Lecanora albella, B. Lecanora argentata, C. Lecanora cenisia (scale= 2cm) in District Mansehra.

138

Plate 3.14: A. Lecanora pseudistera, B. Lecanora pulicaris, C. Lecanora rupicola (scale= 2 cm) in District Mansehra.

139

Plate 3.15: A. Lecidella euphoria, B. Lecidella stigmatea (scale= 0.5 cm) in District Mansehra.

140

Plate 3.16: A. Rhizoplaca chrysoleuca, B. Rhizoplaca melanophthalma C. Rhizoplaca peltata (scale= 0.5 cm) in District Mansehra.

141

10. Lecidaceae

Thallus crustose or squamulose; apothecia biatorine, without a thalline margin; ascospores colourless or brown, unicellular to muriform. Habitat: trees, soil, rocks. Distribution: worldwide.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.16).

Porpidia Körb.

Thallus crustose, thick, continuous to areolate-cracked; prothallus present or absent, black or orange; areoles gray, white or orange, corticated; ascomata apothecia, partially immersed to sessile, scattered or clustered, up to 4 mm in diameter; disc black, flat sometime pruinose; epihymenium olive gray or or brown; hymenium colourless, or below pale green; hypothecium colourless; hypothecium dark brown; asi Porpidia-type, 8- spored, clavate to subcylindrical; ascospores colourless, ellipsoid to broadly ellipsoid, simple, perispore well developed, up to 7 µm thick. Secondary metabolites: Stictic acid, norstictic acid, constictic acid or none. Substrate: rocks rarely on wood.

A total of 16 species of the genus are reported from globe while two species from Pakistan. The present study recorded one species from District Mansehra (Plate 3.17).

1. Porpidia crustulata (Ach.) Hertel & Knoph, in Hertel, Beih. Nova Hedwigia 79: 435 (1984)

Thallus crustose, effuse, thin, continous to areolate; prothallus occasionally present, black to brown; areoles irregularly; upper surface white, greenish gray, rarely tinged orange; apothecia abundant, small, round, sessile, constricted at base, 02-1.0 mm in diameter; disc black, dull, plane to convex, occasionally weakly pruinose; exciple thin, black; epihymenium

142

olivaceous to pale brown, hymenium: 60-85 µm tall, colourless below, dark brown above; hypothecium pale brown to dark brown; asci 8-spored , clavate, 50-80 x 9.5-18 µm; ascospores colourless, ellipsoid, simple, 10-17 x 5-8.5 µm.

Habitat: On siliceous rocks (saxicolous)

Spot Tests: Thallus K- or K+yellow, Pd- or Pd+orange

Secondary metabolites (TLC): Stictic acid, norstictic acid, constictic acid

Specimen Examined: Above lake Saif-ul-Maluk, alt. 3,465 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 438 (HUP), Jalkhad, alt. 3,182 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 511 (HUP).

World Distribution: Asia, Europe, N. America (Alaska), S. America (Chile, Argentina, Venezuela), Africa (S. Africa, Morocco, Algeria), Australasia (Australia, New Zealand).

Fig. 4.16: Distribution of Lecidaceae in District Mansehra; 1. Jalkhad, 2. above Lake Saif-ul-Maluk.

143

Plate 3.17: Porpidia crustulata (scale= 2 cm) in District Mansehra.

144

11. Megasporaceae

Thallus crustose, subfruticose, subfoliose; ascomata immersed; disc flat; asci thicked walled, 1-6 spores/ascus; ascospores variable in size, colourless, single cell and 2-layed wall. Habitat: rocks, soil, bark and wood.

Genera in study area: The present study recorded two genus; Aspicillia Lobothalia from District Mansehra (Fig. 4.17) Key to genera

1a. Apothecia disc black to brown black, white pruinose, epihymenium green to olive or brown………………………………………… Aspicilia

1b. Apothecia disc redish brown, pruinose or not, epihymenium pale brown…………………………………………………………….Lobothalia

Aspicilia A. Massal.

Thallus crustose, smooth to areolate, without marginal lobes; areoles round, angular, or sometimes irregular, concave to flat convex to verrucose; upper surface chalk white, gray, green or brown, in some species soredia or isidia are present, cephalodia absent, sometimes pseudocyphellae present; acomata apothecial, aspicilioid, one to several per areole, normally immersed, sometimes becoming emergent or sessile and rarely appearing lecanorine, round to angular, occasionally elongated or irregular; disc flat to concave, black to brown black sometimes white pruinose; epihymeniumgreen to olive or brown; hymenium hyaline, usually more than 90 µm tall; hypothecium colourless, asci clavate, 2-8 spored; ascospoes hyaline, globose to ellipsoid, simple, 16-25 µm long. Secondary metabolites: norstictic acid and stictic acid. Substrate: usually on rocks, rarely on bark, wood and soil.

The genus has a total of 200 species from the world and six species from Pakistan. The present study recorded two species from District Mansehra.

145

Key to species:

1a. On rocks, ascus 8 spored……………………………………………..….2

1b. On rocks, Ascus 2-6 spored……………………………..…A. desertorum

2a. Spores size larger than 20µm…………………………….…Aspicilia sp.

2b. Spores in size 15-20µm long…. ………………………….…….A.cinerea

1. Aspicilia cinerea (L.) Körb., Syst. lich. germ. (Breslau): 164 (1855)

Thallus crustose, warted-areolate, to 2.5 -7.5 cm in diameter, up to 0.55 mm thick; areoles angular or occasionally irregular, flat to convex, somewhat uneven, 0.5 1.0 mm in diameter, separated by distinct cracks; prothallus absent; upper surface grey to white gray, or white, occasionally with yellowish ting, dull or somewhat shiny; apothecia aspicilioid, slightly concave to flat, 0.3-1.1 mm in diameter, 1-2 per areole; disc black, concave, sometimes plane, without pruina; epihymenium brown to olive brown, without crystals; hymenium hyaline, 90-125 µm tall; hypothecium colourless, 75-110 µm tall; asci clavate, 8-spored, 50-95 x 15-28 µm; ascospores hyaline, simple, ellipsoid, 11-19 x 8-12 µm in diameter.

Habitat: On exposed rocks (Saxicolous)

Spot Tests: Medulla K+ red, C-. Pd+ yellow-orange,

Secondary Metabolites (TLC): Norstictic acid

Specimen Examined: Mandaghucha, alt. 1,890 m, 13.11.2013, Asmat Ullah and Mazhar-ul-Islam 110 (HUP), lake Saif-ul-Mulak, 3,236 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneedd Shah 433 (HUP), Jalkhad, alt. 3,165 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 504 (HUP), Bahsal, alt. 3,299 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 527 (HUP).

146

World Distribution: Asia, Europe, Africa (S. Africa, Morocco), Australasia (New Zealand, Australia), S. America (Brazil, Argentina) C. America (Mexico).

2. Aspicilia desertorum (Kremp.) Mereschk., Trudi naturh. Ver. ksl. Univ. Kasan 43: 36 (1911)

Thallus areolate to verrucose, 1-5 mm in diameter, 0.1-0.5 mm thick; areoles angular to rounded, flat to convex, 0.3-1.7 mm in diameter; prothallus rarely present, sparsely developed along the thallus edge, black or olive black, 0.1-0.3 mm wide; upper surface brown to olive brown, sometimes gray brown, gray white or gray, dull or shiny; apothecia aspicilioid, 0.3-0.6 mm in diameter,1-3 per areole, round elongated or irregular; disc black, concave, occasionally flat, usually with white pruina; epihymenium olive brown to brown, sometimes green, with crystals; hymenium hyaline, 125- 200 µm; asci clavate, 2-6 spored, 70-140 x 22-35 µm; ascospores hyaline, globose to subglobose, simple, 20-32 x 17- 27 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Cortex and Medulla K-, P-, C-.

Secondary Metabolites (TLC): Aspicilin

Specimen Examined: Dader near Siran river, alt. 1,200 m, 10.10.2013, Asmat Ullah, Amir Afridi and Syed Muhammad 05 (HUP), Mundaghucha, alt. 2,082 m, 13.11.2014, Asmat Ullah and Mazhar-ul-Islam 108 (HUP), Oghi top, alt. 1,559 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 225 (HUP), Balakot, alt. 1,126 m, 25.04.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah, 283 (HUP), Paras near the bank of Kunhar river, alt. 1,317 m, 27.07.14, Asmat Ullah, Syed Mushraf Shah and Amir Khan Afridi 326 (HUP).

147

World Distribution: Asia, Europe (Ukraine, Greece and Russia), N. America and C. America (Mexico).

Note: New to study area.

Lobothallia (Clauzade & Cl. Roux) Hafellner, Acta Bot. Malacitana 16(1): 138 (1991).

Thallus placodioid, up to 2.5-6 cm or more across, lobate at margin; lobes tightly attached, plane to convex; upper surface gray to white, brown, or black, continuous to rimose; apothecia up to 2.0 mm in diameter, rounded to irregular, immersed to sessile; disc redish brown, pruinose or not, plane or convex; epihymenium: pale brown; hymenium colourless; paraphyses unbranched; hypothecium colourless to pale gray or brown; asci 8-spored, oblong ellipsoid; ascospores simple, colourless, ellipsoid or oblong, 8.5— 14.5 x 6-10.5 µm. Secondary metabolites: norstictic, constictic acid. Substrate: on rocks.

The genus has four species from globe while previously three species from Pakistan and two from study area. In the present study two species are reported from District Mansehra.

Key to species

1a. Marginal lobes overlapping……………………………………….….…2

1b. Marginal lobes not overlapping………………………….Lobothallia sp.

2a. Marginal lobes flat, not easily separated from substrate…………………………………………………...... L. praeradiosa

2b. Marginal lobes convex easily separated from substrate………………………………………….………..….L. alphoplaca

1. Lobothallia alphoplaca (Wahlenb.) Hafellner, Acta bot. Malac. 16(1): 138 (1991)

148

Thallus placcodioid, up to 2 cm in diameter, areolate in center; prothallus absent or occasionally present, black; areoles to 1-1.5 mm wide, flat, discrete, becoming crenate-lobed; lobes radiating and separarate, imbricate, more often strongly convex, overlapping; uppers surface grayish brown, smooth or wrinkled; lower surface pale or darker brown; apothecia numerous, 0.7-1.5 mm in diameter, flat, sub sessile, not pruinose; disc dark brown to black, shiny; epihymenium green; hymenium colourless, 65 µm tall; hypothecium colourless; paraphyses simple; asci 55-70 x 18-23 µm, oblong-ellipsoid; ascospores colourless, ellipsoid, 10-15 x 5.5-8.5 µm, simple.

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla, K+ red, Pd+ orange, cortex: K+red or K-, Pd + orange or Pd-

Secondary Metabolites (TLC): Norstictic and constictic acid

Specimens Examined: Oghi top, alt. 1,347 m, 15-04-14, Asmat Ullah, Amir Afridi and Kaleem Shah 205 (HUP), Lalazar, Naran, alt. 2,941 m, 11-09- 14, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 509 (HUP), Shogran, alt. 2,313 m, 26-07-2015, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 666 (HUP).

World Distribution: Asia, Europe, N. Africa (Morocco, Algeria), C. America (Mexico), S. America (Argentina), N. America (Alaska), Australisia (Australia).

2. Lobothallia praeradiosa (Nyl.) Hafellner, Acta bot. Malac. 16(1): 138 (1991)

Thallus pacodioid, areolate to areolate-granulose, rosettes, often irregular; areoles up to 1 mm wide, contiguous to scattered, plane to convex, lobes contiguous, plane, imbricate, closely attached, irregularly arranged; upper

149

surface brownish gray or reddish gray, epruinose, weakly maculate; lower surface pale at lobes tips or not visible; apothecia numerous, 1-1.5 mm in diameter, sessile, rounded; disc brown to black, plane to convex; epihymenium pale brown; hymenium colourless, 65-75 µm tall; asci 60-70 x 15-20 µm, oblong ellipsoid; ascospores colourless, ellipsoid to ovoid, 10- 13.5 x 6.5-9.0 µm, simple.

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla K+ red, Pd+ orange cortex: K+Yellow-red, Pd +orange

Secondary Metabolites (TLC): Norstictic acid, constictic acid

Specimens Examined: On way to Naran, alt. 2,701 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 374 (HUP), on way to Lake saif ul Maluk, alt. 2,680 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah, 409 (HUP), Shogran, alt. 2,355 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 711 (HUP).

World Distribution: Asia (Magnolia), Europe, North America (USA) N. Africa, C. America (Mexico).

150

151

12. Mycoblastaceae

Thallus crustose; prothallus present sometime; ascomata apothecial, lecanorine or aspicilliod-lecanoroid. Substrate: rocks, wood, barks and lichen thalli.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.18)

Tephromela Choisy, Bull. Soc. Bot. France 76: 522 (1929).

Thallus crustose, warted or rimose-cracked-areolate; surface pale gray or yellow-green; ascomata apothecia, usually sessile, sometimes stipitat; disc black, cup like to strongly convex; exciple thin; epihymenium usually with purplish pigment; hymenium colourless below, purple to green above; paraphyses simple or sparingly branched, apices not swollen but pigmented hood; hypothecium ochraceous to brown below; asci 8-spored, clavate, Bacidia-type; ascospores colourless, simple, ellipsoid, without a distinct perispore. Secondary metabolites: atranorine in cortex, depsidones in medulla. Substrate: rock, occasionally on bark and wood,

The genus has a total of 30 species from globe and single specie from Pakistan. The present study recorded single specie from District Mansehra (Plate 3.18).

1. Tephromela atra (Huds.) Hafellner, Lichenes Neotropici, Fascicle VII (nos 251-300) (Neumarkt) 7: no. 297 (1983)

Thallus crustose, continuous to areolate, often warted; prothallus occasionally present, black; areoles 0.2-1.3 mm wide, flat to convex, subrounded to subangular; upper surface white to pale gray green, smooth, not pruinose; apothecia abundant, round or irregular, immersed or sessile, flat to slightly convex, 0.7-1.3 mm in diameter; disc black; epihymenium dark red-brown; hymenium 50-120 µm tall, purple brown;

152

hypothecium colourless to pale brown, 100-145 µm tall; asci 8 spored, narrowly clavate; ascospore colourless, ellipsoid, simple, 10.5-14.5 x 5.5-8 µm.

Habitate: On rocks

Spot Tests: Cortex K+ yellow, medulla Pd-

Secondary Metabolites (TLC): Atranorine, Alectoronic acid.

Specimen Examined: On way to Lake Saif ul maluk, alt. 2,767 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 413 (HUP), Manoor valley, alt. 2,723 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul - Islam 493 (HUP).

World Distribution: Asia, Europe, Africa, North America, South America, Australasia, Pacific (Hawaii, Tuamotu), Antarctica.

Note: New to the study area

Fig. 4.18: Distribution of Mycoblastaceae in District Mansehra; 1. Manoor Valley, 2. on way to lake Saif-ul-Maluk.

153

Plate 3.18: Tephromela atra (scale= 0.5 cm) in District Mansehra.

154

13. Nephromataceae

Thallus foliose well developed cortex; ascomata apothecia, cup-shaped; ascospores brown, aseptate. Substrate. On mossey ground, rocks and trees. Distribution: wide spread in distribution.

Generain study area: The present investigation recorded single genus from District Mansehra (Fig. 4.19).

Nephroma Ach.,

Thallus foliose, spreading, dorsiventral, , rosette forming or rarely fragmented, loosely attached, 2-9.5 cm wide, lobate; lobes irregular, broadly elongate; apices rounded to slightly elongate, often ascending at margins, eciliated; upper surface gray brown to brown, with or without isidia, soredia, pruinose or not; lower surface pale brownish to brown, pubesent or tomentose; ascomata apothecia, sessile or rounded to reniform,; disc pale brown to dark brown; epihymenium brown; hymenium 55-85 µm tall, colourless; hypothecium colourless paraphyses unbranched; asci Peltigera-type, 8-spored; ascospores pale brown, subfusiform to fusiform, thin walled, 3-septate. Secondary metabolites: hopane triterpenoids, and depsides. Substrate: on bark, rock or soil.

This genus has 36 species from the world while the present study recorded one specie from District Mansehra (Plate 3.19).

1. Nephroma parile (Ach.) Ach., Lich. univ.: 522 (1810)

Thallus foliose, 3-8.5 cm wide, loosely adnate, forming rosettes or fragmentary, lobate; lobes spreading, broad, elongate, thin; apices entire or subcrenulate, rarely ascending; upper surface dark red brown, shiny or pubescent, epruinose; soredia marginal or laminal, granular; lower surface pale brown, smooth to regulose, nacked or weakly pubescent; apothecia rare, up to 7.5 mm in diameter; disc light brown; exciple colourless or light

155

brown, 20-28 µm thick; epihymenium brown or brownish; hypothecium colourless; asci 8-spored; ascospores light brown, subfusiform, 3-septate, 17.5-20 x 5.5-6.5 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla K+ yellow

Secondary Metabolites (TLC): Hopane, Zeorine

Specimen Examined: Manoor Valley near forest rest house, alt. 2,566 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 464 (HUP), Batakundi, alt. 2,641 m, 01.10.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 628 (HUP), Shogran, alt. 2,314 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 682 (HUP), Shogran on the side of track to Saripaya, alt. 2,528 m ,27.7.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 739 (HUP).

World Distribution: Asia, Europe, N. America (Alaska, USA), S. America (Chile, Argentina) C. America (Mexico).

Note: A new record to Pakistan.

156

Fig. 4.19: Distribution of Nephromataceae in District Mansehra; 1. Batakundi, 2. Manoor Valley near forest rest house, 3.Shogran.

Plate 3.19: Nephroma parile (scale= 1 cm) in District Mansehra.

157

14. Parmeliaceae

Thallus foliose, dorsiventral; attached to substratum with rhizine; apothecia, lecanorine; spores colourless, unicellular.Habitat: trees, rocks. Distribution: Cosmopolitan

Genera in study area: The present study recorded 12 genera from District Mansehra (Fig. 4.20).

Key to genera

1a. Thallus foliose…………………………………………………………….2

1b. Thallus Fruticose…………………………………………………....Usnea

2a. Growing mostly on barks rarely on rocks……………………….……..3

2b. Growing on barks, wood, rocks, soil……………………………...……6

3a. Rhizine absent………………………………………………..Hypogymina

3b. Rhizine present………………………………………………..………….4

4a. Upper surface with or without soredia, isidia maculae…..…...... 5

4b. Upper surface yellow green or gray, without soredia, isidia, maculae……….. ….…………………………………………..Parmeliopsis

5a. Ascospores ellipsoid or subglobose, 9-13 x 5-8 µm in diameter……………………………………………………….…Parmelina

5b. Ascospore ellipsoid, thin walled, 5.5-20 x 4-12 µm in diameter……………………………………………………….Melanohalea

6a. Rhizine simple, concolorous with lower surface…………….………..7

6b. Rhizine, simple, black brownish to pale, black, black to pale…….….8

158

7a. Lower surface shiny to dull, ascospores 9-18 x 4.5-10.5 µm………………………………………………………………...Melanelia

7b. Lower smooth to wrinkled, ascospores 6-16 x 4-10 µm……………………………………………………….…..Flavopunctelia

8a. Upper surface gray to gray green with or without soralia or isidia………………………………………………………………………..9

8b. Not as above

9a. Disc pale to dark brown, ascospores 10-25 x 7-16 µm in diameter…………………………………………………………..Punctelia

9b. Disc pale brown to black, ascospores 10-15 x 6-10 µm in diameter…………………………………………………………...Parmelia

10a. Apothecia, sessile, orbicular, laminal, cup shaped…..…..Canoparmelia

10a. Apothecia, sessile to semi-stalked, laminal…………………………...11

11a. Ascospores, simple, thin walled, 12-20 x 6-10 µm in diameter……………………………………………………..Flavoparmelia

11b. Ascospores, simple, 7-13 x 4-7 µm in diameter………..Xanthoparmelia

Canoparmelia Elix & Hale

Thallus foliose, 2.5-11.5 cm across, closely adnate to adnate, dorsiventral, lobate; lobes sublinear to subirregular, narrow, 0.6-7.5 mm wide; apices subrotund to rotund, eciliate; upper surface pale gray to greenish gray, emaculate, with or without isidia, soredia, pseudocyphellae absent; lower surface black, attachment by simple rhizines, lobe margin with a narrow, pale erhizinate; rhizine simple, tufted or not; ascomata apothecia, laminal, orbicular, cup-shaped, sessile; exciple gray or hyaline; hypothecium hyaline; epihymenium brown or brownish yellow; asci lecanoral, 8-spored;

159

ascospores simple, ellipsoid, 7-20 x 4-9 µm in diameter. Secondary metabobolites: atranorine, chloroatranorine, aliphatic acid, orcinol depsides, anthraquinones. Substrate: mostly on bark or rocks.

A total of 45 species of the genera were reported from the world while one specie from Pakistan. The present study recorded single specie from District Mansehra (Plate 3.20).

1. Canoparmelia texana (Tuck.) Elix & Hale, in Elix, Johnston & Verdon, Mycotaxon 27: 279 (1986)

Thallus foliose, closely adnate, 4-9 cm in diameter, lobate; lobes sublinear, elongate, plane to subconvex, 2.5-4.5 mm wide; pices rotuned, eciliate; upper surface mineral gray, smooth to rugose, dull, maculate, sorediate; soredia granular, whitish, laminal to marginal; lower surface black, rhizinate; rhizines black, simple, short, sparse to moderately dense; apothecia rare, 2.0-4.5 mm in diameter, adnate, laminal on thallus; disc brown, plane; epihymenium 10-12 µm thick; hymenium 35-40 µm tall; asci 8-spored clavate, 24-32 x 12-18 µm; ascospores colourless, ellipsoid, simple, 8-11 x 5-8 µm.

Habitat: On bark (Corticolous)

Spot Tests: Cortex K+ yellow, C-, KC-, Pd+ yellow, medulla K-, C-, KC+ reddish, Pd- .

Secondary Metabolites (TLC): Atranorin, Divaricatic acid

Specimen Examined: On way to Kaghan, alt. 1,995 m, 29.07.2014,Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 382 (HUP), Manoor valley near Forest rest house, alt. 2,572 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 457 (HUP), Shogran, alt. 2,314 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 675 (HUP),

160

Saripaya, alt. 2,810 m, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 718 (HUP).

World Distribution: Asia (India, Thailand, Sumatra, Japan, Taiwan) Africa, South America, Thailand, Java, Sumatra, Japan, India, Australia,

Note: New to the study area

Flavoparmelia Hale

Thallus foliose, dorsiventral, 2.5-20 cm wide, loosely to closely appressed to substrum, lobate; lobes irregular, roughly rounded, ascending imbricate to confluent, cilia absent; upper surface yellow green to green, smooth, plane to rouglose, often with soredia or pustules, epruinose; lower surface black, rhizinate, frequently with brown margin; rhizines simple, sparse to moderately abundant, black or pale towards lobes apices; ascomata apothecial, laminal, up to 10 mm wide, sessile or semi-stalked; disc red- brown; exciple gray or colourless; epihymenium brown or brownish yellow; hypothecium colourless; asci lecanoral, 8-spored; ascospores simple, 12-20 x 6-10 µm, ellipsoid, wall thin, colourless. Secondary metabolites: usnic acid, protiocetraric acid rarely atranorin, chloroatranorin, antraquinones. Substrate: bark, rocks, dead wood.

A total of 35 species of the genus are reported from the world while one specie from Pakistan. The present study recorded single specie from District Mansehra (Plate 3.21).

1. Flavoparmelia caperata (L.) Hale, Mycotaxon 25(2): 604 (1986)

Thallus foliose, 5-20 cm in diameter, adnate to loosely adnate, irregularly lobate; lobes 5-12 mm wide, subirregular, elongate, separate, contiguous to somewhat imbricate; apices rotund, crenate; upper surface yellow green or sometimes green gray, dull to somewhat shiny, epruinose, sorediate;

161

soredia granular to wart like, laminal; lower surface black centrally, brown at apices, rhizinate; rhizines simple, black, somewhat brown or white tipped; apothecia not seen in the study specimen.

Habitat: On bark (Corticolous)

Spot tests: Medulla K+ yellow, Pd+ red,

Secondary Metabolites (TLC): Usnic acid, Protocetraric acid, Caperatic acid.

Specimen examined: Dader, alt. 1,199 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Malik Zahir 38 (HUP), Manoor Valley near forest rest house, alt. 2,562 m, 03.08.14, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 458 (HUP), Lalazar, alt. 2,935 m, 11.09.14, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 586 (HUP), Shogran, alt. 2,333 m, 26.07.15, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 677 (HUP).

World Distribution: Asia (Nepal, India, Tiawan, Japan) Europe, North America, C. America (Mexico, South America, Africa, Australasia.

Note: New to the study area

Flavopunctelia (Krong) Hale

Thallus foliose, up to 15 cm in diameter, dorsiventral, adnate to loosely adnate, lobate; lobes linear to broadly rounded, eciliate, plane, contiguous, up to 7.5 mm in diameter; upper surface greenish yellow to yellowish- green, smooth to wrinkled pseudocyphellae punctiform, with or without isidia or soredia; lower surface pale tan to black, smooth to wrinkled, rhizinate; rhizines simple, generally concolorous with lower surface, absent in broad marginal zone; ascomata apothecia, laminal, sessile to substipitate; disc pale to dark brown; asci lecanora-type, 8-spored; ascospores colourless,

162

round to ellipsoid, simple, 6-16 x 4-10 µm, Secondary metabolites: usnic acid, lecanoric acid. Substrate: on bark, rocks.

The genus has six species from the world and previosly two species are recorded from Pakistan.The present study reported two species from District Mansehra (Plate 3.22).

Key to species:

1a. Pseudocyphellae present, soralia marginal or laminal……………….2

2a. Pseudocyphellae absent, soralia marginal…………………...F. soredica

2a. Soralia marginal or submarginal capitate……………….....F. flaventior

2b. Soralia laminal…………………………………………..Flavpunctelia sp.

1. Flavopunctelia flaventior (Stirt.) Hale, Mycotaxon 20(2): 682 (1984)

Thallus foliose, 4-9.5 cm in diameter, closely adnate, lobate; lobes 2-6 mm wide, sublinear to subirregular, plane, contiguous; upper surface yellowish green to gray, to yellow-green, rugulose in centre, smooth , pseudocyphellate and sorediat; soralia marginal or submarginal, sometimes with white maculae; lower surface blacked to dark brown, rhizinate; rhizines black, few, sparse, tips white; apothecia rare, 2.5-6.5 mm in diameter, constricted at base; disc dark brown; epihymenium brown; hymenium 30-40 µm tall; asci 8-spored, clavate, 32-34 x 16-19 µm; ascospores simple, colourless, oval-ellipsoid, 14-18 x 6.5-9 µm.

Habitat: On bark (corticolous)

Spot Tests: Medulla C+ red, KC+ red,

Secondary Metabolites (TLC): Lecanoric acid, Usnic acid, Atranorin

163

Specimen Examined: Dader, alt. 1,196 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi, Syed Muhammad 80 (HUP), Manda Ghucha, alt. 1,854 m,14.11.2013, Asmat Ullah and Mazhar-ul-Islam 141 (HUP), Manoor Valley near Forest rest house, alt. 2,572 m, 04.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 487 (HUP).

World Distribution: India, Nepal, Europe, South America, North America.

Note: New to the study area.

2. Flavopunctelia soredica (Nyl.) Hale, Mycotaxon 20(2): 682 (1984)

Thallus foliose, up to 11 cm wide, closely adnate, lobate; lobes linear, sublinear or subirregular, plane, 3-7 mm with apices rounded, contiguous; upper surface pale green, yellowish green to greenish yellow, smooth to weakly wrinkled and rugose, soredia white, farinose to granular; lower surface dark brown to black, rhizinate; rhizines simple, black, short, occasionally with white tips, absent in marginal zone; apothecia rare, up to 2.5mm in diameter, constricted at base; disc dark brown, concave; epihymenium brown; hymenium 30-50 µm tall; asci 8-spored, clavate, 24- 30 x 16-20 µm; ascospores colourless, simple8-12 x 5-6.5 µm.

Habitat: On bark and wood

Spot Tests: Medulla C+ red, KC+ red

Secondary Metabolites (TLC): Lecanoric acid, Usnic acid

Specimen Examined: On the side of Naran road from Batakundi, alt. 2,333 m, 05.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 301 (HUP), Kaghan, alt. 2,098 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 384 (HUP), Manoor Valley, alt. 2,595 m, 04.08.2014, Asmat

164

Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 476 (HUP), Shogran, alt. 2,348 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 668 (HUP).

