DOCSLIB.ORG

Suporting Information Evolutionary Convergence in Lignin Degrading Enzymes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Suporting Information Evolutionary Convergence in Lignin Degrading Enzymes UNIVERSIDAD COMPLUTENSE DE MADRID Facultad de Ciencias Químicas Departamento de Bioquímica y Biología Molecular 3 2 1 Doctoral Thesis Resurrection of ancestral ligninolytic peroxidases Resurrección de peroxidasas ligninolíticas ancestrales Iván Ayuso Fernández Supervisors Ángel T. Martínez Ferrer F. Javier Ruiz Dueñ as Madrid, 2019 Universidad Complutense de Madrid Facultad de Ciencias Químicas Departamento de Bioquímica y Biología Molecular Doctoral Thesis Iván Ayuso Fernández Resurrection of ancestral ligninolytic peroxidases Resurrección de peroxidasas ligninolíticas ancestrales Supervisors: Dr. Ángel T. Martínez Ferrer Dr. Francisco Javier Ruiz Dueñas Profesor de Investigación, CSIC Científico Titular, CSIC Madrid, 2019 Front cover: artistic representation of the first versatile peroxidase that appeared in Polyporales evolution, named AVPd in this thesis. Life, uh, finds a way Dr. Ian Malcolm Jurassic Park A mi madre, Julia Descansa en paz Agradecimientos La presente tesis doctoral se ha realizado en el Centro de Investigaciones Biológicas y durante una estancia breve en la Universidad de California en Irvine. Ha sido financiada por una beca de Formación del Personal Investigador (FPI, Ref BES-2012-053513), una beca para estancia breve (Ref EEBB-I-15-10267) así como por los proyectos europeos “Optimized oxidoreductases for medium and large scale industrial biotransformations” (INDOX, Ref KBBE-2013-613549) y "New enzymatic oxidation/oxyfunctionalization technologies for added value bio-based products" (EnzOx2, Ref H2020- BBI-PPP-2015-720297) y del Plan Nacional "Nuevas enzimas oxidativas para una industria sostenible" (NOESIS, Ref BIO2014-56388-R) y “Genomas de basidiomicetos para las biorrefinerias de lignocelulosa” (GENOBIOREF, Ref BIO2017-86559-R). La escritura de la tesis, por mucho que uno se empeñe en hacerla metódica y al amparo de la Ciencia, acaba siendo algo muy personal e íntimo. Por ello, en esta sección quiero reflejar un sincero agradecimiento a aquellas personas que por un motivo u otro han tenido a bien estar cerca de mí durante su desarrollo. Al fin y al cabo la tesis no es del que la hace, sino de todo su entorno. Sirva esto de disclaimer, pues no me voy a acordar de todos casi seguro ya que en nuestro grupo tenemos la inmensa suerte de contar con "sangre fresca" de forma abundante y cíclica. Lo primero agradecer a Ángel Martínez haberme acogido en este grupo y haberme guiado de forma magistral durante todos estos años, especialmente a la hora de exprimir los resultados y sacar las publicaciones adelante. También por tu resolución y gestión de aspectos accesorios de la Ciencia (un mal necesario), por tu humor irónico y por el congreso en Israel, que me permitió ofrecer el PNAS tanto en el Santo Sepulcro como en el Muro de las Lamentaciones. Solo el politeísmo puede explicar que fuese aceptado. También quiero agradecer a Javier Ruiz Dueñas su guía cuando estaba más perdido y su paciencia cuando he sido más rebelde. Tu amabilidad como persona y tus insondables conocimientos sobre peroxidasas han hecho esta tesis posible, aparte de haberme concedido la beca FPI, claro. Muchas gracias, Javi. Muchas gracias a Susana Camarero, ahora también mi "jefa" en el laboratorio 200. Gracias por valorarme y por tus consejos, por las discusiones sobre ciencia y por el Lignobiotech IV. A Marta, por preocuparse siempre por mí, y por su continua simpatía y buen humor que nos agrada el día a día. Gracias a Alicia Prieto, Ali, por ser un ser de luz, y por hacer mucho más llevadero venir a trabajar. Gracias a María Jesús, directora del otro gran bloque de nuestro grupo, por elegir a gente tan guay para su laboratorio. Los