The Genetic Basis of Two Autosomal-Recessive Disorders of Immune Dysfunction

THE GENETIC BASIS OF TWO AUTOSOMAL-RECESSIVE DISORDERS OF IMMUNE DYSFUNCTION

Simon Thomas Cliffe

BBiot (Hons), MHGSA (Molecular Genetics)

A thesis submitted for the degree of

Doctor of Philosophy

November, 2011

School of Medical Sciences, Faculty of Medicine

University of New South Wales, Sydney, Australia

Acknowledgements

The construction of this thesis has been a monumental task, and I would like to thank the multitudes of people who have made this possible.

My supervisor, Dr Michael Buckley, has been the driving force behind my completion of this thesis. I owe an enormous debt of gratitude - not only for the years of guidance and encouragement towards submission of the thesis, but for kindling my enduring interest in the field of human genetics.

My co-supervisor Professor Robert Lindeman deserves accolades for his dealings with a student who is frequently over-confident. The submission of this thesis is a testament to his patience and encouragement.

Dr Tony Roscioli, I need to thank him for his assistance and inspiration throughout this thesis. The VODI project has been his baby, and it has been an honour to work with him throughout my studies. His passion for human genetics is infectious, and has been the driving force behind my growing interest in the field.

I need to thank everyone at SEALS Molecular Genetics, and particularly Dr Melody Caramins and Dr Peter Taylor. The support I have received from people in the laboratory has been above and beyond, and got me through some very dark times in the course of this thesis. I can only hope that I’m able to repay this support in the future.

A special thankyou to all of our collaborators from around the globe, and thanks to all the members of the affected families that have been involved in each of these studies. I hope that this work has in some small way given them some comfort.

To all my family and friends, you have helped me along when it seemed like I would never reach the end. And I wouldn’t have been able to do this without the help and support of Kate.

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction ii Abstract

This thesis describes the mapping and characterisation of the genetic basis of two unrelated disorders of immune function; veno-occlusive disease with immunodeficiency (VODI), and pigmented hypertrichosis with insulin-dependent diabetes mellitus (PHID). These are both autosomal-recessive disorders observed in consanguineous families, in which the genetic lesion was identified primarily using homozygosity mapping.

PHID is a newly described disorder of pigmented hypertrichotic dermatosis, associated with predominantly antibody-negative insulin-dependent diabetes mellitus. Homozygosity mapping of two unrelated patients from consanguineous families identified four shared regions of homozygosity that encompassed 34.7 Mb, and 326 known and predicted genes. Collaboration with another group, and the subsequent addition of SNP genotyping data from three more patients, defined a 1.4 Mb region on 10q22.1 containing 14 genes. Sequence analysis identified five different homozygous mutations within the SLC29A3 gene in these patients.

VODI is a primary immunodeficiency disorder characterised by hypogammaglobulinaemia, T&B cell dysfunction and veno-occlusive disease of the liver. A sequence variant was mapped to SP110 , a gene that associates with the PML nuclear body, which co-segregated with disease in the families. This was not detected in 100 ethnically matched control chromosomes, and RT-PCR, Immunohistochemistry, and western blot examinations showed that SP110 expression and cellular localisation was altered by these mutations.

An examination of the clinical spectrum of defects of SP110 , and related gene SP140 , identified four new SP110 mutations in VODI patients from Italy and the USA. No sequence variants were identified in a cohort of 86 patients with sporadic common variable immunodeficiency, or in 18 with autosomal recessive CVID. This suggests that defects in SP110 are specific for immunodeficiency syndromes that present with the full range of VODI characteristics.

There is substantial evidence that SP110 has a role in the modulation of transcription. A whole genome expression array was performed to identify affected biological pathways, and elucidate the aetiology of the VODI phenotype. This identified a number of genes with dysregulated expression in VODI patient cell lines that are related to B- lymphocyte differentiation, and macrophage function.

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction iii Publications arising from this work

Pigmented Hypertrichosis with Insulin-dependent Diabetes Mellitus

1 Cliffe ST , Kramer JM, Hussain K, Robben JH, de Jong EK, de Brouwer AP, Nibbeling E, Kamsteeg EJ, Wong M, Prendiville J, James C, Padidela R, Becknell C, van Bokhoven H, Deen PMT, Hennekam RCM, Lindeman R, Schenck A, Roscioli T, Buckley MF. SLC29A3 gene is mutated in pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome and interacts with the insulin signaling pathway. Human Molecular Genetics : 18(12): 2257- 2265 (2009).

2 Edghill EL, Hameed S, Verge CF, Rubio-Cabezas O, Argente J, Sumnik Z, Dusatkova P, Cliffe ST , Hennekam RCM, Buckley MF, Hussain K, Ellard S, Attersley, AT. Mutations in the SLC29A3 gene are not a common cause of isolated autoantibody negative type 1 diabetes. Journal of the Pancreas : 10(4): 457-458 (2009).

3 Spiegel R, Cliffe ST , Buckley MF, Crow YJ, Urquhart J, Horovitz Y, Tenenbaum-Rakover Y, Newman WG, Donnai D, Shalev SA. Expanding the clinical spectrum of SLC29A3 gene defects. European Journal of Medical Genetics : 53(5): 309-313 (2010).

Veno-occlusive disease with Immunodeficiency

4 Roscioli T, Cliffe ST , Bloch DB, Bell CG, Mullan G, Taylor PJ, Sarris M, Wang J, Donald JA, Kirk EP, Ziegler JB, Salzer U, McDonald GB, Wong M, Lindeman R, Buckley MF. Mutations in the gene encoding the PML nuclear body protein SP110 are associated with immunodeficiency and hepatic veno- occlusive disease. Nature Genetics : 38(6):620-2 (2006).

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction iv 5 Cliffe ST , Wong M, Taylor PJ, Ruga E, Wilcken B, Lindeman R, Buckley MF, Roscioli T. The First Prenatal Diagnosis for Veno-occlusive Disease and Immunodeficiency Syndrome, an autosomal recessive condition associated with mutations in SP110. Prenatal Diagnosis : 27(7):674-6 (2007).

6 Cliffe ST , Bloch DB, Suryani S, Kamsteeg E, Palendira U, Avery DT, Wainstein B, Trizzino A, Lefranc G, Akatcheriani C, Megarbané A, Gilissen C, Moshous D, Reichenbach J, Misbah S, Salzer U, Abinun M, Ruga E, Ong P, Stepensky P, Ruga E, Ziegler JB, Wong M, Tangye SG, Lindeman R, Buckley MF, Roscioli T. Clinical, Molecular and Cellular Immunology Findings in SP110- associated Veno-occlusive Disease with Immunodeficiency Syndrome. Journal of Allergy and Clinical Immunology [Epub ahead of print] (2012).

7 Wang T, Ong P, Roscioli T, Cliffe ST , Church JA. Hepatic Veno- occlusive Disease with Immunodeficiency (VODI): First Reported Case in the U.S. and Identification of a Unique Mutation in the Gene Encoding a PML Nuclear Body Protein, Sp110. Clinical Immunology [In Press] (2012).

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction v Table of Contents

Acknowledgements ...... ii

Abstract ...... iii

Publications arising from this work ...... iv

Table of Contents ...... vi

List of Figures ...... xi

List of Tables ...... xiii

List of Abbreviations ...... xiv

CHAPTER 1: Statement of the Objective and Summary of this Thesis ...... 1

1.1. Background ...... 1

1.2. Objectives ...... 2

1.3. Overview of the Thesis ...... 3

CHAPTER 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders ...... 5

2.1. Objectives ...... 5

2.2. Gene Identification in Disease ...... 5

2.3. Primary Immunodeficiency Disorders ...... 6

2.4. Compilation of literature describing the identification of the genetic basis of PIDs ...... 7

2.5. Examination of the experimental strategies employed in the identification of the genetic basis of disease ...... 8

2.6. Methodological approaches to gene discovery ...... 9

2.7. Gene Identifications by Mode of Inheritance ...... 11

2.8. Number of patients utilised in different gene identification approaches ...... 12

2.9. Gene identification methods over time ...... 14

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction vi 2.10. Functional candidate methods ...... 16 2.10.1. Cell-surface antigen expression ...... 18 2.10.2. Biochemical functional analysis ...... 19 2.10.3. Animal models ...... 22 2.10.4. Pathway analysis ...... 24 2.10.5. mRNA expression analysis ...... 26

Positional candidates...... 28 2.10.6. Linkage mapping ...... 30 2.10.7. Homozygosity mapping ...... 33

2.11. Phenotypic candidates ...... 36

2.12. Whole genome screening methods ...... 39

2.13. Conclusions ...... 40

CHAPTER 3: Methods ...... 44

3.1. DNA Extraction ...... 44 3.1.2. Puregene extractions ...... 45 3.1.3. DNA extraction from suspension cell cultures ...... 46 3.1.4. DNA extraction from paraffin-embedded tissue using a Qiagen DNeasy extraction kit ...... 46 3.1.5. RNA extraction from BLCLs ...... 48

3.2. Cell culture ...... 48 3.2.1. Cell cryopreservation ...... 48 3.2.2. BLCL culturing procedures ...... 49 3.2.3. Isolation of peripheral blood mononuclear cells from peripheral blood ...... 49 3.2.4. Generation of EBV-transformed lymphoblastoid cell lines ...... 50

3.3. Molecular Biology...... 51 3.3.1. Sequencing procedure...... 51 3.3.2. RT-PCR probes ...... 52 3.3.3. cDNA synthesis ...... 52 3.3.4. Real-Time PCR procedure ...... 53

3.4. Immunochemistry...... 53 3.4.1. Protein Extraction ...... 53

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction vii 3.4.2. Western Blotting ...... 54 3.4.3. Immunohistochemistry ...... 55

3.5. Gene Expression Microarray ...... 57 3.5.1. Microarray Analysis procedures ...... 57

3.6. SNP mapping ...... 58 3.6.1. Mendelian inheritance testing ...... 59

CHAPTER 4: Mapping and Characterisation of the PHID locus ...... 60

4.1. Objectives ...... 60

4.2. Introduction ...... 60 4.2.1. Autozygosity Mapping...... 61 4.2.2. Clinical description of PHID ...... 62

Results ...... 65 4.2.3. Selection of Lebanese-Australian patients ...... 65 4.2.4. High-Density SNP genotyping ...... 65 4.2.5. Mendelian testing ...... 66 4.2.6. Detecting regions of Identity by Descent ...... 67 4.2.7. Shared haplotype model ...... 68 4.2.8. Haplotyping of homozygous segments ...... 70 4.2.9. Non-shared haplotype model ...... 71 4.2.10. Conclusion of pilot phase ...... 75 4.2.11. Fine mapping of PHID locus with three additional subjects ...... 76 4.2.12. Mutation identification in SLC29A3 ...... 78 4.2.13. SLC29A3 encodes human ENT3 ...... 79 4.2.14. Protein consequences of SLC29A3 mutations ...... 80

Discussion of co-publications ...... 83 4.2.15. SLC29A3 spectrum disorder ...... 85 4.2.16. Involvement of SLC29A3 in Type I Diabetes ...... 87

4.3. Summary ...... 88

CHAPTER 5: Veno-Occlusive Disease with Immunodeficiency Syndrome is Due to Mutations in the SP110 gene ...... 89

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction viii 5.1. Objectives ...... 89

5.2. Introduction ...... 89 5.2.1. Veno-occlusive disease mapping and mutation discovery...... 89 5.2.2. Autozygosity mapping in VODI ...... 90 5.2.3. The role of SP110 mutations in VODI ...... 91 5.2.4. The genome-wide microsatellite survey indicated a single region of homozygosity...... 92 5.2.5. Protein truncating mutations are not always pathogenic mutations. . 92 5.2.6. Evidence that mutations in SP110 cause VODI ...... 93

Results ...... 94 5.2.7. SP110 mutations detected in five VODI families ...... 94 5.2.8. SP110 mutations co-segregate with disease in four VODI patients and are not present in 100 control chromosomes ...... 94 5.2.9. Multiple SP110 mutations detected in new VODI patients ...... 95 5.2.10. In silico analysis of non-protein-truncating VODI mutations ...... 97 5.2.11. Functional mutation analysis ...... 98 5.2.12. Quantitative RT-PCR ...... 98 5.2.13. Reduced mRNA expression of SP110 detected in VODI affected individuals ...... 100 5.2.14. SP100 and SP140 mRNA expression is not reduced ...... 103 5.2.15. Western Blot ...... 105 5.2.16. Immunohistochemistry ...... 106

5.3. Mutation screen of SP110 in other diseases ...... 109 5.3.1. SP110 and SP140 sequencing analysis in CVID and IgAD ...... 110 5.3.2. SP110b R544G ...... 111 5.3.3. SP140 N149K ...... 112 5.3.4. SP110 A128V ...... 112 5.3.5. Other low-frequency variants ...... 113

5.4. Discussion ...... 113 5.4.1. SP110 and SP140 variation in CVID ...... 116 5.4.2. SP110 variation and susceptibility to Mycobacterium tuberculosis infection ...... 116 5.4.3. Prenatal diagnosis of VODI ...... 119

5.5. Summary ...... 119

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction ix CHAPTER 6: Whole genome expression profiling in VODI ...... 121

6.1. Objectives ...... 121

6.2. Introduction ...... 121 6.2.1. Gene expression profiling in B-lymphoblastoid cell lines ...... 123 6.2.2. Subjects and Methods ...... 124 6.2.3. Statistical Analysis ...... 124

6.3. Results ...... 125 6.3.1. Preliminary analysis/Data cleanup ...... 125 6.3.2. Validation of Microarray results ...... 125 6.3.3. Microarray Data Breakdown ...... 127 6.3.4. Primary Immunodeficiency genes ...... 129 6.3.5. Significance Analysis of Microarray results ...... 130

6.4. Downstream analysis ...... 135 6.4.1. Gene Ontogeny term annotations ...... 135 6.4.2. Immune System and Apoptosis ...... 136 6.4.3. Glutathione synthesis ...... 138

6.5. Discussion ...... 139

6.6. Summary ...... 143

CHAPTER 7: Discussion ...... 144

7.1. Summary of findings ...... 144 7.1.1. PHID ...... 144 7.1.2. VODI ...... 144

7.2. Future work in VODI and PHID characterisation...... 145

7.3. Comparison of two Homozygosity mapping studies ...... 147

7.4. The importance of disease gene identification ...... 148

Bibliography ...... 151

Appendix ...... 197

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction x List of Figures

Figure 2.1: Methodological approaches used in Gene Identification for primary immunodeficiency diseases published 1985-2011...... 10 Figure 2.2: Inheritance patterns of identified PID genes...... 11 Figure 2.3: Number of affected individuals used in successful gene identification study methodologies...... 13 Figure 2.4: Primary immunodeficiency gene identification studies published from 1985 to 2011...... 14 Figure 2.5: Proportion of successful gene identification studies that utilised each of the approaches to gene identification...... 15 Figure 2.6: Functional candidate approaches in gene identification studies from 1985-2011...... 16 Figure 2.7: Number of individuals studied in Functional candidate approaches...... 17 Figure 2.8: Gene identification strategies used in combination with cell surface antigen expression...... 18 Figure 2.9: Gene identification strategies used in combination with biochemical functional analysis...... 21 Figure 2.10: Gene identification strategies used in combination with animal model studies...... 23 Figure 2.11: Gene identification strategies used in combination with biological pathway analysis...... 25 Figure 2.12: Gene identification strategies used in combination with expression analysis studies...... 27 Figure 2.13: Positional candidate approaches in gene identification studies from 1986-2011...... 29 Figure 2.14: Number of individuals studied in Positional candidate approaches...... 30 Figure 2.15: Gene identification strategies used in combination with linkage analysis...... 32 Figure 2.16: Gene identification strategies used with Homozygosity mapping . 35 Figure 2.17: Gene identification strategies used with Phenotypic screening approaches ...... 38 Figure 4.1: Pedigrees of the six PHID-affected individuals studied in this project ...... 64 Figure 4.2: i) the number of markers on each chromosome, ii) their average homozygosity and iii) the number of SNPs in a significant run...... 69 Figure 4.3: SNP ideogram of individual BII.2 ...... 73

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction xi Figure 4.4: SNP ideogram of individual CII.3 ...... 74 Figure 4.5: Chromosome 10 alignment showing the 1.4Mb critical region, expanded to show the 14 genes within this region...... 78 Figure 4.6: Mutations of SLC29A3 for the five PHID families studied...... 79 Figure 4.7: Protein model of hENT3 showing mutation locations ...... 80 Figure 4.8: Partial protein alignment, showing evolutionary conservation of the identified SLC29A3 mutations...... 81 Figure 5.1: Structure of SP110c , showing location of mutations...... 96 Figure 5.2: Diagram of SP110 isoform-specific Taqman® probes...... 100 Figure 5.3: Total SP110 mRNA expression...... 101 Figure 5.4: SP110c mRNA expression...... 102 Figure 5.5: SP110b mRNA expression...... 102 Figure 5.6: SP100 mRNA expression...... 103 Figure 5.7: SP140 mRNA expression...... 104 Figure 5.8: Immunoblot showing the absence of SP110b and SP110c isoforms in an affected individual (AII.1), and a homozygous wild type family member (CII.4)...... 105 Figure 5.9: Staining of B-LCLs of affected individual AII.1 with anti-SP100 antibodies...... 107 Figure 5.10: Staining of B-LCLs of unaffected individual CII.3 with anti-SP100 antibodies...... 107 Figure 5.11: Staining of B-LCLs of affected individual AII.1 with anti-SP110 antibodies...... 108 Figure 5.12: Staining of B-LCLs of unaffected individual CII.3 with anti-SP110 antibodies...... 108 Figure 6.1: SAM plot of the actual intensity data with the observed SAM score plotted against the ‘‘expected’’ SAM score ...... 131 Figure 6.2: Genes involved in immune system processes and regulation of apoptosis...... 137 Figure 6.3: Genes involved in amino acid transport...... 138

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction xii List of Tables

Table 4.1: Regions of interest identified using the shared-haplotype model. .... 71 Table 4.2: Regions of detected IBD that overlap in individual BII.2 and CII.3. .. 75 Table 5.1: List of SP110 mutations detected in VODI patients ...... 95 Table 5.2: Variants in the SP110 and SP140 screen of CVID and IgAD patients...... 111 Table 6.1: Differential expression comparison between Microarray and Taqman- based results...... 126 Table 6.2: Summary of the results of the microarray analysis...... 128 Table 6.3: PID genes that are differentially expressed in VODI...... 129 Table 6.4: Differentially expressed genes from SAM analysis ...... 132 Table 6.5: DAVID enrichment clusters...... 135 Appendix Table 9.1: Survey of the experimental methodologies used in gene identification papers associated with primary immunodeficiencies published between 1986-2011...... 197 Appendix Table 9.2: The significance thresholds for each of the chromosomes for the shared haplotype model...... 221 Appendix Table 9.3: The significance thresholds for each of the chromosomes for the non-shared haplotype model...... 222 Appendix Table 9.4: Primer sequences ...... 223 Appendix Table 9.5: PID gene expression in VODI ...... 232

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction xiii List of Abbreviations

AD Autosomal Dominant

APS Ammonium Persulphate

AR Autosomal Recessive

ATRA All-Trans-Retinoic Acid

BCG Bacille Calmette-Guérin

BLCL B-Lymphoblastoid Cell Lines bp Base Pairs cDNA Complementary DNA cM centiMorgans

CGH Comparative Genomic Hybridisation

CHS Chediak-Higashi Syndrome

CLD Chloride Losing Diarrhea

CNVs Copy Number Variants

CT Computed Topography scan

CVID Combined Variable Immunodeficiency Disorder

DAPI 4',6-diamidino-2-phenylindole

DAVID Database for Annotation, Visualization and Integrated Discovery del deletion

DNA Deoxyribonucleic acid dNTP Deoxy nucleotide triphosphate dup duplication

ENT3 Human Equilibrative Nucleoside Transporter 3

FBS Foetal Bovine Serum

FHL3 Familial Hemophagic Lymphohistiocytosis Type 3

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction xiv FITC Fluorescein isothiocyanate

GO Gene Ontogeny

GST Glutathione S-transferase

HCV Hepatitis C Virus

HGVS Human Genome Variation Society

HIV Human Immunodeficiency Virus

HSCT Haematopoietic Stem Cell Transplantation hVOD Hepatic Veno-Occlusive Disease

IBD Identity-By-Descent

ICF Immunodeficiency with Centromeric Instability and Facial Anomalies

IDDM Insulin Dependent Diabetes Mellitus

Kb Kilobase

LAD Leukocyte Adhesion Deficiency

LOD Logarithm of the odds

Mb Megabase

MRI Magnetic Resonance Imaging mRNA Messenger RNA

NGS Next Generation Sequencing

NHEJ Non-Homologous End Joining

NMD Nonsense-Mediated Decay

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PHID Pigmented Hypertrichosis with Insulin Dependent Diabetes Mellitus

PID Primary Immunodeficiency Disorder

PML-NB Promyelocytic Leukaemia Nuclear Body

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction xv PTC Premature Termination Codon

RAR α Retinoic Acid Receptor Alpha

RNA Ribonucleic acid

RT-PCR Real Time PCR

SAM Significance Analysis of Microarrays

SCID Severe Combined Immunodeficiency

SDS Sodium Dodecyl Sulphate

SEALS South East Area Laboratory Service

SIFT Sort Intolerant From Tolerant

SNP Single Nucleotide Polymorphism

SOS Sinusoidal Obstruction Syndrome

STD Selective T Cell Deficiency

STR Short Tandem Repeat

TEMED Tetramethylethylenediamine

UTR Untranslated region

VODI Veno-Occlusive Disease With Immunodeficiency Syndrome v/v Volume per volume w/v Weight per volume

The Genetic Basis of Two Autosomal-Recessive Diseases of Immune Dysfunction xvi CHAPTER 1: Statement of the Objective and Summary of this Thesis

1.1. Background

This thesis commenced in 2004 with the establishment of a disease gene mapping unit within the Genetics department of South Eastern Area Laboratory Services. Disease gene identification and mutation analysis leads to improvements in the delivery of personalised medical care to members of families with rare disorders, who might otherwise be poorly catered for by the public health sector. This disease gene mapping group initially focussed on rare autosomal recessive diseases within the Lebanese-Australian community in Sydney, Australia.

Two gene identification studies are presented in this thesis; however, in order to prioritise the studies in which this student played the major research role, they are presented out of their chronological order. In 2007, Prendiville et al. identified a condition later termed “PHID” - consisting of pigmented hypertrichosis with insulin-dependent diabetes mellitus. PHID is a rare genetic disorder that demonstrates autosomal recessive inheritance. The disorder was of interest to the gene mapping unit principally because it is associated with a high frequency of insulin-dependent diabetes mellitus, and immune dysregulation consistent with a granulomatous disorder and a dermatopathy restricted to the skin of the lower abdomen, inguinal region, buttocks and thighs. It was hypothesised that PHID was a monogenic disorder that could be elucidated using a homozygosity mapping approach. The project evolved from two families from the Prendiville et al. publication, and ultimately recruited seven affected individuals from six families based in Vancouver, Lexington, London and Istanbul.

Chapter 1: Statement of the Objective and Summary of this Thesis 1 The second disease gene discussed in this thesis is the cause of veno- occlusive disease with immunodeficiency syndrome, the genetic basis of which was initially identified by Dr Tony Roscioli. VODI had been first described in 1976 in Australian-Lebanese families by Mellis and Bale, and presents with hypogammaglobulinaemia, a combined B and T cell immunodeficiency, and characteristic damage to hepatic sinusoids, also known as sinusoidal obstruction syndrome (SOS) or traditionally as hepatic veno-occlusive disease (hVOD). This rare combination of primary immunodeficiency with a hepatic insult allowed for accurate phenotyping of this condition by Dr Roscioli and the clinical immunologists managing the family. At the outset of this study, four affected individuals within three consanguineous families had been identified. The structure of these pedigrees led to the hypothesis that VODI was an autosomal-recessive monogenic disease, and that homozygosity mapping would be the most effective tool for identifying the affected gene within these affected individuals. A microsatellite screen, followed by fine-mapping, discovered a single candidate gene locus of 1.42 Mb, containing 13 known and predicted genes. A candidate mutation had been detected in these individuals within the gene SP110 .

1.2. Objectives

The PHID study began with the goal of discovering the genetic basis of this disorder, as it appeared possible that this would give some insight into a new Mendelian cause of insulin dependent diabetes mellitus. The study used a variant of the homozygosity mapping approach, which was also employed successfully in the VODI mapping screen. The study proceeded in two stages – the first stage was a pilot study to determine if there were common regions of identity by descent in two Lebanese-Australian patients from two separate consanguineous kindreds. This was moderately successful, however it did not sufficiently define the region to allow for ready gene identification. The second stage of the project then proceeded with the addition of four more patients from three more affected families with Caucasian, Indian, and Pakistani ethnicity.

Chapter 1: Statement of the Objective and Summary of this Thesis 2 The goal of the VODI studies was slightly different, in that a putative disease allele had already been identified for the condition. The goal was therefore to provide evidence to determine whether SP110 was the disease gene and to validate the detected mutations as being clinically responsible for the observed phenotype. This was achieved through a variety of methods including population screening, in silico approaches, and mRNA expression and protein analysis. An additional objective was to define the mutation and clinical spectrum of VODI. This was achieved by a mutation screen of combined variable immunodeficiency disorder (CVID) patients as well as other patients with undefined immune deficiencies. Another goal was to further elucidate the role of SP110 by a whole genome expression array to identify affected biological pathways within VODI patients.

While the two studies shared some structural similarities, there were significant differences which allow for comparisons to be made between the varying approaches, as well as for observations to be made about the optimal research pathway for increased chances of success of a gene identification study.

1.3. Overview of the Thesis

The thesis consists of seven chapters. The second chapter of this thesis is a literature review that identifies and analyses the research strategies used to discover the 212 genes that have been identified to date with a role in the pathogenesis of primary immunodeficiency disorders. This review will identify the experimental approaches and research design that have led to successful research outcomes in these gene identification studies, and draws conclusions about the optimal experimental design.

The third chapter describes the experimental and analytical methods used in this research project.

Chapter four of this thesis is the first results chapter, and describes the design and application of the mapping procedures used to identify regions of interest within the PHID patients in the pilot study. The discovery of the candidate gene

Chapter 1: Statement of the Objective and Summary of this Thesis 3 region was quickly followed by discovery of SLC29A3 as the affected gene in these patients.

Chapter five discusses the mutation detection and validation procedures used to conclusively show that dysfunction of the SP110 gene is the basis of VODI, and that mutations in SP110 are specific for the VODI disorder. Chapter six further investigates the role of SP110 in downstream gene expression, presenting the results of a whole-genome expression analysis of VODI patients. This elucidates affected pathways that are potentially causative in the VODI phenotype.

Chapter seven of this thesis is a general discussion of the importance of gene discovery in both the VODI and PHID studies, and also contrasts the approaches taken in each case.

Appendices follow, containing reprints of each of the articles published during the course of this research.

Chapter 1: Statement of the Objective and Summary of this Thesis 4 CHAPTER 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders

2.1. Objectives

There are four major objectives to this review:

1) To compile a comprehensive cohort of genes that are dysregulated in human primary immunodeficiency disorders.

2) To survey the experimental methodologies that were utilised in the mapping of the genetic basis of these PID syndromes.

3) To evaluate the usage and success of each of these experimental methodologies.

4) To compare the usage of these methods over time, and examine the parameters of each of these studies that were consistent with successful gene identification.

2.2. Gene Identification in Disease

Gene identification in disease is important for a number of reasons. Primarily it enables the confirmation (or exclusion) of a clinical diagnosis and thus is an aid in disease classification and is the basis for prenatal, cascade, targeted or population testing. Appropriate classification and testing in turn provides for access to counselling, permits forward planning of management strategies, and allows parents access to family planning services. This thesis describes the identification of the genetic basis of two disorders of immune function, and this chapter reviews the

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 5 strategies that have been successfully applied in the mapping of all known primary immunodeficiency disorders (PIDs) as of September 2011, and aims to present evidence for the direction these studies may take in the future.

There are many immunological phenotypes which have a genetic basis, including autoimmunity, autoinflammation, angioedema, haemophagocytosis, thrombotic microangiopathy and predispositions to allergy. The reasons for restricting this review just to PIDs are firstly that they are a large set of related disorders, which are directly relevant to this thesis. Secondly, there have been a substantial number of gene identifications, allowing conclusions to be drawn based on a dataset of reasonable size. Thirdly, PID is an excellent model for reviewing gene identification studies as it represents a field of biology transitioning from a primary focus on simple, highly- penetrant Mendelian disorders, to an era of personalised genetic diagnosis for a specific immunological defect. As such the lessons learnt from gene discovery for PID are very relevant for many other genetic disorders. A recent review article examined genes identified in auto-immune disorders (Aksentijevich and Kastner 2011), and articles have also reviewed genes involved in susceptibility to infection (Ranque et al. 2008) and renal dysfunction (de Borst et al. 2008), however no systematic review of PID gene identification strategies has been published in the last 10 years.

2.3. Primary Immunodeficiency Disorders

Primary immunodeficiency disorders are conventionally defined as inherited disorders of the immune system characterised by decreased immunological function which results in susceptibility to multiple episodes of life-threatening infections by a range of pathogens. This category of disease includes such classical disorders of immune dysfunction as the severe combined immunodeficiencies and X-linked agammaglobulinaemia. The definition of PID is expanding rapidly and also includes disorders where there is increased susceptibility to a single episode of life- threatening infection with a single, or a restricted range of pathogens. For this

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 6 reason, although it has been argued that the spectrum of PID syndromes is well defined (Kirkpatrick and Riminton 2007), estimates regarding the number and prevalence of PIDs tend to vary widely. For the purposes of this review, a comprehensive list of all reported PIDs was developed.

2.4. Compilation of literature describing the identification of the genetic basis of PIDs

The World Health Organisation publishes a biannual review of primary immunodeficiency disorders, the latest update of which was released in 2009 (Notarangelo et al. 2009). That document identified 144 primary immunodeficiency syndromes in 8 main categories of PID, and identifies 133 genes with pathogenic mutations. The European Society for Immunodeficiencies (ESID, http://www.esid.org/ accessed on September 20, 2011) also recognises 8 main categories of PID, with 73 Sub-categories and 142 Sub-registry PIDs. The online database Resource of Asian Primary Immunodeficiency Diseases (RAPID, http://rapid.rcai.riken.jp/RAPID, accessed in September 2011), identifies 212 primary immune deficiency genes, 19 of which are associated with multiple PIDs (Keerthikumar et al. 2009b). These lists were combined to provide a comprehensive list of primary immunodeficiency conditions for which a genetic lesion had been discovered, current to September 2011. The total number of PID disorders in which a genetic mutation had been detected was 226, and these are listed in Appendix Table 9.1.

The first publication of a mutation for each of these PID genes was ascertained using a combination of the Web of Knowledge literature database, the PubMed literature database, the manually curated Online Mendelian Inheritance in Man database of genetic diseases, and the RAPID database of PID genes. The methods of gene discovery were then evaluated from each mutation detection paper. Where a combination of approaches was used to define and select a candidate gene, each was assessed. Where previous publications contributed substantially to the identification of the genetic basis, and where multiple gene identification papers were

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 7 published within a year of each other, the methodologies used were also assessed. Some care was taken to include only experimental methods that were used in the identification of the genetic basis of disease – rather than experiments that were performed post facto to increase the quality of the publication – however, this is necessarily subjective, and introduces an element of imprecision to this analysis.

2.5. Examination of the experimental strategies employed in the identification of the genetic basis of disease

This analysis of the published literature, which can be seen summarised in Appendix Table 9.1, has identified that the experimental procedures that were utilised in gene identification can be summarised into four general approaches and ten specific methodologies. These four general approaches, which were deduced from the literature survey of 226 immunodeficiency genes, correspond with the 3 major groups published by Francis Collins in 1995 deduced from the analysis of only 42 genes (Collins 1995), with the addition of a new category for whole genome approaches. Ultimately, the genetic lesion in most conditions was usually characterised and confirmed using some variety of nucleotide sequencing. However, until recently, sequencing was itself too laborious and expensive to be undertaken without a highly specific target region. Therefore, gene identification has relied upon the use of preliminary experimental approaches to limit the number of candidate genes whilst enriching the list for the likely pathogenic gene.

The first general approach was the functional candidate approach, which used knowledge of the biological basis of the condition to identify candidate genes. Five categories of functional candidate approaches were identified: 1) the examination of cell surface antigen expression (CSA), information that was often vital for the characterisation of a PID for clinical treatment, could be used to identify the gene involved in the aberrant expression of these antigens; 2) the biochemical dysfunction (BIO) that was observed in affected individuals was tested, for example by using a variety of enzyme activity assays; 3) genes that were known to interact within the

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 8 same biological pathway as a previously identified disease gene were considered to be candidates (PAN); 4) the examination of model organisms of the disease (ANI), typically mouse models, has provided clues to the pathogenesis of the disease, and lastly; 5) some studies examined differences in cellular expression of either mRNA or protein to determine the affected gene (RNA).

The second general approach used to identify genetic candidates was the positional candidate approach. This approach used genetic linkage mapping to determine the physical location of the candidate gene within the genome. Two specific methodologies were employed: 1) Linkage mapping (LIN), which examined the co- segregation of phenotypic traits with polymorphic genetic markers, and 2) Homozygosity mapping (HOM), a variant of linkage mapping that identifies shared regions of homozygosity within consanguineous children, which are likely to contain the candidate gene.

The third general approach is phenotypic candidate gene identification, where a candidate gene is indicated by phenotypic similarities of a disorder to a previously described condition. This involves a screening approach (SCR), where patients with phenotypically similar conditions are screened for mutations in one or more candidate genes from other similar syndromes.

The fourth general approach is different to the previous three in that it does not first identify a candidate gene or region - whole genome screens in which the genetic lesion was identified directly. This approach included 2 categories: 1) next generation sequencing (NGS) approaches, specifically whole-exome sequencing, and; 2) comparative genome hybridisation microarray (CGH) based approaches used to identify copy number or structural variants that were the cause of disease.

2.6. Methodological approaches to gene discovery

The literature survey summarised in Appendix Table 9.1 identified 226 successful gene identification studies, which utilised 334 experimental approaches. The relative

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 9 frequency of each approach is shown graphically in the pie chart in Figure 2.1 below. The pie chart in the left gives the overall frequency of the four general approaches. The individual frequencies of techniques within the Linkage and Functional categories are represented in the two subsidiary pie charts.

Figure 2.1: Methodological approaches used in Gene Identification for primary immunodeficiency diseases published 1985-2011.

Legend: WGS: whole-genome screen, LINK: linkage, PHEN: phenotypic candidate, FUNC: functional candidate.

The pie charts in Figure 2.4 illustrate that the most frequently used general approach for the identification of PID genes was the functional candidate approach (used in 57% of gene identification papers), followed by linkage approaches (used in 27% of gene identification approaches), and phenotypic candidate approaches (used in 13% of gene identification papers). At the time of writing just seven gene identification papers have utilised next generation sequencing or CGH approaches.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 10 2.7. Gene Identifications by Mode of Inheritance

The pie chart in Figure 2.2 below demonstrates that a majority of the genes identified in primary immunodeficiency show an autosomal-recessive pattern of inheritance.

Figure 2.2: Inheritance patterns of identified PID genes.

Legend: AR: autosomal-recessive inheritance, AD: autosomal dominant, and XL :X-linked inheritance.

Search of the curated database OMIM in October 2011 identified 3,692 entries with the term "autosomal dominant", 3,708 entries for "autosomal recessive" and 1,364 entries for the term "X-linked". When compared with the values derived for PID genes given in Figure 2.2, a Chi-squared analysis yielded a χ2 of 81.9 with 2 degrees of freedom, corresponding to a p-value <0.0001. The differences are driven by the greater proportion of autosomal recessive disease in primary immunodeficiency and correspondingly less autosomal dominant disease, which is clearly not representative of typical patterns of inheritance of human genetic disease. The observed differences may be due to the biology of PID which is predominantly one of loss of immune function - with loss of function being the major correlate of autosomal recessive disease. Alternatively the differences may be a methodological artefact of the high frequency of disorders identified by homozygosity mapping approaches, which

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 11 require an autosomal recessive pattern of inheritance, and of functional assays that may be only sensitive enough to detect presence or absence of a signal. The most likely explanation is that both of these contribute to the high frequency of AR disease genes that have been identified in PID.

2.8. Number of patients utilised in different gene identification approaches

It would be expected that the number of patients that were used in each successful gene identification study would vary to suit the requirements of each methodology. This is shown graphically in the box and whisker plot in Figure 2.3 below. The ‘box’ shows the first and third quartiles and the median, and the whiskers represent the range of each methodological category (the vertical axis is restricted to better highlight the centre quartiles).

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 12 Figure 2.3: Number of affected individuals used in successful gene identification study methodologies.

173 173 1282

Legend: FUNC: functional candidate, LINK: linkage analysis, PHEN: phenotypic candidate, WGS: whole-genome screen. The box indicates the median and the first and third quartiles, and the whiskers indicate the range.

A single factor ANOVA gives a p<0.0005, which confirms there is a difference in the number of affected individuals that are used in each successful study methodology. Comparing each dataset pairwise using t-tests indicates that the median number of affected individuals in functional approaches (2) is significantly lower than linkage approaches (6; p<0.035) and screening approaches (20; p<0.0003), and the number of individuals is also significantly lower in linkage approaches compared to screening approaches (p<0.003). Whole genome screening approaches do not show a significant difference in the sample numbers reported when compared with functional, linkage or screening approaches, although this could be explained by the low number of publications. It could be predicted that over a long enough timescale, whole-genome screens typically only need to study a single affected individual.

On the data analysed, it is clear that functional approaches report the lowest number of affected individuals, followed by linkage approaches, with screening approaches reporting the most affected individuals in the identification of the gene responsible.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 13 While the sample numbers are quite variable, and each of the datasets contains a number of outliers, this result could be taken as a broad indication of the minimum number of patients that would be required for a successful gene identification study using each of the general approaches described. However, this should not be taken as a reflection of the true minimum number of patients required, since for relatively common diseases there may be no opportunity cost to including a larger number of affected individuals in a study.

2.9. Gene identification methods over time

The pie chart in Figure 2.1 shows the total number of gene identification papers that have utilised various methods. However, this survey encompasses over 40 years of research, and the use of these gene identification methodologies has varied over time. Figure 2.4 (below) displays these gene identification studies plotted against the year of publication.

Figure 2.4: Primary immunodeficiency gene identification studies published from 1985 to 2011.

Legend: WGS: whole-genome screen, LINK: linkage analysis, PHEN: phenotypic candidate, FUNC: functional candidate.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 14 Figure 2.4 demonstrates that the number of published gene identification studies increased steadily through the 1990s, reaching an apparent plateau since 1998. This could be attributed to the competing effects of the reduction in the number of ‘easy’ gene identifications (common disorders or the ‘low hanging fruit’ where the biology suggests the genetic cause), and the effects of the Human Genome project (which was published in draft form in 2001 (Lander et al. 2001; Venter et al. 2001)) making linkage and sequencing of genes more accessible to research laboratories. This would appear to be borne out by the reduction in studies utilising functional candidate approaches, and the slight growth of linkage approaches. This is better illustrated in Figure 2.5 below.

Figure 2.5: Proportion of successful gene identification studies that utilised each of the approaches to gene identification.

Legend: WGS: whole-genome screen, LINK: linkage, PHEN: phenotypic candidate, FUNC: functional candidate.

The stacked bar chart in Figure 2.5 (above) makes it apparent that from 1994, although linkage mapping approaches have made up approximately one quarter to one third of successful gene identification studies, there is no indication that this proportion is increasing over time. Although decreasing in number with time, functional approaches remain a large contributor to successful gene identification in PID, likely reflecting the very detailed level of knowledge available for immune

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 15 pathophysiology, and the ready availability of animal models compared with other biological systems. Screening approaches are not a common method of gene identification, and are seen at a relatively constant rate of around 10% of successful studies - often lagging behind previous successful studies that identify the genetic basis of similar diseases.

2.10. Functional candidate methods

As noted above, Functional candidate approaches have played a major role in immunological disease gene identification. The breakdown of each of these methodologies is illustrated in Figure 2.6 below.

Figure 2.6: Functional candidate approaches in gene identification studies from 1985-2011.

Legend: RNA: expression analysis, PAN: pathway analysis, ANI: animal models, BIO: biochemical assay, CSA: cell surface antigens.

In the early years of PID gene identification, the predominant functional candidate approaches were the identification of disease genes by changes in cell surface antigen expression (CSA) and biochemical functional assays (BIO). These

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 16 approaches make up a smaller proportion of the gene identification methodologies utilised over time, possibly as a result of the more easily detectable causes of dysfunction being identified. Conversely, pathway analysis (PAN) approaches are an increasingly successful approach - as knowledge of the biological basis of primary immunodeficiency syndromes increases and the role of systems biology gains increasing prominence, so too does the opportunity to examine biological pathways. Figure 2.7 below illustrates the number of affected individuals that are reported in gene identification studies that utilise each of the experimental methodologies. A single factor ANOVA confirms that there is no significant difference between the functional candidate methods (p<0.19). Each of these approaches is described in more detail in the sections below.

Figure 2.7: Number of individuals studied in Functional candidate approaches.

41 96 173

Legend: CSA: cell surface antigens, BIO: biochemical assay, ANI: animal models, PAN: pathway analysis, RNA: expression analysis. The box indicates the median and the first and third quartiles, and the whiskers indicate the range.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 17 2.10.1. Cell-surface antigen expression

Figure 2.8 below displays how cell surface antigens were used together with other gene identification methodologies for successful gene identification. This method was utilised in the discovery of genetic mutations in 22 genes: CD19 (van Zelm et al. 2006) , CD247 (Rieux-Laucat et al. 2006), CD3E (Soudais et al. 1993), CD3G (Arnaizvillena et al. 1992), CD40 (Ferrari et al. 2001), CD40LG (Aruffo et al. 1993), CD55 (Lublin et al. 1994) , CD59 (Motoyama et al. 1992) , CD81 (van Zelm et al. 2010) , CD8A (de la Calle-Martin et al. 2001), FCGR1A (Vandewinkel et al. 1995) , FCGR3A (deVries et al. 1996) , ICOS (Grimbacher et al. 2003) , IL2RA (Sharfe et al. 1997), IRAK4 (Picard et al. 2003) , ITGB2 (Arnaout et al. 1990), MS4A1 (Kuijpers et al. 2010), PIGA (Bessler et al. 1994), PTPRC (Kung et al. 2000), TNFRSF13C (Warnatz et al. 2009), TRAC (Morgan et al. 2011), and ZAP70 (Arpaia et al. 1994).

Figure 2.8: Gene identification strategies used in combination with cell surface antigen expression.

Legend: CSA: cell surface antigens, BIO: biochemical assay, ANI: animal models, PAN: pathway analysis, RNA: expression analysis, SCR: screening method, LIN: linkage analysis, HOM: homozygosity mapping, NGS: whole genome/exome sequencing, CGH: CGH microarray.

Of these 22 studies, 9 directly identified the gene that was affected through alterations in the expression of the corresponding cell surface antigen. The

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 18 identification of the genetic lesion in leukocyte adhesion deficiency (LAD) is a typical example of such a study. The defective expression in LAD was first characterised by Trowbridge et al. in 1981, who detected a deficiency in the expression of three glycoprotein heterodimers (CD11a/CD18, CD11b/CD18, CD11c/CD18) on the leukocyte cell surface of patients with the disease. Dana et al. (1987) revealed that the defective cell surface expression was secondary to heterogenous defects in the common CD18 subunit. In order to discover the mutant CD18 alleles, Arnaout et al. (1990) constructed a cDNA library from EBV-transformed cells of a LAD patient, and probed with a 2.7 kb CD18-specific probe, which identified ITGB2 . Gene identification studies utilising cell surface antigen expression are all characterised by low numbers of affected patients, and in this study only a single affected person was examined.

In addition to the direct use of cell surface antigens to suggest candidate gene analysis, 5 studies combined this experimental approach with an examination of the biochemical pathways of aberrantly expressed cell surface antigens. CD25 deficiency is an example of this combination of methodologies. Sharfe et al. (1997) describe a male patient of consanguineous parents, who presented with susceptibility to viral, bacterial and fungal infections. Analysis of cell surface antigen expression indicated the absence of CD1 expression on thymus sections, in the context of normal CD3, CD2, CD8, CD4, and MHC class 1 and 2 expression. Sequencing of the CD1a cDNA did not reveal any mutations. It was therefore hypothesised that a defect in the IL2 signalling pathway affected CD1 induction, and flow cytometry showed that IL2-Rα (CD25) was not detected on patient BLCLs. cDNA was sequenced, and this showed a homozygous 4bp deletion in the IL2RA gene.

2.10.2. Biochemical functional analysis

Figure 2.9 below shows how biochemical function analysis was used in successful gene identification studies. These data illustrate that biochemical analysis is a gene identification strategy that is often successful as a standalone approach. Biochemical function analysis was utilised in 65 of the gene identification studies: ADA (Valerio et al. 1986), APOL1 (Vanhollebeke et al. 2006) , C1QA (Petry et al. 1995) , C1QB (McAdam et al. 1988) , C1QC (Slingsby et al. 1996) , C2 (Johnson et al. 1992) , C3

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 19 (Huang and Lin 1994) , C4B (Lokki et al. 1999) , C5 (Wang et al. 1995) , C6 (Nishizaka et al. 1996a) , C7 (Nishizaka et al. 1996b) , C8A (Kojima et al. 1998) , C8B (Kaufmann et al. 1993) , C9 (WitzelSchlomp et al. 1997) , CASP8 (Chun et al. 2002) , CD247 (Rieux-Laucat et al. 2006), CD3G (Arnaizvillena et al. 1992) , CFD (Biesma et al. 2001) , CFH (Warwicker et al. 1998) , CFI (Vyse et al. 1996) , CFP (Westberg et al. 1995) , CIITA (Steimle et al. 1993), CLEC7A (Ferwerda et al. 2009) , CSF3R (Dong et al. 1994) , DCLRE1C (Moshous et al. 2001), FPR1 (Zhang et al. 2010) , G6PC (Lei et al. 1993) , G6PD (Vulliamy et al. 1988) , IFNGR2 (Dorman and Holland 1998) , IGHA1 (Terada et al. 2001) , IGHE (Terada et al. 2001) , IGHG2 (Tashita et al. 1998), IGHG4 (Terada et al. 2001) , IGKC (Milstein et al. 1974) , IL1RN (Aksentijevich et al. 2009) , IRF8 (Hambleton et al. 2011) , LCK (Goldman et al. 1998), LIG1 (Barnes et al. 1992), LIG4 (O'Driscoll et al. 2001), MASP2 (Stengaard-Pedersen et al. 2003) , MBL2 (Summerfield et al. 1995) , MPO (Nauseef et al. 1994) , MVK (Drenth et al. 1999; Houten et al. 1999) , NCF1 (Casimir et al. 1991) , NCF2 (Nunoi et al. 1995) , NCF4 (Matute et al. 2009) , NFKBIA (Courtois et al. 2003) , NHEJ1 (Buck et al. 2006), NRAS (Oliveira et al. 2007) , ORAI1 (Feske et al. 2006), PMS2 (Miyaki et al. 1997) , PNP (Williams et al. 1987) , PRKDC (van der Burg et al. 2009) , RAC2 (Ambruso et al. 2000) , RASGRP2 (Pasvolsky et al. 2007) , RFX5 (Villard et al. 1997) , SERPING1 (Zahedi et al. 1995) , SLC35C1 (Luhn et al. 2001) , SLC37A4 (Gerin et al. 1997; Veiga-da-Cunha et al. 1998) , STAT1 (Dupuis et al. 2001; van de Veerdonk et al. 2011) , TAP2 (Delasalle et al. 1994) , TNFRSF1A (McDermott et al. 1999) , and TYK2 (Minegishi et al. 2006) .

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 20 Figure 2.9: Gene identification strategies used in combination with biochemical functional analysis.

ADA deficiency is one of the earliest identified causes of severe combined immunodeficiency. The aberrant enzyme activity was first described by Giblett et al. (1972), however it was not until 1986 that the genetic basis was discovered. Valerio et al. determined the genetic locus of ADA, and noted that although the levels of ADA mRNA were normal in ADA-deficient SCID patients, ADA protein was absent or severely reduced. In order to determine the precise genetic lesion a cDNA library was constructed from an ADA-deficient patient, and probed using a probe constructed from a normal ADA cDNA. Positive clones were sequenced, revealing compound heterozygous mutations.

The biochemical analysis approach also combined with an analysis of affected biological pathways in 12 studies. An example of this is in the identification of ZAP70 as the gene involved in a variety of severe combined immunodeficiency. In 3 families with selective T cell deficient (STD) patients, Arpaia et al. (1994) observed a characteristic T cell deficient immunophenotype that allowed for a precise estimate of

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 21 the biochemical step being affected. The earliest biochemical event following stimulation of the T cell receptor is the activation of the protein tyrosine kinases: FYN, LCK, and ZAP70. As such, these three genes were screened in 3 patients and their families. In each of the patients, a homozygous splicing defect in ZAP70 was discovered, which led to an abnormal ZAP70 protein containing a 3 residue insertion.

2.10.3. Animal models

Figure 2.10 below demonstrates that unlike the cell surface antigen and biochemical function gene identification strategies which were frequently performed as standalone techniques, Animal models were quite regularly utilised in conjunction with other methodologies in successful gene identification studies. Model organisms were used to identify candidate genes in 30 studies: CARD9 (Glocker et al. 2009a), CD79B (Dobbs et al. 2007; Ferrari et al. 2007), CEBPE (Lekstrom-Himes et al. 1999) , CORO1A (Shiow et al. 2008), FAS (Fisher et al. 1995), FERMT3 (Svensson et al. 2009), FOXN1 (Frank et al. 1999), FOXP3 (Wildin et al. 2001), G6PC (Lei et al. 1993), GFI1 (Person et al. 2003), IGAD1 (Sekine et al. 2007), IKZF1 (Sun et al. 1999), IL7R (Puel et al. 1998), IRF8 (Hambleton et al. 2011), LYST (Nagle et al. 1996), MLPH (Menasche et al. 2003), MYO5A (Pastural et al. 1997), PIK3CD (Jou et al. 2006), PMS2 (Miyaki et al. 1997), PTPRC (Kung et al. 2000), RAG1 (Schwarz et al. 1996), RAG2 (Schwarz et al. 1996), TCIRG1 (Frattini et al. 2000), TNFRSF13B (Castigli et al. 2005; Salzer et al. 2005), TREX1 (Crow et al. 2006a), UNC93B1 (Casrouge et al. 2006), and UNG (Imai et al. 2003).

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 22 Figure 2.10: Gene identification strategies used in combination with animal model studies.

In each of the 5 studies that only used an animal model in the gene discovery process, the human genetic mutation was discovered by examining the human homologue of a known mouse disease gene. A typical example of this is with the discovery of the genetic basis of Chediak-Higashi syndrome (CHS). This study examined 3 patients, 1 from a consanguineous family. CHS is characterised by hypopigmentation, severe immunologic deficiency with neutropenia, and a lack of natural killer cells. The hallmark of this condition is the occurrence of giant inclusion bodies and organelles in a variety of cell types, which are also detected in the beige mouse. The similarity of the mouse and human phenotypes prompted further study, and a human cDNA library was probed with mouse beige probes in order to isolate the human homologue. An 11.4 kb open reading frame that shared 77.2% nucleotide identity was isolated, which encodes LYST , and mutation screening of this gene in the 3 patients with CHS revealed 3 separate mutations.

In 10 cases, the discovery of a genetic lesion in a mouse model was combined with a screening approach in similar PIDs. An example of this is the discovery of the genetic

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 23 basis of coronin-1A deficiency by Shiow et al. (2008). Ptcd mice have a block in thymic egress that leads to peripheral T cell deficiency. Shiow et al. identified the genetic basis of the Ptcd phenotype – mutations in the CORO1A gene. This led the authors to screen 16 SCID patients for mutations in the human homologue of the gene . A single patient from a non-consanguineous family was identified with a heterozygous 2 bp deletion in CORO1A exon 3 on one allele, and a de novo 600Kb deletion encompassing CORO1A and 24 other genes on the other.

2.10.4. Pathway analysis

The use of pathway analysis to identify potential candidate genes has also been quite a successful strategy, either as a standalone test, or in combination with a screening approach. This method of candidate gene identification has been used in 64 gene identification studies: ACTB (Nunoi et al. 1999), BLNK (Minegishi et al. 1999b), C1QC (Slingsby et al. 1996), C3 (Fremeaux-Bacchi et al. 2008), C4BPA (Blom et al. 2008), CASP10 (Wang et al. 1999), CD46 (Noris et al. 2003), CD79A (Minegishi et al. 1999a), CD79B (Dobbs et al. 2007; Ferrari et al. 2007), CD81 (van Zelm et al. 2010), CFB (de Jorge et al. 2007), CFHR1 (Hughes et al. 2006), CFHR3 (Hughes et al. 2006), CFHR5 (Maga et al. 2010), CFI (Fremeaux-Bacchi et al. 2004), CSF2RA (Martinez-Moczygemba et al. 2008), CYBA (Dinauer et al. 1990), F12 (Dewald and Bork 2006), FASLG (Wu et al. 1996), FCN3 (Munthe-Fog et al. 2009), GATA2 (Hsu et al. 2011), IFNGR1 (Jouanguy et al. 1996), IGLL1 (Minegishi et al. 1998), IL12B (Altare et al. 1998a), IL12RB1 (Altare et al. 1998a), IL1RN (Aksentijevich et al. 2009), IL2RA (Sharfe et al. 1997), IRAK4 (Picard et al. 2003), IRF8 (Hambleton et al. 2011), JAK3 (Macchi et al. 1995), MLPH (Menasche et al. 2003) , MRE11A (Stewart et al. 1999), MYD88 (von Bernuth et al. 2008), NCF4 (Matute et al. 2009), NFKBIA (Courtois et al. 2003), NLRP12 (Jeru et al. 2008), PIGA (Bessler et al. 1994), PNP (Williams et al. 1987), PRKDC (van der Burg et al. 2009), RAG1 (Schwarz et al. 1996), RAG2 (Schwarz et al. 1996), RFX5 (Villard et al. 1997), RFXANK (Masternak et al. 1998), RFXAP (Durand et al. 1997), RNASEH2C (Crow et al. 2006b), SLC37A4 (Gerin et al. 1997), STAT1 (Dupuis et al. 2001; Dupuis et al. 2003; Liu et al. 2011; van de Veerdonk et al. 2011), STAT3 (Minegishi et al. 2007),

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 24 STAT5B (Kofoed et al. 2003), STIM1 (Picard et al. 2009), TAP1 (Furukawa et al. 1999), TAPBP (Yabe et al. 2002), THBD (Delvaeye et al. 2009), TLR3 (Zhang et al. 2007), TNFRSF11A (Guerrini et al. 2008), TNFRSF13B (Castigli et al. 2005; Salzer et al. 2005), TNFRSF13C (Warnatz et al. 2009), TRAF3 (de Diego et al. 2010), and ZAP70 (Arpaia et al. 1994).

Figure 2.11: Gene identification strategies used in combination with biological pathway analysis.

Pathway analysis is one of the most commonly utilised single techniques for the discovery of genetic mutations. As shown in Figure 2.11 above, in 20 studies no other experimental approach was used in the identification of the disease gene. The success of this methodology is dependent on the investigator’s knowledge of the affected biological pathway, and on the ability to determine the pathway that is being affected.

It is somewhat misleading to state that 20 gene identification studies used pathway analysis alone - pathway analysis as an experimental approach can only be used where there is a priori evidence of an affected pathway. Rather, these gene

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 25 identifications represent research where non-experimental approaches, such as clinical phenotyping, were used to identify an affected pathway. One example of this is the mapping of the JAK3 protein kinase (Macchi et al. 1995). JAK3 is part of the signalling pathway critical to early T-cell development, which contains the IL-2 receptor - at the time the only reported SCID gene. JAK3 was therefore investigated as a candidate gene in two consanguineous T-cell negative SCID families that were negative for mutations in the γ-chain sequence, and both showed homozygous mutations.

The affected pathway can sometimes be discovered by phenotypic assessment. However, as Figure 2.11 above illustrates, this is commonly determined using a biological assay or an animal model. The gene identification studies that identified IRF8 mutations (Hambleton et al. 2011) as a cause of Dendritic cell immunodeficiency combined pathway analysis with cell surface antigen, biochemical analysis and animal models, demonstrating how multiple lines of evidence can be utilised in gene identification. Hambleton et al. identified that disseminated mycobacterial infection after vaccination with Bacille Calmette-Guérin (BCG) in a patient was a sign of immunodeficiency. The authors assayed whole blood from this individual to demonstrate that after treatment with BCG, phytohemagglutinin and lipopolysaccharide, the production of interleukin-12 was absent and interferon-γ was poor. Flow cytometry confirmed that the infant had a profound deficit of dendritic cells and a high neutrophil count. It was noted that this combination of immunodeficiency, dendritic cell deficiency and myeloproliferation resembled the IRF8-null mouse phenotype, and that IRF8 was one of the genes that were essential to the development pathway of mononuclear phagocytes. Sequencing of the IRF8 gene revealed both autosomal recessive and autosomal dominant mutations.

2.10.5. mRNA expression analysis

The analysis of mRNA for gene identification has a long history in immunology being the technique used in a series of classic studies for the identification of the T cell antigen receptor. It is therefore not unexpected that this technique should have been adapted for the identification of disease genes as shown in Figure 2.12. This methodology has been used in 11 studies: AK2 (Pannicke et al. 2009), C1S (Inoue et

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 26 al. 1998), C4A (Barba et al. 1993), CD3D (Dadi et al. 2003), CD3E (Soudais et al. 1993), IL7R (Puel et al. 1998), NRAS (Oliveira et al. 2007), RASGRP2 (Pasvolsky et al. 2007), RNF168 (Stewart et al. 2009), ROBLD3 (Bohn et al. 2007), and TCN2 (Li et al. 1994).

Figure 2.12: Gene identification strategies used in combination with expression analysis studies.

In the gene identification study by Bohn et al. (2007), the use of gene expression analysis was combined with a linkage mapping approach, and was a vital step in the identification of the genetic mutation in ROBLD3 deficiency. In this study, 4 individuals from a single Mennonite family with an autosomal recessive form of immunodeficiency were analysed. A genome-wide linkage screen with 188 autosomal microsatellite markers was performed, but it was underpowered. Multipoint analysis mapped the disease gene to a region on chromosome 1 that contained 192 known or predicted genes. Initial candidate gene sequencing proved fruitless, and so BLCL expression profiling was used to identify likely candidates. ROBLD3 was the only gene in the critical region that demonstrated underexpression by a factor greater

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 27 than 2. No coding mutations could be identified, but a variant detected in the 3' untranslated region in exon 4 (A>C at the +23 position) segregated perfectly with the disease, and was not detected in 100 European alleles or 34 Mennonite alleles. This study also illustrates that one of the benefits of an mRNA expression analysis approach is that it readily identifies mutations that affect mRNA splicing or stability, which may be overlooked in contemporary genetic screening approaches that are based on exomes, although this might be alleviated by utilising transcriptome sequencing.