World Distribution: India, Japan, South Africa, South America, North America, Japan, Russia.

Hypogymina (Nyl.) Nyl.

Thallus foliose, up to 25 cm or more wide, lobate; lobes solid or hollow, irregular to linear and elongate, erect, contiguous or free, appressed, imbricate, tips pointed to rounded; upper surface gray or suffused brown, corticated, often with soredia or pustules, without isidia and pseudocyphellae; lower surface black, wrinkled, corticate, without rhizines; ascomata present or absent, apothecia, laminal on thallus, orbicular, cup- shaped, sessile or prominently stalked; disc red to yellow-brown, concave to flat; exciple gray or colourless; hpothecium colourless; epihymenium brown; asci lecanora-type, 8-spored; ascospores colourless, simple globose to shortly ellipsoid, 3.5-10 x 3-6 µm. Secondary metabolites: atranorin, chloroatranorin. Substrate: bark, wood, occasionally on rocks.

The above genus represents 80 species from the world while previously one specie is reported from Pakistan. The present study recoreded single taxa from District Mansehra.

1. Hypogymnia tubulosa (Schaer.) Hav., Bergens Mus. Årbok, Naturv. raekke no. 2: 31 (1918) [1917-1918]

Thallus foliose, up to 7 cm broad, erect to sub erect, lobate; lobes 2-3 mm wide, hollow, tubular and ascending, dichomoously branched; upper surface white to greenish gray, not pruinose; lower surface black, rhizines absent, central parts of thallus directly attached to substratum; apothecia: not seen in the study specimen.

Habitat: On bark or wood (corticolous)

165

Spot Tests: Medulla KC+ orange-red, cortex K+ yellow, Pd+ pale yellow,

Secondary Metabolites (TLC): Atranorin, Chloroatranorine, Physodic acid, 3-hydroxyphysodic.

Specimen Examined: Mandaghucha, alt. 1,850 m, 14.11.2013, Asmat Ullah and Mazhar-ul- Islam 142 (HUP), Paras, alt. 1,455 m, 27.07. 2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 331 (HUP), Manoor Valley, alt.2,341 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 459 (HUP), Paras (above River Kunhar), alt. 1,838 m, 05.08.2015, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 645 (HUP).

World Distribution: Asia, Europe, Africa (Kenya, Ethiopia, Morocco) North America (Canada, USA), C. America (Mexico).

Note: New to the study area.

Melanelia Essl.

Thallus foliose, dorsiventral, loosely to closely appressed, lobate; lobes short and rounded to elongate, moderately to loosely attached, margin without cilia; upper surface pale to dark brown, thin or fleshy, emaculate, with or without pseudocyphellae, soredia or isidia; lower surface pale tan to black, shiny to dull, rhizinate; rhizines simple, concolorous with lower surface; ascomata apothecia, sessile or short stalk, laminal; disc red brown to black-brown, concave to flat; asci 8-spored, clavate; ascospores colourless, ellipsoid to ovoid, simple, 9-18 x 4.5-10.5 µm. Secondary metabolites: unidentified brown pigmentlacking secondary substances or commonly with various para-depsides, orcinol or β-orcinol depsidones or aliphatic acid. Substrate: rocks bark or wood.

Previously the genus has three species from Pakistan while the present study recorded single specie from District Mansehra.

166

1. Melanelia disjuncta (Erichsen) Essl., Mycotaxon 7(1): 46 (1978)

Thallus foliose, closely appressed, up to 5.5 cm in diameter, lobate; lobes short and rounded, flat or shortly convex, broadened toward the tips, 0.5- 1.5 mm wide; upper surface dark brown-black, shiny toward margins, smooth or occasionally somewhat pitted near the lobe-ends, isidiate; isidia dark gray to black; lower surface very dark brown to black, rhizinate; rhizines simple, black, scattered; ascomata not seen in the study specimens.

Habitat: On rocks (saxicolous)

Spot Tests: Medulla K-, -C , KC-, Pd-

Secondary Metabolites (TLC): Perlatolic and Stenosporic acid.

Specimen Examined: On way to Jalkhad, alt. 2,700 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 508 (HUP).

World Distribution: Asia, Russia, Siberia Europe, Ireland, Africa (Kenya) North America, (Alaska).

Note: New to study area.

Melanohalea O Blanco, A. crespo, Divaker, Essl., D. Hawksw. & Lumbsch

Thallus foliose, dorsiventral, loosely to closely appressed, up to 7 cm diameter, lobate; lobes 0.5-7 mm wide, plane to concave, flat, apices rounded, margin without cilia; upper surface olivaceous brown, smooth to rugose, emaculate, isidia or soredia present or absent, pseudocyphellate present or absent; lower surface pale brown to black, flat, smooth, rhizinate; rhizines simple; ascomata apothecia sessile to subpedicillate, laminal; disc brown, concave to flat; asci 8-spored, broadly clavate; ascospores colourless, ellipsoid, thin walled, 5.5-20 x 4-12 µm. Secondary metabolites: depsidones in medulla. Substrate: bark, wood, rarely on rocks.

167

The above genera represented 19 species from the world and previously three species from Pakistan. The present study reported single taxa from District Mansehra.

1. Melanohalea elegantula (Zahlbr.) O. Blanco, A. Crespo, Divakar, Essl., D. Hawksw. & Lumbsch, Mycol. Res. 108(8): 882 (2004)

Thallus foliose, loosely to moderately adnate, to 5 cm in diameter, lobate; lobes flat, contiguous to imbricate, overlapping at center, to 2 mm wide; upper surface dark olive brown, usually matt, lacking pseudocyphellae, isidiate; isidia spread over most of the thallus, cylindrical, branched or unbranched; lower surface pale brown, rhizinate; rhizines pale brown or concolorous with lower surface, ascomata rare; ascospores ellipsoid, 7.5- 11.5 x 4-7 µm.

Habitat: On bark or wood (corticolous)

Spot test: All negative

Secondary metabolites (TLC): None detected

Specimen examined: Shogran, alt. 2,350 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah,725 (HUP).

World distribution: Asia, Europe, Scotland, Ireland, South America, North America, Africa, Morocco.

Note: New to the study area.

Parmelia Ach.

Thallus foliose, dorsiventral, loosely to tightly adnate, corticate on both side, 2.0-20.0 cm across, lobate; lobes 1.00-25 mm wide, sublinear to subirregular, with rounded, variously incised, eciliate margins; upper surface gray to gray green, shiny or dull, smooth to foveolate, with or

168

without soredia, isidia, lobules, pseudocyphellae effigurate or linear; lower surface black, uniformly rhizinate to margins; rhizines black, simple, furcated or squarrose; ascomata apothecia, laminal, sessile to pedicellat, 1- 20 mm wide; disc pale brown to black, rarely perforate; exciple gray or colourless; epihymenium brown or brownish yellow; hypothecium colourless; asci 8-spored, cylindrical; ascospores ellipsoid, 10-15 x 6-10 µm. Secondary metabolites: atranorin, chloroatranorin, orcinol depsides, orcinol depsidones, aliphatic acid. Substrate: on bark, wood, rock and soil.

A total of 38 species of the genus are reported from the world while previously three species from Pakistan. The present study recorded single taxa from District Mansehra (Plate 3.23).

1. Parmelia sulcata Taylor, in Mackay, Fl. Hibern. 2: 145 (1836)

Thallus foliose, adnate to loosely adnate, 4-18 cm in diameter, lobate; lobes sublinear, crowded to imbricate, 2-4.5 mm wide, apices truncate; upper surface whitish gray to dark gray, sometimes white pruinose, without isidia, pseudocyphellae laminal and marginal, discrete, forming ridges; soralia marginal and liminal, soredia granular; lower surface black, rhizinate; rhizines black, simple, up to 1.0 mm long; apothecia rare, up to 6.5 mm in diameter; disc dark brown; epihymenium brown, 9.5- 11.5 µm thick; hymenium: 30-35 µm high; asci 8-spored, cylindrical; ascospores colourless, oval, simple, 8.5-11.5 x 5-7 µm.

Habitat: On tree truck (tericolous)

Spot Tests: Medulla K+ yellow turning red, Pd+ orange, cortex K+ yellow, Pd+ yellow.

Secondary Metabolites (TLC): Atranorin, Salazinic acid, Consalazinic acid

169

Specimen Examined: From Kaghan to Naran, alt. 2,711 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 385 (HUP), near Behari village Manoor Valley, alt. 2,308 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 460 (HUP), Manoor Valley near forest rest house, alt. 2,514 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 482 (HUP), Shogran, alt. 2,322 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 678 (HUP), Saripaya, alt. 2,830 m, 27.07.2015,Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 731 (HUP).

World Distribution: Asia (India, Japan) Canada, Europe (Finland, France, Portugal) N. America, S. America (Chile, Argentina, Peru), C. America (Mexico), Australasia (Australia, New Zealand), Antarctica (S. Georgia).

Parmelina Hale

Thallus foliose, adnate to closely adnate, dorsiventral, circular, lobate; lobes 0.6-4.5 mm wide, flat, sub linear to sub irregular; apices subrotund to rotund, ciliate; cilia simple, slender; upper surface gray to gray green, with or without maculate, soredia, isidia, or pustules; lower surface black or dark brown, rhizinate; rhizines black, simple to squarrose; ascomata apothecia, laminal, sessile to subpedicellate up to 4.5 mm in diameter; disc brown, imperforate; exciple gray or colourless; epihymenium brown or brownish yellow; hypothecium colourless; asci 8-spored, clavate; ascospores simple, ellipsoid or subglobose, 9-13 x 5-8 mm. Secondary metabolites: atranorin, chloroatranorin, lecanoric acid. Substrate: on bark, rarely on rocks.

This genus has a total of 10 species from the world while previously two species are reported from Pakistan. The present study reported two species from District Mansehra.

170

Key genera

1a. Apothecia frequent, isidia absent……………………...……..P. quercina

1a. Apothecia rare, isidia present………………………………………...…2

2a. Isidia cylindrical……………………………………………….P. tilliaceae

2b. Isidia flattened………………………………………………Parmelina sp.

1. Parmelina quercina (Willd.) Hale, Phytologia 28: 483 (1974)

Thallus foiliose, closely adnate to adnate, 2-9.5 cm in diameter, irregular branched, lobate; lobes 1.5-3.5 mm wide, narrow, sublinear to subirregular, plane to convex, contiguous to imbricate; apices subrotund, ciliate; cilia simple; upper surface whitish gray to greenish gray, dull, sometimes partly pruinose, soredia, isidia and pustulae absent; lower surface black, rhizinate; rhizines black, simple to rarely squarrose; apothecia laminal, 1.5- 4.5 mm diameter; disc brown, imperforate; ascospores ellipsoid, simple, 6- 11.5 x 5-8.5 µm.

Habitat: On bark (corticolous)

Spot Test: Medulla C+ red, KC+ red, cortex K+ yellow

Secondary Metabolites (TLC): Atranorine, Lecanoric acid.

Specimen Examined: Mandgucha, alt. 1,802 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 144 (HUP), Manoor Valley near Forest rest house, alt. 2,498 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 461 (HUP), Shogran, alt. 2,320 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 679 (HUP).

171

World Distribution: Asia, Europe, (C. America (Mexico) N. America (USA), Africa (S. Africa, Socotra, Morocco), Australasia (Australia, New Zealand).

2. Parmelina tiliacea (Hoffm.) Hale, Phytologia 28(5): 481 (1974)

Thallus foliose, adnate, 4.5-11.5 cm across, lobate; lobes sublinear, irregularly branched, 2.5-6.5 mm wide; apices subrotund, margins crenate, ciliate; cilia simple, black, 0.3-1.0 mm long; upper surface pale grey, dull, white maculate, partly pruinose, isidiate; lower surface black, rhizinate; rhizines black, simple, 0.5-1.5 mm long; apothecia rare, sessile, 3.5 µm in diameter; disc dark brown, concave; epihymenium brown; 15-20 µm thick; hymenium 30-35 µm high; asci 8-spored, clavate; ascospores colourless, spherical to shortly ellipsoid, 7.5-11.5 x 5-7 µm.

Habitat: On bark of coniferous trees (corticolous)

Spot Tests: Medulla C+ red, KC + red, cortex K+ yellow,

Secondary metabolites (TLC): Atranorin, Lecanoric acid

Specimen Examined: Kaghan, alt. 2,215 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 386 (HUP), Naran, alt. 2,668 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 415 (HUP), Near Behari village, Manoor Valley, alt. 2,337 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 462 (HUP), Shogran toward Saripaya, alt. 2,494 m, 27.08.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 734 (HUP).

World Distribution: Asia (India, China) Europe, Africa (Sahara, S. Africa, Madagascar)

172

Parmeliopsis (Nyl.) Nyl.

Thallus foliose, dorsiventral, adnate, closely apressed, lobate; lobes linear to sublinear, discrete and divaricate, or contiguous to overlapping, thin; tip incised, eciliate; upper surface yellow green or gray, lacking isidia, maculae, pseudocyphellae, sorediate; lower surface whitish to pale or dark brown to black, rhizinate; rhizines usually concolorous with lower surface, moderately dense, simple or sparsely furcated; ascomata rare, apothecia, laminal, sessile to semi-stalked; disc pale to dark brown, concave, becoming flat, imperforate; true exciple gray or colourless; epihymenium pale brown, 5-30 µm; hymenium colourless, 30-55 µm high; paraphyses simple, hypothecium colourless; asci: Lecanora-type, 8-spored, clavate; ascospores simple, reniform to ellipsoid, obtuse at poles, with one end more pointed. Secondary metabolites: atranorine, usnic acid, divaricatic acid. Substrate: on bark, wood rarely on rock.

The genus represented four species from world while previously single taxa from Pakistan. The present study recorded one taxas from District Mansehra.

1. Parmeliopsis ambigua (Wulfen) Nyl., Lich. Lapp. Orient. 8: 121 (1866)

Thallus foliose, closely adnate, 1-4.5 cm diameter, forming small rosettes, lobate; lobes discrete, flat to concave, 1 mm wide; upper surface yellowish green, smooth, soralia laminal; lower surface pale brown to dark, rhizinate; rhizines simple, concolorous with lower surface, scattered; apothecia rare, sessile to shortly pedicillate, up to 1-1.5 mm in diameter; disc brown, flat or convex, epruinose; epihymenium pale brown, smooth; hymenium colourless, 50-55 µm high; ascospores 6.0-12.5 x 1.5-4.5 µm, ellipsoid or one end more pointed.

Habitat On bark (corticolous)

173

Spot Tests: Cortex KC+ yellow,

Secondary Metabolites (TLC): Usnic acid

Specimen Examined: Dader, alt. 1,220 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 81 (HUP), Mandagucha, alt. 1,809 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 145 (HUP), Oghi top, alt. 1,610 m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 260 (HUP), Balakot. alt. 1,217 m, 26.04.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 297 (HUP).

World Distribution: Asia, Europe, Africa (Morocco), C. America (Mexico), N. America (USA), South America, Australasia (Australia).

Note: New to the study area

Punctelia Krog

Thallus foliose, adnate to loosely adnate, heteromerous, lobate; lobes 3- 18 mm wide, subirregular to irregular, partly imbricate, margins entire or incised, apices rotund; upper surface gray to gray green, emaculate, pseudocyphellate, with or without soralia or isidia; lower surface white to pale black, rhizinate; rhizines rhizines: simple, brownish to pale, sparse to abundant; apothecia substipitate to stipitate, laminal; disc pale to dark brown; asci Lecanora-type, 8-spored; ascospores colourless, ellipsoid, simple, 10-25 x 7-16 µm. Secondary metabolites: atranorine, aliphatic acid, orcinol depsides. Substrate: barks.

Thi genus has a total of 30 species from the globe while previously single taxa from Pakistan. The present study reported single taxa from District Mansehra as new to Pakistan.

174

1. Punctelia subrudecta (Nyl.) Krog, Nordic Jl Bot. 2(3): 291 (1982)

Thallus foliose, 3-5 cm wide, rosette or irregular, loosely to closely adnate, lobate; lobes 1-2.5 mm wide, flat to concave, irregular; upper surface yellowish gray, usually shiny, smooth, sorediate, pseudocyphellae scattered, laminal, punctiform; soralia laminal; soredia farinose to very coarse; lower surface whitish to pale brown, smooth, rhizinate; rhizines concolorous with lower surface, simple, apothecia: not seen.

Habitat: On tree trunk (corticolous)

Spot Tests: Cortex K+ yellow, Medulla C+ red, KC+ red

Secondary metabolites: Atranorine, Lecanoric acid

Specimen Examined: Near Dader, alt, 1,252 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 16 (HUP), On the side of Kaghan and Naran road, alt. 2,178 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 387 (HUP), Naran, alt. 2,554 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 417 (HUP), Shogran, alt. 2,334 m, 26.07.2015, Asmat Ullah, Amir Khan Afrid and Syed Juneed Shah 680 (HUP), Saripaya, alt. 2,625 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 736 (HUP).

World Distribution: Asia, Europe, Australasia (Australia, New Zealand), Africa (S. Africa, Madagascar, N. Africa, E. Africa), Antarctica, Pacific (Hawaii).

Note: A new recorde to Pakistan

Usnea Dill. ex Adans.

Thallus fruticose, erect to pendant, filamentous, attached by holdfast, branched; branches primary branches tapering towards secondary branches, stout, smooth or faveolate, with or without, papillae,

175

pseudoisidia, fibrils, or soredia, isidomorphs, yellowish to pale greenish, blackened near holdfast; ascomata apothecia, sessile to pedicellate, lateral, subterminal or terminal, cup shaped; disc rounded, flat or concave, pruinose or not; asci Lecanora-type, elongate-clavate, 8-spored; ascospores colourless, simple, ellipsoid. Secondary metabolites: usnic acid, depsides, depsidones or fatty acid. Substrate: on trees.

This genus has 250 species from world while previously six species are reported from Pakistan. The present study recorded two species from District Mansehra.

Key to species

1a. Thallus with soralia, true isidia or isidiomorphs……………………...2

1b. Thallus without soredia………………………………….………………3

2a. Soralia irregular, crowded and coalescing………….….U. fulvoreagens

2b. Soralia regular, rounded, discrete…………………………….Unsea sp.

3a. Thallus with papillae, medulla K+ orange……………………U. florida

3b. Thallus without papillae, Medull K-………………………….Usnea sp.

1. Usnea florida (L.) Weber ex F.H. Wigg., Prim. fl. holsat. (Kiliae) 2: 7 (1780).

Thallus fruticose, erect, 2-9.5 cm long, usually isotomic-dichotomous, divergent, branches; basal part black, often with distinct annulations; branches main branches tapering segment, cylindrical and terete, papillae sparse to numerous, verrucose tubercles, fibercules absent, rare, fibrils 2-5 mm long, slender; apothecia numerous, terminal on main branches; disc flat, smooth or wrinkled, 0.5-2.0 cm in diameter; ascospores 9-11 x 5-7 µm, ellipsoid.

176

Habitat: On bark of Pinus trees

Spot Tests: Cortex KC- or KC+ rose, medulla K+ yellow, KC- or KC+ rose, Pd+ yellow- oranges

Secondary Metabolites (TLC): Thamnolic acid, alectorialic acid

Specimens Examined: Manoor Valley, alt. 2,505 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 463 (HUP).

World Distribution: Asia, Europe (Sweden, Norway, Denmark), Africa (Morocco, Socotra), N. America, S. America, C. America (Guatemala, Panama, Mexico), Pacific (Hawaii).

2. Usnea fulvoreagens (Räsänen) Räsänen, Lich. Fenn. Exs.: no. 13 (1935)

Thallus fruticose, erect, rarely subpendulous, 2-4.5 cm long, branching isotomic- to anisotomic-dichotomous, main branches cylindrical, to 1.5 mm diameter; basal part black, cylindrical and terete, papillae, verrucous, few to numerous, irregularly distributed; tubercles absent, fibercles absent, fibrils few to numerous, slender, soralia conspicuous, deeply excavate, typically reaching the central axis; apothecia not seen in the study specimens.

Habitat: On tress trunks (Corticolous)

Spot Tests: Thallus K+ yellow-red, Pd+ yellow- orange,

Secondary Metabolites (TLC): Usnic acid, Norstictic acid, Stictic acid

Specimens Examined: Shogran on way to Saripaya, alt. 2,438 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 730 (HUP).

177

World Distribution: Asia, Europe (Scotland, Ireland), N. America, C. America.

Note: New to the study area.

Xanthoparmelia Hale

Thallus foliose to subcrustose, dorsiventrally flattened, loosely to closely appressed, corticated on both sides, 3-10 cm in diameter, lobate; lobes irregular to linear, lobes tips subrotuned, lacking cilia; upper surface yellow-green to yellow, smooth to rugulose, epruinose, with or without isidia, soredia and dactyls, pseudcyphellae absent; lower surface black, brown or tan to light reddish brown, sparsely to densely rhizinate; rhizines simple, black or some shade of brown; ascomata apothecia, sessile or semi- stalked, laminal; disc red-brown to brown or black, imperforate, concave, exciple gray or colourless; epihymenium brown or brownish yellow; hypothecium colourless; asci lecanoral, 8-spored; ascospores colourless, ellipsoid, simple, 7-13 x 4-7 µm. Secondary metabolites: usnic acid, orcinol depsides, orcinol depsidones, β-orcinol depsides, aliphatic acid, antraquinones. Substrate: mostely on rocks, sometimes on soil.

This genus has 750 species distributed worldwide while previously four species are reported from Pakistan. The present study recorded two species from District Mansehra.

Key to species

1a. Medulla with major stictic acid norstictic acid and stictic acid major…………………………………………………….……X. conspersa

1b. Medulla with major salazinic acis………………………………………2

2a. Thallus loosely attached substratum, lobes more than 2mm wide………………………………………………...….Xanthoparmelia sp.

178

2b. Thallus tightly attached to substratum, lobes are less than 2 mm wide…...... X. tinctina

1. Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale, Phytologia 28: 485 (1974)

Thallus foliose, 4-11 cm in diameter, adnate to loosely adnate, lobate; lobes 1-2.5 mm wide, subirregular, elongate, plane to subconvex, contiguous to somewhat imbricate; apices subrotund to subtruncate, eciliate; upper surface yellow-green, smooth, isidiate; isidia numerous, laminal, initially globose and constricted at base or cylindrical, simple to coralloid branched; lower surface black, plane, rhizinate; rhizines black, simple, short; apothecia not seen in the study specimens.

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla K+ yellow to orange, C-, KC-, Pd+ orange

Secondary Metabolites (TLC): Usnic acid, stictic acid, constictic, norstictic acids

Specimen Examined: Dader, alt. 1,207 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 82 (HUP), Behsal, alt. 3,297 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 584 (HUP), above Lolosar Lake, alt. 3,570 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazar-ul-Islam 598 (HUP).

World Distribution: Asia (Turkey, Russaia, Japan), Europe (Finland, Belgium, Norway, Italy, Austraia, Hungary) Africa (N. Africa, S. Africa), N. America (USA, Canada), S. America, C. America,, (Guatemala, Mexico), Pacific (New Caledonia, Hawaii).

Note: New to the study area.

179

2. Xanthoparmelia tinctina (Maheu & A. Gillet) Hale, Phytologia 28: 489 (1974)

Thallus foliose, adnate, 2.5-8.5 cm in diameter, lobate; lobes 2-3 mm wide, irregular, somewhat elongate, plane to slightly convex, contiguous to slightly imbricate; apices subrotund, eciliate; upper surface yellow-green, smooth and shiny, isidiate; isidia frequent, globose to subcylindrical, laminal; lower surface black, plane, with sparse to densely rhizinate; rhizines simple, black, 0.2-0.5 mm long; apothecia not seen in the study specimens.

Habitat: On rocks (saxicolous)

Spot Tests: Cortex K-, C-, KC-, Pd-; medulla K+ red, C-, KC-, Pd+ red

Secondary Metabolites (TLC): Usnic acid, Salazinic acid, Consalazinic acid, norstictic acids

Specimen Examined: Dader, alt. 1,235 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 04 (HUP), Naran on way to Lake saif-ul-Maluk, alt. 2,700 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 419 (HUP).

World Distribution: Asia (Pakistan, India) Europe (France, Sweden, Spain, Italy, Portugal, Romania, Hungary, Greece, Bulgaria) Africa (Morocco, Algeria, E. Africa, S Africa), S. America (Argentina), N. America (Arizona), C. America (Mexico).

180

Plate 3.20: Canoparmelia texana in District Mansehra.

181

Plate 3.21: Flavoparmelia caperata (scale= 2 cm) in District Mansehra.

Plate 3.22: A. Flavopunctelia flaventior, B. Flavopunctelia soredica (scale= 2 cm) in District Mansehra.

182

Plate 3.23: Parmelia sulcuta (scale= 2 cm) in District Mansehra.

183

15. Peltigeraceae

Thallus subfruticose to foliose; lower surface non corticated or partly corticated attached to substratum with loose hyphae or rhizine; apothecia marginal and roundish, without thalline margin; acsi 2-8 spored; spores colourless or dark coloured, elongate, 1-many septate. Habitat: soil, over mosses and rocks. Distribution: Boreal to temperate.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.21).

Peltigera Willd.

Thallus foliose, 2-30 cm in diameter, lobate; lobes flattened and elongate, imbricate or separate, dichotomously branched, imbricate; tip rounded to subtruncate, ascending; upper surface bright green, blue gray, gray-brown or brown, dull or shiny, smooth, with or without soredia or isidia; lower surface brownish white, densely arachnoid-tomentose or with anastomosing pale or dark veins, rhizinate; rhizines simple, bushy or fasciculate; ascomata frequent, apothecia, ovoid, semi-immersed; disc red- brown to black, smooth, saddle-shaped, flat or oval; hymenium colourless below, brown above; paraphyses simple, septate, upper part brown; asci cylindrical, fissitunicate, 8-spored; ascospores colourless to pale brown, fusiform to acicular, 3-septate or occasionally many septate. Secondary metabolites: tenuiorin, gyrophoric acid, methyl gyrophate and hopane triterpenoids. Substrate: on soil and among mosses over rocks occasionally on tree trunks.

A total of 70 species of the genus are reported from world while previously six species from Pakistan.The present study recorded three species from district Mansehra (Plate 3.24).

184

Key to species

1a. Rhizines confluent…………………………………………….P. rufescens

1b. Rhizines separate…………………………………………………………2

2a. Apothecia disc flat, rhizines arrange in concentric lines……………………………………………………...…..P. horizontalis

2b. Apothecia tubular or saddle shaped, rhizines not in concentric lines………………………………………………………………….……..3

3a. Apothecia saddle shaped, thallus gray brown, vein brown……………………………………..……………….P. polydactyloon

3b. Apothecia tubular, thallus blue, vein blacking in center……………………………………………………….…Peltigera sp.

1. Peltigera horizontalis (Huds.) Baumg., Fl. Lips.: 562 (1790)

Thallus foliose, adnate, 5.5-9.0 cm in diameter, lobate; lobes elongatete, 2 cm wide and up to 4.5 cm long, imbricate; tips rounded to subtruncate; upper surface blue-gray, often tinged brown, shiny, smooth, without soredia and isidia; lower surface white, smooth, flattened veins becoming darker toward center, rhizinate; rhizines brown-black or black, fasciculate; apothecia rounded, up to 6.5 mm in diameter; disc red brown, flat; ascospores colourless to pale brown, 3- septate, 32-45 x 4-7 µm.

Habitat: Soil over mosses (tericolous)

Spot Tests: All negative

Secondary Metabolites (TLC): Tenuiorin, Gyrophoric acid, Methyl gyrophate

185

Specimen Examined: Manoor Valley near Bahari forest rest house, alt. 2,568 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmah and Mazhar-ul-Islam 466 (HUP).

World Distribution: Asia, Europe, British Isles, Africa, Australia and North America

2. Peltigera polydactylon (Neck.) Hoffm., Descr. Adumb. Plant. Lich. 1(1): 19 (1789) [1790]

Thallus foliose, adnate, 5-18 cm in diameter, lobate; lobes 1-1.5 cm wide and up to 4-5.5 cm long, imbricate; tips rounded to subtruncate, ascending; upper surface dark brown, shiny, smooth, without soredia and isidia; lower surface white, rhizinate; rhizines brown to black, bushy or fasciculate branched; apothecia: rare, up to 7 mm in diameter, round to oblong; disc pale to dark brown; ascospores colourless to pale brown, 3- septate, 45-68 x 3-4.5 µm.