agradecimientos a mis compañeros de poyata deberían ocupar un capítulo entero, y no porque seamos muchos. A lo largo de estos años hemos vivido momentos muy buenos, y algunos peores (sé que estáis pensando todos en cierta etapa), pero si algo es especialmente importante es que, pase lo que pase, el buen ambiente creado por todos se mantiene férreo. Hacéis que dedicarse a un trabajo como este, a veces ingrato y otrora frustrante, no solo sea posible sino que incluso apetezca. Sirva pues este párrafo como un gracias general a todos antes de pasar a algo más específico. Gracias a Ana, por tu amistad y sinceridad, por tus consejos certeros, y por ser tan maña que ni tus telómeros se han atrevido a acortarse. Te dedico una línea extra por todas las calabazas que te he dado (y daré). Gracias a Cris Coscolín, por su cocina, su humor y su tangible locura. A David, por las buenas conversaciones independientemente del tema (salvo una), y por tu espíritu curioso, no lo pierdas. Gracias por tus dibujos que decoran mi sitio, y por aguantar mis recomendaciones musicales sean lo que sean. Gracias también a Pablo, cuya amistad con David me obliga a saltarme el orden alfabético. Me recordáis mucho a Carlos y a mí, y no creo que pueda decir nada que signifique más que eso. Gracias por las épicas historias de mayor o menor veracidad, por los duelos de Magic, y pido perdón público por el fuego amigo que recibiste en el paintball. Piensa que era fácil que acertase en tu cabeza. Gracias a David Amanolito por su peculiar visión de las cosas, casualmente opuesta a cualquier otra. A Davi, porque en los primeros momentos de esta tesis fuiste esencial. Gracias a Elena, por su resolución extrema. A Fran, por las decenas de litros de medio de cultivo, por tener siempre una sonrisa y por los duelos en los pasillos. Gracias a Gonzalo, un gran fichaje, por odiar todo, lo que hace que signifique más que te gustase una de mis charlas. Y por los adjetivos cada vez más locos. Aprende a sentarte de una vez ya, hombre. A Íñigo, por su honestidad y grandeza como persona, que es incomparable. Gracias a Isa Pardo, porque siempre has sido uno de los faros que he seguido como ejemplo, por ser una gran amiga y por tu paciencia ante las absurdas aventuras que siempre te proponíamos Carlos y yo. Espero sinceramente que nuestros caminos se vuelvan a cruzar. Gracias a Isa V, por el drama (por supuesto), por los rayos, por todos los planes a lo largo de estos años y porque en el tiempo que coincidimos en el CIB, el sol brillaba más. Gracias a Jaime, por tu fanatismo por el mundo fúngico e interesarte tanto en nuestro trabajo, y por descubrirnos misteriosos restaurantes. A Jesús, por su amabilidad y por cuidar el diseño! Gracias Jorge, por tu sabiduría e innumerables consejos, casi tantos como cañas contigo, y por demostrar que recorrer el camino de la Ciencia por la vía espartana es posible. Esa plaza vendrá pronto, y su celebración será legendaria. Gracias a Juan, por ser el mejor compañero de piso del mundo, por aguantarme en casa en esta última etapa de muchas quejas, por estar siempre dispuesto a un plan y liarlo hasta su límite. Gracias por tu humor y tus anécdotas geniales, y en definitiva por tu amistad a lo largo de estos años. Gracias a Juanan, el último Manolito en la Guardia, por las conversaciones sobre The Witcher y cualquier videojuego, y por creer en mí más que yo mismo. Sacarás grandes cosas, LPMOs mediante o no. Gracias a Lola, porque eres la mejor persona posible, por enseñarme en mis primeros meses y no parar de enseñarme nunca, y por descubrirnos los manolitos (los de mantequilla tallada). Gracias a Lorea (Delorean Hojaldre), que vino y se fue hablando de Canadá, por su frikismo bioquímico y por mantener la amistad incluso a miles de kilómetros. Gracias a Manuel, erudito, porque su presencia eleva la conversación, por demostrar que los trasgos a veces