Positional candidates

The positional candidate methodologies, taken as a whole, were employed in more successful gene identification studies than the individual functional candidate strategies. Linkage mapping has been utilised in 57 successful gene identification publications, and homozygosity mapping has been used in 33, as shown in Figure 2.13 below.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 28 Figure 2.13: Positional candidate approaches in gene identification studies from 1986-2011.

Legend: LIN: linkage analysis, HOM: homozygosity mapping.

Unlike functional candidate approaches (see Figure 2.7), the different positional candidate approaches do require significantly different numbers of affected individuals for gene identification, as illustrated in Figure 2.14 below.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 29 Figure 2.14: Number of individuals studied in Positional candidate approaches.

173

Legend: The box indicates the median and the first and third quartiles, and the whiskers indicate the range.

Figure 2.14 was constructed using studies that used either homozygosity mapping or linkage mapping, not those studies where both techniques were used. The median number of affected individuals studied in the linkage studies (7) is significantly higher than the number used in homozygosity mapping studies (4), p<0.02. This property is one of the stated advantages of homozygosity mapping as a technique.

2.10.6. Linkage mapping

The Figure 2.15 below shows that linkage studies are rarely used in combination with approaches other than homozygosity mapping, and are most often the sole methodology utilised in a gene identification study, perhaps reflecting that it is frequently the approach of last resort when other biological clues are absent. Linkage mapping approaches have been used in 57 successful gene identification studies to date: AIRE (Nagamine et al. 1997), AK2 (Lagresle-Peyrou et al. 2009), ATM

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 30 (Savitsky et al. 1995), BLM (Ellis et al. 1995), BTK (Duriez et al. 1994; Vetrie et al. 1993), C1QB (McAdam et al. 1988), C4BPA (Blom et al. 2008), CFH (Warwicker et al. 1998), CFHR1 (Hughes et al. 2006), CFHR3 (Hughes et al. 2006), CFHR5 (Gale et al. 2010), CTSC (Toomes et al. 1999), CXCR4 (Hernandez et al. 2003), CYBA (Dinauer et al. 1990), CYBB (Royerpokora et al. 1986), DCLRE1C (Moshous et al. 2001), DKC1 (Heiss et al. 1998), ELANE (Horwitz et al. 1999), ELF4 (Stewart et al. 2008), FOXN1 (Frank et al. 1999), FOXP3 (Wildin et al. 2001), G6PC3 (Boztug et al. 2009), ICOS (Grimbacher et al. 2003), IGHM (Yel et al. 1996), IL2RG (Schmalstieg et al. 1995), LRRC8A (Sawada et al. 2003), MEFV (Bernot et al. 1997); (Aksentijevich et al. 1997), MVK (Drenth et al. 1999; Houten et al. 1999), MYO5A (Pastural et al. 1997), NBN (Matsuura et al. 1998; Varon et al. 1998), NLRP3 (Feldmann et al. 2002), NOD2 (Hampe et al. 2001; Hugot et al. 2001; Miceli-Richard et al. 2001; Ogura et al. 2001), ORAI1 (Feske et al. 2006), PRF1 (Stepp et al. 1999), PSTPIP1 (Wise et al. 2002), RAB27A (Menasche et al. 2000), RMRP (Ridanpaa et al. 2001), SAMHD1 (Rice et al. 2009), SBDS (Boocock et al. 2003), SH2D1A (Coffey et al. 1998), SPINK5 (Chavanas et al. 2000), TAZ (Bione et al. 1996), TBX1 (Yagi et al. 2003), TCIRG1 (Frattini et al. 2000; Kornak et al. 2000), TMC6 (Ramoz et al. 2002), TMC8 (Ramoz et al. 2002), TNFRSF1A (McDermott et al. 1999), TREX1 (Crow et al. 2006a), WAS (Derry et al. 1994; Devriendt et al. 2001; Villa et al. 1995), and XIAP (Rigaud et al. 2006).

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 31 Figure 2.15: Gene identification strategies used in combination with linkage analysis.

Linkage studies are a powerful tool for hypothesis-free determination of the genetic basis of disease. There need be no previous knowledge of the biological parameters of the condition, although there needs to be a clear disease phenotype. Linkage is a method that evaluates the position of genetic markers relative to each other on the basis of the frequency of recombination between them – the lower the observed frequency of recombination, the smaller the physical distance. This recombination frequency can be estimated by the LOD score method (Morton 1955), which compares the likelihood that two loci co-segregate due to linkage, to the likelihood that these loci co-segregate by chance. A LOD score of greater than 3 is widely considered as significant evidence of linkage, and implies 1000 to 1 odds that observed linkage occurs by chance. As a rule of thumb, an informative meiosis can increase the LOD score by about 0.3, so 10 informative events are required to reach a LOD score of greater than 3 in a single family. As such, these studies do require large cohorts of patients, and often several affected families.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 32 Linkage has been the sole experimental approach in 28 studies, and has been used in combination with homozygosity mapping in 10 studies. It has only been infrequently used in combination with functional or phenotypical candidate gene selection approaches. Technological advances such as STR multiplexing and SNP microarray have made linkage studies easier to achieve technically, however the requirement for large cohorts of patients will remain the biggest drawback in these studies.

The technique that is most often used in combination with linkage mapping is the homozygosity mapping of consanguineous patients. This occurs in 10 gene identification studies that utilise homozygosity mapping, and is usually used to combine data from consanguineous and non-consanguineous patients with the same condition. One such example of the use homozygosity mapping is in the identification of UNC13D mutations in familial hemophagic lymphohistiocytosis type 3 (FHL3) by Feldmann et al. (2003). This method examined 8 patients from 6 consanguineous families of Moroccan, Pakistani, and French origin, and 2 patients from a non- consanguineous French family. A 5 cM genome wide microsatellite screen was used in the consanguineous families, and a marker on chromosome 17 was homozygous in all 8 affected individuals. The same microsatellite markers were used in the non- consanguineous family, and bi-point linkage gave a LOD score of 8.07 for the marker on chromosome 17. Fine mapping and haplotype analysis defined this region between the markers D17S1351 and D17S836. Feldmann et al. systematically examined candidate genes in this interval based on their pattern of expression and function in cytotoxic cells. The same 12 bp deletion was detected in the 4 patients of Moroccan origin, indicating that this is likely an ancestral mutation. The French and Pakistani families each had different homozygous mutations. The non- consanguineous patients were all compound heterozygotes for mutations in this gene.

2.10.7. Homozygosity mapping

The Figure 2.16 below shows that, like linkage mapping, homozygosity mapping has been used sporadically with other gene identification strategies, but is primarily either

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 33 the sole approach or combined with linkage mapping. Homozygosity mapping was involved in the successful gene identification of 32 genes in primary immunodeficiency conditions: AICDA (Revy et al. 2000), AK2 (Pannicke et al. 2009), BLM (Ellis et al. 1995), CARD9 (Glocker et al. 2009a), CTSC (Toomes et al. 1999), CXCR4 (Hernandez et al. 2003), DNMT3B (Xu et al. 1999), FADD (Bolze et al. 2010), FERMT3 (Kuijpers et al. 2009; Malinin et al. 2009; Svensson et al. 2009), HAX1 (Klein et al. 2007), IFNGR1 (Jouanguy et al. 1996; Newport et al. 1996), IL10RA (Glocker et al. 2009b), IL10RB (Glocker et al. 2009b), ITK (Huck et al. 2009), LPIN2 (Ferguson et al. 2005), MYO5A (Pastural et al. 1997), RAB27A (Menasche et al. 2000), RNASEH2A (Crow et al. 2006b), RNASEH2B (Crow et al. 2006b), RNASEH2C (Crow et al. 2006b), ROBLD3 (Bohn et al. 2007), SAMHD1 (Rice et al. 2009), SMARCAL1 (Boerkoel et al. 2002), SP110 (Roscioli et al. 2006), SPINK5 (Chavanas et al. 2000), STX11 (zur Stadt et al. 2005), STXBP2 (zur Stadt et al. 2009), TMC6 (Ramoz et al. 2002), TMC8 (Ramoz et al. 2002), TRAC (Morgan et al. 2011), TTC37 (Hartley et al. 2010), UNC13D (Feldmann et al. 2003), and ZBTB24 (de Greef et al. 2011).

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 34 Figure 2.16: Gene identification strategies used with Homozygosity mapping

Homozygosity mapping is a form of linkage that was first proposed by Lander and Botstein in 1987 to identify the basis of homozygous genetic disease in children of consanguineous parents. In these studies, homozygosity of the disease gene locus can be used as a marker for the disease, and the co-occurrence of homozygosity for a particular region in multiple affected individuals is strong evidence of linkage. This approach avoids some of the downfalls of standard linkage mapping, particularly the requirement for large, multiple generation pedigrees. As mentioned in the previous section 2.10.6, homozygosity mapping is frequently combined with linkage mapping, and has been used in combination with functional candidate selection approaches in only a handful of studies.

In 15 studies, homozygosity mapping was the only experimental approach used to identify the genetic basis. The first example of this was in the identification of the DNMT3B gene involved in immunodeficiency with centromeric instability and facial anomalies (ICF). Xu et al. (1999) performed homozygosity mapping of five affected

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 35 individuals from three consanguineous families, and identified a region on 20q11-13. This region contained DNMT3B , which was chosen as a candidate gene, and mutations were identified in each of the patients studied.

Of particular interest recently, homozygosity mapping has been used in combination with whole-exome sequencing screens, one of which also looked at ICF. Approximately half of patients with autosomal recessive ICF do not have mutations in the identified DNMT3B gene. To elucidate the genetic basis of ICF in these individuals, de Greef et al. performed a homozygosity mapping study on five unrelated ICF2 patients born to consanguineous patients, using a Sentrix HumanHap-300 Genotyping BeadChip. Unfortunately, no region of homozygosity was shared by all patients. To further this study, the authors undertook a whole exome screen of one of the patients using the Sequence Capture Human Exome 2.1M Array (Roche NimbleGen), and analysed on the Illumina Genome Analyser IIx system. In one of the homozygous regions that had been detected in four of the five patients, a homozygous sequence variant was detected in the ZBTB24 gene. This result was confirmed using Sanger sequencing, and different mutations were identified in five of eleven affected individuals – which indicates further genetic heterogeneity within ICF.

2.11. Phenotypic candidates

The phenotypic candidate method is slightly different to each of the preceding approaches, in that it is not a direct experimental approach – in many ways it is a process of elimination. As described in the section 2.8 above, the downside to this methodology is the increased number of affected individuals that must be ascertained for a successful gene identification to be published. The successful gene identification publications over time are shown in Figure 2.6 below, and this illustrates that there has been no increase in the success of this approach since the first successful study.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 36 Figure 2.6: Phenotypic candidate approaches in gene identification studies from 1986-2011.

Legend: SCR: screening method

Phenotypic candidate approaches have been used in 45 successful gene identification studies: BLNK (Minegishi et al. 1999b), BTK (Duriez et al. 1994), C3 (Fremeaux-Bacchi et al. 2008), C4BPA (Blom et al. 2008), CD40LG (Aruffo et al. 1993), CD46 (Noris et al. 2003), CD79A (Minegishi et al. 1999a), CD79B (Dobbs et al. 2007; Ferrari et al. 2007), CFB (de Jorge et al. 2007), CFHR5 (Maga et al. 2010), CFI (Fremeaux-Bacchi et al. 2004), CORO1A (Shiow et al. 2008), DKC1 (Yaghmai et al. 2000), ELANE (Dale et al. 2000), F12 (Dewald and Bork 2006), FASLG (Wu et al. 1996), FCN3 (Munthe-Fog et al. 2009), FPR1 (Gwinn et al. 1999), GATA2 (Hsu et al. 2011), GFI1 (Person et al. 2003), IGAD1 (Sekine et al. 2007) , IGLL1 (Minegishi et al. 1998), IKBKG (Doffinger et al. 2001; Filipe-Santos et al. 2006; Orange et al. 2004; Zonana et al. 2000), IKZF1 (Sun et al. 1999), LIG4 (O'Driscoll et al. 2001), NLRP3 (Feldmann et al. 2002), NOD2 (Hampe et al. 2001; Hugot et al. 2001; Ogura et al. 2001), PIK3CD (Jou et al. 2006), RAG1 (Schwarz et al. 1996; Villa et al. 1998), RAG2 (Schwarz et al. 1996; Villa et al. 1998), RECQL4 (Kitao et al. 1999), SLC46A1 (Qiu et al. 2006), THBD (Delvaeye et al. 2009), TNFRSF13B (Castigli et al. 2005;

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 37 Salzer et al. 2005), TREX1 (Crow et al. 2006a), WAS (Derry et al. 1994; Villa et al. 1995).

Figure 2.17: Gene identification strategies used with Phenotypic screening approaches

Figure 2.17 above clearly illustrates that screening methods are overwhelmingly combined with pathway analysis strategies, and also combined well with animal model studies. In 9 gene identification studies, screening was successfully used as the ‘sole’ gene identification strategy – although as with pathway analysis as a sole gene identification strategy, this generally means that a clinical analysis was undertaken rather than using an experimental process, such as with the identification of the WASP gene in X-linked thrombocytopenia (XLT) by Villa et al. (1995). The relationship between Wiskott-Aldrich syndrome and XLT had long been debated. The discovery of mutations in WAS in Wiskott-Aldrich syndrome by Derry et al. (1994) allowed Villa et al to screen 3 unrelated patients with XLT for mutations in the WAS gene, which revealed a different mutation in each patient.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 38 Screening approaches have also been combined with a pathway analysis approach in 21 gene identification studies. These two approaches can work together successfully, as illustrated by the identification of the FASLG gene as the basis of autoimmune lymphoproliferative syndrome (ALS) type 1B. Wu et al. (1996) noted that the genetic basis of ALS type 1A had been identified by Fisher et al. (1995) – the FAS gene. Wu et al. recognised that the FASLG gene was a strong candidate for ALS patients that were mutation negative for FAS . A screening study of 75 patients identified a single patient with a mutation in the FASLG gene.

More so than other approaches, it is expected that this approach would be affected by a large ascertainment bias in the published literature - an unsuccessful screening study does not represent an interesting topic for publication, and the results of a negative study do not directly lead to further studies. However, this might be offset by the relative ease of screening for mutations within a known candidate gene, in a disease with a similar phenotype. So while this approach may be high-risk – in that a negative result is unlikely to be publishable, the low likelihood of a successful study is outweighed the by modest costs involved.

2.12. Whole genome screening methods

Whole genome approaches have been used on 7 occasions, with 3 involving CGH: CHD7 (Vissers et al. 2004), DOCK8 (Zhang et al. 2009), and IL1RN (Reddy et al. 2009); and 4 studies that used whole-exome sequencing: FADD (Bolze et al. 2010), GATA2 (Dickinson et al. 2011), STAT1 (Liu et al. 2011), and ZBTB24 (de Greef et al. 2011).

Comparative genomic hybridization arrays are a relatively inexpensive and readily accessible way to interrogate a syndrome – particularly one that is apparently sporadic. However, given this advantage, the relative rarity of CGH papers may indicate that the outright success of this method is rare for gene identification in primary immunodeficiency syndromes. Although this technique is theoretically biased towards the more easily detectable large copy number variations, which may contain

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 39 many genes, in fact this was not observed in this literature survey of primary immunodeficiency syndromes. One study that was successful was the identification of DOCK8 mutations in patients with a combined immunodeficiency syndrome. Patients from 8 families were studied using 244K Agilent CGH arrays, and homozygous deletions within the DOCK8 gene were identified in 2 of these families. In one family this deletion spanned exons 10 through 23, and in the second family the deletion spanned 5 through 24.

Next generation sequencing approaches are also rare in the literature, although unlike CGH arrays, it is more likely that cost and accessibility is the limiting factor. Two of the four published studies utilised homozygosity mapping to restrict the region of analysis, which indicates that cost and accessibility are still restrictive on the use of this technique, and that the tools to analyse the data are lagging behind the ability to generate them. There was one study that used a whole exome sequencing approach as a sole identification strategy - Dickenson et al. (2011) sequenced the exomes of 4 unrelated people with sporadic dendritic cell, monocyte, B and NK lymphoid deficiency. In each individual, exome sequencing identified between 853 and 1968 novel variants in each person - 190-370 variants that were predicted to be potentially disease-causing using the MutationTaster software. Of these, any 2 persons shared 17-21 variants, and any 3 persons shared 2-6 variants. Only one gene was identified in which all four individuals had a potentially deleterious variation, the GATA2 gene.

2.13. Conclusions

This survey of successful gene identification studies in PID demonstrates that functional methods of candidate gene selection have historically been, and continue to be, the most successful method. It should be recommended then, that any potential gene identification project looks first to a way of identifying the functional defect in a condition, either by interrogating cell surface markers, or through the use of a biochemical assay. The second most successful methodologies were linkage approaches. These methods are usually dependent on large, multi-affected

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 40 pedigrees in order for significant linkage to be obtained. Homozygosity mapping screens do not require large pedigrees to detect the candidate gene region in autosomal-recessive disease, however in all studies surveyed, affected individuals were the children of consanguineous parents, which can be just as restrictive a limitation on patient ascertainment. Phenotypic candidate gene-screening methods should still be considered, as these offer a low cost method of investigating a particular disease gene. However, their low numbers in the literature, and the higher number of patients that are screened to successfully identify a genetic mutation, suggests that these are a low success strategy.

Next generation sequencing is an exciting tool for the future, and has been used both as a single approach, and in combination with homozygosity mapping to interesting effect in recent publications. Homozygosity mapping can therefore remain a useful strategy because it requires a lower number of affected patients and families, although it is limited to consanguineous families, and characteristic monogenic disease.

The curators of the RAPID database have used in silico methods to determine that over 1,440 candidate PID genes exist in the genome (Keerthikumar et al. 2009a). New primary immunodeficiency syndromes are regularly described, and based on the addition of 31 identified PIDs in the four months following the survey of the literature, it is extremely likely there are a number of PID gene mutations that remain to be identified. PID is an exciting and highly relevant model for disease gene identification, as it highlights the evolution in our understanding of the disorders themselves. There has been a tendency of some medical geneticists toward an unrealistically naive view of Mendelian disease as a group of disorders characterised in the main by a single gene with a clearly defined major phenotype with an accepted range of phenotypic variation and penetrance. In contrast, animal and plant genetic models demonstrate that Mendelian phenotypes are only rarely truly monogenic, and are more accurately considered as a subset of quantitative trait phenotypes which lie towards to one end of the distribution of phenotypic effects where there is one predominant gene. These concepts are gradually being incorporated into immunology, with the view of PID shifting from one of predisposition to multiple life- threatening events from a diverse range of infectious organisms, to include a single

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 41 life-threatening event from a single, or narrow range, of pathogens in an otherwise healthy patient (Casanova and Abel 2007). More controversially, PID could ultimately be considered as a disorder of impaired immunity in which the requirement for clinical disease is discarded altogether. The relevant phenotype would rest upon the experimental demonstration of an anomaly in cellular or molecular function, and would therefore enter the world of complex genetics.

The classical period of PID gene identification may be considered to have ended in the mid-to-late 2000s as the result of two publications. The first was the first publication of the ‘immunological hole’ theory by Prof Jean-Laurent Casanova, in which two otherwise healthy unrelated individuals demonstrated susceptibility to herpes simplex encephalitis due to mutations in the UNC93B gene (Casrouge et al. 2006). This theory extends the definition of an immunodeficiency disorder from a syndrome characterized by multiple episodes of infection due to a range of pathogens +/- an increased risk of other immunological phenomena such as autoimmunity or lymphoma, to a syndrome definition which includes a single episode of life-threatening infection due to a single pathogen. Diseases encompassed by this new definition are expected to be more frequent than classical syndromes of PID, coevolving with the growing awareness of the high mutability of the human genome uncovered by microarray and next generation sequencing approaches.

The second paper did not concern an immunological disorder per se but is an illustrative story of a patient referred for diagnosis of Bartter syndrome, a group of rare conditions that affect the kidneys (Choi et al. 2009). A whole-exome screen was undertaken, and the results identified a homozygous point mutation in the SLC26A3 gene - a gene previously associated with the distinct syndrome, chloride losing diarrhea (CLD). This diagnosis had not been considered by two teams of specialist nephrologists based in Istanbul and New York who referred the patient and it was only after the mutation data were available that symptoms of recurrent diarrhea were ascertained and the patient was correctly reclassified as CLD. Subsequent analysis of 39 patients with mutation negative Bartter syndrome identified 5 (12%) with mutations in SLC26A3 indicating that misdiagnosis in this condition occurs at moderate frequency. This case illustrates the ability of NGS to go directly from phenotype to mutation genotype in a single individual without any intermediary step.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 42 Taken together these papers offer an insight into the likely growth pattern for the identification of significant PID genes in the next decade. It is expected that there will be significant growth in the identification of genes involved in common, complex, and apparently sporadic immunodeficiencies. This also has broader implications into all disease gene identifications, and will be further enabled by personalized genomics based initially on whole exome, and later whole genome sequencing.

Chapter 2: Gene Mapping Strategies in Primary Immunodeficiency Disorders 43 CHAPTER 3: Methods

3.1. DNA Extraction

Several different DNA extraction methods were employed during the course of this work. This reflected different quality and quantity requirements of downstream applications, different tissues used, and advances in available technology over this period. These are described below, with indications as to when and for what they were employed.

3.1.1. Ammonium acetate DNA extraction from whole blood

Ammonium acetate extraction methods were used where large amounts of genomic DNA were required. This method was first described by Miller et al., (1988). 5-10mL of whole blood was added to 40mL of red cell lysis solution

(150mM NH 4Cl, 10mM KH 4CO 3, 100 M Na 2EDTA) and incubated for 60 minutes at room temperature. White cells were pelleted by centrifugation in a Heraeus Labofuge GL bench-top centrifuge for 10 minutes at 2000g. The supernatant was removed and the white cell pellet re-suspended in 35mL of red cell lysis solution to ensure complete lysis of residual red cells and re- centrifuged using the above conditions. White cells were digested by overnight incubation at 50 oC in a solution of 2mL of TE lysis buffer (20mM Tris.Cl, 5mM EDTA, pH 8), 30 L of 10mg/mL proteinase K and 100 L of 10% w/v sodium dodecyl sulphate (SDS). The following morning this reaction was cooled at 4 oC for at least an hour, and protein was precipitated by the addition of 700 L 5M ammonium acetate, followed by vigorous shaking and centrifuged for 10 minutes at 3000g in a bench-top centrifuge. The supernatant was carefully aspirated and the DNA it contained was precipitated by the addition of 4mL of

Chapter 3: Methods 44 absolute ethanol, for a final ethanol concentration of 66%. The DNA was isolated with a sterile microbiological loop and washed with 300 L of 70% ethanol to remove excess salt, and allowed to air dry. The DNA was resuspended in 200 L of 10mM Tris.Cl pH 8, 1mM EDTA for experimental use and stored at 4°C for periods of up to 6 months. Stock DNA was stored at minus 20°C.

3.1.2. Puregene extractions

The Gentra Puregene TM system (Qiagen Cat: 158422) was used for rapid DNA extraction for the purposes of PCR or sequencing. The total amount of DNA acquired is approximately 10 µg, which makes this method unsuitable for downstream applications such as Southern blot or large-scale sequencing scans. For these applications, an ammonium acetate extraction was employed.

The whole blood sample was mixed thoroughly, then 300µL of whole blood was transferred to a 1.5mL eppendorf tube, containing 900µL of ‘Red Blood Cell Lysis Solution’ (Cat: 158422). This was vortexed to mix, and sporadically throughout a 10-30 minute incubation at room temperature, to ensure thorough lysis. This was centrifuged for 60 seconds at 13,000g in a Heraeus Biofuge. The supernatant was removed with a pipette leaving behind a visible cell pellet and a 10-20 µL volume of residual liquid. The tube was vortexed to resuspend the cell pellet, and 300 µL of ‘Cell Lysis Solution’ added. This was then vortexed again to aid cell lysis. 100 µL of ‘Protein Precipitation Solution’ was then added to the cell lysate, and vortexed vigorously for 20 seconds. The samples were then allowed to sit for 5-10 mins at room temperature, and then centrifuged at 13,000g in the Heraeus Biofuge for 3 minutes. The precipitated proteins formed a tight dark brown pellet, and the DNA-containing supernatant was gently poured into a clean 1.5 mL tube containing 300 µL of 100% isopropanol. The sample was mixed by gentle inversion until white threads of DNA formed a visible clump. This was then centrifuged at 13,000g in the Heraeus Biofuge for 1 minute, and the supernatant carefully pipetted off, making sure the DNA pellet was not disturbed. 300 µL of 70% ethanol was added, and then the tube was gently inverted several times. The tube was again centrifuged at 13,000g in the

Chapter 3: Methods 45 Heraeus Biofuge for 1 minute, and the supernatant removed. Residual ethanol was removed with a pipette, and the DNA pellet was allowed to air dry for 10 minutes. 100 µL of ‘DNA Hydration Solution’ was then added to dissolve the DNA pellet, and mixed well. The solubilised DNA was stored 4oC for subsequent analysis, or at -20 oC for long term storage.

3.1.3. DNA extraction from suspension cell cultures

For the purposes of DNA extraction from suspension cell cultures, a variation of the described ammonium acetate extraction method (see 3.1.1) was used. Cell concentrations were determined using a haemocytometer, and the volume containing 1x10 7 cells was centrifuged at 1500g for 10 minutes. The supernatant was removed, and the cells were washed with non-sterile Dulbecco’s phosphate buffered saline, pH 7.2 (PBS, Invitrogen Cat: 14190- 144), and centrifuged again at 1500g for 10 minutes. At this stage, the pelleted cells were incubated overnight at 50 oC in a solution of 2mL of TE lysis buffer (20mM Tris.Cl, 5mM EDTA, pH 8), 30 L of 10mg/mL proteinase K and 100 L of 10% w/v SDS. The procedure from this point on is identical to the ammonium acetate extraction procedure for whole blood.

3.1.4. DNA extraction from paraffin-embedded tissue using a Qiagen DNeasy extraction kit

In the case of some of the deceased members in the VODI pedigrees described in 5.2.7, whole blood was not available for analysis. DNA could only be obtained from archival tissues, embedded in paraffin. The DNA obtained using this method was suitable only for very short sequencing amplicons, described below in Appendix Table 9.4. 5 m histological sections of paraffin embedded samples (liver, spleen, inflammatory tissue) were obtained from the Histopathology department at South Eastern Area Laboratory Services using disposable microtome blades to prevent inter-sample contamination. 1 - 10 sections were placed in a 1.5mL Eppendorf tube. 1.2mL of histochemical grade xylene was added and the contents vortexed vigorously to dissolve the paraffin. The

Chapter 3: Methods 46 samples were then centrifuged at 13,000g in a Heraeus Biofuge for 5 minutes at room temperature prior to removing the supernatant. 1.2mL of absolute ethanol was added to the pellet to remove residual xylene and the solution mixed by gentle vortexing. The samples were re-centrifuged at 13,000g for 5 minutes at room temperature and the supernatant removed. The ethanol/vortexing /centrifugation/supernatant removal steps were repeated and the open tube then incubated at 37 oC (in a heating block) for between 10-15 minutes in order to evaporate residual ethanol.

The tissue pellet was resuspended in 180 L of buffer ATL (Qiagen proprietary tissue lysis buffer) and vortexed after the addition of 20 L of 10mg/mL proteinase K. The resulting solution was incubated at 55 oC for 1-3 hours to promote protein digestion and release of DNA from precipitated protein/DNA complexes. The solution was vortexed for 15 seconds and combined with 200 L of lysis buffer AL (Qiagen proprietary tissue lysis buffer containing 25- 50% of the chaotropic agent guanidinium chloride and other non-specified reagents) and 200 L of absolute ethanol. After mixing, the solution was pipetted into a Qiagen DNeasy Mini Spin Column and centrifuged at 8000rpm in a bench top microfuge for 1 minute to bind the DNA into the matrix under high salt conditions and the flow through was then discarded. The DNeasy Mini Spin Column was then placed in a new 1.5mL collection tube and 500 L of lysis buffer AW1 (Qiagen proprietary tissue lysis buffer containing 25-50% guanidinium chloride and other non-hazardous components [non-specified]) was added prior to centrifugation at 8000rpm for 1 minute then discarding the flow through. The DNeasy Mini Spin Column was then placed in a new 2mL collection tube, and 500 L of buffer AW2 (1% sodium azide) was added prior to centrifugation at 14,000rpm for 3 minutes to remove PCR inhibitors to the flowthrough which was then discarded. The DNeasy Mini Spin Column was then placed in a clean 2mL tube. 100 L of elution buffer AE (Qiagen proprietary elution buffer containing 10mM Tris-Cl, 0.5mM EDTA at pH of 9.0) was pipetted directly onto the DNeasy membrane prior to incubation at room temperature for 1 minute and centrifugation at 8000rpm for 1 minute in a bench top microfuge to elute DNA under low salt concentrations.

Chapter 3: Methods 47 3.1.5. RNA extraction from BLCLs

The cell concentration of an established suspension cell culture (see 3.2.2) was measured with a haemocytometer, and then diluted to 1 x10 6 cells/mL in serum- rich growth media (RPMI1640 (Gibco) supplemented with 25mM HEPES, 20% heat-inactivated foetal bovine serum, 100 U/mL penicillin, 100 g/mL streptomycin, 20 mM L-glutamine). These cells were incubated at 37 oC, 5%

CO 2, and harvested after 48 hours. Cell cultures were centrifuged at 400g for 10 min at room temperature, then the supernatant was removed and the cells were resuspended in 10mL of room temperature PBS (pH 7.2), and re-centrifuged under the same conditions. The supernatant was removed leaving ~250µL. This was kept on ice, and 750µL of TRIzol (Invitrogen Cat: 15596) was added, and pipetted up and down to disrupt cell membranes. This was then centrifuged at 12,000g, 4 oC, for 10 min. The supernatant containing RNA was removed to a clean eppendorf tube and 200µL of Chloroform was added, and shaken hard for 2 minutes. This was then left to settle on the bench for 5 min, after which it was centrifuged at 12,000g, 4 oC, for 15 min. The upper, aqueous phase was then transferred into a clean eppendorf tube and 0.5 mL of ice cold isopropanol was added. This was mixed thoroughly by inversion, and allowed to settle on the bench for 15 min. This was then centrifuged at 12,000g, 4 oC for 10 min. The supernatant was removed and discarded. The pellet was washed with 1mL of 70% ethanol, vortexed and centrifuged at 7500g, 4 oC for 5 min. The supernatant was discarded and the pellet air-dried for 10 min, and dissolved in

20µL Diethyl pyrocarbonate treated-H2O. Solubilised mRNA samples were stored at -20 oC.

3.2. Cell culture

3.2.1. Cell cryopreservation

The purpose of cell cryopreservation is to preserve cells, to guard against any potential contamination, and for long term storage of cells not in regular use.

Chapter 3: Methods 48 Cells to be cryopreserved were pelleted as described in previous methods, and resuspended at between 5 x 10 6 and 10 x 10 6 cells/mL in freezing solution (10% dimethyl sulphoxide (DMSO), 90% growth medium, at 4oC). This cell suspension was then aliquoted, with 1.0 mL of cell suspension per cryovial. Cryovials were then immediately placed in a room temperature controlled cooling container and transferred to a -80 oC freezer which permits slow controlled cooling of cells to minimize ice crystallisation cell injury. Vials were left undisturbed in a -80 oC freezer for up to 48 hours and then placed in liquid nitrogen tank for long term storage.

To thaw cells for growth, the cryovial was transferred from liquid nitrogen to a 37 oC water bath. When a small ice crystal remained in the cryovial, the cryovial was transferred to a biosafety cabinet. The outside of the cryovials was dried and wiped with 70% ethanol before opening to prevent contamination. Cells were transferred from the cryovial to a 15 mL falcon centrifuge tube using a sterile transfer pipette. Growth medium was added dropwise to a total of 10mL. The cells were then centrifuged at 400g for 10 min and gently resuspended in 10mL of growth medium, and this wash step was repeated in order to elute the majority of DMSO.

3.2.2. BLCL culturing procedures

Suspension cultures that had been thawed as described in 3.2.1 above were maintained in growth media (RPMI 1640 (Gibco Cat: 11875-093) supplemented with 10% foetal bovine serum (FBS), 2mM L-glutamine, 200U/mL penicillin, and 200mg/mL streptomycin) in 10mL or 25mL tissue culture flasks, at 37 oC with

5% CO 2. Cells were passaged 1:2 every 4-5 days.

3.2.3. Isolation of peripheral blood mononuclear cells from peripheral blood

5 – 10 mL of whole blood was collected under aseptic conditions into a Lithium Heparin pathology collection tube. This was transferred into a 50 mL Falcon centrifuge tube and an equal volume of sterile room temperature PBS (pH 7.2)

Chapter 3: Methods 49 was added. Using a mixing cannula, the diluted blood was slowly overlaid over 15 mL of sterile Lymphoprep TM (Axis-Shield Cat: 1114544), taking care to maintain the integrity of the interface between blood/media mixture and the Lymphoprep TM . These tubes were then centrifuged at 600g for 20 min at room temperature with the brake off. The cloudy mononuclear cell interface was then aspirated, being careful not to aspirate much of the upper layer, and transferred into a sterile 50 mL centrifuge tube. 35 mL of PBS was added, and centrifuged at 600g for 10 min at room temperature with the brake on. The supernatant was discarded, and this wash step was repeated. The cell pellet was resuspended into 2 mL of growth medium (RPMI 1640, 10% foetal bovine serum, L- glutamine, penicillin/strepamicin), and cell numbers were determined by haemocytometer.

3.2.4. Generation of EBV-transformed lymphoblastoid cell lines

PBMCs were isolated from 10mL of peripheral blood taken in Lithium Heparin tubes within 24-48 hours of collection. Between 5x10 6 –1x10 7 PBMCs were centrifuged 1000 rpm for 5 min, and supernatant removed. Cells were then resuspended into 0.5 – 2.5 mL B95.8 tissue culture supernatant containing active Epstein Barr virus. Cells were then incubated for 1hr at 37 °C, 5% CO 2, with gentle agitation every 15 minutes. 10 mL of growth medium (RPMI, 10% Foetal Bovine Serum, 2mM L-glutamine, 100units/mL penicillin, 100ug/mL strepomycin) was added, and then centrifuged at 1200 rpm for 5 min, and supernatant removed. This was repeated, then cells were resuspended in 2 mL growth medium supplemented with 2 µg/mL cyclosporin A. These were plated into 2 wells with 1 mL/well in a 48-well plate and incubated for 7 days at 37 °C,

5% CO 2. After 7 days, a further 1 mL of cyclosporin-A supplemented growth medium was added to each well, and the cells were incubated for another 7 days at 37 °C 5% CO 2. On days 14 and 21, growth medium was renewed by removing 1 mL spent media and replacing with 1 mL fresh growth medium. Cells were then expanded into 24 well plates when large clumps of LCLs were visible by inverted microscopy and the media turned yellow consistent with active cellular metabolism. Cells were kept in cyclosporin-A supplemented

Chapter 3: Methods 50 growth medium for 3-4 weeks, then transferred to non-supplemented growth medium. Once cells were well established, they were expanded into 25 mL tissue culture flasks.

3.3. Molecular Biology

3.3.1. Sequencing procedure

PCR was performed in a 20µL reaction volume consisting of 10µL AmpliTaq Gold 2X Mastermix (Applied Biosystems Cat: 4318739, containing AmpliTaq

Gold DNA polymerase (0.05 U/µL), dNTP (400uM each), and MgCl 2 5 mM), 100ng genomic DNA, and 5pmol of forward and reverse primer (primer sequences shown in tables below). Thermocycling conditions were: initial denaturation at 95°C/10min followed by 32 amplification cycles (95°C/30sec, 52°C/10sec, 56°C/20sec, 60°C/20sec, 72°C/1min), and final extension 72°C/7min. PCR products were purified by incubation at 37°C for 4hr-overnight with 1U of exonuclease I (GE Life sciences Cat: E70073X) and 1U of shrimp alkaline phosphatase (GE Life sciences Cat: E70092X). Enzymes were deactivated at 95°C for 10min before cycle sequencing.

Sequencing was performed in a 20µL reaction with 1µL of BigDye TM Terminator v3.1 (Applied Biosystems Cat: 4337456), 3.5 µL of 5X Sequencing Buffer (Applied Biosystems Cat: 4336697), 1.5pmol of forward or reverse primer, and 2µL of PCR product. Thermocycling conditions were: initial denaturation at 94°C/10sec followed by 25 amplification cycles (95°C/20sec, 50°C/5sec, 60°C/4 min). Sequencing products were cleaned up to remove unincorporated labeled nucleotides and primers which would degrade sequence clarity using DyeEx columns (Qiagen Cat: 63206) and analysed using an ABI 3130xl Genetic Analyser (Applied Biosystems).

Chapter 3: Methods 51 3.3.2. RT-PCR probes

For the RNA stability experiments, Taqman probes (Applied Biosystems Cat: 4331182) specific to each SP110 isoform were selected using the Applied Biosystems TaqMan® Assay Design Tool; Hs894000_m1 ( SP110c), Hs185406_m1 ( SP110b), Hs897925_m1 ( SP110a), Hs893493_m1 (all SP110 ), as well as to linked genes Hs610654_m1 ( SP140 ), Hs162109_m1 ( SP100 ). Three published house-keeping genes (de Kok et al. 2005) were used as endogenous controls: GAPDH - Hs99999905_m1, RPLP0 - Hs99999902_m1, HPRT1 Hs99999909_m1.

For the microarray validation, the expression of several transcripts was quantitated to validate the results of the microarray. 14 differentially expressed genes were selected and their expression levels measured using Taqman Gene Expression Assays (Cat: 4331182) The targets were; NDRG1 – Hs00608387_m1, CYP11A1 – Hs00167984_m1, ADAMTS6 – Hs01058097_m1, RNF144B – Hs00403456_m1, EMILIN1 – Hs00170878_m1, DPYD – Hs00559279_m1, RHOBTB3 – Hs00208554_m1, STK17B – Hs00177790_m1, MUM1 – Hs00213970_m1, BMPR2 – Hs00176148_m1, COL4A3 – Hs00184277_m1, LAG3 – Hs00158563_m1, FGFR - Hs100241111_m1, CXCL16 – Hs00222859_m1.

3.3.3. cDNA synthesis

The Superscript III First-Strand Synthesis System for RT-PCR was used (Invitrogen Cat: 18080-051). Extracted RNA was diluted to 200ng/µL in DEPC- treated H20. A mixture of 1µL of extracted RNA, 1µL of random hexamers, 1µL o of dNTPs, and 7µL of DEPC-treated H20 was incubated at 65 C for 5 min, then put on ice for 1 min. A mixture containing 2µL of 10X RT buffer, 4µL MgCl 2, 2µL DTT, 1µL RNase Out, and 1 µL of Superscript III was then added to each tube, which was incubated at 50 oC for 50 min, followed by 85 oC for 5 min, then placed in ice. 1µL of RNase H was added to each tube, and then incubated at 37 oC for 20 minutes. This reaction could be stored at -20 oC before continuing with real-time PCR.

Chapter 3: Methods 52

3.3.4. Real-Time PCR procedure

RT-PCR was performed by first aliquotting a mixture of 10µL of generated cDNA, 8µL of RealMasterMix Probe ROX (Eppendorf Cat: 2200920), and 2 µL of H 2O into a 0.1mL Rotor-Disc 72 (Corbett Research Cat: 6001-015), and sealing the tubes. This disc was then cycled using a Rotor-Gene RG-3000 (Corbett Research). Cycling was performed with an initial 95 oC for 3 min, followed by 55 cycles of 95 oC for 10 sec, and 60 oC for 30 sec. Data analysis was performed using the Rotor-Gene 6 software on the Rotor-Gene. Data were first normalised to the ROX dye in the RealMasterMix, then smoothed using the ‘Dynamic Tube’, ‘Slope Correct’, and ‘Ignore First 10 cycles’ options. The fluorescence level for the threshold cycle (C T) was determined automatically, using an internal dilution series. To determine expression changes for each probe, 3-6 replicates were compared to 3 housekeeping genes (with the relative expression averaged), and normalised against a control sample, using the 2 -∆∆ CT method (Livak and Schmittgen 2001).

3.4. Immunochemistry

3.4.1. Protein Extraction

To extract cellular proteins, 15 mL of suspension culture at approximately 1x10 6 cells/mL was centrifuged at 1000g for 8 min, and the supernatant discarded. The cell pellet was then washed with room temperature PBS (pH 7.2) and centrifuged again. The pellet was then resuspended in 100µL of room temperature PBS (pH 7.2). 100µL of SDS sample lysis buffer (2% SDS w/v, 100 mM DTT, 60mM Tris (pH 6.8), 0.01% bromophenol blue, 10% glycerol) was then added, and the sample was heated to 70 oC for 10 minutes. DNA in the sample was sheared by 4 - 5 aspirations each with an 18-gauge, then with a 21- gauge needle.

Chapter 3: Methods 53 3.4.2. Western Blotting

The protein extracts were then run on an SDS-PAGE gel electrophoresis system. This gel was constructed in two parts, with a lower resolving gel that was poured on the lower bottom 2/3, and a stacking gel on the upper 1/3. The 8% resolving gel was made up of 1.5mL of 40% 37.5:1 acrylamide/bisacrylamide (Amresco Cat: 0254), 5mL of 1.5M Tris (pH 8.8), 100µL of 20% SDS, and dH2O to 20mL. When ready to pour, 20µL tetramethylethylenediamine (TEMED; Amresco Cat: 0761-25mL) and 200µL of 10% w/v ammonium persulphate (APS; Amresco Cat: 7727-54-0) were added to the acrylamide mixture, and the gel was gently poured between two glass plates with a 1.5mm separator. The top of the gel was then covered with isopropanol, and allowed to set for 30min-2hrs. After the gel had set, the top of the gel was washed twice with distilled H 2O, then with 1X TBE running buffer (89mM Tris, 89mM Boric Acid, 2 mM EDTA, pH 8.3). This gel was then overlaid with a 5% stacking gel: 0.5mL of 40% 37.5:1 acrylamide/bisacrylamide (Amresco Cat: 0254), 50µL of 20% SDS, 2.5mL of 1M Tris (pH 8.8), up to 10mL with dH2O. When ready to pour, 100µL of APS and 10µL of TEMED were added. This was carefully poured on top of the resolving gel, and a comb placed into the gel. This was then allowed to set for 30min-2hrs. The comb was removed, and the sample wells were washed with 1X TBE running buffer before samples were loaded. 50µL of the extracted cellular protein mixture was loaded into each well. A Precision Plus Protein TM dual colour size standard (Bio Rad Cat: 161-0374) was also loaded to track migration through the gel. This gel was then run at 40-50 mA for 2.5 hrs at 4oC in a cold room.

Once the protein mixture was resolved on the acrylamide gel, it was transferred to a nylon membrane for western blotting by electroblotting, as follows: The Hybond membrane was prepared in 100% ethanol. A ‘transfer sandwich’ was constructed as follows; beginning on black ‘gel’ side. A sponge moistened in 1X TBE transfer buffer was placed on the bottom, followed with 3 pieces of wet Whatman paper cut to size. The gel was then placed on the sandwich, and the Hybond membrane placed on the gel carefully, rolling any air bubbles out. Four pieces of wet Whatman paper were carefully placed on top of this, followed by a second wet sponge. This transfer sandwich was then squeezed into the gel

Chapter 3: Methods 54 holder, and this was inserted into the transfer tank, with the gel towards the cathode, and the Hybond membrane towards the anode. Cold transfer buffer (TBE, 4 oC) was then added, together with a 100mL frozen block of 1x TBE to keep the temperature of the transfer low. This was then run at 250 mA for 1 hr in a 4 oC cold room. After this, the gel holder was dismantled, the Hybond membrane removed and placed into 100% ethanol briefly, then rinsed in dH 2O. Nonspecific protein hybridisation was reduced by ‘blocking’ the membrane with 5% non-fat powdered milk in PBS (pH 7.2) for 1 hr on a rocking platform, ensuring that it remained fully submerged at all times.

This membrane was then probed using antisera from a patient with primary biliary cirrhosis, containing antibodies against SP110 (provided by Donald Bloch). Using a heat sealer, three sides of a plastic bag were sealed, containing the membrane. The solution of antibody in 5% non fat powder milk in PBS (pH 7.2) at a dilution of 1/1000 was then added. The remaining side was then sealed, not leaving an air bubble if possible. This was incubated at room temperature on a rocking platform for 1 hour. The filter was then washed 3 times in PBS, then a mixture of 30mL of 5% non-fat powdered milk in PBS (pH 7.2), and 6µL of secondary antibody (rat anti-human Ig antibody, conjugated to horseradish peroxidase; Bio Rad Cat: 166-2408EDU) was added and incubated for 1hr at room temperature. The filter was washed in PBS 3 more times, and then was ready for detection. The membrane was incubated for 3 min at room temperature in Immun-Star HRP substrate (Bio Rad Cat: 170-5040), then sealed in cling wrap avoiding bubbles and folds in the covering. This membrane was then exposed to Kodak Biomax film for 30 sec and 5 min, and the film was developed using standard methods.

3.4.3. Immunohistochemistry

Immunohistochemistry was performed by the candidate in the laboratory of Prof Donald Bloch, Massachusetts General Hospital, Boston. BLCLs from the affected members of the VODI families were cultured as described in 3.2.2. Approximately 50,000 cells were subjected to cytospin centrifugation at 500rpm for 5 minutes and gently drained of their supernatant. The cells were then fixed

Chapter 3: Methods 55 by flooding the slide with a solution of 2% formalin in room temperature PBS (pH 7.2) for 10 mins. After removal of the formalin, a mixture of 50mL of 100% methanol and 2µL of 2mg/mL 4',6-diamidino-2-phenylindole (DAPI) was added to permeabilise the cells and stain the cell nuclei . The methanol-DAPI solution was then aspirated and the cells covered with 50% ethanol in PBS (pH 7.2) to prevent drying.

The antibodies used in the following analysis were those reported previously by Donald Bloch (Bloch et al. 1999; Bloch et al. 2000). A rat anti-human SP110 polyclonal antiserum raised against a recombinant peptide consisting of SP110 amino acids 219-435 fused to glutathione S-transferase (GST), and a rat anti- human SP100 polyclonal antiserum raised against an SP100-GST fusion protein made from the full length SP100 cDNA cloned into pGEX. The protein was made and purified by Jeff Parven at Harvard Medical School and the antibodies were purified at Cocalico Biologicals Inc., Pennsylvania.

For indirect immunofluorescent staining, 1:100 dilutions of rat anti-SP110 and rat-anti-SP100 were placed in separate tubes in a total volume of 500 µL (5 µL of each antiserum in 495 µL of PBS (pH 7.2)). 125 µL of each antibody dilution was used to cover the cytospin preparations. The cells were incubated in darkness for 1 hour at room temperature. The excess antiserum was eluted by adding 500µL PBS and agitating gently 10 minutes. This process was repeated twice.

Secondary antibodies were used as follows, using species-specific fluorescein isothiocyanate (FITC) - conjugated donkey anti-rat-IgG in 50% glycerol, which were vortexed after mixing. 1% solutions of each labelled secondary antibody were prepared in volumes of 500 µL of PBS (pH 7.2). 125 µL of anti-rat FITC- labeled secondary antibody solution was added to the cells previously stained with anti-SP110 antiserum or to the anti-SP100 stained cells. The wells were incubated at room temperature for 1 hour and then excess secondary antibody removed by washes with room temperature PBS (pH 7.2) as described above. A gel mountant was added to prevent fading and drying and a cover slip affixed permanently with enamel. The stained cells were observed under confocal microscopy with appropriate filters for scoring and photography.

Chapter 3: Methods 56 3.5. Gene Expression Microarray

EBV transformed B cell lines from 4 patients (2 unrelated individuals and a sibling pair), all of whom were homozygous for the Lebanese-Australian founder mutation c.642del, were cultured using the conditions outlined in section 3.2.2, together with 5 unrelated controls generously provided by Dr John Zeigler at the Sydney Children’s Hospital. Total RNA was extracted from EBV transformed B cells using a QIAGEN RNeasy Mini Kit (Cat: 74106) following the manufacturer’s instructions, and transported at room temperature to the Australian Genome Research Facility (www.agrf.org.au). 500ng of total RNA was labelled with Cy3 using the Ambion Total Prep RNA amplification kit (Ambion Cat: IL1791) and the quantity of labelled product was determined with an Agilent Bioanalyser 2100 using the NanoChip protocol. 1.5 µg of labelled RNA in 30µL was hybridised to the Illumina WG-6 Human v2.0 microarray platform (containing 48,701 probes targeting 42,648 transcripts) at 58 oC for 16 hours on a rocking platform. After hybridisation, non-specifically bound RNA was removed following the manufacturer’s instructions, and the specifically bound material coupled with Cy3 was scanned with an Illumina BeadArray Reader. The BeadStudio software was used to convert the array signal for analysis.

3.5.1. Microarray Analysis procedures

Measurable signals (Illumina Bead Studio detection p-value <0.05) were detected for 15,144 (35.5%) probes in at least 2 cases and 3 controls. In order to identify gene expression differences, the data were median-normalised and analysed using the Significance Analysis of Microarrays (SAM) software. Unlogged data were formatted and manipulated using the SAM v3.09 Addin for Microsoft Excel. The settings used included: Two class unpaired Response Type, Standard Analysis type, T-statistic without median centring of arrays. One thousand permutations of the data were performed with a minimum fold change threshold of 1.5x, a delta value of 1.28 which yielded a predicted false discovery

Chapter 3: Methods 57 rate of 4.78% (Tusher et al. 2001a). The list of differentially expressed genes were analysed by the Database for Annotation, Visualization and Integrated Discovery (DAVID) software (http://niaid.abcc.ncifcrf.gov/). DAVID recognised 225 of the 253 (88.9%) differentially expressed probes based on their Illumina probe ID as protein encoding genes. DAVID functional annotations were analysed under the high classification stringency option with the background assigned as the Illumina WG-6_V2_0_R4_11223189_A gene set. Enrichment p-values represent 1/log 10 of the probability that the functional annotations would be clustered by chance (cut-off E=1.30, equal to a probability of 0.05).

3.6. SNP mapping

The affected children were identified as a result of the publication of the clinical phenotype of PHID, principally by direct contact with a senior clinician. Consent for genetic testing was obtained following local clinical guidelines. Five unrelated families of diverse ethnic origins (one North American Caucasian, one Indian, one Pakistani and two Australian Lebanese), of which four were known to be consanguineous, were studied using SNP microarrays. Families A–D were analysed with an Affymetrix 50K SNP array and two affected siblings in family E with an Affymetrix 10K SNP array. Regions of excess homozygosity were identified using an adapted algorithm (Woods et al. 2004), which calculated the number of contiguous homozygous SNPs required for significance in relation to degree of consanguinity for each individual. Some leeway was permitted for the presence of heterozygous SNPs interrupting long homozygous segments to allow for signal miscalls and de novo mutations. Identity by descent was defined as regions where this significance reached a threshold of p < 0.001.

Chapter 3: Methods 58 3.6.1. Mendelian inheritance testing

A simple function was designed in Microsoft Excel 2007 that examined the parental genotypes, and determined whether the called offspring genotype was possible, based on the calls in Table 7.1 below:

Table 7.1: Table showing genotypes that could be detected as being discordant using paternity information. Parental genotype Possible offspring Impossible genotypes offspring Paternal Maternal genotypes

AA AA AA AB, BB

AA AB AA, AB BB

AA BB AB AA, BB

AB AA AA, AB BB

AB AB AA, AB, BB

AB BB AB, BB AA

BB AA AB AA, BB

BB AB AB, BB AA

BB BB BB AA, AB

Testing this function with randomly generated genotypes (at a proportion of 35% AA, 35% BB and 30% AB) led to 45% of calls being deemed impossible by the algorithm for each family. In addition, the substitution of sample BII.1 into the algorithm for family C produced an impossible genotype in 14.5% of markers.

Chapter 3: Methods 59 CHAPTER 4: Mapping and Characterisation of the PHID locus

4.1. Objectives

1) To map the chromosomal region containing the causative gene for the recently described disorder PHID in six affected individuals from five consanguineous families

2) Using a candidate gene selection approach, identify the mutations that are causative of the PHID disorder

4.2. Introduction

This chapter is being reported out of chronological order, however the success of the VODI mapping project, reported in chapter 5 of this thesis, highlighted the enormous potential of autozygosity mapping to aid in the discovery of the genetic basis of autosomal recessive disease within consanguineous families. As a result of the laboratory’s collaboration with clinical immunologists from the Children’s Hospital, Westmead, the rare immunological condition, pigmented hypertrichotic dermatosis with insulin-dependent diabetes mellitus (PHID), was suggested as a new gene-identification project. Genetic analysis began with two Sydney families in which this disorder was segregating, but eventually expanded to include a total of six affected individuals from five families, ascertained from institutions in Vancouver, Lexington, Los Angeles, London and Istanbul.

As with the VODI mapping project, autozygosity mapping was deemed to be the most suitable gene identification method, given the autosomal recessive pattern

Chapter 4: Mapping and Characterisation of the PHID locus 60 of inheritance, the frequency of consanguinity in the PHID families and the high confidence in the clinical phenotyping due to the rare combination of hypertrichosis and diabetes mellitus. Autozygosity mapping is generally regarded as a hypothesis-free technique, as it requires no previous biochemical analysis of the genetic pathways that may be involved in the disease - it rests purely on a genetic model that people within a consanguineous pedigree with the same autosomal recessive disease should be homozygous for a common genomic region (Lander and Botstein 1987). As a result, the success of the analysis relies strongly on assumptions about the structure of the pedigrees under examination and the accuracy of clinical phenotyping.

This project was undertaken in two stages, and the presentation of results in this chapter reflects this two-stage approach. The first stage consisted of a pilot study in which two families (B and C, see Figure 4.1), were examined to exclude copy number variants as a potential cause of PHID syndrome, as well as to develop and validate the methods used to perform high-density SNP genotyping and candidate gene selection. In the second stage of the project, data were added from 3 additional families (A, D and E) which permitted fine mapping of the disease gene locus. Candidate gene selection and resequencing led to the discovery of the mutations in the gene responsible, SLC29A3 .

4.2.1. Autozygosity Mapping

Autozygosity mapping, also called homozygosity mapping, is a technique that utilises the genomic characteristics of consanguineous families to detect the genetic basis of autosomal recessive disease with greater power than traditional linkage techniques. This technique was first proposed in 1987 by Lander and Botstein. The principle advantages of this technique are in the power to map genetic loci with smaller families and to include single member families where parental and sibling samples are unavailable.

Homozygosity in the genome that is attributable to inheritance of an allele from a single ancestor is termed identity-by-descent (IBD). This is distinct from identity-by-state, or homozygosity that occurs by chance, not via inheritance of

Chapter 4: Mapping and Characterisation of the PHID locus 61 an ancestral allele. IBD can arise in an individual via two methods - 1) as a result of direct inbreeding within a pedigree, and the length of these homozygous segments is proportionally related to the co-efficient of inbreeding (F) and, 2) as a result of forgotten/undetected consanguinity in a family that spans many generations – this is particularly pertinent for populations that have historically been ‘bottle-necked’, such as the Ashkenazi Jewish population, and the Lebanese-Australian population in Australia.

There is a complicated relationship between the length of a homozygous segment within an individual, the co-efficient of inbreeding, and the age of the mutation. Within a single affected individual, the size of the homozygous fragment is directly proportional to the size of F – for example, Genin (Genin et al. 1998) predicted that an individual with parents that were siblings ( F=1/4) would have an IBD segment of 0.38 morgans on average, whereas an individual whose parents were second cousins ( F=1/64) would have an IBD segment of 0.22 morgans on average. Conversely, the length of the ancestral haplotype, on which a founder mutation is present, is proportional to the number of meiosis experienced by that haplotype – in effect, the age of the mutation. The literature is ambiguous as to the precise definition of IBD, and whether it implies a segment of homozygosity within an individual, or to an ancestral haplotype that bears a founder mutation. For the purposes of this thesis, IBD will be defined as the presence of a segment of homozygosity within an individual that is not identity-by-state, and the co-inheritance of an ancestral haplotype by multiple individuals will be referred to as a shared haplotype/shared homozygosity.

4.2.2. Clinical description of PHID

Pigmented hypertrichotic dermatosis with insulin-dependent diabetes mellitus is a recently described clinical disorder characterised by a unique association of a dermatosis with diabetes mellitus and granulomatous inflammatory lesions similar to those observed in Rosai Dorfman syndrome. This disorder was first described in 2007 by Dr Julie Prendiville, a dermatologist from the British Columbia’s Children’s Hospital, Vancouver (Prendiville et al. 2007). That report

Chapter 4: Mapping and Characterisation of the PHID locus 62 described four affected individuals in four families: one East Indian boy, two unrelated Lebanese-Australian boys, and a Caucasian-American boy. Subsequent publication of a report of two more affected individuals, female siblings in a single Pakistani family in the UK, completed the description of the six individuals that were the basis of this gene identification study (Hussain et al. 2009). A comparison of the clinical features of these six children appears in Figure 4.1 below.

The skin pigmentation in these affected individuals has a distinct clinical appearance and distribution. It presents as regional dermal inflammation with perivascular T-, B- and plasma-cell infiltration in the reticular dermis, which underlies pigmented and often thickened skin that demonstrates hypertrichosis (abnormal hair growth). The distribution of the dermatosis typically included the upper thigh, but was also variably involved the inguinal regions and external genitalia, lower legs, arms, chest, abdomen, axillae and chin. Overlying hypertrichosis and induration of areas of pigmentation was also variably present. Histology of affected skin showed an infiltrate of lymphocytes and plasma cells in the lower dermis forming granulomatous lesions. Lymph node biopsy did not identify histiocytes that displayed the typical nuclear morphology of Rosai-Dorfman disease, no emperipolesis, and no abnormal S-100 staining. The initial description of the Sydney, Vancouver and Lexington families with this disorder noted several overlapping phenotypic characteristics with another disorder: POEMS in childhood - Polyneuropathy, Organomegaly, Endocrinopathy, M-protein, and Skin changes (Marina and Broshtilova 2006). However, the investigators were unable to collaborate in this study, due to previous research commitments.

Of particular interest was the high frequency of insulin dependent diabetes mellitus (IDDM) in five of the six patients studied. These affected children presented between the ages of 4-15 years, most frequently as a result of diabetic ketoacidosis, and remained insulin dependent. Although there were only a small number of individuals with PHID, it was striking that four of the five children with this diagnosis had autoantibody negative IDDM. Insulin-dependent Diabetes mellitus is not an uncommon disorder, with a prevalence in Australia of around 0.38% in 2008 (Australian Bureau of Statistics 2011). Auto-antibody

Chapter 4: Mapping and Characterisation of the PHID locus 63 negative IDDM however is rare, reflecting that autoantibody negative IDDM cohort is enriched for patients with IDDM of genetic origin. Hussain et al. report that diabetes mellitus is a feature of disease in 78 entries in the London Medical Database, primarily as an abnormality of insulin secretion or of insulin activity, and is frequently associated with skin and hair symptoms (Hussain et al. 2009).