Habitat: Soil over mosses (tericolous)

Spot Tests: All negative

Secondary Metabolites (TLC): Tenuiorin, Gyrophoric acid, Methyl gyrophate and Zeorine

Specimen Examined: Manoor Valley on way Ansoo Lake, alt. 2,700 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 488 (HUP).

World Distribution: Asia, Europe (England, Scotland), Africa (S. Africa, Tanzania, Morocco, Kenya) S. America (Brazil, Colombia, Argentina, Chile), N. America, C. America (Mexico), Australasia, Pacific.

186

3. Peltigera rufescens (Weiss) Humb., Fl. Friberg. Spec. (Berlin): 2 (1793)

Thallus foliose, rosette forming or fragmented, 5-18 cm in diameter; lobes 1 cm wide and up to 4.5 cm long, contiguous or somewhat overlapping; tips rounded, often ascending; upper surface grayish brown to brown, dull, smooth, white-gray pruinose, without isidia or soredia; lower surface; pale brown, with anastomosing brown veins, rhizinate; rhizines brown, fasciculate; apothecia frequent, up to 4.5 mm in diameter, oblong, saddle- shaped; disc red-brown to black, recurved; ascospores: 35-70 x 3-5 µm, colourless to pale brown, 3-5-septate.

Habitat: Soil (tericolous)

Spot Tests: All negative

Secondary metabolites: None detected.

Specimen Examined: Shogran on way to Saripaya, alt. 2,610 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 727 (HUP).

World Distribution: Asia, Europe, British Isles, North America, South America, C. America, Australasia (Australia, New Zealand), Pacific (Hawaii), Antarctica.

187

Fig. 4.21: Distribution of Peltigeraceae in District Mansehra; 1. Batakundi, 2. Manoor Valley near forest rest house, 3. Shogran.

188

Plate 3.24: A. Peltigera horizontalis, B. Peltigera polydactylon, C. Peltigera rufescens (scale= 2 cm) in District Mansehra.

189

16. Peltulaceae

Genera in study area: The present study recorded single genera from District Mansehara (Fig. 4.22).

Peltula Nyl.

Thallus crustose, areolate, squamulose, or subfruticose, dorsiventral, margin: minutely lobate to effigurate; upper surface olive green to olive brown, rarely black, corticated, with or without soredia; lower surface corticated, attached by an umbilicus, rhizohyphal weft or rhizines; ascomata apothecia, immersed; disc punctiform; asci 16-100 or more spores, clavate to obclavate, 65-160 x 8-30 µm; ascospores simple, hyaline, globose to ellipsoid, 3-12 x 2-6 µm. Secondary metabolites: none detected. Substrate: acidic or calcareous rocks or soil.

This genus has 40 species from the world while three species from Pakistan.The present study recorded single taxa from District Mansehra (Plat 3.25).

1. Peltula obscurans (Nyl.) Gyeln., Reprium nov. Spec. Regni veg. 38: 308 (1935)

Thallus squamulose, often widely scattered but sometimes rosette-shaped; squamules lightly or deeply lobed, flat to convex, up to 2 mm diameter; upper surface olive-brown to brown, not sorediate; lower surface paler than the upper surface, attached by a branched umbilicus; apothecia one per squamule, adnate, with a raised rim; disc red to yellow-brown, 0.5-1 mm in diameter; ascospores ovoid to ellipsoid, 4.5-7.6 x 3 µm.

Habitat: On rocks (saxicolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

190

Specimen Examined: Dader, alt. 1,205 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 18 (HUP).

World Distribution: Asia, Southern Europe, S. America, N. America, C. America (Mexico), Australasia (Australia).

Fig. 4.22: Distribution of Peltulaceae in District Mansehra. 1. Dader.

Plate 3.25: Peltula obscurans (scale= 2 cm) in District Mansehra.

191

17. Pertusariaceae

Thallus crustose; apothecia perithecia; spores septate to muriform. Habitate: trees, rocks. Distribution: Boreal to temperate.

Genera in study area: The present study recorded single genera from District Mansehra (Fig. 4.23).

Pertusaria DC. in Lam. & DC.

Thallus crustose, thick or thin, continuous, cracked or areloate; upper surface gray but some green or yellow, white or blue black, dull or shiny, smooth or rugulose, with or without soredia or isidia; ascomata entirely or partly immersed; disc small, punctiform to broad; epihymenium colourless to dark, prominent; hymenium colourless, subglobose to discoid; hypothecium colourless, reduce; asci 1-8- spored, clvavate to cylindrical; ascospores simple, colourless, thick walled, ellipsoid. Secondary metabolites: xanthones, β-orcinol depsides, or fatty acid. Substrate: bark, rock, soil or moss.

The genus represented 350 species from the world and five species from Pakistan. The present study recorded single taxa from District Mansehra (Plate 3.26).

1. Pertusaria leioplaca DC., in de Candolle & Lamarck, Fl. franç., Edn 3 (Paris) 5/6: 173 (1815)

Thallus crustose, fissured with thin verrucae, margins entire; uppers surface white to pale gray shiny, smooth, not pruinose, without isidia or soredia; fertile verrucae numerous, concolorous with thallus, 0.6-2.0 mm in diameter; apothecia 2-4 per verruca; disc black, punctiform; epihymenium colourless; hymenium colourless, 430 µm tall; hypothecium colourless to yellowish; asci 4-8-spored, cylindrical; ascospores colourless, ellipsoid, 40- 110 x 25-45 µm.

192

Habitat: On bark (Corticolous)

Spot Tests: Thallus K+ yellow, C-, KC yellow, Pd+ orange.

Secondary Metabolites (TLC): Stictic acid, constictic acid.

Specimen Examined: Mandagucha, alt. 2,053 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 147 (HUP), Shogran, alt. 2,407 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 728 (HUP).

World Distribution: Asia, Europe, British Isles, Africa (S. Africa, Morocco), North America, S. America, C. America (Mexico, Nicaragua), Caribbean (Bermuda), Pacific (New Caledonia, Hawaii, Marquesas).

Note: New to study area.

Fig. 4.23: Distribution of Pertusariaceae in District Mansehra; 1. Shogran, 2. Mandagucha.

193

Plate 3.26: Pertusaria leioplaca (scale= 2 cm) in District Mansehra.

194

18. Physciaceae

Thallus crustose or foliose; apothecia lecanorine or biatorine; spores brown, 2- celled or polarilocular. Habitat: rocks and trees. Distribution: boreal to temperate.

Genera in study area: The present study recorded seven genera from District Mansehra (Fig. 4.24).

Key to genera

1a. Thallus Crustose………………………………………………………….2

1a. Thallus foliose ………………………………………………………...….3

2a. Asci 8-spored…………………………………………………..Amandinea

2b. Asci 4-16 or polysporous………………………………….……….Buellia

3a. Upper surface of Thallus with short hairs, mostly at lobes tip……………………………………………………………….Anaptychia

3b. Upper surface of Thallus without hair…………………………..…….4

4a. Thallus divided deeply, lobes linear, 1 mm wide………….…..Physica

4a. Not as above

5a. Ascspores dark brown, thin walled, smooth, 1-septate…..Hetrodermia

5b. Ascospores brown………………………………………..………………6

6a. Lower surface black to brown, rhizene black, squarrosely branched………………………………………………………....Physconia

6b. Lower white or black, rhizine simple, black…………...…Phaeophyscia

195

Amandinea M. Choisy ex Scheid. & H. Mayrhofer

Thallus crustose, rimose, sometimes bullate; ascomata apothecia, lecanorine or lecideine, immersed or sessile, broad or constricted base; epihymenium brown; hymenium without oil droplets; paraphyses simple or branched, apicall cell swollen and pigmented with dark brown cap; asci clavate, 8-spored, Lecanora-type; ascospores 1-septate, without or with median spore wall thickening, brown. Substrate: on bark, soil, rocks and artificial substrata. Distribution in world: cosmopolitan.

A total of 30 species of the genus are reported from globe and previously three species from Pakistan. The present study recorded one species from District Mansehra (Plat 3.28).

1. Amandinea punctata (Hoffm.) Coppins & Scheid., Lichenologist 25(4): 343 (1993)

Thallus crustose, smooth to rimose, very thin or inconspicuous; prothallus rarely present, dark or gray; upper surface pale to dark gray, rarely brown, epruinose, esorediate; apothecia numerous, lecideine; 0.3-0.6 mm in diameter; disc black, flat to slightly convex, epruinose; epihymenium brown; hymenium hyaline, without oil droplets; paraphyses simple to slightly branched, apical cell swollen, with a brown cap; asci 8-spored, clavate, Bacidia-type; ascospores brown, ellipsoid, 1-septate, 11.5 -16.5 x 5.5- 9.0 µm.

Habitat: On bark or wood (corticolous)

Spot Tests: All negative,

Secondary Metabolites (TLC): None detected

Specimen Examined: On way to Naran, alt. 2,452 m, 29.07.2014, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 389 (HUP), Manoor Valley, alt.

196

2660m, 04.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 489 (HUP), Shogran, alt. 2,320 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 684 (HUP).

World Distribution: Asia, Europe. Africa (S. Africa, Morocco), S. America, N. America, C. America (Mexico), Caribbean (Bermuda, Guadeloupe), Antarctica, Pacific (Hawaii).

Note: New to the study area.

Anaptychia Korb.

Thallus foliose or shrubby, dorsiventral, moderately to very loosely attached, small to medium sized, lobate; lobes branched, elongate; upper surface dingy white or gray to dark brown, matt, with marginal cilia, soredia and isidia absent; lower surface pale or darkening, rhizinate; rhizines pale or darkening, simple or furcate to squarrosely branched; ascomata apothecia, stalked, rather rare; asci 8-spored, Lecanora-type, subclavate to clavate; ascospores Physconia-type, dark brown, 1-septate, 25.5-45 x 12.5-23 µm. Secondary metabolites: none. Substrate: bark, wood, rocks and sometime on soil.

A total of 15 species of the genus are reported from world while previously two species reported from Pakistan. The present study recorded two species from District Mansehra (Plate 3.29).

Key to species

1a. On rock, thallus brown, without marginal cilia……………………………………………..……Anaptychia runcinata

1b. Epiphytic, thallus grey, with marginal cilia……..…Anaptychia crinalis

197

1. Anaptychia crinalis (Schleich.) Vezda

Thallus foliose or fruticose, dorsiventral, 4-7 cm wide, lobate; lobes elongate to linear, branched, prostrate to erect , flattened; upper surface brown, whitish grey, greyish- brown to brown, matt, smooth, or with some tiny hairs; epruinose, isidia and soredia absent; lower surface white, rhizinet; rhizine, simple, unbranched; ascomata apothecia, 2.5-4.5 mm in diameter, stalked; disc flat to concave, occasionally with white pruina, dark, brown; asci lecanora- type; ascospores hyaline, oblong-ellipsoid, thin walled, 2-celled, 36-45 x 17.5-21.5 µm in diameter.

Habitate: On bark

Spot Tests: All negative

Secondary Metabolites: None detected

Specimen Examined: Manoor Valley near Forest rest house, alt. 2,569 m, 03.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 467 (HUP), Shogran, alt. 2,337 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 689 (HUP), on way to Saripaya, alt. 2,617 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 737 (HUP).

World Distribution: Asia (Iran, Turkey), Europe (Central and southern Europe), N. America (Ontario, Michigan).

Note: A new record to Pakistan.

2. Anaptychia runcinata (With.) J.R. Laundon, Lichenologist 16(3): 225 (1984)

Thallus foliose, orbicular, 9 cm in diameter, forming rosettes, closely attached, lobate; lobes 0.25-2.5 mm wide, flat to convex, slightly wider at the apices, overlapping towards the center; upper surface dark brown, dull olive green when wet; lower surface pale to brown black, rhizinet; rhizines

198

simple, brown to black, scattered; apothecia frequent, 1-2.5 mm in diameter; disc black-brown.

Habitat: On rocks.

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Mandagucha, alt. 1,866 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 48 (HUP).

World Distribution: Asia (Turkey, China, Pakistan, Mongolia), Europe, Africa (N. Africa, Morocco).

Note: New to the study area

Buellia De Not., Giorn. Bot. Ital. 2: 174-224 (1864), nom. Cons.

Thallus crustose, smooth, rimose, areolate, granular, placodiod, sometimes subsquamulose or sublobate; prothallus frequently present, usually dark; upper surface white to gray, yellow or brown, plane to uneven, smooth to roughened, epruinose or pruinose; ascomata apothecial, immersed to sessile, black, sometimes white-pruinose; disc rarely concave, usually plane, black or dark brown, pruinose or epruinose; hymenium hyaline or green in upper part, with or without oil drop; paraphyses free, apically swollen, with pigmented cap; epihymenium brown, green black, or dull olive; asci clavate, Lecanora-type, 4-16 or polysporous; ascospores brown, ellipsoid, straight or curved, oblong or fusiform, 1 septate. Secondary metabolites. 2-O-methylperlatolic acid, atranorine, barbatic acid, connorstictic acid, confluentic acid and norstictic acid. Substrate. On bark, wood, siliceous or rarely calcareous rocks, some species grow on soil.

199

A total of 400 species of the genus are reported from the world and two species from Pakistan while the present study recorded single taxa from District Mansehra (Plate 3.30).

1. Buellia stellulata (Taylor) Mudd, Man. Brit. Lich.: 216 (1861)

Thallus crustose, rimose-cracked, 1-2 cm in diameter; prothallus conspicuous black, strongly developed in most specimens and growing between areoles; upper surface usually white to pale gray or dark gray, dull or shiny, epruinose, esorediate; apothecia lecideine, 0.2-3 mm in diameter, immersed , rarely sessile; disc black, epruinose, plane, with age becoming slightly convex; exciple thin; epihymenium olive green; hymenium hyaline, without oil drop; asci clavate, bacidia-type, 8-spored; ascospores soon brown, oblong to ellipsoid, 1 septate, , wall evenly thickened, 8.7-11 x 4.8-6.1 µm in diameter.

Habitat: On siliceous rock (Saxicolous)

Spot Tests: K+ yellow turning red, C-, KC-, Pd-

Secondary Metabolites (TLC): Norstictic acid

Specimen Examined: Dader, alt. 1,223 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 19 (HUP).

World Distribution: Asia, Europe, Africa, North America, South America, Australia, New Zealand

Heterodermia Trevis. Atti della Soc. Ital. Sci. Nat. 11: 613 (1869)

Thallus foliose, dorsiventral, heteromerous, rosette forming, loosely to closely attached lobate; lobes linear or linear - cuneate, elongate to shorter, branching dichotomous to irregular; tips rounded, sometimes ascending, marginal cilia present or absent; cilia black or pale; upper surface grayish to gray white or greenish white, soredia or isidia present or absent; lower

200

surface white, pale to dark grayish, corticated or ecorticated, often coloured with yellow orange pigment, rhizinate; rhizines simple to branched, white to black; apothecia rare; disc brown or black; asci 8-spored, Lecanora- type; ascospores dark brown, thick walled, smooth, 1-septate, 15-54 x 7-25 µm. Secondary metabolites: atranorine zeorine, ß-orcinol depsides and ß- orcinol depsidones and different pigments. Substrate: rocks bark or wood, rarely on soil.

A total of 92 species of the genus are distributed worldwide and previously five species are reported from Pakistan. The present study recorded two species from District Mansehra.

Key to species

1a. Apothecia laminal, lobes sorediate………………………………….….2

1b. Apothecia apical, lobes not sorediat…………….……Heterodermia sp.

2a. Lower surface with yellow or orange pigment………...... H. obsurata

2b. Lower surface without yellow or orange pigment…………H. japonica

1. Heterodermia japonica (M. Satô) Swinscow & Krog, Lichenologist 8: 122 (1976)

Thallus foliose, up to 6.5 cm in diameter, loosely adnate, lobate; lobes up to 2 mm wide, sublinear, elongate, not ascending; upper surface greenish white, uneven, sorediate; soredia farinose to granular; lower surface white, ecorticated, spotted with pale yellow to orange pigment, rhizinate; rhizines black, marginal, simple, 1-4 mm long; apothecia rare, 1-8 mm in diameter; disc brown, concave, pruinose; asci 8-spored, cylindrical to subclavate; ascospores brown, ellipsoid, l-septate, 20-30 x 11-16 µm.

Habitat: On tree trunks (corticolous)

201

Spot Tests: Cortex K+ yellow, Pd+ yellow; medulla K+ yellow or yellow to orange, Pd- or + yellow to orange

Secondary Metabolites (TLC): Atranorin, chloroatranorin, zeorin, norstictic acid, salazinic acid

Specimen Examined: Kaghan on way to Naran, alt. 2,236 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 390 (HUP), Naran, alt. 2,504 m, 29.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 407 (HUP), Manoor Valley, alt. 2,623 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 490 (HUP), Shogran, alt. 2,319 m, 26.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 685 (HUP).

World Distribution: Asia (Pakistan, Tiawan, Philphine), Europe. N. America

Note: New to the study area.

2. Heterodermia obscurata (Nyl.) Trevis., Nuovo G. bot. ital. 1: 114 (1869)

Thallus foliose, 2-4.5 cm diameter, orbicular rosettes or irregularly spreading, lobate; lobes flat to slightly, eciliate; upper surface gray-white, shiny, rarely pruinose sorediate; soredia granular; lower surface rhizinate; rhizines black, simple to squarrosely branched, marginal; apothecia 1-4.5 mm in diameter, rare; dis: blackish brown, epruinose; asci 8-spored, cylindrical to subclavate; ascospores 27.5-35 x 15.5-20 µm in diameter, brown, ellipsoid, l-septate.

Habitat: On tree trunks (corticolous)

Spot Tests: Cortex K+ yellow, Pd+ yellow

Secondary Metabolites (TLC): Atranorin, chloroatranorin, zeorin

202

Specimen Examined: Behari village, Manoor Valley, alt. 2,487 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam, 467 (HUP), Kiwai, alt. 1,720 m, 22.08.2015, Asmat Ullah and Amir Khan Afridi 767 (HUP).

World Distribution: Asia (Pakistan, Tiawan), Europe, N. America

Note: New to the study area.

Phaeophyscia R. Moberg Symb. Bot. Ups. 22(1): 29 (1977).

Thallus foliose, lobate; lobes discrete or weakly overlapping, short or usually elongate, less or more closely adnate; upper surface gray brown to dark brown often dark green when wet, soredia or isidia present or absent; lower surface white or black, rhizinate; rhizines simple, black; ascomata apothecia, sessile, laminal, with rhizines on lower side disc brown to black; epihymenium brown, hymenium colourless; paraphysis slender, apices pale brown, clavate; asci Lecanora-type, 8-spored; ascospores 1-septate, brown. Secondary metabolites: skyrin.

A total of 40 species of the genus are reported from the world and eight species from Pakistan.The present study recorded three species from District Mansehra (Plate 3.31).

Key to species

1a. Soralia or isidia absent…………………………………………...,……..2

1b. Soralia or isidia predent…………………………………………………3

2a. Medulla white, corticolous……………………………………...P. ciliata

2b. Medulla orange red, saxicolous……………………………P. endoccina

3a. With soredia, no isidia ……………………………………….P. orbicular

203

3b. With isidia-soredia or isidia……………………………Phaeophyscia sp.

1. Phaeophyscia ciliata (Hoffm.) Moberg, Symb. bot. upsal. 22(no. 1): 30 (1977)

Thallus foliose, orbicular, up to 4.5 cm in diameter; lobes elongate and discrete, 1.5 mm broad, usually flat, prostrate; upper surface brown to dark brown, epruinose, without soredia or isidia; lower surface black, dull to weakly shiny, rhizinate; rhizines abundant, simple, black; apothecia abundant, sessile, up to 2.5 mm in diameter, with a corona of rhizines; ascospores Physcia-type, ellipsoid, 17-24 x 7-10 µm.

Habitat: On bark (corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected.

Specimen Examined: Dader, alt. 1,205 m, 10.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 20 (HUP), Naran, alt. 2,541 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 410 (HUP), Near Lalazar, 2,539 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 593 (HUP), Shogran, alt. 2,330 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 681 (HUP), On side of track to Saripaya, alt. 2,723 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 733 (HUP).

World Distribution: Asia (widespread), Europe, Africa (S. Africa, Morocco, C. America (Mexico), N. America (Canada, USA), S. America (widespread), Australasia (Australia).

204

2. Phaeophyscia endococcina (Körb.) Moberg, Symb. bot. upsal. 22(no. 1): 35 (1977)

Thallus Foliose, up to 3 cm diameter, orbicular irregular to irregular, closely attached, lobeite; lobed separate 0.2-1.0 mm wide; upper surface greyish brown to dark brown, not isidiate, smooth, eciliate; lower surface black, rhizinate; rhizines black; apothecia abundant, 1.5 mm in diameter, margin crenulate, under side with corona; ascospores Physcia-type, 17.5-25 x 8-11-(15) µm.

Habitat: On rock (saxicolous)

Spot Tests: K+ purple

Secondary Metabolites (TLC): Skyrine, zeorine

Specimen Examined: Kaghan, alt 2,341 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 388 (HUP), Manoor Valley on way to Ansoo lake, alt. 2,654 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar- ul-Islam 483 (HUP), Shogran, alt. 2,389 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 712 (HUP).

World Distribution: Asia, Europe, North America

3. Phaeophyscia orbicularis (Neck.) Moberg, Symb. bot. upsal. 22(no. 1): 44 (1977)

Thallus foliose, orbicular to irregular, up to 4 cm in diameter; lobes 0.5-1.0 mm broad, flat, not ascending, overlapping or separate, sorediate; soredia laminal, powdery to finely granular; lower surface black, dull or rather shiny; rhizines simple, black; apothecia abundant, sessile, up to 1.5 mm in diameter, with a corona of rhizines; ascospores Physcia-type ellipsoid, 17.5-25.5 x 7.5-11 µm.

205

Habitat: On bark (corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected.

Specimen Examined: Paras, alt. 1,376 m, 28.07.2014, Asmat Ullah, Amir Khan and Syed Mushraf Shah 362 (HUP), on way to Jalkhad, alt. 2,628 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 510 (HUP).

World Distribution: Asia, Europe, Africa (Morocco, Algeria) C. America (Mexico), S. America (Brazil, Paraguay), N. America (Canada, USA), Australasia (wide spread), Pacific (New Caledonia)

Note: New to the study area.

Physcia (Schreb.) Michaux

Thallus foliose, loosely adnate, lobate; lobe discrete or over lapping, with or without cilia; upper surface gray to blue gray, dull or shiny, sometime maculate or with or without soredia or isidia; lower surface pale, rhizinate; rhizines, simple or furcate; ascomata apothecial, laminal on lobes, lecanorine, sessile or shortly stiptate; disc brown to black, sometimes pruinose; epihymenium brown or orange brown; hymenium colourless; paraphyses simple or forked; hypothecium colourless; asci Lecanora-type, 8-spored, cylindrical; ascospores brown, ellipsoid, 1-septate. Secondary metabolites: atranorine zeorine. Substrate: on bark, wood and rocks.

This genus has 70 species which are distributed worldwide; previously 10 species are reported from Pakistan while the present study recorded three species from District Mansehra.

206

Key to species

1a. Thallus sorediate………………………………………………...P. dubia

1b. Thallus esorediat…………………………………………………………2

2a. Upper thallus surface with white maculae………………...... P. aipolia

2b. Upper thallus surface lacking white maculae……………………...... 3

3a. Lobes flat, up to 3 mm wide, K+ (Medulla)

3b. Lobes flat to slightly convex, up to 1.5mm wide, K- (Medulla)……………………………….…………………….....P. stellaris

1. Physcia aipolia (Ehrh. ex Humb.) Fürnr., Naturhist. Topogr. Regensburg 2: 249 (1839)

Thallus orbicular to irregular, to 4.5 cm diameter, lobate; lobes flat to convex, slightly overlapping, ascending at tips, eciliate; upper surface whitish gray to dark gray, white-maculate, without soredia or isidia; lower surface white to pale, without cilia, rhizinate; rhizines simple, black; apothecia abundant, up to 2 mm in diameter; disc black, white-pruinose; epihymenium orange brown; hymenium colourless, 85 µm tall paraphyses clavate, simple; hypothecium colourless, 70 µm tall; asci Lecanora-type, cylindrical or clavate; ascospores brown, 1-septate, 20.5-25 x 9-12 µm,

Habitat: On tree trunks (corticolous)

Spot Tests: Cortex and Medulla K+ yellow, Pd+ yellow

Secondary Metabolites (TLC): Atranorine, Zeorine

Specimen Examined: Kaghan, alt. 2,089 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 392 (HUP), Naran, alt. 2,505 m,

207

30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 412 (HUP), Lalazar, alt. 3,009 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 599 (HUP).

World Distribution: Asia, Europe, Africa, N. America (USA), C. America (Mexico), S. America, Pacific (Guam), Australasia

2. Physcia dubia (Hoffm.) Lettau, Hedwigia 52: 254 (1912)

Thallus irregular, to 3 cm diameter, loosely adnate, lobate; lobes elongated, narrow, separated, sometimes ascending, eciliate; upper surface whitish gray to dark gray, without pruina and maculation, sorediate; soralia marginal al lobes tips; lower surface pale, rhizinate; rhizines white to black; apothecia uncommon, up to 2 mm in diameter, margin sorediate; ascospores Physcia-type, brown, 1-septate.

Habitat On rocks (Saxicolous)

Spot Tests: Upper cortex K+ yellow, Pd+ yellow

Secondary Metabolites (TLC): Atranorine

Specimen Examined: Kaghan, alt. 2,270 m, 29.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 399 (HUP), Shogran, alt 2,324 m, 26.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 688 (HUP).

World Distribution: Asia, Europe, Africa (Ethiopia, Morocco, Kenya, S. America (Chile, Argentina), N. America (USA), C. America (Guatemala, Mexico)

3. Physcia stellaris (L.) Nyl., Act. Soc. linn. Bordeaux 21: 307 (1856)

Thallus orbicular or irregular, up to 4.5 cm diameter, loosely adnate, lobate; lobes radiating, narrow, up to 1 mm wide, eciliate; upper surface whitish gray to dark gray, without pruina, not maculate, soredia and isidia absent;

208

lower surface white, rhizinate; rhizines white to black, simple; apothecia present, sessile, concave, 1.5-2.0 mm in diameter; disc black; epihymenium orange-brown; hymenium 60 µm high, colourless; paraphyses simple; hypothecium 70 µm tall; asci Lecanora-type, cylindrical or narrow clavate; ascospores 1-septate, brown, ellipsoid, 16-7.5 µm.

Habitat: On tree trunks and branches (corticolous)

Spot Tests: Medulla K-, Pd-, cortex K+ yellow, Pd+

Secondary Metabolites (TLC): Atranorine

Specimen Examined: Kaghan, alt. 2,278 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 391 (HUP), Shogran on way to Saripaya, alt. 2,515 m, 27.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 717 (HUP).

World Distribution: Asia, Europe, Africa, S. America, N. America (Canada, USA), C. America, Caribbean (Bermuda, Bahamas) Australasia.

Physconia Poelt

Thallus foliose, loosely attached, lobate; lobes short to elongate, discrete or slightly overlapping, mostly more than 3 mm wide; upper surface gray brown or reddish brown; lower surface black to brown, moderately to densely rhizinate; rhizenes black, squarrosely branched; ascomata apothecia, laminal; disc brown, pruinose; epihymenium brown; hymenium colourless; paraphyses simple or branched, apices clavate, with thin dark brown cap; hypothecium colourless; asci 8-spored, clavate; ascospores brown, 1-septate, 22-38 x 12-20 µm, Physconia-type. Secondary metabolites: not detected. Substrate: bark, rock, wood, soil or mosses.

209

The genus represents a total of 25 species from world and six species from Pakistan. The present study recorded single taxa from District Mansehra (Plate 3.32).

1. Physconia muscigena (Ach.) Poelt, Nova Hedwigia 9: 30 (1965)

Thallus foliose, irregular, occasionally orbicular, loosely adnate; lobes variable size, discrete to elongated, marginal lobes broad, inner lobes narrow, ascending; upper surface brown to dark brown, pruinose, without isidia or soredia; lower surface brown to black, dull to shiny, rhizinate; rhizines black, squarrosely branched; apothecia up to 4.5 mm in diameter; ascospores 22.5-31.5 x 11.5-17 µm.