ganan a los elfos, por su genialidad como DM y por ser una de las mejores amistades que puedo tener. Gracias por dejarte forzar a una eventual caña, y por jamás hacer caso a mis consejos! Sé que demostrarás que el hygge es una mamarrachada vikinga. Gracias a Marcos (qué casualidad que caigas cerca de Manuel!), por las conversaciones sobre música y por demostrar que de Francia también pueden salir cosas buenas. Gracias a María Molina, por sus legendarias tartas de queso y su simpatía contagiosa! Te irá bien en esas monitorizaciones, sean lo que sean. A Mariu, por su rotundo mandar, por elevar el nivel en el pádel, y por su ejemplar estoicismo en la ciencia. Gracias a Meme, porque tu visión de las cosas es maravillosa, por las fiestas y los dansins, y por tus consejos. Gracias a Minipiticli (aka Alberto), por las anécdotas y las risas, y por traer torreznos sorianos en tu cumpleaños (cosa que será cierta independientemente de cuándo se lea esta declaración). Gracias a Neumara, por traer un poco de samba a nuestro grupo. Gracias a Rash y a Ander, mi dúo cómico favorito, por ser tan geniales sin pretenderlo. Gracias a Sonia y a Andrés, por haber montado el Team Rocket en el 209, y por haber hecho que esa etapa de mi tesis solo la recuerde con risas. Gracias a Vero, un ángel PhD, porque tu infinita bondad nos hacía a todos mejores, y por enseñarme tanto. Gracias a Willian, inquietantemente perfecto, porque tu estancia no dejó indiferente a nadie. Me gustaría decir unas palabras de toda la gente de máster y grado que ha entrado a lo largo de estos años, porque todos merecen unas. En su lugar voy a hacer una lista. Gracias a Anna, Carlos (oh valla!), Chantal y María, a Cynthia, Jose, Julia, Jakub (!), Malina, María Mer, Mario (el armario), Marta (la de Jorge), Miguel, Mihai (tee champion), Rocío… y de los que me olvido seguro. Dais mucha guerra, pero compensa.
Load more

Recommended publications
  • A Copper Protein and a Cytochrome Bind at the Same Site on Bacterial Cytochrome C Peroxidase† Sofia R
    14566 Biochemistry 2004, 43, 14566-14576 A Copper Protein and a Cytochrome Bind at the Same Site on Bacterial Cytochrome c Peroxidase† Sofia R. Pauleta,‡,§ Alan Cooper,⊥ Margaret Nutley,⊥ Neil Errington,| Stephen Harding,| Francoise Guerlesquin,3 Celia F. Goodhew,‡ Isabel Moura,§ Jose J. G. Moura,§ and Graham W. Pettigrew‡ Veterinary Biomedical Sciences, Royal (Dick) School of Veterinary Studies, UniVersity of Edinburgh, Summerhall, Edinburgh EH9 1QH, U.K., Department of Chemistry, UniVersity of Glasgow, Glasgow G12 8QQ, U.K., Centre for Macromolecular Hydrodynamics, UniVersity of Nottingham, Sutton Bonington, Nottingham LE12 5 RD, U.K., Unite de Bioenergetique et Ingenierie des Proteines, IBSM-CNRS, 31 chemin Joseph Aiguier, 13402 Marseilles cedex 20, France, Requimte, Departamento de Quimica, CQFB, UniVersidade NoVa de Lisboa, 2829-516 Monte de Caparica, Portugal ReceiVed July 5, 2004; ReVised Manuscript ReceiVed September 9, 2004 ABSTRACT: Pseudoazurin binds at a single site on cytochrome c peroxidase from Paracoccus pantotrophus with a Kd of 16.4 µMat25°C, pH 6.0, in an endothermic reaction that is driven by a large entropy change. Sedimentation velocity experiments confirmed the presence of a single site, although results at higher pseudoazurin concentrations are complicated by the dimerization of the protein. Microcalorimetry, ultracentrifugation, and 1H NMR spectroscopy studies in which cytochrome c550, pseudoazurin, and cytochrome c peroxidase were all present could be modeled using a competitive binding algorithm. Molecular docking simulation of the binding of pseudoazurin to the peroxidase in combination with the chemical shift perturbation pattern for pseudoazurin in the presence of the peroxidase revealed a group of solutions that were situated close to the electron-transferring heme with Cu-Fe distances of about 14 Å.