Figure 4.1: Pedigrees of the six PHID-affected individuals studied in this project

Ethnicity East Indian Lebanese Lebanese Caucasian Pakistani Pakistani American

Consanguinity Not reported First cousins First cousins Fourth - - cousins

Inflammatory - + + - + + Symptoms

Short Stature + - - - + +

Dysmorphic Features Long philtrum, - Long philtrum, - Ptosis, low Ptosis, low clinodactyly clinodactyly ears, set ears, hypertelorism hypertelorism, clinodactyly

Ketoacidosis 15y - 9y 7y 4y 12y

Exocrine Pancreas - - - - + + Dysfunction

Diabetes – Antibodies Elevated Anti - - - - - GAD 65

Serum Elevated IgA Decreased IgM Elevated IgG Decreased Decreased NA Immunoglobulins decreased IgM IgM IgA

Onset and Locations of 15y, chin, axillae, 2-3y, abdomen, 2-3 months, 10y, lower 9m, limbs and Dorsum of Hyperpigmentation back, abdomen, genitalia, inner upper thigh, back, back hands and inner thigh, thighs, buttocks, scrotum abdomen, knees inguinal folds, legs inner thigh genitalia

Onset Hypertrichosis 15y 2-3y 2-3m 11y 9m 12y

Proptosis / Periorbital + Proptosis / - + Proptosis - - - Swelling / Extraocular onset 11y Muscle Infiltrate

Abdominal Findings HS, HS and para- HS and Biliary HS, Pancreas (clinical and imaging) Pancreatomegaly aortic pancreatic atresia Pancreatic normal size lymphadenopathy hypoplasia hypoplasia

Cerebral Imaging Orbital thickening NA Right frontal NA NA NA (MRI/CT) and EOM lobe gliosis infiltrate Legend: HS – Hepatosplenomegaly, EOM – Extraocular muscle, MRI – Magnetic resonance, CT – Computed tomography.

Chapter 4: Mapping and Characterisation of the PHID locus 64 Results

4.2.3. Selection of Lebanese-Australian patients

The first stage of this project examined DNA samples from patients BII.2 and CII.3. Before SNP genotyping was performed, deletions/duplications in the genomes of these two patients were excluded using a BlueGnome CytoChip comparative genomic hybridisation (CGH) microarray, with the assistance of Artur Darmanian at the Children’s Hospital at Westmead, Sydney. The BlueGnome CytoChip CGH array is a whole-genome BAC array with a median resolution of 0.5-1 Mb, and therefore will not necessarily detect smaller copy number variants (CNVs). No CNVs were detected in patient CII.3. In BII.2, a duplication of up to 2.87 Mb corresponding to the probe RP11-298A10 on 7q34 was detected, however a single duplicated signal is insufficient to identify a duplicated region using criteria of at least 5 adjacent probes. These results indicated that the pathogenic genetic lesion in these patients was likely to be a small sequence change rather than a gross cytogenetic abnormality, and was therefore a suitable candidate for homozygosity mapping.

4.2.4. High-Density SNP genotyping

A SNP-genotyping platform was used to identify homozygous segments of the genome that might contain the pathogenic variant(s). The Affymetrix 50K GeneChip was selected as a suitable platform that offered a reasonable compromise between price and informativeness.

Nine members of families B, and C, consisting of two patients, four parents and three unaffected siblings, were genotyped using an Affymetrix 50K Hin dIII SNP microarray as described in Methods 3.3.7. Later, the affected individuals in families A and D were also genotyped with the same platform. The microarray that was utilised contains 55,721 autosomal SNPs, spaced with an average density of 1 SNP per 0.08 cM. The manufacturer’s documentation indicates an average minor allele frequency of 0.2 and an average homozygosity of 70%

Chapter 4: Mapping and Characterisation of the PHID locus 65 using this platform. Data was captured and stored in a .dtt format compatible with the GCOS software, and genotype calls were performed using GTYPE version 4.0. This software does not give genotype calls in standard ATCG nomenclature, but uses the symbols A and B to represent each of the SNP alleles at a given locus.

The successful call rate of the screen was >94% for all samples. On average, 72% of markers were homozygous for all individuals genotyped, consistent with the manufacturer’s claims. All nine genotyped individuals in families B and C had identical genotypes at 29% of marker loci. The two affected individuals BII.2 and CII.3 were homozygous and identical at 53% of markers. Only 22.7% of autosomal markers were heterozygous in individual BII.2 and 25.0% in CII.3.

4.2.5. Mendelian testing

The data obtained were tested to ensure that the reported genotypes were consistent with the pedigree information. This had the dual benefits of ensuring that there had not been a sample mix-up, which could be devastating for the analysis, and also allowed for discordant genotyping calls to be removed from downstream analysis. A simple function was designed in Microsoft Excel 2007 that examined the parental genotypes, and determined whether the called offspring genotype was possible, as described in Methods 3.3.8.

When analysed in this manner the level of discordance observed in the patient data averaged less than 0.1% for each affected individual, with 1.9 discordant calls per chromosome in BII.2, and 1.5 in CII.3. These results precluded a sample mix-up, and controlled for any non-Mendelian errors in the pedigree structures. Non-Mendelian offspring genotypes reflect a combination of miscalled results in the offspring and parental genotype data as well as de novo SNP mutations. Markers that reflected impossible genotypes were removed for the purposes of downstream analysis of the data.

Chapter 4: Mapping and Characterisation of the PHID locus 66 4.2.6. Detecting regions of Identity by Descent

A review of homozygosity mapping by Dr Tony Roscioli in 2007 indicated that homozygosity mapping at the time was most commonly performed using microsatellite markers, rather than high-density SNP genotyping (Roscioli 2007). Where SNP genotyping had been used for autozygosity mapping studies, frequently a rather unscientific approach was used to determine the criteria for a homozygous region, including arbitrary thresholds applied to homozygous runs. In 2004, a publication by Woods et al. detailed a simple statistical function to calculate the probability that a run of homozygous SNPs would occur by chance (Woods et al. 2004). This algorithm, and the published analysis program EXCLUDE-AR, had been designed for a 10K SNP array data. Therefore, for the purposes of autozygosity mapping in this gene-identification study, the algorithm was modified for the calculation of homozygous run significance with newer SNP genotyping platforms with higher density SNP data, and to allow for different genetic hypotheses to be tested.

Three major changes were made to the algorithm designed by Woods et al. Firstly, each of the chromosomes were analysed independently, rather than as a single dataset. This change is appropriate, as chromosomes assort independently during meiosis, and the genome cannot simply be thought of as a single DNA strand. This removed the possibility of false positive results at chromosome telomeres due to the juxtaposition of two non-contiguous datasets into a single dataset. Secondly, rather than taking the manufacturer’s estimate of marker homozygosity, the observed homozygosity rate was used for downstream analysis. This is especially important for independent analysis of the chromosomes, as marker homozygosity varies from 64.8% on chromosome 20 to 83.6% on chromosome 10 for patient BII.2. Thirdly, following on from the first two changes, the number of adjacent homozygous SNPs that constituted a statistically significant run was also calculated separately for each chromosome, for each individual. The modified algorithm and the calculation of the significance thresholds for each of the chromosomes is provided in Appendix Table 9.2. The threshold level of significance chosen was p < 0.001, as proposed in Woods’ 2004 publication.

Chapter 4: Mapping and Characterisation of the PHID locus 67 The algorithm for analysis of the significance of homozygous runs was designed to test for two different models of inheritance: the shared-haplotype model , which analysed the two PHID patients and their families as if they shared a common ancestral haplotype, which bears a common ancestral mutation at the disease locus. This approach gave much greater significance to each of the smaller regions of shared homozygosity detected, compared to the second model. The second model was the non-shared-haplotype model . This model analysed each individual separately – that is, it identified regions of IBD where both parental alleles inherited by the affected individual share a common ancestor. The boundaries of those regions of IBD that overlap for each of the affected individuals demarcate candidate regions for the disease gene mutation. This model grants the freedom to detect different homozygous mutations in each affected individual, without precluding the discovery of a shared ancestral mutation. However, this reduces the sensitivity of the screen, requiring longer homozygous runs of SNPs to reach statistical significance.

4.2.7. Shared haplotype model

The shared haplotype model is based on the assumption that the disease causing mutation lies within an ancestral haplotype that is shared by affected individuals BII.2 and CII.3. Although these individuals are not known to be related, the fact that they come from the same ethnic group raises the possibility that they are distant relatives. Regions of shared homozygosity are those where the affected individuals are homozygous, and both share the same haplotype. Using the algorithms and p-values described, the threshold number of contiguous homozygous SNPs required to indicate significant IBD for each chromosome were calculated, and these are shown in Figure 4.2 below. Due to the design of the algorithm, the variation in the number of consecutive homozygous markers is attributed to the variability of the average homozygosity of markers on each chromosome, and to the total number of markers on a given chromosome. The relationship between these three attributes is shown on the graph below.

Chapter 4: Mapping and Characterisation of the PHID locus 68 Figure 4.2: i) the number of markers on each chromosome, ii) their average homozygosity and iii) the number of SNPs in a significant run.

Legend: The number of SNP markers on each chromosome comes from the manufacturers information. The average homozygosity of SNPs on each chromosome are calculated from the 9 typed individuals from families B and C. The number of SNPs for a significant run are calculated to a p<0.001.

Figure 4.2 shows that the number of SNP markers per chromosome decreases approximately in proportion to the physical size of each chromosome. The average homozygosity of the markers on each chromosome varied more widely in these two individuals, between 66% and 74%. Given this variability, it is interesting that the n values for statistically significant run length were less variable – the smallest window was 9 contiguous homozygous SNPs on chromosome 19, to 12 contiguous homozygous SNPs on chromosomes 1-7. Using these indicated n values as cut-offs for regions of homozygosity, this analysis identified 171 regions of IBD in the two affected individuals at a p value of > 0.001, a subset of which are listed in Table 4.2 in the section below.

Chapter 4: Mapping and Characterisation of the PHID locus 69 4.2.8. Haplotyping of homozygous segments

To reduce the number of regions of interest, the data were then re-examined taking into account the clinical state of other family members. The genotypes in the unaffected siblings were placed into haplotypes, using informative SNPs from each parent. Where an unaffected sibling shared the same haplotype as an affected family member, the region could be excluded.

Through this process 109 regions were excluded, leaving 62 regions of interest. Of these regions, 21 contained no known or predicted genes, and so these regions were also removed from consideration for positional candidate genes. It was appreciated and accepted that this involved a low risk that a mutation in an uncharacterised gene or a micro-RNA might also be excluded from the data, as was the case for a variant associated with muscle mass in the Texel sheep (Clop et al. 2006). The resulting 41 candidate regions, described in Figure 4.3 below, represent 37.2 Mb of genomic sequence and include a total of 247 known and predicted genes.

Chapter 4: Mapping and Characterisation of the PHID locus 70 Table 4.1: Regions of interest identified using the shared-haplotype model. Chromosome Start End Size (Mb) Window 1 86167436 86686055 0.52 18 75373794 75744925 0.37 13 225698443 226554104 0.86 13 2 169324821 169955143 0.63 12 3 162226281 162751587 0.53 15 125828567 127226369 1.40 13 161237209 162150167 0.91 12 4 107666917 108249085 0.58 12 147538629 148082548 0.54 13 5 35273617 35828799 0.56 15 64643686 65655130 1.01 21 131731675 132874401 1.14 16 145187074 145855452 0.67 14 145855452 146185979 0.33 15 123644632 124508428 0.86 14 6 96070485 96433187 0.36 12 7 27749955 28176557 0.43 14 146465531 146677236 0.21 12 10 68389831 70340702 1.95 28 71655739 72818586 1.16 13 79908148 82217610 2.31 17 28856335 29302080 0.45 12 31169915 32008735 0.84 14 36950870 37948268 1.00 13 59412301 59785229 0.37 14 12 7779822 9299991 1.52 12 16233479 16831987 0.60 12 78166794 79104469 0.94 13 81117144 82374238 1.26 31 84667680 85151083 0.48 14 85811365 87791327 1.98 15 110170474 111751790 1.58 12 13 90808658 91208271 0.40 14 14 62667297 62925328 0.26 12 15 41999160 42609135 0.61 11 18 28636091 29263749 0.63 15 29655848 30856188 1.20 25 30919759 32275026 1.36 17 21 41489507 42433102 0.94 12 42965672 44890060 1.92 13 22 38322130 39874421 1.55 10 Legend: Regions are defined by the first heterozygous SNP on either side of the window, based on the March 2006 assembly of the Human Genome (Hg18/NCBi36).

4.2.9. Non-shared haplotype model

The second mapping approach used was the non-shared haplotype model. The approach makes no assumptions about shared ancestry in the two families, rather it defines regions of IBD independently for each individual. Candidate regions are defined where both patients have regions of IBD that overlap.

Chapter 4: Mapping and Characterisation of the PHID locus 71 The modified Woods’ et al. formula was again used to determine significant regions of IBD in each individual. The number of contiguous homozygous SNPs that were required to define a homozygous run, and by extension the minimum size of the detectable homozygous regions, increased substantially using this model. This is a clear disadvantage of this analysis method, as the average length of a homozygous run increased from 9-12 to 55 contiguous SNPs in the 50K screen, which is approximately equivalent to an average region size of 3.95 cM. As such, this screen does not provide significantly more data than a 5cM STR screen. In fact it gives somewhat less, given that the informativeness of SNP markers is generally much lower than STR markers.

The number of contiguous homozygous SNPs required to call a significant homozygous run on each chromosome in each of the affected individuals BII.2 and CII.3 is tabulated in Appendix Table 9.3. The SNP ideograms shown in Figure 4.3 and Figure 4.4 were constructed to show these regions graphically.

Chapter 4: Mapping and Characterisation of the PHID locus 72 Figure 4.3: SNP ideogram of individual BII.2

Legend: Green bars indicate homozygous SNPs, red bars indicate heterozygous SNPs. Blue bars indicate a significant run of homozygous SNPs that suggest identity by descent (p < 0.001). The vertical axis indicates each chromosome, and the horizontal axis gives the physical position of each SNP (Hg18/NCBi36).

Chapter 4: Mapping and Characterisation of the PHID locus 73 Figure 4.4: SNP ideogram of individual CII.3

Chapter 4: Mapping and Characterisation of the PHID locus 74 As shown in Figure 4.3 and Figure 4.4, this algorithm defined 21 homozygous regions in patient BII.2, and 15 regions in patient CII.3. The sizes of these regions range from 6.2Mb to 63.1Mb. Four overlapping homozygous regions were detected, totalling 34.72 Mb and including 326 genes. The genotypes of unaffected siblings BII.1, CII.1 and CII.2 were analysed to attempt to exclude regions of interest, however each of these regions co-segregated with disease within families B and C.

A noteworthy finding was that six of the homozygous regions identified using the shared-haplotype method partially overlapped with regions of IBD identified using the non-shared haplotype analysis; one of the seven regions on chromosome 10 overlapped, as did all three regions on chromosome 18 and both regions on chromosome 21.

Table 4.2: Regions of detected IBD that overlap in individual BII.2 and CII.3. Shared- Size Number Chromosome Start End haplotype (Mb) of genes Start End None 79767277 85659029 5.9 23 2p11.2-12

10q22.1-23.1 71655739 87533376 15.9 142 79908148 82217610

28636091 29263749

18q12.1-12.2 28112358 35304882 7.2 36 29655848 30856188

309197507 32275026

41489507 42433102 21q22.2-22.3 41083714 46844296 5.8 125 42965672 44890060

4.2.10. Conclusion of pilot phase

The pilot study as described was deemed to be successful in defining a methodology for identifying regions of IBD and homozygosity in affected individuals. This analysis resulted in the identification of 247 genes in the shared haplotype model and 326 genes using the non-shared haplotype model. There were a combined total of 519 known and predicted genes across 39 regions including 59 genes in common between the two approaches.

Chapter 4: Mapping and Characterisation of the PHID locus 75 Exonic resequencing was performed on promising positional candidate genes CCAR1 , DNA2L , SIRT1 and TAXBP1 but did not detect any mutations in these genes. It was determined that successful gene identification would require finer resolution of the disease gene locus.

4.2.11. Fine mapping of PHID locus with three additional subjects

In the second stage of the project we obtained access to two further patient DNA samples from subjects included in Prendiville’s 2007 paper: one Indian patient (AII.1) and a Caucasian American (DII.1). These patient samples were genotyped on the same Affymetrix 50K platform. In addition, we contacted the group in London and were able to access the SNP genotyping results of a pair of siblings that were both affected with PHID (Hussain et al. 2009). These individuals had been genotyped on an Affymetrix 10K platform at Great Ormond Street Hospital, and meta-analysis of these results was performed using the algorithms defined in the first stage of this project. As the individuals included in the analysis came from a range of ethnic backgrounds and geographic origins the non-shared haplotype analysis model was used to define regions of homozygosity in each affected individual.

Using this method, statistically significant regions of homozygosity were detected in the six individuals, but there was no single region where all six individuals shared homozygous blocks that were statistically significant. This could be caused by several different factors, either genetic, experimental or analytical (arising as the result of the significance thresholds used). Genetic factors that could cause this result include genetic heterogeneity, with different genetic causes of disease in different families. The patients could be phenocopies, displaying similar phenotypes but their disorder arising from environmental rather than genetic factors. Experimentally, one likely possibility that is that the screen was not powerful enough to detect the disease gene locus, as regions of homozygosity smaller than 3.8 Mb could not be detected using this algorithm with the Affymetrix platform. Indeed, in patients AII.1 and DII.1, the consanguinity of the parents was either in doubt, or they were much more distantly related than in the other families. This would lead to smaller

Chapter 4: Mapping and Characterisation of the PHID locus 76 blocks of homozygosity, potentially unable to be detected using this screen. Therefore the data were re-analysed, removing each patient from the analysis one at a time.

By restricting the analysis to five of the six patients, there were two regions of overlapping homozygosity, both on 10q. The first region overlapped between rs1870141 (position 82,217,610 on the Hg18/NCBI36 assembly of the Human genome) and rs594467 position 85,475,453), and excluded patient BII.1. This 3.26 Mb region encompassed 3 known and predicted genes: SH2D4B , TSPAN14 and NRG3. These genes were resequenced in all affected individuals, but no coding mutations were detected.

The second region of overlapping homozygosity was between coordinates rs10509321 (position 71,655,739) and rs1900515 (position 73,083,561), and defined a 1.43 Mb disease locus. Inspection of the data from patient AII.1, the single patient who did not meet the criteria for a homozygous region at this position, showed a run of 15 contiguous homozygous SNPs between rs10509327 (position 72,264,168) and rs1668157 (73,576,156) that failed to meet the threshold for statistically significant homozygosity on this chromosome. The 1.43 Mb critical region contained 14 known and predicted genes, shown in Figure 4.5 below: PPA1 , NPFFR1 , LRRC2 , EIF4EBP2 , NODAL , KIAA1274 , ADAMTS14 , C10orf27 , PRF1 , SGPL1 , PCBD1 , UNC5B , SLC29A3 , CDH23. Resequencing of 13 of these 14 genes was undertaken; CDH23 was excluded from the first sequencing screen due to its size, 62 exons, and the fact that mutations in this gene cause the well described inherited deafness syndromes, Usher 1D (Zheng et al. 2005). (As mutations were discovered in the SLC29A3 gene in all of the affected individuals, CDH23 was never sequenced).

Chapter 4: Mapping and Characterisation of the PHID locus 77 Figure 4.5: Chromosome 10 alignment showing the 1.4Mb critical region, expanded to show the 14 genes within this region.

71655739 73083561

AII.1

BII.2

CII.3

DII.1

EII.1

EII.2

PPA1 NPFFR1 LRRC20 NODAL PRF1 C10orf27 PCBD1

EIF4EPP2 KIAA1274 ADAMTS14 SGPL1 UNC5B SLC29A3 CDH23

4.2.12. Mutation identification in SLC29A3

Resequencing analysis of the SLC29A3 gene identified five different homozygous mutations. The DNA sequence of each mutation is shown inFigure 4.6. The five homozygous mutations identified segregated with the disease and were not present in over 100 Lebanese and Pakistani control chromosomes.

Chapter 4: Mapping and Characterisation of the PHID locus 78 Figure 4.6: Mutations of SLC29A3 for the five PHID families studied.

4.2.13. SLC29A3 encodes human ENT3

The SLC29A3 gene encodes the human equilibrative nucleoside transporter 3 (ENT3), an 11 transmembrane domain integral membrane protein (Figure 4.7 ). ENT3 is a 475 amino acid protein that transports hydrophilic nucleosides, nucleobases and nucleoside analogue drugs across cell membranes down their concentration gradients (Baldwin et al. 2004; Baldwin et al. 2005). Sequence homology extends to taxa including mammals, teleost fish, tunicates, insects, round worms and slime moulds (Acimovic and Coe 2002; Machado et al. 2007). In contrast to other members of the ENT gene family which are predominantly expressed as integral plasma membrane proteins, hENT3 is an integral

Chapter 4: Mapping and Characterisation of the PHID locus 79 membrane protein mainly localising to intracellular organelles (Rose and Coe 2008). However the subcellular localisation of hENT3 has not been definitively assigned, with data indicating that hENT3 may localize to acidic late endosomes, lysosomes and mitochondria (Baldwin et al. 2005; Govindarajan and Unadkat 2008). It has been proposed that hENT3 functions as a pH- dependant transporter of nucleosides across the lysosomal membrane (Baldwin et al. 2005). The availability of a cytoplasmic pool of nucleosides is a key requirement for several cellular pathways, notably for the nucleotide salvage pathway (Baldwin et al. 2004) and in the generation of adenosine and guanosine triphosphates for cellular energy metabolism and signal transduction.

Figure 4.7: Protein model of hENT3 showing mutation locations

4.2.14. Protein consequences of SLC29A3 mutations

Two homozygous mutations predicted to cause premature protein truncation were identified, as shown in Figure 4.6 above. The 1 base pair deletion c.940del in patient BII.2, which causes the frame shift mutation p.Y314Tfs in transmembrane domain 7, is predicted to result in the substitution of transmembrane domains 8-11 with an alternate protein sequence of 91 amino acids derived from an alternate reading frame. A nonsense mutation c.1330G>T in AII.1 causes the protein mutation p.E444X. This is predicted to lead to premature protein truncation with loss of part of the final cytoplasmic domain

Chapter 4: Mapping and Characterisation of the PHID locus 80 and transmembrane domain 11 of ENT3. Splice site prediction using the human splicing finder prediction algorithm module in Alamut 2.0 indicates that this mutation could be associated with the creation of a novel donor splice site in exon 6 with the elimination of the polyadenylation signal and possible transcription read-through into an adjacent gene. It would appear unlikely that either residual protein would be capable of nucleoside transport function.

Three homozygous missense mutations of ENT3 were identified to involve amino acids whose physicochemical properties are highly conserved in evolution, as shown in the partial protein alignment in Figure 4.8.

Figure 4.8: Partial protein alignment, showing evolutionary conservation of the identified SLC29A3 mutations.

113 120 432 450 Homo sapiens VP SML CLV LALL YG PKIVP RELA EATG Pan troglodytes VP SML CLV LALL YG PKIVP RELA EATG Macaca mulatta VP SML CLV LALL YG PKIVP RELA EATG Mus musculus VP SLLFLV LVLIYG PKIVP RELA EATS Canis familiaris VSSVLCLM LALMYG PKIVP RELA EATG Monodelphis domestica VP SVLCLI LALMYG PKIMPKELA EATG Gallus gallus VP SVLCLL LTLVYG PKIMPKELA EAAG Drosophilia melanogaster IPNLVF NW LGMM YAPQT VHT KYQTT AG Caenorhabditis elegans VPNLIVAI LGMM YTPRVCPPEYS KLA G Arrow labels show amino acid positions a) 116, b) 437 and c) 449

The first missense mutation involves methionine 116 in transmembrane domain 2, which is a small hydrophobic amino acid in species as distantly related as humans and nematodes. The mutation substitutes a large basic amino acid, arginine into this position (p.M116R). The Grantham score for this substitution is 91, which is classified as a moderate change (Grantham 1974). Analysis using the SIFT prediction software also classifies this as a likely deleterious change (Ng and Henikoff 2001). The introduction of a large basic amino acid into a transmembrane domain would likely result in significant disruption of the hydrophobic nature of the domain and might result in retention of the transporter

Chapter 4: Mapping and Characterisation of the PHID locus 81 protein within the endoplasmic reticulum, as has been demonstrated for other membrane proteins (de Mattia et al. 2004). Analysis of this mutation using splice site predictor programs yielded scores indicative of a novel splice acceptor site although of lesser magnitude than the wild type acceptor splice site of this exon. Due to the lack of a patient cell line, it could not be determined whether splicing was affected.

The second missense change is a glycine to arginine substitution at ENT3 amino acid 437 (p.G437R) which is located in the putative cytoplasmic domain between transmembrane domains 10 and 11. The p.G437R change involves the substitution of a large basic amino acid at a position where 41 members of the ENT family in species as distantly related as humans and Aradopsis thaliana encode a small hydrophobic amino acid (Acimovic and Coe 2002). The Grantham difference for this change is 125 and is classified as moderately radical change. Despite a SIFT prediction that this change is likely to be tolerated it is believed that the Grantham and evolutionary conservation data are in this instance more reliable indicators of pathogenicity given the tendency of SIFT to under-call the pathogenicity of missense substitutions compared with other methods (Rudd et al. 2005). Splice site prediction results were also consistent with the creation of a novel acceptor splice site but again the results were of lower magnitude than those for the wild type acceptor site of this exon.

The third missense change occurs at ENT3 amino acid residue 449 which is also located in the final putative intracellular domain between transmembrane domains 10 and 11, and involves the substitution of a threonine by an arginine (p.T449R). The amino acids encoded at this position in hENT3 orthologues are small polar/uncharged or small hydrophobic residues. Substitution by arginine is associated with a Grantham score of 71 and is predicted by SIFT not to be tolerated. No novel mRNA splice site was predicted as a result of this substitution.

Chapter 4: Mapping and Characterisation of the PHID locus 82 Discussion of co-publications

The results presented in this chapter identified five mutations in the equilibrative nucleoside transporter 3 protein that are associated with a syndrome of insulin dependent diabetes mellitus, localised hypertrichosis and perivascular inflammatory cell infiltration of the dermis and subcutis. The aetiological role of the novel homozygous protein truncating and missense mutations in PHID was established by segregation of the disease with the homozygous genotypes, their absence in a population of normal control chromosomes from people of Middle-eastern and Pakistan ancestry, and conservation of the physicochemical properties of the amino acids across species. The mutations are present on five different haplotypic backgrounds, indicating that they are independent events manifested here as the result of consanguinity. These results were published in 2009 in the journal Human Molecular Genetics (Cliffe et al. 2009).

The effect of the p.T449R missense mutation was further examined in the Cliffe et al. (2009) paper by Dr Joris Robben, a postdoctoral scientist in the laboratory of Prof Peter Deen Department of Physiology in the Nijmegen Centre for Molecular Life Sciences at Radboud University Nijmegen Medical Centre, The Netherlands. Fibroblasts from a patient in family E were examined, showing a significantly lower level of expressed ENT3 protein (30.1%), associated with a reduced level of SLC29A3 mRNA (34%). The residual protein also showed an altered intracellular distribution by fluorescent immunohistochemistry. Control cells showed ENT3 localisation to intracellular membrane compartments, which corroborates previous reports (Baldwin et al. 2005). The altered ENT3-T449R protein localised to late-endosomal and lysosomal compartments. This accumulation, despite overall reductions in protein levels, suggests a defect of cellular trafficking.

The production of an animal model is a crucial step to study genetic effects relevant to PHID pathology. In addition to the identification of hENT3 mutations as the cause for PHID, Cliffe et al. report the characterisation of the physiological function of an ENT3 orthologue in Drosophila melanogaster using a knockdown of the Drosophila orthologue of ENT3: ENT1 (here termed

Chapter 4: Mapping and Characterisation of the PHID locus 83 dmENT1 for clarity). Knockdown of dmENT1 by RNAi was performed by Dr Jamie Kremer in the laboratory of Associate Professor Annette Schenck in the Department of Human Genetics at Radboud University Nijmegen Medical Centre, The Netherlands. These experiments showed full induction of the ubiquitously expressed RNAi at 28 oC resulted in a semi viable to lethal phenotype, depending on the degree of induction of the RNAi. This lethal phenotype was able to be rescued by overexpression of dmENT1. The fact that dmENT1 knockdown mutants die at multiple stages of development suggests that this protein, rather than being required for a specific developmental process, has crucial housekeeping or metabolic function.

In addition to the general role of dmENT1 on survival, a specific fly phenotype was identified among flies where the induction of the RNAi was performed at a lower temperature (25 oC) which led to a range of sensory bristle defects of the fly scutellum. Sensory bristle defects have been previously described in a knock-down of Is1 , the ortholog of the pancreatic differentiation gene Islet in humans (Biryukova and Heitzler 2005).

Despite human body hair and fly bristles sharing only limited functional features, ectopic bristles induced by loss of dmENT1 expression are a striking phenotype in light of human hypertrichosis associated with PHID. Fly bristles have been principally studied to learn about human hair cell biology in the inner ear (Adam et al. 1998; Eddison et al. 2000) but they also share some features with body hair follicle cells, such as their differentiation from epithelial cells which depends on similar molecular mechanisms including delta/notch-mediated lateral inhibition (Eddison et al. 2000; Millar 2002). A role for dmENT1 in the regulation of Drosophila bristle development may extend beyond this observation. In a large scale Drosophila overexpression study, overexpression of dmENT1 in proneural clusters caused loss of sensory bristles (Molnar et al. 2006), suggesting that dmENT1 indeed functions as a crucial regulator of bristle development. Why ubiquitous knockdown of dmENT1 induces ectopic bristles only on the scutellum of the fly remains elusive, but it is of interest that inactivation of the Drosophila ortholog of the lim-homeodomain transcription factor Islet-1, an essential regulator of pancreatic morphogenesis in humans, also produces bristle phenotypes restricted to the scutellum (Biryukova and

Chapter 4: Mapping and Characterisation of the PHID locus 84 Heitzler 2005). The human hypertrichosis phenotype also occurs in restricted, rather stereotyped areas, and not over the entire body.

4.2.15. SLC29A3 spectrum disorder

Following the publication of the clinical description of pigmented hypertrichotic dermatosis with insulin-dependent diabetes mellitus in the four boys that were studied in this chapter (Prendiville et al. 2007), a similar disease, H syndrome, was reported (Molho-Pessach et al. 2008a). Molho-Pessach et al. reported ten patients from six unrelated Arab families that displayed a similar cutaneous phenotype, with overlaps in several systemic manifestations: hepatosplenomegaly, heart anomalies, short stature, orbital proptosis, episcleritis, hypogonadism and gynecomastia. Two major differences between the two groups of patients were the absence of insulin-dependent diabetes mellitus in the patients with H syndrome, but a prevalence of hearing loss in five of the 10 patients reported. Given these similarities, Molho-Pessach et al. made the assumption that the two diseases were the same multi-systemic disorder. As we were preparing to publish the findings of mutations within SLC29A3 as being causative of PHID syndrome in late 2008 (during the period where we were characterising the Drosophila model discussed below in section 4.2.16), a paper was published from the Weizmann Institute of Science in Jerusalem indicating that mutations within SLC29A3 are associated with H syndrome (Molho-Pessach et al. 2008b). Although there was no functional work to confirm that this gene was causative, the overlap between the phenotypes suggests that it is highly likely that SLC29A3 mutations are causative in both PHID and H syndrome.

In the 2009 publication of the PHID mutations, it was argued that PHID and H syndrome could in fact be allelic conditions with different manifestations but the skin disease features in common. Molho-Pessach has recently argued that this distinction is artificial (Molho-Pessach et al. 2010), as patients homozygous for the G427S mutation have been described with and without both diabetes mellitus and deafness, and the clinical description of H syndrome has been updated to include diabetes mellitus as a clinical factor – indeed it has been

Chapter 4: Mapping and Characterisation of the PHID locus 85 reported as the earliest and sole manifestation of the H syndrome (Broshtilova et al. 2009), although the two patients reported are the only ones to develop diabetes mellitus, in a single family that has not been reported to exhibit deafness.

An opportunity to resolve this issue presented itself when our research group was contacted by a clinical geneticist in Manchester, UK who had a family which manifested both PHID and H syndrome like phenotypes. Mutation screening in this family demonstrated inheritance of homozygous SLC29A3 mutations in one patient (p.G437R) and compound heterozygous mutations in his affected aunts (p.G427S and p.G437R), both of whom had diabetes mellitus, and one of whom had severe hearing loss (Spiegel et al. 2010). This study confirmed that the deafness and insulin-dependent diabetes mellitus phenotypes appeared to be associated with both genotypes, which supports the assertion that PHID and H syndrome are the same condition with phenotypic variation, rather than allelic disorders with specific phenotype-genotype correlations.

Further research has recently identified SLC29A3 mutations in clinically similar conditions Faisalabad histiocytosis and in Rosai-Dorfman disease (Avitan- Hersh et al. 2011; Morgan et al. 2010). Morgan et al. reports several overlapping cutaneous, histopathological and systemic manifestations in these conditions, although PHID remains the only disorder with a high prevalence of diabetes mellitus, and does not share the life-threatening lymph node enlargement seen in Faisalabad histiocytosis and Rosai-Dorfman disease. The addition of these diverse manifestations to the range of phenotypes associated with mutations in the SLC29A3 gene suggest that each of these related diseases should be viewed as part of an “ SLC29A3 spectrum disorder”. This particular finding is especially interesting, given that an initial diagnosis of Rosai-Dorfman disease in the PHID cohort was considered, and ultimately rejected based on immunohistochemical findings.

Chapter 4: Mapping and Characterisation of the PHID locus 86 4.2.16. Involvement of SLC29A3 in Type I Diabetes

The diabetes mellitus manifestation in the PHID-affected individuals in the SLC29A3 spectrum disorder remains an intriguing aspect of the phenotype, and suggestive of an interaction of ENT3 with the insulin signalling pathway. Dr Jamie Kremer (the postdoctoral fellow in Professor Annette Schenck’s research group referenced previously) had previously worked on insulin signalling in Drosophila and therefore examined the effects of insulin signalling on the size and number of cells in the Drosophila wing following targeted knock-down of dmENT1 expression in this organ. The Drosophila wing can be considered to be a blade of two cell layers and as it is an organ that is not essential for survival, it serves as an excellent model in which to assay cellular growth and development. Targeted inactivation of dmENT1 in the dorsal wing cell layer produces a wing-curl phenotype that indicates whether the growth rate of this cell layer has increased or decreased when compared to the adjacent wing cell layer. Knockdown of dmENT1 produced an up-curled wing phenotype in this system - consistent with dmENT1 having a positive role in cellular growth. This phenotype could be rescued by co-expression of known insulin pathway genes: Insulin receptor , P13 Kinase and Akt. These results are consistent with previous observations that dorsal wing activation of positive regulators of insulin signalling cause the opposite phenotype, down-bending of the wing (Montagne et al. 1999). Taken together, these results show that dmENT1 is a positive promoter of cell size or number, and that it interacts with the insulin signalling pathway.

Given these findings it was of interest to determine whether mutations in SLC29A3 could be identified in a cohort of individuals with auto-antibody negative type 1 diabetes mellitus. This study was undertaken in the laboratory of Professor Andrew Hattersley at the Peninsula Medical School Exeter UK. Studies performed by Dr Emma Edghill showed that SLC29A3 is expressed in beta cells of the pancreas. Mutation screening of the six coding exons of SLC29A3 in 47 cases of auto-antibody negative IDDM did not detect any mutations (Edghill et al. 2009).

While retrospective power analyses are controversial, it can be argued that examination of 47 patients at 80% power and a 5% level of significance can

Chapter 4: Mapping and Characterisation of the PHID locus 87 allow the researchers to exclude a measurable relative risk of rare SLC29A3 mutations in type-1 diabetes mellitus greater than 0.3, as calculated by Yang et al. (Yang et al. 1997). This calculation assumes that the susceptibility genotype exists at a population frequency of 0.05, and that the individuals studied have all been regularly exposed to predisposing environmental factors. As such, while it may be concluded that SLC29A3 mutations are not a common cause of type-1 diabetes mellitus based on the work of Edghill et al., it is still possible that rare SLC29A3 mutations have a limited role in this disorder. Future work should consider resequencing of the SLC29A3 gene in larger numbers of patients with type I diabetes mellitus.

4.3. Summary

This chapter describes the successful homozygosity mapping of six patients with PHID, using a combination of 50K and 10K SNP genotyping arrays. The identification of a 1.4Mb shared region of homozygosity in five of the six patients, which contained 14 known and predicted genes, was vital to the identification of five different mutations in the gene SLC29A3. This mutation identification has been important for the clinical management of patients with PHID, and has also been instrumental in the definition of an ‘ SLC29A3 clinical spectrum’, that includes patients with clinical features of PHID, H syndrome, faisalabad histiocytosis and Rosai-Dorfman disease.

The following chapter presents the results from a second homozygosity mapping study, which was successful in identifying the genetic basis of the immunodeficiency syndrome VODI. This work was completed chronologically much earlier than the current chapter, and therefore there were a number of differences in the study design that allow for comparisons to be made.

Chapter 4: Mapping and Characterisation of the PHID locus 88 CHAPTER 5: Veno-Occlusive Disease with Immunodeficiency Syndrome is Due to Mutations in the SP110 gene

5.1. Objectives

1) To screen the SP110 gene for mutations in other patients with veno- occlusive disease with immunodeficiency syndrome

2) To analyse detected sequence variants to characterise whether they represent pathogenic changes

3) To screen patients with phenotypically similar conditions for mutations in the SP110 and related SP140 genes

5.2. Introduction

5.2.1. Veno-occlusive disease mapping and mutation discovery

Veno-occlusive disease with immunodeficiency syndrome is an autosomal- recessive condition, first described in 1976. Dr Craig Mellis and Dr Patricia Bale describe five infants in three unrelated Lebanese Australian families who died in their first year of life due to veno-occlusive disease of the liver with severe hypogammaglobulinaemia, multiple infections and lymphoid germinal centre depletion (Mellis and Bale 1976). Mellis and Bale proposed that this represented a new paediatric immunodeficiency disorder and that the condition be termed VODI. Subsequently a total of 19 cases have been ascertained in the Sydney region over a period of 35 years, by clinicians at both major paediatric hospitals.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 89 There was considerable discussion at the time as to whether VODI was an inherited disorder or whether it represented an example of familial poisoning with pyrrolizidine alkaloids (usually ingested in African bush teas) which are known to be capable of producing veno-occlusive disease of the liver and can affect multiple family members (Selzer and Parker 1951). The early age of onset and repeated denials by the families that their diets included potential alkaloid containing foods indicated the genetic hypothesis was the best interpretation of the data, but this view was not universally accepted.

As VODI presented as a rare autosomal recessive disorder with a high frequency of consanguinity and principally affecting a single ethnic group, a homozygosity mapping study was undertaken by Dr Tony Roscioli in the SEALS Genetics laboratory. Dr Roscioli studied six children from five families with VODI, in a project that led to the identification in 2005 of a single base deletion in the SP110 gene (Roscioli et al. 2006) .

5.2.2. Autozygosity mapping in VODI

Dr Tony Roscioli performed an autozygosity mapping study on four affected individuals (AII.1, BII.1, BII.2, and CII.1) from three consanguineous families. The method used was a short tandem repeat (STR) genome-wide screen which utilised 800 markers at an average density of 5cM. From Genin et al. (1998), there is a 92.9% chance that a 5cM screen will detect a homozygous marker adjacent to the disease locus in the child of parents that are first cousins. This screen identified five STR markers where all affected individuals were homozygous for the same genotype, and a further 13 markers where one allele differed by a single repeat unit. These regions were re-examined by typing the parental STR markers, with the hypothesis that unaffected parents should be heterozygous at these loci. These highly stringent selection criteria led to the selection of a single candidate region on chromosome 2. Fine-mapping of this region was undertaken with these four individuals, and included two more affected individuals from families D and E. Fine mapping demonstrated a 1.42 Mb homozygous region between STR markers AFMB329WE9 and AFM324VC9 at chromosome 2q36.3-q37.1, which contained 13 transcripts in

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 90 the May 2003 genome assembly, including the lymphocyte expressed SP110 , SP100 and SP140 genes. Significantly, family E did not share the same homozygous haplotype of markers with the other families at this locus. Using a candidate gene selection approach, Dr Roscioli chose SP110 as the most appropriate gene, and sequenced the exonic sequence of affected individual AII.1. This identified a single base deletion in exon 5: c.642delC.

5.2.3. The role of SP110 mutations in VODI

The aim of this study was to discover whether the mutation in SP110 identified by Tony Roscioli was common for all individuals with VODI, and to characterise whether this was the genetic basis of VODI in all six individuals studied. The hypothesis for the study was that SP110 is the sole causative gene for VODI, and the lack of a common ancestral haplotype in family E was due to allelic heterogeneity. The alternative hypotheses were either that the mutation in SP110 represented a false positive result, or that it is only one of a number of disease genes capable of causing VODI and that another gene within the identified homozygous region (or potentially other homozygous regions within the genome) contained causative mutations.

The prima facie case supporting the hypothesis of SP110 as the causative gene for VODI rested on two pillars. Firstly, the detection of a 1.42 Mb homozygous region between STR markers AFMB329WE9 and AFM324VC9 at chromosome 2q36.3-q37.1 - the only detected region from a 5cM whole-genome screen where all affected individuals were homozygous and their parents heterozygous. Secondly, the discovery of a sequence variant in SP110 in one affected individual that would be predicted to lead to a protein-truncating variation in the protein. Each of these threads of evidence are expanded in the following sections.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 91 5.2.4. The genome-wide microsatellite survey indicated a single region of homozygosity.

The 1.42 Mb homozygous region on chromosome 2q36.3-q37.1 was described by Dr Roscioli as the only detected region from a 5cM whole-genome screen where all affected individuals were homozygous and their parents heterozygous. This pattern of inheritance was consistent with the autosomal recessive character of the VODI disease.

Microsatellites are fast-mutating DNA sequences, and are therefore particularly useful for disorders which have a historically recent origin (of the order 500- 2,000 years). A 5cM genome wide scan was the best available technology in 2004, but has subsequently been replaced by high density SNP-microarrays, providing 10,000 to over a million features on a single chip. The use of 250K arrays has highlighted that in any homozygosity mapping study there are multiple regions of IBD which exist on a continuum from large to extremely small. There is a 7.1% chance that the marker adjacent to the disease locus is not homozygous in a 5cM STR screen (Genin et al. 1998). In addition, Dr Roscioli did not explore the possibility that the ancestral mutation could be different in some or all of the families in the original screen, and so excluded markers that were homozygous in the affected individuals, but not shared. Additionally, the highly stringent criteria used to exclude regions where the parents markers were homozygous (which could represent an uninformative marker rather than a true homozygous segment) possibly led to a type II error, erroneously excluding a region of IBD. Therefore, the identification of a single homozygous region in the 5cM microsatellite screen did not exclude the possibility that the causative gene lay in an unevaluated homozygous region.

5.2.5. Protein truncating mutations are not always pathogenic mutations.

The c.642delC mutation identified in these families is a protein truncating mutation resulting from the single base pair deletion. Protein truncating mutations are only rarely polymorphisms; however this is not unheard of. Notable examples of genes that contain polymorphic stop codons are the variant p.R577X in ACTN3 (North et al., 1999) and p.K3326X in BRCA2 (Borg

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 92 et al., 2010), but others have been reported for the immune system expressed genes TAP2 , the V β18 allele of the T cell receptor. The scale of this problem has recently been identified in the International GOLD Consortium mutation survey of 720 X chromosome genes in 208 individuals with mental retardation (Tarpey et al. 2009). Twenty-one polymorphic protein-truncating mutations were identified, including two genes where there were two different protein truncating mutations ( MAGEE2 and UBE2NL ). Further evidence comes from studies in yeast where a survey of 88,000 SNPs between two yeast strains identified 31 polymorphic stop codons (Doniger et al. 2008). Therefore, it remained possible that the c.642delC mutation identified in SP110 was a naturally occurring low frequency variant.

However, even if the c.642delC mutation in the SP110 gene does lead to inactivation of the protein, this alone does not necessarily imply that SP110 is the cause of VODI. In a review of phenotypes in mice where gene targeting was used to inactivate genes, Barbaric suggests that even in the absence of systematic reporting of negative findings, a phenotype is absent in 10-15% (Barbaric et al. 2007). Prospective data from the German Mouse Clinic which offers standardised detailed mouse phenotyping reveals that 60% of new lines do not have a recognisable phenotype. Yeast data where genes are systematically inactivated leads to a no-phenotype call in 40-60% of mutants (Giaever et al. 2002; Smith et al. 1996; Winzeler et al. 1999). The most likely reason for the lack of a phenotype in a targeting study is protein functional redundancy. This is of particular relevance to SP110 , as there are two very highly related genes, SP100 and SP140, immediately adjacent to SP110 within the identified region of homozygosity.

5.2.6. Evidence that mutations in SP110 cause VODI

While the a priori case for SP110 as the genetic basis of VODI was strong, it was not definitive. Further steps were taken to confirm that SP110 mutations are causative in VODI. These included the identification of multiple mutations in the same gene, the analysis of control chromosomes, and the examination of mRNA expression and SP110 protein expression in affected patients.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 93 Results

5.2.7. SP110 mutations detected in five VODI families

With the discovery of the c.642delC in exon 5 of SP110 in the first patient, the first priority was to sequence this amplicon in each of the remaining patients from the original mapping study. The same homozygous c.642delC was discovered in all four affected individuals in three of the families: AII.1, BII.1, BII.2, and CII.3. This result was expected – each of these families shared IBD at this locus. Family E was not included in the original genome-wide mapping study as there was no living affected individual available, however fine-mapping of this locus showed that the parental samples showed different ancestral haplotypes at this gene locus. Sequencing did not show a mutation in exon 5 of SP110 in this family. Full SP110 gene sequencing of affected individual EI.1 showed a different mutation – a homozygous c.40delC mutation in exon 2 of the SP110 gene, shown on the diagram at Figure 5.1 below. The mutations of each of the affected individuals are listed in Table 5.1.

5.2.8. SP110 mutations co-segregate with disease in four VODI patients and are not present in 100 control chromosomes

Having confirmed that protein-truncating mutations are present in each of the affected individuals studied in the initial mapping study, the co-segregation of mutations with disease in each of these pedigrees was examined. No unaffected individuals were homozygous for the mutation - in each family the parents were heterozygous for the family mutation. Among the unaffected siblings who were available for analysis, CII.3 was heterozygous for the c.642delC mutation, and CII.4 was homozygous for the wild-type SP110 allele.

To ensure that the detected variants did not represent a low-frequency normal variant, 50 ethnically matched control individuals were screened. These individuals were ascertained through the Haematology department at the South East Area Laboratory Services, Randwick Australia. These were

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 94 immunologically normal individuals, and were de-identified for the purposes of the analysis. In 100 control chromosomes, neither the c.40delC nor the c.642delC mutation was detected. This indicates that even in the Lebanese- Australian community these represent rare variants.

5.2.9. Multiple SP110 mutations detected in new VODI patients

Following the publication of the gene identification paper in Nature Genetics in 2006 (Roscioli et al. 2006), several new cases were referred to the laboratory for SP110 sequence analysis. A number of new mutations were identified. These are described in Table 5.1 below.

Table 5.1: List of SP110 mutations detected in VODI patients

Patient SP110 Mutation AII.1 c.642delC p.S215AfsX14 BII.1 c.642delC p.S215AfsX14 BII.2 c.642delC p.S215AfsX14 CII.1 c.642delC p.S215AfsX14 DII.1 c.642delC p.S215AfsX14 EI.1 c.40delC p.Q14SfsX25 GI.1 c.642delC p.S215AfsX14 Patient 1 c.319_325dupGGTGCTT pS109WfsX5 Patient 2 c.78_79delinsAT p.I27L Patient 3 c.667+1dup intron 5 splice site mutation Patient 4 c.642delC p.S215AfsX14 Patient 5 c.642delC p.S215AfsX14 Legend: Reference sequence for SP110c - NM_080424.2, and protein reference NP_536349.2

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 95 Figure 5.1: Structure of SP110c, showing location of mutations.

Legend: SP110c accesion - NM_080424.2.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 96 5.2.10. In silico analysis of non-protein-truncating VODI mutations

Three of the five mutations identified were frame-shift mutations which introduced a premature truncation codon early in the mRNA and are predicted to be pathogenic.

Patient 3 was demonstrated to have a duplication of the third base in codon 223, the final base of exon 5. HGVS nomenclature requires that this mutation is labelled as the intronic mutation c.667+1dup, implying a splice site mutation. The most likely biological outcome however is that the duplicated G base essentially moves the donor splice of intron 5 one base 3’, so introducing a single base frameshift. The mRNA splicing programs incorporated in Alamut v2.0 (Interactive Biosoftware) also predict a frame shift due to the insertion of a single base in codon 223 resulting in a premature nonsense mutation four codons downstream.

The mutation identified in patient 2 is the first instance of a missense mutation associated with VODI. The dinucleotide deletion/insertion mutation c.78_79delinsAT involves the third base of codon 26 (GCC>GCA, both of which encode alanine) and the adjacent first base of codon 27 (ATA>TTA, isoleucine to leucine) [p.I27L]. The predicted isoleucine to leucine substitution of codon 27 is a very conservative change with a Grantham distance of only 5, but is predicted to be damaging by PolyPhen2 with a significant (HumVar) score of 0.949 based on the evolutionary conservation of Isoleucine at this position. In this instance, the mutation is located within the highly conserved SP100 domain which may mediate dimerisation with SP140 (Bloch et al. 2000; Nicewonger et al. 2004; Seeler et al. 1998). Multispecies alignment of the protein sequence surrounding isoleucine 27 demonstrates that this is a strongly conserved residue with a PhyloP score of 1.98. The dinucleotide indel mutation is not present in control chromosomes, nor is it represented in the 8000 SP110 alleles represented in the recent data release from the Exome Variant Server, NHLBI Exome Sequencing Project (ESP), Seattle, WA (URL: http://evs.gs.washington.edu/EVS/) [accessed November 2011].

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 97 5.2.11. Functional mutation analysis

Experimental evidence to this point has showed that there are multiple mutations in the SP110 gene, all of which co-segregate with disease in each of these families, and which are not present in a cohort of ethnically matched control chromosomes. In silico analysis has also confirmed that these sequence variants are likely to be pathogenic.

It was very likely that the gene for VODI is expressed in lymphocytes as the mutation produces a B and T cell immunodeficiency and patients have lymph nodes with depleted germinal centres. Lymphocytes were an easily accessible tissue from both carriers and controls, and immortalised B-lymphoblastoid cell lines were available on six individuals affected with VODI: CII.1, BII.1, BII.2, AII.1, patient 1 and patient 4. These provided a valuable resource for examining the effects of the c.642delC and the c.319_325dupGGTGCTT mutations.

Two streams of functional analysis were addressed. The first looked at the variation of the mRNA expression. The second looked at the variation in protein expression, utilising western blotting and immunohistochemistry.

5.2.12. Quantitative RT-PCR

In order to validate the pathogenicity of mutations within the SP110 gene, it is important to analyse how these mutations effect mRNA expression. It was hypothesized that the potential effects on mRNA expression patterns might include: 1) nonsense-mediated decay (NMD) of the mRNAs that have a frameshifting or nonsense mutation. This would be reflected in reduced levels of expression, or alternatively 2) over-expression of the mRNA, as feedback mechanisms react to a paucity of effective protein being produced, and leading to an observation of higher levels of mRNA produced. 3) differential splicing of the gene could also occur in some instances.

Nonsense-mediated mRNA decay is a surveillance mechanism that recognizes and degrades transcripts carrying premature termination codons (PTCs) arising from erroneous transcription or splicing, or that are encoded by splice-site or nonsense/frame-shift mutations (Khajavi et al. 2006). NMD has been shown to

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 98 modulate human disease phenotypes - for example, the clearance of mutant transcripts by NMD may reduce disease severity by eliminating transcripts that encode proteins with dominant-negative effects. In a recent publication, Dr Andrew Wilkie of Oxford University observed that disease phenotypes associated with NMD may also depend on the position of a PTC within the gene, because PTCs are recognized by the presence of exon junction complexes at downstream exon-exon junctions (Jenkins et al. 2011). Therefore, PTCs may escape NMD if they are located in the final exon or 3 ′ end of the penultimate exon. One of the striking observations about VODI mutations is the skewed distribution of protein truncating mutations in VODI patients, which are restricted to just 3 exons at the 5’ end of the gene. These mutations would therefore be predicted to cause nonsense-mediatated decay.

Changes in mRNA expression patterns were assessed using two different approaches. A quantitative-fluorescent approach, with a TaqMan® Gene Expression Assay (Applied Biosystems), was selected to determine changes in SP110 expression levels. This system is highly discriminating, and by selecting probes that straddle unique exon-exon boundaries, it is possible to distinguish between different genes, and different transcripts of the same gene. Secondly, cDNA PCR, and cycle sequencing of the products, were used to examine differential splicing patterns.

Patients affected with the c.642delC mutation were much more numerous, and thus easiest to study in the mutation validation experiments. In particular, material was available from family C that contained siblings with genotypes that were homozygous normal (CII.4), heterozygous (CII.3), or homozygous for the c.642delC mutation (CII.1), allowing for intra-family examination of mRNA expression differences. The results of expression analyses were normalised against an unaffected non-family member.

The RT-PCR results were normalised at three stages, as recommended by Huggett et al (2005). Firstly, the number of cells harvested was equivalent for each sample. Secondly, the amount of RNA added to the reverse-transcriptase reaction was made equivalent. Thirdly, expression levels were normalised against internal housekeeping genes. These housekeeping genes were selected from a review of housekeeping genes (de Kok et al. 2005) and

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 99 validated to show that they gave consistent results at increasing concentrations of cDNA.

Taqman® probes were selected to provide resolution between the different SP110 isoforms, as indicated in Figure 5.2. The Hs00894000_m1 targets the exon 17-18 boundary, which is specific for SP110c, and will not detect either SP110a or SP110b. The Hs00185406_m1 probe targets the unique exon boundary of 14-15’ of SP110b. The Hs00893493_m1 probe targets the SP110 exon 1-2 boundary, and will detect three SP110 isoforms (a fourth SP110 isoform, NM_001185015.1, has since been identified). The probes Hs00610654_m1 and Hs00162109_m1 target SP140 and SP100 respectively.

Figure 5.2: Diagram of SP110 isoform-specific Taqman® probes.

Legend: Hs00893493_m1 probe in red targets the SP110 exon 1-2 boundary, the Hs00185406_m1 probe in blue targets the unique exon boundary of 14-15’ of SP110b, and the Hs00894000_m1 probe in purple targets the exon 17-18 boundary of SP110c. Diagram from the Applied Biosystems TaqMan® Assay Design Tool.

5.2.13. Reduced mRNA expression of SP110 detected in VODI affected individuals

Figure 5.3, Figure 5.4 and Figure 5.5 show that SP110 mRNA expression is consistently and markedly reduced in each of the affected individuals compared to a homozygous wild-type, unaffected sibling. The average total SP110 expression is reduced to 14.8% ± 7.4% for individuals with the c.642delC mutation. The heterozygous individual CII.3 shows an expression level of 68.7%

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 100 ± 14.1%. These levels are similarly reduced for both the SP110c and SP110b isoforms, as the figures below show.

Figure 5.3: Total SP110 mRNA expression.

Legend: Results using Taqman® probe Hs00893493_m1 in four affected individuals, CII.1, BII.1, BII.2 and AII.1, and one heterozygous individual, CII.3, normalised to homozygous wild type family individual CII.4. Error bars indicate the standard error of 6 technical replicates for each sample as calculated using the User Bulletin #2 for the ABI PRISM 7700 sequence detection system (2001).

Figure 5.4 shows that SP110c mRNA expression is reduced to 17.12% ± 12.12% for individuals with the c.642delC mutation, and individual CII.3 shows an expression level of 58.4% ± 6.2%. patient 1, with the c.319_325dupGGTGCTT mutation, also showed a reduction in SP110c mRNA expression of 38.7% ± 2.1% in a later experiment.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 101 Figure 5.4: SP110c mRNA expression.

Legend: Results using Taqman® probe Hs00894000_m1 in five affected individuals: CII.1, BII.1, BII.2, AII.1 and Patient 1, and one heterozygous individual, CII.3, normalised to homozygous wild type family individual CII.4. Error bars indicate the standard error of 6 technical replicates for each sample as calculated using the User Bulletin #2 for the ABI PRISM 7700 sequence detection system (2001).

Figure 5.5 shows that as with the previous probes, SP110b mRNA expression is similarly reduced in each of the affected individuals. The average SP110b expression is reduced to 9.0% ± 7.0% for individuals with the c.642delC mutation. The heterozygous individual CII.3 shows an expression level of 50.1% ± 9.2%. patient 1 showed a reduction in mRNA expression of 28.6% ± 4.4%.

Figure 5.5: SP110b mRNA expression.

Legend: Results using Taqman® probe Hs00185406_m1 in five affected individuals: CII.1, BII.1, BII.2, AII.1 and Patient 1, and one heterozygous individual, CII.3, normalised to homozygous wild type family individual CII.4. Error bars indicate the standard error of 6 technical replicates for each sample as calculated using the User Bulletin #2 for the ABI PRISM 7700 sequence detection system (2001).

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 102

patient 3, with a c.667+1dup mutation was also examined, and these results are published in Cliffe et al. (2012). This showed levels of SP110b mRNA reduced to 36.0% ± 2.7%, and SP110c reduced to 66.0% ±1.9%, consistent with the reduction in mRNA expression levels observed with the c.642delC and c.319_325dupGGTGCTT mutations.

5.2.14. SP100 and SP140 mRNA expression is not reduced

In marked contrast to the results from all three probes targeting different SP110 isoforms, neither SP100 nor SP140 showed a reduction in expression, as demonstrated in Figure 5.6 and Figure 5.7 below. Figure 5.6 shows that the average expression of SP100 is 111.6% ± 14.9% for individuals with the c.642delC mutation, and 123.7% ± 17.6% for the unaffected sibling CII.3.

Figure 5.6: SP100 mRNA expression.

Legend: Results using Taqman® probe Hs00162109_m1 in four affected individuals, CII.1, BII.1, BII.2 and AII.1, and one heterozygous individual, CII.3, normalised to an unrelated homozygous wild type individual. Error bars indicate the standard error of 6 technical replicates for each sample as calculated using the User Bulletin #2 for the ABI PRISM 7700 sequence detection system (2001).

Figure 5.7 shows that the average expression of SP140 is 105.7% ± 11.1% for individuals with the c.642delC mutation, and 111.8% ± 15.4% for the unaffected sibling CII.3.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 103 Figure 5.7: SP140 mRNA expression.

Legend: Results using Taqman® probe Hs00610654_m1 in four affected individuals, CII.1, BII.1, BII.2 and AII.1, and one heterozygous individual, CII.3, normalised to homozygous wild type family individual CII.4. Error bars indicate the standard error of 6 technical replicates for each sample as calculated using the User Bulletin #2 for the ABI PRISM 7700 sequence detection system (2001).