Habitat: On mosses (Musicolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Lalazar, alt. 2,913 m, 10.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 560 (HUP).

World Distribution: Asia, Europe, N. America (Alaska) S. America (Chile, Argentina), Africa (Tanzania, Kenya, Morocco, Ethiopia), Antarctica.

210

Fig. 4.24: Distribution of Physciaceae in District Mansehra: 1. Lulusar lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan.

Plate 3.27: Amandinea punctate (scale= 1cm) in District Mansehra.

211

Plate 3.28: A. Anaptychia crinalis, B. Anaptychia runcinata (scale= 1 cm) in District Mansehra.

Plate 3.29: Buellia stellulata (scale= 0.5 cm) in District Mansehra.

212

Plate 3.30: A. Phaeophyscia ciliate, B. Phaeophyscia endococcina, C. Phaeophyscia orbicularis (scale= 0.5 cm) in District Mansehra.

213

Plate 3.31: Physconia muscigena (scale= 1 cm) in District Mansehra.

214

19. Psoraceae

Thallus squamulose to placodiod or crustose, ascospores colourless, aseptat. Habitat soil and rocks.

Genera instudy area: The present study recorded single genus from District Mansehra (Fig. 4.25).

Psora Hoffm.

Thallus squamulose, thick; prothallus absent; squamules 2-7 mm wide, ascending or imbricate, rounded to elongate; upper surface yellow to red brown, dull or shiny, white pruinose or not; lower surface white to brown; ascomata apothecia, sessile, laminal or marginal, brown black, flat or weakly convex, pruninose or not; epihymenium red brown or brown; hypothecium brown or colourless; asci 8-spored, clavate; ascospores simple colourless, ellipsoid, without thick perispore. Secondary metabolites: none detected. Substrate: soil and rocks.

This genus has a total of 40 species from world and two species from Pakistan. The present study recorded one species from District Mansehra (Plate 3.33).

1. Psora decipiens (Hedw.) Hoffm., Descr. Adumb. Plant. Lich. 2(4): 68 (1794)

Thallus squamulose; squamules scattered to contiguous, up to 4.5 mm wide, rounded, adnate; upper surface pink-red-brown, dull or shiny, white pruinose, smooth or fissured; apothecia marginal, up to 2 mm diameter, black, epruinose or white pruinose; ascospores 9.5-16.0 x 6.5-8 µm, ellipsoid.

Habitat: On soil (tericolous)

Spot Tests: All negative

215

Secondary Metabolites (TLC): None detected

Specimen Examined: Lalazar, alt 3,089 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah, 594 (HUMP).

World Distribution: Europe, Africa, Asia, Africa, N. America, S. America (Argentina), C. America (Mexico), Australasia.

Fig. 4.25: Distribution of Psoraceae in District Mansehra; 1. Lalazar.

216

Plate 3.32: Psora decipiens (scale= 2 cm) in District Mansehra.

217

20. Ramalinaceae

Thallus fruticose, flattened; apothecia lateral and terminal, lecanorine; spores colourless, 2-celled. Habitat rocks and trees. Distribution: temperate to tropical.

Genera in study area: The present study recorded three genera from District Mansehra (Fig. 4.26).

Key to genera

1a. Thallus Crustose…………………………...... 2

1b. Thallus Fruticose, erect to pendent attached by holdfast, branches solid or fistulose…… ………………………………...…………Ramalina

2a. Upper surface smooth to nodulose or papillate, lower surface present in Squamulose species, attachment organs absent…...... Lecania

2b. Upper surface smooth, cracked, warted, lower surface absent……………………………………………………..…………Bacidia

Bacidia De Not., Giorn. Bot. Ital. 2: 189 (1846).

Thallus: crustose or occasionally granular, areolate, rimose; prothallus often absent, usually thin when present; upper surface pale green, pale gray or green gray, smooth, cracked, warted, without isidia or soredia; ascomata apothecia, flat to convex, variously coloured with white pruina, upto 2 mm wide; epihymenium containing pigment and occasionally with crystals; hymenium colourless, 60-125 µm tall; paraphyses straight, simple or rarely branched, apical cell often swollen; asci:8-spored, clavate to cylindrical-clavate, Bacidia-type; ascospores hyaline, 3 or many septate, oblong, baciliform, fusiform, without a distinct epispore. Secondary

218

metabolites: atranorine. Substrate: mostly on bark but some species are found on soil and rocks

A total of 250 species of the genus are distributed worldwide and previously four are reported from Pakistan. The present study recorded three species from District Mansehra (Plate 3.35).

Key to species

1a. Apothecia black or dark lavender brown……………………………...2

1b. Apothecia yellow orange, brown orange or whitish to pink……...…3

2a. Thallus smooth, apothecia black, lichen substance absent……………………………………...……………….…B. laurocerasi

2b. Thallus granulose-verrucose, apothecia lavender brown, lichen substance atranorin present…………………………………..Bacidia sp.

3a. Apothecia whitish, pink or pink-yellow, ascospores up to 15- septate……………………………………………………………..B. rosella

3b. Apothecia yellow brown to orange brown, ascospores up to 9- sepate…………………………………………………….……….B. rubella

1. Bacidia laurocerasi (Delise ex Duby) Zahlbr., Cat. Lich. Univers. 4: 213 (1926) [1927]

Thallus thin, smooth, cracked or warted; upper surface pale gray or greenish gray; ascomata usually numerous, 0.5-1.0 mm in diameter, flat to convex and immarginate; disc pink brown; epihymenium pale gray brown to dark brown; hymenium colourless, 60-85 µm tall; hypothecium colourless; paraphysis simple or branched, apices swollen and pigmented; ascospores 7-septate, acicular, 30-70 x 2-3.5 µm.

219

Habitat: On bark (Corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Dader, alt. 1,295 m, 10.10.2013, Asmat Ullah, Amir Afridi and Syed Muhammad 13 (HUP), Shogran, alt. 2,318 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 673 (HUP).

World Distribution: Asia, Africa (S. Africa, Morocco, Algeria), Europe, Russia, N. America (USA, Canada), Caribbean (Bahamas), C. America (Mexico), S. America (Colombia, Brazil), Australasia (Australia, NewZealand)

Note: New to the study area.

2. Bacidia rubella (Hoffm.) A. Massal., Ric. auton. lich. crost. (Verona): 118, fig. 231 (1852)

Thallus thin to richly granular isidiate; granules 65-115 µm in diameter; upper surface gray to yellow-green; ascomata apothecia, flat to slightly convex, sessile, 0.5-1.2 mm in diameter; disc pale to dark red brown, pruinose; epihymenium hyaline; hymenium hyaline or orange red or yellow in upper part, 75-100 µm tall; paraphyses simple or forked above, apically slightly swollen; asci lecanoran type; ascospores hyaline, 3-9 septate, 45-75 x 3-4 µm.

Habitat: On bark (Corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimens Examined: On tthe side of Siran River Dader, alt. 1,240 m, 08.11.2013, Asmat, Amir Khan Afridi and Syed Muhammad 77 (HUP), Kathai Oghi, alt. 1,204 m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem

220

Shah 258 (HUP), Paras, alt. 1,639 m, 28.07.14, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 361 (HUP), On the side track to saripaya, alt. 2,548 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 708 (HUP).

World Distribution: Asia (Japan, Turkey, Russia), Africa (N. Africa), Europe, C. America (Mexico). N. America.

3. Bacidia rosella (Pers.) De Not., G. bot. ital. 2(1.1): 190 (1846)

Thallus crustose; upper surface green gray, continuous or cracked; apothecia 0.25-.8 mm in diameter, sessile, slightly white pruinose, flat to convex; disc pale orange; epihymenium pale brown to brown; hymenium colourless, 110 µm tall; hypothecium colourless; paraphysis simple; asci Bacidia-type, cylindrical, 80-95 x 10-12 µm; ascospores colourless, 9-15 sepate.

Habitat: On bark (Corticolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected

Specimens Examined: On the side of road from Dader to Shinkari, alt. 1,287 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 22 (HUP), Mundaghucha, alt. 1,878 m, 14.11.2013, Asmat Ullah and Mazhar-ul- Islam 143 (HUP), Oghi top, alt. 1,482 m, 15.4.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 259 (HUP), Balakot, alt. 1,154 m, 26.04.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 296 (HUP), Shogran, alt. 2,424 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 674 (HUP).

World Distribution: Asia (Turkey, Japan, Russia), N. Africa (Morocco).

Note: New to the study area.

221

Lecania A. Massal. Alc.

Thallus crustose, continuous or scattered granules, warted or areolate, papillate or somewhat lobed; prothallus present or absent; upper surface gray white to brown-black, smooth to nodulose or papillate, sometimes pruinose; lower surface present in squamulose, specialized attachment organs are absent; ascomata apothecial, 0.2- 2.0 mm in diameter, sessile; disc pale to black-brown, flat to convex, occasionally weakly or densely pruinose; epihymenium colourless to pale to dark reddish brown, occasionally containing crystal of calcium oxalate; hymenium colourless, 35-95 µm tall; paraphyses simple, thick, apical cell swollen, containing dark pigment cap; hypothecium colourless or pale yellow; asci Bacidia-type, clavate, 8(-16) spored; ascospores colourless, 1-3-septate, oval to elongate- ellipsoid, thin walled, without thickened perispore. Secondary metabolites: atranorine and sometime unidentified terpens are present. Substrate: on soil, rocks bark, sometimes on wood.

A total of 40 species are reported from world and previously two species from Pakistan. The present study recorded two species from District Mansehra.

Key to species

1a. Spores 3-septate ……………………………………………………….....2

1b. Spores non-septate………………………………………………………..3

2a. Thallus powdery, indistinct-spores …………………………Lecania sp.

2b. Thallus smooth, thin……………………………………………L. naeglii

3a. Mature ascospores curved……………………………….….Lecania sp.

3b. Mature ascospores, not curved………………………………..L. cyrtella

222

1. Lecania cyrtella (Ach.) Th. Fr., Lich. Scand. (Upsaliae) 1(1): 294 (1871)

Thallus crustose, inconspicuous, effuse or immersed; prothallus present, white; surface white to pale gray, rather smooth to wrinkled and roughened; apothecia 0.3-0.5 mm in diameter, very numerous, scattered to crowded, emergent to sessile; disc pale pink to red-brown, flat to markedly convex, epruinose; epihymenium brown, usually with fine pigment granules; hymenium colourless, 30-50 µm tall; paraphyses simple, or ocassionaly branched; hypothecium colourless, 25-65 µm thick; asci 8- spored, clavate, 28-40 x 9.5-11.5 µm; ascospores colourless, narrowly ellipsoid, bent when muture, 9.5-14 x 3.5-5 µm.

Habitat: On bark (corticolous)

Spot Tests: All negative,

Secondary Metabolites (TLC): None detected,

Specimen Examined: Above paras, alt. 1,792 m, 08.05.2015, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 653 (HUP), on way to Saripaya, alt. 2,884 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 742 (HUP).

World Distribution: Asia, Africa (S. Africa, Morocco, Algeria), Europe, British Isles, N. America (USA, Canada), S. America (Argentina), Australasia (New Zealand, Australia).

2. Lecania naegelii (Hepp) Diederich & van den Boom, in Boom, Brand, Diederich, Aptroot & Sérusiaux, Bull. Soc. Nat. luxemb. 95: 154 (1994)

Thallus crustose, thin, inconspicuous; upper surface white to grey, thin; apothecia sessile, dispersed, flat to convex, 0.15-0.6 mm in diameter; disc

223

black, not pruinose; epihymenium green gray, hyaline or with pale gray- brown to blue green granules; hymenium pale yellow brown, 50-60 µm tall; hypothecium pale yellow brown, 190 µm tall; paraphyses simple or forked, apices swollen, apical cell pigmented; asci biatora type, 8-spored; ascospores colourless, straight, narrowly ellipsoid, oblong to fusiform, 13.5 -24.5 x 3.5-5.0 µm.

Habitat: Bark (corticolous)

Spot Tests: Thallus K-, C-, P-,

Secondary Metabolites (TLC): None detected,

Specimen Examined: Above paras, alt. 1,994 m, 08.05.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 746 (HUP).

World Distribution: Asia, Europe, British Isles, North America (Canada, USA), Africa (Tunisia, Morocco), Australasia (New Zealand)

Ramalina Ach.

Thallus fruticose, often , erect to pendent, attached by holdfast; branches solid or fistulose, flattened or sometimes terete; surface yellowish or grayish green, smooth or angular, occasionaly become striately ridged; pseudocyphellae present or absent, ellipsoid, short linear, or striate, often sorediate but lacking isidia; asomata apothecia, substipitate to stipitate; disc pale green, brown, concave to plane, sometimes white pruinose; epihymenium colourless; hymenium in upper part colourless, below yellow brown; hypothecium pale brown; paraphyses simple; asci 8-spored, elongate-clavate, Bacidia-type; ascospores colourless, fusiform or broadly ellipsoid, 1-septate. Secondary metabolites: usnic acid, depsides, depsidones, aliphatic acid, atranorin. Substrate: on bark, wood, soil and rock.

224

A total of 200 species of the genus are reported from world and four species from Pakistan while the present study recorded one species from District Mansehra (Plat 3.34).

1. Ramalina sinensis Jatta, G. bot. ital., n.s. 9: 462 (1902)

Thallus fruticose, often erect, up to 6.5cm long, attached at basal holdfast; branching palmate or fan-shaped, growing from narrow holdfast; branches up to 22mm wide, solid, flattened; upper surface yellowish green, uneven, wrinkled, lacking isidia, soredia and pseudocyphellae; lower surface pale; apothecia up to 9.5mm in diameter, laminal or subterminal; disc flat to convex; asci 8-spored, elongate-clavate; ascospores colourless, ellipsoid,1- septate, 11.5-15.5 x 6-7µm.

Habitat: On bark (Corticolous)

Spot tests: Cortex KC+ yellow, Pd-.

Secondary Metabolites (TLC): Usnic acid, atranorin.

Specimen Examined: Naran, alt. 2,632 m, 29.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 393 (HUP), Manoor Valley forest house, alt. 2,519 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam, 468 (HUP), Lalazar, alt. 3,018 m, 10.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 554 (HUP), Shogran, alt. 2,318 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 683 (HUP), on way to Saripaya, alt. 2,604 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 722 (HUP).

World Distribution: Asia, Europe, N. America (USA, Canada), C. America (Mexico), Africa (N. Africa).

Note: New to the study area.

225

Fig. 4.26: Distribution of Ramalinaceae in District Mansehra; 1. Lalzar, 2. Naran,3. Manoor Valley, 4. Sharan , 5. on way to Saripaya.

Plate 3.33: Ramalina sinensis (sacle= 2 cm) in District Mansehra.

226

Plate 3.34: A. Bacidia laurocerasi, B. Bacidia rosella, C. Bacidia rosella (scale= 2 cm) in District Mansehra.

227

21. Rhizocarpaceae

Thallus crustose; prothallus present; ascomata immersed in thallus or lecideine; ascospores usually brown septate to muriform. Substrat: rocks.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.27).

Rhizocarpon DC.

Thallus crustose, orbicular or spreading, areolate, cracked, verrucose, or slightly effigurate at margin; prothallus usually present, black or white to brown gray; upper surface green brown or white, rarely isidiate or sorediate; ascomata apothecia, black, round to angular, concave to strongly convex; epihymenium brown, green; hymenium colourless, near epihymeniun greenish to red brown; paraphyses conglutinate, richly branched and anastomosed, apical cell slightly to distinctly thickened; hypothecium brown, 30-55 µm tall, lacking crystals; asci clavate to cylindrical, 1-8 spored; ascospores pale to dark brown, ellipsoid, 1-septate to muriform. Secondary metabolites: rhizocarpic acid, depsides, depsidones. Substrate: on rocks.

Previously, 200 species of the genus are reported from globe and four species from Pakistan. The present study recorded three species from District Mansehra (Plate 3.36).

Key to species

1a. Epithecium granular, brown black, medulla I+ blue……R. viridiarum

1b. Epitheciun not granular, green brown or red brown…………………2

2a. Medulla K+ yellow, Pd + orange………………………..R. lecanorinum

2b. Medulla K-, Pd-…………………………………...……..R. geographicum

228

1. Rhizocarpon geographicum (L.) DC., in Lamarck & de Candolle, Fl. franç., Edn 3 (Paris) 2: 365 (1805)

Thallus crustose, areolate, up to 9 cm in diameter; prothallus black; areoles up to 1.3 mm in diameter, rounded to angular or irregular or crescent shape, plane to strongly convex; upper surface green , smooth, epruinose; apothecia up to 1 mm in diameter, round or angular; disc plan or weakly convex, black, epruinose; epihymenium red brown or brown to olive- green; hymenium colourless or more rarely green, 100-175 µm tall; hypothecium dark brown; asci 8-spored, clavate; ascospores dark brown, ellipsoid, muriform, 20.5-34.5 x 10-20 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla K-, C-, or rarely C+ red, P+ yellow.

Secondary metabolites (TLC): Rhizocarpic acid, psoromic acids

Specimen Examined: Naran, alt. 3,141 m, 29.07.2014, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 394 (HUP), Lake Saif -ul- Maluk, alt. 3,369 m, 30.07.2014, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 423 (HUP), Manoor Valley, alt. 3,101 m, 04.08.2014, Asmat, Mazhar-ul-Islam Ashfaq Ahmad, 494 (HUP), Jalkhad, alt. 3,292 m, 10.08.2014, Asmat, Mazhar- ul-Islam and Ashfaq Ahmad 512 (HUP).

World Distribution: Asia, Europe, N. America, S, America, C. America, Africa (N. Africa, S. Africa), Australasia, Pacific (Hawaii), Antarcatica.

Note: New to the study area

2. Rhizocarpon lecanorinum Anders, Hedwigia 64: 261 (1923)

229

Thallus crustose, areolate; prothallus black; areoles up to 1-2 mm in diameter, contiguous to somewhat dispersed, matt, smooth, initially rounded, crescent-shaped; upper surface bright yellow to green yellow; apothecia to 1 mm in diameter; disc black, flat to convex, round, epruinose; epihymenium pale green-brown; hymenium colourless; hypothecium brown-black, thin; ascospores brown, muriform, 32.550 x 13.5-22.5 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: K+ yellow, P+ orange.

Secondary Metabolites (TLC): Rhizocarpic acid

Specimen Examined: Lake saif-ul-Maluk, alt. 3,200 m, 30.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah Afridi 435 (HUP), Jalkhad, alt. 3,159 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 528 (HUP).

World Distribution: Asia, Europe, N. America (Alaska), S. America, Africa (S. Africa), Australasia

Note: A new record to Pakistan.

3. Rhizocarpon viridiatrum (Wulfen) Körb., Syst. lich. germ. (Breslau): 262 (1855)

Thallus crustose, 0.4-1.5 cm in diameter, areolate; areoles up to 0.5 mm in diameter, convex to palne, round to angular; surface greyish-green to green, smooth, epruinose; apothecia up to 0.7 mm in diameter, round or irregularly angular; disc black, convex, epruinose; epihymenium brown; hymenium colourless, 80-135 µm tall; hypothecium dark brown; asci 8- spored, clavate; ascospores muriform, ellipsoid, 11.5-24.5 x 7-12.5 µm.

230

Habitat: On rocks (Saxicolous)

Spot Tests: Medulla K+ yellow, Pd+ orange.

Secondary Metabolites (TLC): Rhizocarpic acids

Specimen Examined: Lake Saif-ul-Maluk, alt 2,740 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 434 (HUP).

World Distribution: Asia, Europe, N. America (Arizona, California), S. America (Colombia, Bolivia, Chile) Africa (Kenya, Natal, Morocco) Australasia (New Zealand).

Note: New to the study area.

Fig. 4.27: Distribution of Rhizocarpaceae in District Mansehra: 1. Jalkhad, 2. Naran, 3. lake Saif -ul- Maluk, 4. Manoor Valley.

231

Plate 3.35: A. Rhizocarpon geographicum (scale= 2 cm), B. Rhizocarpon lecanorinum (scale= 0.5 cm), C. Rhizocarpon viridiatrum (scale= 2 cm) in District Mansehra.

232

22. Stereocaulaceae

Thallus fruticose; ascospores colourless, several septate to muriform. Habitat: soil and rocks. Distribution: arctic to tropical.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.28)

Lepraria Ach.

Thallus crustose, leprose, attached by whole under surface or partly free from substratum, unstratified and then completely composed of soredia, stratified or compact, forming irregular or rosettes spreading; prothallus absent; upper surface gray, blue green, white or yellow, usually leprose; soredia rounded, farinose to coarse, often pruinose due to presence of crystals; ascomata absent. Secondary metabolites: Atranorine, constictic acid, stictic acid, zeorine. Substrate: on rocks, bark and soil.

Previously, 40 species of the above genus are reported from globe while two species are reported from Pakistan. The present study recorded one specie from District Mansehra (Plate 3.37).

1. Lepraria elobata Tønsberg, Sommerfeltia 14: 197 (1992)

Thallus crustose, leprose, thin or sometimes thick, irregular, up to 0.5 mm thick, firmly fastened to substrate; upper surface pale blue gray to dull blue gray, isidia absent, soredia present; soredia 15-40 µm in diameter, loosely to strongly packed, mostly farinose, sometimes coarse and up to 0.1 mm wide; lower surface absent; ascomata: absent.

Habitat: On bark and wood (Corticolous)

Spot Test: K- or K+ yellow, Pd+ orange,

Secondary Metabolites (TLC): Atranorine, constictic acid, stictic acid, zeorine.

233

Specimen Examined: Mandgucha, alt. 1,808 m, 14.11.2014, Asmat Ullah and Mazhar-ul-Islam 150 (HUP), Shogran, alt. 2,423 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 700 (HUP).

World Distribution: Europe, N. America, C. America.

Note: A new record to Pakistan.

Fig. 4.28: Distribution of Stereocaulaceae in District Mansehra; 1. Shogran, 2. Mandagucha.

Plate 3.36: Lepraria elobata (scale= 2 cm) in District Mansehra.

234

23. Teloschistaceae

Thallus crustose, foliose or fruticose; apothecia lecanorine or lecidine; disc usually orange; spores colourless, polarilocular. Habitat: rocks, trees and humus. Distribution: temperate and tropical.

Genera in study area: The present study recorded three genera from District Mansehra (Fig. 4.29).

Key to genera

1a. Thallus Crustose, Squamulose to placodioid, apothecia lecanorine or lecideine, disc pruinose or epruinose……………………….…Caloplaca

1b. Thallus foliose …………………………………………………………..2

2a. Lower surface grayish white, epihymenium pale orange……………………………………………………..Xanthomendoza

2b. Lower surface white to pale brown, corticated, epihymenium golden, orange…………………………………………………Xanthoria

Caloplaca Th. Fr.,

Thallus crustose, squamulose-placodioid, verrucose or granular furfuraceous, effigurate or lobed; prothallus orange, white, black or not visible; upper surface yellow, yellowish orange, gray, or brown red, smooth or verruculose, isidia, soralia, blastidia or lobules absent or present; ascomata apothecia, lecanorine or lecideine, immersed, adnate or stipitate; disc orange, yellow to red , gray, brown or black, convex or concave, flat, epruinose or pruinose; hymenium hyaline; epihymenium brown, gray or golden; paraphyses simple or branched, apical cell enlarge; asci clavate, 8- spored; ascospores hyaline, ellipsoid, with 2 locules or rarely 4 locules. Secondary metabolites: Teloschistin, emodin, parietin. Substrate: on rock, trees, rarely on soil and wood.

235

There are a total of 800 species of the genus distributed worldwide. Previously 62 species are reported from Pakistan while the present study recorded three species from District Mansehra (Plate 3.38).

Key to species

1a. K+ purple, thallus and or soredia yellow to orange………………….2

1b. K-, soredia and thallus white, grey or green..………………. ……….3

2a. Soralia marginal, lobes 0.5-1.00 mm wide…………….……C. decipiens

2b. Soralia laminal, lobes 0.2-0.5 mm wide………….…..……C. cirrochora

3a. Thallus placodioid or lobate, effigurate, coarsely sorediate……………………………………………….……....C. teicholyta

3b. Thallus crustose, soredia discrete………………………….Caloplaca sp.

1. Caloplaca cirrochroa (Ach.) Th. Fr., Lich. Scand. (Upsaliae) 1(1): 171 (1871)

Thallus placodioid, 5.5 cm across, closely appressed, lobeate, scattered or contiguous thalli; lobes rounded, elongated, shallowly convex, contiguous, separated by parallel-aligned furrow; upper surface dirty or brown orange, soralia present, laminal, small, scattered, flat, rounded, to 0.7 mm in diameter, soredia lemon yellow, farinose; apothecia absent.

Habitat: On rocks (Saxicolous)

Spot Tests: K+ purple all part

Secondary Metabolites (TLC): Parietin

Specimen Examined: Dader, alt. 1,343 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 85 (HUP).

236

World Distribution: Asia, Europe, Africa (Egypt). N. America, S. America (Brazil, Argentina), Australasia (Australia).

Note: New to the study area.

2. Caloplaca decipiens (Arnold) Blomb. & Forssell, Cat. Lich. Univers. 7: 226 (1931)

Thallus crustose, 2.5 cm across, lobate; lobes elongate, appressed; prothallus absent; upper surface yellow to orange yellow, pruinose, soralia usually present, soredia granular, concolorous with thallus; apothecia rare, lecanorine, adnate, 0.5-1 mm in diameter; disc flat, orange, epruinose; epihymenium golden, K+ red, C-; hymenium hyaline, 60-80 µm tall; paraphyses simple, apical cell 2-5 µm wide; asci 8-spored, cylindrical; ascospores hyaline, 11-14 x 6-8 µm in diameter, ellipsoid, 2 locules.

Habitat: On rocks (Saxicolous)

Spot Tests: Thallus K+ red, C-, apothecia K+ red, C-

Secondary Metabolites (TLC): Teloschistin, parietin, emodin

Specimen Examined: Manoor Valley on way to Ansoo lake, alt. 3,553 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 498 (HUP), Jalkhad, alt. 3,200 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 530 (HUP).

World Distribution: Asia, Europe, Africa (Morocco, Algeria, Tunisia) N. America (USA), C. America, Australasia (New Zealand).

Note: New to the study area.

3. Caloplaca teicholyta (Ach.) J. Steiner, Sber. Akad. Wiss. Wien, Math.-naturw. Kl., Abt. 1 104: 388 (1895)

237

Thallus crustose, slightly placodioid with rounded lobe tips thin to thick, closely appressed lobes; lobe end poorly differentiated, flat or convex, rounded; upper surface white to bluish gray, sorediate at center; soredia white, granular; apothecia uncommon, 0.7 mm in diameter, scattered or sometimes crowded, immersed, deeply concave at first, becoming flat, sometime thalline margin also present; disc orange to red brown, occasionally white pruinose; paraphyses branched, slender, flexuose, apically not swollen; ascospores ellipsoid, 14.5-17.5 x 7.5-10 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: Apothecia K + purple red, thallus K-

Secondary Metabolites (TLC): Teloschistin

Specimen Examined: Lalazar, 2,855 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 595 (HUP).

World Distribution: Asia, Europe (Scotland, Ireland), Africa (Morocco, Algeria, Tunisia, Egypt), North America, S. America (Mexico).

Note: New to the study area.

Xanthomendoza S. Kondratyuk & Karnefelt, Biblioth. Lichenol. 68: 26 (1997).

Thallus foliose to umbilicate, loosely attached, lobate; lobes erect or semi- erect, discrete, elongate, eciliate; upper surface pale yellow to reddish orange, smooth to somewhat wrinkled, with or without sorediate, lacking pseudocyphellae; lower surface grayish white, rhizinate; rhizines simple; ascomata apothecia, sessile to stipitate, laminal; disc darker orange than the thallus; epihymenium pale orange; hymenium colourless below but light orange above; hypothecium colourless; paraphyses simple or branched; asci 8-spored, clavate to broadly clavate, Teloschistes-type; ascospores

238

colourless, ellipsoid to oblong, polarilocular, 10-20 x 5-8 µm. Secondary metabolites: Parietin, fallacinal, teloschistin and parietinic acid. Substrate: on bark, rock, rarely on soil.

This genus has a total of 20 species from the world. The present study recorded two species from District Mansehra.

Key to species

1a. Thallus rosette like, rhizines present, abundant……………...X. fallax

1b. Thallus cushion like, rhizines absent or sparse………………………2

2a. Soredia powdery, lobe narrow………………………….………X. fulva

2b. Soredia granular, lobe broad………………….…….Xanthomendoza sp.