    [Show full text]
  • Weiterführende Literatur Zum Lehrbuch „Biochemie“ (Kapitel 4 – 50)
    Weiterführende Literatur zum Lehrbuch „Biochemie“ (Kapitel 4 – 50) Im Buch ist aus Platzgründen auf die Angabe weiterführender Literatur verzichtet worden. Auskünfte zu den thematischen Schwerpunkten der vier Hauptteile II bis V geben die im Folgenden aufgeführten knapp 1000 einschlägigen Artikel aus wissenschaftlichen Fachzeitschriften. Die Zusammenstellung folgt der Gliederung des Buchs. Jeder Link führt direkt zur Literaturliste des entsprechenden Kapitels, aber es ist stets auch die gesamte Literatur hinterlegt (z.B. für einen kompletten Ausdruck). Die Aufstellung enthält überwiegend Review-Artikel der letzten 4 Jahre, in denen der aktuelle Kenntnisstand zu einem ausgewählten Thema von führenden Wissenschaftlern präsentiert wird. Beim Einführungsteil (Kapitel 1 bis 3) haben wir dagegen bewusst auf Spezialliteratur verzichtet; hier sei auf einschlägige Lehrbücher der Biochemie, Molekularbiologie, Genetik und Zellbiologie, die diesen fundamentalen Aspekten breiten Raum widmen, verwiesen. Falls Sie als Leser interessante Artikel finden, die unsere Literatursammlung ergänzen und bereichern könnten, bitten wir um kurze Mitteilung an den Verlag. Werner Müller-Esterl Ulrich Brandt Oliver Anderka Stefan Kerscher 1 Teil II Struktur und Funktion von Proteinen 4 Proteine – Werkzeuge der Zelle 4.1 Liganden binden an Proteine und verändern deren Konformation Wilson MA, Brunger AT (2000) The 1.0 Å crystal structure of Ca2+-bound calmodulin: an analysis of disorder and implications for functionally relevant plasticity, J Mol Biol 301, 1237-1256 O'Day DH & Myre MA (2004) Calmodulin-binding domains in Alzheimer's disease proteins: extending the calcium hypothesis. Biochemical and Biophysical Research Communications, 320, 1051-1054. 4.2 Enzyme binden Substrate und setzen sie zu Produkten um Showalter AK & Tsai MD (2002) A reexamination of the nucleotide incorporation fidelity of DNA polymerases.
    [Show full text]
  • Part I Principles of Enzyme Catalysis
    j1 Part I Principles of Enzyme Catalysis Enzyme Catalysis in Organic Synthesis, Third Edition. Edited by Karlheinz Drauz, Harald Groger,€ and Oliver May. Ó 2012 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2012 by Wiley-VCH Verlag GmbH & Co. KGaA. j3 1 Introduction – Principles and Historical Landmarks of Enzyme Catalysis in Organic Synthesis Harald Gr€oger and Yasuhisa Asano 1.1 General Remarks Enzyme catalysis in organic synthesis – behind this term stands a technology that today is widely recognized as a first choice opportunity in the preparation of a wide range of chemical compounds. Notably, this is true not only for academic syntheses but also for industrial-scale applications [1]. For numerous molecules the synthetic routes based on enzyme catalysis have turned out to be competitive (and often superior!) compared with classic chemicalaswellaschemocatalyticsynthetic approaches. Thus, enzymatic catalysis is increasingly recognized by organic chemists in both academia and industry as an attractive synthetic tool besides the traditional organic disciplines such as classic synthesis, metal catalysis, and organocatalysis [2]. By means of enzymes a broad range of transformations relevant in organic chemistry can be catalyzed, including, for example, redox reactions, carbon–carbon bond forming reactions, and hydrolytic reactions. Nonetheless, for a long time enzyme catalysis was not realized as a first choice option in organic synthesis. Organic chemists did not use enzymes as catalysts for their envisioned syntheses because of observed (or assumed) disadvantages such as narrow substrate range, limited stability of enzymes under organic reaction conditions, low efficiency when using wild-type strains, and diluted substrate and product solutions, thus leading to non-satisfactory volumetric productivities.