These results all show that there is a consistent reduction of SP110 mRNA detected in B-lymphoblastoid cell lines of affected individuals. This reduction is also observed to a lesser degree within heterozygous individuals, and no reduction is observed in the normal family member. It is very likely that this reduction is due to nonsense-mediated decay, and these data suggest that feedback loops do not lead to any compensatory increase in the level of expression, or that any increase is insufficient to overcome the effects of NMD. No corresponding changes in mRNA levels were seen in the evolutionarily related, physically adjacent control genes, SP100 and SP140, consistent with the view that these genes are not directly involved in the VODI pathology.

To detect any splice variants in patient 1 or patient 4, primers were designed that lay across exon-exon boundaries, and extracted patient cDNA was amplified and migrated on an SDS-PAGE gel. No bands of reduced size consistent with aberrant splicing were detected in either patient, indicating that the sequence variations do not cause splicing defects (data not shown).

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 104 5.2.15. Western Blot

During a visit to the laboratory of Prof Donald Bloch, Massachusetts General Hospital, Boston, this researcher performed a number of protein blot analyses using an anti-SP110 autoantiserum. This antiserum was isolated from an individual with primary biliary cirrhosis, and contained autoantibodies to many promyelocytic nuclear body proteins (Bloch et al. 1996; Bloch et al. 2000). The western blot in Figure 5.8 confirmed the absence of SP110 protein expression in the transformed B-lymphoblastoid cell line from affected individual AII.1 with the c.642delC mutation, unlike the homozygous wild-type sibling CII.4. These data are consistent with the loss of full length SP110 in the affected individuals with homozygous mutations in the SP110 gene. These data were published in Roscioli et al. (2006).

Figure 5.8: Immunoblot showing the absence of SP110b and SP110c isoforms in an affected individual (AII.1), and a homozygous wild type family member (CII.4).

AII.1 CII.4

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 105

5.2.16. Immunohistochemistry

Although the western blotting results support the concept that SP110 expression is markedly diminished in VODI lymphoblasts, it was also possible that denaturation of the protein in the western blot procedure could lead to a false negative result. Therefore in order to validate the western blotting result, immunohistochemical analysis of patient cells was also performed. and Figure 5.10 below show that control SP100 staining was consistent with normal promyelocytic leukaemia nuclear body (PML-NB) formation and numbers in both the affected individual AII.1, and the unaffected heterozygous sibling CII.3. These data were published in Roscioli et al. (2006).

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 106 Figure 5.9: Staining of B-LCLs of affected individual AII.1 with anti-SP100 antibodies.

DAPI

SP100

Figure 5.10: Staining of B-LCLs of unaffected individual CII.3 with anti-SP100 antibodies.

DAPI

SP100

In contrast, Figure 5.11 and Figure 5.12 below show that SP110 staining was normal in the unaffected heterozygous sibling CII.3, showing several intense spots consistent with recruitment of SP110 to the PML-NB. The affected individual AII.1 however showed an absence of nuclear staining, consistent with a dysfunction of the localisation of the protein.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 107 Figure 5.11: Staining of B-LCLs of affected individual AII.1 with anti-SP110 antibodies.

DAPI

SP110

Figure 5.12: Staining of B-LCLs of unaffected individual CII.3 with anti-SP110 antibodies.

DAPI

SP110

These data are consistent with a reduction of expression of SP110, with aberrant cellular localisation, without disruption of the PML NB in individuals with VODI. This suggests that SP110 is not crucial for the formation of the PML NB as this macromolecular complex appears to be found with normal distribution and size within the nucleus in individuals without functional levels of SP110.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 108 5.3. Mutation screen of SP110 in other diseases

Given the clustering of the six reported mutations in SP110 to just three exons it was an open question as to whether mutations in other parts of the SP110 gene could be associated with other forms of immunodeficiency. common variable immunodeficiency (CVID) is the most prevalent primary immunodeficiency that requires clinical intervention. The disorder is characterized by defects in the terminal stages of B cell differentiation, manifested as reduced numbers of memory B and plasma cells, with low levels of serum immunoglobulins and impaired antibody responses. CVID patients are at increased risk of sinopulmonary, gastrointestinal and autoimmune disorders and an elevated risk for non-Hodgkin’s and gastrointestinal malignancies (Quinti et al. 2007). Patients are categorized as CVID when they fulfill certain diagnostic criteria (www.esid.org; IUIS, 1999) and when other known causes for their immunodeficiency have been excluded. A recognizable Mendelian pattern of inheritance can be identified in only 15-25% of cases of CVID and of these 80% are autosomal dominant (AD) families. The only gene that has been associated with AD CVID is TNFRSF13B (encoding the TACI protein). Approximately 20% of multiplex families show autosomal recessive (AR) inheritance and mutations in the ICOS , TNFRSF13B , BAFF-R and CD19 genes have been implicated in these families (Salzer et al. 2007). Overall, a pathogenic mutation can be identified in only 10% of patients with CVID.

Several genome-wide linkage studies have been performed on collections of multiplex CVID families, with reports of linkage to the HLA locus and to chromosome 4q and 16q (Finck et al. 2006; Kralovicova et al. 2003). The small number of multigenerational families, inconsistency in linkage results between studies and the production of different linkage results for the same cohort under different clinical definitions indicates that traditional linkage is unlikely be successful in future gene discovery in CVID.

It is notable that VODI and CVID share some common immunophenotypic features. These include respiratory infections, low immunoglobulin levels, splenomegaly, low circulating B memory cells and absent germinal centres.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 109 CVID differs from VODI with a later age of onset, an increased cancer risk, and a T cell defect in 40% of CVID patients. Conversely, the characteristic veno- occlusive disease of VODI has not been reported in any cases of CVID. This is not without genetic precedent - there are multiple examples of mutations within the same gene being associated with divergent phenotypes, for example mutations in RAG1 and RAG2 are pathogenic in both Omenn syndrome (Villa et al. 1998), as well as in SCID (Schwarz et al. 1996), despite the two diseases presenting with quite different laboratory and clinical manifestations. It was proposed that SP110 therefore represented a candidate gene in cases of CVID where a genetic basis was unknown, and a systematic screen of cohorts of both sporadic and autosomal-recessive CVID was undertaken. This screen also examined the related, and physically adjacent gene SP140 . These two genes share significant similarity, and personal communications suggested that SP110 and SP140 interact, so SP140 was also considered to be a potential candidate gene.

DNA samples from people with a diagnosis of CVID were made available by Dr Ulrich Salzer of University Hospital Freiburg, Germany. This cohort of CVID patients is one of the largest and most intensively studied CVID cohorts available, and has been screened for mutations in the known and candidate CVID genes: ICOS, TACI, BAFFR, CD19, APRIL , BCMA , IL10 , IL10RA , IL10RB , IL21 , IL21R and CCL18 (Salzer et al. 2008). This cohort consisted of 86 sporadic CVID cases (84 European descent, 1 Iraqi and 1 Turkish) and 18 people with autosomal recessive CVID (10 European descent, 1 Iranian, 5 Turkish and 2 Lebanese). 2 IgAD samples were also examined (both of European descent).

5.3.1. SP110 and SP140 sequencing analysis in CVID and IgAD

A sequencing screen was undertaken to determine whether there were any point mutations, small insertion/deletions, or other changes detectable by sequencing. The sequencing methodology used is described in the Methods chapter, and primer sequences in Appendix Table 9.4 of this thesis. The nucleotide sequences were base-called using Sequence Analysis software from

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 110 Applied Biosystems, and analysed with the Mutation Explorer software from SoftGenetics. The SP110 amplicon sequences were aligned against NM_080424.2 ( SP110c) and NM_004510.3 ( SP110b) and the SP140 sequences were aligned against NM_007237.4.

This analysis did not detect any nonsense mutations or frame-shifting mutations in the sequenced exons of either SP110 or SP140 . A number of synonymous variants were observed in both SP110 and SP140, all of which were associated with a dbSNP reference number. No further in vitro analysis was performed on these variants. A number of low-frequency nonsynonymous single nucleotide polymorphisms were detected, and these are listed in Table 5.2 below. Two novel single nucleotide polymorphisms were detected, each in a single patient: SP110b R544G and SP140 N149K. These sequence variants are discussed in further detail below.

Table 5.2: Variants in the SP110 and SP140 screen of CVID and IgAD patients.

Frequency Grantham Gene Variant Exon (%) dbSNP dist Sporadic SP110 CVID G126S 4 1.3 rs41309086 56 86 Cases A128V 4 19.3 rs11556887 64 E267G 7 6.0 rs1129425 98 S425L 11 16.7 rs3948464 145 R544G 15' 1.2 Novel 125 SP140 N149K 4 1.1 Novel 94 Autosomal- SP110 Recessive A128V 4 11.1 rs11556887 64 CVID 18 Cases SP140

None

detected

5.3.2. SP110b R544G

In a single CVID patient, identified as MB043, a heterozygous c.1630A>G sequence variant was detected in the alternate exon 15 of isoform SP110b (NM_004510.3). This change turns an arginine into a glycine at position 544 of

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 111 the SP110b protein product. This is a novel variant that has not been reported on dbSNP. Multiple sequence alignment at this position shows a moderately conserved amino acid, and the Grantham distance of these two residues is 125 [0-215]. This sequence variant is predicted by Polyphen-2 to be probably damaging with a score of 0.992, and SIFT predicts that this variant will affect protein function (with low confidence).

5.3.3. SP140 N149K

A second novel sequence variant was detected in a single patient, MB023. This heterozygous c.447C>A sequence variant causes an asparagine substitution to a lysine at the 149 position of the SP140 protein product. This variant has also not been reported on dbSNP. Multiple sequence alignment of this residue shows weak conservation, and the Grantham distance is a moderate 94 [0-215]. This sequence variant is predicted by Polyphen-2 to be benign with a score of 0.128, and SIFT predicts that this substitution would be tolerated.

5.3.4. SP110 A128V

The SP110 c.383C>T sequence variant was detected in 16 of the patients with sporadic CVID and in 2 of the patients with Autosomal-Recessive CVID. This variant causes the substitution of the highly conserved alanine residue to a valine at position 128 of the SP110 protein. The Grantham distance between these two residues is small, 64 [0-215], however Polyphen-2 predicts that this variation is probably damaging with a score of 0.998. SIFT also predicts that this variation would affect protein function, with low confidence. This sequence variant has been reported in dbSNP as rs11556887, and is a validated SNP showing a heterozygosity rate of 18.6% in the Caucasian European Hapmap dataset.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 112 5.3.5. Other low-frequency variants

Three more low-frequency variants were detected in SP110 . The heterozygous SP110 variant G126S was observed in a single sporadic CVID patient, MB084. This sequence variant has been reported on dbSNP as variant rs11556887, but is unvalidated. The Grantham distance between these two residues is low (56 [0-215]), Polyphen-2 predicts this variant to be benign with a score of 0.013, and SIFT predicts this variant will be tolerated.

The heterozygous SP110 variant E267G was observed in 5 individuals with sporadic CVID. This sequence variant has been reported in dbSNP as variant rs1129425. The affected residue is moderately conserved, and the Grantham distance between these residues is 98 [0-215]. Polyphen-2 predicts that this variant is probably damaging with a score of 0.995, however SIFT predicts that this variant would be tolerated.

The heterozygous SP110 variant S425L was observed in 17 individuals. This sequence variant has been reported on dbSNP as variant rs3948464, but is unvalidated. This residue is weakly conserved, and although the Grantham distance between these two residues is high (145 [0-215]), Polyphen-2 predicts this variant to be benign with a score of 0.000. SIFT also predicts that this variant would be tolerated.

5.4. Discussion

The validation process undertaken in this chapter provides substantial evidence that mutations in SP110 cause the VODI phenotype. Firstly, five different mutations in this gene are associated with the disease, including four different frame-shifting insertions and deletions that are protein-truncating mutations, and a missense mutation of a highly conserved residue. It is a truism in genetics that one of the best lines of evidence that mutations within a gene are the cause of a given syndrome, is the identification of multiple pathogenic alleles of the gene that are associated with the same disorder.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 113 Second, these mutations were detected in the homozygous state in all affected individuals, and were heterozygous or homozygous wild type in all unaffected family members. None of these mutations were detected in 100 ethnically matched chromosomes. In silico analysis indicates that the non-truncating mutation occurs in a highly conserved region, and is predicted to be not tolerated.

Third, mRNA analysis indicates that the affected RNA is targeted for nonsense mediated decay, with consistent reductions in SP110 levels being detected with all three SP110-targeting probes. Notably, a reduction in mRNA was also detected in the unaffected heterozygous sibling. Reduction of mRNA expression was not detected in the physically adjacent and functionally-related genes SP100 and SP140 .

Fourth, western blotting showed that SP110c protein expression was absent at the expected size in patient B-LCLs, and immunohistochemistry showed that the cellular localisation of the defective protein was aberrant. Taken together, these results confirm the prima facie hypothesis that mutations in the SP110 gene cause VODI syndrome.

It is interesting to note the uneven distribution of the mutations in the SP110 gene, with 11 of the 12 patients described in this Chapter displaying homozygosity for protein-truncating mutations in SP110 in coding exons 2, 4 and 5. No mutations have been detected 3’ of exon 5, and they are all located in the region which is common to all mRNA isoforms. If abolition of the putative gene interaction domains encoded in the 3’ region of the gene (the SAND, bromodomain and PHD domains) were critical for SP110 function, then truncating mutations located anywhere in the gene might be expected to generate VODI-alleles. Although further mutation screening will be required to confirm that the spectrum of truncating mutations is in fact non-random, the currently observed skewed distribution suggests that alternative mechanisms, other than simply disruption of DNA binding/transcriptional regulation, may be important factors for VODI pathogenesis.

Prof Donald Bloch has recently provided evidence that the missense mutation p.I27L also produces an unstable protein with markedly reduced protein levels, consistent with the results presented in this thesis and in Roscioli et al (2006)

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 114 and these results are published in Cliffe et al. (2012). Therefore each mutation documented to date results in a reduction of SP110 expression, suggesting that the reduction in protein expression is the key pathogenic event that causes the typical findings of not only immunodeficiency but also veno-occlusive disease.

It could be speculated that the known mutations in VODI produce two effects; reduction of gene expression and abolition of the 3’ region of the SP110 gene. These two events may have different consequences in the different tissues associated with VODI pathology. For example it may be that the immunodeficiency is predominantly due to alteration in the transcription of critical T and B cell genes, whereas the veno-occlusive disease is predominantly due to the reduction of structural SP110 for incorporation into nuclear bodies. The possibility that SP110 mutations may have an effect on critical immune cell gene transcription is investigated in the following Chapter 6.

The role of nuclear bodies is still poorly understood. SP110 , SP100 and SP140 are all related to Promyelocytic Leukaemia Nuclear Body (PML-NB). Evidence points to the role of SP100 as a PML-NB matrix component (Wiesmeijer et al. 2002). A number of other functionally related proteins, including SP110 and SP140, are recruited to the PML-NB (Hofmann and Will 2003). It is an interesting observation that autoantibodies derived from people with primary biliary cirrhosis have been utilized to identify the cDNAs encoding the PML-NB components SP100 and SP140 (Bloch et al. 1996; Szostecki et al. 1990) – this provides a link between the PML-NB and dysfunction of the liver, and may suggest that the nuclear body has a role in the hepatic veno-occlusive disease component of this disorder.

SP110 may also play a role in the response to viral infection. The involvement of PML-NBs in the pathogenesis of Promyelocytic leukaemia and acute viral infections is well described (Chelbi-Alix et al. 1998; Lallemand-Breitenbach et al. 2001; Walsh et al. 2006; Zhong et al. 2000). PML NBs have also been implicated in transcriptional regulation, the antiviral response, DNA repair and apoptosis (Carbone et al. 2002; Everett 2001; Regad and Chelbi-Alix 2001; Wang and Todd 2003; Zhong et al. 2000), however the total spectrum of the function of these macromolecular complexes is still debated. Between 10-30 PML-NBs localize to the nucleus and their components disperse in response to

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 115 cellular damage (heat shock, cadmium) and viral infections (Negorev and Maul 2001). SP100 and PML are induced by IFN γ (Chelbi-Alix et al. 1995; Guldner et al. 1992; Lavau et al. 1995; Stadler et al. 1995), consistent with a role in antiviral response. PML over-expression induces resistance to vesicular stomatitis virus and Influenza A virus (Chelbi-Alix et al. 1998). In addition, SP110b has been demonstrated to be a transcriptional co-repressor of the retinoic acid receptor alpha (RAR α). The hepatitis C virus (HCV) core protein has been shown to interact with the SP110b isoform causing its sequestration from the nucleus, resulting in inactivation of SP110b repressor action, thus promoting all-trans -retinoic acid (ATRA)-induced cell death (Watashi et al. 2003a).

5.4.1. SP110 and SP140 variation in CVID

The immune phenotype similarities between VODI and CVID were a sufficient reason to screen for pathogenic mutations in SP110 , and the related gene SP140 . Unlike in VODI, no nonsense or frame-shifting mutations were detected in the CVID cohort. A number of low frequency SNPs were detected in the heterozygous state in the sporadic CVID cohort, that were predicted by in silico analysis to be potentially damaging including a novel R544G SNP in SP110b, however it is worth noting that a recent review of pathogenicity prediction accuracy of available analysis algorithms by Thusberg et al. (2011) rated the accuracy of PolyPhen 2 as 0.71, and of SIFT as 0.65. As such, it is recommended that further functional testing of the biological significance of these variants should be considered in order to classify these sequence variants in the SP110 gene.

5.4.2. SP110 variation and susceptibility to Mycobacterium tuberculosis infection

The publication of the role of SP110 in VODI was contemporaneous with the exploration of another interesting role for the gene. Pan et al. identified a mouse strain, C3HeB/FeJ, that shows a significantly increased susceptibility to tuberculosis infection. This particular mouse strain lacks intra-macrophage expression of Ipr1 - the closest homologue of human SP110 in mice, sharing

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 116 41% identity with SP110b (Pan et al. 2005). This led to a number of gene association studies to determine the extent of the effect of SP110 on tuberculosis susceptibility.

A study by Tosh et al. found the initial positive association for SP110 in genetic susceptibility to tuberculosis in a study of 27 SNPs using a family based design, including 219 families from The Gambia, 99 from the Republic of Guinea, and 102 from Guinea-Bissau (Tosh et al. 2006). Three SNPs were detected with significant p-values, rs2114592 (p<0.02), SP110int10 (p<0.02), and rs3948464 (p<0.01). These results conflicted with a subsequent study by Thye et al. which found no association of 21 SP110 alleles with pulmonary tuberculosis in a cohort of over 1000 sputum positive West African patients, and >1000 apparently exposed healthy controls (Thye et al. 2006). A resequencing and association analysis by Szeszko et al. also found no significant association with tuberculosis susceptibility (Szeszko et al. 2007). This study genotyped 29 SP110 polymorphisms, in a study population of 1,528 patients from St Petersburg and 384 from Samara. 2,104 control samples were obtained from adult blood bank donors with no history of tuberculosis. Interestingly, a number of SNPs gave p-values that were almost significant, but rs3948464 was not one of them (p<0.92). A short report by Babb et al. also showed no association of 8 SP110 polymorphisms in a South African population, including rs3948464 (p<0.828). This study examined 381 cases with tuberculosis and 417 healthy controls - however it does not identify whether or not the healthy controls had been exposed to tuberculosis. More recently, a study by Zembrzuski et al. examined the role of two SP110 polymorphisms in susceptibility to tuberculosis in the Xavante, an indigenous group in Brazil (Zembrzuski et al. 2010). Unfortunately, both SP110 alleles were either non polymorphic or had very low variability, so no useful data were obtained. Most recently, a study of the Chinese population by Liang et al. identified 2 SP110 variants that were associated with susceptibility to tuberculosis, rs11556887 (p<0.005), and rs1135791 (p<0.0062). A total of 6 SP110 variants were genotyped in a cohort of 308 pulmonary TB patients and 628 healthy controls taken from clinically normal blood donors (Liang et al. 2011).

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 117 The combination of each of the negative and positive associations presented in each of these studies leaves a very confusing situation. It is important to differentiate between the studies that use controls that are negative for tuberculosis despite exposure, and healthy controls that are unlikely to have been exposed to tuberculosis. There is also some disparity in how tuberculosis positive patients are ascertained in each of the studies, for example whether or not extra-pulmonary tuberculosis and HIV-positive patients were excluded. As such, while candidate gene association studies can be useful, it seems unlikely that further studies into the link between SP110 polymorphisms and susceptibility to tuberculosis will clarify the situation. Another means of study should be pursued.

One such direction of study has been to examine the expression of SP110 in the cells of affected individuals. Maddocks et al. used cDNA microarrays to identify the global gene responses of primary human macrophages to co- infection with HIV and Mycobacterium tuberculosis (Maddocks et al. 2009). This approach identified a number of genes related to the interferon signalling cascade, and included SP110 , which was upregulated 2.1 fold in the affected cell lines . This result is corroborated by another study that measured mRNA levels of SP110 , as well as CORO1A and TLR2 , in 22 patients with pulmonary tuberculosis (Constantoulakis et al. 2010). Constantoulakis et al. found that SP110 expression was significantly higher in the PBMCs of patients with active tuberculosis than in uninfected patients. Taken together, these studies indicate that increased SP110 expression is associated with tuberculosis infection, and suggests that SP110 forms part of the cellular response to infection. These results are also consistent with the enhanced susceptibility to TB exhibited by the C3HeB/FeJ mouse strain in which SP110 is inactivated. The lack of obvious susceptibility of VODI patients to mycobacterial infection suggests that the nature of the mutation in the C3HeB/FeJ strain may also contribute to this susceptibility as it is clear that the murine mutation is a genomic rearrangement event that involves both DNA sequence and copy number changes and does not recapitulate the human mutational architecture.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 118 5.4.3. Prenatal diagnosis of VODI

One of the important outcomes of the identification of pathogenic genetic mutations is the ability to provide an accurate estimate of recurrence risks for an affected family. This includes, but is not limited to, prenatal diagnosis of the mutation status of a foetus. The results from the reported research, and from the work of Dr Roscioli, led to the design and publication of a prenatal diagnosis procedure (Cliffe et al. 2007), which is offered solely by the South Eastern Area Laboratory Service laboratory at the Prince of Wales and Sydney Children’s Hospital, Australia. This laboratory also provides carrier testing for at-risk family members ( http://www.ncbi.nlm.nih.gov/books/NBK1271 ).

5.5. Summary

This chapter describes the mutation detection and validation of 11 families with VODI, which came as a result of a homozyogosity mapping study of three consanguineous patients. This has led to the identification of five mutations in the SP110 gene, and accounts for all of the families studied. The lines of evidence that confirm the pathogenicity of the SP110 c.642delC mutation specifically, and SP110 as the disease gene in VODI, were 1) that this disease allele was not detected in 100 ethnically matched control chromosomes, 2) that multiple mutations were described in the homozygous state in affected individuals, and which co-segregated with disease in all families, 3) expression studies showed that SP110 expression was reduced in affected and heterozygous individuals – likely as a result of nonsense-mediated decay, 4) western blot showed the normal SP110 bands were absent in affected individuals, and 5) immunohistochemistry showed that the mutant SP110 did not co-localise with the PML-nuclear body in affected individuals, unlike a normal control.

Taken together, these lines of evidence are strong proof that SP110 is the disease gene responsible for VODI. A screening study did not find evidence that mutations in SP110 were a common cause of CVID, however there remains a

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 119 possibility of a more subtle role for the gene in this disease, and in other immune dysfunctions such as susceptibility to tuberculosis. To explore these possibilities, and to generate a greater understanding of the aetiology of the VODI phenotype, the following chapter describes the result of a whole genome expression analysis of VODI patients aimed to achieve that goal.

Chapter 5: VODI Syndrome is Due to Mutations in the SP110 gene 120 CHAPTER 6: Whole genome expression profiling in VODI

6.1. Objectives

1) To discover whole genome expression differences between VODI affected patients and an unaffected control group.

2) To discover affected pathways that may elucidate the aetiology of the VODI phenotype.

6.2. Introduction

In the previous Chapter 5, studies identified SP110 as the dysfunctional gene in VODI syndrome. The demonstration that mutations in SP110 are fully penetrant causes of a primary immunodeficiency disorder raises a number of important questions as to the function and the cellular role of this protein and the part it plays in the aetiology of the VODI phenotype, particularly in view of the paucity of previous research relating to SP110 .

A classical approach to the experimental exploration of SP110 dysfunction would involve the genetic manipulation of one or more inbred strains of laboratory mouse. However, it appears that SP110 is one of a small number of genes where this approach may not be feasible. Firstly, an existing laboratory mouse strain, C3HeB/FeJ, lacks intra-macrophage expression of Ipr1 - the closest homologue of human SP110 in mice, sharing 41% identity with SP110b (Pan et al. 2005). The defining characteristic of this mouse strain is an extreme susceptibility to tuberculosis. This differs significantly from the VODI phenotype in humans, raising the possibility that the proteins may have slightly different

Chapter 6: Whole genome expression profiling in VODI 121 biological roles in the two mammals. Discordant immunological phenotypes between human and mice are well documented - in their review of this issue in 2004, Mestas and Hughes identified 70 discordancies between human and mouse immune systems involving both innate and adaptive immunity.

Secondly, the genomic structure of the SP110 gene in the mouse prohibits simple germline genetic manipulation, as it is incorporated into a rearranged and amplified genomic region containing approximately 60-2,000 copies of SP110 and ~20 adjacent genes (Agulnik et al. 1993; Traut et al. 2001; Weichenhan et al. 2001). An important consequence of this genomic rearrangement is that it has not been feasible in the laboratory to produce a genetic knockout which is specific to SP110 by gene targeting. This finding would also suggest that overexpression is unlikely to be associated with an abnormal phenotype given Ipr1 is constitutively amplified, and presumably functional, in all mouse strains except for C3HeB/FeJ.

In view of these difficulties, a decision was made to study the effects of SP110 deficiency in cell lines generated from VODI patient cells and tissues. The measurable reduction of SP110 mRNA levels in EBV-transformed B lymphoblastoid cell lines derived from affected individuals and heterozygous carriers of VODI were described in Chapter 5.

There was reason to suspect that a differential RNA expression approach would be fruitful, as SP110 may play a role in the modulation of transcription. As described in Chapter 5, SP110 is associated with the PML nuclear body, which has a complex role in the cell, with probable involvement in the regulation of biological pathways involving apoptosis and response to viral infection (Regad and Chelbi-Alix 2001). Also, SP110b has been reported as a transcriptional corepressor of retinoic acid receptor alpha-mediated pathways, and SP110c as a co-activator (Watashi et al. 2003b). Similar to the PML nuclear body, RAR α pathways are involved in the regulation of apoptosis, and with protection from viral infection. Taken together, these data suggest that SP110 plays a role in the regulation of transcription of certain cellular pathways, and imply that SP110 deficiency could result in measurable differences in the expression of SP110- regulated genes.

Chapter 6: Whole genome expression profiling in VODI 122 The hypothesis explored in this chapter is that there will be a detectable signal of mRNA expression changes within the VODI-affected individuals, and that this signal will allow inferences to be made about the function of the SP110 gene, and the aetiology of the VODI phenotype.

6.2.1. Gene expression profiling in B-lymphoblastoid cell lines

Agammaglobulinaemia and combined immunodeficiency are among the most severe and consistent features of the VODI phenotype. Blood-based samples are the most readily available sources for material for gene expression studies, however ready access to the VODI affected individuals was not possible. Therefore, B-lymphoblastoid cell lines (BLCL) offered an appropriate tissue type for examination that was already available for analysis in four affected individuals. Min et al. in 2010 indicated that although gene expression analysis could clearly discriminate between whole blood- and BLCL- extracted RNA, BLCLs were less variable and expressed more genes. BLCLs showed an increase in probes enriched for the GO term “Cell cycle phase”, and it was suggested that this may reflect the indefinite BLCL propagation (Min et al. 2010). BLCLs express all known SP110 transcripts, and these transcripts were all reduced in each of the VODI affected individuals studied in Chapter 5. Other members of the SP100-like gene family, SP100 and SP140 were demonstrated to be expressed in BLCLs of affected individuals, and did not show reduced expression.

A number of genome-wide expression profiling studies of disease using BLCLs have been published – a PubMed search of “lymphoblastoid” and “microarray” identified 90 studies as of September 2011. Two notable examples of were successful in identifying differentially transcribed genes in patients with Fragile- X (Bittel et al. 2007a) and Prader-Willi (Bittel et al. 2007b) syndromes. In the first study in 2007, Bittel et al. examined four cases with Fragile X syndrome with four control samples. 90 differentially expressed genes were detected with a relative expression differential of greater than 1.5 fold. 10 genes were selected for further validation using a more sensitive RT-PCR system. Each of these were found to be significantly differentially expressed in the same

Chapter 6: Whole genome expression profiling in VODI 123 direction as indicated by the microarray results, confirming the usefulness of whole genome expression array as a screening protocol to generate hypotheses about the aetiology of disease. The second study into Prader-Willi syndrome examined 13 patients in a similar fashion. In that report, 323 probes were found to be significantly differentially expressed.

6.2.2. Subjects and Methods

B-cell lymphoblastoid cell lines were available from four of the affected individuals described in Chapter 5: BII.1, BII.2, CII.1, and patient 4. Five unrelated, unaffected B-LCL lines were sourced from Professor John Zeigler at the Sydney Children’s Hospital at Randwick. The results of the four VODI affected individuals were subsequently pooled as the ‘VODI’ group, and the five unaffected samples as the ‘CONTROL’ group for downstream analysis.

Whole genome expression analysis was performed using the Illumina WG-6 Human v2.0 microarray platform. This microarray allows for the assay of more than 48,000 transcripts and profiles six samples simultaneously on a single array. Quality control was performed using the BeadStudio software package.

Total RNA was harvested from these BLCL cultures according to the methods described in Methods section 3.1.5. RNA quality was examined on an agarose gel, and by UV spectroscopy. Differential gene expression was determined using an Illumina Human WG-6 Genechip, and analysed using BeadStudio software. The reliability of results obtained from the cDNA microarray was assessed using a Taqman based RT-PCR method, as described in Methods section 3.3.2. These experiments were performed on RNA harvested from independently cultured cell lines, under identical conditions.

6.2.3. Statistical Analysis

The most commonly used parametric method of determining differentially expressed genes from microarray data is the two-sample t-test (Dudoit et al. 2002). However, as Jeffrey et al. (Jeffery et al. 2006) reports, t-test analyses can give spurious results in studies with low sample numbers due to the

Chapter 6: Whole genome expression profiling in VODI 124 increased likelihood of low inter-sample variability due to chance alone. For this reason, further analysis using the Significance Analysis of Microarrays software package (Tusher et al. 2001b) was performed to generate a robust list of differentially expressed genes. A threshold of a 1.5 fold expression differential was selected. This differential signal intensity cut-off was selected because reports in the literature suggest that 1.5-fold increases or decreases in gene signal intensity are generally reproducible and expression changes of 1.5-fold can be confirmed by quantitative RT-PCR (Bittel et al. 2007a; Bittel et al. 2007b; Hu et al. 2006). A 1.5x fold change is also the change in expression levels which would be associated with a typical duplication or chromosomal trisomy, both of which are well documented to be capable of having phenotypic effects.

6.3. Results

6.3.1. Preliminary analysis/Data cleanup

Before data analysis, an intensity-based filtering of array elements was undertaken, as recommended by Quackenbush (2002). This was achieved using the BeadStudio assigned detection p-value. Probe intensity data that were not significantly different from background intensity at a p<0.05 were defined as showing no detectable expression, and were given a nominal value of ‘2’. After this data cleaning, 21,747 (51%) of probes showed no detectable expression in any of the nine samples analysed. The data were then median- normalised to prepare the data for comparison.

6.3.2. Validation of Microarray results

The reliability of the microarray data was confirmed by the independent analysis of seven candidate genes using a Taqman gene expression assay. Independent confirmation of microarray data by RT-PCR has been reported as the most common method of array validation (Chuaqui et al. 2002). These seven genes were selected from a shortlist of candidate genes with a

Chapter 6: Whole genome expression profiling in VODI 125 differential expression of at least 1.5 fold, and that were found to be significantly differentially expressed using a Student’s t-test at a p value of 0.05. In all seven genes, the case:control expression differentials were all in the same direction as those detected in the microarray screen, and were of an equivalent magnitude with a r 2 value of 0.83. The list of differentially expressed genes with their associated fold expression changes is given in Table 6.1 below.

Table 6.1: Differential expression comparison between Microarray and Taqman- based results. Gene Function Microarray Taqman Expression Expression

Reduced 95% CI Expression

Homozygous loss of the gene 0.074 +/- NDRG1 associated with demyelinating 0.06 .068 polyneuropathy, deafness.

0.33 +/- CYP11A1 Cytochrome p450 family member. 0.32 0.19

Increased

Expression

Involved in puracial and thymidine 7.23 +/- DPYD 4.05 catabolism. 1.11

Plays a role in small GTPase- 5.91 +/- RHOBTB3 mediated 4.43 0.39 signal transduction.

2.67 +/- STK17B Positive regulator of apoptosis. 2.82 0.39

1.63 +/- MUM1 Involved in the regulation of interferon 2.56 0.13

Mutations associated with familial 1.56 +/- BMPR2 2.04 pulmonary venoocclusive disease. 0.37

Chapter 6: Whole genome expression profiling in VODI 126 6.3.3. Microarray Data Breakdown

Having determined that the expression data generated by the arrays were valid, the next logical step was to investigate which genes and biological pathways were dysregulated. The Illumina GeneChip contains 48,701 probes, which target 42,648 known and predicted gene targets and splice variants. The BeadStudio software used to analyse these data gives a detection p-value, which indicates whether the signal can be distinguished from the background intensity. Using a BeadStudio detection threshold p < 0.05, an average of 15,914 gene probes were detected in the control group and 16,180 were detected in the VODI group, as shown in Table 6.2 below. This suggests that the SP110 -truncating mutation does not significantly activate or repress global expression.

As shown in Table 6.2, a total of 12,883 probes were detected in all five control samples, and 13,309 probes were detected in all of the four VODI samples. Thus, 12,097 (28.4%) were expressed in all samples, and 15,144 (35.5%) probes were detected in at least 2 case and 3 control samples.

Chapter 6: Whole genome expression profiling in VODI 127 Table 6.2: Summary of the results of the microarray analysis.

Microarray summary Total gene-probes 42648 CONTROLS Cont1 Cont2 Cont3 Cont4 Cont5 Total detected probes 16410 15721 16183 16096 15158 % 38.5% 36.9% 37.9% 37.7% 35.5%

VODI CII.1 BII.1 BII.2 Patient 4 Total detected probes 16136 16326 16272 15986 % 37.8% 38.3% 38.2% 37.5%

TOTAL CONTROL VODI Probes detected in all samples 12097 12883 13309 % 28.4% 30.2% 31.2% Probes detected in 2+ VODI or 3+ CONTROL 15751 16870 % 36.9% 39.6% Probes detected in 2+ VODI and 3+ CONTROL 15144 % 35.5%

The vast majority of probes show expression differentials between case and control groups of less than 1.5 fold. As an internal control, it was noted that the probe targeting SP110 was detected as downregulated to 0.24 of the normal (p< 6.47 x 10 -5) – consistent with results presented in Chapter 5 of this thesis.

A total of 4,276 probes showed greater than 1.5 fold differential up regulation in the VODI patient group, and 2,709 probes showed greater than 1.5 fold differential down regulation. This is consistent with prior data that the more prevalent SP110b isoform functions as a co-repressor of transcription (Watashi et al. 2003b), and the suggestion that the removal of this protein will tend to increase transcription of affected pathways.

Chapter 6: Whole genome expression profiling in VODI 128 6.3.4. Primary Immunodeficiency genes

A whole-genome expression approach was the goal of this project, and this follows in section 6.3.5 below. Before undertaking whole genome analysis, the 212 known primary immunodeficiency genes described in Chapter 2 of this thesis were used as candidate genes for differential expression analysis in VODI patients, as a pilot experiment. The total list of genes was median- normalised, and then a Student’s t-test used to identify genes that were significantly differentially expressed at a p-value of 0.05. The complete list of primary immunodeficiency gene differential expression is in Appendix Table 9.5, and the list of significantly differentially expressed PID genes is in Table 6.3

Table 6.3 below. No differential expression threshold was applied.

Table 6.3: PID genes that are differentially expressed in VODI.

Genes Expression T-test Controls Cases Decreased Expression SP110 0.22 4.5E-05 5 4 TNFRSF13C 0.53 8.1E-03 5 4 F12 0.67 4.2E-02 5 4 RFXAP 0.71 1.2E-03 5 4 LRRC8A 0.77 2.5E-02 5 4 TAP1 0.78 6.9E-03 5 4 IFNGR2 0.79 4.7E-02 5 4 Increased Expression ZAP70 10.79 4.4E-02 1 4 C4BPB 7.82 1.9E-02 4 4 CFP 3.85 9.5E-04 4 4 RAB27A 2.89 1.3E-02 4 4 CIITA 2.20 3.4E-03 5 4 RASGRP2 1.92 3.8E-02 5 4 CD55 1.69 1.0E-02 5 4 ADA 1.64 6.6E-03 5 4 JAK3 1.44 4.5E-02 5 4 G6PD 1.32 5.0E-02 5 4 ZBTB24 1.19 2.6E-02 5 4

The above table shows SP110 as clearly the most underexpressed gene from the PID gene cohort – which is to be expected. However, it is also notable that TNFRSF13C is also underexpressed in VODI patients. This gene was identified

Chapter 6: Whole genome expression profiling in VODI 129 with mutations in CVID (Warnatz et al. 2009), and further strengthens the suspicion that VODI and CVID share a common pathophysiology. BAFFR enhances B-cell survival in vitro , and is a regulator of the peripheral B-cell population, and also promotes the survival of mature B-cells and the B-cell response.

ZAP70 was detected with quite high overexpression in VODI patients, 10.8 fold. This result is interesting, as ZAP70 is involved in defective T-cell signalling (Arpaia et al. 1994), however the result is based on the results of only a single control sample – the other four did not show a detectable signal. RAB27A and RASGRP2 , both overexpressed in VODI, are both related to congenital defects in phagocyte number and function. CIITA , ADA , and JAK3 are all related to combined B and T cell dysfunction. ADA is upregulated in VODI patients; elevated levels of ADA have previously been associated with haemolytic anaemia, a process that can lead to jaundice and increase the risk of long term effects such as pulmonary hypertension.

6.3.5. Significance Analysis of Microarray results

To identify differentially expressed genes between cases and controls the dataset was analysed using the SAM software. The SAM software parameters employed were a false discovery rate of < 5% with a 2-class unpaired t-test, and a threshold of 1.5 fold expression differential. 1000 permutations were used, as recommended in the SAM user manual. A delta value of 1.28 was chosen, which corresponds to a median false detection rate of 4.78%, shown in Figure 6.1 below. The plot shows significantly differentially upregulated genes as red (upper right) and significantly differentially downregulated genes as green (lower left).

Chapter 6: Whole genome expression profiling in VODI 130 Figure 6.1: SAM plot of the actual intensity data with the observed SAM score plotted against the ‘‘expected’’ SAM score

From the total of 15,144 probes expressed in case and control lymphoblastoid cells, 253 (1.67%) were identified as showing significant differential expression with greater than 1.5-fold expression differential. Among these were 93 upregulated and 160 downregulated genes, shown in Table 6.4 below. Independent t-test calculations corroborated these findings of the SAM software, indicating that this is a robust gene list. Of particular note the probe targeting SP110 mRNA showed statistically significant differential downregulation (p<1.95x10 -5), consistent with the known aetiology of VODI and the results of RT-PCR expression studies in Chapter 5 of this thesis.

Chapter 6: Whole genome expression profiling in VODI 131 Table 6.4: Differentially expressed genes from SAM analysis

Gene Ratio Gene Ratio Gene Ratio Gene Ratio

1 IRAK3 9.61 33 ALDH2 2.59 65 MARCH2 1.82 97 LOC130576 10.00 2 MYH11 8.24 34 RUNX1 2.58 66 FBXW7 1.81 98 UNQ2541 9.09 3 C4BPB 7.71 35 FAM105A 2.58 67 MGC39900 1.79 99 PRODH 9.09 4 P2RX5 7.40 36 CSPG4 2.57 68 POPDC2 1.77 100 CYP4F3 8.33 5 SPINT2 5.56 37 CD83 2.56 69 EXOC2 1.76 101 PHGDH 8.33 6 IRAK3 5.27 38 MIB1 2.37 70 SUSD1 1.75 102 CXCL16 8.33 7 ROGDI 4.98 39 HS.439642 2.35 71 CUX1 1.74 103 KCNMB2 8.33 8 HMHB1 4.69 40 ELL2 2.33 72 ACP2 1.74 104 SCNN1B 7.14 9 TRIB2 4.51 41 HS.556255 2.29 73 PHF23 1.73 105 LOC126661 7.14 10 ZEB2 4.65 42 ALDH4A1 2.28 74 SESN1 1.73 106 LCE1B 7.14 11 VPS37B 4.38 43 MUM1 2.28 75 GNA15 1.72 107 COL5A1 6.25 12 C13ORF18 4.34 44 SDCCAG8 2.27 76 TM7SF3 1.69 108 PBX4 5.88 13 LOC728014 3.90 45 OSBPL3 2.16 77 SUMF1 1.67 109 AIM2 5.88 14 DPYD 3.82 46 MLLT11 2.10 78 HS.406790 1.63 110 INHBE 5.88 15 C21ORF91 3.88 47 FAM89B 2.09 79 LOC642921 1.62 111 HLA-C 5.56 16 CFP 3.70 48 C4ORF32 2.09 80 MKL1 1.61 112 IL12A 5.56 17 KCNMB4 3.74 49 CIITA 2.08 81 TMTC4 1.59 113 KCTD12 4.76 18 SLC4A11 3.65 50 LOC441461 2.07 82 HS.211298 1.59 114 SP110 4.76 19 HS.560343 3.55 51 HS.582009 2.07 83 ADA 1.57 115 CKAP4 4.17 20 ACOXL 3.60 52 RNF170 2.06 84 C7ORF49 1.56 116 TBC1D8 4.00 21 KIAA0746 3.37 53 F11R 2.05 85 LOC654191 1.55 117 ITIH1 3.85 22 LBH 3.31 54 PKIA 2.02 86 PACS2 1.55 118 SIT1 3.85 23 HNRPLL 3.33 55 JARID1B 2.01 87 RSU1 1.55 119 MSX1 3.70 24 NFKBIZ 3.08 56 CXXC4 1.99 88 FLJ35773 1.53 120 LCE1E 3.70 25 REL 3.09 57 HS.22689 1.96 89 HS.578383 1.53 121 CXORF57 3.70

Chapter 6: Whole genome expression profiling in VODI 132 Gene Ratio Gene Ratio Gene Ratio Gene Ratio

26 GSN 2.87 58 LOC652541 1.93 90 CERK 1.52 122 HS.465528 3.57 27 NMT2 2.73 59 KMO 1.92 91 SLC5A6 1.52 123 CYP11A1 3.45 28 PTK2 2.70 60 SFMBT2 1.90 92 MGC16169 1.52 124 CTH 3.45 29 ITPR2 2.64 61 BAZ2B 1.90 93 PPAPDC2 1.51 125 HS.226765 3.33 30 TNFSF4 2.63 62 FYTTD1 1.89 94 TIAM2 20.00 126 LCE1D 3.33 31 STK17B 2.61 63 FHOD1 1.87 95 NDUFA4L2 14.29 127 CD27 3.33 32 C20ORF108 2.60 64 ABCC10 1.83 96 EMR1 11.11 128 GPT2 3.33

129 PRSS16 3.33 161 SLC3A2 2.17 193 HMGCS1 1.82 225 GSTM4 1.61 130 HS.517692 3.23 162 SLC1A5 2.17 194 PDP2 1.79 226 SC65 1.61 131 PKHD1L1 3.23 163 TRIB3 2.17 195 CDK2AP2 1.79 227 LOC654174 1.61 132 MANEAL 3.13 164 ANG 2.17 196 LOC650826 1.79 228 FLJ21839 1.61 133 LRRC26 3.13 165 SELM 2.13 197 HS.131041 1.75 229 DPY19L2P2 1.59 134 SLC45A3 3.13 166 LOC651621 2.13 198 EMP3 1.75 230 TULP3 1.59 135 ZBTB32 3.13 167 FKBP11 2.13 199 FLCN 1.75 231 HS.551957 1.59 136 UPP1 3.03 168 ASAH1 2.08 200 TBC1D3C 1.75 232 LOC645535 1.56 137 TCEA3 2.94 169 LOC642559 2.04 201 PPP1R15A 1.75 233 HPS1 1.56 138 LOC440160 2.94 170 FLJ22639 2.04 202 RPL39L 1.75 234 SCD 1.56 139 WBP5 2.78 171 LOC143666 2.04 203 GNPDA1 1.72 235 LOC652595 1.56 140 CD84 2.78 172 SHMT2 2.04 204 CDT1 1.72 236 AVPI1 1.56 141 HS.88156 2.70 173 ARHGEF17 2.00 205 C21ORF57 1.72 237 PPP2R3B 1.56 142 LRIG3 2.70 174 HOXB7 2.00 206 LOC51149 1.72 238 ANKRD13A 1.56 143 HS.445414 2.56 175 DNAJC3 2.00 207 PDIA4 1.69 239 ANXA5 1.54 144 HS.577342 2.56 176 TNFRSF13C 2.00 208 SQSTM1 1.69 240 HSP90B1 1.54 145 SLC43A1 2.50 177 LY9 2.00 209 AARS 1.69 241 TMEM48 1.54 146 SLC6A9 2.38 178 BCKDHA 1.96 210 C18ORF19 1.67 242 SNHG4 1.54

Chapter 6: Whole genome expression profiling in VODI 133 Gene Ratio Gene Ratio Gene Ratio Gene Ratio

147 HS.487766 2.38 179 LOC642946 1.96 211 PLEKHA7 1.67 243 HS.566161 1.54 148 LOC388681 2.33 180 AFMID 1.96 212 ARL5B 1.67 244 EPS15L1 1.54 149 C22ORF34 2.33 181 HSPA5 1.96 213 GGH 1.67 245 RCC1 1.54 150 TMEM156 2.33 182 RHOV 1.96 214 ARMET 1.67 246 BNIP1 1.54 151 DHRS2 2.33 183 SLC7A5 1.96 215 C19ORF44 1.67 247 SLC20A1 1.52 152 BCAS4 2.33 184 SERPINE2 1.96 216 OPLAH 1.67 248 CDCA7L 1.52 153 NT5C3L 2.27 185 SLC7A1 1.92 217 UAP1L1 1.64 249 CCDC104 1.52 154 FAM119B 2.27 186 NUDT8 1.92 218 PGM3 1.64 250 SPATA7 1.52 155 EIF4EBP1 2.22 187 ZNF292 1.92 219 LILRA6 1.64 251 PGRMC1 1.52 156 C6ORF223 2.22 188 ENO2 1.89 220 LOC650215 1.64 252 LOC643430 1.52 157 TSPAN9 2.22 189 RNPC2 1.89 221 EXOSC5 1.64 253 PCK2 1.52 158 AMFR 2.22 190 HPCAL1 1.89 222 STT3A 1.64 159 ASNS 2.22 191 CST3 1.85 223 GARS 1.64 160 APOBEC3B 2.17 192 PKMYT1 1.82 224 PLP2 1.61

Legend: Red highlighted ratios are upregulated, Green highlighted ratios downregulated in VODI samples .

Chapter 6: Whole genome expression profiling in VODI 134 6.4. Downstream analysis

6.4.1. Gene Ontogeny term annotations

To uncover functional classes among the differentially expressed genes, and to avoid observational biases, the differentially expressed gene list was then classified into gene ontogeny classes using DAVID (Huang et al. 2009a; 2009b). Eleven clusters were identified by DAVID with significant enrichment scores ( ≥1.3) the details of which are provided in Table 6.5 below.

Table 6.5: DAVID enrichment clusters.

Enrichment Cluster Genes

Cluster 1 – cell fractions HIP1R, HMGCS1, HPS1, PKMYT1, ASNS, ACP2, TSPAN9, SLC1A5, STT3A, TIAM2, SPINT2, PGRMC1, ENO2, CERK, SCNN1B, CD27, PLP2, CKAP4, AARS, GARS, HLA-C, PKIA, ITPR2, HSP90B1, SLC6A9, CYP4F3, SLC5A6, AMFR, PLP2, HIP1R, CKAP4, HPS1, PKMYT1, ACP2, HLA-C, TSPAN9, ITPR2, SLC1A5, HSP90B1, SLC6A9, STT3A, TIAM2, PGRMC1, ENO2, CYP4F3, SLC5A6, AMFR, CERK, SCNN1B, CD27 Cluster 2 – transmembrane SLC1A5, SLC6A9, SLC7A1, SLC3A2, SLC5A6, SLC43A1, transport SLC7A5 Cluster 3 – negative regulation LOC400750, DHRS2, HSP90B1, MSX1, BNIP1, SQSTM1, of apoptosis AARS, ASNS, MKL1, ANXA5, CD27, ADA Cluster 4 – catabolic processes BCKDHA, ACOXL, ALDH4A1, KMO, AFMID, PRODH

Cluster 5 – ER signalling LOC400750, AARS, AMFR, PPP1R15A pathways Cluster 6 – biosynthetic CTH, SCD, PHGDH, ALDH4A1, ASNS, PRODH processes Cluster 7 – leukocyte/lymphocyte CD83, SIT1, IL12A, TNFRSF13C, RORA, CD27, ADA activation Cluster 8 – kinase regulator activity TRIB3, DNAJC3, PKIA, TRIB2 Cluster 9 – immune system CFP, CD83, IRAK3, IL12A, TNFRSF13C, C4BPB, CD27, ADA process Cluster 10 – regulation of AARS, STK17B, ARHGEF17, ASNS, ANXA5, ADA, LOC400750, apoptosis DHRS2, HSP90B1, MSX1, BNIP1, TIAM2, SQSTM1, IL12A, MKL1, CD27, PRODH Cluster 11 – lymphocyte/leukocyte CD83, SIT1, IL12A, TNFRSF13C, CD27, ADA activation

Chapter 6: Whole genome expression profiling in VODI 135 The cell fraction GO group, that was given the highest rank, was not considered biologically meaningful as it represents a diverse range of proteins enriched as the result of subcellular fractionation - an analytical biochemistry process rather than a biological process.

6.4.2. Immune System and Apoptosis

There was enrichment for GO terms associated with leukocyte and lymphocyte activation terms, and with the immune system [10 genes (4.0%)]. This is consistent with the observed VODI phenotype. Enrichment for terms associated with the regulation of apoptosis was also observed [17 genes (6.8%)] – this is also consistent with published data that implicate SP110 with the PML nuclear body, which is involved in apoptosis. These two enrichment groups combined, through the common members ADA , CD27 and IL12A, contain 24 genes - 9.6% of the SAM-generated differentially expressed gene list. The overlap of each of these enrichment clusters in illustrated in the Venn diagram in Figure 6.2 below.

Chapter 6: Whole genome expression profiling in VODI 136 Figure 6.2: Genes involved in immune system processes and regulation of apoptosis.

Negative regulation of apoptosis Regulation of apoptosis

AARS, ASNS, ANXA5, STK17B, ARHGEF17, LOC400750, DHRS2, TIAM2, PRODH HSP90B1, MSX1, BNIP1 SQSTM1, MKL1

ADA, CD27 Leukocyte/lymphocyte IL12A activation CD83, Immune system SIT1, RORA TNFRSF13C process

CFP, IRAK3, C4BPB

Among the genes of interest in the immune system enrichment cluster are the previously noted PID genes ADA , a gene responsible for a form of severe combined immunodeficiency, and TNFRSF13C , linked to combined variable immunodeficiency. Of the other immune related genes, CD27 is involved in the regulation of survival of activated T-cells, and may also play a role in apoptosis through association with the gene SIVA1 . IL12A is a cytokine that can act as a growth factor for activated T and NK cells, enhance the lytic activity of NK/lymphokine-activated killer cells, and stimulate the production of IFN γ. SIT1 negatively regulates TCR (T-cell antigen receptor)-mediated signalling in T- cells, and is involved in the positive selection of T-cells. CD83 plays a significant role in antigen presentation and cellular interactions that follow lymphocyte activation. IRAK3 is an essential component of the Toll/IL-R immune signal transduction pathways, acting as a negative regulator. This protein is primarily expressed in monocytes and macrophages. There are also a number of genes

Chapter 6: Whole genome expression profiling in VODI 137 that are related to the regulation of apoptosis, including the upregulation of STK17B , a positive regulator of apoptosis.

6.4.3. Glutathione synthesis

Interestingly, there was also a significant enrichment of terms associated with amino acid transport (7 genes (2.8%)). Several of these genes have reported functions that include transport of amino acids involved in the synthesis of glutathione in the liver; glutathione has been associated with protection from veno-occlusive disease. These are shown in the Venn diagram below.

Figure 6.3: Genes involved in amino acid transport.

Amino acid transport SLC1A5 SLC3A2 SLC6A9 SLC7A5

Carboxylic/organicSLC43A1 acid transport SLC7A1 SLC5A6

The relationship between glutathione concentration in hepatic tissues and veno- occlusive disease has been well established. Wilson et al. reported the propensity of macrocyclic pyrrolizidine alkaloid to cause a pulmonary syndrome in rats, which they hypothesised was related to a toxic pathway in the liver (Wilson et al. 1992). They also described a potential detoxification pathway mediated by glutathione conjugation. These observations were confirmed in 1995 by Yan et al., who describe a positive relationship between glutathione concentration and metabolism of pyrrolizidine alkaloid within isolated, perfused rat liver (Yan and Huxtable 1995). They also indicated that glutathione depletion

Chapter 6: Whole genome expression profiling in VODI 138 leads to a switch in the biliary release from 7-glutathionyl-6,7-dihydro- 1- hydroxymethyl-5H-pyrrolizine (a relatively mild toxic agent) to the highly toxic dehydromonocrotaline. More recent publications have targeted glutathione-S- transferase genes as potential targets/causes of veno-occlusive disease in HSCT. Glutathione is synthesised/regulated in the body from the amino acids L- cysteine, L-glutamic acid, and glycine (Lu 1999).

SLC1A5 , SLC7A5 , and SLC3A2 are all downregulated in the VODI group. SLC1A5 regulates the uptake of L-glutamine, and loss of SLC1A5 function has been shown to inhibit cell growth, and to activate autophagy. SLC7A5 functions as part of a heterodimeric complex with SLC3A2 as a bidirectional transporter, and mediates the exchange of intracellular L-glutamine for extracellular L- leucine (Nicklin et al. 2009). SLC1A5 interacts with the SLC7A5 /SLC3A2 complex to affect the intracellular transport of essential amino acids, including L-cysteine. SLC6A9 (GLYT1) is also downregulated in VODI. GLYT1 is an astrocytic glycine transporter, and plays a role in the regulation of glycine levels in excitatory synapses. Reduced expression has been reported in cases of acute liver failure, and has been implicated in hepatic encephalopathy (Zwingmann et al. 2002).

6.5. Discussion

Microarray technology is a powerful tool that can be used to obtain a global and unbiased view of gene expression, thus allowing insights into biological mechanisms which may be useful for the generation of experimental hypotheses. The use of SAM analysis of the microarray data provided a convenient analysis protocol for the examination of differential gene expression. There has been some commentary about the use of the Microsoft Excel addin version of the SAM analysis program - in his 2005 review of microarray analysis protocols, Larrson describes problems with the Microsoft Excel addin, that when used with the internal fold-change filter can alter the results compared to those obtained from the use of an external filter. While this was a concern, we noted

Chapter 6: Whole genome expression profiling in VODI 139 our dataset has a greater level of overall expression (39%) than the data that Larrson examined which only showed 20% expression. In addition, the Taqman validation of the microarray data in Section 6.3.2 demonstrates that the microarray data was corroborated by results obtained in a Taqman assay, and can be considered robust.

One of the typical clinical features of SP110 deficiency in humans is a severe immunodeficiency with elements of both B and T cell dysfunction. TNFRSF13C, one of the genes involved with CVID, is downregulated 2-fold. ADA, a gene responsible for a form of SCID, was also differentially expressed, however it was upregulated 1.6 fold, rather than downregulated as in ADA-deficient SCID. Consistent with the VODI phenotype, we were able to demonstrate abnormalities of key regulatory molecules of T cells ( SIT1 , RORA ), B cells (CD83 ) and both T&B cells ( CD27 , IRAK3 ). The observed gene expression changes affecting these cellular pathways are likely underlie the defects of lymphocyte development, activation, memory cell formation and proliferation observed in VODI.

One such late B-cell differentiation pathway that was altered involved a 3-fold decrease in the expression of CD27 . This result is interesting, however it has been hypothesized that this could be due to an artefact of the preparation of the EBV-transformed B cell lines – since the B cells of the control samples contain more CD27-positive memory B cells than patient B cells, it is more likely that they could generate a CD27-positive B-lymphoblastoid cell line. As such, this result could indicate a different cell type, rather than differential expression. However, as the control and case results are pooled for this analysis, the likelihood that such an occurrence would greatly affect results is reduced.

It is of interest that several other members of the TNFR superfamily were also shown to have altered expression patterns which may impact on B cell function (Agematsu et al. 1998; Jacquot et al. 1997). As described, TNFRSF13C is downregulated approximately 2-fold in VODI, and binding of BAFF to its receptor encoded by the TNFRSF13C gene delivers a powerful survival signal to BCR positive B cells (Mihalci et al. 2010). The identification of 2-2.8-fold decreased expression for two members of the SLAM family in cells from VODI patients, LY9 (SLAMF3/CD229 ) and CD84 (SLAMF5 ) is also consistent with the

Chapter 6: Whole genome expression profiling in VODI 140 failure of production of memory B cells in VODI patents, as these molecules are expressed at increased levels on memory B cells compared to naïve B cells (Romero et al. 2004). In contrast the gene encoding T and B cell antigen CD83 demonstrated a 2.5-fold increase in its expression. Over-expression of CD83 has been associated with inhibition of late maturation of B cells (Breloer et al. 2007).

As noted in the introduction to this chapter, SP110 deficiency leads to a supersusceptibility to mycobacterial infection in the C3HeB/FeJ mouse strain; however VODI patients do not appear to be at increased risk of mycobacterial diseases. Gene expression differences between VODI and control cells appear to implicate SP110 deficiency in disturbances of IL12/IFN γ pathways which play pivotal roles in resistance to mycobacterial infection (Al-Muhsen and Casanova 2008). Expression of IL12A, encoding the IL-12 p35 subunit, was reduced 5.6- fold either as the direct consequence of lack of SP110 expression, or possibly indirectly as a result of the 5-10-fold increased expression of IRAK3 - both of which have been implicated in a reduction in the ability of macrophages to control mycobacterial infection (Pathak et al. 2005). The 3.1-fold increased expression of REL , a member of the NF-κB family of transcription factors which is capable of inducing IL12 expression, may be the result of a feedback system initiated by the reduction of IL12. Annexin 5 also shows decreased expression in this dataset, possibly as a consequence of decreased signalling via the IFN γ receptor as a result of decreased IFN γ production (Leon et al. 2006).