1. Xanthomendoza fallax Søchting, Kärnefelt & S.Y. Kondr., Mitt. Inst. Allg. Bot. Hamburg 30-32: 237 (2002)

Thallus foliose, up to 2.5 cm wide, adnate to loosely adnate, rosette, lobate; lobes flattened to convex, dorsiventral; tips truncate to rotund; upper surface yellow to orange, smooth, sorediate; soredia powdery; lower surface white to yellow; apothecia rare, up to 2.0 mm in diameter, laminal; disc orange; epihymenium brown; hymenium colourless below, 55-100 µm tall; paraphyses simple or branched, septate; hypothecium colourless to pale brown; asci: , 8-spored, clavate; ascospores colourless, ellipsoid, polarilocular, 11.0-15.0 x 5.5-9 µm.

Habitat: On bark (Corticolous)

Spot Tests: K+ purple, C-, KC-, Pd-.

Secondary Metabolites (TLC): Parietin, fallacinal, teloschistin, parietinic acid.

239

Specimen Examined: Kaghan, alt. 2,296 m, 29. 07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 398 (HUP), Manoor Valley Behari village, alt. 2,498 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 459 (HUP).

World Distribution: Asia, Europe, N. America.

2. Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr., Mitt. Inst. Allg. Bot. Hamburg 30-32: 237 (2002)

Thallus foliose, adnate to loosely adnate, lobate; lobes up to 0.2-0.5 mm wide, flattened to slightly convex, dorsiventral; tips truncate; upper surface orange to dark orange, smooth, sorediate; soredia powdery; lower surface white to yellow, smooth, rarely rhizinate; rhizenes white, short; apothecia rare, up to 3.5 mm in diameter, laminal, stipitate; disc orange; epihymenium brown; hymenium colourless below, 55-100 µm tall; paraphyses simple to branched, septate; hypothecium colourless to pale brown; asci 8-spored, clavate; ascospores colourless, ellipsoid, polarilocular, 10.5-20 x 5.5-9 µm.

Habitat: On bark (Corticolous)

Spot Tests: Upper surface K+ purple, C-, KC-, Pd-

Secondary Metabolites (TLC): Parietin, fallacinal, teloschistin, parietinic acid

Specimen Examined: Naran, alt. 2,622 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 408 (HUP), Shogran, alt. 2,442 m, 27.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 732 (HUP).

World Distribution: Asia Europe N. America

240

Xanthoria (Fr) Th. Fr.,

Thallus foliose, loosely to closely attacheddorsiventral, orbicular, rosette spreading, lobate; lobes flat, to convex or concave, elongate; tips ascending to erect; upper surface bright yellow orange or orange red, corticate, smooth or wrinkled; lower surface white to pale brown, corticate, rhizinate; rhizines pale, simple; ascomata apothecia, sessile to subpedicellate; disc yellow, orange or orange red, plane or concave, epruinose; epihymenium golden, orange; hymenium 50-60 µm; hypothecium colourless; paraphyses apical cell swollen; asci 8-spored, clavate; ascospores colourless, ellipsoid, polarilocular. Secondary metabolites: Anthraquinones paritin, teloscistin, fallacinal, emodin. Substrate: on bark or rock.

The genus represented a total of 50 species from world and four species fom Pakistan. The present study recorded two species from District Mansehra.

Key to species:

1a. Thallus isidiate or sometimes sorediate...... X. sorediata

1b. Thallus lacking isidia and soredia...... 2

2a. Thallus orange to dark yellow, corticolous, lobes plane or convex...... X. parietina

2b. Thallus orange red to red brown, saxicolous, lobes convex………………………………………………………..Xanthoria sp.

1. Xanthoria parietina (L.) Th. Fr., Lich. Arctoi 3: 69 (1860)

Thallus foliose, rosettes, to 8 cm wide, lobate; lobes flat, rounded, dorsiventral; upper surface orange, yellow or orange yellow, smooth, not sorediate; lower surface near margin pale yellow, in center white, wrinkled, attached with white hapters; apothecia abundant, concave to flat,

241

slightly stalked, 0.5-2.0 mm in diameter; disc orange; epihymenium orange; hymenium colourless 65 µm tall; hypothecium colourless paraphyses simple, slightly moniliform; asci 8-spored, clvate, Teloscistes-type; ascospores colourless, ellipsoid, polarilocular, 11.5-12.5 x 7-8 µm.

Habitat: On twigs (Corticolous)

Spot Test: Thallus K+ purpel

Secondary Metabolites (TLC): Paritin, teloscistin, fallacinal, emodin

Specimen Examened: Manoor Valley on way to Ansoo Lake, alt. 2,786 m, 04.08. 2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 499 (HUP), Lalazar, alt. 3,031 m, 11.09.4014, Asmat Ullah, Amir Khan and Syed Juneed Shah 600 (HUP), Shogran, alt. 2,325 m, 26.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 691 (HUP), Saripaya, alt. 2,900 m, 27.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 745 (HUP).

World Distribution: Asia, Europe, Africa, N. America.

Note: A new record to Pakistan.

2. Xanthoria sorediata (Vain.) Poelt, Mitt. bot. St. Samml., Münch. 11: 29 (1954)

Thallus foliose, to 3.5 cm wide, tightly adnate, rosettes or small colonies, tightly lobate; lobes flattened to convex, dorsiventral, rotund to truncate; upper surface yellow to orange, sorediate; soredia granular; lower surface smooth or somewhat wrinkled, white, short, white hapters; apothecia rare, up to 2 mm in diameter, laminal; epihymenium brown; hymenium 60-90 µm tall, colourless below; hypothecium colourless to pale brown; paraphyses simple; asci 8-spored, clavate; ascospores colourless, ellipsoid, polarilocular, 10.5-12 x 6.5-9 µm.

242

Habitat: On rock (Saxicolous)

Spot Tests: Upper surface K+ purple, C-, KC-, Pd-

Secondary Metabolites (TLC): Parietin, fallacinal, emodin, teloschistin

Specimen Examined: Jalkhad, alt. 3,179 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 514 (HUP), Barwai, alt. 2,979 m, 15.09.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 609 (HUP).

World Distribution: Asia, Europe, N. America, C. America (Mexico), N. Africa (Morocco).

Note: New to the study area.

Fig. 4.29: Distribution of Teloschistaceae in District Mansehra; 1. Lulusar lake, 2. Lalazar, 3. Kaghan, 4. near forest rest house Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan.

243

Plat 3.37: A. Caloplaca cirrochroa, B. Caloplaca decipiens, C. Caloplaca teicholyta (scale= 0.5 cm) in District Mansehra.

244

24. Thelotremataceae

Thallus crustose; apothecia immersed (more or less); spores colourless or brown, septate to muriform. Habitat: Trees, soil, rocks. Distribution: temperate to tropical.

Genera in study area: The present study recorded single genus from District Mansehra (Fig. 4.30).

Diploschistes Norman, Nyt. Mag. Naturvid. 7: 232 (1853).

Thallus crustose, continous to cracked-areolate; upper surface gray-white, smooth to verrucose, often pruinose; ascomata apothecia, laminal, immersed; disc black, occasionally pruinose; exciple brown to dark brown; epihymenium colourless to black; hymenium colourless; hypothecium colourless to brown or black; asci elongate-clavate to subcylindrical, 1-8 spored; ascospores brown to dark brown or purple-black, broadly ellipsoid, smooth, muriform, lacking a distinct perispore or gelatinous sheath. Secondary metabolites: para-depsides (eg lecanoric, diploschistesic acid), Orsellinic acid. Substrate: on soil, rock, lichens or mosses.

This genus has a total of 35 species from the world and four species are reported from Pakistan. The present study recorded three species as new to District Mansehra (Plate 3.39).

Key to species:

1a. Grayish, saxicolous, K- or K+ yellow to red……………....D. scruposus

1a. Whitish to grayish, terricolous or muscicolous, K+ yellow to red….2

2a. Hymenium 75-115 µm tall, asci 4-spored, ascospores 17-30 x 5.5-14 µm………………………………………………………..…...D. muscorum

245

2b. Hymenium 105-170 µm tall, asci 4-8 spored, ascospores 19.5-37.5 x 9- 16.5 µm…………………………………………………………D. diacapsis

1. Diploschistes diacapsis (Ach.) Lumbsch, Lichenologist 20(1): 20 (1988)

Thallus crustose, rimose- to verrucose-areolate; areoles plane to subconvex,1.0-15 mm thick, to 0.5-2.0 mm in diameter; upper surface pale gray, rough, dull, slightly whitish or grayish pruinose; ascomata urceolate, subimmersed, up to 2.5 mm in diameter, sessile; disc blackish, concave, white or gray pruinose; exciple up to 75 µm thick; epihymenium gray brown; hymenium colourless to pale brown, 105-170 µm high; hypothecium 30-60 µm tall; paraphysis simple; asci 4-8-spored, subclavate to cylindrical; ascospores brown, broadly ellipsoid, 19.5-37.5 x 9-16.5 µm, muriform.

Habitat: On soil (Tericolous)

Spot Tests: K+ yellow to red, C+ red, KC-, Pd-,

Secondary Metabolites (TLC): Lecanoric acids, diploschistesic acid

Specimen Examined: Dader, alt. 1,232 m, 08.11.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 73 (HUP), on way to Lake Saif-ul- Maluk, alt. 2,744 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 404 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Somalia, Morocco, Egypt), S. America (Peru, Chile, Colombia), N. America (USA), C. America (Mexico), Australia (Australia).

Note: New to the study area

2. Diploschistes muscorum (Scop.) R. Sant., in Hawksworth, James & Coppins, Lichenologist 12(1): 106 (1980)

246

Thallus crustose, continuous, weakly areolate; prothallus present, white; areoles thin or thick, plane to subconvex, 0.2-0.5 mm in diameter; upper surface white to pale brown, rough, slightly or profusely grayish or whitish pruinose; ascomata urceolate, up to 1.6mm in diameter, sessile; disc blackish, concave, slightly white pruinose; exciple 65-70 µm thick; epihymenium colourless; hymenium 75-115 µm high; hypothecium dark brown, 80-95 µm tall; asci subclavate to cylindrical, 70-80 x 11-18 µm, 4- spored; ascospores brown, ellipsoid, 17-30 x 5.5-14 µm.

Habitat: On soil (Tericolous)

Spot Tests: Thallus K+ yellow to red, C+ red

Secondary Metabolites (TLC): Lecanoric acids, diploschistesic acid

Specimen Examined: Dader, alt. 1,205 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 07 (HUP), Parehna, alt. 1,006 m, 05.12.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 155 (HUP), Oghi, alt. 1,440 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 223 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Algeria, Morocco), N. America, Caribean, S. America (Uraguay, Cheli, Argentena), C. America (Mexico).

Note: New to the study area

3. Diploschistes scruposus (Schreb.) Norman, Nytt Mag. Natur. 7: 232 (1853) [1852]

Thallus crustose, effuse, sometimes bullate, rimose; upper surface pale brown gray, shiny or dull, smooth, epruinose; apothecia 1.5-2.5 mm in diameter, unceolate, sessile; disc blackish, white pruinose; epihymenium brown; hymenium colourless, 100-130 µm tall; hypothecium brown, 50-90

247

µm tall; paraphysis simple; asci 8-spored, subclavate to cylindrical; ascospores: brown, ellipsoid, muriforn, 20-30 x 10-15 µm.

Substrate: On rock (Saxicolous)

Spot Tests: K± yellow to red, C+ red,

Secondary Metabolites (TLC): Diploschistesic acid, lecanoric acid, orsellinic acid

Specimen Examined: Mandgucha, alt. 1,899 m, 14.11.2013, Asmat Ullah and Mazhar-ul-Islam 139 (HUP), Manoor Valley, alt. 2,874 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 475 (HUP), Jalkhad, alt. 3,000 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 502 (HUP), Barawai, alt. 2,900 m, 15.09.2014, Asmat Ullah and Amir Khan Afridi 601 (HUP).

World Distribution: Asia, Europe, Africa, C. America (Mexico), N. America, S. America, Australasia (Australia, New Zealand), Hawaii.

Note: New to the study area

Fig. 4.30: Distribution of Thelotremataceae in District Mansehra; 1. Jalkhad. 2. Barhawai, 3. on way to lake Saif-ul-Maluk, 4. Manoor Valley, 6. Dader, 7. Mandagucha, 8. Oghi, 9. Parehna.

248

Plate 3.38: A. Diploschistes diacapsis, B. Diploschistes muscorum, C. Diploschistes scruposus (scale= 0.5 cm) in District Mansehra.

249

25. Trapeliaceae

Thallus crustose to lobate or squamulose; apothecia biatorine or lecanorine, sessile; sopres colourless, unicellular. Habitat: rocks. Distribution: arctic to temperate.

Genera in study area: The present investigation recorded single genus from District Mansehra (Fig. 4.31).

Trapeliopsis Hertel & Gotth. Schneid.

Thallus crustose, spreading, areolate, or squamulose to small foliose; upper surface pale green to greyish, isidia or soredia absent or present; ascomata apothecia, constricted at base, appressed; disc yellow brown to black; exciple colourless; epihymenium usually pigmented; hymenium colourless, weakly amyloid; paraphyses branched, anastomosing, septate; asci 8- spored, clavate-cylindrical; ascospores colourless, ellipsoid, simple, smooth, without thick perispore. Secondary metabolites: gyrophoric acid, substrate: on rocks, wood and soil.

The present study recorded one specie as new to Pakistan from District Mansehra.

1. Trapeliopsis granulosa (Hoffm.) Lumbsch, in Hertel, Lecideaceae exsiccatae, Fascicle V (München) 5: no. 99 (1983)

Thallus crustose, warted-areolate; areoles up to 0.1-0.4 mm in diameter, slightly to strongly convex; upper surface white to pale gray, rarely dark green, dull, usually sorediate; soralia 0.3-0.6 mm in diameter, whitish to cream-yellow, irregular and granular; apothecia frequent, 0.4-1.0 mm in diameter, sessile with a constricted base; disc variable in colour, pale pink to reddish brown, or green gray, dull, flat to weakly convex , epruinose; exciple colourless or grayish brown near margin; epihymenium pale to greenish, 10-20 µm high; hymenium 50-70 µm tall; paraphyses hyaline,

250

strongly branched and anastomosing; hypothecium colourless to pale orange brown, 10-75 µm high; ascospores colourless, simple, 10.5-13x 4.5- 6.5 µm.

Habitat: On rotting wood and bark (Corticolous)

Spot Tests: Thallus C+ red, KC+ red,

Secondary Metabolites (TLC): Gyrophoric acid.

Specimen Examined: Mandaghucha, alt. 1,928 m, 14.11.2014, Asmat Ullah and Mazhar-ul-Islam 151 (HUP), Kaghan, alt. 2,231 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 395 (HUP).

World Distribution: Asia, Europe, Africa (Madagascar, S. Africa, Morocco), N. America, S. America, Caribbean, Australasia (Australia), Antarctica.

Note: New to Pakistan.

Fig. 4.31: Distribution of Trapeliaceae in District Mansehra: 1. Kaghan, 2. Mandaghucha.

251

26. Umbilicariaceae

Thallus foliose, umbilicate; apothecia superlecideoid; ascospores colourless or brown, unicellular or muriform. Habitat: rocks. Distribution: arctic to temperate to tropical.

Genera in study area: The present study recorded a single genus from District Mansehra (Fig. 4.32).

Lasallia Merat

Thallus foliose, umbilicate, monophyllus, dorsiventral, attached by stout; upper surface whitish gray or light to dark brown, dull, densely postulate, isidia present or absent; lower surface whitish gray to dark brown or black, smooth to tiny papillose to areolate, without rhizines; ascomata apothecia, sessile or stalked; disc dark brown to black, flat to undulate; true exciple present, persistent; hymenium colourless; paraphyses simple or slightly branched, apices clavate, cap dark brown; asci Umbilicaria-type, clavate, 1-2 spored; ascospores pale to dark brown, muriform. Secondary metabolites: anthraquinones, gyrophoric acid, papulosin. Substrate: on siliceous rock, cliffs, boulders in sun and shade.

The genus represented a total of 17 species from the world and single taxa from Pakistan. The present study recorded single taxa from District Mansehra (Plate 3.40).

Lasallia papulosa (Ach.) Llano, (1950)

Thallus umbilicate, monophyllus, up to 8.5 cm in diameter, margin irregular or scalloped; upper surface gray, occasionally brown or covered with rusty red pruina; lower surface ashen gray or brown, smooth to slightly areolate; apothecia common, up to 2.0 mm in diameter, sessile to subpedicellate; disc dark brown to black, flat to undulate; asci clavate, 1-

252

spored; ascospores muriform, colourless initially becoming brown, 50-90 x 30-40 µm.

Habitat: On rock (Saxicolous)

Spot Tests: Upper cortex: K- , C+ red, KC+ red, Pd-,

Secondary Metabolites (TLC): Anthraquinones, gyrophoric acid, papulosin,

Specimen Examined: Dader, alt. 1,215 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 06 (HUP).

World Distribution: Asia, Europe, Africa (S. Africa, Morocco, Kenya, Tanzania).

Fig. 4.32: Distribution of Umbilicariaceae in District Mansehra. 1. Dader.

253

Plate 3.39: Lasallia papulosa (scale= 0.5 cm) in District Mansehra.

254

27. Verrucariaceae

Thallus foliose or crustose, usually corticate when foliose, non-corticate when crustose. Photobiont green algal cells. Perithecia immersed or superficial, simple, entire or dimidiate; ascus with 1-8 spores, occasionally 16 spores; spores colourless or sometimes brown, simple.

Genera in study area: The present study recorded four genera from District Mansehra (Fig. 4.33).

Key to genera

1a. Thallus Crustose ………………………………………………..……….2

1a. Thallus foliose or Squamulos…………………………………………..3

2a. Perthecia black, immersed or sessile, asci 8-spored……..…Verrucaria

2b. Not as above

3a. Thallus foliose, growing on rocks, spore simple without perispore……………………………………………………Dermatcarpon

3b. Thallus Squamulose or subfoliose, growing on rocks, soil, mosses…4

4a. on soil, ascus 8-spored……………………………….……Catapyrenium

4b. on soil, rocks, ascus bisporous………………………………Endocarpon

Catapyrenium Flot.

Thallus squamulose, attached by intricate, rhizoidal hyphae or rhizines; squamules rounded, dispersed, loosely or closely adnate, contiguous or imbricate; upper surface greenish gray or brown, smooth or minutely scabrose, soredia and isidia absent; lower surface pale black, bare or with rhizohyphal weft, hyphal tuft or rhizines; ascomata perithecia, immersed, laminal, immersed, subglobose or broadly pyriform; exciple colourless,

255

brownish, brown-black; paraphyses absent; asci clavate, 8-spored, thin walled, wall non amyloid, without an ocular chamber; ascospores biseriate, simple, hyaline, ellipsoid or ovoid-clavate. Secondary metabolites: none detected. Substrate: on soil, over plants debris and bryophytes.

A total of 8 species of the genus are reported from the globe while two species from Pakistan. The present study recorded one species from District Mansehera (Plate 3.41)

Catapyrenium cinereum (Pers.) Körb., Syst. lich. germ. (Breslau): 325 (1855)

Thallus squamules, small, up to 3 mm across, closely adnate, finely incised, occasionally subgranular in central part, usually whitish pruinose; lower surface dark on black loose hypothallus; ascomata perithecia, numerous, immersed in the thallus; exciple pale when young, soon becoming blackish or brown throughout; asci clavate, 8-spored; ascospores simple, hyaline, biseriate, clavate, 16.5-23 x 6-8.5 µm.

Habitat: On soil (Tericolous)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Dader, alt. 1,215 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 031 (HUP).

World Distribution: Asia, Europe, British Isles, Africa (S. Africa, Uganda), North America, S. America (Chile), Australasia (Australia, New Zealand) and Antarctica.

Note: New to the study area.

256

Dermatacarpon Eschw.

Thallus: foliose; upper surface gray to brown, vegetative propagules absent; lower surface dark brown to almost black, smooth, rugose, reticulate, some species on lower surface with rhizine like structure, single or multiholdfast; ascomata perithecial, immersed in thallus, broadly obpyriform to subglobose; asci clavate or cylindrical, bitunicate, thin walled, 8-spored; ascospores colourless, simple, smooth, ellipsoid, without perispore, irregularly arranged in ascus, 8-25 µm long. Secondary metabolites: none detected. Substrate: on rocks in damp habitat.

The genus represented 35 species from the world and two species from Pakistan. The present study recorded one species from District Mansehra (Plate 3.41).

1. Dermatocarpon miniatum (L.) W. Mann, Lich. Bohem. Observ. Dispos.: 66 (1825)

Thallus foliose, entire or lobed, up to 20-45 mm in diameter, attached to substratum by central holdfast; lobes flat or slightly rippled, 1-6.5 cm broad; upper surface pale gray to gray brown, slightly white pruinose; lower surface light brown to dark brown, smooth to warty, occasionally with reticulate veins; ascomata perithecia, abundant, immersed, black, 190 µm in diameter; ascospores hyaline, simple, elongated, 7.5-13.5 x 5-6 µm.

Habitat: On rocks (Saxicolou)

Spot Test: All negative

Secondary Metabolites (TLC): None detected

Specimen Examined: Near Bafa Durah, alt. 934 m, 09.11.2013, Asmat Ullah and Amir Khan Afridi 99 (HUP), Dader on the bank of Siran river, alt. 1,205 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 01

257

(HUP), on side of road from Naran to Lake Saif-ul-Maluk, alt. 2,990 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 403 (HUP), Jalkhad, alt. 3,167 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul- Islam 515 (HUP).

World Distribution: Asia, Europe, British Isles, Africa (Algeria, Morocco), North America, S. America (Venezuela, Colombia), C. America (Mexico), Australasia.

Note: New to the study area.

Endocarpon Hed.

Thallus squamulose, to subfoliose; squmules 0.5-10 mm wide, scattered to contiguous or imbricate, rounded or variously lobed, plane to convex, closely appressed to ascending; upper surface brown, smooth or rugulose to shallowly rimose, isidia or soredia absent; lower surface pale, bare, or with rhizohyphal weft or rhizines; ascomata perithecia, broadly pyriform to subglobose, laminal, immersed; exciple dark throughout; asci bitunicate, clavate or cylindro-clavate, thin walled, usually bisporous; ascospores colourless, or pale to dark brown, multiseptate to muriform. Secondary metabolites: none detected. Substrate: soil, rocks, on mosses, rarely barks.

A total of 60 species of the genus are reported from world and one specie from Pakistan. The present study recorded one specie from District Mansehra (Plate 3.41)

1. Endocarpon pusillum Hedw., Descr. micr.-anal. musc. frond. (Lipsiae) 2: 56 (1789)

Thallus squmulose; squmules scattered or contiguous, 0.8-3 mm wide, 0.15- 0.20 mm thick, closely appressed to substratum, usually weak to deeply lobate; upper surface pale to dark raddish brown, smooth, dull; lower surface black, rhizinate; rhizines black usually conspicuous, moderately to

258

richly branched; perithecia up to 0.4 mm wide, globose; exciple 20-35 µm thick, brown-black to black; asci clavate to cylindro clavate, 2-spored, 80- 120 x 17-30 µm; ascospores colourless to dark brown, muriform, ellipsoid to subcylindrical, 30-50 x 16-20 µm.

Habitat: On soil (tericolous)

Spot Tests: All negative,

Secondary Metabolites (TLC): None detected

Specimen Examined: Dader, alt 1,209 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Malik Zahir 40 (HUP).

World Distribution: Asia, Africa, N. America, (Canada, USA), S. America, C. America (Guatemala, Mexico), Hawaii, Australasia.

Verrucaria Schrader

Thallus crustose, immersed or superficial, continuous or rimose to areolate; upper surface white, gray, green, brown, black or purple, dull or shiny very rarely isidiate-pseudosorediate; ascomata perithecia, black, globose or broadly ovoid, immersed, laminal or lateral; exciple hyaline, brown or black; involucrellum present or absent; paraphyses disappearing; asci 8- spored, clavate, fissitunicate; ascospores colourless, subglobose, ellipsoid, smooth, thin walled. Secondary metabolites: absent. Substrate: mostly on rock, occasionally on bark or soil.

The genus has 200 species distributed worldwide; previously six species are reported from Pakistan. The present study recorded one specie from from District Mansehra (Plate 3.42).

1. Verrucaria muralis Ach., Methodus, Sectio prior (Stockholmiæ): 115 (1803)

259

Thallus crustose, immersed to superficial, irregularly rimose, rarely areolate; aupper surface white-green or brown-white,dull, epruinose; perithecia black, semi-immersed or almost sessile, apex rounded to slightly flattened; exciple colourless to pigmented at base, sub-globose, 0.2-0.35 mm wide; involucrellum present around upper half of exciple, more or less hemispherical; asci 8-spored, clavate, 60-75 x 15.5-22 µm; ascospores colourless, narrowly to broadly ellipsoid, simple, 16.5-24.5 x 8-12 µm.

Habitat: On rocks (Saxicolous)

Spot Tests: All negative

Secondary Metabolites (TLC): None detected.

Specimen Examined: Lalazar, alt. 2,600 m, 10.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 597 (HUP).

World Distribution: Asia, (Japan, Taiwan) Europe, Africa, North America, Australasia (Australia, New Zealand).

Fig. 4.33: Distribution of Verrucariaceae in District Mansehra; 1. Jalkhad, 2. Dader.

260

Plate 3.40: A. Catapyrenium cinereum, B. Dermatocarpon miniatum, C. Endocarpon pusillum (scale= 0.5 cm) in District Mansehra.

261

Plate 3.41: Verrucaria muralis (scale= 2 cm) in District Mansehra.

4.2 Lichen Species Identified by DNA Barcoding

All reported lichen species from study area were also tested by DNA barcoding for identification. Amomg 110 lichen species, only five species were identified by the above method (Table 4.9).

1. Lecanora allophana (Ach.) Nyl.

DNA barcoding: Maximum homology of the lichen sample P-10 (Gene bank accession number KY548051.1) with Lecanora allophana at nucleotide sequence level (98% identity and 100% query).

2. Phaeophyscia ciliata (Hoffm.) Moberg

DNA Barcoding: Maximum homology of the lichen sample P-7 (Gene bank accession number AY498676.1) with Phaeophyscia ciliata at nucleotide sequence level (99% identity and 100% query).

3. Physcia aipolia (Ehrh. ex Humb.) Fürnr.

DNA barcoding: Maximum homology of the lichen sample P-50 (Gene bank accession number GU247177.1) with Physcia aipolia at nucleotide sequence level (99% identity and 100% query).

262

4. Physcia dubia (Hoffm.) Lettau

DNA barcoding: Maximum homology of the lichen sample P-59 (Gene bank accession number KX550105.1) with Physcia dubia at nucleotide sequence level (91% identity and 73% query).

5. Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr.

DNA barcoding: Maximum homology of the lichen sample P-48 (Gene bank accession number KC179134.1) with Xanthomendoza fulva at nucleotide sequence level (100% identity and 100% query).

Table 4.9: List of species identified by DNA barcoding.

Sr. Accession Identity Lichens species No No at NCBI 1 Lecanora allophana (Ach.) Nyl. KY548051.1 100% 2 Phaeophyscia ciliata (Hoffm.) Moberg AY498676.1 99% 3 Physcia aipolia (Ehrh. ex Humb.) Fürnr. GU247177.1 99% 4 Physcia dubia (Hoffm.) Lettau KX550105.1 100% Xanthomendoza fulva (Hoffm.) Søchting, 5 KC179134.1 100% Kärnefelt & S.Y. Kondr.

263

4.3 Biological Activities

4.3.1 Antibacterial Activity

The crude acetonic extract of ten selected lichen species showed variable range of zone of inhibitions (7.00 – 12.66 mm) against tested bacteria (Table 4.10). The zones of inhition for control were recorded in range of 18 - 22 mm against all bacterial strains. Acetone extract exhibted from Flavoparmelia caperata, Cladonia pyxidata and Lecanora allophana caused maximum zones of inhibition (12.66 mm) against Escherichia coli, Enterococcus faecali, S. aureus and S. epidermidis. Slightly narrow zones of inhibition (12.33 mm) were recorded for Flavoparmelia caperata and Lecanora allophana against Staphylococcus epidermidis. The crude methanolic extract of selected lichen species showed variable range of zone of inhibitions (7.00 – 12.33 mm) against tested bacteria (Table 4.11). The zones of inhibition for control were recorded in range of 18 - 21 mm against all bacterial strains. For crude methanolic extracts, maximum zone of inhibation (12.33 mm) were recorded for lichen species Flavoparmelia caperata and Rhizocarpon viridiatrum against Escherichia coli and Pseudomonas aeroginosa, followed by Caloplaca decipines, Collema flaccidum, Lecanora allophana and Usnea fulvoreagens (zone of inhibition 12.33 mm) against Enterococcus faecali and Pseudomonas aeroginosa.