    [Show full text]
  • Enzyme DHRS7
    Toward the identification of a function of the “orphan” enzyme DHRS7 Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Selene Araya, aus Lugano, Tessin Basel, 2018 Originaldokument gespeichert auf dem Dokumentenserver der Universität Basel edoc.unibas.ch Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Alex Odermatt (Fakultätsverantwortlicher) und Prof. Dr. Michael Arand (Korreferent) Basel, den 26.6.2018 ________________________ Dekan Prof. Dr. Martin Spiess I. List of Abbreviations 3α/βAdiol 3α/β-Androstanediol (5α-Androstane-3α/β,17β-diol) 3α/βHSD 3α/β-hydroxysteroid dehydrogenase 17β-HSD 17β-Hydroxysteroid Dehydrogenase 17αOHProg 17α-Hydroxyprogesterone 20α/βOHProg 20α/β-Hydroxyprogesterone 17α,20α/βdiOHProg 20α/βdihydroxyprogesterone ADT Androgen deprivation therapy ANOVA Analysis of variance AR Androgen Receptor AKR Aldo-Keto Reductase ATCC American Type Culture Collection CAM Cell Adhesion Molecule CYP Cytochrome P450 CBR1 Carbonyl reductase 1 CRPC Castration resistant prostate cancer Ct-value Cycle threshold-value DHRS7 (B/C) Dehydrogenase/Reductase Short Chain Dehydrogenase Family Member 7 (B/C) DHEA Dehydroepiandrosterone DHP Dehydroprogesterone DHT 5α-Dihydrotestosterone DMEM Dulbecco's Modified Eagle's Medium DMSO Dimethyl Sulfoxide DTT Dithiothreitol E1 Estrone E2 Estradiol ECM Extracellular Membrane EDTA Ethylenediaminetetraacetic acid EMT Epithelial-mesenchymal transition ER Endoplasmic Reticulum ERα/β Estrogen Receptor α/β FBS Fetal Bovine Serum 3 FDR False discovery rate FGF Fibroblast growth factor HEPES 4-(2-Hydroxyethyl)-1-Piperazineethanesulfonic Acid HMDB Human Metabolome Database HPLC High Performance Liquid Chromatography HSD Hydroxysteroid Dehydrogenase IC50 Half-Maximal Inhibitory Concentration LNCaP Lymph node carcinoma of the prostate mRNA Messenger Ribonucleic Acid n.d.