VODI patient cells have also been shown to have a 5.9-fold reduction in AIM2 expression. AIM2 is involved in sensing of intracellular pathogens via the binding of bacterial/viral DNA and subsequent triggering of the caspase-1- mediated pro-inflammatory cytokines which ultimately leads to macrophage cell death (Alnemri 2010). The extensive disturbance seen in mediators of mycobacterial infection control in the differential gene expression studies suggests that SP110 deficiency influences pathways of mycobacterial resistance in both humans and mice, but that the C3HeB/FeJ mouse strain may possibly represent an extreme supersusceptibility phenotype due to the genomic alteration of the SP110 region in that strain.

Chapter 6: Whole genome expression profiling in VODI 141 Another cardinal feature of the VODI phenotype is the hepatic veno-occlusive disease. Glutathione conjugation has been shown to act to mediate a detoxification pathway in the liver, acting as a protective against hepatic veno- occlusive disease. Therefore, the enrichment of a group of transport proteins (and specifically SLC1A5 , SLC7A5 , and SLC3A2 ) gives an interesting insight into the potential mechanism for veno-occlusive disease dysfunction within the VODI phenotype, and may have greater implications in the prevention of SOS after bone marrow transplant.

The findings of this differential gene expression study have provided insight into some of the molecular changes underlying the observed VODI patient phenotypes and represent a rich source of observations for generating and testing hypotheses about the aetiology of this disease. These data provided evidence for SP110 functions that were expected, such as immune regulatory pathways, and also highlighted some biological pathways that had not previously been considered as playing a role in the VODI pathophysiology. Many of these would provide a logical basis for further research into the aetiology of the VODI phenotype.

Unfortunately, this experiment was not as successful as we had hoped in identifying new biological pathways involved in the aetiology of the VODI phenotype. This is mostly due to statistical power - previous genome-wide expression profiling studies with similar patient numbers produced similar sized gene lists (Bittel et al. 2007a; Bittel et al. 2007b). However, the relatively low number of patient samples makes it difficult to detect subtle differential gene expression. In addition, the parameters of the differentially expressed gene list were designed to provide a robust, rather than exhaustive, list of affected genes, and this makes ontological analyses of this gene list difficult to interpret. As annotations of genes within the Human genome improve, this analysis may become more effective with smaller gene networks.

This approach was a useful method for confirming the observed immune phenotype of the VODI patients, and also implicates some interesting biological pathways which can be used to generate hypotheses for future study into the aetiology of VODI. In particular, future work should examine the enriched group of transport proteins, to determine whether they play a role in the glutathione-

Chapter 6: Whole genome expression profiling in VODI 142 depletion of zone-3 hepatocytes in patients with VODI, which could be a major factor in the susceptibility to hepatic veno-occlusive disease that is characteristic to this disorder.

6.6. Summary

This chapter describes the results of whole-genome expression profiling of four affected VODI individuals, with the c.642delC mutation. Downstream analysis of this data using the SAM software package identified a cohort of 253 differentially expressed genes in the VODI cohort. This gene cohort includes a number of differentially expressed genes that are related to CVID and SCID, and a number of genes involved in the immune response. These results corroborate data that were generated using an immune-phenotyping approach, and strengthen the hypothesis that SP110 may play a role in CVID. These data also identify a number of genes involved with apoptosis, which suggests interesting avenues for further study into the role of SP110 and the PML-NB that also has roles in the regulation of apoptosis. Finally, a number of transport proteins that are involved in glutathione transport offer a number of potential targets for the further study into the aetiology of the hepatic veno-occlusive disease that is characteristic of the VODI syndrome.

Chapter 6: Whole genome expression profiling in VODI 143 CHAPTER 7: Discussion

7.1. Summary of findings

7.1.1. PHID

This thesis describes the mapping and identification of the genetic basis of pigmented hypertrichotic dermatosis with insulin-dependent diabetes mellitus syndrome. Five different mutations in the SLC29A3 gene were discovered in the cohort of patients studied, demonstrating an important role in the range of SLC29A3 clinical spectrum disorders that have been described to date. PHID is also the only manifestation of these disorders that demonstrates a high prevalence of antibody-negative, insulin-dependent diabetes mellitus. Animal studies have demonstrated that ENT3 interacts with the insulin-signalling pathway, however a limited screening study of patients affected with type-1 diabetes mellitus found that exonic mutations in SLC29A3 are not a common factor in the aetiology of this disease.

7.1.2. VODI

The work of Dr Roscioli in determining the genetic basis of veno-occlusive disease with immunodeficiency was confirmed and built upon in this thesis. Five separate mutations, including four novel ones, were detected in the SP110 gene in the course of this research. This has been very important for the confirmation of the diagnosis of VODI in a number of affected individuals, and the Molecular Genetics department at SEALS continues to offer prenatal diagnosis to several of the Australian families from this study.

Chapter 7: Discussion 144 The screen of patients with CVID, IgAD, and uncharacterised immune deficiencies did not identify any novel pathogenic mutations in the SP110 or SP140 genes. A number of SNPs were detected, however the structure of the study does not allow for any comparisons of relative SNP frequencies, or for unclassified variants to be conclusively categorised. Of the two novel SNPs that were detected, the SP110b R544G was predicted by In silico analysis to be potentially damaging – however it is notable that all VODI mutations identified to date have been detected in the first five coding exons of the SP110 gene. Further work should be done to examine whether this sequence variant does have a pathogenic effect.

7.2. Future work in VODI and PHID characterisation

As a result of the work presented in this thesis, the Genetics department at SEALS Randwick can now offer genetic testing for individuals with these conditions, and prenatal diagnosis for carrier parents of VODI. As a result, work is continuing as far as the ascertainment of new patients and new families with these diseases. Further studies should concentrate on identifying the biological basis of the disease in each of these diseases. A logical first step in each disease would be the creation of animal models in which the biology of the disease can be interrogated.

In the case of PHID, an intriguing Drosophila melanogaster endophenotype has been studied, which is highly suggestive of a role for SLC29A3 in the maintenance of insulin-response pathways. A mouse model of SLC29A3 deficiency could identify more precisely the cause of type-1 diabetes in individuals with mutations in the SLC29A3 gene, firstly by the confirmation of a syndrome caused by reduction or deletion of this gene in the mouse model. Further experiments could then concentrate on the identification of the affected pathways involved, and the mechanism by which these pathways cause type-1 diabetes in these individuals. As it happens, a mouse model for SLC deficiency was designed after the completion of this work. Hsu et al (2012) found that

Chapter 7: Discussion 145 these mice developed a spontaneous and progressive macrophage-dominated Histiocytosis – a cellular process caused at least in part by increased expression of macrophage colony-stimulating factor and receptor. While this suggests a molecular basis for the development of the Histiocytosis in patients with PHID, this work did not identify any potential mechanisms for the observed type 1 diabetes.The aetiology of the VODI phenotype has still yet to be satisfactorily elucidated, and although the microarray assessment of the condition provided several interesting avenues for further research, it did not have the statistical power to indicate subtle changes in gene expression. Unfortunately, due to the paucity of the condition (which is likely to become more rare in Australia due to the provision, and take-up, of prenatal genetic diagnosis in the affected families), and the severity of the disease, there are few surviving individuals available for further testing. As for PHID, future work should concentrate on creating a suitable animal model for testing. However, Mus musculus has been found to be unacceptable on several fronts – as discussed in Chapter 6, a mouse model that lacks transcription of the mouse SP110 homologue Ipr1 does not produce a VODI phenocopy. In addition, the systematic gene knockout screen undertaken by the Wellcome Trust Sanger Institute was also unsuccessful (personal communication). The failure of each of these models to sufficiently reproduce the VODI phenotype is likely due to the large genomic amplified region in Mus musculus at this locus. Therefore, it is recommended that either a different mouse model, Mus caroli for example (Traut et al. (2001) report that this mouse species does not contain the amplified cluster, however they are known to be a more difficult animal to work with), or a different model such as Rattus rattus , which also does not contain an amplified region, should be considered to allow for further study of this disease. In particular, it would be valuable to be to identify any iatrogenic factors that lead to the hepatic veno-occlusive disease; currently HSCT is an incredibly risky treatment for the immunodeficiency of patients with VODI, due to the risk of complications such as veno-occlusive disease.

Chapter 7: Discussion 146

7.3. Comparison of two Homozygosity mapping studies

There are some comparisons between the VODI and PHID mapping approaches. The VODI screen used a 5cM microsatellite screen to detect regions of homozygosity, whereas the PHID study utilised a 50K Affymetrix SNP technology. At the time that this study was performed, the choice between these two platforms was a difficult one – statistical considerations meant that the smallest region of identity by descent that could be significantly detected with a 50K SNP array was around 3.4 cM – not offering much more resolution than the alternative. However, the informativeness of the microsatellite markers, as there could be a number of alleles at a given locus was much greater, and so offered more information. As each method was successful in this thesis, the point is now moot. Given the same decision today, however, there is not much doubt that SNP genotyping is the clear choice. The equivalent Affymetrix SNP genotyping array, the Genome-Wide Human SNP Array 6.0 has more than 900,000 genotyping SNP markers, and over 940,000 copy number probes. This equates to a genotyping marker every 0.007 cM, and using the algorithm described in section 4.3.4 and the technical specifications available, would be able to identify a region of significant IBD as small as 0.22 Mb in an affected individual. Another notable observation is that shared ethnicity cannot be taken to mean a shared ancestral allele in all cases. In both studies, the attempt to find the gene of interest could have been fatally disrupted if this particular pedigree characteristic was deemed essential, with family D in the case of VODI bearing a different ancestral mutation than the rest of the originally mapped families, and each of the families in the PHID study bearing a different ancestral mutation. It is also quite possible for a homozygosity mapping study to be confounded by the presence of a compound heterozygote affected individual, as Spiegel et al. discovered in their own search for the PHID gene (Spiegel et al. 2010), or by variable expressivity or incomplete penetrance of a given phenotype.

Chapter 7: Discussion 147 This thesis also illustrates that homozygosity mapping has a particular advantage over traditional linkage mapping methods, in that large and deep pedigrees are unnecessary – access to the affected individuals is often all that is required for a successful study. However, the number of affected individuals that are required is dictated by the size the region of overlapping IBD. This candidate region needs to be large enough that it can be distinguished from a region of homozygosity by state, but defined to a small enough region that gene – sequencing is possible. In the PHID mapping study, two affected individuals did not provide enough resolution, and it required the addition of four additional patients before a candidate gene sequencing approach was successful. Likewise, the VODI critical region was discovered with four affected individuals, but could easily have taken much longer to discover the affected gene, if the affected gene had not been selected as the first priority candidate gene. This problem is largely a function of the ease with which candidate genes can be sequenced to discover pathogenic mutations. As sequencing technology continues to improve, these restrictions will be reduced – ultimately to the point that mapping will no longer be required at all.

The review of primary immunodeficiency genes presented in this thesis showed the effects of this increased power with next generation sequencing, indicating that there have already been a number of PID genes that have been discovered with whole-exome screens. Two of these studies used a combined approach that included a homozygosity mapping study with a whole exome sequencing screen. Although improvements in price and availability of whole exome, and eventually whole genome, sequencing will eventually make most linkage mapping approaches redundant, there is still very much a role for this approach in contemporary studies.

7.4. The importance of disease gene identification

The disease gene mapping group at SEALS has successfully mapped two novel disease genes, in two rare diseases within the Lebanese-Australian

Chapter 7: Discussion 148 community of Sydney. Gene identification can be incredibly important for patients. In 2005, the European Organisation for Rare Diseases reported that 25% of affected individuals experienced a delay of at least 5 years from the time of first symptoms to diagnosis. Of these, 40% had initially been diagnosed incorrectly, and unnecessary medical interventions were experienced by 59% of these individuals. Mutation identification for patients can be important – a specific diagnosis can be confirmed or excluded, the prognosis of the disease may be predicted, access to various therapies may be affected, and an accurate recurrence risk can be estimated to allow for family planning. Insufficient knowledge about genetic causation, and technical limitations of scanning for mutations, are the principal limitations on mutation detection, and fewer than 50% of families with monogenic disease currently receive a gene specific diagnosis.

Next generation sequencing provides a valuable tool for disease gene identification into the future. The ability to sequence the entire genome would tend to devalue all of the other gene-identification strategies identified in the literature reviewed in Chapter 2. There remain some significant downsides to the current next generation sequencing technologies however, not least of which is the cost, which still remains in the 10’s of thousands of dollars per genome. Other problems as identified by Meldrum et al. (2011) and Tran et al. (2012) include the length of the reads (between 36-700 bp with current technologies), and a high error rate that requires deep sequencing to ensure accuracy – typically 30-50x coverage. This is even more problematic if the cause of the inaccuracy is a systematic bias and not random error, as deeper reads may not be sufficient to overcome this issue. Misalignments can occur due to ambiguity in short read sequences, and the gaps and misassemblies of the human genome. Additionally, deletions of greater than ~100 bp can be difficult to align, and most contemporary alignment algorithms will simply remove such affected reads from the analysis – which can obscure causative mutations. Repeat regions within the genome, including short and long interspersed nuclear elements, can also complicate the alignment, and potentially obscure mutations. Each of these drawbacks will be improved in time, as more sophisticated algorithms are designed, and as technology

Chapter 7: Discussion 149 improves to allow longer reads that assist alignment. In the meantime, the continued use of homozygosity mapping and other linkage approaches will assist in the interpretation of next-generation screening results.

Disease gene identification is also important for the augmentation of knowledge in the aetiology of disease. A review by Marodi and Notarangelo (2007) illustrated that the identification of the disease genes in rare primary immunodeficiencies, including VODI, has led to the identification of novel and unanticipated biological pathways in immunological disease. These pathways can now be exploited for further research into the disease pathophysiology, into phenocopies of disease that are caused by other genes within the same biological pathway, and ultimately into the search for a treatment.

Chapter 7: Discussion 150 Bibliography

Acimovic Y, Coe IR. 2002. Molecular evolution of the equilibrative nucleoside transporter family: identification of novel family members in prokaryotes and eukaryotes. Mol Biol Evol 19(12):2199-210.

Adam J, Myat A, Le Roux I, Eddison M, Henrique D, Ish-Horowicz D, Lewis J. 1998. Cell fate choices and the expression of Notch, Delta and Serrate homologues in the chick inner ear: parallels with Drosophila sense-organ development. Development 125(23):4645-54.

Agematsu K, Nagumo H, Oguchi Y, Nakazawa T, Fukushima K, Yasui K, Ito S, Kobata T, Morimoto C, Komiyama A. 1998. Generation of plasma cells from peripheral blood memory B cells: synergistic effect of interleukin-10 and CD27/CD70 interaction. Blood 91(1):173-80.

Agulnik S, Plass C, Traut W, Winking H. 1993. Evolution Of A Long-Range Repeat Family In Chromosome-1 Of The Genus Mus. Mammalian Genome 4(12):704-710.

Aksentijevich I, Centola M, Deng ZM, Sood R, Balow JE, Wood G, Zaks N, Mansfield E, Chen X, Eisenberg S et al. 1997. Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever. Cell 90(4):797-807.

Aksentijevich I, Kastner DL. 2011. Genetics of monogenic autoinflammatory diseases: past successes, future challenges. Nature Reviews Rheumatology 7(8):468-477.

Aksentijevich I, Masters SL, Ferguson PJ, Dancey P, Frenkel J, van Royen- Kerkhoff A, Laxer R, Tedgard U, Cowen EW, Pham TH et al. 2009. An Autoinflammatory Disease with Deficiency of the Interleukin-1-Receptor Antagonist. New England Journal of Medicine 360(23):2426-2437.

Al-Muhsen S, Casanova JL. 2008. The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. J Allergy Clin Immunol 122(6):1043-51; quiz 1052-3.

Bibliography 151 Alnemri ES. 2010. Sensing Cytoplasmic Danger Signals by the Inflammasome. Journal of Clinical Immunology 30(4):512-519.

Altare F, Durandy A, Lammas D, Emile JF, Lamhamedi S, Le Deist F, Drysdale P, Jouanguy E, Doffinger R, Bernaudin F et al. 1998a. Impairment of mycobacterial immunity in human interleukin-12 receptor deficiency. Science 280(5368):1432-1435.

Altare F, Lammas D, Revy P, Jouanguy E, Doffinger R, Lamhamedi S, Drysdale P, Scheel-Toellner D, Girdlestone J, Darbyshire P et al. 1998b. Inherited interleukin 12 deficiency in a child with bacille Calmette-Guerin and Salmonella enteritidis disseminated infection. Journal of Clinical Investigation 102(12):2035- 2040.

Ambruso DR, Knall C, Abell AN, Panepinto J, Kurkchubasche A, Thurman G, Gonzalez-Aller C, Hiester A, deBoer M, Harbeck RJ et al. 2000. Human neutrophil immunodeficiency syndrome is associated with an inhibitory Rac2 mutation. Proceedings of the National Academy of Sciences of the United States of America 97(9):4654-4659.

Arnaizvillena A, Timon M, Corell A, Perezaciego P, Martinvilla JM, Regueiro JR. 1992. Primary Immunodeficiency Caused By Mutations In The Gene Encoding The Cd3-Gamma Subunit Of The Lymphocyte-T Receptor. New England Journal of Medicine 327(8):529-533.

Arnaout MA, Dana N, Gupta SK, Tenen DG, Fathallah DM. 1990. Point Mutations Impairing Cell-Surface Expression Of The Common Beta-Subunit (Cd-18) In A Patient With Leukocyte Adhesion Molecule (Leu-Cam) Deficiency. Journal of Clinical Investigation 85(3):977-981.

Arpaia E, Shahar M, Dadi H, Cohen A, Roifman CM. 1994. Defective T-Cell Receptor Signaling And Cd8(+) Thymic Selection In Humans Lacking Zap-70 Kinase. Cell 76(5):947-958.

Aruffo A, Farrington M, Hollenbaugh D, Li X, Milatovich A, Nonoyama S, Bajorath J, Grosmaire LS, Stenkamp R, Neubauer M et al. 1993. The Cd40 Ligand, Gp39, Is Defective In Activated T-Cells From Patients With X-Linked Hyper-Igm Syndrome. Cell 72(2):291-300.

Bibliography 152 Ault BH, Schmidt BZ, Fowler NL, Kashtan CE, Ahmed AE, Vogt BA, Colten HR. 1997. Human factor H deficiency - Mutations in framework cysteine residues and block in H protein secretion and intracellular catabolism. Journal of Biological Chemistry 272(40):25168-25175.

Avitan-Hersh E, Mandel H, Indelman M, Bar-Joseph G, Zlotogorski A, Bergman R. 2011. A Case of H Syndrome Showing Immunophenotye Similarities to Rosai-Dorfman Disease. American Journal of Dermatopathology 33(1):47-51.

Baldwin SA, Beal PR, Yao SY, King AE, Cass CE, Young JD. 2004. The equilibrative nucleoside transporter family, SLC29. Pflugers Arch 447(5):735-43.

Baldwin SA, Yao SY, Hyde RJ, Ng AM, Foppolo S, Barnes K, Ritzel MW, Cass CE, Young JD. 2005. Functional characterization of novel human and mouse equilibrative nucleoside transporters (hENT3 and mENT3) located in intracellular membranes. J Biol Chem 280(16):15880-7.

Barba G, Rittner C, Schneider PM. 1993. Genetic-Basis Of Human- Complement C4a Deficiency - Detection Of A Point Mutation Leading To Nonexpression. Journal of Clinical Investigation 91(4):1681-1686.

Barbaric I, Miller G, Dear TN. 2007. Appearances can be deceiving: phenotypes of knockout mice. Briefings in functional genomics & proteomics 6(2):91-103.

Barnes DE, Tomkinson AE, Lehmann AR, Webster ADB, Lindahl T. 1992. Mutations In The Dna Ligase-I Gene Of An Individual With Immunodeficiencies And Cellular-Hypersensitivity To Dna-Damaging Agents. Cell 69(3):495-503.

Barroso S, Rieubland C, Alvarez AJ, Lopez-Trascasa M, Bart PA, Nunez- Roldan A, Sanchez B. 2006. Molecular defects of the C7 gene in two patients with complement C7 deficiency. Immunology 118(2):257-260.

Bernot A, Clepet C, Dasilva C, Devaud C, Petit JL, Caloustian C, Cruaud C, Samson D, Pulcini F, Weissenbach J et al. 1997. A candidate gene for familial Mediterranean fever. Nature Genetics 17(1):25-31.

Bessler M, Mason PJ, Hillmen P, Miyata T, Yamada N, Takeda J, Luzzatto L, Kinoshita T. 1994. Paroxysmal-Nocturnal Hemoglobinuria (Pnh) Is Caused By Somatic Mutations In The Pig-A Gene. Embo Journal 13(1):110-117.

Bibliography 153 Biesma DH, Hannema AJ, van Velzen-Blad H, Mulder L, van Zwieten R, Kluijt I, Roos D. 2001. A family with complement factor D deficiency. Journal of Clinical Investigation 108(2):233-240.

Bione S, Dadamo P, Maestrini E, Gedeon AK, Bolhuis PA, Toniolo D. 1996. A novel X-linked gene, G4.5. is responsible for Barth syndrome. Nature Genetics 12(4):385-389.

Biryukova I, Heitzler P. 2005. The Drosophila LIM-homeo domain protein Islet antagonizes pro-neural cell specification in the peripheral nervous system. Dev Biol 288(2):559-70.

Bittel DC, Kibiryeva N, Butler MG. 2007a. Whole genome microarray analysis of gene expression in subjects with fragile X syndrome. Genetics in Medicine 9(7):464-472.

Bittel DC, Kibiryeva N, Sell SM, Strong TV, Butler MG. 2007b. Whole genome microarray analysis of gene expression in Prader-Willi syndrome. American Journal of Medical Genetics Part A 143A(5):430-442.

Bloch DB, Chiche JD, Orth D, de la Monte SM, Rosenzweig A, Bloch KD. 1999. Structural and functional heterogeneity of nuclear bodies. Molecular and Cellular Biology 19(6):4423-4430.

Bloch DB, delaMonte SM, Guigaouri P, Filippov A, Bloch KD. 1996. Identification and characterization of a leukocyte-specific component of the nuclear body. Journal of Biological Chemistry 271(46):29198-29204.

Bloch DB, Nakajima A, Gulick T, Chiche JD, Orth D, de la Monte SM, Bloch KD. 2000. SP110 localizes to the PML-SP100 nuclear body and may function as a nuclear hormone receptor transcriptional coactivator. Molecular and Cellular Biology 20(16):6138-6146.

Blom AM, Bergstrom F, Edey M, Diaz-Torres M, Kavanagh D, Lampe A, Goodship JA, Strain L, Moghal N, McHugh M et al. 2008. A novel nonsynonymous polymorphism (p.Arg240His) in C4b-binding protein is associated with atypical hemolytic uremic syndrome and leads to impaired alternative pathway cofactor activity. Journal of Immunology 180(9):6385-6391.

Bibliography 154 Boerkoel CF, Takashima H, John J, Yan J, Stankiewicz P, Rosenbarker L, Andre JL, Bogdanovic R, Burguet A, Cockfield S et al. 2002. Mutant chromatin remodeling protein SMARCAL1 causes Schimke immuno-osseous dysplasia. Nature Genetics 30(2):215-220.

Bohn G, Allroth A, Brandes G, Thiel J, Glocker E, Schaffer AA, Rathinam C, Taub N, Teis D, Zeidler C et al. 2007. A novel human primary immunodeficiency syndrome caused by deficiency of the endosomal adaptor protein p14. Nature Medicine 13(1):38-45.

Bolze A, Byun M, McDonald D, Morgan NV, Abhyankar A, Premkumar L, Puel A, Bacon CM, Rieux-Laucat F, Pang K et al. 2010. Whole-Exome-Sequencing- Based Discovery of Human FADD Deficiency. American Journal of Human Genetics 87(6):873-881.

Boocock GRB, Morrison JA, Popovic M, Richards N, Ellis L, Durie PR, Rommens JM. 2003. Mutations in SBDS are associated with Shwachman- Diamond syndrome. Nature Genetics 33(1):97-101.

Borg A, Haile RW, Malone KE, Capanu M, Diep A, Torngren T, Teraoka S, Begg CB, Thomas DC, Concannon P et al. . 2010. Characterization of BRCA1 and BRCA2 Deleterious Mutations and Variants of Unknown Clinical Significance in Unilateral and Bilateral Breast Cancer: The WECARE Study. Human Mutation 31(3):E1200-E1240.

Boztug K, Appaswamy G, Ashikov A, Schaffer AA, Salzer U, Diestelhorst J, Germeshausen M, Brandes G, Lee-Gossler J, Noyan F et al. 2009. A Syndrome with Congenital Neutropenia and Mutations in G6PC3. New England Journal of Medicine 360(1):32-43.

Breloer M, Kretschmer B, Luthje K, Ehrlich S, Ritter U, Bickert T, Steeg C, Fillatreau S, Hoehlig K, Lampropoulou V et al. 2007. CD83 is a regulator of murine B cell function in vivo. Eur J Immunol 37(3):634-48.

Broshtilova V, Ramot Y, Molho-Pessach V, Zlotogorski A. 2009. Diabetes mellitus may be the earliest and sole manifestation of the H syndrome. Diabetic Medicine 26(11):1179-1180.

Bibliography 155 Buck D, Malivert L, de Chasseval P, Barraud A, Fondaneche MC, Sanal O, Plebani A, Stephan JL, Hufnagel M, le Deist F et al. 2006. Cernunnos, a novel nonhomologous end-joining factor, is mutated in human immunodeficiency with microcephaly. Cell 124(2):287-299.

Carbone R, Pearson M, Minucci S, Pelicci PG. 2002. PML NBs associate with the hMre11 complex and p53 at sites of irradiation induced DNA damage. Oncogene 21(11):1633-40.

Casanova JL, Abel L. 2007. Perspective - Primary immunodeficiencies: A field in its infancy. Science 317(5838):617-619.

Casimir CM, Bughanim HN, Rodaway ARF, Bentley DL, Rowe P, Segal AW. 1991. Autosomal Recessive Chronic Granulomatous-Disease Caused By Deletion At A Dinucleotide Repeat. Proceedings of the National Academy of Sciences of the United States of America 88(7):2753-2757.

Casrouge A, Zhang SY, Eidenschenk C, Jouanguy E, Puel A, Yang K, Alcais A, Picard C, Mahfoufi N, Nicolas N et al. 2006. Herpes simplex virus encephalitis in human UNC-93B deficiency. Science 314(5797):308-312.

Castigli E, Wilson SA, Garibyan L, Rachid R, Bonilla F, Schneider L, Geha RS. 2005. TACI is mutant in common variable immunodeficiency and IgA deficiency. Nature Genetics 37(8):829-834.

Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, Bonafe JL, Wilkinson J, Taieb A, Barrandon Y et al. 2000. Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nature Genetics 25(2):141-142.

Chelbi-Alix MK, Pelicano L, Quignon F, Koken MH, Venturini L, Stadler M, Pavlovic J, Degos L, de The H. 1995. Induction of the PML protein by interferons in normal and APL cells. Leukemia 9(12):2027-33.

Chelbi-Alix MK, Quignon F, Pelicano L, Koken MH, de The H. 1998. Resistance to virus infection conferred by the interferon-induced promyelocytic leukemia protein. J Virol 72(2):1043-51.

Choi M, Scholl UI, Ji WZ, Liu TW, Tikhonova IR, Zumbo P, Nayir A, Bakkaloglu A, Ozen S, Sanjad S et al. 2009. Genetic diagnosis by whole exome capture

Bibliography 156 and massively parallel DNA sequencing. Proceedings of the National Academy of Sciences of the United States of America 106(45):19096-19101.

Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL, Krizman DB, Tangrea MA, Ahram M et al. 2002. Post-analysis follow-up and validation of microarray experiments. Nature Genetics 32:509-514.

Chun HJ, Zheng LX, Ahmad M, Wang J, Speirs CK, Siegel RM, Dale MK, Puck J, Davis J, Hall CG et al. 2002. Pleiotropic defects in lymphocyte activation caused by caspase-8 mutations lead to human immunodeficiency. Nature 419(6905):395-399.

Cliffe ST, Kramer JM, Hussain K, Robben JH, de Jong EK, de Brouwer AP, Nibbeling E, Kamsteeg EJ, Wong M, Prendiville J et al. 2009. SLC29A3 gene is mutated in pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome and interacts with the insulin signaling pathway. Human Molecular Genetics 18(12):2257-2265.

Cliffe ST, Wong M, Taylor PJ, Ruga E, Wilcken B, Lindeman R, Buckley MF, Roscioli T. 2007. The first prenatal diagnosis for veno-occlusive disease and immunodeficiency syndrome, an autosomal recessive condition associated with mutations in SP110. Prenatal Diagnosis 27(7):674-676.

Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibe B, Bouix J, Caiment F, Elsen JM, Eychenne F et al. 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics 38(7):813-818.

Coffey AJ, Brooksbank RA, Brandau O, Oohashi T, Howell GR, Bye JM, Cahn AP, Durham J, Heath P, Wray P et al. 1998. Host response to EBV infection in X-linked lymphoproliferative disease results from mutations in an SH2-domain encoding gene. Nature Genetics 20(2):129-135.

Collins FS. 1995. Positional Cloning Moves From Perditional To Traditional. Nature Genetics 9(4):347-350.

Constantoulakis P, Filiou E, Rovina N, Chras G, Hamhougia A, Karabela S, Sotiriou A, Roussos C, Poulakis N. 2010. In vivo expression of innate immunity

Bibliography 157 markers in patients with mycobacterium tuberculosis infection. Bmc Infectious Diseases 10.

Courtois G, Smahi A, Reichenbach J, Doffinger R, Cancrini C, Bonnet M, Puel A, Chable-Bessia C, Yamaoka S, Feinberg J et al. 2003. A hypermorphic I kappa B alpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cell immunodeficiency. Journal of Clinical Investigation 112(7):1108-1115.

Crow YJ, Hayward BE, Parmar R, Robins P, Leitch A, Ali M, Black DN, van Bokhoven H, Brunner HG, Hamel BC et al. 2006a. Mutations in the gene encoding the 3 '-5 ' DNA exonuclease TREX1 cause Aicardi-Goutieres syndrome at the AGS1 locus. Nature Genetics 38(8):917-920.

Crow YJ, Leitch A, Hayward BE, Garner A, Parmar R, Griffith E, Ali M, Semple C, Aicardi J, Babul-Hirji R et al. 2006b. Mutations in genes encoding ribonuclease H2 subunits cause Aicardi-Goutieres syndrome and mimic congenital viral brain infection. Nature Genetics 38(8):910-916.

Dadi HK, Simon AJ, Roifman CM. 2003. Effect of CD3 delta deficiency on maturation of alpha/beta and gamma/delta T-cell lineages in severe combined immunodeficiency. New England Journal of Medicine 349(19):1821-1828.

Dale DC, Person RE, Bolyard AA, Aprikyan AG, Bos C, Bonilla MA, Boxer LA, Kannourakis G, Zeidler C, Welte K et al. 2000. Mutations in the gene encoding neutrophil elastase in congenital and cyclic neutropenia. Blood 96(7):2317- 2322. de Borst MH, Benigni A, Remuzzi G. 2008. Primer: strategies for identifying genes involved in renal disease. Nature Clinical Practice Nephrology 4(5):265- 276. de Diego RP, Sancho-Shimizu V, Lorenzo L, Puel A, Plancoulaine S, Picard C, Herman M, Cardon A, Durandy A, Bustamante J et al. 2010. Human TRAF3 Adaptor Molecule Deficiency Leads to Impaired Toll-like Receptor 3 Response and Susceptibility to Herpes Simplex Encephalitis. Immunity 33(3):400-411. de Greef JC, Wang J, Balog J, den Dunnen JT, Frants RR, Straasheijm KR, Aytekin C, van der Burg M, Duprez L, Ferster A et al. 2011. Mutations in

Bibliography 158 ZBTB24 Are Associated with Immunodeficiency, Centromeric Instability, and Facial Anomalies Syndrome Type 2. American Journal of Human Genetics 88(6):796-804. de Jong R, Altare F, Haagen IA, Elferink DG, de Boer T, Vriesman P, Kabel PJ, Draaisma JMT, van Dissel JT, Kroon FP et al. 1998. Severe mycobacterial and Salmonella infections in interleukin-12 receptor-deficient patients. Science 280(5368):1435-1438. de Jorge EG, Harris CL, Esparza-Gordillo J, Carreras L, Arranz EA, Garrido CA, Lopez-Trascasa M, Sanchez-Corral P, Morgan BP, de Cordoba SR. 2007. Gain-of-function mutations in complement factor B are associated with atypical hemolytic uremic syndrome. Proceedings of the National Academy of Sciences of the United States of America 104(1):240-245. de Kok JB, Roelofs RW, Giesendorf BA, Pennings JL, Waas ET, Feuth T, Swinkels DW, Span PN. 2005. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Laboratory Investigation 85(1):154-159. de la Calle-Martin O, Hernandez M, Ordi J, Casamitjana N, Arostegui JI, Caragol I, Ferrando M, Labrador M, Rodriguez-Sanchez JL, Espanol T. 2001. Familial CDS deficiency due to a mutation in the CD8 alpha gene. Journal of Clinical Investigation 108(1):117-123. de Mattia F, Savelkoul PJ, Bichet DG, Kamsteeg EJ, Konings IB, Marr N, Arthus MF, Lonergan M, van Os CH, van der Sluijs P et al. 2004. A novel mechanism in recessive nephrogenic diabetes insipidus: wild-type aquaporin-2 rescues the apical membrane expression of intracellularly retained AQP2-P262L. Hum Mol Genet 13(24):3045-56.

Delasalle H, Hanau D, Fricker D, Urlacher A, Kelly A, Salamero J, Powis SH, Donato L, Bausinger H, Laforet M et al. 1994. Homozygous Human Tap Peptide Transporter Mutation In Hla Class-I Deficiency. Science 265(5169):237-241.

Dell'Angelica EC, Shotelersuk V, Aguilar RC, Gahl WA, Bonifacino JS. 1999. Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor. Molecular Cell 3(1):11-21.

Bibliography 159 Delvaeye M, Noris M, De Vriese A, Esmon CT, Esmon NL, Ferrell G, Del- Favero J, Plaisance S, Claes B, Lambrechts D et al. 2009. Thrombomodulin Mutations in Atypical Hemolytic-Uremic Syndrome. New England Journal of Medicine 361(4):345-357.

Derry JMJ, Ochs HD, Francke U. 1994. Isolation Of A Novel Gene Mutated In Wiskott-Aldrich Syndrome. Cell 78(4):635-644.

Devriendt K, Kim AS, Mathijs G, Frints SGM, Schwartz M, Van den Oord JJ, Verhoef GEG, Boogaerts MA, Fryns JP, You DQ et al. 2001. Constitutively activating mutation in WASP causes X-linked severe congenital neutropenia. Nature Genetics 27(3):313-317. deVries E, Koene HR, Vossen JM, Gratama JW, vondemBorne A, Waaijer JLM, Haraldsson A, deHaas M, vanTol MJD. 1996. Identification of an unusual Fc gamma receptor IIIa (CD16) on natural killer cells in a patient with recurrent infections. Blood 88(8):3022-3027.

Dewald G, Bork K. 2006. Missense mutations in the coagulation factor XII (Hageman factor) gene in hereditary angioedema with normal C1 inhibitor. Biochemical and Biophysical Research Communications 343(4):1286-1289.

Dickinson RE, Griffin H, Bigley V, Reynard LN, Hussain R, Haniffa M, Lakey JH, Rahman T, Wang XN, McGovern N et al. 2011. Exome sequencing identifies GATA-2 mutation as the cause of dendritic cell, monocyte, B and NK lymphoid deficiency. Blood 118(10):2656-2658.

Dinauer MC, Pierce EA, Bruns GAP, Curnutte JT, Orkin SH. 1990. Human Neutrophil Cytochrome-B Light Chain (P22-Phox) - Gene Structure, Chromosomal Location, And Mutations In Cytochrome-Negative Autosomal Recessive Chronic Granulomatous-Disease. Journal of Clinical Investigation 86(5):1729-1737.

Dobbs AK, Yang TY, Farmer D, Kager L, Parolini O, Conley ME. 2007. Cutting edge: A hypomorphic mutation in ig beta (CD79b) in a patient with immunodeficiency and a leaky defect in BCeH development. Journal of Immunology 179(4):2055-2059.

Bibliography 160 Doffinger R, Smahi A, Bessia C, Geissmann F, Feinberg J, Durandy A, Bodemer C, Kenwrick S, Dupuis-Girod S, Blanche S et al. 2001. X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappa B signaling. Nature Genetics 27(3):277-285.

Dong F, Hoefsloot LH, Schelen AM, Broeders L, Meijer Y, Veerman AJP, Touw IP, Lowenberg B. 1994. Identification Of A Nonsense Mutation In The Granulocyte-Colony-Stimulating Factor-Receptor In Severe Congenital Neutropenia. Proceedings of the National Academy of Sciences of the United States of America 91(10):4480-4484.

Doniger SW, Kim HS, Swain D, Corcuera D, Williams M, Yang S-P, Fay JC. 2008. A Catalog of Neutral and Deleterious Polymorphism in Yeast. Plos Genetics 4(8).

Dorman SE, Holland SM. 1998. Mutation in the signal-transducing chain of the interferon-gamma receptor and susceptibility to mycobacterial infection. Journal of Clinical Investigation 101(11):2364-2369.

Drenth JPH, Cuisset L, Grateau G, Vasseur C, van de Velde-Visser SD, de Jong JGN, Beckmann JS, van der Meer JWM, Delpech M, Int Hyper-Ig DSG. 1999. Mutations in the gene encoding mevalonate kinase cause hyper-IgD and periodic fever syndrome. Nature Genetics 22(2):178-181.

Dudoit S, Yang YH, Callow MJ, Speed TP. 2002. Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments. Statistica Sinica 12(1):111-139.

Dupuis S, Dargemont C, Fieschi C, Thomassin N, Rosenzweig S, Harris J, Holland SM, Schreiber RD, Casanova JL. 2001. Impairment of mycobacterial but not viral immunity by a germline human STAT1 mutation. Science 293(5528):300-303.

Dupuis S, Jouanguy E, Al-Hajjar S, Fieschi C, Al-Mohsen IZ, Al-Jumaah S, Yang K, Chapgier A, Eidenschenk C, Eid P et al. 2003. Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nature Genetics 33(3):388-391.

Bibliography 161 Durand B, Sperisen P, Emery P, Barras E, Zufferey M, Mach B, Reith W. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. Embo Journal 16(5):1045-1055.

Duriez B, Duquesnoy P, Dastot F, Bougneres P, Amselem S, Goossens M. 1994. An Exon-Skipping Mutation In The Btk Gene Of A Patient With X-Linked Agammaglobulinemia And Isolated Growth-Hormone Deficiency. Febs Letters 346(2-3):165-170.

Eddison M, Le Roux I, Lewis J. 2000. Notch signaling in the development of the inner ear: lessons from Drosophila. Proc Natl Acad Sci U S A 97(22):11692-9.

Edghill EL, Hameed S, Verge CF, Rubio-Cabezas O, Argente J, Sumnik Z, Dusatkova P, Cliffe ST, Hennekam RCM, Buckley MF et al. 2009. Mutations in the SLC29A3 gene are not a common cause of isolated autoantibody negative type 1 diabetes. JOP : Journal of the pancreas 10(4):457-8.

Ellis NA, Groden J, Ye TZ, Straughen J, Lennon DJ, Ciocci S, Proytcheva M, German J. 1995. The Blooms-Syndrome Gene-Product Is Homologous To Recq Helicases. Cell 83(4):655-666.

European Organisation for Rare Diseases. 2005. Rare Diseases: Understanding this Public Health Priority. European Organisation for Rare Diseases, France.

Everett RD. 2001. DNA viruses and viral proteins that interact with PML nuclear bodies. Oncogene 20(49):7266-73.

Feldmann J, Callebaut I, Raposo G, Certain S, Bacq D, Dumont C, Lambert N, Ouachee-Chardin M, Chedeville G, Tamary H et al. 2003. Munc13-4 is essential for cytolytic granules fusion and is mutated in a form of familial hemophagocytic lymphohistiocytosis (FHL3). Cell 115(4):461-473.

Feldmann J, Prieur AM, Quartier P, Berquin P, Certain S, Cortis E, Teillac- Hamel D, Fischer A, de Saint Basile G. 2002. Chronic infantile neurological cutaneous and articular syndrome is caused by mutations in CIAS1, a gene highly expressed in polymorphonuclear cells and chondrocytes. American Journal of Human Genetics 71(1):198-203.

Bibliography 162 Ferguson PJ, Chen S, Tayeh MK, Ochoa L, Leal SM, Pelet A, Munnich A, Lyonnet S, Majeed HA, El-Shanti H. 2005. Homozygous mutations in LPIN2 are responsible for the syndrome of chronic recurrent multifocal osteomyelitis and congenital dyserythropoietic anaemia (Majeed syndrome). Journal of Medical Genetics 42(7):551-557.

Fernie BA, Wurzner R, Orren A, Morgan BP, Potter PC, Platonov AE, Vershinina IV, Shipulin GA, Lachmann PJ, Hobart MJ. 1996. Molecular bases of combined subtotal deficiencies of C6 and C7 - Their effects in combination with other C6 and C7 deficiencies. Journal of Immunology 157(8):3648-3657.

Ferrari S, Giliani S, Insalaco A, Al-Ghonaium A, Soresina AR, Loubser M, Avanzini MA, Marconi M, Badolato R, Ugazio AG et al. 2001. Mutations of CD40 gene cause an autosomal recessive form of immunodeficiency with hyper IgM. Proceedings of the National Academy of Sciences of the United States of America 98(22):12614-12619.

Ferrari S, Lougaris V, Caraffi S, Zuntini R, Yang J, Soresina A, Meini A, Cazzola G, Rossi C, Reth M et al. 2007. Mutations of the Ig beta gene cause agammaglobulinemia in man. Journal of Experimental Medicine 204(9):2047- 2051.

Ferwerda B, Ferwerda G, Plantinga TS, Willment JA, van Spriel AB, Venselaar H, Elbers CC, Johnson MD, Cambi A, Huysamen C et al. 2009. Human Dectin- 1 Deficiency and Mucocutaneous Fungal Infections. New England Journal of Medicine 361(18):1760-1767.

Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, Hogan PG, Lewis RS, Daly M, Rao A. 2006. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 441(7090):179-185.

Filipe-Santos O, Bustamante J, Haverkamp MH, Vinolo E, Ku CL, Puel A, Frucht DM, Christel K, von Bernuth H, Jouanguy E et al. 2006. X-linked susceptibility to mycobacteria is caused by mutations in NEMO impairing CD40- dependent IL-12 production. Journal of Experimental Medicine 203(7):1745- 1759.

Finck A, Van der Meer JWM, Schaffer AA, Pfannstiel J, Fieschi C, Plebani A, Webster ADB, Hammarstrom L, Grimbacher B. 2006. Linkage of autosomal-

Bibliography 163 dominant common variable immunodeficiency to chromosome 4q. European Journal of Human Genetics 14(7):867-875.

Fisher GH, Rosenberg FJ, Straus SE, Dale JK, Middelton LA, Lin AY, Strober W, Lenardo MJ, Puck JM. 1995. Dominant Interfering Fas Gene-Mutations Impair Apoptosis In A Human Autoimmune Lymphoproliferative Syndrome. Cell 81(6):935-946.

Frank J, Pignata C, Panteleyev AA, Prowse DM, Baden H, Weiner L, Gaetaniello L, Ahmad W, Pozzi N, Cserhalmi-Friedman PB et al. 1999. Exposing the human nude phenotype. Nature 398(6727):473-474.

Frattini A, Orchard PJ, Sobacchi C, Giliani S, Abinun M, Mattsson JP, Keeling DJ, Andersson AK, Wallbrandt P, Zecca L et al. 2000. Defects in TCIRG1 subunit of the vacuolar proton pump are responsible for a subset of human autosomal recessive osteopetrosis. Nature Genetics 25(3):343-346.

Fredrikson GN, Westberg J, Kuijper EJ, Tijssen CC, Sjoholm AG, Uhlen M, Truedsson L. 1996. Molecular characterization of properdin deficiency type III - Dysfunction produced by a single point mutation in exon 9 of the structural gene causing a tyrosine to aspartic acid interchange. Journal of Immunology 157(8):3666-3671.

Fremeaux-Bacchi V, Dragon-Durey MA, Blouin J, Vigneau C, Kuypers D, Boudailliez B, Loirat C, Rondeau E, Fridman WH. 2004. Complement factor I: a susceptibility gene for atypical haemolytic uraemic syndrome. Journal of Medical Genetics 41(6).

Fremeaux-Bacchi V, Miller EC, Liszewski MK, Strain L, Blouin J, Brown AL, Moghal N, Kaplan BS, Weiss RA, Lhotta K et al. 2008. Mutations in complement C3 predispose to development of atypical hemolytic uremic syndrome. Blood 112(13):4948-4952.

Furukawa H, Murata S, Yabe T, Shimbara N, Keicho N, Kashiwase K, Watanabe K, Ishikawa Y, Akaza T, Tadokoro K et al. 1999. Splice acceptor site mutation of the transporter associated with antigen processing-1 gene in human bare lymphocyte syndrome. Journal of Clinical Investigation 103(5):755-758.

Bibliography 164 Gale DP, de Jorge EG, Cook HT, Martinez-Barricarte R, Hadjisavvas A, McLean AG, Pusey CD, Pierides A, Kyriacou K, Athanasiou Y et al. 2010. Identification of a mutation in complement factor H-related protein 5 in patients of Cypriot origin with glomerulonephritis. Lancet 376(9743):794-801.

Genin E, Todorov AA, Clerget-Darpoux F. 1998. Optimization of genome search strategies for homozygosity mapping: influence of marker spacing on power and threshold criteria for identification of candidate regions. Annals of Human Genetics 62:419-429.

Gerin I, Veiga-da-Cunha M, Achouri Y, Collet JF, Van Schaftingen E. 1997. Sequence of a putative glucose 6-phosphate translocase, mutated in glycogen storage disease type Ib. Febs Letters 419(2-3):235-238.

Giaever G, Chu AM, Ni L, Connelly C, Riles L, Veronneau S, Dow S, Lucau- Danila A, Anderson K, Andre B et al. 2002. Functional profiling of the Saccharomyces cerevisiae genome. Nature 418(6896):387-391.

Giblett ER, Anderson JE, Cohen F, Pollara B, Meuwisse.Hj. 1972. Adenosin- Deaminase Deficiency In 2 Patients With Severely Impaired Cellular Immunity. Lancet 2(7786):1067-&.

Glocker EO, Hennigs A, Nabavi M, Schaffer AA, Woellner C, Salzer U, Pfeifer D, Veelken H, Warnatz K, Tahami F et al. 2009a. A Homozygous CARD9 Mutation in a Family with Susceptibility to Fungal Infections. New England Journal of Medicine 361(18):1727-1735.

Glocker EO, Kotlarz D, Boztug K, Gertz EM, Schaffer AA, Noyan F, Perro M, Diestelhorst J, Allroth A, Murugan D et al. 2009b. Inflammatory Bowel Disease and Mutations Affecting the Interleukin-10 Receptor. New England Journal of Medicine 361(21):2033-2045.

Goldman FD, Ballas ZK, Schutte BC, Kemp J, Hollenback C, Noraz N, Taylor N. 1998. Defective expression of p56lck in an infant with severe combined immunodeficiency. Journal of Clinical Investigation 102(2):421-429.

Govindarajan R, Blonski, M., Ming Tse, C.M., Wang, J., and, Unadkat JD. The human equilibrative nucleoside transporter-3 is a mitochondrial transporter that transports anti-HIV dideoxynucleoside drugs. FASEB J; 2008. p. 1132.2.

Bibliography 165 Grantham R. 1974. Amino acid difference formula to help explain protein evolution. Science 185(4154):862-4.

Grimbacher B, Hutloff A, Schlesier M, Glocker E, Warnatz K, Drager R, Eibel H, Fischer B, Schaffer AA, Mages HW et al. 2003. Homozygous loss of ICOS is associated with adult-onset common variable immunodeficiency. Nature Immunology 4(3):261-268.

Guerrini MM, Sobacchi C, Cassani B, Abinun M, Kilic SS, Pangrazio A, Moratto D, Mazzolari E, Clayton-Smith J, Orchard P et al. 2008. Human osteoclast-poor osteopetrosis with hypogammaglobulinemia due to TNFRSF11A (RANK) mutations. American Journal of Human Genetics 83(1):64-76.

Guldner HH, Szostecki C, Grotzinger T, Will H. 1992. IFN enhance expression of SP100, an autoantigen in primary biliary cirrhosis. J Immunol 149(12):4067- 73.

Gwinn MR, Sharma A, De Nardin E. 1999. Single nucleotide polymorphisms of the N-formyl peptide receptor in localized juvenile periodontitis. Journal of Periodontology 70(10):1194-1201.

Hambleton S, Salem S, Bustamante J, Bigley V, Boisson-Dupuis S, Azevedo J, Fortin A, Haniffa M, Ceron-Gutierrez L, Bacon CM et al. 2011. IRF8 Mutations and Human Dendritic-Cell Immunodeficiency. New England Journal of Medicine 365(2):127-138.

Hampe J, Cuthbert A, Croucher PJP, Mirza MM, Mascheretti S, Fisher S, Frenzel H, King K, Hasselmeyer A, MacPherson AJS et al. 2001. Association between insertion mutation in NOD2 gene and Crohn's disease in German and British populations. Lancet 357(9272):1925-1928.

Hartley JL, Zachos NC, Dawood B, Donowitz M, Forman J, Pollitt RJ, Morgan NV, Tee L, Gissen P, Kahr WHA et al. 2010. Mutations in TTC37 Cause Trichohepatoenteric Syndrome (Phenotypic Diarrhea of Infancy). Gastroenterology 138(7):2388-U249.

Heiss NS, Knight SW, Vulliamy TJ, Klauck SM, Wiemann S, Mason PJ, Poustka A, Dokal I. 1998. X-linked dyskeratosis congenita is caused by mutations in a

Bibliography 166 highly conserved gene with putative nucleolar functions. Nature Genetics 19(1):32-38.

Hernandez PA, Gorlin RJ, Lukens JN, Taniuchi S, Bohinjec J, Francois F, Klotman ME, Diaz GA. 2003. Mutations in the chemokine receptor gene CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease. Nature Genetics 34(1):70-74.

Hoffman HM, Mueller JL, Broide DH, Wanderer AA, Kolodner RD. 2001. Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome. Nature Genetics 29(3):301-305.

Hofmann TG, Will H. 2003. Body language: the function of PML nuclear bodies in apoptosis regulation. Cell Death and Differentiation 10(12):1290-1299.

Horwitz M, Benson KF, Person RE, Aprikyan AG, Dale DC. 1999. Mutations in ELA2, encoding neutrophil elastase, define a 21-day biological clock in cyclic haematopoiesis. Nature Genetics 23(4):433-436.

Houten SM, Kuis W, Duran M, de Koning TJ, van Royen-Kerkhof A, Romeijn GJ, Frenkel J, Dorland L, de Barse MMJ, Huijbers WAR et al. 1999. Mutations in MVK, encoding mevalonate kinase, cause hyperimmunoglobulinaemia D and periodic fever syndrome. Nature Genetics 22(2):175-177.

Hsu AP, Sampaio EP, Khan J, Calvo KR, Lemieux JE, Patel SY, Frucht DM, Vinh DC, Auth RD, Freeman AF et al. 2011. Mutations in GATA2 are associated with the autosomal dominant and sporadic monocytopenia and mycobacterial infection (MonoMAC) syndrome. Blood. United States. p. 2653-5.

Hsu CL, Lin W, Seshasayee D, Chen YH, Ding X, Lin Z, Suto E, Huang Z, Lee WP, Park H, Xu M, Sun M, et al. 2012. Equilibrative nucleoside transporter 3 deficiency perturbs lysosome function and macrophage homeostasis. Science 335: 89-92

Hu VW, Frank BC, Heine S, Lee NH, Quackenbush J. 2006. Gene expression profiling of lymphoblastoid cell lines from monozygotic twins discordant in severity of autism reveals differential regulation of neurologically relevant genes. Bmc Genomics 7.

Bibliography 167 Huang DW, Sherman BT, Lempicki RA. 2009a. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research 37(1):1-13.

Huang DW, Sherman BT, Lempicki RA. 2009b. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols 4(1):44-57.

Huang JL, Lin CY. 1994. A Hereditary C3 Deficiency Due To Aberrant Splicing Of Exon-10. Clinical Immunology and Immunopathology 73(2):267-273.

Huck K, Feyen O, Niehues T, Ruschendorf F, Hubner N, Laws HJ, Telieps T, Knapp S, Wacker HH, Meindl A et al. 2009. Girls homozygous for an IL-2- inducible T cell kinase mutation that leads to protein deficiency develop fatal EBV-associated lymphoproliferation. Journal of Clinical Investigation 119(5):1350-1358.

Huggett J, Dheda K, Bustin S, Zumla A. 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes and Immunity 6(4):279- 284.

Hughes AE, Orr N, Esfandiary H, Diaz-Torres M, Goodship T, Chakravarthy U. 2006. A common CFH haplotype, with deletion of CFHR1 and CFHR3, is associated with lower risk of age-related macular degeneration. Nature Genetics 38(10):1173-1177.

Hugot JP, Chamaillard M, Zouali H, Lesage S, Cezard JP, Belaiche J, Almer S, Tysk C, O'Morain CA, Gassull M et al. 2001. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature 411(6837):599- 603.

Hussain K, Padidela R, Kapoor RR, James C, Banerjee K, Harper J, Wilson LC, Hennekam RCM. 2009. Diabetes mellitus, exocrine pancreatic deficiency, hypertrichosis, hyperpigmentation, and chronic inflammation: confirmation of a syndrome. Pediatric Diabetes 10(3):193-197.

Imai K, Slupphaug G, Lee WI, Revy P, Nonoyama S, Catalan N, Yel L, Forveille M, Kavli B, Krokan HE et al. 2003. Human uracil-DNA glycosylase deficiency

Bibliography 168 associated with profoundly impaired immunoglobulin class-switch recombination. Nature Immunology 4(10):1023-1028.

Inoue N, Saito T, Masuda R, Suzuki Y, Ohtomi M, Sakiyama H. 1998. Selective complement C1s deficiency caused by homozygous four-base deletion in the C1s gene. Human Genetics 103(4):415-418.

Jacquot S, Kobata T, Iwata S, Morimoto C, Schlossman SF. 1997. CD154/CD40 and CD70/CD27 interactions have different and sequential functions in T cell-dependent B cell responses: enhancement of plasma cell differentiation by CD27 signaling. J Immunol 159(6):2652-7.

Jeffery IB, Higgins DG, Culhane AC. 2006. Comparison and evaluation of methods for generating differentially expressed gene lists from microarray data. Bmc Bioinformatics 7.

Jenkins D, Baynam G, De Catte L, Elcioglu N, Gabbett MT, Hudgins L, Hurst JA, Jehee FS, Oley C, Wilkie AOM. 2011. Carpenter syndrome: extended RAB23 mutation spectrum and analysis of nonsense-mediated mRNA decay. Human Mutation 32(4):E2069-E2078.

Jeru I, Duquesnoy P, Fernandes-Alnemri T, Cochet E, Yu JW, Lackmy-Port-Lis M, Grimprel E, Landman-Parker J, Hentgen V, Marlin S et al. 2008. Mutations in NALP12 cause hereditary periodic fever syndromes. Proceedings of the National Academy of Sciences of the United States of America 105(5):1614- 1619.

Johnson CA, Densen P, Hurford RK, Colten HR, Wetsel RA. 1992. Type-I Human-Complement C2 Deficiency - A 28-Base Pair Gene Deletion Causes Skipping Of Exon-6 During Rna Splicing. Journal of Biological Chemistry 267(13):9347-9353.

Jou ST, Chien YH, Yang YH, Wang TC, Shyur SD, Chou CC, Chang ML, Lin DT, Lin KH, Chiang BL. 2006. Identification of variations in the human phosphoinositide 3-kinase p110 delta gene in children with primary B-cell immunodeficiency of unknown aetiology. International Journal of Immunogenetics 33(5):361-369.

Bibliography 169 Jouanguy E, Altare F, Lamhamedi S, Revy P, Emile JF, Newport M, Levin M, Blanche S, Seboun E, Fischer A et al. 1996. Interferon-gamma-receptor deficiency in an infant with fatal bacille Calmette-Guerin infection. New England Journal of Medicine 335(26):1956-1961.

Kaufmann T, Hansch G, Rittner C, Spath P, Tedesco F, Schneider PM. 1993. Genetic-Basis Of Human-Complement C8-Beta Deficiency. Journal of Immunology 150(11):4943-4947.

Keerthikumar S, Bhadra S, Kandasamy K, Raju R, Ramachandra YL, Bhattacharyya C, Imai K, Ohara O, Mohan S, Pandey A. 2009a. Prediction of Candidate Primary Immunodeficiency Disease Genes Using a Support Vector Machine Learning Approach. DNA Research 16(6):345-351.

Keerthikumar S, Raju R, Kandasamy K, Hijikata A, Ramabadran S, Balakrishnan L, Ahmed M, Rani S, Selvan LDN, Somanathan DS et al. 2009b. RAPID: Resource of Asian Primary Immunodeficiency Diseases. Nucleic Acids Research 37:D863-D867.

Khajavi M, Inoue K, Lupski JR. 2006. Nonsense-mediated mRNA decay modulates clinical outcome of genetic disease. European Journal of Human Genetics 14(10):1074-1081.

Kirkpatrick P, Riminton S. 2007. Primary immunodeficiency diseases in Australia and New Zealand. Journal of Clinical Immunology 27(5):517-524.

Kitao S, Shimamoto A, Goto M, Miller RW, Smithson WA, Lindor NM, Furuichi Y. 1999. Mutations in RECQL4 cause a subset of cases of Rothmund-Thomson syndrome. Nature Genetics 22(1):82-84.

Klein C, Grudzien M, Appaswamy G, Germeshausen M, Sandrock I, Schaffer AA, Rathinam C, Boztug K, Schwinzer B, Rezaei N et al. 2007. HAX1 deficiency causes autosomal recessive severe congenital neutropenia (Kostmann disease). Nature Genetics 39(1):86-92.

Kofoed EM, Hwa V, Little B, Woods KA, Buckway CK, Tsubaki J, Pratt KL, Bezrodnik L, Jasper H, Tepper A et al. 2003. Growth hormone insensitivity associated with a STAT5b mutation. New England Journal of Medicine 349(12):1139-1147.

Bibliography 170 Kojima T, Horiuchi T, Nishizaka H, Fukumori Y, Amano T, Nagasawa K, Niho Y, Hayashi K. 1998. Genetic basis of human complement c8 alpha-gamma deficiency. Journal of Immunology 161(7):3762-3766.

Kornak U, Schulz A, Friedrich W, Uhlhaas S, Kremens B, Voit T, Hasan C, Bode U, Jentsch TJ, Kubisch C. 2000. Mutations in the a3 subunit of the vacuolar H+-ATPase cause infantile malignant osteopetrosis. Human Molecular Genetics 9(13):2059-2063.