264

Table 4.10: Antibacterial activity of acetone extracts of selected lichen species from District Mansehra.

Bacterial strains and zone of inhibition (mm) Sr. No. Lichen species E. coli S. epidermi-dis B. subtilis E. faecalis P. aerogin-osa S. aure-us 1 Caloplaca decipiens 8.66 10.00 0 10.33 10.66 10,00 2 Cladonia pyxidata 9.66 8.33 8 12.66 9.66 8.33 3 Collema flaccidum - 0 0 0 8.66 8.66 4 Dermatocarpon miniatum 10.33 8 8 8.33 8.33 8.33 5 Flavoparmelia caperata 12.66 12.33 9.66 10.33 11.33 11.33 6 Flavopunctelia flaventior 0 9 0 8 0 9 7 Lecanora allophana 10 12.33 10.66 10 7 12.66 8 Peltigera polydactylon 0 8.66 0 0

9 Rhizocarpon viridiatrum 7.66 11.33 10.66 9.33 7.33 8.66 10 Usnea fulvoreagens 7.66 8.33 7.66 8.33 8.00

265

Table 4.11: Antibacterial activity of methanol extracts of selected lichen species from District Mansehra.

Bacterial strains and zone of inhibition Lichen species Sr. No. E. coli S. epidermidis B. subtilis E. faecalis P. aeroginosa S. aureus 1 Caloplaca decipiens 10.33 7 8.33 10.66 8 8.33 2 Cladonia pyxidata 0 7 0 10 0 0 3 Collema flaccidum 0 7 0 10.66 7 8 4 Dermatocarpon miniatum 0 7 0 9 7 7.66 5 Flavoparmelia caperata 12.33 7 10.33 10 12.33 9.66 6 Flavopunctelia flaventior 8 7 0 8 8 8.66 7 Lecanora allophana 8.33 7 9.66 10.66 10 9 8 Peltigera polydactylon 0 7 0 0 7 0 9 Rhizocarpon viridiatrum 12.33 7 10 0 10 7 10 Usnea fulvoreagens 8 7 9 10 10.66 7

266

4.3.2 Antifungal Activity

The crude acetonic extract of selected lichen species showed variable range of zone of inhibition (7.00 – 11.33 mm) against tested fungi (Table 4.12). The zones of inhition for control were recorded in range of 17 - 19 mm against all tested fungal strains. For crude acetone extracts maximum zones of inhibition (11.33 mm) were recorded for Caloplaca decipines, Flavoparmelia caperata and Lecanora allophana against Aspergillus fumigatus and A. niger, followed by Cladonia pyxidata, Flavoparmelia caperata and Lecanora allophana (Zone of inhibition 10.66 mm) against Aspergillus fumigatus, A. niger and Fusarium solani. The crude methanolic extract of selected lichen species showed variable range of zone of inhibition (7.00 – 10.66 mm) against tested fungi (Table 4.13). The zones of inhibition for control were recorded in range of 16 - 19 mm against all tested fungal strains. For crude methanolic extracts maximum zone of inhibation (10.66 mm) were recorded for lichen species Flavoparmelia caperata and Lecanora allophana against Aspergillus fumigatus and A. niger, while slightly lower zone of inhibition (10.33 mm) were shown by Flavopunctelia flaventior against A. niger.

267

Table 4.12: Antifungal activity of acetone extracts of selected lichen species from District Mansehra.

Sr. No Lichen species Fungal strain and zone of inhibation (mm) A. niger A. fumigatus F. solani F. oxysporium 1 Dermatocarpon miniatum 8.33 7.33 7.66 7.33 2 Caloplaca decipiens 9.66 11.33 9.33 8.33 3 Cladonia pyxidata 8.33 10.66 8.66 9.33 4 Collema flaccidum 0 0 0 0 5 Flavoparmelia caperata 10.66 11.33 9 10 6 Flavopunctelia flaventior 9 8.33 7 7.33 7 Lecanora allophana 11.33 10.0 10.66 8.33 8 Peltigera polydactylon 0 0 0 0 9 Rhizocarpon viridiatrum 7.33 8.66 7 8.33 10 Usnea fulvoreagens 9.66 7 8 8.33

268

Table 4.13: Antifungal activity of methanol extracts of selected lichen species from District Mansehra.

Sr. No. Lichen species Fungal strain and zone of inhibition A. niger A. fumigatus F. solani F. oxysporium 1 Dermatocarpon miniatum 8 7.66 7 7.33 2 Caloplaca decipiens 8 8.66 9 8.33 3 Cladonia pyxidata 8 8.66 7.33 8.66 4 Collema flaccidum 0 0 0 0 5 Flavoparmelia caperata 9.66 10.66 8.33 9.66 6 Flavopunctelia flaventior 10.33 8.66 7.33 9.66 7 Lecanora allophana 10.66 9.33 9 8.33 8 Peltigera polydactylon 0 0 0 0 9 Rhizocarpon viridiatrum 8.33 8 7 8.66 10 Usnea fulvoreagens 9.66 8.33 8 9.33

269

4.3.3 Cytotoxcity Assay

The crude acetonic extracts of investigating lichen species in different concentration were shown variable range of (4% - 60%) toxic effect on larvae of A. salina (Table 4.14). In crude acetone extract concentration of 0.05 mg/mL, maximum mortality rate (60%) was recorded for Flavopunctelia flaventior followed by Flavoparmelia caperata (40%) while maximum mortality rate for extract of concentration 0.01 mg/mL were recorded for Flavopunctelia flaventior (40%). Similary, for extracts in concentration 0.001 mg/mL, 30% mortality rate was recorded for same species (Fig. 4.34). The crude methaholic extracts of investigating lichen species in different concentration were shown variable range of (3% - 53%) toxic effect on larvae of A. salina (Table 4.15). In crude methaholic extract of concentration 0.05 mg/mL, maximum mortility (53%) was shown by Flavopunctelia flaventior followed by Flavoparmelia caperata (50%). In concentration of 0.01 mg/mL maximum mortality was shown by Flavoparmelia caperata (40%) followed by Flavopunctelia flaventior (30%). Similarly, in concentration of 0.001 mg/mL, maximum mortilty (30%) was shown by Flavoparmelia caperata (Fig. 4.35).

270

Table 4.14: Percentage mortality of acetone extracts of selected lichen species from District Mansehra.

Percentage mortality Sr. No. Lichen species 0.05 mg/mL 0.01 mg/mL 0.001 mg/mL LC50 ( mg/mL) 1 Caloplaca decipiens 4% 0% 0% 579.77 2 Cladonia pyxidata 7% 4% 0% 399. mg/mL 3 Collema flaccidum 0% 0% 0% 0% 4 Dermatocarpon miniatum 10% 10% 0% 325.51 5 Flavoparmelia caperata 40% 30% 26% 86.09 6 Flavopunctelia flaventior 60% 40% 30% 31.87 7 Lecanora allophana 30% 10% 0% 83.77 8 Peltigera polydactylon 30% 20% 20% 142.66 9 Rhizocarpon viridiatrum 24% 13% 4% 119.37 10 Usnea fulvoreagens (Rasanen) 17% 7% 0% 153.82

271

Table 4.15: Percentage mortality of methanol extracts of selected lichen species from District Mansehra.

Percentage mortality Sr. No. Lichen species 0.05 mg/mL 0.01 mg/mL 0.001 mg/mL LC50 (mg/mL) 1 Caloplaca decipiens 10% 0% 0% 234.40 2 Cladonia pyxidata 10% 7% 0% 290.76 3 Collema flaccidum 0% 0% 0%

4 Dermatocarpon miniatum 30% 30% 20% 184.66 5 Flavoparmelia caperata 53% 27% 13% 45.01 6 Flavopunctelia flaventior 50% 40% 30% 48.11 7 Lecanora allophana 10% 7% 0% 290.76 8 Peltigera polydactylon 30% 20% 20% 142.66 9 Rhizocarpon viridiatrum 27% 17% 7% 112 10 Usnea fulvoreagens (Ra 20% 3% 0% 122.88

272

70% 60%

A.salina 50% 40% 30% 0.05 mg/mL 20% 0.01 mg/mL

% % mortality of 10% 0.001mg/mL 0%

Lichen species

Fig. 4.34: Percentage mortality of acetone extracts of selected lichen species from District Mansehra.

60%

50% 0.05 mg/mL

40% A. salina 0.01 mg/mL 30% 0.001mg/mL 20%

10%

% % mortalityof 0%

Lichen species

Fig. 4.35: Percentage mortality of methanol extracts of selected lichen species from District Mansehra.

273

4.3.4 Anticarcinogenic Activity

The crude acetonic extracts of investigating lichen species in different concentration were shown variable range of tumor inhibition (8% - 40%) (Table 4.16). Tumor inhibitions for control were recorded in range of 95%- 100%. For crude acetonic extracts in concentration of 0.05 m/mL, maximum tumor-inhibition activity (40%) were recorded for lichen species Flavoparmelia caperata followed by Rhizocarpon viridiatrum (39%) and Dermatocarpon miniatum 38%. While in extracts of concentration 0.01 mg/mL maximum tumor-inhibition were recorded for Flavoparmelia caperata (38%), Rhizocarpon viridiatrum and Dermatocarpon miniatum (33% each). Similarly, in concentration of 0.001 mg/mL, maximum activity (30%) was shown by Flavoparmelia caperata (Fig. 4.36). The crude methanolic extracts of investigating lichen species in different concentration were shown variable range (8% - 38%) of tumor inhibition (Table. 4.16). Tumor inhibitions for control were recorded in range of 95%-100%. Crude methanolic extracts in concentration of 0.05 mg/mL maximum tumor- inhibition (38%) were recorded for lichen species Flavopunctelia flaventior followed by Flavoparmelia caperata and Rhizocarpon viridiatrum (37% each). While in extracts of concentration 0.01mg/mL, maximum activity (31%) was shown by Flavoparmelia caperata followed by Flavopunctelia flaventior (30%) and in concentration 0.001 mg/mL maximum activity (30%) was shown by Flavopunctelia flaventior (Fig. 4.37).

274

Table 4.16: Anticarcinogenic activity of acetone and methanol extracts of selected lichen species from District Mansehra.

Acetone Extracts Methanol Extracts Sr. No. Lichen species 0.05 mg/mL 0.01 mg/mL 0.001 mg/mL 0.05 mg/mL 0.01 mg/mL 0.001 mg/mL 1 Caloplaca decipiens 0% 0% 0% 0% 0% 0% 2 Cladonia pyxidata 17% 8% 0% 18% 10% 0% 3 Collema flaccidum 17% 13% 12% 17% 10% 0% 4 Dermatocarpon miniatum 38% 33% 26% 31% 19% 10% 5 Flavoparmelia caperata 40% 38% 34% 37% 31% 15% 6 Flavopunctelia flaventior 36% 23% 20% 38% 30% 27% 7 Lecanora allophana 18% 13% 0% 0% 0% 0% 8 Peltigera polydactylon 34% 23% 20% 30% 16% 8% 9 Rhizocarpon viridiatrum 39% 33% 29% 37% 25% 13% 10 Usnea fulvoreagens 29% 20% 11% 28% 20% 9%

275

40% 35% 30% 25% 20% 15% 0.05 mg/mL 10% % % tumorinhibation 5% 0.01 mg/mL 0% 0.001 mg/mL

Fig. 4.36: Percentage tumor-inhibition of acetone extracts of selected lichen species from District Mansehra.

40% 35% 30% 25% 20% 15% 0.05 mg/mL

10% 0.01 mg/mL % % tumorinhibation 5% 0.001 mg/mL 0%

Fig. 4.37: Percentage tumor-inhibition of methanol extracts of selected lichen species from District Mansehra.

276

4.3.5 Antioxidant Activity

The crude acetonic extracts of investigating lichen species in different concentration were shown variable range (12% - 66%) of DPPH radical scavenging activity. For control DPPH radical scavenging activity were recorded in range of 61%- 79% (Table. 4.17). For crude acetone extracts in concentration of 1000 µg/mL, the strongest DPPH radical scavenging were recorded for Cladonia pyxidata (66%), Rhizocarpon viridiatrum (63%) and Peltigera polydactylon (58%). While in concentration 500 µm/mL, Rhizocarpon viridiatrum showed 60%, Peltigera polydactylon 56% and Cladonia pyxidata showed 54% antioxidant activity. Similarly, in concentration of 250 µg/mL maximum activity were shown by Rhizocarpon viridiatrum (56%) and Peltigera polydactylon (50%), while for concentration of 125 µg/mL maximum activity (47%) were shown by Peltigera polydactylon (Fig. 4.38). The crude methanolic extracts of investigating lichen species in different concentration were shown variable range of DPPH radical scavenging activity (8% - 57%). For control DPPH radical scavenging activity were recorded in range of 61%- 79% (Table. 4.18). For crude methanolic extracts in concentration of 1000µg/mL, highest DPPH free radical scavenging was recorded for Rhizocarpon viridiatrum (56%) and Peltigera polydactylon (50%), while in concentration of 500µg/mL, maximum activity was shown by Peltigera polydactylon (55%) and Rhizocarpon viridiatrum (55%). Similarly, for crude methanolic extracts in concentration of 250 µg/mL, maximum activity was recorded for Peltigera polydactylon (51%) and Rhizocarpon viridiatrum (46%) while in concentration of 125 µg/mL, maximum activity was shown by Rhizocarpon viridiatrum (44%) and Flavoparmelia caperata (41%) (Fig. 4.39).

277

Table 4.17: Antioxidant activity of acetone extracts of selected lichen species from District Mansehra.

Percent free radical scavenging activity Sr. No. Lichen Species

1000 µg/mL 500 µg/ml 250 µg/ml 125 µg/ml 1 Caloplaca decipiens 17 12 0 0 2 Cladonia pyxidata 66 54 44 40 3 Collema flaccidum 37 31 30 25 4 Dermatocarpon miniatum 52 47 43 36 5 Flavoparmelia caperata 46 39 33 26 6 Flavopunctelia flaventior 29 26 22 20 7 Lecanora allophana 40 37 29 26 8 Peltigera polydactylon 58 56 51 41 9 Rhizocarpon viridiatrum 63 60 56 49 10 Usnea fulvoreagens 33 31 26 24

Ascorbic acid 79 72 65 61

278

Table 4.18: Antioxidant activity of methanol extracts of selected lichen species from District Mansehra.

Percent free radical scavenging activity Sr. No. Lichen Species 1000 µg/mL 500 µg/mL 250 µg/mL 125 µg/mL 1 Caloplaca decipiens 29 20 13 0 2 Cladonia pyxidata 49 47 41 33 3 Collema flaccidum 26 19 13 11 4 Dermatocarpon miniatum 48 46 37 33 5 Flavoparmelia caperata 51 48 43 41 6 Flavopunctelia flaventior 31 29 23 21 7 Lecanora allophana 37 36 30 28 8 Peltigera polydactylon 56 55 51 38 9 Rhizocarpon viridiatrum 57 55 46 44 10 Usnea fulvoreagens 26 23 16 8 Ascorbic acid 79 72 65 61

279

80 70 1000 µg/mL 60 500 µg/mL 50 250 µg/mL 40 30 125 µg/mL 20

10 % DPPH scavenging 0

Lichen species

Fig. 4.38: Antioxidant activity of acetone extracts of selected lichen species from District Mansehra.

80 70 1000 µg/mL 60 500 µg/mL 50 40 250 µg/mL 30 125 µg/mL 20

10 % % DPPHscavenging 0

Lichen species

Fig. 4.39: Antioxidant activity of methanol extracts of selected lichen species from District Mansehra.

280

Chapter 5

DISSCUSSION

In the present study, species diversity of lichens in District Manshera was evaluated alongwith in-vitro antimicrobial, cytotoxic, antitumor and antioxidant activities of acetone and methanol crude extract of the lichens. Recently worldwide, there is great focus on the taxonomy, ecology and phylogenetic study of lichens to explore their biodiversity and biological importance (Geiser et al., 2010; Leavitt and Clair, 2011; Lendemer and Hodkinson, 2013; McMurray et al., 2013; Shrestha et al., 2012). Due to highly diverse topographic and climatic attributes, Pakistan serves a distinct home land for a diverse flora. The higher plants of Pakistan are documented comprehensively (Stewart, 1972; Ali and Qaiser, 1995-2012), however exploration of lower plants including lichens remain neglected. Unfortunately, the lichen flora of Pakistan is still little known and even earlier available literature provides just sample checklists for some localities of Pakistan (Hawksworth and Mahmood 1971; Shaheen and Iqbal, 1978; Aptroot and Iqbal, 2011). In order to asses our lichens resource, detail documentation of lichen flora of Pakistan is important future target. As Pakistan covers a vast area (7,960,962 km2), therefore area-wise lichen exploration is possible rather than taking into account the whole country simultaneously. Furthermore, contrary to previous studies which involved the collection of lichen samples from roadsides and in particular season, an additional attempt was made to collect the lichen samples round the year and less explored localities difficult to access such as Manoor Valley, Lulusar Lake, Jalkhad, Saripaya and Mandagucha.

In current study, a thorough field survey based on scientific investigation was carried out in selected areas of District Manshera during January 2012 to July 2015. During the field surveys, about 900 lichen specimens were

281

collected from various localities of the District Mansehra. Identification of the collected lichen specimens via morphological, anatomical, chemistry of thalli and DNA barcoding indicated that collected lichen specimens belonged to 110 lichen taxa representing 27 families and 56 genera from the study area. Previously 96 taxa belonging to 25 families and 50 genera were reported from District Mansehra (Aptroot and Iqbal, 2012). Surprisingly, only 36 already reported lichen species were recollected and while the remaining 60 species were not found in the study area.

The highest number of genera was shown by Parmeliaceae with 12 genera (10.90%) followed by Physciaceae 7 genera (6%), Teloschistaceae 4 genera (3.63%) and Verrucariaceae 4 genera (3.63%). Similar high diversity has been reported for Parmeliaceae and Physciaceae from District Tamil Nadu (Nayaka et al., 2001), Jammu and Khasmir (Goni and Sharma, 2015) and Uttarkand (Mishra and Upreti, 2016). Higher number of lichen species were recorded for family Parmeliaceae with 17 species (15.45%), followed by Lecanoraceae 15 species (13.63%), Physciaceae 13 species (11.81%) and Teloschistaceae 9 species (8.18%) is comparable to studies carried out in Kombam district, India (Nayaka et al., 2001), Laltipur district (Devkota, 2008) and Kathmandu and Sagarmatha national Parks, Nepal (Baral, 2015).

Among 110 lichens species, only five species were identified through DNA barcoding. The common reasons are the failure of amplification process to obtain the target gene in selected lichens. All specimens where amplification failed were collected 2.5 - 3 years ago. Complete sequences were obtained from DNA extracted from the specimens collected within 1 year. Kelly et al. (2011) also reported that amplification failure is one of common reason for not obtaining target gene and the in DNA extracted from 3 years old samples (7.1%) or (9.8%) amplification failed.

282

Most interestingly, among the identified lichen species, 12 species were new to Pakistan viz., Acarospora veronensis, Anaptychia crinalis, Candelariella efflorescens, Cladonia caespiticia, Cladonia floerkeana, Lecanora chlarotera, Lecanora pulicaris, Lepraria elobata, Nephroma parile, Punctelia subrudecta, Rhizocarpon lecanorinu and Trapeliopsis granulosa. Additionally, in the current investigation 59 identified species belonging to 17 families and 35 genera were recorded for the first time in District Mansehra, Khyber Paktonkhawa. Meanwhile as far as various growth forms of recorded lichen species are concerned, Crustose included 51 species (46.36%) and foliose comprised 47 species (42.72%). A similar ratio of crustose and foliose growth forms were also recorded by some other investigators from different region of the world; District Poonch (Khan et al., 2010), Uludag mountain, Bursa (Ozturk et al., 2010), Southern Assam (Rout et al., 2010) and Jammu and Kashmir (Ghoni and Sharma 2015). In addition, the lichen species from District Mansehra prefer specific habitats; 55 species were corticolous (50%), 42 species saxicolous (38.18%), 12 species tericolous (10.9%) and only one muscicolous (0.9%). The occurrence of dominant corticolous and saxicolous lichen species was confirmed by similar studies conducted earlier in differen area; Kombam district, Western Ghat and Jummu and Kashmir (Nayaka et al., 2001; Vinayaka, 2011; Ghoni and Sharma, 2015).

Lichen species from District Mansehra colonized on different substrates like trees, rocks, soil and mosses. On the basis of hosted substrate, the present study recorded 43 species on bark (39.09%), followed by 42 species on rocks (38.18%) and 12 species on soil (10.9%). Lichen always prefers bark of trees as indicated by Vinayaka et al. (2016) in their investigation suggesting a higher number of species inhabiting bark of trees. In the view of conservation, majority of the lichen species (78.13%) are recorded at two or more localities while 23 taxa (21.87%) are restricted to single locality and

283

fall under rare category. Hence, these taxa deserve immediate attention and an effective conservation action plan should be developed at urgent bases.

Emergence of bacterial resistance to various drugs such as β-lactam antibiotics has limited the scope of existing antibiotics and forced the concerted efforts to search and develop new bioactive compounds for the treatment of these strains (Stapleton and Taylor, 2002). After the publication of first report on antibacterial activity of lichen species by Burkholder et al. (1944), and many other research works have been done in recent years on the antibacterial potentials of lichen species. The results of these researches have manifested that lichen can be another option for drug discovery against several antibiotic resistant strains (Lauterwein et al., 1995; Cocchietto et al., 2002; Francolini et al., 2004; Molnar and Farkas, 2010; Boustie et al., 2011; Pompilio et al., 2013; Shrestha and Clair, 2013 a,b; Ramos et al., 2014; Rankovic et al., 2014).

In present study, we evalualted the antibiotic activities of methanolic and acetonic crude extracts of selected lichen species against some bacterial strains. Maximum zone of inhibition (12.66 mm) of the crude acetone extracts against Escherichia coli (ATCC_39111) was recorded for Flavoparmelia caperata. Chauhan and Abraham (2013) also recorded zone of inhibition within range of 6.00 mm to 22.66 mm for methanol extracts Parmotrema sp. in different concentrations. In case of Pseudomonas aeroginosa (ATCC_10145), maximum zone of inhibition (11.33 mm) was recorded for Flavoparmelia caperata. Srivastava et al. (2013b) was also recorded almost identical zone of inhibition (12.30 mm) against P. aeruginosa for ethanol extract of Usnea ghattensis. The maximum zone of inhibition of the crude extracts against Gram+ve S. epidermidis (ATCC- 700587) was recorded for Flavoparmelia caperata and Lecanora allophana (12.33 mm). Karagoz et al. (2009) also reported identical zone of inhibition

284

(13.00 mm) for the ethanol extract of Peltigera polydactylon against S. epidermidis. Maximum inhibition zone (10.66 mm) against Bacillus subtilis (ACTT 6633) were shown by Lecanora allophana, Rhizocarpon viridiatrum. An earlier study also reported identical zone of inhibition (10.0 mm) for aquous extracts of Peltigera praetextata and Umbilicaria vellea against Bacillus subtilis (Karagoz et al. 2009). The crude acetonic extract of Cladonia pyxidata exhibited maximum zone of inhibition (12.66 mm) against Gram+ve bacterium E. faecialis (ATCC-19433). Almost similar results were reported for the acetonic extract of Roccella belangeriana against Gram+ve Enterococci sp. (Karthikaidevi et al., 2009). Meanwhile, crude acetonic extracts of Lecanora allophana showed maximum zone of inhibition (12.66 mm) against Gram+ve S. aureus (ATCC_33591). Hengameh and Rajkumar (2017) reported identical zone of inhibition (12.00 mm) for methanol extracts of Parmotrema tinctorum.

The antibacterial activity of crude methanolic extract of selected species proved tremendously effective against Gram+ve and Gram-ve bacterial strains. The crude methanolic extract of Flavoparmelia caperata and Rhizocarpon viridiatrum showed maximum zone of inhibition (12.33 mm) against Gram-ve E. coli (ATCC_39111). Aslan et al. (2006) also recorded zone of inhibition within range of 4.0 mm to 19.00 mm for methanol extracts of Cladonia foliacea, Evernia divaricate, Evernia prunastri and Neofuscella pulla.

The methanolic extracts of Flavoparmelia caperata showed maximum zone of inhibition (10.33 mm) aganist Bacillus subtilis. Stojanovic et al. (2013) reported slightly higher zone of inhibition (15.7 mm) for methanol extracts of Parmelia sulcata against Bacillus subtilis. Maximum zone of inhibition (10.66 mm) against Enterococcus faecalis (ATCC -19433) were recorded for Collema flaccidum, Lecanora allophana and Caloplaca decipines (10.66 mm). There exists compatibility in the activity of methanolic extracts against E.

285

faecialis of various lichen species reported in the studies of Devi et al. (2011) and Chauhan and Abraham (2013). Similary, maximum zone of inhibition (12.33 mm) against Gram-ve P. aeruginosa (ATCC_10145) was recorded for methanolic extract of Flavoparmelia caperata. Similar results were reported for extracts of species Alectoria sarmentose, Bryoria fuscescens, Evernia divaricate, Platismatia glauca Ramalina farinacea and Parmotrema sp. (Cobanoglu et al., 2010; Chauhan and Abraham, 2013). The methanolic extract of Flavoparmelia caperata exhibited maximum zone of inhibition (09.66 mm) against Gram+ve S. aureus (ATCC_33591). Similar, antibacterial effectiveness were reported for methanolic extract of four lichen species against S. aureus in various investigations (Chauhan and Abraham, 2013; Abuiraq et al., 2015).

The present study also investigated the antifungal activities of crude acetonic and methanolic extracts of ten species against four fungal strains; A.niger (ATCC_16888), A.fumigatus (ATCC_16424), F.solani (ATCC_46492) and F. oxyporium (ATCC_10913). Almost all fungal strains were vulnerable to crude acetonic and methanolic extracts of lichens except Peltigera polydactylon and Collema flaccidum. However, contrary to present study, remarkable antifungal activity of Peltigera polydactylon crude extracts was observed against Candida albicans in previous study (Shrestha et al., 2015). Crude acetonic extracts of Lecanora allophana manifested maximum activity (11.33 mm) against A. niger (ATCC_16888). Devi et al., 2016 recorded no activity for the methanolic extract of Ramalina conduplicans against A. niger. Maximum zones of inhibition (11.33 mm) against A. fumigatus (ATCC_16424) were recorded for Flavoparmelia caperata and Caloplaca decipines. In the study of Rankovic and Misic (2007), significant activity (11.0 mm) was recorded for ethyl acetate extracts of lichen species Alectoria sarmentosa against the above fungal species. In case of F.solani (ATCC_46492), maximum zone of inhibition (10.66 mm) was shown by

286

crude acetone extract of Lecanora allophana. Chauhan and Abraham (2013) also recorded zone of inhibition (22.66 mm) for methanol extracts Parmotrema sp. against Fusarium sp. Similarly, crude acetonic extracts of Flavoparmelia caperata showed maximum zone of inhibition (10.0 mm) against F. oxyporium (ATCC_10913). Almost similar results were reported by Rankovic and Misic (2007) for crude ethyl acetate extracts of lichen species Cladonia rangiferina with comparable zones of inhibitions (12.0 mm). Furthermore, crude methanolic extracts of Lecanora allophana and Flavoparmelia caperata showed maximum zones of inhibition (10.66 mm each) against A. niger (ATCC_16888) and A. fumigatus (ATCC_16424), respectively. Rankovic et al. (2010) also reported 7.0 mm and 6.0 mm zone of inhibition for extract of Ochrolechia tartarea and Parmelia centrifuga against A. niger. In crude methanolic extracts against F. oxysporium (ATCC_10913), maximum zone of inhibition was shown by Flavoparmelia caperata and Flavopunctelia flaventior (9.66 mm). In addition, crude methanolic extracts of Lecanora allophana and Caloplaca decipines manifested maximum zone of inhibition (9.00 mm) against F. solani (ATCC_46492). Almost identical zone of inhibition (08.0 mm) was reported for the aqueous extract of Alectoria sarmentosa (Rankovic and Misic, 2007).