    [Show full text]
  • Enzyme Promiscuity Prediction Using Hierarchy-Informed Multi-Label Classification Gian Marco Visani1, Michael C
    Bioinformatics doi: 10.1093/bioinformatics/xxxxx Advance Access Publication Date: 22 Jan 2021 Manuscript Category Systems Biology Enzyme promiscuity prediction using hierarchy-informed multi-label classification Gian Marco Visani1, Michael C. Hughes1 and Soha Hassoun1,2,* 1Department of Computer Science, Tufts University, 161 College Ave, Medford, MA, 02155, USA, 2Department of Chemical and Biological Engineering, Tufts University, 4 Colby St, Medford, MA, 02155, USA *To whom correspondence should be addressed. Associate Editor: XXXXXXX Received on XXXXX; revised on XXXXX; accepted on XXXXX Abstract Motivation: As experimental efforts are costly and time consuming, computational characterization of enzyme capabilities is an attractive alternative. We present and evaluate several machine-learning models to predict which of 983 distinct enzymes, as defined via the Enzyme Commission (EC) numbers, are likely to interact with a given query molecule. Our data consists of enzyme-substrate interactions from the BRENDA database. Some interactions are attributed to natural selection and involve the enzyme’s natural substrates. The majority of the interactions however involve non-natural substrates, thus reflecting promiscuous enzymatic activities. Results: We frame this “enzyme promiscuity prediction” problem as a multi-label classification task. We maximally utilize inhibitor and unlabelled data to train prediction models that can take advantage of known hierarchical relationships between enzyme classes. We report that a hierarchical multi-label neural network, EPP-HMCNF, is the best model for solving this problem, outperforming k-nearest neighbours similarity-based and other machine learning models. We show that inhibitor information during training consistently improves predictive power, particularly for EPP-HMCNF. We also show that all promiscuity prediction models perform worse under a realistic data split when compared to a random data split, and when evaluating performance on non-natural substrates compared to natural substrates.
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • Biosynthesis of New Alpha-Bisabolol Derivatives Through a Synthetic Biology Approach Arthur Sarrade-Loucheur
    Biosynthesis of new alpha-bisabolol derivatives through a synthetic biology approach Arthur Sarrade-Loucheur To cite this version: Arthur Sarrade-Loucheur. Biosynthesis of new alpha-bisabolol derivatives through a synthetic biology approach. Biochemistry, Molecular Biology. INSA de Toulouse, 2020. English. NNT : 2020ISAT0003. tel-02976811 HAL Id: tel-02976811 https://tel.archives-ouvertes.fr/tel-02976811 Submitted on 23 Oct 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE En vue de l’obtention du DOCTORAT DE L’UNIVERSITÉ DE TOULOUSE Délivré par l'Institut National des Sciences Appliquées de Toulouse Présentée et soutenue par Arthur SARRADE-LOUCHEUR Le 30 juin 2020 Biosynthèse de nouveaux dérivés de l'α-bisabolol par une approche de biologie synthèse Ecole doctorale : SEVAB - Sciences Ecologiques, Vétérinaires, Agronomiques et Bioingenieries Spécialité : Ingénieries microbienne et enzymatique Unité de recherche : TBI - Toulouse Biotechnology Institute, Bio & Chemical Engineering Thèse dirigée par Gilles TRUAN et Magali REMAUD-SIMEON Jury
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Prokaryotic Origins of the Non-Animal Peroxidase Superfamily and Organelle-Mediated Transmission to Eukaryotes
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 89 (2007) 567–579 www.elsevier.com/locate/ygeno Prokaryotic origins of the non-animal peroxidase superfamily and organelle-mediated transmission to eukaryotes Filippo Passardi a, Nenad Bakalovic a, Felipe Karam Teixeira b, Marcia Margis-Pinheiro b,c, ⁎ Claude Penel a, Christophe Dunand a, a Laboratory of Plant Physiology, University of Geneva, Quai Ernest-Ansermet 30, CH-1211 Geneva 4, Switzerland b Department of Genetics, Institute of Biology, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil c Department of Genetics, Federal University of Rio Grande do Sul, Rio Grande do Sul, Brazil Received 16 June 2006; accepted 18 January 2007 Available online 13 March 2007 Abstract Members of the superfamily of plant, fungal, and bacterial peroxidases are known to be present in a wide variety of living organisms. Extensive searching within sequencing projects identified organisms containing sequences of this superfamily. Class I peroxidases, cytochrome c peroxidase (CcP), ascorbate peroxidase (APx), and catalase peroxidase (CP), are known to be present in bacteria, fungi, and plants, but have now been found in various protists. CcP sequences were detected in most mitochondria-possessing organisms except for green plants, which possess only ascorbate peroxidases. APx sequences had previously been observed only in green plants but were also found in chloroplastic protists, which acquired chloroplasts by secondary endosymbiosis. CP sequences that are known to be present in prokaryotes and in Ascomycetes were also detected in some Basidiomycetes and occasionally in some protists.