Kralovicova J, Hammarstrom L, Plebani A, Webster ADB, Vorechovsky I. 2003. Fine-scale mapping at IGAD1 and genome-wide genetic linkage analysis implicate HLA-DQ/DR as a major susceptibility locus in selective IgA deficiency and common variable immunodeficiency. Journal of Immunology 170(5):2765- 2775.

Kuijpers TW, Bende RJ, Baars PA, Grummels A, Derks IAM, Dolman KM, Beaumont T, Tedder TF, van Noesel CJM, Eldering E et al. 2010. CD20 deficiency in humans results in impaired T cell-independent antibody responses. Journal of Clinical Investigation 120(1):214-222.

Kuijpers TW, van de Vijver E, Weterman MAJ, de Boer M, Tool ATJ, van den Berg TK, Moser M, Jakobs ME, Seeger K, Sanal O et al. 2009. LAD-1/variant syndrome is caused by mutations in FERMT3. Blood 113(19):4740-4746.

Kung C, Pingel JT, Heikinheimo M, Klemola T, Varkila K, Yoo LI, Vuopala K, Poyhonen M, Uhari M, Rogers M et al. 2000. Mutations in the tyrosine phosphatase CD45 gene in a child with severe combined immunodeficiency disease. Nature Medicine 6(3):343-345.

Lagresle-Peyrou C, Six EM, Picard C, Rieux-Laucat F, Michel V, Ditadi A, Demerens-de Chappedelaine C, Morillon E, Valensi F, Simon-Stoos KL et al. 2009. Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics 41(1):106-111.

Lallemand-Breitenbach V, Zhu J, Puvion F, Koken M, Honore N, Doubeikovsky A, Duprez E, Pandolfi PP, Puvion E, Freemont P et al. 2001. Role of promyelocytic leukemia (PML) sumolation in nuclear body formation, 11S proteasome recruitment, and As2O3-induced PML or PML/retinoic acid receptor alpha degradation. Journal of Experimental Medicine 193(12):1361-1371.

Bibliography 171 Lander ES, Botstein D. 1987. Homozygosity Mapping - a Way to Map Human Recessive Traits with the DNA of Inbred Children. Science 236(4808):1567- 1570.

Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W et al. 2001. Initial sequencing and analysis of the human genome. Nature 409(6822):860-921.

Lavau C, Marchio A, Fagioli M, Jansen J, Falini B, Lebon P, Grosveld F, Pandolfi PP, Pelicci PG, Dejean A. 1995. The acute promyelocytic leukaemia- associated PML gene is induced by interferon. Oncogene 11(5):871-6.

Lei KJ, Shelly LL, Pan CJ, Sidbury JB, Chou JY. 1993. Mutations In The Glucose-6-Phosphatase Gene That Cause Glycogen-Storage-Disease Type-1a. Science 262(5133):580-583.

Lekstrom-Himes JA, Dorman SE, Kopar P, Holland SM, Gallin JI. 1999. Neutrophil-specific granule deficiency results from a novel mutation with loss of function of the transcription factor CCAAT enhancer binding protein epsilon. Journal of Experimental Medicine 189(11):1847-1852.

Leon C, Nandan D, Lopez M, Moeenrezakhanlou A, Reiner NE. 2006. Annexin V associates with the IFN-gamma receptor and regulates IFN-gamma signaling. J Immunol 176(10):5934-42.

Li N, Rosenblatt DS, Kamen BA, Seetharam S, Seetharam B. 1994. Identification Of 2 Mutant Alleles Of Transcobalamin-Ii In An Affected Family. Human Molecular Genetics 3(10):1835-1840.

Liang L, Zhao YL, Yue J, Liu JF, Han M, Wang HX, Xiao HP. 2011. Association of SP110 gene polymorphisms with susceptibility to tuberculosis in a Chinese population. Infection Genetics and Evolution 11(5):934-939.

Liu LY, Okada S, Kong XF, Kreins AY, Cypowyj S, Abhyankar A, Toubiana J, Itan Y, Audry M, Nitschke P et al. 2011. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis. Journal of Experimental Medicine 208(8):1635-1648.

Bibliography 172 Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25(4):402-408.

Lokki ML, Circolo A, Ahokas P, Rupert KL, Yu CY, Colten HR. 1999. Deficiency of human complement protein C4 due to identical frameshift mutations in the C4A and C4B genes. Journal of Immunology 162(6):3687-3693.

Lu SC. 1999. Regulation of hepatic glutathione synthesis: current concepts and controversies. Faseb Journal 13(10):1169-1183.

Lublin DM, Mallinson G, Poole J, Reid ME, Thompson ES, Ferdman BR, Telen MJ, Anstee DJ, Tanner MJA. 1994. Molecular-Basis Of Reduced Or Absent Expression Of Decay-Accelerating Factor In Cromer Blood-Group Phenotypes. Blood 84(4):1276-1282.

Luhn K, Wild MK, Eckhardt M, Gerardy-Schahn R, Vestweber D. 2001. The gene defective in leukocyte adhesion deficiency II encodes a putative GDP- fucose transporter. Nature Genetics 28(1):69-72.

Macchi P, Villa A, Giliani S, Sacco MG, Frattini A, Porta F, Ugazio AG, Johnston JA, Candotti F, O'Shea JJ et al. 1995. Mutations Of Jak-3 Gene In Patients With Autosomal Severe Combined Immune-Deficiency (SCID). Nature 377(6544):65- 68.

Machado J, Abdulla P, Hanna WJ, Hilliker AJ, Coe IR. 2007. Genomic analysis of nucleoside transporters in Diptera and functional characterization of DmENT2, a Drosophila equilibrative nucleoside transporter. Physiol Genomics 28(3):337-47.

Maddocks S, Scandurra GM, Nourse C, Bye C, Williams RB, Slobedman B, Cunningham AL, Britton WJ. 2009. Gene expression in HIV-1/Mycobacterium tuberculosis co-infected macrophages is dominated by M-tuberculosis. Tuberculosis 89(4):285-293.

Maga TK, Nishimura CJ, Weaver AE, Frees KL, Smith RJH. 2010. Mutations in Alternative Pathway Complement Proteins in American Patients with Atypical Hemolytic Uremic Syndrome. Human Mutation 31(6):E1445-E1460.

Bibliography 173 Malinin NL, Zhang L, Choi J, Ciocea A, Razorenova O, Ma Y-Q, Podrez EA, Tosi M, Lennon DP, Caplan AI et al. 2009. A point mutation in KINDLIN3 ablates activation of three integrin subfamilies in humans. Nature Medicine 15(3):313-318.

Marina S, Broshtilova V. 2006. POEMS in childhood. Pediatric Dermatology 23(2):145-148.

Marodi L, Notarangelo LD. 2007. Immunological and genetic bases of new primary immunodeficiencies. Nature Reviews Immunology 7(11):851-861.

Martinez-Moczygemba M, Doan ML, Elidemir O, Fan LL, Cheung SW, Lei JT, Moore JP, Tavana G, Lewis LR, Zhu YM et al. 2008. Pulmonary alveolar proteinosis caused by deletion of the GM-CSFR alpha gene in the X chromosome pseudoautosomal region 1. Journal of Experimental Medicine 205(12):2711-U19.

Masternak K, Barras E, Zufferey M, Conrad B, Corthals G, Aebersold R, Sanchez JC, Hochstrasser DF, Mach B, Reith W. 1998. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. Nature Genetics 20(3):273-277.

Matsuura S, Tauchi H, Nakamura A, Kondo N, Sakamoto S, Endo S, Smeets D, Solder B, Belohradsky BH, Kaloustian VMD et al. 1998. Positional cloning of the gene for Nijmegen breakage syndrome. Nature Genetics 19(2):179-181.

Matute JD, Arias AA, Wright NAM, Wrobel I, Waterhouse CCM, Li XJ, Marchal CC, Stull ND, Lewis DB, Steele M et al. 2009. A new genetic subgroup of chronic granulomatous disease with autosomal recessive mutations in p40(phox) and selective defects in neutrophil NADPH oxidase activity. Blood 114(15):3309-3315.

McAdam RA, Goundis D, Reid KBM. 1988. A Homozygous Point Mutation Results In A Stop Codon In The Clq B-Chain Of A Clq-Deficient Individual. Immunogenetics 27(4):259-264.

McDermott MF, Aksentijevich I, Galon J, McDermott EM, Ogunkolade BW, Centola M, Mansfield E, Gadina M, Karenko L, Pettersson T et al. 1999. Germline mutations in the extracellular domains of the 55 kDa TNF receptor,

Bibliography 174 TNFR1, define a family of dominantly inherited autoinflammatory syndromes. Cell 97(1):133-144.

Meldrum C, Doyle MA, Tothill RW. 2011. Next-Generation Sequencing for Cancer Diagnostics: a Practical Perspective. The Clinical Biochemist Reviews 32(4): 177-195.

Mellis C, Bale PM. 1976. Familial Hepatic Veno-Occlusive Disease With Probable Immune Deficiency. Journal of Pediatrics 88(2):236-242.

Menasche G, Ho CH, Sanal O, Feldmann J, Tezcan I, Ersoy F, Houdusse A, Fischer A, de Saint Basile G. 2003. Griscelli syndrome restricted to hypopigmentation results from a melanophilin defect (GS3) or a MYO5A F-exon deletion (GS1). Journal of Clinical Investigation 112(3):450-456.

Menasche G, Pastural E, Feldmann J, Certain S, Ersoy F, Dupuis S, Wulffraat N, Bianchi D, Fischer A, Le Deist F et al. 2000. Mutations in RAB27A cause Griscelli syndrome associated with haemophagocytic syndrome. Nature Genetics 25(2):173-176.

Mestas J, Hughes CCW. 2004. Of mice and not men: Differences between mouse and human immunology. Journal of Immunology 172(5):2731-2738.

Miceli-Richard C, Lesage S, Rybojad M, Prieur AM, Manouvrier-Hanu S, Hafner R, Chamaillard M, Zouali H, Thomas G, Hugot JP. 2001. CARD15 mutations in Blau syndrome. Nature Genetics 29(1):19-20.

Mihalci SA, Huddleston PM, Wu XS, Jelinek DF. 2010. The Structure of the TNFRSF13C Promoter Enables Differential Expression of BAFF-R during B Cell Ontogeny and Terminal Differentiation. Journal of Immunology 185(2):1045- 1054.

Millar SE. 2002. Molecular mechanisms regulating hair follicle development. J Invest Dermatol 118(2):216-25.

Milstein CP, Steinber.Ag, McLaughl.Cl, Solomon A. 1974. Amino-Acid Sequence Change Associated With Genetic Marker Inv(2) Of Human Immunoglobulin. Nature 248(5444):160-161.

Bibliography 175 Min JL, Barrett A, Watts T, Pettersson FH, Lockstone HE, Lindgren CM, Taylor JM, Allen M, Zondervan KT, McCarthy MI. 2010. Variability of gene expression profiles in human blood and lymphoblastoid cell lines. Bmc Genomics 11.

Minegishi Y, Coustan-Smith E, Rapalus L, Ersoy F, Campana D, Conley ME. 1999a. Mutations in Ig alpha (CD79a) result in in B-cell development. Journal of Clinical Investigation 104(8):1115-1121.

Minegishi Y, Coustan-Smith E, Wang YH, Cooper MD, Campana D, Conley ME. 1998. Mutations in the human lambda 5/14.1 gene result in B cell deficiency and agammaglobulinemia. Journal of Experimental Medicine 187(1):71-77.

Minegishi Y, Rohrer J, Coustan-Smith E, Lederman HM, Pappu R, Campana D, Chan AC, Conley ME. 1999b. An essential role for BLNK in human B cell development. Science 286(5446):1954-1957.

Minegishi Y, Saito M, Morio T, Watanabe K, Agematsu K, Tsuchiya S, Takada H, Hara T, Kawamura N, Ariga T et al. 2006. Human tyrosine kinase 2 deficiency reveals its requisite roles in multiple cytokine signals involved in innate and acquired immunity. Immunity 25(5):745-755.

Minegishi Y, Saito M, Tsuchiya S, Tsuge I, Takada H, Hara T, Kawamura N, Ariga T, Pasic S, Stojkovic O et al. 2007. Dominant-negative mutations in the DNA-binding domain of STAT3 cause hyper-IgE syndrome. Nature 448(7157):1058-U10.

Miyaki M, Nishio J, Konishi M, KikuchiYanoshita R, Tanaka K, Muraoka M, Nagato M, Chong JM, Koike M, Terada T et al. 1997. Drastic genetic instability of tumors and normal tissues in Turcot syndrome. Oncogene 15(23):2877-2881.

Moins-Teisserenc HT, Gadola SD, Cella M, Dunbar PR, Exley A, Blake N, Baycal C, Lambert J, Bigliardi P, Willemsen M et al. 1999. Association of a syndrome resembling Wegener's granulomatosis with low surface expression of HLA class-I molecules. Lancet 354(9190):1598-1603.

Molho-Pessach V, Agha Z, Aamar S, Glaser B, Doviner V, Hiller N, Zangen DH, Raas-Rothschild A, Ben-Neriah Z, Shweiki S et al. 2008a. The H syndrome: A genodermatosis characterized by indurated, hyperpigmented, and hypertrichotic

Bibliography 176 skin with systemic manifestations. Journal of the American Academy of Dermatology 59(1):79-85.

Molho-Pessach V, Lerer I, Abeliovich D, Agha Z, Abu Libdeh A, Broshtilova V, Elpeleg O, Zlotogorski A. 2008b. The H Syndrome Is Caused by Mutations in the Nucleoside Transporter hENT3. American Journal of Human Genetics 83(4):529-534.

Molho-Pessach V, Suarez J, Perrin C, Chiaverini C, Doviner V, Tristan-Clavijo E, Colmenero I, Giuliano F, Torrelo A, Zlotogorski A. 2010. The H syndrome: Two novel mutations affecting the same amino acid residue of hENT3. Journal of Dermatological Science 57(1):59-61.

Molnar C, Lopez-Varea A, Hernandez R, de Celis JF. 2006. A gain-of-function screen identifying genes required for vein formation in the Drosophila melanogaster wing. Genetics 174(3):1635-59.

Montagne J, Stewart MJ, Stocker H, Hafen E, Kozma SC, Thomas G. 1999. Drosophila S6 kinase: a regulator of cell size. Science 285(5436):2126-9.

Morgan NV, Goddard S, Cardno TS, McDonald D, Rahman F, Barge D, Ciupek A, Straatman-Iwanowska A, Pasha S, Guckian M et al. 2011. Mutation in the TCR alpha subunit constant gene (TRAC) leads to a human immunodeficiency disorder characterized by a lack of TCR alpha beta(+) T cells. Journal of Clinical Investigation 121(2):695-702.

Morgan NV, Morris MR, Cangul H, Gleeson D, Straatman-Iwanowska A, Davies N, Keenan S, Pasha S, Rahman F, Gentle D et al. 2010. Mutations in SLC29A3, Encoding an Equilibrative Nucleoside Transporter ENT3, Cause a Familial Histiocytosis Syndrome (Faisalabad Histiocytosis) and Familial Rosai- Dorfman Disease. Plos Genetics 6(2).

Moshous D, Callebaut I, de Chasseval R, Corneo B, Cavazzana-Calvo M, Le Deist F, Tezcan I, Sanal O, Bertrand Y, Philippe N et al. 2001. Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell 105(2):177-186.

Bibliography 177 Motoyama N, Okada N, Yamashina M, Okada H. 1992. Paroxysmal-Nocturnal Hemoglobinuria Due To Hereditary Nucleotide Delection In The Hrf20 (Cd59) Gene. European Journal of Immunology 22(10):2669-2673.

Munthe-Fog L, Hummelshoj T, Honore C, Madsen HO, Permin H, Garred P. 2009. Immunodeficiency Associated with FCN3 Mutation and Ficolin-3 Deficiency. New England Journal of Medicine 360(25):2637-2644.

Nagamine K, Peterson P, Scott HS, Kudoh J, Minoshima S, Heino M, Krohn KJE, Lalioti MD, Mullis PE, Antonarakis SE et al. 1997. Positional cloning of the APECED gene. Nature Genetics 17(4):393-398.

Nagle DL, Karim MA, Woolf EA, Holmgren L, Bork P, Misumi DJ, McGrail SH, Dussault BJ, Perou CM, Boissy RE et al. 1996. Identification and mutation analysis of the complete gene for Chediak-Higashi syndrome. Nature Genetics 14(3):307-311.

Nauseef WM, Brigham S, Cogley M. 1994. Hereditary Myeloperoxidase Deficiency Due To A Missense Mutation Of Arginine-569 To Tryptophan. Journal of Biological Chemistry 269(2):1212-1216.

Negorev D, Maul GG. 2001. Cellular proteins localized at and interacting within ND10/PML nuclear bodies/PODs suggest functions of a nuclear depot. Oncogene 20(49):7234-7242.

Newport MJ, Huxley CM, Huston S, Hawrylowicz CM, Oostra BA, Williamson R, Levin M. 1996. A mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infection. New England Journal of Medicine 335(26):1941-1949.

Ng PC, Henikoff S. 2001. Predicting deleterious amino acid substitutions. Genome Res 11(5):863-74.

Nicewonger J, Suck G, Bloch D, Swaminathan S. 2004. Epstein-Barr virus (EBV) SM protein induces and recruits cellular SP110b to stabilize mRNAs and enhance EBV lytic gene expression. Journal of Virology 78(17):9412-9422.

Nicklin P, Bergman P, Zhang BL, Triantafellow E, Wang H, Nyfeler B, Yang HD, Hild M, Kung C, Wilson C et al. 2009. Bidirectional Transport of Amino Acids Regulates mTOR and Autophagy. Cell 136(3):521-534.

Bibliography 178 Nishizaka H, Horiuchi T, Zhu ZB, Fukumori Y, Nagasawa K, Hayashi K, Krumdieck R, Cobbs CG, Higuchi M, Yasunaga S et al. 1996a. Molecular bases for inherited human complement component C6 deficiency in two unrelated individuals. Journal of Immunology 156(6):2309-2315.

Nishizaka H, Horiuchi T, Zhu ZB, Fukumori Y, Volanakis JE. 1996b. Genetic bases of human complement C7 deficiency. Journal of Immunology 157(9):4239-4243.

Noguchi M, Yi HF, Rosenblatt HM, Filipovich AH, Adelstein S, Modi WS, McBride OW, Leonard WJ. 1993. Interleukin-2 Receptor Gamma Chain Mutation Results In X-Linked Severe Combined Immunodeficiency In Humans. Cell 73(1):147-157.

Noris M, Brioschi S, Caprioli J, Todeschini M, Bresin E, Porrati F, Gamba S, Remuzzi G, Int Registry Recurrent F. 2003. Familial haemolytic uraemic syndrome and an MCP mutation. Lancet 362(9395):1542-1547.

North KN, Yang N, Wattanasirichaigoon D, Mills M, Easteal S, Beggs AH. 1999. A common nonsense mutation results in alpha-actinin-3 deficiency in the general population. Nature Genetics 21(4):353-354.

Notarangelo LD, Fischer A, Geha RS, Casanova JL, Chapel H, Conley ME, Cunningham-Rundles C, Etzioni A, Hammartrom L, Nonoyama S et al. 2009. Primary immunodeficiencies: 2009 update. Journal of Allergy and Clinical Immunology 124(6):1161-1178.

Nunoi H, Iwata M, Tatsuzawa S, Onoe Y, Shimizu S, Kanegasaki S, Matsuda I. 1995. AG Dinucleotide Insertion In A Patient With Chronic Granulomatous- Disease Lacking Cytosolic 67-Kd Protein. Blood 86(1):329-333.

Nunoi H, Yamazaki T, Tsuchiya H, Kato S, Malech HL, Matsuda I, Kanegasaki S. 1999. A heterozygous mutation of beta-actin associated with neutrophil dysfunction and recurrent infection. Proceedings of the National Academy of Sciences of the United States of America 96(15):8693-8698.

O'Driscoll M, Cerosaletti KM, Girard PM, Dai Y, Stumm M, Kysela B, Hirsch B, Gennery A, Palmer SE, Seidel J et al. 2001. DNA ligase IV mutations identified

Bibliography 179 in patients exhibiting developmental delay and immunodeficiency. Molecular Cell 8(6):1175-1185.

Ogura Y, Bonen DK, Inohara N, Nicolae DL, Chen FF, Ramos R, Britton H, Moran T, Karaliuskas R, Duerr RH et al. 2001. A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature 411(6837):603-606.

Oliveira JB, Bidere N, Niemela JE, Zheng LX, Sakai K, Nix CP, Danner RL, Barb J, Munson PJ, Puck JM et al. 2007. NRAS mutation causes a human autoimmune lymphoproliferative syndrome. Proceedings of the National Academy of Sciences of the United States of America 104(21):8953-8958.

Orange JS, Levy O, Brodeur SR, Krzewski K, Roy RM, Niemela JE, Fleisher TA, Bonilla FA, Geha RS. 2004. Human nuclear factor kappa B essential modulator mutation can result in immunodeficiency without ectodermal dysplasia. Journal of Allergy and Clinical Immunology 114(3):650-656.

Pan H, Yan BS, Rojas M, Shebzukhov YV, Zhou HW, Kobzik L, Higgins DE, Daly MJ, Bloom BR, Kramnik I. 2005. Ipr1 gene mediates innate immunity to tuberculosis. Nature 434(7034):767-772.

Pannicke U, Honig M, Hess I, Friesen C, Holzmann K, Rump EM, Barth TF, Rojewski MT, Schulz A, Boehm T et al. 2009. Reticular dysgenesis (aleukocytosis) is caused by mutations in the gene encoding mitochondrial adenylate kinase 2. Nature Genetics 41(1):101-105.

Pastural E, Barrat FJ, DufourcqLagelouse R, Certain S, Sanal O, Jabado N, Seger R, Griscelli C, Fischer A, DesaintBasile G. 1997. Griscelli disease maps to chromosome 15q21 and is associated with mutations in the myosin-Va gene. Nature Genetics 16(3):289-292.

Pasvolsky R, Feigelson SW, Kilic SS, Simon AJ, Tal-Lapidot G, Grabovsky V, Crittenden JR, Amariglio N, Safran M, Graybiel AM et al. 2007. A LAD-III syndrome is associated with defective expression of the Rap-1 activator CalDAG-GEFI in lymphocytes, neutrophils, and platelets. Journal of Experimental Medicine 204(7):1571-1582.

Pathak SK, Basu S, Bhattacharyya A, Pathak S, Kundu M, Basu J. 2005. Mycobacterium tuberculosis lipoarabinomannan-mediated IRAK-M induction

Bibliography 180 negatively regulates Toll-like receptor-dependent interleukin-12 p40 production in macrophages. J Biol Chem 280(52):42794-800.

Person RE, Li FQ, Duan ZJ, Benson KF, Wechsler J, Papadaki HA, Eliopoulos G, Kaufman C, Bertolone SJ, Nakamoto B et al. 2003. Mutations in proto- oncogene GFI1 cause human neutropenia and target ELA2. Nature Genetics 34(3):308-312.

Petry F, Le DT, Kirschfink M, Loos M. 1995. Nonsense And Missense Mutations In The Structural Genes Of Complement Component C1q A-Chains And C- Chains Are Linked With 2 Different Types Of Complete Selective C1q Deficiencies. Journal of Immunology 155(10):4734-4738.

Picard C, McCarl CA, Papolos A, Khalil S, Luthy K, Hivroz C, LeDeist F, Rieux- Laucat F, Rechavi G, Rao A et al. 2009. Brief Report: STIM1 Mutation Associated with a Syndrome of Immunodeficiency and Autoimmunity. New England Journal of Medicine 360(19):1971-1980.

Picard C, Puel A, Bonnet M, Ku CL, Bustamante J, Yang K, Soudais C, Dupuis S, Feinberg J, Fieschi C et al. 2003. Pyogenic bacterial infections in humans with IRAK-4 deficiency. Science 299(5615):2076-2079.

Prendiville J, Rogers M, Kan A, de Castro F, Wong M, Junker A, Becknell C, Schultz K. 2007. Pigmented hypertrichotic dermatosis and insulin dependent diabetes: Manifestations of a unique genetic disorder? Pediatric Dermatology 24(2):101-107.

Procaccio V, Salazar G, Ono S, Styers ML, Gearing M, Davila A, Jimenez R, Juncos J, Gutekunst A, Meroni G et al. 2006. A mutation of beta-actin that alters depolymerization dynamics is associated with autosomal dominant developmental malformations, deafness, and dystonia. American Journal of Human Genetics 78(6):947-960.

Puel A, Ziegler SF, Buckley RH, Leonard WJ. 1998. Defective IL7R expression in T-B+NK+ severe combined immunodeficiency. Nature Genetics 20(4):394- 397.

Qiu AD, Jansen M, Sakaris A, Min SH, Chattopadhyay S, Tsai E, Sandoval C, Zhao RB, Akabas MH, Goldman ID. 2006. Identification of an intestinal folate

Bibliography 181 transporter and the molecular basis for hereditary folate malabsorption. Cell 127(5):917-928.

Quackenbush J. 2002. Microarray data normalization and transformation. Nature Genetics 32:496-501.

Quinti I, Soresina A, Spadaro G, Martino S, Donnanno S, Agostini C, Claudio P, Franco D, Pesce AM, Borghese F et al. 2007. Long-term follow-up and outcome of a large cohort of patients with common variable immunodeficiency. Journal of Clinical Immunology 27(3):308-316.

Ramoz N, Rueda LA, Bouadjar B, Montoya LS, Orth G, Favre M. 2002. Mutations in two adjacent novel genes are associated with epidermodysplasia verruciformis. Nature Genetics 32(4):579-581.

Ranque B, Alter A, Schurr E, Abel L, Alcais A. 2008. Leprosy: a paradigm for the study of human genetic susceptibility to infectious diseases. M S-Medecine Sciences 24(5):491-497.

Reddy S, Jia S, Geoffrey R, Lorier R, Suchi M, Broeckel U, Hessner MJ, Verbsky J. 2009. BRIEF REPORT An Autoinflammatory Disease Due to Homozygous Deletion of the IL1RN Locus. New England Journal of Medicine 360(23):2438-2444.

Regad T, Chelbi-Alix MK. 2001. Role and fate of PML nuclear bodies in response to interferon and viral infections. Oncogene 20(49):7274-7286.

Revy P, Muto T, Levy Y, Geissmann F, Plebani A, Sanal O, Catalan N, Forveille M, Dufourcq-Lagelouse R, Gennery A et al. 2000. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the hyper- IgM syndrome (HIGM2). Cell 102(5):565-575.

Rice GI, Bond J, Asipu A, Brunette RL, Manfield IW, Carr IM, Fuller JC, Jackson RM, Lamb T, Briggs TA et al. 2009. Mutations involved in Aicardi-Goutieres syndrome implicate SAMHD1 as regulator of the innate immune response. Nature Genetics 41(7):829-U89.

Ridanpaa M, van Eenennaam H, Pelin K, Chadwick R, Johnson C, Yuan B, vanVenrooij W, Pruijn G, Salmela R, Rockas S et al. 2001. Mutations in the

Bibliography 182 RNA component of RNase MRP cause a pleiotropic human disease, cartilage- hair hypoplasia. Cell 104(2):195-203.

Rieux-Laucat F, Hivroz C, Lim A, Mateo V, Pellier I, Selz F, Fischer A, Le Deist F. 2006. Brief report: Inherited and somatic CD3 zeta mutations in a patient with T-cell deficiency. New England Journal of Medicine 354(18):1913-1921.

Rigaud S, Fondaneche MC, Lambert N, Pasquier B, Mateo V, Soulas P, Galicier L, Le Deist F, Rieux-Laucat F, Revy P et al. 2006. XIAP deficiency in humans causes an X-linked lymphoproliferative syndrome. Nature 444(7115):110-114.

Romero X, Benitez D, March S, Vilella R, Miralpeix M, Engel P. 2004. Differential expression of SAP and EAT-2-binding leukocyte cell-surface molecules CD84, CD150 (SLAM), CD229 (Ly9) and CD244 (2B4). Tissue Antigens 64(2):132-44.

Roscioli T. 2007. The Genetic Basis of Veno-occlusive Disease with Immunodeficiency Syndrome. Thesis (PhD) University of New South Wales.

Roscioli T, Cliffe ST, Bloch DB, Bell CG, Mullan G, Taylor PJ, Sarris M, Wang J, Donald JA, Kirk EP et al. 2006. Mutations in the gene encoding the PML nuclear body protein SP110 are associated with immunodeficiency and hepatic veno-occlusive disease. Nature Genetics 38(6):620-622.

Rose JB, Coe IR. 2008. Physiology of nucleoside transporters: back to the future. Physiology (Bethesda) 23:41-8.

Royerpokora B, Kunkel LM, Monaco AP, Goff SC, Newburger PE, Baehner RL, Cole FS, Curnutte JT, Orkin SH. 1986. Cloning The Gene For An Inherited Human Disorder - Chronic Granulomatous-Disease - On The Basis Of Its Chromosomal Location. Nature 322(6074):32-38.

Rudd MF, Williams RD, Webb EL, Schmidt S, Sellick GS, Houlston RS. 2005. The predicted impact of coding single nucleotide polymorphisms database. Cancer Epidemiol Biomarkers Prev 14(11 Pt 1):2598-604.

Salzer U, Birmelin J, Bacchelli C, Witte T, Buchegger-Podbielski U, Buckridge S, Rzepka R, Gaspar HB, Thrasher AJ, Schmidt RE et al. 2007. Sequence

Bibliography 183 analysis of TNFRSF13b, encoding TACI, in patients with systemic lupus erythematosus. Journal of Clinical Immunology 27(4):372-377.

Salzer U, Chapel HM, Webster ADB, Pan-Hammarstrom Q, Schmitt-Graeff A, Schlesier M, Peter HH, Rockstroh JK, Schneider P, Schaffer AA et al. 2005. Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nature Genetics 37(8):820-828.

Salzer U, Neumann C, Thiel J, Woellner C, Pan-Hammarstrom Q, Lougaris V, Hagena T, Jung J, Birmelin J, Du L et al. 2008. Screening of functional and positional candidate genes in families with common variable immunodeficiency. Bmc Immunology 9:9.

Savitsky K, Barshira A, Gilad S, Rotman G, Ziv Y, Vanagaite L, Tagle DA, Smith S, Uziel T, Sfez S et al. 1995. A Single Ataxia-Telangiectasia Gene With A Product Similar To Pi-3 Kinase. Science 268(5218):1749-1753.

Sawada A, Takihara Y, Kim JY, Matsuda-Hashii Y, Tokimasa S, Fujisaki H, Kubota K, Endo H, Onodera T, Ohta H et al. 2003. A congenital mutation of the novel gene LRRC8 causes agammaglobulinemia in humans. Journal of Clinical Investigation 112(11):1707-1713.

Schafer BL, Bishop RW, Kratunis VJ, Kalinowski SS, Mosley ST, Gibson KM, Tanaka RD. 1992. Molecular-Cloning Of Human Mevalonate Kinase And Identification Of A Missense Mutation In The Genetic-Disease Mevalonic Aciduria. Journal of Biological Chemistry 267(19):13229-13238.

Schmalstieg FC, Leonard WJ, Noguchi M, Berg M, Rudloff HE, Denney RM, Dave SK, Brooks EG, Goldman AS. 1995. Missense Mutation In Exon-7 Of The Common Gamma-Chain Gene Causes A Moderate Form Of X-Linked Combined Immunodeficiency. Journal of Clinical Investigation 95(3):1169-1173.

Schwarz K, Gauss GH, Ludwig L, Pannicke U, Li Z, Lindner D, Friedrich W, Seger RA, HansenHagge TE, Desiderio S et al. 1996. RAG mutations in human B cell-negative SCID. Science 274(5284):97-99.

Seeler JS, Marchio A, Sitterlin D, Transy C, Dejean A. 1998. Interaction of SP100 with HP1 proteins: a link between the promyelocytic leukemia-

Bibliography 184 associated nuclear bodies and the chromatin compartment. Proc Natl Acad Sci U S A 95(13):7316-21.

Sekine H, Ferreira RC, Pan-Hammarstrom Q, Graham RR, Ziemba B, de Vries SS, Liu JB, Hippen K, Koeuth T, Ortmann W et al. 2007. Role for Msh5 in the regulation of Ig class switch recombination. Proceedings of the National Academy of Sciences of the United States of America 104(17):7193-7198.

Selzer G, Parker RGF. 1951. Senecio Poisoning Exhibiting As Chiaris Syndrome - A Report On 12 Cases. American Journal of Pathology 27(5):885-7.

Sharfe N, Dadi HK, Shahar M, Roifman CM. 1997. Human immune disorder arising from mutation of the alpha chain of the interleukin-2 receptor. Proceedings of the National Academy of Sciences of the United States of America 94(7):3168-3171.

Shiow LR, Roadcap DW, Paris K, Watson SR, Grigorova IL, Lebet T, An JP, Xu Y, Jenne CN, Foger N et al. 2008. The actin regulator coronin 1A is mutant in a thymic egress-deficient mouse strain and in a patient with severe combined immunodeficiency. Nature Immunology 9(11):1307-1315.

Slingsby JH, Norsworthy P, Pearce G, Vaishnaw AK, Issler H, Morley BJ, Walport MJ. 1996. Homozygous hereditary Clq deficiency and systemic lupus erythematosus - A new family and the molecular basis of Clq deficiency in three families. Arthritis and Rheumatism 39(4):663-670.

Smith V, Chou KN, Lashkari D, Botstein D, Brown PO. 1996. Functional analysis of the genes of yeast chromosome V by genetic footprinting. Science 274(5295):2069-2074.

Soudais C, Devillartay JP, Ledeist F, Fischer A, Lisowskagrospierre B. 1993. Independent Mutations Of The Human Cd3-Epsilon Gene Resulting In A T-Cell Receptor/Cd3 Complex Immunodeficiency. Nature Genetics 3(1):77-81.

Spiegel R, Cliffe ST, Buckley MF, Crow YJ, Urquhart J, Horovitz Y, Tenenbaum-Rakover Y, Newman WG, Donnai D, Shalev SA. 2010. Expanding the clinical spectrum of SLC29A3 gene defects. European Journal of Medical Genetics 53(5):309-313.

Bibliography 185 Stadler M, Chelbi-Alix MK, Koken MH, Venturini L, Lee C, Saib A, Quignon F, Pelicano L, Guillemin MC, Schindler C et al. 1995. Transcriptional induction of the PML growth suppressor gene by interferons is mediated through an ISRE and a GAS element. Oncogene 11(12):2565-73.

Australian Bureau of Statistics. 2006. Diabetes in Australia: A Snapshot, 2007- 08. 4820.0.55.001 ed. Viewed November 2011.

Steimle V, Otten LA, Zufferey M, Mach B. 1993. Complementation Cloning Of An Mhc Class-Ii Transactivator Mutated In Hereditary Mhc Class-Ii Deficiency (Or Bare Lymphocyte Syndrome). Cell 75(1):135-146.

Stengaard-Pedersen K, Thiel S, Gadjeva M, Moller-Kristensen M, Sorensen R, Jensen LT, Sjoholm AG, Fugger L, Jensenius JC. 2003. Inherited deficiency of mannan-binding lectin-associated serine protease 2. New England Journal of Medicine 349(6):554-560.

Stepp SE, Dufourcq-Lagelouse R, Le Deist F, Bhawan S, Certain S, Mathew PA, Henter JI, Bennett M, Fischer A, Saint Basile GD et al. 1999. Perforin gene defects in familiar hemophagocytic lymphohistiocytosis. Science 286(5446):1957-1959.

Stewart DM, Tian L, Notarangelo LD, Nelson DL. 2008. X-linked hypogammaglobulinemia and isolated growth hormone deficiency: an update. Immunologic Research 40(3):262-270.

Stewart GS, Maser RS, Stankovic T, Bressan DA, Kaplan MI, Jaspers NGJ, Raams A, Byrd PJ, Petrini JHJ, Taylor AMR. 1999. The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia- telangiectasia-like disorder. Cell 99(6):577-587.

Stewart GS, Panier S, Townsend K, Al-Hakim AK, Kolas NK, Miller ES, Nakada S, Ylanko J, Olivarius S, Mendez M et al. 2009. The RIDDLE Syndrome Protein Mediates a Ubiquitin-Dependent Signaling Cascade at Sites of DNA Damage. Cell 136(3):420-434.

Bibliography 186 Sumiya M, Super M, Tabona P, Levinsky RJ, Arai T, Turner MW, Summerfield JA. 1991. Molecular-Basis Of Opsonic Defect In Immunodeficient Children. Lancet 337(8757):1569-1570.

Summerfield JA, Ryder S, Sumiya M, Thursz M, Gorchein A, Monteil MA, Turner MW. 1995. Mannose-binding protein gene-mutations associated with unusual and severe infections in adults. Lancet 345(8954):886-889.

Sun L, Heerema N, Crotty L, Wu X, Navara C, Vassilev A, Sensel M, Reaman GH, Uckun FM. 1999. Expression of dominant-negative and mutant isoforms of the antileukemic transcription factor Ikaros in infant acute lymphoblastic leukemia. Proceedings of the National Academy of Sciences of the United States of America 96(2):680-685.

Suzuki T, Sakagami T, Rubin BK, Nogee LM, Wood RE, Zimmerman SL, Smolarek T, Dishop MK, Wert SE, Whitsett JA et al. 2008. Familial pulmonary alveolar proteinosis caused by mutations in CSF2RA. Journal of Experimental Medicine 205(12):2703-U189.

Svensson L, Howarth K, McDowall A, Patzak I, Evans R, Ussar S, Moser M, Metin A, Fried M, Tomlinson I et al. 2009. Leukocyte adhesion deficiency-III is caused by mutations in KINDLIN3 affecting integrin activation. Nature Medicine 15(3):306-312.

Szeszko JS, Healy B, Stevens H, Balabanova Y, Drobniewski F, Todd JA, Nejentsev S. 2007. Resequencing and association analysis of the SP110 gene in adult pulmonary tuberculosis. Human Genetics 121(2):155-160.

Szostecki C, Guldner HH, Netter HJ, Will H. 1990. Isolation and characterization of cDNA encoding a human nuclear antigen predominantly recognized by autoantibodies from patients with primary biliary cirrhosis. J Immunol 145(12):4338-47.

Tarpey PS, Smith R, Pleasance E, Whibley A, Edkins S, Hardy C, O'Meara S, Latimer C, Dicks E, Menzies A et al. 2009. A systematic, large-scale resequencing screen of X-chromosome coding exons in mental retardation. Nature Genetics 41(5):535-543.

Bibliography 187 Tashita H, Fukao T, Kaneko H, Teramoto T, Inoue R, Kasahara K, Kondo N. 1998. Molecular basis of selective IgG2 deficiency - The mutated membrane- bound form of gamma 2 heavy chain caused complete IgG2 deficiency in two Japanese siblings. Journal of Clinical Investigation 101(3):677-681.

Terada T, Kaneko H, Li AL, Kasahara K, Ibe M, Yokota S, Kondo N. 2001. Analysis of Ig subclass deficiency: First reported case of IgG2, IgG4, and IgA deficiency caused by deletion of Cal, psi C gamma, C gamma 2, C gamma 4, and C epsilon in a Mongoloid patient. Journal of Allergy and Clinical Immunology 108(4):602-606.

Thusberg J, Olatubosun A, Vihinen M. 2011. Performance of Mutation Pathogenicity Prediction Methods on Missense Variants. Human Mutation 32(4):358-368.

Thye T, Browne EN, Chinbuah MA, Gyapong J, Osei I, Owusu-Dabo E, Niemann S, Rusch-Gerdes S, Horstmann RD, Meyer CG. 2006. No associations of human pulmonary tuberculosis with SP110 variants. Journal of Medical Genetics 43(7).

Toomes C, James J, Wood AJ, Wu CL, McCormick D, Lench N, Hewitt C, Moynihan L, Roberts E, Woods CG et al. 1999. Loss-of-function mutations in the cathepsin C gene result in periodontal disease and palmoplantar keratosis. Nature Genetics 23(4):421-424.

Topaloglu R, Bakkaloglu A, Slingsby JH, Mihatsch MJ, Pascual M, Norsworthy P, Morley BJ, Saatci U, Schifferli JA, Walport MJ. 1996. Molecular basis of hereditary C1q deficiency associated with SLE and IgA nephropathy in a Turkish family. Kidney International 50(2):635-642.

Tosh K, Campbell SJ, Fielding K, Sillah J, Bah B, Gustafson P, Manneh K, Lisse I, Sirugo G, Bennett S et al. 2006. Variants in the SP110 gene are associated with genetic susceptibility to tuberculosis in West Africa. Proceedings of the National Academy of Sciences of the United States of America 103(27):10364-10368.

Tran B, Dancey JE, Kamel-Reid S, McPherson JD, Bedard PL, Brown AMK, Zhang T, Shaw T, Shaw P, Onetto N, Stein L, Hudson TJ, Neel BG, Siu LL.

Bibliography 188 2012. Cancer Genomics: Technology, Discovery and Translation. Journal of Clinical Oncology 30(6):647-660.

Traut W, Rahn IM, Winking H, Kunze B, Weichenhan D. 2001. Evolution of a 6- 200 Mb long-range repeat cluster in the genus Mus. Chromosoma 110(4):247- 252.

Tusher VG, Tibshirani R, Chu G. 2001a. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98(9):5116- 21.

Tusher VG, Tibshirani R, Chu G. 2001b. Significance analysis of microarrays applied to the ionizing radiation response. Proceedings of the National Academy of Sciences of the United States of America 98(9):5116-5121.

Valerio D, Dekker BMM, Duyvesteyn MGC, Vandervoorn L, Berkvens TM, Vanormondt H, Vandereb AJ. 1986. One Adenosine-Deaminase Allele In A Patient With Severe Combined Immunodeficiency Contains A Point Mutation Abolishing Enzyme-Activity. Embo Journal 5(1):113-119. van de Veerdonk FL, Plantinga TS, Hoischen A, Smeekens SP, Joosten LAB, Gilissen C, Arts P, Rosentul DC, Carmichael AJ, Smits-van der Graaf CAA et al. 2011. STAT1 Mutations in Autosomal Dominant Chronic Mucocutaneous Candidiasis. New England Journal of Medicine 365(1):54-61. van der Burg M, Ijspeert H, Verkaik NS, Turul T, Wiegant WW, Morotomi-Yano K, Mari PO, Tezcan I, Chen DJ, Zdzienicka MZ et al. 2009. A DNA-PKcs mutation in a radiosensitive T(-)B(-) SCID patient inhibits Artemis activation and nonhomologous end-joining. Journal of Clinical Investigation 119(1):91-98. van Zelm MC, Reisli I, van der Burg M, Castano D, van Noesel CJM, van Tol MJD, Woellner C, Grimbacher B, Patino PJ, van Dongen JJM et al. 2006. An antibody-deficiency syndrome due to mutations in the CD19 gene. New England Journal of Medicine 354(18):1901-1912. van Zelm MC, Smet J, Adams B, Mascart F, Schandene L, Janssen F, Ferster A, Kuo CC, Levy S, van Dongen JJM et al. 2010. CD81 gene defect in humans disrupts CD19 complex formation and leads to antibody deficiency. Journal of Clinical Investigation 120(4):1265-1274.

Bibliography 189 Vandewinkel JGJ, Dewit TPM, Ernst LK, Capel PJA, Ceuppens JL. 1995. Molecular-Basis For A Familial Defect In Phagocyte Expression Of Igg Receptor-I (CD64). Journal of Immunology 154(6):2896-2903.

Vanhollebeke B, Truc P, Poelvoorde P, Pays A, Joshi PP, Katti R, Jannin JG, Pays E. 2006. Brief report: Human Trypanosoma evansi infection linked to a lack of apolipoprotein L-I. New England Journal of Medicine 355(26):2752-2756.

Varon R, Vissinga C, Platzer M, Cerosaletti KM, Chrzanowska KH, Saar K, Beckmann G, Seemanova E, Cooper PR, Nowak NJ et al. 1998. Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell 93(3):467-476.

Veiga-da-Cunha M, Gerin I, Chen YT, de Barsy T, de Lonlay P, Dionisi-Vici C, Fenske CD, Lee PJ, Leonard JV, Maire I et al. 1998. A gene on chromosome 11q23 coding for a putative glucose-6-phosphate translocase is mutated in glycogen-storage disease types Ib and Ic. American Journal of Human Genetics 63(4):976-983.

Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith HO, Yandell M, Evans CA, Holt RA et al. 2001. The sequence of the human genome. Science 291(5507):1304-+.

Vetrie D, Vorechovsky I, Sideras P, Holland J, Davies A, Flinter F, Hammarstrom L, Kinnon C, Levinsky R, Bobrow M et al. 1993. THE GENE INVOLVED IN X-LINKED AGAMMAGLOBULINEMIA IS A MEMBER OF THE SRC FAMILY OF PROTEIN-TYROSINE KINASES. Nature 361(6409):226-233.

Villa A, Notarangelo L, Macchi P, Mantuano E, Cavagni G, Brugnoni D, Strina D, Patrosso MC, Ramenghi U, Sacco MG et al. 1995. X-Linked Thrombocytopenia And Wiskott-Aldrich Syndrome Are Allelic Diseases With Mutations In The Wasp Gene. Nature Genetics 9(4):414-417.

Villa A, Santagata S, Bozzi F, Giliani S, Frattini A, Imberti L, Gatta LB, Ochs HD, Schwarz K, Notarangelo LD et al. 1998. Partial V(D)J recombination activity leads to Omenn syndrome. Cell 93(5):885-896.

Villard J, Reith W, Barras E, Gos A, Morris MA, Antonarakis SE, VandenElsen PJ, Mach B. 1997. Analysis of mutations and chromosomal localisation of the

Bibliography 190 gene encoding RFX5, a novel transcription factor affected in major histocompatibility complex class II deficiency. Human Mutation 10(6):430-435.

Vissers L, van Ravenswaaij CMA, Admiraal R, Hurst JA, de Vries BBA, Janssen IM, van der Vliet WA, Huys E, de Jong PJ, Hamel BCJ et al. 2004. Mutations in a new member of the chromodomain gene family cause CHARGE syndrome. Nature Genetics 36(9):955-957. von Bernuth H, Picard C, Jin ZB, Pankla R, Xiao H, Ku CL, Chrabieh M, Ben Mustapha I, Ghandil P, Camcioglu Y et al. 2008. Pyogenic bacterial infections in humans with MyD88 deficiency. Science 321(5889):691-696.

Vulliamy TJ, Durso M, Battistuzzi G, Estrada M, Foulkes NS, Martini G, Calabro V, Poggi V, Giordano R, Town M et al. 1988. Diverse Point Mutations In The Human Glucose-6-Phosphate-Dehydrogenase Gene Cause Enzyme Deficiency And Mild Or Severe Hemolytic-Anemia. Proceedings of the National Academy of Sciences of the United States of America 85(14):5171-5175.

Vyse TJ, Morley BJ, Bartok I, Theodoridis EL, Davies KA, Webster ADB, Walport MJ. 1996. The molecular basis of hereditary complement factor I deficiency. Journal of Clinical Investigation 97(4):925-933.

Walsh EC, Sabeti P, Hutcheson HB, Fry B, Schaffner SF, de Bakker PI, Varilly P, Palma AA, Roy J, Cooper R et al. 2006. Searching for signals of evolutionary selection in 168 genes related to immune function. Hum Genet 119(1-2):92-102.

Wang J, Zheng LX, Lobito A, Chan FKM, Dale J, Sneller M, Yao X, Puck JM, Straus SE, Lenardo MJ. 1999. Inherited human Caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II. Cell 98(1):47-58.

Wang WY, Todd JA. 2003. The usefulness of different density SNP maps for disease association studies of common variants. Hum Mol Genet 12(23):3145- 9.

Wang XF, Fleischer DT, Whitehead WT, Haviland DL, Rosenfeld SI, Leddy JP, Snyderman R, Wetsel RA. 1995. Inherited Human-Complement C5 Deficiency - Nonsense Mutations In Exon-1 (Gln(1) To Stop) And Exon-36 (Arg(1458) To

Bibliography 191 Stop) And Compound Heterozygosity In 3 African-American Families. Journal of Immunology 154(10):5464-5471.

Warnatz K, Salzer U, Rizzi M, Fischer B, Gutenberger S, Bohm J, Kienzler AK, Pan-Hammarstrom Q, Hammarstrom L, Rakhmanov M et al. 2009. B-cell activating factor receptor deficiency is associated with an adult-onset antibody deficiency syndrome in humans. Proceedings of the National Academy of Sciences of the United States of America 106(33):13945-13950.

Warwicker P, Goodship THJ, Donne RL, Pirson Y, Nicholls A, Ward RM, Turnpenny P, Goodship JA. 1998. Genetic studies into inherited and sporadic hemolytic uremic syndrome. Kidney International 53(4):836-844.

Watashi K, Hijikata M, Tagawa A, Doi T, Marusawa H, Shimotohno K. 2003a. Modulation of retinoid signaling by a cytoplasmic viral protein via sequestration of SP110b, a potent transcriptional corepressor of retinoic acid receptor, from the nucleus. Mol Cell Biol 23(21):7498-509.

Watashi K, Hijikata M, Tagawa A, Doi T, Marusawa H, Shimotohno K. 2003b. Modulation of retinoid signaling by a cytoplasmic viral protein via sequestration of SP110b, a potent transcriptional corepressor of retinoic acid receptor, from the nucleus. Molecular and Cellular Biology 23(21):7498-7509.

Weichenhan D, Kunze B, Winking H, van Geel M, Osoegawa K, de Jong PJ, Traut W. 2001. Source and component genes of a 6-200 Mb gene cluster in the house mouse. Mammalian Genome 12(8):590-594.

Westberg J, Fredrikson GN, Truedsson L, Sjoholm AG, Uhlen M. 1995. Sequence-Based Analysis Of Properdin Deficiency - Identification Of Point Mutations In 2 Phenotypic Forms Of An X-Linked Immunodeficiency. Genomics 29(1):1-8.

Wiesmeijer K, Molenaar C, Bekeer I, Tanke HJ, Dirks RW. 2002. Mobile foci of SP100 do not contain PML: PML bodies are immobile but PML and SP100 proteins are not. Journal of Structural Biology 140(1-3):180-188.

Wildin RS, Ramsdell F, Peake J, Faravelli F, Casanova JL, Buist N, Levy-Lahad E, Mazzella M, Goulet O, Perroni L et al. 2001. X-linked neonatal diabetes

Bibliography 192 mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nature Genetics 27(1):18-20.

Williams SR, Gekeler V, McIvor RS, Martin DW. 1987. A Human Purine Nucleoside Phosphorylase-Deficiency Caused By A Single Base Change. Journal of Biological Chemistry 262(5):2332-2338.

Wilson DW, Segall HJ, Pan LC, Lame MW, Estep JE, Morin D. 1992. Mechanisms And Pathology Of Monocrotaline Pulmonary Toxicity. Critical Reviews in Toxicology 22(5-6):307-325.

Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H et al. 1999. Functional characterization of the S-cerevisiae genome by gene deletion and parallel analysis. Science 285(5429):901-906.

Wise CA, Gillum JD, Seidman CE, Lindor NM, Veile R, Bashiardes S, Lovett M. 2002. Mutations in CD2BP1 disrupt binding to PTP PEST and are responsible for PAPA syndrome, an autoinflammatory disorder. Human Molecular Genetics 11(8):961-969.

WitzelSchlomp K, Spath PJ, Hobart MJ, Fernie BA, Rittner C, Kaufmann T, Schneider PM. 1997. The human complement C9 gene - Identification of two mutations causing deficiency and revision of the gene structure. Journal of Immunology 158(10):5043-5049.

Woods CG, Valente EM, Bond J, Roberts E. 2004. A new method for autozygosity mapping using single nucleotide polymorphisms (SNPs) and EXCLUDEAR. Journal of Medical Genetics 41(8):4.

Wu JG, Wilson J, He J, Xiang LB, Schur PH, Mountz JD. 1996. Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease. Journal of Clinical Investigation 98(5):1107-1113.

Xu GL, Bestor TH, Bourc'his D, Hsieh CL, Tommerup N, Bugge M, Hulten M, Qu XY, Russo JJ, Viegas-Pequignot E. 1999. Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 402(6758):187-191.

Bibliography 193 Yabe T, Kawamura S, Sato M, Kashiwase K, Tanaka H, Ishikawa Y, Asao Y, Oyama J, Tsuruta K, Tokunaga K et al. 2002. A subject with a novel type I bare lymphocyte syndrome has tapasin deficiency due to deletion of 4 exons by Alu- mediated recombination. Blood 100(4):1496-1498.

Yaghmai R, Kimyai-Asadi A, Rostamiani K, Heiss NS, Poustka A, Eyaid W, Bodurtha J, Nousari HC, Hamosh A, Metzenberg A. 2000. Overlap of dyskeratosis congenita with the Hoyeraal-Hreidarsson syndrome. Journal of Pediatrics 136(3):390-393.

Yagi H, Furutani Y, Hamada H, Sasaki T, Asakawa S, Minoshima S, Ichida F, Joo K, Kimura M, Imamura S et al. 2003. Role of TBX1 in human del22q11.2 syndrome. Lancet 362(9393):1366-1373.

Yan CC, Huxtable RJ. 1995. Relationship Between Glutathione Concentration And Metabolism Of The Pyrrolizidine Alkaloid, Monocrotaline, In The Isolated, Perfused Liver. Toxicology and Applied Pharmacology 130(1):132-139.

Yang QH, Khoury MJ, Flanders WD. 1997. Sample size requirements in case- only designs to detect gene-environment interaction. American Journal of Epidemiology 146(9):713-720.

Yel L, Minegishi Y, CoustanSmith E, Buckley RH, Trubel H, Pachman LM, Kitchingman GR, Campana D, Rohrer J, Conley ME. 1996. Mutations in the mu heavy-chain gene in patients with agammaglobulinemia. New England Journal of Medicine 335(20):1486-1493.

Zahedi R, Bissler JJ, Davis AE, Andreadis C, Wisnieski JJ. 1995. Unique c1 inhibitor dysfunction in a kindred without angioedema .2. Identification of an ala(443)- val substitution and functional-analysis of the recombinant mutant protein. Journal of Clinical Investigation 95(3):1299-1305.

Zembrzuski VM, Basta PC, Callegari-Jacques SM, Santos RV, Coimbra CEA, Salzano FM, Hutz MH. 2010. Cytokine genes are associated with tuberculin skin test response in a native Brazilian population. Tuberculosis 90(1):44-49.

Zhang Q, Davis JC, Lamborn IT, Freeman AF, Jing H, Favreau AJ, Matthews HF, Davis J, Turner ML, Uzel G et al. 2009. Combined Immunodeficiency

Bibliography 194 Associated with DOCK8 Mutations. New England Journal of Medicine 361(21):2046-2055.

Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ. 2010. Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature 464(7285):104-U115.

Zhang SY, Jouanguy E, Ugolini S, Smahi A, Elain G, Romero P, Segal D, Sancho-Shimizu V, Lorenzo L, Puel A et al. 2007. TLR3 deficiency in patients with herpes simplex encephalitis. Science 317(5844):1522-1527.

Zheng QY, Yan D, Ouyang XM, Du LL, Yu H, Chang B, Johnson KR, Liu XZ. 2005. Digenic inheritance of deafness caused by mutations in genes encoding cadherin 23 and protocadherin 15 in mice and humans. Human Molecular Genetics 14(1):103-111.

Zhong S, Salomoni P, Ronchetti S, Guo A, Ruggero D, Pandolfi PP. 2000. Promyelocytic leukemia protein (PML) and Daxx participate in a novel nuclear pathway for apoptosis. J Exp Med 191(4):631-40.

Zonana J, Elder ME, Schneider LC, Orlow SJ, Moss C, Golabi M, Shapira SK, Farndon PA, Wara DW, Emmal SA et al. 2000. A novel X-linked disorder of immune deficiency and hypohidrotic ectodermal dysplasia is allelic to incontinentia pigmenti and due to mutations in IKK-gamma (NEMO). American Journal of Human Genetics 67(6):1555-1562. zur Stadt U, Rohr J, Seifert W, Koch F, Grieve S, Pagel J, Strauss J, Kasper B, Nurnberg G, Becker C et al. 2009. Familial Hemophagocytic Lymphohistiocytosis Type 5 (FHL-5) Is Caused by Mutations in Munc18-2 and Impaired Binding to Syntaxin 11. American Journal of Human Genetics 85(4):482-492. zur Stadt U, Schmidt S, Diler AS, Henter JI, Kabisch H, Schneppenheim R, Nurnberg P, Janka G, Hennies HC. 2005. Linkage of familial hemophagocytic lymphohistiocytosis (FHL) type-4 to chromosome 6q24 and identification of mutations in syntaxin 11. Human Molecular Genetics 14(6):827-834.

Bibliography 195 Zwingmann C, Desjardins P, Hazell A, Chatauret N, Michalak A, Butterworth RF. 2002. Reduced expression of astrocytic glycine transporter (Glyt-1) in acute liver failure. Metabolic Brain Disease 17(4):263-273.

Bibliography 196 Appendix

Appendix Table 9.1: Survey of the experimental methodologies used in gene identification papers associated with primary immunodeficiencies published between 1986-2011.

Abbreviations used in the table for the methods of gene identification: PAN: Pathway analysis , ANI: Animal model , CSA: Cell Surface analysis , BIO: Biochemical function analysis , RNA: RNA expression analysis , LIN: Linkage analysis , HOM: Homozyogosity linkage analysis , SCR: Screening study , CGH : Comparative genomic array , NGS: Whole exome/genome sequencing

Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) A: Combined T-cell and B-cell immunodeficiencies Adenosine BIO: Previous work identified that Adenosine Deaminase activity was reduced in these families. An ADA-deficient cell line was deaminase used to create a cosmid library, which was screened with an ADA cDNA probe to locate the precise genetic insult in the ADA ADA deficiency (Valerio et al. 1986) gene. HOM: Pannicke et al. performed homozygosity mapping using 250K SNP genotyping of six affected individuals from five families, three that were consanguineous. This revealed a shared region on chromosome 1p34.3-1p36.11 that contained 185 genes. (Lagresle-Peyrou et al. RNA: 80 of these genes were expressed in bone marrow, and each was examined. AK2 cDNAs were revealed to be smaller in 2009; Pannicke et al. affected individuals than in normal controls. LIN: In a separate study, Lagresle-Peyrou et al. used linkage with 7 affected AK2 Reticular dysgenesis 2009) individuals to map the AK2 locus to a 2Mb region on chromosome 1. Sequencing of the entire region discovered the AK2 gene. CSA: Rieux-Laucat describes a SCID patient with decreased numbers of T cells, which express low levels of CD3 ε and α/β T cell receptors. BIO: in vitro T cell proliferation and activation assays showed that the proliferative defect in the patient’s T cells was (Rieux-Laucat et al. restricted to the initial steps of CD3 signalling. Both CD3 ζ and CD3 ε were not detected in plasma membranes, however in whole CD247 CD3 ζ deficiency 2006) cell lysates only CD3 ζ was undetectable. Sequencing of CD3 ζ showed a homozygous nonsense mutation in the patient.