Brine shrimp lethality assay in present study was carried out to evaluate the potential effects of ten selected species of lichens. In acetone extract of concentrations 0.05mg/mL, 0.01mg/mL and 0.001mg/mL, maximum mortalities of 60%, 40% and 30%, respectively were shown by Flavopunctelia flaventior. In the crude methanol extract of concentration 0.05mg/mL, maximum mortality of 53% (LC50 45.01 mg/mL) was shown by lichen species Flavoparmelia caperata, while in extract of concentration 0.01mg/mL, maximum mortality (40%) was shown by Flavopunctelia flaventior. For extract of concentration 0.001mg/mL, maximum mortality (30%) was shown by Flavopunctelia flaventior. Similar results were reported for

287

methanolic extracts of lichens Heterodermia sp., Ramalina sp. and Everniastrum cirrhatum, which showed comparable toxic effects on A. salina (Paudel et al., 2012; Kekuda et al., 2012).

Until now, only limited data is available about anticarcinogic activity of lichens. However, according to some investigations, lichen species exert significant antitumor effects on human and animal (Bezivin et al., 2003; Triggiani et al., 2009). Out of ten species screened for antitumor activity in current study, the crude methanolic extracts of eight lichen species and crude acetone extracts of nine species manifested antitumor potential of variable ranges at concentrations of 0.05mg/ml, 0.01mg/ml, and 0.001mg/ml. According to this study, lichens can be good lead for antitumor applications as this capacity is pertinent to other studies (Bezivin et al., 2003). Crude acetonic and methanolic extracts of Flavoparmelia caperata induced maximum antitumor activity while extracts of Caloplaca decipines did not showed any antitumor activity. Crude acetonic extracts of the selected species showed higher degree of anticancer activity as compared to crude methanolic extracts of the same species. Crude acetone extracts of selected lichens at concentration of 0.05mg/ml induced variable range (40%) of antitumor activity from lichen species Flavoparmelia caperata, followed by Rhizocarpon viridiatrum (39%), Dermatocarpon miniatum (38%), Flavopunctelia flaventior (36%), Peltigera polydactylon (34%) and Usnea fulvoreagens (29%). While in the extracts of 0.01 mg/mL, maximum activity was shown by Rhizocarpon viridiatrum (33%), followed by Peltigera polydactylon, Flavopunctelia flaventior (23%) and Usnea fulvoreagens (20%). Similarly, in extracts of concentration of 0.001 mg/mL, maximum activity (34%) were recorded for lichen species Flavoparmelia caperata, followed by Rhizocarpon viridiatrum (29%), Dermatocarpon miniatum (26%) and Peltigera polydactylon, Flavopunctelia flaventior (20%).

288

The crude methanol extracts of selected lichen species at 0.05mg/mL concentration manifested comparable antitumor activity of 38% for Flavopunctelia flaventior, followed Flavoparmelia caperata, Rhizocarpon viridiatrum (37%), Peltigera polydactylon (30%) and Dermatocarpon miniatum, Usnea fulvoreagens (28%). In addition, at concentrations (0.01mg/mL), maximum antitumor activity (31%) was recorded for extracts of Flavoparmelia caperata, followed by Flavopunctelia flaventior (30%), Rhizocarpon viridiatrum (25%) and Usnea fulvoreagens (20%). Finally, at lower concentration of 0.001mg/mL, maximum activity (27%) was shown by Flavopunctelia flaventior.

In current study antioxidant potential of ten selected lichen species was adopted to assess their significance in biomedical applications. The tested lichen extracts demonstrated a strong antioxidant potential against DPPH oxidative system in-vitro. In the screened lichen extracts, the percentage inhibition of DPPH increased with increase in concentration of crude extracts. As far as maximum and minimum range of percentage inhibition of each extract is concerned, crude acetone extract of 1000 ug/mL manifested DPPH radical scavenging activity in the range of 17%-66%, while crude methanolic extract of 1000ug/mL showed percentage inhibition in the range of 26%-57%. The strongest DPPH radical scavenging activity (66%) was shown by Cladonia pyxidata and minimum activity (17%) was shown by Caloplaca decipines. With the increase in the concentration of extracts, DPPH radical scavenging activity was also increased. In a study conducted by Gulcin et al. (2002), the antioxidant activity of Cetraria islandica was evaluated and aqueous extracts of this species showed significant DPPH radical scavenging activity. In the concentration of 500ug/mL, the lichen species Rhizocarpon viridiatrum showed 63% and Caloplaca decipines showed 12% DPPH radical scavenging activity. While in concentration of 250 ug/mL, Rhizocarpon viridiatrum showed 56% activty

289

and Flavopunctelia flaventior showed 22%, while Caloplaca decipines showed no activity. Similarly, in concentration of 125ug/mL, maximum activity (49%) was shown by Rhizocarpon viridiatrum, while Flavopunctelia flaventior and Caloplaca decipines showed 20% and no activity, respectively. Kosanic et al. (2014) reported the antioxidant activity of acetone extract of lichen species Lecanora muralis, L. atra, Cladonia furcata and found highest antioxidant activity (90.08%) for lichen Lecanora atra.

In methanolic extracts of concentration 1000ug/mL, 57% DPPH radical scavenging activity was recorded for lichen species Rhizocarpon viridiatrum, while Collema flaccidum and Usnea fulvoreagens showed 26% activity each. While in extract of concentration 500ug/mL, 55% activity was recorded for each Rhizocarpon viridiatrum and Peltigera polydactylon, while Collema flaccidum showed 19% activity. Similarly, in extracts of concentration 250ug/mL, Peltigera polydactylon showed 51% DPPH radical scavenging activity, while Caloplaca decipines and Collema flaccidum showed 13% activity each. In concentration of 125ug/mL, maximum activity (44%) was recorded by Rhizocarpon viridiatrum and minimum activity (8%) was shown by Usnea fulvoreagens, while Caloplaca decipines didn’t show any activity. Kosanic et al. (2011) and Manojlovic et al. (2011) have also worked on the antioxidant activities of some lichen species. Their studies reported a maximum DPPH radical scavenging activity of 69.87% for methanol extracts of lichen species Lasallia pustulata and while 51% activity was observen in case of Toninia candida.

290

CONCLUSION

The District Mansehra shows remarkably high lichen diversity and 110 lichen species are documented distributed in 56 genera and 27 families. Parmeliaceae with 12 genera (10.90%) is the largest family while the remeaning families have 1-7 genera per family. Substrate-wise, 43 species are found on bark of trees while in various habitat corticolous lichens with 55 lichen species show their dominace in the study area. There is need to give attention to this major group of lower plants.

The maximum antibacterial activity of crude aceton extracts are recorde for lichen species Flavoparmelia caperata, Lecanora allophana and Cladonia pyxidata with a maximum zone of inhibition (12.66 mm) while in crude methanol extracts maximum zone of inhibition (12.33 mm) are show by lichen species Flavoparmelia caperata and Rhizocarpon viridiatrum. In addedtion, maximum antifungal activity of crude acetone extracts are shown by lichen species Caloplaca decipine and Flavoparmelia caperata (11.66 mm) while for methanol extracts maximum activity are shown by Flavoparmelia caperata and Lecanora allophana (10.66 mm). The highest percent free radical scavenging activity for crude acetone extract is shown by Cladonia pyxidata (66%) while highest antioxidant activity of crude methanol extracts is shown by Rhizocarpon viridiatrum l (57%). Maximum cytotoxic effect of crude acetone extract is recorde for (concentration of 0.05mg/mL) Flavopunctelia flaventior (60%) while maximum cytotoxic effect of crude methanol extract is show by (0.05mg/mL) Flavoparmelia caperata (53%). The highest antitumor activity of crude acetone extract of Flavoparmelia caperata is 40% while crude methanol extract of lichen species Flavopunctelia flaventior demonstrate maximum antitumor potential (38%). Thus, further study is needed to mark the chemical constituent of the extract from lichen species.

291

RECOMMENDATIONS

The following suggestions are recommending in order to further studies and in the view of conservation of the taxa:

1. Further studies should be done in order to assess the unexplored lichens diversity of Hazara Division.

2. Taxanomic studies and distribution of lichen taxa should be done especialy in Hazara division and Pakistan.

3. Further study should be done in order to identify the algal or cyanbacterial symbiots of lichens diversity of Hazara Division.

4. Molecular studies of the lichen taxa should be carried out in order to authenticity of idenfication of lichen flora of Hazara Division and Pakistan.

5. Crude extracts tested lichen species posses compunds with antibacterial, antifungal, antioxidant, cytotoxicity and antitumor activities which require further investigation to determine the compunds for treatment of diseases in plants and human.

292

REFFRENCES

Abuiraq, L., G. Kanan, M. Wedyan and A. El-Oqlah. 2015. Efficacy of Extracts of Some Lichens for Potential Antibacterial Activity. Res. J. Pharm. Biol. Chem. Sci., 6(1): 318-331.

Ahmadjian, V. 1993. The Lichen Symbiosis. John Wiley and Sons, New York.

Alexeeva, N. 2005. Lichens from Islands in the Russian part of the Gulf of Finland. Folia Cryptogamica Estonica, 41: 5–12.

Anonymous. 1998. District census report of Mansehra. 1-1.

Anonymous. 2005. Mapping and documentation of the cultural assets of Kaghan Valley, Mansehra. United Nations Educational, Scientific and Cultural Organization, Islamabad.

Anonymous. 2011. Archeological exploration in Balakot, District Mansehra (2006-2007): A Preliminary Report. Pakistan Heritage, 3: 149-160.

Ali, S. I. 1978. The Flora of Pakistan: some general and analytical remarks. Notes Roy. Bot. Gard. Edinb., 36: 427-439.

Ali, S.I. and M. Qaiser (Eds.). 1995-2012. Flora of Pakistan. University of Karachi, Karachi.

Almborn, O. 1989. Revision of the lichen genus Teloschistes in central and southern Africa. Nordic J. Bot., 8(5):521-537.

Anjali, D. B., S. Mohabe, A. M. Reddy and S. Nayaka. 2015. Antimicrobial activities of 2-propanol crude extract from lichen Parmotrema tinctorum (Despr. ex. Nyl.) Hale, collected from Eastern Ghats, India. Curr. Res. Environ. Appl. Mycol., 5(3): 160-168.

Anne, G. K. 1998. Distribution and diversity of alpine lichens: biotic and abiotic factors influencing alpine lichen communities in the northeast Olympic and North Cascade Mountains. Ph.D Thesis, Department of Botany, Univ., of Washington, USA.

293

Aptroot, A. 2001. Lichens from Gambia, with a new black-fruiting isidiate Caloplaca on savannah trees. Cryptogam., Mycol., 22: 265–270.

Aptroot, A. and F. J. Feijen. 2002. Annotated checklist of the lichens and lichenicolous fungi of Bhutan. Fungal Divers., 11: 21-48.

Aptroot, A. and S. H. Iqbal. 2012. Annotated checklist of Lichen of Pakistan, with report of new record. Herzogia, 25(2): 211-229.

Armstrong, R. A and A. R. Welch. 2007. Review article; Competition in lichen communities. Symbiosis, 43: 1–12.

Aslan, A., M. Gulluce, M. Sokmen, A. Adiguzel, F. Sahin and H. Ozkan. 2006. Antioxidant and Antimicrobial Properties of the Lichens Cladonia foliacea, Dermatocarpon miniatum, Everinia divaricata, Evernia prunastri and Neofuscella pulla. Pharmaceutical Biology, 44(4):247–252.

Awan, M. S., Z. Iqbal, S. M Shah, Z. Jamal, G. Jan, M. Afzal, A. Majid and A. Gul. 2011. Studies on traditional knowledge of economicaly important plants of Kaghan valley, Mansehra District, Pakistan. J. Med. Plants Res., 5(16): 3958-3967.

Awasthi, D. D. 1965. Catalogue of the lichen from India, Nepal, Pakistan and Ceylon. J. Cramer.

Awasti, D. D. 1988. A Key to Macrolichens of India and Nepal. J. Hattori Bot. Lab., 65: 207-302.

Awasti, D. D. 1990. A Key to Microlichens in India, Nepal and Sri Lanka. Bibl. Lichenol., 40: 1-336.

Aydin, E. and H. Turkez. 2011. Antioxidant and genotoxicity screening of aqueous extracts of four lichens collected from North East Anatolia. Fresen. Environ. Bull., 20 (8a): 2085 – 2091.

294

Aydin, S. and K. Kinalioglu. 2013. The Investigation of Antibacterial Activities of Ethanol and Methanol Extracts of Flavoparmelia caperata (L.) Hale (Parmeliaceae) and Roccella phycopsis Ach. (Roccellaceae) Lichens Collected from Eastern Black Sea Region, Turkey. J. appl. Pharm. Sci., 3 (02): 143-147.

Backorova M., B. M. Mikes, R. J. Jendze, R. lovsky and P. Fedorocko. 2011. Variable responses of different human cancer cells to the lichen compounds parietin, atranorin, usnic acid and gyrophoric acid. Toxicol. In vitro, 25(1): 37-44.

Balaji, P. and G. N. Hariharan. 2013. Checklist korovitych lisejniku pohori Siruvani Hills (Bolampatti II Forest Range) v Zapadnim Ghatu, stat Tamil Nadu, India. Czech. Mycol.., 65(2): 219–232.

Balaji, P., P. Bharath, R. S. Satyan and G. N. Hariharn. 2006. In vitro antimicrobial activity of Roccella montagnei thallus extract. J. Trop. Med. Plants 7(3): 169-173.

Baral, B. 2015. Enumeration of lichen diversity in Manaslu conservation area and Sagarmatha national park of Nepal. Int. J. Biodivers., 7(3): 140-147.

Baral, B. and B. L. Maharjan. 2011. Assessment of antimicrobial and phytochemical potential of high altitude Nepalese lichen. J. Microbiol. Biotechnol. Food Sci., 1(2): 98-112.

Basile, A., D. Rigano, S. Loppi, A. Santi, A. Nebbioso, S. Sorbo, B. Conte, L. Paoli, F. Ruberto, A. M. Molinari, L. Altucci and P. Bontempo. 2015. Antiproliferative, Antibacterial and Antifungal Activity of the Lichen Xanthoria parietina and its secondary metabolite Parietin. Int. J. Mol. Sci., 16: 7861-7875.

295

Begerow, D., H. Nilsson, M. Unterseher and W. Maier. 2010. Current state and perspectives of fungal DNA barcoding and rapid identification procedures. Appl. Microbiol. Biotechnol., 87(1): 99-108.

Bezivin, C., S. Tomasi, F. Devehat and C. Boustie. 2003. Cytotoxic activity of some lichen extracts on murine and human cancer cell lines. Phytomed., 10: 499-503.

Blaxter M, J. Mann, T. Chapman, F. Thomas, C. Whitton, R. Floyd and E. Abebe. 2005. Defining operational taxonomic units using DNA barcode data. Philos. Trans. R. Soc. Lond. B. Biol. Sci., 360(1462): 1935- 43.

Blazekovic, B., G. Stanic, S. Pepeljnjak and S. Vladimir-Knezevic. 2011. In Vitro Antibacterial and Antifungal Activity of Lavandula × intermedia Emeric ex Loisel. `Budrovka’. Molecules, 16: 4241-4253.

Blinkova, O. and G. Urbanavichus. 2005. Ecological analysis of lichens in the Teberda State Biosphere Reserve (North-Western Caucasus, Russia). Folia. Cryptogam. Est., 41: 23–35.

Boustie, J., S. Tomasi and M. Grube. 2011. Bioactive lichen metabolites: alpine habitats as an untapped source. Phytochem. Rev., 10: 287-307.

Boustie J. and Grube M. 2005. Lichens? A promising source of bioactive secondary metabolites. Plant Genet. Resour., 3(2): 273-287.

Burkholder, P. R, A. W. Evans, I. Mcveigh and H. K. Thornton. 1944. Antibiotic Activity of Lichens. Proc. Natl. Acad. Sci. U.S. A., 30, 250-5.

Butler, N. J. 1950. A guide to the collections of botanical specimens. Tuatara. 3(2): 67-77. Caldiz, M. S. 2005. Diversity and growth of epiphytic macrolichens in northwestern Patagonian Nothofagus forests. Ph. D Thesis, Southern Swedish Forest Research Centre, Swedish Univ. of Agricultural Sciences, Alnarp.

296

Candana, M., M. Yılmaza, T. Tayb, M. Kıvanc and H. Turk. 2006. Antimicrobial Activity of Extracts of the Lichen Xanthoparmelia pokornyi and its Gyrophoric and Stenosporic Acid Constituents. Z. Naturforsch., 61c: 319-323.

Chahra, D., M. Ramdani, T. Lograda, P. Chalard and G. Figueredo. 2016. Chemical composition and antimicrobial activity of Evernia prunastri and Ramalina farinacea from Algeria. Issues Biol. Sci. Pharma. Res., 4(5): 35-42.

Chauhan, R. and J. Abraham. 2013. In Vitro Antimicrobial Potential of the Lichen Parmotrema sp. extracts against various pathogens. Iran. J. Basic Med. Sci., 16(7): 882–885.

Cobanoglu, G. and O. Sevgi. 2009. Analysis of the distribution of epiphytic lichens on Cedrus libani in Elmali Research Forest (Antalya, Turkey). J. Environ. Biol., 30(2): 205-212.

Cobanoglu, G., C. Sesal, B. Gokmen and S. Cakar. 2010. Evaluation of the antimicrobial properties of some lichens. South-west J. Hortic. Biol. Environ., 1(2): 153 – 158.

Cocchietto, M., N. Skert, P. Nimis and G. Sava. 2002. A review on usnic acid, an interesting natural compound. Naturwissenschaften, 89: 137- 146.

Culberson, C. F. 1972. Improved condition and new data for identification of lichen product by standardized thin layer chromatographic method. J. Chromatogr., 72: 113-125.

Culberson, C. F. and H. Kristinsson. 1970. A standardized method for identification of lichen product. J. Chromatogr., 46: 85-93.

Desbenoit, B., E. Galin and S. Akkouche. 2004. Simulating and modeling lichen growth. Comput. Graph. Forum., 23: 341-350.

297

Devi, G. K., P. Anantharaman, K. Kathiresan and T. Balasubramanian. 2011. Antimicrobial activity of lichen Rocella belangeriana (Awasti) from mangroves of Gulf of Mannar. Indian J. Mar. Sci., 40(3): 449- 453.

Devkota, O. 2008. Taxonomic study of lichens of Phulchowki hills, Lalitpur District (Kathmandu valley). Sci. World J., 6 (6): 44-51).

Dey, A. K., G. K. Mishra, J. Rout and D. K. Upreti. 2015. An enumeration of epiphytic lichens from Hojai sub-division of Nagaon district, Assam, India. Int. J. Adv. Res. Biol. Sci., 2(10): 111–115.

Dietrich, M. and C. Scheidegge. 1997. Frequency, diversity and ecological strategies of epiphytic lichens in the Swiss Central Plateau and the Pre-Alps. Lichenologist 29: 237–258.

Divakar, P. K., A. Crespo, O. Blanco, H. T. Lumbsch. 2006. Phylogenetic significance of morphological characters in the tropical Hypotrachyna clade of parmelioid lichens (Parmeliaceae, Ascomycota). Mol. Phylogenet. Evol., 40: 448–458.

Dorszynska, M. M., G. Wezgrzyn and B. G. Krzeminska. 2014. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis. FEMS Microbiol. Lett., 353 (1): 57–62.

Elix, J. A. 2014. A Catalogue of Standardized Chromatographic Data and Biosynthetic Relationships for Lichen Substances, (3rd Ed) Canberra.

Emsen, B., A. Aslan, B. Togar, H. Turkez. 2015. In Vitro Antitumor Activities of the Lichen Compounds Olivetoric, Physodic and Psoromic Acid in Rat Neuron and Glioblastoma Cells. Pharm. Biol., 54 (9): 1748-1762.

Esimone, C. O. and M. U. Adikwu. 1999. Antimicrobial activity and cytotoxicity of Ramalina farinacea. Fitoterpia., 70(4): 428-437.

298

Farkas, V. 2003. Structure and biosynthesis of fungal cell walls: Methodological approaches. Folia Microbiol., 48: 469–478.

Francolini, I., P. Norris, A. Piozzi, G. Donelli and P. Stoodley. 2004. Usnic acid, a natural antimicrobial agent able to inhibit bacterial biofilm formation on polymer surfaces. Antimicrob. Agents Chemothe.,. 48: 4360-4365.

Friedel, T and B. Budel. 2008. Photobiont. In: Nash T. H (Ed) Lichen Biology. Cambridge University Press, Cambridge, pp 9-26.

Galun, M. 1988. CRC handbook of Lichenology. Vol. III, 95-107, CRC Press, Boca Raton, Florida.

Gardes, M. and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes--application to the identification of mycorrhizae and rusts. Mol. Ecol., 2(2):113-8.

Geiser, L. H., S. E. Jovan, D. A. Glavich and M. K. Porter. 2010. Lichen- based critical loads for atmospheric nitrogen deposition in Western Oregon and Washington Forests, USA. Environ. Pollut., 158: 2412- 2421.

Gilbert, O. 2004. Lichens (Naturally Scottish). Scottish Natural Heritage.

Goni, R. and N. Sharma. 2015. Additions to lichen flora of Jammu and Kashmir, India. Trop. Plant Resh., 2(2): 78–81.

Green, T. G. A., J. Horstman, H. Bonnett, A. Wilkins and W. Silvester. 1980. Nitrogen fixation by members of the Stictaceae (Lichens) of New Zealand. New Phytol., 84(2): 339-48.

Grujicic, D., I. Stosic, M. Kosanic, T. Stanojkovic, B. Rankovic, O. M. Djordjevic. 2014. Evaluation of in vitro antioxidant, antimicrobial, genotoxic and anticancer activities of lichen Cetraria islandica. Cytotechnology, 66(5): 803-813.

299

Gupta, S., H. Rai, D. K. Upreti, P. K. Sharma and R. K. Gupta. 2016. New addition to the Lichen flora of Uttarakhand, India. Trop. Plant Resh., 3(1): 224–229.

Gupta, S., R. Khare, H. Rai, D. K. Upreti, R. K. Gupta, P. K. Sharma, K. Srivastava and P. Bhattacharya. 2014. Influence of macro-scale environmental variables on diversity and distribution pattern of lichens in Badrinath valley, Western Himalaya. Mycosphere. 5(1): 229–243.

Gulcin, I., M. Oktay, O. I. Kufrevioglu and A. Aslan. 2002. Determination of antioxidant activity of lichen Cetraria islandica. J. Ethnopharmacol., 79: 325-329.

Guvenc, S., S. Oran and S. Ozturk. 2009. The Epiphytic Lichens on Anatolian Black Pine Pinus nigra Arnd. subsp. pallasiana (Lamb.) Holmboe in Mt. Uludag (Bursa, Turkey). J. Appl. Biol. Sci., 3(2): 157- 161.

Halama, P., and C. V. Haluwin. 2004. Antifungal activity of lichen extracts and lichenic acids. Biol. Control. 49 (1): 95–107.

Halcomb, H. 2010. Lichens. The University of Tennesse.

Halici, M. G. and A. Aksoy. 2006. Saxicolous and Tericolous lichens of Sirvan mountain (Pinarbasi, Kayseri). Turk. J. Bot., 30: 477-481.

Halici, M. G., V. John and A. Aksoy. 2005. Lichens of Erciyes Mountain (Kayseri, Turkey). Fl. Medit., 15: 567-580.

Hansen, E. S. 2009. Lichens from Johannes V. Jensen Land, N Greenland, the northernmost arctic land area. Willdenowia, 39: 179–186.

Hansen, E. S. 2007. Lichen from Saqqaq and Qeqertaq central west Greenland. Folia Cryptog. Estonica, 43: 1-12.

300

Haq, M. U., Z. A. Reshi, D. K. Upreti and M.A. Sheikh. 2012. Lichen wealth of Jammu and Kashmir- A promising plant source for Bioprospection. Life Sci. J., 4: 926-929.

Hara, K., M. Endo, H. Kawakami, M. Komine and Y. Yamamoto. 2011. Anti-oxidation activity of ethanol extracts from natural thalli of lichens. Mycosystema, 30(6): 950-954.

Hawksworth, D. L. and T. Mahmood. 1971. Some lichens coniferous forest in West Pakistan. Pak. J. Sci. Ind. Res., 12 (1-2): 113-115.

Herrera, M., R. Lucking, R. E. Perez, A. Campos, P. Martinez, and A. Barcenas. 2004. The folicolous lichen flora of Mexico. V. Biogeographical affinities, altitudinal preferences, and an updated checklist of 293 species. Lichenologist, 36: 309–327.

Huneck, S. 1999. The significance of lichens and their metabolites. Naturwissenschaften.86 (2): 559-570.

Hussain, F. and I. Ilahi. (1991). Ecology and Vegetation of Lesser Himalayas, Pakistan. Department of Botany University of Peshawar, Pakistan. Jadoon Printing Press, Peshawar.

Idamokoro, E. M., P. J. Masika, V. Muchenje, D. Falta and E. Green. 2014. In-vitro antibacterial sensitivity of Usnea barbata lichen extracted with methanol and ethyl-acetate against selected Staphylococcus species from milk of cows with mastitis. Arch. Tierz., 57(25): 1-9

Javeria, S., S. K. Shahi, M. P. Shahi, and D. K. Upreti. 2013. Parmotrema nilgherrense: potential antimicrobial activity against drug resistant pathogens. Int. J. Microbial. Resource Technol., 2(1): 36-40.

Jesus, E. E., J. S. Hur, K. I. R. Notarte, K. A. A. Santiago and C. Tee. 2016. Antibacterial, antioxidant, and cytotoxic activities of the corticolous lichens Canoparmelia aptata, Pannaria sp., and Parmotrema gardneri

301

collected from Mt. Banahaw, Quezon, Philippines. Curr. Res. Environ. Appl. Mycol., 6(3): 173–183.

Jönsson, M. T., G. Thor and P. Johansson. 2011. Environmental and historical effects on lichen diversity in managed and unmanaged wooded meadows. Appl. Veg. Sci., 14(1): 120–131.

Juriado, I., J. Paal and J. Liira. 2003. Epiphytic and epixylic lichen species diversity in Estonian natural forests. Biodivers. Conserv., 12(8): 1587– 1607.

Kaffer, M. I., R. V. Dantas and S. M. A. Martins. 2016. Characterization of the epiphytic lichen vegetation in a riparian forest in southern Brazil. Plant Ecol. Evol., 149 (1): 92–100.

Kantvilas, G., J. A. Elix and S. J. Jarman. 2008. A contribution to an inventory of lichens from South Sister, northeasternTasmania. Pap. Proc. R. Soc. Tasmania, 142(2): 49-60.

Karabulut, G. and S. Ozturk. 2015. Antifungal activity of Evernia prunastri, Parmelia sulcata, Pseudevernia furfuracea var. furfuracea. Pak. J. Bot., 47(4): 1575-1579.

Karagoz, A., N. Doruoz, Z. Zeybek and A. Aslan. 2009. Antibacterial activity of some lichen extracts. J. Med. Plants Res., 3(12): 1034-1039.

Karthikaidevi, G., G. Thirumaran, K. Manivannan, P. Anantharaman, K. Kathiresan and T. Balasubaramanian. 2009. Screening of the Antibacterial Properties of Lichen Roccella belangeriana (Awasthi) from Pichavaram Mangrove (Rhizophora Sp.). Adv. Biol. Res., 3 (3-4): 127-131.

Karunaratne., V. K. Bombuwella, S. Kathirgamanather and V. M. Thadhani. 2005. Lichen: A Chemically important Biota. J. Natl. Sci. Found Sri., 33(3): 169-186.

302

Kasimogullari, S. C., S. Oran, F. Ari, E. Ulukaya, N. Aztopal, M. Sarimahmut and S. Ozturk. 2014. Genotoxic, cytotoxic, and apoptotic effects of crude extract of Usnea filipendula Stirt. in vitro. Turk. J. Biol., 38: 940-947.

Kekuda, P., T. Ramanoorthy, H. Raghavedra, L. Shitty, S. Devidas, V. T. Mudduray and K. S. Vinayaka. 2012. Antifungal and cytotoxic activity of Everniastrum cirrhatum (fr) Hale. Chiang Mai J. Sci., 39(1): 76-83.