    [Show full text]
  • ( 12 ) United States Patent
    US010208322B2 (12 ) United States Patent ( 10 ) Patent No. : US 10 ,208 , 322 B2 Coelho et al. (45 ) Date of Patent: * Feb . 19, 2019 ( 54 ) IN VIVO AND IN VITRO OLEFIN ( 56 ) References Cited CYCLOPROPANATION CATALYZED BY HEME ENZYMES U . S . PATENT DOCUMENTS 3 , 965 ,204 A 6 / 1976 Lukas et al. (71 ) Applicant: California Institute of Technology , 4 , 243 ,819 A 1 / 1981 Henrick Pasadena , CA (US ) 5 ,296 , 595 A 3 / 1994 Doyle 5 , 703 , 246 A 12 / 1997 Aggarwal et al. 7 , 226 , 768 B2 6 / 2007 Farinas et al. ( 72 ) Inventors : Pedro S . Coelho , Los Angeles, CA 7 , 267 , 949 B2 9 / 2007 Richards et al . (US ) ; Eric M . Brustad , Durham , NC 7 ,625 ,642 B2 12 / 2009 Matsutani et al. (US ) ; Frances H . Arnold , La Canada , 7 ,662 , 969 B2 2 / 2010 Doyle et al. CA (US ) ; Zhan Wang , San Jose , CA 7 ,863 ,030 B2 1 / 2011 Arnold (US ) ; Jared C . Lewis , Chicago , IL 8 ,247 ,430 B2 8 / 2012 Yuan 8 , 993 , 262 B2 * 3 / 2015 Coelho . .. .. .. • * • C12P 7 /62 (US ) 435 / 119 9 ,399 , 762 B26 / 2016 Farwell et al . (73 ) Assignee : California Institute of Technology , 9 , 493 ,799 B2 * 11 /2016 Coelho .. C12P 7162 Pasadena , CA (US ) 2006 / 0030718 AL 2 / 2006 Zhang et al. 2006 / 0111347 A1 5 / 2006 Askew , Jr . et al. 2007 /0276013 AL 11 /2007 Ebbinghaus et al . ( * ) Notice : Subject to any disclaimer , the term of this 2009 /0238790 A2 9 /2009 Sommadosi et al. patent is extended or adjusted under 35 2010 / 0056806 A1 3 / 2010 Warren U .
    [Show full text]
  • New Automatically Built Profiles for a Better Understanding of the Peroxidase Superfamily Evolution
    University of Geneva Practical training report submitted for the Master Degree in Proteomics and Bioinformatics New automatically built profiles for a better understanding of the peroxidase superfamily evolution presented by Dominique Koua Supervisors: Dr Christophe DUNAND Dr Nicolas HULO Laboratory of Plant Physiology, Dr Christian J.A. SIGRIST University of Geneva Swiss Institute of Bioinformatics PROSITE group. Geneva, April, 18th 2008 Abstract Motivation: Peroxidases (EC 1.11.1.x), which are encoded by small or large multigenic families, are involved in several important physiological and developmental processes. These proteins are extremely widespread and present in almost all living organisms. An important number of haem and non-haem peroxidase sequences are annotated and classified in the peroxidase database PeroxiBase (http://peroxibase.isb-sib.ch). PeroxiBase contains about 5800 peroxidase sequences classified as haem peroxidases and non-haem peroxidases and distributed between thirteen superfamilies and fifty subfamilies, (Passardi et al., 2007). However, only a few classification tools are available for the characterisation of peroxidase sequences: InterPro motifs, PRINTS and specifically designed PROSITE profiles. However, these PROSITE profiles are very global and do not allow the differenciation between very close subfamily sequences nor do they allow the prediction of specific cellular localisations. Due to the rapid growth in the number of available sequences, there is a need for continual updates and corrections of peroxidase protein sequences as well as for new tools that facilitate acquisition and classification of existing and new sequences. Currently, the PROSITE generalised profile building manner and their usage do not allow the differentiation of sequences from subfamilies showing a high degree of similarity.
    [Show full text]