Appendix 197 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) RNA: A consanguineous Mennonite family with 3 SCID affected individuals was studied. Gene expression within the thymus of patient 1 was compared to that of a normal thymus using an oligonucleotide microarray. This identified 353 annotated downregulated genes, and 504 upregulated genes. There were relatively few T-cell regulation genes aberrantly expressed; 12 in CD3D CD3 δ deficiency (Dadi et al. 2003) total. Sequencing of all CD3 variants was undertaken, and homozygous mutations in CD3 δ were detected. CSA: The authors describe an immune deficient child with abnormally low cell surface expression of the TCR/CD3 on the cell surface of T lymphocytes. RNA: Previous work had described reduced expression of CD3 ε mRNA, which was also 168bp shorter than the predicted size of the mRNA fragment. Soudais et al. used RT-PCR to confirm a full in-frame deletion of exon 7 of CD3 ε. CD3E CD3 ε deficiency (Soudais et al. 1993) Genomic sequencing identified a splice site variant in exon 7. CSA: Two brothers showed a similar defect in expression of T-cell receptor-CD3 complex. BIO: Biochemical analysis of the (Arnaizvillena et al. patients T-cells showed many of the proteins required to build this receptor complex, except for CD3 γ. Sequencing of T-cell CD3G CD3 γ deficiency 1992) mRNA revealed compound heterozygous mutations in one of the affected siblings. CSA: Three affected patients were identified with hypogammaglobulinaemia with normal levels of IgM. No expression of CD40 CD40 CD40 deficiency (Ferrari et al. 2001) was detected on B cells, and RT-PCR identified a deletion of 94 nt – matching the sequence of exon 5 of CD40. SCR: Previous work had identified the CD40 ligand as a switch responsible for B cell differentiation. Therefore, Aruffo et al. screened 9 patients with CVID, HIGM, or XLA to evaluate their response to CD40-dependent signals. CSA: CD40LG expression CD40 ligand was found to be absent in HIGM. mRNA expression studies showed normal levels of CD40LG expression within activated T CD40LG deficiency (Aruffo et al. 1993) cells, but sequencing showed a number of silent and missense changes. (de la Calle-Martin et CSA: CD8 expression was found to be absent on the cell surface of peripheral blood cells of a single patient with CD8A CD8 α deficiency al. 2001) consanguineous parents. Sequencing analysis revealed a missense mutation in the CD8A gene. CGH: Two patients with CHARGE syndrome were screened using a CGH microarray platform optimized for high resolution CHARGE Syndrome screening of submicroscopic copy-number changes. This identified a 2.3Mb region of deletion overlap, containing nine annotated with or predicted genes. Screening of 17 additional patients did not reveal any further deletions, however sequencing of the coding CHD7 immunodeficiency (Vissers et al. 2004) regions of each of the nine genes revealed 10 different heterozygous mutations in CHD7 . MHCII BIO: 3 patient cell lines with MHC class II deficiency were examined. cDNA libraries in expression vectors were transfected into transactivating these cell lines, which were then screened for restoration of HLA class II promoter activity. This identified the CIITA gene. CIITA protein deficiency (Steimle et al. 1993) ANI: Mice with mutations in the COROA1 gene are lymphocytopenic due to the inability of mature T cells to be released into peripheral circulation. SCR: Given this, an unspecified number of SCID patients were screened for mutations in the human homologue of the gene. A single patient from a non-consanguineous family was identified with a 2bp deletion in CORO1A exon Coronin-1A 3. As this is a recessive condition, CGH array was used to assay gene copy number, revealing a de novo 600Kbp deletion CORO1A deficiency (Shiow et al. 2008) encompassing CORO1A and 24 other genes. LIN: Previous linkage studies mapped the Artemis gene locus to a 6.5cM region on chr10. Moshous et al. identified the gene using cDNA cloning methods. BIO: 13 patients were all shown to have a dysfunction in DNA breakage repair, using a V(D)J recombination assay. Sequencing the Artemis gene showed genomic deletions of exons 1-4 in 3 patients, and a range of DCLRE1C Artemis deficiency (Moshous et al. 2001) nonsense and missense mutations in the remaining patients.

Appendix 198 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) T-cell ANI: The authors describe two affected sisters with a clinical phenotype that was reminiscent of the nude mouse model, which immunodeficiency, results from mutations in whn . LIN: Microsatellite markers near the human WHN gene gave a LOD of 1.32 in a family with two congenital alopecia, affected patients, weakly suggestive of linkage. Sequencing of the gene identified a nonsense mutation. FOXN1 and nail dystrophy (Frank et al. 1999) ANI: Homozygous deletion of the Ikaros exons 3 and 4, required for sequence-specific DNA binding, results in a complete arrest in the development of all lymphoid lineages in mice SCR: Leukemic cells from 12 infants diagnosed with acute lymphoblastic IKZF1 Ikaros deficiency (Sun et al. 1999) leukaemia were screened for mutations in the Ikaros gene, and revealed dominant-negative mutations in all samples. CSA: A male child of consanguineous parents showed an absence of CD1 cell surface staining. CD1 sequence was revealed to be normal. PAN: It was hypothesised that an IL-12 signal was necessary for CD1 induction, and flow cytometry revealed an IL-2 receptor α-chain absence of detectable CD25 in patient B lymphoblastoid cells. Sequencing revealed a homozygous 4bp deletion in the IL2RA IL2RA deficiency (Sharfe et al. 1997) gene in the patient. LIN: Previous linkage had localised the XSCID locus to a region within Xq13. Noguchi et al. mapped IL-2R γ, a critical T-cell X-linked combined (Schmalstieg et al. signalling molecule, to the same locus on the X chromosome, which remained tightly linked with fine mapping. This strongly IL2RG immunodeficiency 1995) suggested that IL-2R γ was the XSCID gene, so 3 XSCID patients were sequenced for mutations in IL-2R γ. X-linked severe LIN: Previous linkage had localised the XSCID locus to a region within Xq13. Noguchi et al. mapped IL-2R γ, a critical T-cell combined signalling molecule, to the same locus on the X chromosome, which remained tightly linked with fine mapping. This strongly immunodeficiency suggested that IL-2R γ was the XSCID gene, so 3 XSCID patients were sequenced for mutations in IL-2R γ. disease (Noguchi et al. 1993) Interleukin-7 ANI: Diminished T-cell development is observed in IL7- and IL7R-deficient mice. RNA: RNA analysis of 2 SCID patients showed receptor-alpha normal IL7 and greatly reduced IL7R levels. IL7R deficiency (Puel et al. 1998) PAN: Jak3 protein kinase had been found to associate with the IL-2 receptor, at the time the only reported SCID gene. Jak3 was therefore investigated as a candidate gene in two consanguineous SCID families that were negative for mutations in the γ-chain JAK3 JAK3 deficiency (Macchi et al. 1995) sequence. BIO: A male patient from a non-consanguineous family was analysed, and the expression and activation of protein tyrosine kinases involved in the signal transduction cascade was assessed. The level of p56Ick in the patient T cells was less than 10% of a normal control. cDNA PCR demonstrated an absence of exon 7 of the LCK gene in the affected patient, however the precise LCK p56 Lck deficiency (Goldman et al. 1998) genetic lesion was not found. BIO: 46BR cells show a strongly reduced rate of joining of strand breaks generated after exposure to DNA-damaging agents, DNA ligase I however this was distinct from the phenotype observed in Bloom’s syndrome. The recent cloning of DNA ligase I allowed for LIG1 deficiency (Barnes et al. 1992) mutation screening.

Appendix 199 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) Two separate and independent approaches were used by O’Driscoll et al to identify mutations in DNA Ligase IV. BIO: In the first approach, cell lines of uncharacterised immunodeficiency patients were screened for sensitivity to radiation. This identified 1 patient with defective DNA breakage repair mechanisms. This patient was negative for mutations in NBS1 and MRE11, and all components of the DNA-PK complex were expressed normally. SCR: 37 patients with Nijmegen Breakage Syndrome–like DNA ligase IV characteristics, that were negative for mutations in NBS1, were screened for Lig4 mutations. 3 of these patients were positive for LIG4 deficiency (O'Driscoll et al. 2001) nonsense and missense mutations in the Lig4 gene. Buck et al. describe a systematic experimental design to identify genetic factors involved in DNA repair. In this paper, they describe a new syndrome of human combined immunodeficiency with microcephaly. BIO: Fibroblast cell lines were transfected with restriction-enzyme-digested plasmids containing either blunt-blunt or incompatible overhang. Recircularised plasmids were recovered after 48 hours and analysed for accuracy of the DNA end joining. Three patient cell lines showed striking inaccuracy in Cernunnos joining, which could be rescued by retroviral transduction of a human thymic cDNA library, and a single cDNA, Cernunnos, was NHEJ1 deficiency (Buck et al. 2006) found to be responsible. Missense or nonsense mutations in Cernunnos were identified in all 5 patients. LIN: A linkage approach was used by the authors. To increase the power of the linkage, the investigators assumed they could phenotypically recognise heterozygotes. BIO: In addition to the linkage, the authors also undertook a genome-wide RNAi screen ORAI1 TMEM142 deficiency (Feske et al. 2006) for genes in ANI: Drosphila that could be knocked down to identify regulators of calcium transport. PAN/BIO: Giblett et al. describe a patient with CVID who showed clinical symptoms indistinguishable from ADA deficiency. ADA activity was normal, and accordingly cells were examined for abnormally low activity levels of enzymes involved in purine and Purine nucleoside pyrimidine metabolic pathways, identifying PNP. Fox et al showed aberrant PNP immunoreactivity, and no detectable protein or phosphorylase catalytic activity within erythrocytes or fibroblasts from a patient with this condition. Williams et al. found the genetic lesion PNP deficiency (Williams et al. 1987) responsible. Radiosensitive T-B- BIO: Clonogenic survival assays showed that ID177 fibroblasts were x-ray sensitive, indicating a defect in NHEJ. PAN: Known Severe Combined (van der Burg et al. NHEJ genes were not mutated, so van der Burg et al. analysed NHEJ components, and detected mutations in DNA-PKs. PRKDC Immunodeficiency 2009) CSA: A male patient presented at 2 months with SCID. Stained thin sections from the patient’s lymph node did not show expression of CD45, and CD45 was lacking on the cell surface of all of the patient’s leukocytes. ANI: Previous reports indicate that the CD45-deficient mouse model displays a similar T-cell phenotype, and Southern Blot analysis of the patient’s DNA indicated a large heterozygous deletion in the CD45 gene. A de novo splice site variant on the second allele was detected, and PTPRC CD45 deficiency (Kung et al. 2000) negligible CD45 mRNA was detected in EBV-transformed cells. SCR: Omenn syndrome is a form of SCID with a variable number of circulating T cells, that coexpress activation markers and respond poorly to mitogens and antigens. Given the similarity of the conditions, the authors screened 7 patients for mutations in RAG1 Omenn syndrome (Villa et al. 1998) Rag1 and Rag2, and identified mutations in all cases. PAN: RAG1 and RAG2 are both lymphocyte-specific genes, that confer V(D)J recombination activity, essential for the generation of antigen-binding diversity in lymphocyte development. ANI: Rag-1 and Rag-2 deleted mouse models demonstrate a lack of mature B and T cells. SCR: Given these, the authors screened a cohort of 20 SCID patients, 14 B- and 16 B+ patients, for RAG1 deficiency (Schwarz et al. 1996), mutations in these two genes. Homozygous and compound heterozygous mutations were found in both genes.

Appendix 200 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) SCR: Omenn syndrome is a form of SCID with a variable number of circulating T cells, that coexpress activation markers and respond poorly to mitogens and antigens. Given the similarity of the conditions, the authors screened 7 patients for mutations in RAG2 Omenn syndrome (Villa et al. 1998) Rag1 and Rag2, and identified mutations in all cases. PAN: RAG1 and RAG2 are both lymphocyte-specific genes, that confer V(D)J recombination activity, essential for the generation of antigen-binding diversity in lymphocyte development. ANI: Rag-1 and Rag-2 deleted mouse models demonstrate a lack of mature B and T cells. SCR: Given these, the authors screened a cohort of 20 SCID patients, 14 B- and 16 B+ patients, for RAG2 deficiency (Schwarz et al. 1996) mutations in these two genes. Homozygous and compound heterozygous mutations were found in both genes. RFX5, MHC class II BIO: Following the success of the C2TA mapping described above, the authors examined 2 patient cell lines with MHC promoter X box deficiency. PAN: Plasmids were transfected into these cell lines containing sequences of critical pathway genes, to detect those regulatory factor 5 that restore the transcription of HLA-DR genes. RFX5 deficiency (Villard et al. 1997) PAN: MHC-II deficiency had been shown to be caused by defects in trans-acting factors essential for the transcription of the (Masternak et al. MHCII genes. The RFXANK gene encodes a homologue of RFX – a protein complex in which mutations had been previously RFXANK RFXANK deficiency 1998) detected, and was considered a potential candidate. Regulatory factor X- PAN: 2 patients with MHC-II deficiency were described without RFX5 mutations. RFX5 was used as a probe to identify RFXAP in associated protein a cDNA library. Sequence analysis of this gene revealed a frameshifting mutation in one of the affected patients. RFXAP deficiency (Durand et al. 1997) Hereditary folate SCR: Qiu et al. identified a novel low-pH folate transformer. In the process of characterising this gene, the authors screened a malabsorption with family with hereditary folate malabsorption, and identified homozygous mutations in the affected individuals. SLC46A1 immunodeficiency (Qiu et al. 2006) PAN: The authors describe a cohort of patients with CVID similar to Orai1 deficiency that were negative for mutations in Orai1. STIM1 STIM1 deficiency (Picard et al. 2009) Stim1 interacts with Orai1 to mediate the function of CRAC channels, so was targeted for sequencing analysis. PAN: A patient with bare lymphocyte syndrome is described by the authors. As TAP2 mutations had previously been described TAP1 TAP1 deficiency (Furukawa et al. 1999) in this condition, the authors analysed each of the molecules involved in the maturation pathway of class I molecules. BIO: The authors describe 5 adults with necrotising granulomatous lesions, associated with recurrent bacterial respiratory (Moins-Teisserenc et infections. Transport of a radiolabelled peptide into the endoplasmic reticulum of patient cells was completely abolished, which TAP2 TAP2 deficiency al. 1999) implicated a defect in the TAP complex. Sequence analysis revealed frameshifting mutations within the TAP2 gene. PAN: A patient with a similar phenotype, yet displaying normal TAP polypeptides presented with type 1 bare lymphocyte syndrome. Further study indicated that the related tapasin polypeptide was lacking. A homozygous deletion that encompassed TAPBP Tapasin deficiency (Yabe et al. 2002) exons 4-7 was identified. CSA: The immunophenotype of a cohort of patients with a selective T-cell deficiency indicates a precise biochemical defect that implicates three genes. PAN: Zap-70 is one of the 3 genes related to this biochemical pathway. The authors identified multiple ZAP70 ZAP70 deficiency (Arpaia et al. 1994) sequence variants.

Appendix 201 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s)

B: Predominantly antibody deficiencies HOM: The authors examined patients with an autosomal recessive form of hyper-IgM syndrome. A genome-wide linkage scan of Activation-induced 18 patients in 12 families was performed, using homozygosity mapping for the eight consanguineous families and bipoint LOD cytidine deaminase score analysis for all families. This mapped the gene locus to a 5 cM region on chr12p13, which contains the AID gene. AICDA deficiency (Revy et al. 2000) Sequencing revealed multiple missense mutations. PAN: A cohort of patients with a BTK-deficient phenotype, without mutations in the BTK gene, was identified. As BLNK plays an (Minegishi et al. important role in mammalian B cell development, it was considered a strong candidate for analysis. SCR: 25 patients without BLNK BLNK deficiency 1999b) BTK mutations were scanned and 2 missense mutations were identified. LIN: X-linked Agammaglobulinaemia was the first described immunodeficiency. The linkage mapping of the gene spanned several papers, and defined the region of interest to Xq21.3-22. Southern blot analysis of the gene region with different restriction X-linked enzymes identified a number of rearrangements of the BTK gene, and sequence analysis of the cDNA revealed 2 missense BTK agammaglobulinemia (Vetrie et al. 1993) mutations in 2 patients. X-linked LIN: A cohort of patients is described with X-linked Agammaglobulinaemia inherited together with isolated growth hormone agammaglobulinemia deficiency. Previous work had identified that this disease mapped to the same region as the then-recently described BTK gene. and isolated growth SCR: A patient with the combined disorder was screened for mutations in the BTK gene, and a frameshifting deletion was hormone deficiency (Duriez et al. 1994) identified. (van Zelm et al. CSA: Four patients are described with hypogammaglobulinaemia, and shown to have an absence of CD19 expression on their B CD19 CD19 deficiency 2006) cells. Sequencing analysis revealed a frameshifting insertion in the CD19 gene. SCR: Minegishi et al. screened a number of patients with early-onset hypogammaglobulinaemia and absent B cells for mutations (Minegishi et al. in genes that are expressed in early stages of B-cell differentiation. PAN: The Ig α protein is structurally similar to CD3 chains on CD79A Ig-alpha deficiency 1999a) T cells, and is able to induce B cell differentiation in mice. SCR: Ferrari et al. screened a number of patients with early-onset hypogammaglobulinaemia and absent circulating B cells for mutations in genes that are expressed in early stages of B-cell differentiation. PAN: The Ig β gene is part of the B cell (Dobbs et al. 2007; development pathway. ANI: Ig β-null mice display a similar phenotype. In a separate study, Dobbs et al. also describe the CD79B Ig-beta deficiency Ferrari et al. 2007) discovery of missense mutations of the CD79B gene in a patient. CSA: A female patient of consanguineous parents was described with recurrent respiratory tract infections, and an acute glomerulonephritis with nephrotic range proteinuria and gross hematuria. The lack of CD19 expression resembled CD19 (van Zelm et al. deficiency, but no mutations in this gene were identified. PAN: CD81 interacts with CD19, and so was considered a prime CD81 CD81 deficiency 2010) candidate. Sequencing analysis revealed a splice site mutation in exon 6 of the CD81 gene. (Grimbacher et al. CSA: ICOS is a T cell specific cell surface receptor. 32 CVID patients were examined for expression. 4 patients from 2 families ICOS ICOS deficiency 2003) showed reduced expression. LIN: Linkage analysis showed that the ICOS locus segregated with disease within these 2 families.

Appendix 202 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) ANI: The authors studied the effects of gene knockouts of a number of genes involved in mismatch repair and found that 2 genes, MSH4 and MSH5, were involved in the resolution of DNA Holliday junctions. The authors postulated that this made MSH5 an attractive candidate for human Ig deficiency SCR: 96 patients with IgAD or CVID were screened for mutations in MSH5, and IGAD1 IgA deficiency (Sekine et al. 2007) several non-synonymous variants were detected. BIO: Terada et al. describe 4 patients with various immune deficiency clinical characteristics. In one of these patients, Southern IGHA1 α1 isotype deficiency (Terada et al. 2001) blot analysis revealed a deletion of the region containing the genes IGHA1, IGHG2, IGHG4, and IGHE. BIO: Terada et al. describe 4 patients with various immune deficiency clinical characteristics. In one of these patients, Southern IGHE ε isotype deficiency (Terada et al. 2001) blot analysis revealed a deletion of the region containing the genes IGHA1, IGHG2, IGHG4, and IGHE. BIO: 2 patients were identified with recurrent sinopulmonary infections. Routine examination of serum immunoglobulins revealed IGHG2 IgG2 deficiency (Tashita et al. 1998) an absence of IgG2. Sequence analysis revealed a frameshifting mutation in the IGHG2 gene. BIO: Terada et al. describe 4 patients with various immune deficiency clinical characteristics. In one of these patients, Southern IGHG4 γ4 isotype deficiency (Terada et al. 2001) blot analysis revealed a deletion of the region containing the genes IGHA1, IGHG2, IGHG4, and IGHE. LIN: Two consanguineous families are reported with autosomal recessive defects in B-cell development. A limited-scope linkage approach was used, examining only regions that contained known genes expressed in early B-cell development. The best heavy-chain linkage was on chromosome 14, proximal to the immunoglobulin heavy-chain locus. Sequencing analysis revealed a splice site IGHM deficiency (Yel et al. 1996) mutation in exon 4 of the IGHM gene. BIO: In 1965 Terry et al. defined 3 allotypes of the Ig heavy chain. In 1974, Milstein identified the molecular basis of these allotypes. In 1976, Zegers et al. identified a patient with Cystic fibrosis and IgA deficiency and a total lack of immunoglobulins Kappa light-chain with kappa chains. In 1985, Stavnezer-Nordgren et al. identified compound heterozygous mutations in a patient with kappa-chain IGKC deficiency (Milstein et al. 1974) immunodeficiency. SCR: DNA from 8 unrelated patients with sporadic agammaglobulinaemia, who did not have mutations in Btk, mu heavy chain, (Minegishi et al. or in XLA. PAN: These samples were screened for mutations in lambda 5, Iga, and IgB. 1 patient was found to have a nonsense IGLL1 λ5 deficiency 1998) mutation in one allele, and a substitution of a proline with a leucine in the other. Non-Bruton type LIN: A patient with congenital agammaglobulinaemia was reported with no mutation in the known BTK genes. Karyotype analysis autosomal dominant revealed an apparently balanced chromosomal translocation, however closer examination showed that the LRRC8A gene was LRRC8A agammaglobulinemia (Sawada et al. 2003) truncated by the translocation CSA: A patient with persistent hypogammaglobulinaemia, with normal B cell numbers is described. Immunophenotyping showed normal numbers of CD19 positive B cells, but CD20 expression was conspicuously absent. Sequencing analysis revealed MS4A1 CD20 deficiency (Kuijpers et al. 2010) compound heterozygous mutations of the splice donor sequence in the patient. The authors describe a number of patients with B-cell immunodeficiency, who were mutation-negative for the known disease p110delta defect with related genes. ANI: Mouse knockout studies have identified a number of genes that lead to a similar phenotype, including B-cell PIK3CD. SCR: Screening of 16 patients from 15 non-consanguineous families revealed five different single base polymorphisms PIK3CD immunodeficiency (Jou et al. 2006) in this gene.

Appendix 203 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) ANI: Animal models of BAFF-deficiency show fewer peripheral B cells, and impaired immune responses. PAN: TACI, encoded by TNFRSF13B, is a member of the same family of genes that transduce key signals that regulate immune cells. SCR: TACI was a suitable candidate for further study, so Salzer et al. screened162 unrelated individuals with CVID for mutations, and identified 3 Immunoglobulin A (Castigli et al. 2005; different mutations in familial cases, and 4 different mutations in sporadic CVID. In a separate study, Castigli et al. made the TNFRSF13B deficiency 2 Salzer et al. 2005) same observations, and identified 4 mutations in 35 patients. ANI: Animal models of BAFF-deficiency show fewer peripheral B cells, and impaired immune responses. PAN: TACI, encoded by TNFRSF13B, is a member of the same family of genes that transduce key signals that regulate immune cells. SCR: TACI was a suitable candidate for further study, so Salzer et al. screened162 unrelated individuals with CVID for mutations, and identified 3 TNFRSF13B (Castigli et al. 2005; different mutations in familial cases, and 4 different mutations in sporadic CVID. In a separate study, Castigli et al. made the deficiency Salzer et al. 2005) same observations, and identified 4 mutations in 35 patients. PAN: BAFFR is in the same biochemical pathway as TACI, and so was considered a candidate for closer examination. CSA: BAFF receptor (Warnatz et al. Several patients were identified that showed low cell surface expression of the BAFF-R, and in 1 patient a mutation in this gene TNFRSF13C deficiency 2009) was discovered. ANI: UNG-deficient mouse models show a HIGM phenotype. 3 patients with HIGM that did not have mutations in AICDA were UNG UNG deficiency (Imai et al. 2003) examined. Sequence analysis revealed mutations in all 3 patients in the UNG gene.

C: Other Well-defined Immunodeficiency Syndromes LIN: Previous linkage studies had located an AT locus on chr11q22-23. Additional studies reduced this interval to ~3Mb. Further work by Collins et al in the construction of YAC contigs, and fine mapping of the region reduced the critical region to approximately 500kb. An ORF was identified, and Southern blot demonstrated a homozygous deletion in this gene in affected members of an extended Palestinian-Arab family. A restriction fingerprinting search of the region was then undertaken, with abnormal patterns being directly sequenced. A variety of deletions and insertions were detected, either as homozygotes or as ATM Ataxia-telangiectasia (Savitsky et al. 1995) compound heterozygotes. LIN/HOM: Previous linkage allowed the authors to localise the BLM locus to a region on chromosome 15q26.1. A mutation search failed to uncover mutations in FUR , so BLM was scanned for mutations using single strand conformation polymorphism BLM Bloom syndrome (Ellis et al. 1995) analysis. Sequencing analysis revealed the underlying genetic changes, identifying 7 unique mutations. LIN: Previous linkage by the authors had identified a 1.4 Mb region on chromosome Xq, which contained 28 positional candidate Dyskeratosis genes. A thorough screen of these genes was undertaken using Southern and Northern blotting, and a partial gene deletion of DKC1 congenita-1 (Heiss et al. 1998) DKC1 was identified in a single patient, allowing five unique mutations to be identified in 5 patient cell lines. Hoyeraal- SCR: The authors describe a four year old patient with Hoyeraal-Hreidarsson syndrome. A review of literature indicated Hreidarsson significant shared phenotypic similarity with congenital X-linked dyskeritosis. DKC1 mutations had been implicated with DKC, so syndrome (Yaghmai et al. 2000) this gene was analysed. Immunodeficiency- HOM: The authors had previously undertaken a homozygosity mapping study that had identified a region on 20q11-13. As this centromeric region contained a novel DNA methyltransferase, the authors screened 5 patients with ICF for deletions within the gene instability-facial DNMT3B. All the affected patients screened had homozygous or compound heterozygous mutations in this gene. DNMT3B anomalies syndrome (Xu et al. 1999)

Appendix 204 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) CGH: A CGH microarray of families 1 and 2 revealed homozygous deletions in the DOCK8 gene. Sequencing of families 3-6 showed compound heterozygous deletions that were not reported in SNP databases, and were not identified in 38 patients with DOCK8 DOCK8 deficiency (Zhang et al. 2009) other HIES, or in 115 control subjects. CSA: The authors describe a 3 year old boy who suffered from recurrent viral respiratory tract infections. H also had a severe Natural killer cell reaction to Bacille Calmette-Guerin vaccination. Immunophenotyping showed that the patient’s NK cells were not stained by the FCGR3A deficiency (deVries et al. 1996) CD16 monoclonal antibodies, and sequencing analysis revealed mutations in the gene encoding CD16. Ataxia- PAN: The authors encountered 2 patients with clinical features of an ataxia telangiectasia-like disorder that did not exhibit ocular telangiectasia-like telangiectasia. No ATM mutation was identified in these patients, so the authors undertook a mutation screen of the other genes MRE11A disorder (Stewart et al. 1999) related to DNA repair. Unique mutations were identified in each of the affected individuals. LIN: Previous genome-wide linkage described a 1 cM region on chr8 in a group of 14 families, consisting of both NBS and Berlin Nijmegen breakage (Matsuura et al. 1998; breakage syndrome (BBS). Caron et al. surmised that identical haplotypes indicated genetic homogeneity. In a separate study, NBN syndrome Varon et al. 1998) Matsuura et al. used previous mapping results to isolate the cDNA encoding NBS1, and identified a 5 bp deletion in 13 patients. The authors describe a patient with familial adenomatous polyposis. BIO: A high frequency of DNA instability was observed in the patient’s normal tissues. ANI: This high instability had been reported previously in knock-out mouse models of PMS2. PMS2 PMS2 deficiency (Miyaki et al. 1997) Mutation detection in this patient identified a heterozygous mutation in this patient. Rothmund-Thomson SCR: Similar immune phenotypes are caused by mutations in WRN and BLM both DNA helicase homologues. Kitao et al. syndrome with screened 7 affected individuals for mutations in the recently cloned RECQL4, and discovered the same compound heterozygous RECQL4 immunodeficiency (Kitao et al. 1999) mutations in all patients. LIN: Previous linkage has been performed in patients with cartilage hair hypoplasia, and a region of less than 1 Mb has been identified, however no mutation had been detected. The authors studied 16 multiplex pedigrees and 42 uniplex, and genotyped Cartilage hair 23 polymorphic markers across this locus, reducing the interval to 145 kb. This region contained 11 genes, and the coding RMRP hypoplasia (Ridanpaa et al. 2001) regions of all were sequenced. Mutations were identified in the RMRP gene. RNA: RIDDLE syndrome is an immunodeficiency disorder that exhibits radiosensitivity. The authors data mined an siRNA screen of DNA damage repair to identify potential candidates. 59 candidate genes were identified, and in a secondary screen RNF168 RNF168 RIDDLE Syndrome (Stewart et al. 2009) was one of only 2 genes identified. Sequence analysis identified two unique mutations in a RIDDLE patient cell line. Schimke type HOM: A genome-wide scan in four consanguineous families identified linkage at chr2q35. Haplotype analysis narrowed the immuno-osseous genetic interval to 13.5 cM. This region contained 54 positional candidate genes and ESTs in this region. SMARCAL1 was SMARCAL1 dysplasia (Boerkoel et al. 2002) considered to be a good candidate, and mutations were detected in each of the affected individuals. Hepatic veno- HOM: 4 affected members, from 3 consanguineous Lebanese families were examined for regions of shared homozygosity. A occlusive disease & single marker met this expectation, and a 1.42 Mb region was identified using fine mapping. SP110 was a strong positional SP110 immunodeficiency (Roscioli et al. 2006) candidate, and all members of the original cohort had mutations in this gene. HOM/LIN: Pairwise linkage to 6 candidate chromosomal regions was initially unsuccessful in a set of eight families. Genome- wide search for linkage was then attempted, giving 2 markers with LOD>2 on chromosomes 5 and 20. Homozygosity mapping Comel-Netherton excluded the chromosome 20 region. Haplotype analysis determined a maximal linkage interval of 3.5 cM, containing 8 genes. In SPINK5 syndrome (Chavanas et al. 2000) a subsequent paper, Chavanas et al identify mutations in the SPINK5 gene.

Appendix 205 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) PAN: TYK2 has been previously identified as a causative gene in autosomal recessive hyper-IgE syndrome. The authors considered STAT3 to be a suitable candidate gene as it is a part of this signalling cascade. 8 of 15 patients studied had STAT3 STAT3 deficiency (Minegishi et al. 2007) heterozygous mutations in the STAT3 gene. LIN: DiGeorge is a relatively common chromosomal microdeletion. The common interval deleted contains ~30 genes, and TBX1 TBX1 DiGeorge anomaly (Yagi et al. 2003) was suggested to be an important factor. Yagi et al. identified 3 mutations in 2 patients without the common 22q11.2 deletion. LIN: Nine patients with autosomal recessive malignant osteopetrosis were studied by Frattini et al. Previous linkage had defined a region on 11q13, containing multiple candidate genes. ANI: Mouse knockout models of TCIRG1 exhibited osteoclast-rich Autosomal recessive (Frattini et al. 2000; osteopetrosis, and so this gene was considered a strong candidate. Sequence analysis identified 5 unique mutations in 9 TCIRG1 osteopetrosis 1 Kornak et al. 2000) families. In a separate study, Kornak et al. followed the same logic to identify 5 mutations in 5 affected families. The authors describe a patient with transcobalamin II deficiency, characterised by failure to thrive, megaloblastic anemia, Transcobalamin II impaired immune system and neurological manifestations. RNA: Immunoprecipitation of cellular extract revealed the absence of TCN2 deficiency (Li et al. 1994) the 43 kDa TCN2 protein. Sequence analysis revealed a 4 bp deletion in the TCN2 gene. Autosomal PAN: Two patients were studied with autosomal recessive osteopetrosis with hypogammaglobulinaemia, in which mutations of Recessive the known causative genes were absent. The authors hypothesised that a gene that acted in the RANKL-RANK osteoclast Osteopetrosis with differentiation pathway was the most likely candidate. Mutations were detected in the TNFRSF11A gene. TNFRSF11A immuodeficiency (Guerrini et al. 2008) PAN: The authors identified that susceptibility to herpes simplex encephalitis had been associated with multiple different genes on the TLR3 signalling pathway. Therefore, they underwent a search for mutations in other genes in this pathway. Mutations TRAF3 TRAF3 deficiency (de Diego et al. 2010) were detected in the TRAF3 gene of a single female patient. HOM: 12 patients from 11 families were studied, 8 of which were from consanguineous families. A genome wide homozygosity study was undertaken using an Affymetrix 250K SNP genotyping array, revealing 3 regions of interest, and further linkage with Trichohepatoenteric the extra families narrowed the candidate region to a 12.9 Mb region on chromosome 5q, containing 57 genes. The authors TTC37 Syndrome (Hartley et al. 2010) sequenced 42 of these genes before identifying mutations in the TTC37 gene in all 12 patients. BIO: The authors describe a patient with a clinical diagnosis of hyper IgE syndrome. The patient showed a defect of the ability of CD4+ T cells to produce IFN-gamma after stimulation with IL-12. Severe defects in IL6 and IL10 signalling was also observed, suggesting an abnormality in a cytokine signalling pathway. TYK2 was considered as a candidate, and a homozygous mutation TYK2 TYK2 deficiency (Minegishi et al. 2006) was detected. Wiskott-Aldrich LIN: Previous linkage over 5 different papers ranging from 1987-1992 localised the WAS locus to a >1Mb region on chrXp11.22- WAS syndrome (Derry et al. 1994) p11.23. Construction of a YAC contig identified seven distinct transcription units. X-linked severe LIN: 5 males in a three generation family of European descent presented with an X-linked immunodeficiency. Linkage analysis of congenital the entire X chromosome revealed a region of linkage in a 35cM region containing WAS, known to be mutated in Wiskott-Aldrich neutropenia (Devriendt et al. 2001) Syndrome and XLT. X-linked SCR: The relationship between WAS and XLT had long been debated. The recent discovery of mutations in WAS for Wiskott- thrombocytopenia (Villa et al. 1995) Aldrich Syndrome allowed for a screen of 3 unrelated patients, revealing a different mutation in each patient.

Appendix 206 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) HOM: A homozygosity mapping study was perfomed on 5 unrelated patients within 5 consanguineous pedigrees. No overlapping region of homozygosity was shared by all 5 affected individuals NGS: A whole exome sequencing screen was performed on a ZBTB24 ICF syndrome type 2 (de Greef et al. 2011) single affected individual. A mutation was discovered in a region that was homozygous for 4 of 5 affected individuals.

D: Diseases of Immune Dysregulation Autoimmune polyendocrinopathy LIN: Previous linkage had mapped the APECED locus on chr 21q22.3. There was no evidence of locus heterogeneity. This with candidiasis and contig of somewhat less that 500kb was cloned into a BAC, and novel genes were examined. One of which was AIRE ectodermal (Nagamine et al. AIRE dystrophy 1997) Hermansky-Pudlak (Dell'Angelica et al. SCR: AP-3 was identified as being important for pigmentation in Drosophila, so 20 fibroblast cultures of HPS patients were AP3B1 syndrome 2 1999) screened with immunofluorescence microscopy using Ab to sigma, beta3, and omega3 subunits of the AP3 complex. Autoimmune PAN: The molecular basis of ALPS type 2 had not been identified. Caspase 10, along with 9 other genes, was considered a lymphoproliferative strong candidate gene due to its role in the Fas pathway. Sequencing analysis of one family identified missense mutation in this CASP10 syndrome, type IIa (Wang et al. 1999) gene. Caspase 8 BIO: Recruitment of CASP8 to the death inducing signalling complex was reduced in patients. 2 siblings were examined. CASP8 deficiency (Chun et al. 2002) Biochemical analysis of the genes involved in apoptosis showed caspase-8 was underexpressed, and a mutation was found Autoimmune ANI: Mouse models of autoimmunity showed that the mouse homologues for Fas and Fas ligand were related to a condition of lymphoproliferative hypogammaglobulinaemia, autoimmunity. In a group of 5 patients that showed impaired apoptosis and ALPs heterozygous FAS syndrome, type IA (Fisher et al. 1995) mutations were found in Fas. Autoimmune PAN: Following the identification of FAS as an ALPS causative gene, the faslg gene was a strong candidate in FAS-mutation lymphoproliferative negative patients. SCR: 75 patients were screened for mutations in the FASLG gene, and 1 patient was identified with a mutation FASLG syndrome, type 1B (Wu et al. 1996) in this gene. X-linked The authors describe five families with X-linked recessive neonatal diabetes mellitus with enteropathy and endocrinopathy LIN: immunodeficiency, This disease had been previously mapped to Xp11.23-Xq13.3, syntenic to the mouse scurfy locus. ANI: Mouse scurfy is an X- polyendocrinopathy, linked condition, which is phenotypically similar to the human syndrome. Sequence analysis revealed unique mutations in 4 of FOXP3 enteropathy (Wildin et al. 2001) these families. HOM: A single consanguineous family of Turkish descent with 2 affected children with typical characteristics of XLP. Mutations in SLAM, SAP, 2B4, FAS and EAT were excluded. 5 homozygous regions detected (LOD>2.15), the largest being a 17.2Mb region on chromosome 5q31-5q34 containing 78 positional candidates. ITK was the most likely candidate, and sequencing identified ITK ITK deficiency (Huck et al. 2009) homozygous mutation C1085T. ANI: The beige mouse model displays a similar phenotype to that seen in CHS patients. Human cDNA libraries were screened Chediak-Higashi with mouse beige probes. Sequence analysis of 3 patients with CHS was undertaken, and 2 unique mutations were identified in LYST syndrome (Nagle et al. 1996) the LYST gene.

Appendix 207 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) Autoimmune BIO: The patient’s cells were identified to resist cell death induced by IL-2 withdrawal. RNA: The specific defect was identified lymphoproliferative using gene expression profiling, which identified 205 differentially expressed probes. NRAS syndrome, type IV (Oliveira et al. 2007) Familial LIN: Previous linkage studies had mapped the disease gene locus to 10q21-22. 8 unrelated Familial hemophagocytic hemophagocytic lymphohistiocytosis, type 2- linked patients (5 consanguineous) had the coding regions of the perforin gene sequenced. 9 lymphohistiocytosis, independent mutations were discovered. PRF1 type 2 (Stepp et al. 1999) XLP1, SH2D1A LIN: Previous linkage mapped gene to a region on chrXq25. Construction of a YAC contig allowed for the identification of 4 SH2D1A deficiency (Coffey et al. 1998) genes in the region that were subsequently screened for mutations. Familial HOM: Genome-wide homozygosity mapping of a large consanguineous Kurdish kindred, with 5 children affected with FHL. This hemophagocytic showed linkage to a 10cM region (2-point LOD of 4.89) which, by screening candidate genes, led to the identification of a lymphohistiocytosis homozygous deletion of 5bp in the STX11 exon 2. In addition to this family, mutations were discovered in 5 other STX11 type 4 (zur Stadt et al. 2005) consanguineous families. Familial HOM: Familial hemophagic lymphohistiocytosis is rare automal recessive disease that exhibits extended genetic heterogeneity. hemophagocytic 15 unrelated patients from consanguineous families that were mutation negative for known FHL genes were studied in a genome lymphohistiocytosis wide homozygosity mapping screen, which identified a region of homozygosity on chromosome 19 containing 36 genes. STXBP2 type 5 (zur Stadt et al. 2009) Sequencing analysis of STCBP2 successfully identified 5 unique mutations. CSA: The authors describe two consanguineous families with an autosomal recessive immunodeficiency. Flow cytometry TCR-alpha experiments identified a distinctive immunophenotype. HOM: Homozygosity mapping of the 2 affected individuals in these TRAC deficiency (Morgan et al. 2011) families identified 2 homozygous regions on chromosome 14q11.2. Sequence analysis identified a mutation in the TRAC gene. Familial LIN/HOM: The FLH3 group was distinguished from FHL1 and 2 by analysing the hair shafts. Homozygosity mapping was hemophagocytic performed (5cM) in the consanguineous families, and bi-point LOD score analysis on the other family. A marker on chr17 was lymphohistiocytosis linked in all families, with a LOD of 8.07. Sequencing revealed mutations in all affected individuals. UNC13D type 3 (Feldmann et al. 2003) X-linked familial hemophagocytic LIN: 18 Families with XLP were examined to determine mutations in the SAP gene. 15 harboured SAP mutations, however 12 lymphohistiocytosis; individuals from 3 families did not have mutations in SAP, and the protein was shown to be expressed normally in these X-linked subjects. Subsequent analysis of the X chromosome in these families showed a unique region of 10cM at Xq25 that contained 7 lymphoproliferative known genes (including SAP). Mutations were ultimately discovered in the XIAP gene. XIAP syndrome 2 (Rigaud et al. 2006) E: Congenital defects of Phagocyte number, function or both EXP: A female patient was described with recurrent infections, photosensitivity and mental retardation. Two-dimensional PAGE analysis of protein expression in neutrophils from this patient demonstrated a unique protein spot at 42 kDa, with a shifted pI relative to normal β-actin. A cDNA library was constructed from mRNA from these cells, and a missense mutation in β-actin was ACTB Beta-Actin deficiency (Nunoi et al. 1999) identified.

Appendix 208 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) ANI : Striking phenotypic similarities were reported between C/EBP ε knockout mice and SGD patients, including susceptibility to Neutrophil-specific (Lekstrom-Himes et al. bacterial infections and characteristic neutrophil morphology. Sequencing the CEBPE gene in SGD patients revealed a 5bp CEBPE granule deficiency 1999) deletion in exon 2. PAN: Martinez-Moczygembaz et al. describe a patient that was mutation negative for the known genes related to PAP. Given (Martinez- this, and increased GM-CSF, suggested a defect in the receptor. Flow cytometry confirmed this, and sequencing showed a Moczygemba et al. homozygous deletion of exons 5-13 in the patient. In a separate study, Suzuki et al. describe 2 sisters with pulmonary alveolar Pulmonary alveolar 2008; Suzuki et al. proteinosis. BIO: an increase of GM-CSF (granulocyte/macrophage colony stimulating factor) suggested a defect in the receptor. CSF2RA proteinosis 2008) ANI: this increase in GM-CSF is seen in CSF2RB deficient mice. Missense mutations were detected in the CSF2RA gene. Severe congenital neutropenias, BIO : The in vitro response to hematopoietic growth factors was assessed, and the G-CSF-induced granulocytic colony formation including Kostmann was significantly impaired. Sequencing of the CSF3R gene identified a single point, nonsense mutation. CSF3R syndrome (Dong et al. 1994) Papillon-Lefevre LIN: Previous linkage studies had defined a 4-5 cM region on chromosome 11 with a high LOD score of 8.24. HOM: This study CTSC syndrome (Toomes et al. 1999) examined 8 consanguineous families, and defined a critical region of 1.2 cM, and selected CTSC as a candidate. PAN: The authors surmised that the gene responsible for AR-CGD could be the light chain of cytochrome b. LIN: Linkage by CYBA p22phox deficiency (Dinauer et al. 1990) southern blot defined a region on 16q24, and cDNA sequencing detected 4 mutations in 3 affected individuals. X-linked chronic LIN: Previous linkage studies had defined a region on Xp, which was then defined to a region on Xp21.1 using 13 families. granulomatous (Royerpokora et al. Royer-Pokora et al. defined the linkage region, and examined mRNA transcripts from this region in 21 CGD affected patients – CYBB disease 1986) detecting partial gene deletions in the heavy chain of cytochrome b in 4 patients. LIN: The authors used genome-wide linkage with 13 affected families to identify a region on 19p13.3. This region contained the ELANE Cyclic neutropenia (Horwitz et al. 1999) ELA2 gene, and sequencing analysis revealed 7 different mutations. Severe congenital SCR: The recent discovery of ELANE mutations in autosomal dominant cyclic neutropenia prompted the authors to screen other neutropenia, neutropenias. 25 congenital neutropenia, 4 cyclic neutropenia and 3 Shwachman-Diamond Syndrome patients were screened for autosomal dominant (Dale et al. 2000; mutations in the ELA2 gene. 18 heterozygous mutations were identified in the congenital neutropenias, all four cyclic neutropenia 1 Horwitz et al. 1999) patients bore mutations, and none of the Shwachman-Diamond Syndrome patients. (Vandewinkel et al. CSA : Four individuals were identified within a single family who lack phagocyte expression of CD64. The CD64 is made up of FCGR1A CD64 deficiency 1995) proteins that are coded by genes FCGR1A, -1B and 1C, and mutations were discovered in FCGR1A. HOM : Svensson et al. describe a Maltese subject and two Turkish subjects that were studied using a homozygosity mapping approach, giving a large region 65.3 Mb. ANI : FERMT3-deficient mice have leukocytes with integrin-function defects and a (Kuijpers et al. 2009; Glanzmann’s thrombasthenia-like phenotype. A second study by Kuijpers et al. also used a homozygosity mapping approach Leukocyte adhesion Malinin et al. 2009; with 3 patients. A third study by Malinin et al. identified 2 siblings with symptoms. BIO: cellular assays identified a defect in FERMT3 deficiency, type III Svensson et al. 2009) integrin activation. PAN: genes involved in the integrin activation pathway were interrogated, identifying mutations in FERMT3 . BIO: Neutrophils from patients with localised juvenile periodontitis were assayed for their responsiveness to various chemotactic Localized juvenile agents, revealing a dysfunctional reaction. Receptors for FMLP are involved in activation and response to chemotactic stimuli. FPR1 periodontitis (Gwinn et al. 1999) SCR: Given this, the authors screened 30 patients for mutations in the FPR1 gene, revealing a characteristic SSCP pattern.

Appendix 209 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) BIO: The biological basis of glycogen storage disease has been characterised for many years, however the gene and mutations Glycogen storage had not been discovered. ANI: A murine G6Pase cDNA was used to screen a library and identify the human cDNA. The G6PC disease Ia (Lei et al. 1993) identification of the gene allowed the authors to identify mutations in two patients with the disease. LIN: Mutations in both ELA2 and HAX1 were excluded in 5 consanguineous families with neutropenia. Linkage analysis identified Severe congenital that the gene of interest was located on chromosome 17q21. Several candidate genes were identified in this interval, of which G6PC3 neutropenia, AR 4 (Boztug et al. 2009) G6PC3 was the best candidate, due to abnormal glucose metabolism in neutropenia. Glucose 6- BIO: The authors describe glucose-6-phosphate dehydrogenase as the most common human enzymopathy, affecting over 400 phosphate million people worldwide in 1988. Biochemical and clinical criteria describe over 300 variants of this disorder. The G6PD gene dehydrogenase had recently been cloned, and the authors sequenced 7 affected individuals, revealing 6 point mutations. G6PD deficiency (Vulliamy et al. 1988) ANI: Mouse models that are GFI1-deficient show a neutropenic phenotype, making this gene a candidate in patients where ELA2 mutations were excluded. SCR : 105 unrelated neutropenic probands were screened for mutations, two mutations were GFI1 GFI1 deficiency (Person et al. 2003) discovered. HOM: A genome wide homozygosity mapping screen was undertaken with 3 unrelated Kurdish families with autosomal recessive Severe congenital severe congenital neutropenia. This defined an interval on chromosome 1 containing 234 genes. The authors regarded HAX1 as HAX1 neutropenia, AR 3 (Klein et al. 2007) a strong candidate as it participates in B cell receptor-mediated signal transduction. HOM: 360 polymorphic satellites were typed in each of the four affected Maltese individuals and their consanguineous parents. A single 5-cM region was identified on chromosome 6q in which all affected children were homozygous for the same alleles, and their parents and unaffected siblings were not. IFGR1 was among the genes within this region, and seemed a likely candidate. In a separate study, Jounguy et al. examined a patient with the same phenotype. ANI: The authors noted that mice with IFNGR1 IFN γ1-receptor (Jouanguy et al. 1996; deletions showed susceptibility to BCG infection. PAN: a limited homozygosity mapping procedure was used to examine each of IFNGR1 deficiency Newport et al. 1996) the genes in the pathway, and IFNGR1 was identified as the likely candidate. BIO: Examination of the biochemical function of the cells of a single patient with susceptibility to mycobacterial infection identified IFN γ2-receptor (Dorman and Holland a reduction in the amount of IFN-γ, but an intact IL-12 response. Appropriate TNF-α production under IFN-γ-independent IFNGR2 deficiency 1998) conditions suggested a defect in the IFN-γ receptor. CSA: Previous studies indicated impaired cell-surface expression leukocyte adhesion molecules, in a patient with severe and Leukocyte adhesion recurrent bacterial infections, was secondary to defects in the common CD18 subunit. The authors identified the cDNA, and ITGB2 deficiency I (Arnaout et al. 1990) sequencing revealed 2 mutations. Two forms of Griscelli Syndrome had previously been described. PAN : The genes responsible for GS1 (MYO5A) and GS2 (RAB27A) form a protein complex with MLPH, shown to be essential for the capture and movement of melanosomes. ANI : Griscelli syndrome, (Menasche et al. Animal models of GS1 and GS2 show a similar diluted pigmentation as does the mouse model of MLPH deficiency, leading the MLPH type 3 2003) authors to hypothesize that MLPH was the gene responsible for GS3. BIO: Previous biochemical analysis by the authors demonstrated that 13 affected individuals lacked MPO enzymatic function. Myeloperoxidase Southern blots from Bgl II digested genomic DNA, probed with MPO cDNA, revealed a 2.1kb fragment in patients. Sequencing of MPO deficiency (Nauseef et al. 1994) exon 10 of this gene revealed a mutation in 6 of the affected individuals.

Appendix 210 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) ANI : The related phenotypes of patients with Griscelli syndrome, and the dilute mouse made the non-conventional myosin gene family good candidates for this disease. HOM /LIN : Three consanguineous and one non-consanguineous family were used to Griscelli syndrome, exclude a majority of these genes, leaving only two on chromosome 15q21-22. Sequencing revealed MYO5A was mutated in all MYO5A type 1 (Pastural et al. 1997) affected individuals. NCF1 p47 phox deficiency (Casimir et al. 1991) BIO: Mutations in NCF1 cause a failure to generate superoxide. BIO: The authors describe a patient with autosomal recessive chronic granulomatous disease. Cell-free assays were performed using neutrophil membranes to demonstrate p67-phox deficiency. The cDNA from the patient was isolated and sequenced, and NCF2 p67 phox deficiency (Nunoi et al. 1995) revealed a 2bp insertion. BIO : Characterisation of the patient’s neutrophils highlighted the NADPH oxidase defect, particularly with markedly reduced intracellular superoxide production. PAN : None of the four genes that encode subunits of the phagocyte NADPH oxidase NCF4 p40phox deficiency (Matute et al. 2009) contained mutations. NCF4 encodes a fifth subunit, and was sequenced, revealing 2 unique mutations in the affected patient. Griscelli syndrome, (Menasche et al. LIN/HOM: Homozygosity mapping (after linkage mapped the locus to 15q21) RAB27A type 2 2000) BIO: The phenotype of this patient was defined by neutrophils with a marked decrease in motility not due to a leukocyte adhesion deficiency, azurophilic granule secretion, superoxide generation, and polarization in response to various stimuli. This LAD with RAC2 suggested that the molecular defect was due to a protein related to both regulation of oxygen production and shape RAC2 deficiency (Ambruso et al. 2000) change/motility. BIO : Biological analysis of the patients showed nearly completely absent platelet aggregation. RNA : RABGRP2 has been implicated as a key regulator of platelet aggregation, and expression analysis showed almost zero expression of this gene in leukocyte adhesion patient cells. Homozygosity mapping with a single microsatellite marker suggested both patients were homozygous for the same RASGRP2 deficiency type 3 (Pasvolsky et al. 2007) affected allele, and this was confirmed with sequencing. HOM: Four individuals from a single Mennonite family were analysed. A genome-wide screen with 188 autosomal microsatellite markers was used, but was somewhat underpowered. Multipoint analysis mapped the disease gene to a region on chromosome 1. the maximal possible linkage region (size unrevealed) contained 192 known or predicted genes. Initial candidate gene sequencing proved fruitless, RNA: BLCL expression profiling was used to find candidates. p14 was demonstrated to be underexpressed by a factor greater than 2 in the subjects. Although no coding mutations were discovered in this gene, there was a mutation detected in the 3' untranslated region in exon 4 (A>C at the +23 position). This mutation segregated perfectly with the ROBLD3 p14 deficiency (Bohn et al. 2007) disease, and was not detected in 100 'control' alleles, or in 34 Mennonite alleles.

LIN: Previous linkage studies showed that the syndrome is linked to a 1.9 cM interval at 7q11, containing 18 genes. The authors Shwachman- chose 8 of these for further analysis, and sequencing revealed multiple different mutations in the SBDS gene. SBDS Diamond syndrome (Boocock et al. 2003) Leukocyte adhesion BIO: LAD2 is characterised by a reduction in the transport of GDP-fucose into various Golgi vesicles. 12 cDNAs from C elegans SLC35C1 deficiency, type II (Luhn et al. 2001) that were homologous to known sugar transporter proteins were cloned into LADII patient cells. 1 re-established expression.

Appendix 211 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) BIO: 2 patients with glycogen storage disease were assayed, demonstrating a reduction of glucose-6-phosphatase activity. PAN: Glycogen storage the authors suspected a glucose-6-phosphatase transporter, and assayed a cDNA library to identify candidates. A 2.2 kb cDNA SLC37A4 disease 1b (Gerin et al. 1997) was identified that demonstrated 3 mutations in the 2 patients studied, which were not detected in 4 controls. BIO: Biochemical evidence indicates the presence of a defect in inorganic phosphate transport in individuals with Glycogen- Glycogen storage (Veiga-da-Cunha et al. storage disease type 1c. A novel glucose-6-phosphate translocase was identified previously to be mutated in GSD type 1b. SCR: disease 1c 1998) The authors screened 26 patients with GSD type 1c, and identified mutations in each. Two unrelated patients were studied, showing unexplained mycobacterial disease. Mutations in IL12B and IL12B1 were Partial STAT1 excluded. BIO: Cellular responses to interferon-γ, and interferon α/β and were assayed, identifying an aberrant response. PAN: STAT1 deficiency (Dupuis et al. 2001) The authors performed sequencing analysis on the 2 genes common to these signalling pathways, JAK1 and STAT1. The authors report 2 patients with susceptibility to severe mycobacterial and viral infections. PAN: STAT1 was considered to be a likely candidate due to its involvement in both interferon-γ, and interferon α/β signalling pathways. Homozygous mutations were STAT1 deficiency (Dupuis et al. 2003) identified in both affected individuals. Autosomal dominant NGS: Liu et al. used whole exome sequencing to investigate 6 individuals with AD CMCD. 3 different missense STAT1 mutations chronic (Liu et al. 2011; van were identified in 4 patients. BIO: In a separate study, van de Veerdonk et al. used a biological assay of patient cells to mucocutaneous de Veerdonk et al. determine the integrity of of immune pathways, and identified a defect in both interleukin-12 and interleukin-23 pathways in 14 candidiasis 2011) patients. PAN: 100 candidate genes were sequenced, and a number of mutations were identified in the STAT1 gene. LIN: Four families affected with Barth syndrome were studied. The locus of the gene was previously mapped by the authors to a region on Xq28. This region contained 30 genes, five of which were considered good candidates for further analysis. Unique TAZ Barth syndrome (Bione et al. 1996) mutations were discovered in the TAZ gene in all patients. F: Defects in Innate Immunity BIO: APOL1 had previously been identified as the protein in human serum that confers resistance to infection by Trypanosoma (Vanhollebeke et al. brucei rodesiense . The authors examined a patient who presented with a consistent infection of this species, and identified 2 APOL1 Trypanosomiasis 2006) different mutations in the APOL1 gene.

HOM: 5 affected and 8 unaffected individuals in a single consanguineous pedigree were genotyped using a 250K Affymetrix SNP array. A 1.3 Mbp region on chromosome 9 segregated perfectly with the disease, yielding a peak multipoint LOD score of 3.6. This region contained 121 positional candidate genes. ANI: CARD9 was selected as a likely candidate, as Card9-/- mice are CARD9 CARD9 deficiency (Glocker et al. 2009a) susceptible to fungal infections. Familial chronic BIO: The authors describe a family with four woman affected with recurrent vulvovaginal candidiasis. A functional assay was mucocutaneous designed to screen mononuclear cells for functional defects. The impaired response in this family indicated a potential defect in candidiasis with dectin1 recognition. The gene encoding dectin-1, CLEC7A, was sequenced, and revealed a homozygous nonsense mutation in CLEC7A Dectin-1 deficiency (Ferwerda et al. 2009) these individuals. LIN/HOM: A whole genome scan was employed (method not described in this paper) identifying a 12 cM critical region. This (Hernandez et al. region contained 23 known or predicted genes. The most attractive candidate in this region was the chemokine receptor gene CXCR4 WHIM syndrome 2003) CSCR4. One frameshift, and two nonsense mutations were discovered.

Appendix 212 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) HOM: A genome wide homozygosity mapping screen was undertaken with 3 affected individuals and their families, using the Affymetrix 500K SNP array. This identified 2 regions of homozygosity. NGS: In parallel to the linkage analysis, the authors also performed whole exome sequencing on one of the affected individuals, which identified 23,146 sequence variations, of which 67 occurred in the chromosome 11 candidate region, and 14 in the chromosome 18 region. Only one nonsynonymous variant had FADD FADD deficiency (Bolze et al. 2010) not been reported, and this was validated as the causative mutation. Atypical SCR : Filipe-Santos et al. evaluated 3 kindreds with sporadic mycobacterial disease. None of the 6 patients displayed anhidrotic mycobacteriosis, (Filipe-Santos et al. ectodermal dysplasia, however congenital incisors in one patient led the authors to consider IKBKG. Sequencing analysis IKBKG familial, X-linked 1 2006) identified missense mutations in all families. Ectodermal SCR: Recent mutations in in the IKKBKG gene had been identified to cause familial incontinential pigmenti. This condition was dysplasia, found to cause male prenatal lethality, and Zonana et al. hypothesized that ‘milder’ mutations might be the cause of a novel hypohidrotic, with immune deficiency. A screen of 8 affected males from 4 families identified mutations in all affected individuals. immune deficiency (Zonana et al. 2000) Immunodeficiency SCR: Orange et al. identified a patient with a specific pattern of infectious susceptibility and immunodeficiency. Despite the without anhidrotic patient not displaying ectodermal dysplasia, the authors considered IKBKG due to the lack of specific antibody production and ectodermal dysplasia (Orange et al. 2004) atypical mycobacterial infection. Sequencing analysis revealed a splice site mutation that caused exon 9 to be skipped. Osteopetrosis, lymphedema and SCR: Doffinger et al. describe 2 unrelated male patients with a novel EDA-ID syndrome with osteopetrosis lymphedema. anhidrotic Sequence analysis of the IKBKG gene revealed a mutation at the stop codon, which encoded a protein 27 residues longer than ectodermal dysplasia the wild-type. & immunodeficiency (Doffinger et al. 2001) PAN: The authors describe a patient with BCG and Salmonella enteritidis infection. Mutations in previously identified genes were not detected, and so other molecules involved in the IFN-γR1-mediated immunity pathways were assessed. A large homozygous IL12B IL-12 p40 deficiency (Altare et al. 1998b) mutation within the IL12B gene was detected. Four patients from 3 families were investigated by Altare et al. with disseminated mycobacterial infections that were not explained by mutations in known IFN-γR1 deficiency genes. PAN: The known role of IL12 caused the authors to seek mutations Interleukin-12 in the IL12B gene, and a nonsense mutation was identified in one patient. BIO: In a separate study, de Jong et al. examined 3 receptor beta (Altare et al. 1998a; de patients with cells that were deficient in IL12R signalling and IFN-γ production. IL12RB1 sequencing analysis revealed nonsense IL12RB1 deficiency Jong et al. 1998) mutations in all affected patients. CSA: Immunophenotyping indicated a defect in TIR pathway signalling. PAN: Further tests indicated that this defect occurred IRAK4 IRAK4 deficiency (Picard et al. 2003) upstream of TRAF-6 and downstream of the individual membrane receptors. PAN: 9 children from 5 families with invasive pyogenic bacterial diseases were investigated. IRAK-4 deficiency was negative. (von Bernuth et al. MYD88 was investigated, as the protein plays a role in the recruitment of IRAK4 to Toll-like receptors. Homozygous in-frame MYD88 MyD88 deficiency 2008) deletions found in 3 families, compound heterozygous mutations in 1, and homozygous missense mutation in 1.