Khan, S. I., A. K. Raina and D. K. Upreti. 2010. Enumaration and distribution of lichen in Surankot, District Poonch, J and K (India). Environ. Cons., 11(3): 27-31.

Killmann, D. and E. Fischer. 2005. New records for the lichen flora of Rwanda, East Africa. Willdenowia, 35(1): 193-204.

Kelly, L. J., P. M. Hollingsworth, B. J. Coppins, C. J. Ellis, P. Harrold and J. Tosh. 2011. DNA barcoding of lichenized fungi demonstrates high identification success in a floristic context. New Phytologist, 191: 288– 300.

Kirk, P., P. Cannon, D. Minter and J. Stalpers. 2008. Dictionary of Fungi, (10th Ed). CABI Europe, Oxford.

Knudsen, K. K., M. Harding and J. Hoines. 2013. The Lichen Flora of Joshua Tree National Park An Annotated Checklist. Natural Resource Technical Report NPS/JOTR/NRTR—2013/743

Kosanic, M. and B. Rankovic. 2010. Screening of Antimicrobial Activity of Some Lichen species In Vitro. Kragujevac J. Sci., 32: 65-72.

Kosanic, M., B. R. Rankovic and T. P. Stanojkovic. 2012. Antioxidant, antimicrobial and anticancer activities of three Parmelia species. J. Sci. Food Agric., 92(9): 1909-1916.

303

Kosanic, M., D. Seklic, S. Markovic and B. Rankovic. 2014. Evaluation of antioxidant, antimicrobial and anticancer properties of selected lichens from Serbia. Dig. J. Nanomater. Biostruct., 9(1): 273–287.

Kosanic, M., N. Manojlovic, S. Jankovic, T. Stanojkovic and B. Rankovic. 2013b. Evernia prunastri and Pseudoevernia furfuraceae lichens and their major metabolites as antioxidant, antimicrobial and anticancer agents. Food Chem. Toxicol., 53: 112–118.

Kosanic. M., B. Rankovic and T. Stanojkovic. 2013a. Investigation of selected Serbian lichens for antioxidant, antimicrobial and anticancer properties. J. Anim. Plant Sci., 23(6): 1628-1633.

Kumar, J., H. Rai, R. Khare, D. K. Upreti, P. Dhar, A. B. Tayade, O. P. Chaurasia and R. B. Srivastava. 2014a. Elevational controls of lichen communities in Zanskar valley, Ladakh, a Trans Himalayan cold desert. Trop. Plant Res., 1(2): 48–54.

Kumar, J., P. Dhar, A. B. Tayade, D. Gupta, O. P. Chaurasia and D. K. Upreti. 2014b. Antioxidant Capacities, Phenolic Profile and Cytotoxic Effects of Saxicolous Lichens from Trans-Himalayan Cold Desert of Ladakh. PLoS ONE 9(6):

Kumar, B. 2010. Ecological, Social and Commercial Role of Lichens in India with Special Reference to Garhwal Himalayas. Academ. Arena, Supplement 0201.

Kumar, S. R., N. Thajuddin and C. Venkateswari. 2010. Antibacterial activity of cyanolichen and symbiotic cyanobacteria against some selected microorganisms. Afr. J. Microbiol. Res., 4(13): 1408-1411.

Kumar, S. R., N. Thajuddin and D. K. Upreti. 2011. Diversity of lichens in Kollihills of Tamil Nadu, India. Int. J. Biod. Cons., 3(2): 36-39.

Kusumaningrum, I. K., W. P. Suwarso and A. H. Cahyana. 2011. Screening for Bioactive compound Group in Parmotrema tinctorum’s Extract

304

and Bioactivity Test of Dichloromethane Extract as Anti-tuberculosis against Mycobacterium tuberculosis H37RV and Toxicity against Artemia salina. Sci. J. Ubu., 2(1):53–59.

Lauterwein, M., M. Oethinger, K. Belsner, T. Peters and R. Marre. 1995. In vitro activities of the lichen secondary metabolites vulpinic acid, (+)- usnic acid, and (-)-usnic acid against aerobic and anaerobic microorganisms. Antimicrob. Agents Chemother., 39(11): 2541-2543.

Leavitt, S. D. and L. L. Clair. 2011. Estimating Xanthoparmelia (Parmeliaceae) population density in subalpine communities in southern Utah, USA using two distance methods, with implications for assessing community composition. Bryologist, 114: 625-636.

Lendemer, J. C and B. P. Hodkinson. 2013. A radical shift in the taxonomy of Lepraria s.I: molecular and morphological studies shed new light on the evolution of asexuality and lichen growth form diversification. Mycologia, 105(4): 994-1018.

Logesh, A. R., M. Chinlampianga, A. C. Shukla and D. K. Upreti. 2015. Studies on Lichens of Mizoram, Northeast India. Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci. DOI 10.1007/s40011-015-0592-z

Luo, H., M. Ren, K. Lim, Y. J. Koh, L. S. Wang and J. S. Hur. 2006. Antioxidative Activity of Lichen Thamnolia vermicularis in vitro. Mycobiol., 34(3): 124-127.

Lutzoni, F and J. Miadlikowsk. 2009. Lichen. Quick Guide. Curr. Biol., 19: 502-503.

Madamombe, I. T. and A. J. Afolayan. 2003. Evaluation of antimicrobial activity of extracts from African Usnea barbata. Pharm., Biol., 4(4): 199-202.

305

Manojlovic, N.T., S. Solujic and S. Sukdolak. 2002. Antimicrobial activity of extract and anthraquinones from Caloplaca schaereri. Lichenologist 34: 83-85.

Manojlovic, N. T., P. J. Vasiljevic, P. Z. Maskovic. 2012. Chemical composition and antioxidant activity of lichen Toninia candida. Rev. Bras. Farmacogn., 22(2): 291-298.

Marmor, L., T. Torra, E. Leppik, L. Saag and T. Randlane. 2011. Epiphytic lichen diversity in Estonian and Fennoscandian old coniferous forests. Folia Cryptog. Estonica, 48: 31–43.

Matsunaga, K. K. S., R. A. Stockey and A. M. F. Tomescu. 2013. Honeggeriella Complexa gen. et sp. nov., a heteromerous lichen from the lower cretaceous of Vancouver Island (British Columbia, Canada). Am. J. Bot., 100(2): 450-459.

Mazari, P., M. R Khan, M. A. Khan, K. Y. Khan, M. Zafar, B. Ali and R. Niamat. 2012. Pollen fertility estimation of selected taxa of Kaghan valley, Pakistan. Res. Plant Biol., 2(4): 16-21.

Mcmurray, J. A., D. W. Roberts, M. E. Fenn, L. H. Geiser and S. Jovan (2013). Using Epiphytic Lichens to Monitor Nitrogen Deposition near Natural Gas Drilling Operations in the Wind River Range, WY, USA. Water Air Soil Pollut., 224: 1487.

Melo, M.G.D., A. A. S. Araújo, M. R. Serafini, L. F. Carvalho, M. S. Bezerra, C. S. Ramos, L. R. Bonjardim, R. L. C. A. Junior, J. T. Lima, R. S. Siqueira, V. S. Fortes, M. J. V. Fonseca and L. J. Q. Junior. 2011. Anti- inflammatory and toxicity studies of atranorin extracted from Cladina kalbii Ahti in rodents. Braz. J. Pharm Sci., 47(4): 861-872.

Mishra, G. K. and D. K. Upreti. 2016. Diversity and Distribution of Macro- lichen in Kumaun Himalaya, Uttarakhand. Int. J. Adv. Res., 4(2): 912- 925.

306

Mitrovic, T., S. Stamenkovic, V. Cvetkovic, M. Nikolic, S. Tosic and D. Stojicic. 2011a. Lichens as source of versatile bioactive compounds. Biologica Nyssana, 2(1): 1-6.

Mitrovic. T., S. Stamenkovic, V. Cvetkovic, S. Tosic, M. Stankovic, I. Radojevic, O. Stefanovic, L. Comic, D. Dacic, M. Curcic and S. Markovic. 2011b. Antioxidant, Antimicrobial and Antiproliferative Activities of Five Lichen Species. Int. J. Mol. Sci., 12(8): 5428-5448.

Molnar, K. and E. Farkas. 2010. Current result on Biological activities of Lichen secondary compound; a Review. Z. Naturforsch. C Bio. Sci., 65(3-4): 157-173.

Moniri, M. H., H. J. M. Sipman and M. Schultz. 2014. New Records of Lichenized and Lichenicolous Fungi from Northeastern Iran. Herzogia, 27(2): 367-376.

Muggia., L. I. Schmitt and M. Grube. 2009. Lichens as treasure chests of natural products. SIM NEWS, 59: 85-97.

Nayaka, S. 2007. Diversity and distribution of lichens in Katarniaghat Wildlife Sanctuary, Uttar Pradesh. 30th Botanical Conference of Indian Botanical Society, at Jiwaji University, Gwalior.

Nayaka, S., D. K. Upreti and P. K. Divakar. 2001. Distribution and diversity of lichens in Meghamalai Wildlife Sanctury, Kambam district, Tamil Nadu, India. Biol. Memoirs., 27(2): 51–58.

Nayanakantha, N. M. C. and S. Gajameragedara. 2003. A survey of lichens in the Kandy Municipal Region. Cey. J. Sci. (Bio. Sci.),1: 35–41.

Neeraj, V., B. C. Behera, H. Parizadeh, B. O. Sharma. 2011. Bactericidal Activity of Some Lichen Secondary Compounds of Cladonia ochrochlora, Parmotrema nilgherrensis & Parmotrema sancti-angelii. Int. J. Drug Dev. Res., 3 (3): 222-232.

307

Negi, H. R. 2003. Lichens: A valuable Bio resource for environmental Monitoring and sustainable development. Resonance, 8(1): 51-58.

Nguyen T. T, S. Yoon, Y. Yang, H. O. Lee and S. Oh. 2014. Lichen Secondary Metabolites in Flavocetraria cucullata Exhibit Anti-Cancer Effects on Human Cancer Cells through the Induction of Apoptosis and Suppression of Tumorigenic Potentials. PLoS ONE 9(10): e111575. doi:10.1371/journal.pone.0111575

Obermayer, W. 2004. Additions to the lichen flora of the Tibetan region. Bibl. Lichenol., 88: 479-526.

Odabasoglu, F., A. Aslan, A. Cakir, H. Suleyman, Y. Karagoz, M. Halici and Y. Bayir. 2004. Comparison of antioxidant activity and phenolic content of three lichen species. Phytother. Res., 18(11): 938-41.

Okuyama E., K. Umeyama, M. Yamazaki, Y, Kinoshita and Y. Yamamoto. 1995. Usnic acid and diffractaic acid as analgesic and antipyretic components of Usnea diffracta. Planta Med., 61(2): 113-115.

Orange, A., P.W. James and F. J. White. 2001. Micro-chemical Methods for the Identification of Lichens. British Lichen Society, UK, 101pp.

Ozturk, S. and S. Guvence. 2010. The distribution of epiphytic lichens on Uludag fir (Abies nordmanniana (Steven) Spach subsp. bornmuelleriana (Mattf.) Coode and Cullen) forests along an altitudinal gradient (Mt. Uludag, Bursa, Turky). Ekoloji, 19(74): 131-138.

Ozturk, S., S. Oran, S. Guvenc and N. Dalkiran. 2010. Analysis of the distribution of epiphytic lichens in the oriental beech (Fagus Orientalis Lipsky) forests along an altitudinal gradient in Uludag Mountain, Bursa, Turkey. Pak. J. Bot., 42(4): 2661-2670.

Paksa, O and P. Skaloud. 2008. Change of Chloroplast structure in Lichenized algae. Symbiosis, 46(3): 153-160.

308

Paudel, B., H. D. Bhattarai, D. P. Pandey, J. S. Hur, S. G. Hong, Chan Kim and J. H. Yim. 2012. Antioxidant, Antibacterial activity and Brine shrimp toxicity test of some mountainous lichens from Nepal. Biol. Res., 45(4): 387-391.

Pinokiyo, A. and K. P. Singh. 2006. New species and new record of foliicolous lichenized fungi from Sikkim (India). Mycotaxon. 97: 57- 61.

Pinokiyo, A., K. P. Singh and J. S. Singh. 2008. Diversity and distribution of lichen in relation to altitude within a protected biodiversity hot spot, north-east India. Lichenologist, 40: 47-62.

Pinokiyo, A., K. P. Singh and S. K. Borethakur. 2004. Foliicolous Species of Porina (lichen) from Arunaehal Pradesh. J. Indian Forest. 27(4): 407- 416.

Pisutthanana, S., P. Plianbangchang, N. Pisutthanana, S. Ruanruaya and O. Muanrita. 2004. Brine Shrimp Lethality Activity of Thai Medicinal Plants in the Family Meliaceae. Naresuan Uni. J., 12(2): 13-18.

Pompilio, A., S. Pomponio, V. Di Vincenzo, V. Crocetta, M. Nicoletti, M. Piovano, J. A. Garbarino and G. Di Bonaventura. 2013. Antimicrobial and antibiofilm activity of secondary metabolites of lichens against methicillin-resistant Staphylococcus aureus strains from cystic fibrosis patients. Future microbiol., 8(2): 281-292.

Prabhu, S. S. and S. S. Sudha. 2015. Evaluation of the antibacterial properties of some Lichen species against human pathogens. Int. J. Adv. Res. Biol. Sci., 2(4): 177–181.

Quilhot, W., M. Cuellar, R. Diaz, F. Riquelme and C. Rubio. 2012. Lichens of Aisen, Southern Chile. Gayana Bot., 69(1): 57-87.

309

Ramamoorthy, P. K. T., R. H. L. Shetty, S. Devidas, V. T. Mudduraj and K. S. Vinayaka. 2012. Antifungal and Cytotoxic Activity of Everniastrum cirrhatum (Fr.) Hale. Chiang Mai J. Sci., 39(1): 76-83.

Ramos, D. B. M., F. S. Gomes, T. H. Napoleao, P. M. G. Paiva, M. D. C. Silva and L. C. B. B. Coelho. 2014. Antimicrobial Activity of Cladonia verticillaris Lichen Preparations on Bacteria and Fungi of Medical Importance. Chin. J. Biol. http://dx.doi.org/10.1155/2014/219392.

Rana, K., S. Nayaka, P. Shukla and D. K. Upreti. 2015. Notes on Occurrence of Fruticose Lichens in Joram Top, Ziro Valley, Arunachal Pradesh with 10 New Records to the State. Int. J. Sci. Res., 4(12): 999-1003.

Rankovic, B., M. Kosanic, T. Stanojkovic, P. Vasiljevic and N. Manojlovic. 2012. Biological activities of Toninia candida and Usnea barbata together with their norstictic acid and usnic acid constituents. Int. J.

Mol. Sci., 13(11): 14707-14722

Rankovic, B and M. Misic. 2007. Antifungal activity of extract of lichens Alectoria sarmentosa and Cladonia rangiferina. Mikol. Fitopatol., 41: 276– 81.

Rankovic, B. R., M. M. Kosanic and T. P. Stanojkovic. 2011. Antioxidant, antimicrobial and anticancer activity of the lichens Cladonia furcata, Lecanora atra and Lecanora muralis. BMC Complement. Altern. Med., 11: 97. doi: 10.1186/1472-6882-11-97

Rankovic, B., D. Rankovic and D. Maric. 2010. Antioxidant and antimicrobial activity of some lichen species. Mikrobiologiya, 79(6): 809-815.

Rankovic, B., M. Kosanic and T. Stanojkovic. 2014. Stereocaulon paschal lichens as antioxidant, antimicrobial and anticancer agent. Farmacia 62(2): 306-317.

310

Rankovic, B., M. Misic and S. Sukdolak. 2009. Antimicrobial activity of extracts of the lichens Cladonia furcata, Parmelia caperata, Parmelia pertusa, Hypogymnia physodes and Umbilicaria polyphylla. Biologia, 64(1): 53-58.

Ravaglia, L. M., K. Goncalves, N. M. Oyama, R. G. Coelho, A. A. Spielmann and N. K. Honda. 2014. In vitro radical-scavenging activity, toxicity against A. salina, and NMR profiles of extracts of lichens collected from Brazil and Antarctica. Quim. Nova, 37(6): 1015-1021.

Redzic, S., S. Barudanovic and S. Pilipovic. 2010. Wild Mushrooms and Lichens used as Human Food for Survival; Podrinje - in War Conditions Zepa Region (Bosnia and Herzegovina, W. Balkan). Hum. Ecol. Rev., 17(2): 175-187.

Rezanka, T. and V. M. Dembitsky. 2006. The colleflaccinosides, two chiral bianthraquinone glycosides with antitumor activity from the lichen Collema flaccidum collected in Israel and Russia. Nat. Prod. Res., 20(10): 969-980.

Ribera, A. E and G. Zuniga. 2012. Induced plant secondary metabolites for phytopatogenic fungi control: a review. J. Soil Sci. Plant Nutr., 12 (4): 893-911.

Rosabal, D., A. R. Burgaz and R. D. Masa. 2010. Diversity and distribution of epiphytic macrolichens on tree trunks in two slopes of the montane rainforest of Gran Piedra, Santiago de Cuba. Bryologist, 113(2): 313-321.

Rosato, V. G. 2006. Diversity and distribution of lichens on mortar and concrete in Buenos Aires province, Argentina. Darwiniana, 44(1): 89- 97.

311

Rout, J. A., B. Singh and D. K. Upreti. 2012. Lichen flora on betel nut (Areca catechu) palm tree from a pristine habitat in southern Assam, India. Vegetos, 25(1): 198-201.

Rout, J., P. Das and D. K. Upreti. 2010. Epiphytic lichen diversity in a Reserve Forest in southern Assam, northeast India. Trop. Ecol., 51(2): 281-288.

Saag, L., E. S. Hanen, A. Saag and T. Rindlane. 2007. Survey of lepraria and Leprocaulon in Greenland. Mycotaxon, 102: 57-90.

Sanders, W. B. 2001. Interface between Mycology and Plant morphology. Bioscience, 51(12): 1025-1036.

Santiago, K. A. A., J. N. C. Borricano, J. N. Canal1, D. M. A. Marcelo1, M. C. P. Perez, and T. E. E. Cruz. 2010. Antibacterial activities of fruticose lichens collected from selected sites in Luzon Island, Philippines. Philipp. Sci. Lett., 3(2): 18-29.

Sati, S. C. and S. Joshi. 2011. Antibacterial activity of the Himalayan lichen Parmotrema nilgherrense extracts. Br. Microbiol. Res. J., 1(2): 26-32.

Serusiaux, E., B. Goffinet, J. Miadlikowska and O. Vitikainen. 2009. Taxonomy, phylogeny and biogeography of the the lichen genus Peltigera in Papua New Guinea. Fungal Divers., 38: 185-224.

Shah, G. M. and M. A. Khan (2006). Common medicinal Folk recipes of Siran valley, Mansehra, Pakistan. Ethnobot. leaflets 10: 49-62.

Shah, N. C. 2013. Lichens of Commercial importance in India. Herbal Tech Industry. 10(01): 13-17.

Shahbaz, B., T. Ali and M. Awais. 2012. Perceived impact of precipitation in forest managmentnon natural and social capitals in Mansehra district of Pakistan. J. Anim. plant sci., 22(4): 1167-1172.

312

Shaheen, B. and S. H. Iqbal. 1978. The Parmelia borreri Group (lichens) in Pakistan. Biologia, 24(2): 367-372.

Shahi, M. P, S. K. Shahi, A. Dikshit and D. K. Upreti. 2012. Broad spectrum antifungal activity of Indian lichen Peltigera praetextata extracts to control fungal. Int. J. Curr. Innov. Res.,1(1): 1-6.

Shahidi, F. and P. K. Janitha, P. D. Wanasundara. 1992. Phenolic antioxidants. Crit. Rev. Food Sci. Nutr., 32(1): 67-103.

Sharma, B. C. and S. Kalikotay. 2012. Screening of antioxidant activity of lichens Parmotrema reticulatum and Usnea sp. from Darjeeling hills, India. IOSR J. Pharm., 2(6): 54–60.

Sharma, B. C., S. Kalikotay and B. Rai. 2012. Assessment of antimicrobial activity of extracts of few common Lichen of Darjeeling Hills. Ind. J. Fund. App. Life Sci., 2 (1): 120-126.

Shetty, P. P., G. S. Pandit and B. O. Sharma. 2012. Lichens on mangrove plants in Andaman Islands, India. Mycosphere, 3(4): 476-484.

Shrestha, G, and L. L. S. Clair. 2013b. Lichens: a promising source of antibiotic and anticancer drugs. Phytochem. Rev., 12(1): 229-244.

Shrestha, G. and L. L. S. Clair. 2013a. Antimicrobial activity of extracts from two lichens Ramalina menziesii and Usnea lapponica. Bulletin of the California Lichen Society, 20(1): 5 -10.

Shrestha, G., A. M. El-Naggar, L. L. S. Clair and K. L. Neill. 2015. Anticancer Activities of Selected Species of North American Lichen Extracts. Phytother. Res., 29 (1): 100–107.

Shrestha, G., S. L. Petersen and L. L. S. Clair. 2012. Predicting the distribution of the air pollution sensitive lichen species Usnea hirta. Lichenologist, 44: 511-521.

313

Shukla, P., D. K. Upreti, S. Nayaka and P. Tiwari. 2014. Natural dye from Himalayan lichens. Indain J. Tradit. Know., 13(1): 195-201.

Silva, C. M. S. M. D. and S. P. Senanayake. 2015. Assessment of Epiphytic Lichen Diversity in Pine Plantations and Adjacent Secondary Forest in Peacock Hill, Pussellawa, Sri Lanka. Int. J. Mod. Bot., 5(2): 29-37.

Singh, K. P., A. Pinokiyo and S. K. Borthakur. 2006. Foliicolous lichens of India with special reference to Arunaehal Pradesh, India. J. Forest. 29(3): 219-333.

Singh, P., K. P. Singh and A. B. Bhatt. 2015. Diversity and distribution of microlichens in the state of Arunachal Pradesh, Eastern Himalaya, India. Check List, 11(6): 1807.

Sinha, S. N. and M. Biswas. 2011. Evaluation of antibacterial activity of some lichen from Ravangla, Sikkim, India. Int. J. Pharma. Bio. Sci., 2(4): 23-28.

Sipman, H. and T. Raus. 2002. An Inventory of the Lichen Flora of Kalimnos and Parts of Kos (Dodecanisos, Greece). Willdenowia, 32(2): 351-39.

Slack, N. G. 1988. The Ecological Importance of Lichens and Bryophytes. In T. W. Nash III and V. Wirth (Ed.), Lichens and Bryophytes and air quality. J. Cramer, Berlin, pp 23-53.

Srivastava, P., A. R. Logesh, D. K Upreti, T. N. Dhole and A. Srivastava. 2013a. In-vitro evaluation of some Indian lichens against human pathogenic bacteria. Mycosphere 4(4): 734–743.

Srivastava, P., D. K. Upreti, T. N. Dhole and A. K. Srivastava. 2013. In-vitro evaluation of the antimicrobial activities of lichen Usnea ghattensis. Int. J. Curr. Microbiol. App. Sci., 2(5): 271-279.

314

Stapleton, P. D and P. W. Taylor. 2002b. Methicillin resistance in Staphylococcus aureus: mechanisms and modulation. Sci. Prog., 85(1): 57-72.

Stewart, R. R. 1972. An annotated catalogue of the vascular plants of West Pakistan and Kashmir. In Nasir, E. & S. I. Ali (Ed.), Flora of West Pakistan Fakhri Press, Karachi. 1028 pp.

Stojanovic, I., N, Radulovic, V. Cvetkovic, T. Mitrovic and S. Stamenkovic. 2014. Antimicrobial activity of methanol extracts of four Parmeliaceae lichen species. FACTA UNIVERSITATIS, 11(1): 45 – 53.

Susithra, E., K. M. Rao, K. V. Ramseshu and S. Meena. 2011. Evaluation of In-vitro Antioxidant activity of isolated compounds of lichen, Usnea undulate. J. Pharm. Res., 4(2): 352-355.

Syed, H. H., R. Ullah, F. Haq and M. I. Ullah. 2012. Ladybird beetles fauna of Hazara University, garden campus, Mansehra, Pakistan. Int. J. Biosci., 2(11): 58-65. Tabarez, M. R., R. Jansen, M. Sylla, H. Lunsdorf, S. Haubler, D.A. Santosa, K. N. Timmis and G. Molinari. 2006. 7-O-Malonyl Macrolactin A, a New Macrolactin Antibiotic from Bacillus subtilis Active against Methicillin-Resistant Staphylococcus aureus, Vancomycin-Resistant Enterococci, and a Small-Colony Variant of Burkholderia cepacia. Antimicrob. Agents Chemother., 50(5): 1701-1709.

Temina, M., S. Y. Kondratyuk, S. D. Zelenko, S. P. Wasser and E. Nevo. 2005. Lichen-forming, lichenicolous and allied fungi of Israel. In: Wasser, S. P. and E. Nevo (Ed.). Biodiversity of Cyanoprocaryotes, Algae and Fungi of Israel. ARA Ganter Verlag, Ruggell.

Thadhani, V. M., M. I. Choudhary, S. Khan and V. Karunaratne. 2012. Antimicrobial and toxicological activities of some depsides and depsidones. J. Natl. Sci. Found. Sri., 40(1): 43-48.

315

Tiwari, P., H. Rai, D. K. Upreti, S. Trivedi and P. Shukla. 2011b. Antifungal Activity of a Common Himalayan Foliose Lichen Parmotrema tinctorum (Despr. ex Nyl.) Hale. Nat. Sci., 9(9): 167–171.

Tiwari, P., H. Rai, D. K. Upreti, S. Trivedi and O. Shukla. 2011a. Assessment of antifungal activity of some himalayan foliose lichens against plant pathogenic fungi. Am. J. Plant Sci., 2(6): 841–846.

Triggiani D, D. Ceccarelli, A. Tiezzi, T. Pisani, S. Munzi, C. Gaggi and S. Loppi. 2009. Anti-proliferative activity of lichen extracts on murine myeloma cells. Biologia. 64(1): 59-62.

Tufan, O., H. Sumbul and A. O. Turk. 2005. The lichen flora of the Termessos National Park in Southwestern Turkey. Turkish lichens. Mycotaxon, 94: 43-46.

Turk, A. Q., M. Yilmaz, M. Kivanc and H. Turk. 2003. The Antimicrobial Activity of extracts of the lichen Cetraria aculeata and its protolichesterinic acid constituent. Z. Naturforsch., 58c: 850-854.

Uppadhyay, V., K. K. Ingle, S. Trivedi and D. K. Upreti. 2016. Diversity and distribution of lichens from the monuments of Gwalior division, Madhya Pradesh with special reference to rock porosity and lichen growth. Trop. Plant Res., 3(2): 384–389.

Vidyalakshmi, A. and K. Kruthika. 2012. Antibacterial activity of Parmelia perlata. Asian Pac. J. Trop. Biomed., 2(2): 892-894.

Vinayaka, K. S., S. Nayaka, Y. L. Krishnamurthy and D. K. Upreti. 2012. A report on some macro-lichens new to Karnataka, India. J. Threat. Taxa, 4(1): 2318-2321.

Vinayaka, K. S. 2011. A Study on Diversity and Conservation of Lichens in Shettihalli Wildlife Sanctuary, Western Ghats, India. Final Report. Kuvempu University, Shankaraghatta, Shimoga District, Karnataka

316

Vinayaka, K. S., H. C. Chetan and A. R. Mesta. 2016. Diversity and Distribution Pattern of Lichens in the MidElevation Wet Evergreen Forest, Southern Western Ghats, India. Int. J. Res. Studies Biosci., (IJRSB), 4(1): 15-20.

Wang, L., T. Narui, H. Harada, C. F. Culberson, and W. L. Culberson. 2001. Ethnic Uses of Lichens in Yunnan, China. Bryologist, 104(3): 345-349.

White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White (Eds.) PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., New York. Pp. 315-322.

Wolseley, P. A. and B. A. Hudson. 1995. Key to lichen genera in Thailand with special reference to epiphytic taxa, part 1: Macro-lichens. Bull. Am. Mus. Nat. Hist., 43: 303-335.

Zedda, L., M. Schultz and G. Rambold. 2009. Diversity of epiphytic lichens in the savannah biome of Namibia. Herzogia 22: 153–164.

317