Appendix 213 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) Autosomal dominant BIO: The authors describe a patient with EDA-ID, who showed a reduction in IKBKG activity, but was negative for mutations in anhidrotic the IKBKG gene. PAN: The authors dissected the affected pathway, and identified the NFKBIA gene. Sequencing analysis ectodermal dysplasia revealed a missense mutation. NFKBIA and T-cell ID (Courtois et al. 2003) The authors describe multiple patients with Aicardi-Goutieres syndrome, an autosomal recessive neurological disorder with immunological features. 3 genes, encoding the subunits of the Ribonuclease H2 subunit: RNASEH2A, RNASEH2B, and Aicardi-Goutieres RNASEH2C. HOM: A single consanguineous family was revealed to have a small region of homozygosity on chromosome RNASEH2A syndrome (Crow et al. 2006b) 19p13.13, which contained the RNASEH2A gene. Sequencing revealed a mutation in each of the affected individuals. Aicardi-Goutieres HOM: The authors performed high-density genotyping in 10 families, 8 of which were consanguineous. A critical region was RNASEH2B syndrome (Crow et al. 2006b) identified on chromosome 13q14.3. Sequencing revealed multiple unique mutations. HOM: Genome wide homozygosity mapping of 6 consanguineous families identified a gene locus on chromosome 11q13.2. Aicardi-Goutieres PAN: This region contains RNASE2C, which the authors considered a good candidate due to its biochemical relationship to RNASEH2C syndrome (Crow et al. 2006b) RNASEH2A. Sequencing revealed multiple unique mutations. HOM: The authors had previously identified mutations in AGS, however not all patients had mutations in the known genes. A genome-wide SNP genotyping screen was undertaken in four affected families, identifying a shared region of homozygosity on Aicardi-Goutieres chromosome 20q11. LIN: high density mapping of this interval was undertaken with a further 2 families, leading to the SAMHD1 syndrome (Rice et al. 2009) identification of a <1Mb region, and homozygous mutations in the SAMHD1 gene were identified. PAN: A girl with short stature and immunodeficiency was examined. There were no detected mutations in the growth hormone receptor. Of the 3 known biochemical pathways known to respond to GH, the STAT pathway was shown to be aberrant. STAT5b STAT5B STAT5B deficiency (Kofoed et al. 2003) was poorly expressed, and was not phosphorylated after GH treatment. PAN: TLR3 induces IFN induction, recognizes double stranded virus RNA (like HSV-1), and is expressed in CNS resident cells, TLR3 TLR3 deficiency (Zhang et al. 2007) and peripheral nerves. This strongly suggested a role for TLR3 in herpes simplex virus 1 encephalitis. LIN/HOM: Previous mapping studies reported a 1cM susceptibility locus for EV1 to chr17q25. This region contained 2 known genes, and 4 predicted genes. Sequencing analysis of all exons of these genes identified homozygous nonsense mutations in Epidermodysplasia each of the consanguineous families in EVER1. Sequencing the affected family in the third Algerian family located a TMC6 verruciformis type 1 (Ramoz et al. 2002) frameshifting mutation in EVER2. none of these mutations were identified in 90 unrelated individuals. LIN/HOM: Previous mapping studies reported a 1cM susceptibility locus for EV1 to chr17q25. This region contained 2 known genes, and 4 predicted genes. Sequencing analysis of all exons of these genes identified homozygous nonsense mutations in Epidermodysplasia each of the consanguineous families in EVER1. Sequencing the affected family in the third Algerian family located a TMC8 verruciformis type 2 (Ramoz et al. 2002) frameshifting mutation in EVER2. None of these mutations were identified in 90 unrelated individuals. LIN: Previous linkage had identified a critical region for AGS on chromosome 3p21, containing the gene TREX1. ANI: TREX1 Aicardi-Goutieres null mice show overactivation of innate immunity, so TREX1 was considered a good candidate. SCR: 23 patients with AGS TREX1 syndrome (Crow et al. 2006a) screened for mutations in TREX1, and 5 distinct mutations were detected in 10 families. UNC93B1 UNC93B deficiency (Casrouge et al. 2006) ANI: A mouse model had previously been described with absent UNC-93B expression.

Appendix 214 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) G: Autoinflammatory Disorders Inflammatory bowel HOM: The authors describe 2 unrelated consanguineous families with individuals affected with early-onsent inflammatory bowel disease with IL10R1 disease. A homozygosity mapping approach was utilised, that analysed each family independently. In the first family, a region on IL10RA deficiency (Glocker et al. 2009b) chromosome 11q was identified, which contained IL20RA, and a mutation was identified in the index patient. Inflammatory bowel HOM: The authors describe 2 unrelated consanguineous families with individuals affected with early-onsent inflammatory bowel disease with IL10R2 disease. A homozygosity mapping approach was utilised, that analysed each family independently. In the second family, a region IL10RB deficiency (Glocker et al. 2009b) on chromosome 21 was analysed, containing IL10RB. Homozygous mutations were identified in both affected siblings. BIO: Aksentijevich et al. report nine children from six families with neonatal onset of sterile multifocal osteomyelitis, periostitis Interleukin-1 (Aksentijevich et al. and pustulosis PAN: An abnormal response to the interleukin 1 receptor antagonist anakinra prompted the authors to search for receptor antagonist 2009; Reddy et al. mutations in the interleukin-1 pathway. In a separate study, Reddy et al. examined a patient with a similar phenotype. LIN: IL1RN deficiency 2009) genome-wide linkage identified a deletion on chromosome 2q, that encompassed 6 genes, including IL1RN . HOM: Genome-wide homozygosity mapping and parametric linkage analysis were used to determine candidate loci. 4 regions of homozygosity were found, and 3/4 were excluded using markers within the regions of homozygosity. A region of 5.5 cM on chromosome 18 was identified. This region contains 11 known and predicted genes. A missense mutation was detected in all LPIN2 Majeed syndrome (Ferguson et al. 2005) affected members in the first family, and the second family had a 2bp deletion, causing a premature termination. Familial LIN: Previous linkage by Aksentijevich et al. (1997) localised the gene responsible for FMF on a genomic contig on chromosome Mediterranean fever, 16. This entire region was sequenced, revealing the MEFV gene. Four missense mutations were identified. MEFV autosomal dominant (Bernot et al. 1997) LIN: The authors describe a panel of 61 families with autosomal recessive familial Mediterranean fever. Previous linkage had Familial established a 1 Mb interval on chromosome 16, and linkage by the authors defined a critical region of 200 kb, containing 9 Mediterranean fever, (Aksentijevich et al. expressed transcripts. Sequencing identified new microsatellites in the region, which aided further linkage, and mutations were autosomal recessive 1997) eventually detected in the MEFV gene. BIO: Houten et al. found MK activity to be decreased in 4 patients with Hyper-IgD syndrome. Sequence analysis revealed (Drenth et al. 1999; mutations in the MVK gene. LIN: In a separate study, Drenth et al. performed a genome-wide linkage search in 4 families, which MVK Hyper-IgD syndrome Houten et al. 1999) identified the locus containing MVK. . BIO: A patient was described, with an absence of mevalonate kinase activity common to mevalonic aciduria. The identification of Mevalonic aciduria (Schafer et al. 1992) the MVK cDNA allowed for sequencing analysis, which identified a missense mutation in this patient. Familial cold PAN: Two families with periodic fever syndromes were studied. The affected individuals were negative for mutations in all known autoinflammatory genes, and so the authors searched for a new gene in the NALP pathway, particularly NLRP12. Mutations were revealed in both NLRP12 syndrome (Jeru et al. 2008) affected individuals. SCR: Genes had been identified with recurrent inflammatory syndromes. LIN: Disease segregation was compatible with linkage NLRP3 CINCA syndrome (Feldmann et al. 2002) to CIAS1 .

Appendix 215 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) LIN: Previous linkage indicated that FCAS mapped to a locus on chr1q44. This critical region was narrowed to a 1Mb using

Familial cold haplotype analyses, and then all potential exons in this region were sequenced. More than 80 exons were sequenced, revealing autoinflammatory 4 separate mutations that segregated with the disease in each family. syndrome (Hoffman et al. 2001) Muckle-Wells SCR: Genes had been identified with recurrent inflammatory syndromes. LIN: Disease segregation was compatible with linkage syndrome (Feldmann et al. 2002) to CIAS1. (Miceli-Richard et al. LIN: Previous linkage identified the BS locus on chr16p12. CARD15 was a good candidate gene for this condition, and so was NOD2 Blau syndrome 2001) screened for mutations. LIN: Genome-wide searches for idiopathic inflammatory bowel disease genes had identified a locus on chromosome 16q SCR: This locus precisely overlapped with the recently identified NOD2 gene. Given the role of NOD2 in recognising bacterial (Hampe et al. 2001; components, Ogura et al. surmised that this gene would be a good candidate for further study in 12 affected families. In a second Hugot et al. 2001; study, Hampe et al. performed a similar screen, and genotyped a SNP that associated with Crohn’s disease, and in a third study Crohn's disease Ogura et al. 2001) Hugot et al. identified 3 mutations in the gene. Pyogenic sterile LIN: Previous genome-wide linkage analysis mapped both PAPA and FRA to a locus on 15q, and proposed that these two arthritis, pyoderma phenotypes represented the same disease. A BAC clone was constructed, and the region was found to contain 6 candidate gangrenosum, and genes PSTPIP1 acne syndrome (Wise et al. 2002) Tumor necrosis The authors describe 7 families with autosomal dominant periodic fever syndromes LIN: Previous genome-wide searches had factor receptor- identified a 19cM region on chromosome 12, containing a number of positional candidate genes. BIO: The authors suspected a associated periodic (McDermott et al. role for TNFR1, when it was observed that serum levels of TNFR1 were reduced in patients. TNFRSF1A syndrome 1999) H: Complement Deficiencies BIO: Functional studies by Petry et el. showed that the patient was totally functionally deficient for C1q. Sequencing identified a (Petry et al. 1995; missense mutation in the first exon of the C1QA gene. In a separate study, Topaloglu et al. mirrored the experimental procedure C1QA C1qA deficiency Topaloglu et al. 1996) in 2 siblings in a Turkish family, also identifying a homozygous nonsense mutation. BIO: C1q-deficient patients show a characteristic lack of C1q functional activity in serum, that can be restored in a dose- dependent manner by adding purified C1q. LIN: Restriction mapping of clones from 8 patients, using C1q cDNA as a probe C1QB C1qB deficiency (McAdam et al. 1988) identified an abnormal Taq I restriction fragment, which was found to be due to a nonsense mutation. BIO: As described, C1q deficiency can be identified by a lack of functional activity in patient serum. PAN: A-, B- and C- chains of C1QC C1qG deficiency (Slingsby et al. 1996) C1q were amplified and sequenced in 4 affected individuals. RNA: An Immunoblot identified the absence of C1s protein in a patient. Previous work has identified combined deficiencies of C1S C1s deficiency (Inoue et al. 1998) C1s and C1r, and this is the first identification of a mutation being exclusively found in C1s.

Appendix 216 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) BIO: Deficiency of C2 is the most frequently occurring inherited defect of the complement system in individuals of western European descent. C2 functional assays were used to evaluate eight C2 deficient patients. Genomic DNA was sequenced in C2 C2 deficiency (Johnson et al. 1992) these individuals, identifying a 28-bp deletion that caused aberrant splicing of the cDNA. BIO: The authors describe a patient with episodic attacks of pneumonia, otitis media, septic arthritis and skin infection. Complement haemolytic assay identified an absence of serum C3, and sequencing analysis of this gene revealed mutations in C3 C3 deficiency (Huang and Lin 1994) the splice site, which caused an abnormal splicing of the cDNA. PAN: Atypical haemolytic uremic syndrome has been linked to mutations in genes encoding the complement regulator factors H, Hemolytic uremic I, and membrane cofactor protein CD46. As a proportion of the remaining patients have persistently low serum levels of another syndrome, atypical, (Fremeaux-Bacchi et complement factor, C3, this was considered to be a candidate for study. SCR: 26 patients with low C3 were screened for C3 susceptibility to, 5 al. 2008) mutations in C3, and mutations were detected in 14. Complete C4 deficiency is associated with severe immune defects. Complement factor C4 is encoded by 2 genes, C4A and C4B. RNA: The authors identified 12 individuals that demonstrated a null allele for C4A. Sequencing analysis of these individuals C4A C4A deficiency (Barba et al. 1993) identified a 2bp insertion in the C4A gene. BIO: The authors identified a Finnish woman with photosensitivity, malar rash, leukopenia, and rheumatoid factor. Serum studies revealed an absence of complement factor C4.Sequencing analysis revealed identical frameshifting mutations on both the C4A C4B C4B deficiency (Lokki et al. 1999) and C4B genes. PAN: Atypical haemolytic uremic syndrome has been linked to mutations in genes encoding the complement regulators factor H, factor I, CD46 and C3. LIN: C4BPA and C4BPB are within a single nucleotide polymorphism haplotype block that has been C4 binding protein strongly associated with the severity of disease. SCR: 40 aHUS patients were screened for mutations in the C4BP genes, and a C4BPA alpha deficiency (Blom et al. 2008) mutation was discovered in C4BPA. BIO: Three African-American families were previously described with a detectable absence of C5 activity. The 41 exons of C5 C5 C5 deficiency (Wang et al. 1995) were sequenced in these families, identifying 2 different nonsense mutations in this cohort. BIO: Two unrelated individuals with C6 deficiency were studied. Serum haemolytic activity was measured, and showed (Nishizaka et al. undetectable activity in the patients’ serum, compared to normal results from one of the unaffected parents. Sequencing of C6 C6 C6 deficiency 1996a) identified unique mutations in each individual. (Barroso et al. 2006; BIO: 2 individuals were described by Nishizaka et al. with recurrent bacterial infections. Assays showed an absence of Fernie et al. 1996; complement factor C7 in serum. Sequencing analysis revealed a nonsense mutation in one patient, and a frameshift mutation in Nishizaka et al. the other. A separate study by Fernie et al. identified missense mutations in C7, in a patient with combined C6 and C7 deficiency. C7 C7 deficiency 1996b) BIO: Two unrelated individuals with undetectable C8 protein in serum were studied. Total haemolytic activity in these individuals C8A C8A deficiency (Kojima et al. 1998) was restored by addition of purified C8 protein. Sequencing of the C8A gene revealed unique mutations in each individual. BIO: The C8 protein is encoded by 3 genes, C8A, C8B and C8G. C8B deficiency was studied in seven patients, with functional (Kaufmann et al. studies of C8-dependent haemolytic activity used to establish C8 deficiency. Previous Southern blots had revealed no major C8B C8B deficiency 1993) deletion or rearrangement in this gene, and sequencing revealed mutations in this gene.

Appendix 217 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) BIO: Serum C9 concentration was measured in two brothers with neisserial meningitis, and was found to be completely absent. The cDNA sequence of C9 had previously been published, so the authors used exonic primers to sequence introns, to design a (WitzelSchlomp et al. primer set of intronic primers, to sequence each of the exons. Via this method, the authors detected 2 compound heterozygous C9 C9 deficiency 1997) nonsense mutations in both affected brothers. PAN: Mutations in factor H had been reported in a number of patients with cases of haemolytic uraemic syndrome, however this did not account for all cases. The authors hypothesised that other complement regulatory proteins could be involved. SCR: 25 CD46 CD46 deficiency (Noris et al. 2003) consecutive patients were screened by the authors for mutations in 3 genes, and a mutation in the MCP gene was detected. Decay-accelerating CSA: The authors describe a rare individual with inherited low or absent CD55 expression on the erythrocyte cell surface – factor (CD55) usually seen in an acquired condition. The molecular basis of this absence was identified by sequencing the DAF gene, and a CD55 deficiency (Lublin et al. 1994) single missense mutation was discovered. (Motoyama et al. CSA: A patient with paroxysmal nocturnal hemoglobinuria was assessed, and an absence of HRF20 expression was observed CD59 CD59 deficiency 1992) on the patient’s cells. Sequencing analysis of patient genomic DNA revealed two single nucleotide frameshifting deletions. PAN : Complement profile analysis of 74 individuals with atypical haemolytic uremic syndrome allowed the authors to identify a subgroup with alternative pathway activation. SCR: Despite a previous screen failing to identify mutations in the CFB gene, the authors felt this subgroup warranted another screen, and 2 different heterozygous missense mutations were identified in this CFB Factor B deficiency (de Jorge et al. 2007) group. BIO: A patient with a serious Neisseria meningitides infection was assessed with a routine complement assay, which revealed the absence of alternative pathway activation of the complement system. The activity of factor D was tested, and was revealed to CFD Factor D deficiency (Biesma et al. 2001) be completely deficient. Sequencing analysis revealed a homozygous nonsense mutation in the affected individual. BIO: A child with chronic hypocomplementemic renal disease was assessed with a routine complement assay, revealing decreased C3 and factor B, and a complete absence of factor H. Sequence analysis of genomic DNA revealed 2 compound CFH Factor H deficiency (Ault et al. 1997) heterozygous mutations in the CFH gene. LIN: A limited linkage analysis was undertaken in 4 families with atypical haemolytic uremic syndrome, and identified a 26 cM Atypical hemolytic (Warwicker et al. region on chromosome 1q32. This region contained CFH, and sequencing of this gene revealed a missense mutation in one of uremic syndrome 1998) these families. PAN: The authors identified that the AMD susceptibility gene CFH was located in a cluster of functionally related genes, arranged in tandem on chromosome 1q23. LIN: 173 individuals were genotyped for 30 SNPs spanning the CFH region, to identify haplotype information across the genes in the region. On one haplotype, which was associated with a lower risk of CFHR1 CFHR1 deficiency (Hughes et al. 2006) macular degeneration, an 84 kb deletion was detected that encompassed CFHR1 and CFHR3. PAN: The authors identified that the AMD susceptibility gene CFH was located in a cluster of functionally related genes, arranged in tandem on chromosome 1q23. LIN: 173 individuals were genotyped for 30 SNPs spanning the CFH region, to identify haplotype information across the genes in the region. On one haplotype, which was associated with a lower risk of CFHR3 CFHR3 deficiency (Hughes et al. 2006) macular degeneration, an 84 kb deletion was detected that encompassed CFHR1 and CFHR3.

Appendix 218 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) PAN: Maga et al. designed a mutation sequencing screen for all genes implicated with aHUS, especially those related to CFH. SCR: 144 patients were screened for mutations in each of the genes in the CFH related pathway. Mutations were detected in (Gale et al. 2010; each of these genes, including 3 novel CFHR5 mutations in 4 patients. LIN: In a separate study, Gale et al. performed a CFHR5 CFHR5 nephropathy Maga et al. 2010) genome-wide linkage screen in 2 families with C3 glomerulonephritis. This led to the identification of a mutation in CFHR5. BIO: Two pedigrees were identified with recurrent pyogenic infections, and a complement assay revealed no detectable factor I or factor B, and low C3. Southern blot analysis showed no evidence of a gross rearrangement of gene structure, but sequencing CFI Factor I deficiency (Vyse et al. 1996) analysis revealed a homozygous missense mutation in one family, and compound heterozygous mutations in the second. PAN: A group of patients with atypical haemolytic uremic syndrome were identified that did not have mutations in complement factor H. Considering the rold of factor H in the regulation of the alternative complement pathway, the authors speculated that Atypical hemolytic (Fremeaux-Bacchi et other complement regulators could be involved, specifically factor I. SCR: 25 patients were screened, and in 2 cases nonsense uremic syndrome al. 2004) mutations in the CFI gene were identified. BIO: Properdin deficiency was identified as an inherited disorder causing increased susceptibility to meningococcal disease in (Fredrikson et al. 1990. Circulating properdin was not detectable in the 4 affected patients studied by Westberg et al. Sequencing analysis of the 1996; Westberg et al. properdin gene revealed point mutations that were the basis of both properdin deficiency type I and properdin deficiency type II. CFP Properdin deficiency 1995) A subsequent study by Fredrikson et al. identified a missense mutation in an individual with properdin deficiency type III. PAN: The authors described a novel form of hereditary angioedema with similar symptoms to type I and type II, but with normal C1 inhibitor concentration and activity. The authors hypothesised that inappropriate activation of the kinin-forming cascade could Hereditary (Dewald and Bork be the basis of this disease, and factor XII is a major constituent of this pathway. SCR: 20 unrelated female patients were F12 angioedema, type III 2006) screened for mutations in the F12 gene, and 2 missense mutations were identified in 6 of those screened. PAN: The authors recognised that there was compelling evidence for complement deficiency to be associated with susceptibility to infections and autoimmunity. The lectin pathway, which is one of the pathways that activates the complement system, consists (Munthe-Fog et al. of four recognition molecules, including ficolin-3 (encoded by FCN3). SCR: 1282 patients with various immunodeficiencies were FCN3 Ficolin-3 deficiency 2009) screened for mutations in FCN3, and a single patient was detected as homozygous for a frameshifting mutation. BIO: A patient with recurrent inflammatory disease was examined with a full complement analysis, and showed severe hypocomplementemia. Analyses showed the functional activity of the mannan-binding lectin-MASP complex was severely (Stengaard-Pedersen deficient, and that these complexes contained no MASP-2 – confirmed on Western blot. Sequencing revealed a missense MASP2 MASP2 deficiency et al. 2003) mutation in this patient. BIO: A defect in opsonisation had been shown to cause immunodeficiency in some individuals. Mannose binding protein (encoded by MBL2) acts on this pathway, and was demonstrated to have low serum concentration in affected individuals. MBL2 MBP deficiency (Sumiya et al. 1991) Sequence analysis of 16 patients in 3 families identified a missense mutation in all affected individuals. Paroxysmal CSA: Paroxysmal nocturnal haemoglobinuria is caused by the absence of glycosyl phosphatidylinositol-anchored surface nocturnal proteins, due to a defect in synthesis of this anchor molecule. PAN: The precise defect in this synthesis pathway was pinpointed PIGA haemoglobinuria (Bessler et al. 1994) to PIGA, and mutation analysis of four patient cell lines revealed a common mutation.

Appendix 219 Gene/Mutation Gene PID Syndrome Identification Methods of gene identification study(s) BIO: A large kindred was described that showed an inherited reduction of complement C4, compatible with hyposynthesis. In C1 inhibitor addition, diminished serum C1r binding and relative resistance to trypsin cleavage suggested an unusual C1 inhibitor defect. SERPING1 deficiency (Zahedi et al. 1995) Sequencing revealed heterozygous missence mutations in all affected individuals in the kindred. PAN: Mutations had been discovered in a number of genes that accounted for roughly 50% of aHUS. THBD encodes Atypical HUS thrombomodulin, which was a candidate due to its role in regulating coagulation, innate immunity, and complement activation. (Haemolytic Uremic SCR: 152 consecutive patients with aHUS were screened for mutations in all known genes, as well as THBD. Six sequence THBD Syndrome) (Delvaeye et al. 2009) variants were discovered.

I: Non-defined disorders X-linked LIN: A single family has been described with agammaglobulinemia and isolated growth hormone deficiency. Previous work had hypogammaglobulin demonstrated no linkage between this disease and the BTK gene locus. Linkage with new family members defined 2 intervals on emia with growth the X chromosome, encompassing 32 Mb, and containing 102 known and predicted genes. Sequencing revealed a novel ELF4 hormone deficiency (Stewart et al. 2008) missense mutation in the ELF4 gene. NGS: Dickinson et al. used an exome sequencing approach with 4 unrelated patients with dendritic cell, monocyte, B and natural MonoMAC killer lymphoid deficiency syndrome. This identified 4 novel mutations in the GATA2 gene. PAN: In a separate study, Hsu et al. syndrome; GATA2 (Dickinson et al. 2011; noted that individuals with the syndrome did not have mutations in known genes of the IFN-γ/IL-12 pathway. SCR: GATA2 was GATA2 deficiency Hsu et al. 2011) considered a candidate, and 20 patients with the syndrome were identified, revealing 12 mutations in GATA2. BIO : Assays of whole blood in 3 affected individuals showed that production of IL12 in response to Bacille Calmette-Guérin vaccine was completely absent. PAN : IRF8 is one of the genes encoding transcription factors that are essential to the Dendritic cell (Hambleton et al. development of nuclear phagocytes in mice. ANI : The combination of immunodeficiency, dendritic cell deficiency, and IRF8 immunodeficiency 2011) myeloproliferation in these patients was similar to the phenotype of IRF8 null mice.

Appendix 220 Appendix Table 9.2: The significance thresholds for each of the chromosomes for the shared haplotype model.

H n Modified Algorithm: p = ( H x /2 ) x ( M – n ) H=Average marker homozygosity M=Total number of markers n=Run of contiguous homozygous SNPs p=probability of a run of n SNPs

Chromosome Markers Homozygosity Run (p < 0.001) Chr1 4542 73.6% 12 Chr2 5070 73.7% 12 Chr3 3956 72.1% 12 Chr4 4346 72.3% 12 Chr5 4212 73.0% 12 Chr6 3959 70.9% 12 Chr7 3437 72.9% 12 Chr8 3551 70.6% 11 Chr9 2354 71.3% 11 Chr10 2741 73.8% 12 Chr11 2466 74.4% 12 Chr12 2578 72.2% 11 Chr13 2652 72.4% 12 Chr14 1929 72.0% 11 Chr15 1440 72.2% 11 Chr16 1144 72.3% 11 Chr17 985 70.2% 10 Chr18 1726 73.0% 11 Chr19 327 66.7% 9 Chr20 992 67.9% 10 Chr21 880 73.6% 11 Chr22 434 70.8% 10

Appendix 221 Appendix Table 9.3: The significance thresholds for each of the chromosomes for the non-shared haplotype model.

Modified Algorithm: p = ( H )n x ( M – n ) H=Average marker homozygosity M=Total number of markers n=Run of contiguous homozygous SNPs p=probability of a run of n SNPs

BII.2 CII.3 Run Run Chromosome Markers Homozygosity p<0.001 Markers Homozygosity p<0.001 Chr1 4316 74.3% 51 4436 80.8% 72 Chr2 4848 80.3% 66 4967 75.4% 55 Chr3 3754 77.5% 59 3872 73.7% 50 Chr4 4160 80.4% 70 4275 72.7% 48 Chr5 4023 79.0% 64 4125 72.7% 48 Chr6 3749 75.2% 53 3892 72.7% 48 Chr7 3247 76.7% 57 3380 78.2% 61 Chr8 3353 74.4% 51 3474 72.2% 46 Chr9 2217 76.6% 55 2301 72.2% 45 Chr10 2618 87.5% 192 2694 78.8% 109 Chr11 2349 75.9% 54 2416 83.0% 79 Chr12 2441 71.2% 43 2539 79.6% 65 Chr13 2540 74.8% 51 2604 72.5% 46 Chr14 1832 74.6% 50 1903 74.1% 49 Chr15 1373 72.4% 46 1413 72.8% 47 Chr16 1073 82.6% 72 1116 72.4% 43 Chr17 922 71.8% 41 961 73.5% 45 Chr18 1639 75.5% 50 1696 78.6% 59 Chr19 301 71.8% 37 312 70.2% 35 Chr20 947 67.8% 35 972 67.5% 34 Chr21 842 76.5% 50 864 72.7% 42 Chr22 410 75.9% 46 423 71.4% 38

Appendix 222 Appendix Table 9.4: Primer sequences

Primer name Primer sequence (5' to 3') SP110 primers SP110 Exon 1 F CTGATCCCAACTGGCAACAC Sp110 Exon 1 R CATGTCTGAGCTCTGAGAGAG SP110 Exon 2 F CAAAGTGCCGGGATTACAGG SP110 Exon 2 R GCCTTCCAAACTCTGGAAGC SP110 Exon 3 F GTGACCGCTCTACCTTAGAG SP110 Exon 3 R CTCCTGCAGCTGTACCAATGA SP110 Exon 4 F CCCATCCTATTGGAAGGCATG SP110 Exon 4 R GTCAAGATGCTGGGATTGGC SP110 Exon 5 F GTGGGTAAGACCTAGAGTCC SP110 Exon 5 R GTTCCCACCATAGCCTCTTG SP110 Exon 6 F CTCTATGCCATCCTTTCCCAG SP110 Exon 6 R CTGTATCCATTCAGAGGTCGG SP110 Exon 7 F CAAGACAGAGCCAGGGAATTC SP110 Exon 7 R GGTCACATAGTGGTGCTCTTG SP110 Exon 8 F GTACCATCACCTAAGGTCACC SP110 Exon 8 R CACAGCTTGACCTACAAGCC SP110 Exon 9 F GGTCATACCAGGAGTGAAAGC SP110 Exon 9 R GTACCTGCTTCAGGAGAGAC SP110 Exon 10 F GCCTCCAAGACTCAACTTCAG SP110 Exon 10 R GCCTCAGTGTAAGACAGCTC SP110 Exon 11 F CCTACACTAGTGGAGCTTGC SP110 Exon 11 R CTATCTGACCCTGTACTGCTC SP110 Exon 12 F CCACTGGAGGGCTTGAAATAC SP110 Exon 12 R CCATGACGGTGGAGAACAAC SP110 Exon 13 F GGCCACTGTGTACACATAG SP110 Exon 13 R CTTCTGCAGTCTAGCTAGCAG SP110 Exon 14 F CAGAGGAAGTCTCTCTTGACC SP110 Exon 14 R GAATCCTAACGGGAGCTCTTC SP110 Exon 15 F GATATCCACTCTGGCACACAC SP110 Exon 15 R CTAGGAAAGGGCACTTCCAG SP110 Exon 16 F CATGTGGGGATCTTGGACAC SP110 Exon 16 R CCTTTGGTACATTGCCCTGAC SP110 Exon 17 F CCATCCGTGTGCATGTCTAG SP110 Exon 17 R CTTCCTGAGCAAACTGCAGC SP110 Exon 18 F GACCCTGGAAATGAAGGCTTG SP110 Exon 18 R CTTGTTTGAGCTCTCCCCAG SP110 Exon 19 F CAGGAATTCAAGGCTGCAGTG SP110 Exon 19 R GACAGTGGGGAGAATGTGAAC SP110b Exon 15 F CAGTGTGATGTCTGGGTAC SP110b Exon 15 R GGTCTTGCTATGTTGCCTAG

Appendix 223 Primer name Primer sequence (5' to 3') SP110 cDNA primers cSP110 e1.2 for CTCAAAGTCCAGGATGTTCACC cSP110 e4.5 rev GGTCACTGAAGTGCTTCTTCC cSP110 e3.4 for GCTTCAAACGTGTTGGTGCTTC cSP110 e8.9 rev GATGAGGCTGTCCCTCCTG cSP110 e6.7 for GGCTCTATGCCAGAGATAAGAG cSP110 e13.14 rev CACTTCACTGAGGATCCGTG cSP110 e12.13 for TATTCACCGAAGAGGAAAACCC cSP110 e16.17 rev CTCACATTTCAGCTGGTCCTG cSP110 e15.16 for GTGGAAGCCAAGAGGATGCTG cSP110 e3UTR rev CCCATCAGCTGAATCCTGAG SP140 primers SP140 E2F AATCTTCTAACCACCACAAACC SP140 E2R TGTCACCTCCTAACCTACAG SP140 E3F GGTGGAGGACATTTAAGAAGTC SP140 E3R CACTCCCACTGTATGTAAACTC SP140 E4F AATCTTGACTGGGATGTTGG SP140 E4R TAACAGAGGGCTAAGACAGG SP140 E5F GGGACCTTCCAGATTATCAGG SP140 E5R AGCAGAATTATAGGATCCAAGGAC SP140 E6F AGGTCCTTGGAGCAATAGTG SP140 E6R GGTTGCATAGAGATAGGCCA SP140 E7F CCCGAATATTAGAGCTCAGCA SP140 E7R ATGGATGGATGAATGGATGGA SP140 E8F CACTACAATCTCCATCATGCTC SP140 E8R GCAATCCAGTAATCTGATAGAGAC SP140 E9F ATTACAGAGAAGGAGAAAGAGGAG SP140 E9R TATGCGAATGTGAAGAAGGG SP140 E10F CCTACAGAACCCACCTACAG SP140 E10R GAGGAAAGACAATCAGGAAACAC SP140 E11F AGAGGAGATGTAACAAGATGGA SP140 E11R CGAATGTGAAGAAGAGAAGGG SP140 E12F CTTCAGCTTTCCACATCTTCAC SP140 E12R AAAGTCAATCAGGAAACACGAG SP140 E13-14F ACTCTTCTGTGGTCATTGTC SP140 E13-14R GAATAGAATTCTGGACAGACTGG SP140 E15F GCCTTCTGTAGTATACATTGTCC SP140 E15R AGGTCATCCTTCTGTCTACCA SP140 E16F TATAACTCTGTACTCAACCTCCAC SP140 E16R TATAGAACTCTGGCTCTGGG SP140 E17F GGATCCAGAATGAGACCCAG SP140 E17R CTCCAATTGACTAAGCTTGATGAG

Appendix 224 Primer name Primer sequence (5' to 3') SP140 E18F TTCTTCATACCTTAAAGGCTAGGG SP140 E18R CTGAAAGTACAGTGTACCGC SP140 E19F AAATGCCACTTGGAAGAAAGAC SP140 E19R TTGTGATGCCTTCAGATAGGA SP140 E20F AGACTCTCCTGCTATTGATCTG SP140 E20R AGTGAGAGGATAAACCCACTG SP140 E21F AATATTTGGGAGGAGGTTGGA SP140 E21R TCAAATTAGCGACTCTGAAGG SP140 E22F TAGAAACTTAAACCACTGGAGC SP140 E22R CACAGAACATATGCCTGGAG SP140 E23F TTCCTTCATATCCCAGGGAG SP140 E23R GTGGAAGATCCCTTAAAGGAC SP140 E24F AATCTTGCATACTTTGGGAGG SP140 E24R GGCTCCTTTCAGTACATTCC SP140 E25-26F GTTAGAGAAACTTGAGGAAGAAGG SP140 E25-26R AGCTTATTACAGGATGAGGGA SP140 E27-28F ATTCTCAGTTGAAAGGTGTCTC SP140 E27-28R AAGTGAAGGCAAGAAGTGTG TSPAN14 primers TSN14 e1F CGGGAGCTTTCTAGAATCCGC TSN14 e1R GTCTGGCAAATCAAGAGTGTGTG TSN14 e2F CAGTGTGGACTTTGCTCTGTG TSN14 e2R ACTGCACAAGAAATGCTTGTTGTC TSN14 e3F CTGTCAACAAGAGGGCTGAG TSN14 e3R ACCTGCTCTGACCAGGTAAC TSN14 e4F TGCTGAGGATGGTGGTTCTG TSN14 e4R CCACAGAGAAGGCCTGATGC TSN14 e5F CCTGGCATCACTATGAATGATGC TSN14 e5R GACAGAGAAGTATCCTAGAGCAC TSN14 e6F CATGAGCTGTAATGGAATTTGCAC TSN14 e6R CCACTTCAATTTGCACTCGTGC TSN14 e7F CCTGCTCCTTACCAGAGCTC TSN14 e7R ACTGGACCCATGCACTCTATG TSN14 e8F GTGAGGAGAGGCGTGCAG TSN14 e8R AGCAGAAACAGAGAGGTCACG SH2DB4 Primers SH2DB4 e1F AGCAGTCCGTAGTGCAGAGC SH2DB4 e1R CACAGCCTGGCCCTGC SH2DB4 e2F GTTCCATAGAGTGATGTGATGGTTG SH2DB4 e2R AACATGATGGAACTCCATCTCTAC SH2DB4 e3F CACCGAATTCTGATAGACCAAGG SH2DB4 e3R AACCAATGGCCAAGGATTGATCC

Appendix 225 Primer name Primer sequence (5' to 3') SH2DB4 e4F ATCCACTGCAGAATCCCAGAG SH2DB4 e4R GAAATGACGAATGAGTACATCAGC SH2DB4 e5F GCACCAACCAAATACTTCCTGTC SH2DB4 e5R CCCAAACTACACAGCAAATCTGG SH2DB4 e6F CTTAGCATATTCATTCTCTCATGGC SH2DB4 e6R CAGAGAGAGGCAAAGATGTGG SH2DB4 e7F GTTTCTCTGTCTTGAACCACTCTC SH2DB4 e7R CCTTGAGGCATATTAATCTACTTTTTCC SH2D4B e1aF CTGGTGCGTGCATCCCAG SH2D4B e1aR GACTGGTGGCCTACCTCTC NRG3 primers NRG3 e1aF CAGGGAGCGGATTTGCATGC NRG3 e1aR CTAATCCGGTTGGGCGTCC NRG3 e1bF CCACTACCACTTCCACCACG NRG3 e1bR GGAGGGCAGAAGGGAAACTC NRG3 e2F GGCCTCCATACAGAGATCCAG NRG3 e2R CGGATATGACACATACCAGATGC NRG3 e3F CTGTTCTCACATTTATGTAATTGATGGC NRG3 e3R ACAAGACTGAAATATAGCTTTCAGCTG NRG3 e4F GAGGGTTAGTCTTATGAGCACTG NRG3 e4R CATTACTTAGTGAAAACTCGACAAGAG NRG3 e5F GCTTTGAAAGACTCCTACCAGC NRG3 e5R CAGGTTCCCTCTGTGTGGC NRG3 e6F GAAATGAGAGAAGGGTTCTCTTCG NRG3 e6R ATTTACAAGTCTGATCCCAGGCTC NRG3 e7F TGGCATTCCAGTAACTTCTCAATGC NRG3 e7R ACAGTTGTCTCTCCTAAGTCATGC NRG3 e8F AGCTTGAGCAGCCACCTGTG NRG3 e8R CAACTATACATCAAAGTTGGTTCACC NRG3 e9F CGAGTTGATGGAGTGGACTAATG NRG3 e9R GTTAAACAGAGAAGTAAACTGAAGCTC NRG3 e10aF GAATTCAGTGAGATGGTGCATGTG NRG3 e10aR CTGCTATAAGACAATCGCTGACTG NRG3 e10bF CAAATGCCAGGGATTTCTGAAGTC NRG3 e10bR CTTCTAAGTAGATGCTCTTAAATTAATGC NRG3 e1aFb CGAAGGTGAAGACCGGCTC NRG3 e1aRb CGATGAACAGAGGTACCACG NRG3 e1aFc GAGTTACGCTGTAGCGACTGC AIFM2 Primers AIFM2 e2F GATCGAGGCCTCTCTCACTG AIFM2 e2R AGCCCCAGAGCAGAGACAAG AIFM2 e3F GTTCTGAGTCACTCTGGCTTC

Appendix 226 Primer name Primer sequence (5' to 3') AIFM2 e3R TCTCTTGACCCTGGAGGATC AIFM2 e4F AGTAGGATGCAGAGGCCTAG AIFM2 e4R AAGGCTGTCCTTCCATCTGC AIFM2 e5F GTAGGTGTGTTTCATATGTCCCTG AIFM2 e5R TCTGCCCTGAGCAAATTCCTG AIFM2 e6F TGGAGGTGGACGTTCGTGC AIFM2 e6R GCTGGAAGCAGTCACCAAGC AIFM2 e7F GGGTTAGCCTTGGCCTGG AIFM2 e7R CAGAGGGTACTGGAGAGCAAG AIFM2 e8F TGGTGGCCACTTAACACAGC AIFM2 e8R CCCCATGTTTAACCCCAAACTC AIFM2 e9F CACTCTGGGAGGTGCAGC AIFM2 e9R CATGCGCCAAGCAGTCCG PPA1 primers PPA1_1F AAGCCGAAGGAACAGAACCAG PPA1_2F AAGTGGCAGTGAGCCAAGATC PPA1_3F GACTTCAAAGATCTGATACAATGAAC PPA1_4F CCGATTATGGAAACACCTTAGTTC PPA1_5F GATGTGTAGTAGGAGCTACAGC PPA1_6F CCCTATGACCTAGAAGAAAATAGG PPA1_7-8F GTGCATCTTGAAATCTGCTTATTCTC PPA1_9F GCCCAATCTCAGTTTCTTAAATCCG PPA1_10F CATGAGCCACTGCACTGTC PPA1_11F GTAGAGAAATTTTGTATGTATGCCTG PPA1_1R GGCAAGTATGCAATGTGAGG PPA1_2R GCTGTTCTTGAACTTCTGGACTC PPA1_3R CCAATGAGAGTATCTGTGGCTG PPA1_4R CAGACTTGCAACTCAGTCTGTAG PPA1_5R GCAATGCAGAACATGTCCAGTTC PPA1_6R CATAGAAATAATGCTTGTCCAGTGC PPA1_7-8R CAAGCTGGTCTGCTTTGTGTG PPA1_9R CCCTCAGCTTCTCCCTCAG PPA1_10R CACAGGATGGTGACTGTAACATC PPA1_11R CAAGTGACTTCCAAATGACAACTG NPFFR1 primers NPFFR1_1F TGGTTAAGGTTTGGCACACAG NPFFR1_2F TGAAAGTCTGCAAGCAGAGAC NPFFR1_3AF GCGATGATGAAGGTCAGGTG NPFFR1_3BF GCGCGCGTGGTGCACATG NPFFR1_1R AGCCCAGCAATGATATCTGTC NPFFR1_2R CTACCTTCAGGCCTTCCAG NPFFR1_3AR GTCGATGAGCAGCAGCAGC

Appendix 227 Primer name Primer sequence (5' to 3') NPFFR1_3BR CACACCAGGCCGCTATCG LRRC20 primers LRRC20_2F CTCTCGGCCCTGCAAGAG LRRC20_3F GTCTGAAGCCTGGTCCTG LRRC20_4F CATGGAATCAGCCCTGTGC LRRC20_5F GGTGCTCAGAGTCCTCATG LRRC20_2R GGACCCACAGTAAGAAATGTC LRRC20_3R GGAATGATTTCATGGGTGTCGC LRRC20_4R CCTTTGCTCAGGCATCTCAG LRRC20_5R CTGAGTTTGCACAGCAGCTG EIF4EBP2 primers EIF4EBP2_1F GCTGCTGTTGCTCCTGAG EIF4EBP2_2F GTTTACAGGCAGAGAGGTTAGAG EIF4EBP2_3F CAGATTAAGACCAGCCAAAGC EIF4EBP2_1R GTAAAGGGTCCCGAACGCTC EIF4EBP2_2R CAGTGTGCTGAGATTGTGCC EIF4EBP2_3R GCAAGGGCCTTCAATCTAACC KIAA1274 primers KIAA1274_2F CAGGCACTCAGTGAGCATG KIAA1274_3F GTGTTGAGGAAGAAGGGAAGAG KIAA1274_4F CATGAACTGCAGGCAACTTGAG KIAA1274_5F GAGGTAGCATTTGGACTGAGC KIAA1274_6-7F GCTCAGCCAGGACACTCAG KIAA1274_8F CAGGTGGAGCTGATCAGG KIAA1274_9-10F CCTGTAGTCTGGTGTCCCC KIAA1274_11-12F CTGCCTGAGGAGTCTGTCC KIAA1274_13-14F CTTGGGCCAGGTCCTGAC KIAA1274_15F TCAGGGATGGGACTGGAAGC KIAA1274_16-17F CACGCACATGGTCTCATGCAC KIAA1274_18F CTGTCCTCCCTCAGTCTGAG KIAA1274_19F CAGCTCTGAGGCTGGATCAC KIAA1274_20F GGCCTTAGTGGCACCCTC KIAA1274_2R CAAGCGTTAAGTGCTGTATGCC KIAA1274_3R CTGGGGCACCAGGAATCAAC KIAA1274_4R CAACCAGACCAACAGCAGTG KIAA1274_5R ATAGGAAGTCCTTCCTCTGGC KIAA1274_6-7R CCTCCATGGGGACGACTC KIAA1274_8R CTCCCAGCAAGTCTCGTGG KIAA1274_9-10R GCTGCTGCGTCTCCCATG KIAA1274_11-12R GTACACAGCCATGCCCACTTC KIAA1274_13-14R CAGATTCTCCATCTGTCTGCG KIAA1274_15R CACACGTACACACACACAAAGC

Appendix 228 Primer name Primer sequence (5' to 3') KIAA1274_16-17R GACCGGCAAGCAGGAGTC KIAA1274_18R CACTTCCACTTCCAGAAGGTG KIAA1274_19R GTCAGATTAGACAAACTCTTGGCC KIAA1274_20R GAGAAGAGGACAGAGAGATCC C10ORF27 primers C10ORF27_3F GGGTGATACAGCATGCAAATGC C10ORF27_4F CAGATTTCAGAGCTCCTCAGG C10ORF27_5F GTTCTTGTCTCACCTCTGCC C10ORF27_6F CCCATGGTGTGAATCCAGATC C10ORF27_7F CCCTGGCAACGCTGTGATG C10ORF27_8F CACAGACCCTTGTGGGAACAC C10ORF27_9F GACCTGAGGGCAGAAGGTG C10ORF27_10F CACAGTTGTCTGGGTCTGG C10ORF27_11F CATTCGCTCCATTCCTCTCAG C10ORF27_3R GCTAACTTGAGCCTGAGGAC C10ORF27_4R GGCTGGGTTCTTTGGCAGC C10ORF27_5R GACCTCACTGACCTAAGAGC C10ORF27_6R CACTGTGACCTTTCCCCTG C10ORF27_7R GTCATAGCCCCTGCTGCTG C10ORF27_8R GTTAGTTTGGGGCTCCAAAGTG C10ORF27_9R GTAGCACTAGAAGGTCCCTG C10ORF27_10R TCTGAATTCTTCCTCACTGATCC C10ORF27_11R GGGCTTTCCCATGGGAGTG PCBD1 primers PCBD1_1F CGGTGATGGTCTCACGAGG PCBD1_2F CAGGGTGCCACCCTTGAG PCBD1_3F GACTTTCTTCCTACTGCAAGGAC PCBD1_4F CTGGCCAGCTGCTATTCTGG PCBD1_1R ACAGAGAGCCGGGCAGAG PCBD1_2R GATGATACTTTCTGAGTTAGACAGG PCBD1_3R GATTCTAGGCATGTGCAATCTCAG PCBD1_4R GTATCACAGCTTCCTGGGAAATG SGPL1 primers SGPL1_2F GGGAAACCTAGTTGCAGCAGG SGPL1_3F AGCCTTGAGGGCTGTAGATG SGPL1_4F CTGCTTTACTGTGTGTGTTATGTG SGPL1_5F GTACATGCCAGAAAGTAGCTGATC SGPL1_6F GATTTGCTATAAGAATGCTGTTGGG SGPL1_7F CATGTCTGTCTCCTCTGCTATG SGPL1_8F CCTGAGCCAAAATTAGGCTTAGC SGPL1_9F GAATGATTTCCTAAATAGGAGGGAAG SGPL1_10F CTCTCAGACTATTCTCCAAATGGAC

Appendix 229 Primer name Primer sequence (5' to 3') SGPL1_11F GCCCATCTTTCCACCCATGTC SGPL1_12F GGGAAACATAACAGAGAAACTGAG SGPL1_13F CCACTGATCCAGTGTAGCCC SGPL1_14F CCAGCCCATGCCTGACAC SGPL1_15F GAATGATGGGATGCCTTAGGTG SGPL1_2R GAGCCGAGATCATGCCACTG SGPL1_3R GCACTCCAGCCTAGCAACAG SGPL1_4R CCATCCAAGCTGTGACCACC SGPL1_5R CACTGTCTCTGAGATTTGCTTGC SGPL1_6R CATCTGACAGGACTACCTTCC SGPL1_7R GTTCTTTAAGCCATCCTAGCAACTC SGPL1_8R TAGTATATACTATGCATGATCTGGG SGPL1_9R GACTGAAGCTGCAGTCAATCAC SGPL1_10R CCCCACAGCAGAGACTAGC SGPL1_11R CAATTTGAGATAAAGGTAACAGGTTC SGPL1_12R CTAAGCCCTAAGCTGCTGC SGPL1_13R GTATCTAATAATTCCAGGTGGCAAG SGPL1_14R GAGACTTCAGCAACCCTAAGG SGPL1_15R CTAGGGTAACATTTATAACAAGGGC UNC5B primers UNC5B_1F GCAACTTCGGAGGCACAGC UNC5B_2F CAGGAGTGCCAGACTTGACC UNC5B_3F CAGGTGAGTGGCCATGAAGC UNC5B_4F GCTTAGGATCCCAGAGTCAGG UNC5B_5F GGTGCTCTTAACCCCAGAGC UNC5B_6F CCAGTTCTGAGTCCCTACAC UNC5B_7-8F TGTATGCATGCATGTGTGTTGGC UNC5B_9F GATAGAGAGGTTCAAGGCTAGC UNC5B_10F ATTTGGGTGGGATTTTGCAGTGG UNC5B_11F CCTAGACAAGCCAGCACTGG UNC5B_12-13F CTTTGCCGAGCTCTTCACTGC UNC5B_14F GTCATCTATTCATCTTCTCACACC UNC5B_15F CTGAGCCTCCATTTCTATGAGG UNC5B_16F GAAGGGTGGCCATGCAGG UNC5B_17F GGGACACCAAAGCTCACAGC UNC5B_1R CATCGATGCGACGAAAGACC UNC5B_2R ACCATGGCTGTGTGAAGTCTC UNC5B_3R ATCCATGTGCTGGGATGTCTC UNC5B_4R CCGTGGGGTTATGCCTGTG UNC5B_5R CCAGGAATGCCCAACTTGG UNC5B_6R AGAGATCAGAGCATCTAGTCAGC UNC5B_7-8R GAAAAGCCAGCCAAAGAGAACC

Appendix 230 Primer name Primer sequence (5' to 3') UNC5B_9R CCTTCTCGGTAGTTCTCTAATCC UNC5B_10R GTGAGATGGGATTAGGGCAGC UNC5B_11R CTTGTAGCCAGCTTGTCAACC UNC5B_12-13R GCAGGGATCATGCAGCTGG UNC5B_14R GCATGTGGCTGCCCATTGC UNC5B_15R GTGTGCAGCTGGAATATCTGG UNC5B_16R CCAATCCTGAGTTGCTGATTTGC UNC5B_17R GCCTCCAGAGGCTTCAGC SLC29A3 primers SLC29A3_1F CATGGGCAGTGCGTTTAAGAC SLC29A3_2F CTCCAACCAGGCTTTGGTGAC SLC29A3_3F CGGTCTTAGGCTGGAGATGG SLC29A3_4F CAGAGTGAACAGTCCTAACTGC SLC29A3_5F AATGCTGGAAATGCTTGGCTGC SLC29A3_6.1F GACTCAGATCCCAAGCAACC SLC29A3_6.2F CGTCCACCTGAAGACTGTGG SLC29A3_1R GGAAGAGAAGATAGAGACCCAG SLC29A3_2R AAACAGTAAGTGATCTAAAGGCTGG SLC29A3_3R CAGCGATGTCACAGTATGTGG SLC29A3_4R GTAGTAGAAATGACCGTTGTTGTTC SLC29A3_5R ACGTCCACCAGCCAAGCC SLC29A3_6.1R GAGGTAGCCGTTGCTGAGC SLC29A3_6.2R GCACTGGCTTTGTAATAACTCTAGG

Appendix 231 Appendix Table 9.5: PID gene expression in VODI Genes Aff/Nor T-test Expression Differential

SP110 0.22 4.54E-05 SLC46A1 0.38 6.04E-02 TLR3 0.45 5.36E-02 C1R 0.45 2.67E-01 TNFRSF13C 0.53 8.11E-03 ICOS 0.62 5.80E-01 HAX1 0.65 5.12E-02 F12 0.67 4.22E-02 NOD2 0.67 1.02E-01 TMC8 0.69 1.35E-01 RFXAP 0.71 1.19E-03 NCF4 0.75 1.61E-01 NCF2 0.76 5.77E-01 LRRC8A 0.77 2.54E-02 TAP1 0.78 6.92E-03 CD81 0.78 7.87E-02 IFNGR2 0.79 4.72E-02 LPIN2 0.80 1.55E-01 TCN2 0.81 5.13E-01 RECQL4 0.81 2.45E-01 PIGA 0.82 7.82E-02 TNFRSF13B 0.82 2.92E-01 IRF8 0.83 2.93E-01 NHEJ1 0.84 3.58E-01 RAC2 0.85 2.08E-01 AK2 0.85 1.24E-01 SBDS 0.86 4.19E-01 LIG1 0.86 1.97E-01 STAT1 0.86 4.93E-01

BIRC4 0.86 1.69E-01

Appendix 232 IKZF1 0.86 6.41E-01 CTSC 0.87 3.52E-01 CFI 0.87 2.17E-01 NCF1 0.87 6.30E-01 SLC37A4 0.87 3.24E-01 MVK 0.88 4.49E-01 TAZ 0.88 2.51E-01 TRAF3 0.88 2.50E-01 ACTB 0.89 3.90E-01 WAS 0.89 3.23E-01 BLNK 0.89 5.54E-01 TMC6 0.90 6.32E-01 CYBA 0.91 3.33E-01 IL12RB1 0.91 5.06E-01 ELF4 0.91 5.36E-01 FAS 0.92 5.32E-01 PTPRC 0.92 7.13E-01 RNASEH2A 0.93 6.56E-01 SERPING1 0.93 5.85E-01 G6PC3 0.93 5.15E-01 CD40 0.93 5.59E-01 APOL1 0.94 6.58E-01 CYBB 0.95 8.76E-01 CEBPE 0.95 6.91E-01 LCK 0.95 8.69E-01 MRE11A 0.95 6.91E-01 FCN3 0.95 9.31E-01 CD247 0.95 9.62E-01 UNG 0.97 7.53E-01 UNC13D 0.97 7.56E-01 NFKBIA 0.97 7.76E-01 CD79A 0.97 8.47E-01 ITGB2 0.97 8.88E-01 STXBP2 0.98 8.27E-01

Appendix 233 CD46 0.99 9.07E-01 TNFRSF11A 0.99 9.85E-01 FPR1 1.00 9.74E-01 IL10RA 1.00 9.94E-01 TCIRG1 1.01 9.66E-01 TAPBP 1.01 9.50E-01 UNC93B1 1.01 9.72E-01 SPINK5 1.02 8.89E-01 BLM 1.02 9.04E-01 PRKDC 1.03 7.21E-01 NRAS 1.03 8.87E-01 PIK3CD 1.03 7.11E-01 FERMT3 1.04 7.01E-01 CORO1A 1.05 8.24E-01 TYK2 1.05 6.13E-01 CSF2RA 1.06 8.35E-01 SAMHD1 1.06 8.90E-01 PSTPIP1 1.06 6.60E-01 RFXANK 1.06 6.00E-01 C1S 1.06 9.68E-01 MYO5A 1.06 7.41E-01 TAP2 1.06 8.23E-01 RNASEH2B 1.07 8.26E-01 IKBKG 1.08 4.52E-01 SLC35C1 1.08 3.95E-01 ORAI1 1.08 5.30E-01 FOXP3 1.09 3.45E-01 MAPBPIP 1.09 5.50E-01 BTK 1.09 5.66E-01 AP3B1 1.10 4.33E-01 CD19 1.10 6.77E-01 STX11 1.10 3.37E-01 LIG4 1.10 4.99E-01 FCGR3A 1.13 1.70E-01

Appendix 234 RFX5 1.13 2.58E-01 DKC1 1.14 8.74E-02 SMARCAL1 1.16 1.60E-01 FADD 1.16 4.05E-01 IL10RB 1.16 2.66E-01 IFNGR1 1.17 4.57E-01 DCLRE1C 1.18 7.41E-01 STAT3 1.18 1.35E-01 ZBTB24 1.19 2.63E-02 STIM1 1.20 9.85E-02 MYD88 1.23 4.01E-01 CXCR4 1.23 5.66E-01 TREX1 1.24 5.03E-01 CD59 1.26 2.79E-01 NLRP3 1.26 2.11E-01 IRAK4 1.28 1.36E-01 AICDA 1.29 5.14E-01 STAT5B 1.29 1.45E-01 C5 1.32 1.14E-01 G6PD 1.32 5.00E-02 IL2RG 1.33 1.68E-01 CD79B 1.36 1.43E-01 CARD9 1.40 2.08E-01 PRF1 1.42 2.23E-01 GFI1 1.42 1.98E-01 JAK3 1.44 4.47E-02 SH2D1A 1.49 2.51E-01 CASP10 1.50 1.30E-01 TNFRSF1A 1.51 9.04E-02 RNF168 1.54 1.45E-01 ADA 1.64 6.59E-03 CHD7 1.65 6.22E-02 CD55 1.69 1.03E-02 DOCK8 1.90 7.88E-02

Appendix 235 RASGRP2 1.92 3.78E-02 PMS2 2.00 3.27E-01 CIITA 2.20 3.37E-03 LYST 2.25 2.12E-01 GATA2 2.86 3.79E-01 RAB27A 2.89 1.28E-02 CFD 3.35 1.82E-01 CFP 3.85 9.49E-04 C4BPA 3.86 1.36E-01 CFHR1 4.41 1.17E-01 CASP8 6.01 3.07E-01 C4BPB 7.82 1.87E-02 IL2RA 8.63 7.01E-02 ZAP70 10.79 4.42E-02

Appendix 236 Human Molecular Genetics, 2009, Vol. 18, No. 12 2257–2265 doi:10.1093/hmg/ddp161 Advance Access published on March 31, 2009 SLC29A3 gene is mutated in pigmented hypertrichosis with insulin-dependent diabetes mellitus syndrome and interacts with the insulin signaling pathway

Simon T. Cliffe1,2,{, Jamie M. Kramer3,{, Khalid Hussain4,{, Joris H. Robben5, Eiko K. de Jong3, Arjan P. de Brouwer3, Esther Nibbeling3, Erik-Jan Kamsteeg3, Melanie Wong6, Julie Prendiville7, Chela James4, Raja Padidela4, Charlie Becknell8, Hans van Bokhoven3, Peter M.T. Deen5, Raoul C.M. Hennekam9, Robert Lindeman1,2, Annette Schenck3, Tony Roscioli1,3 and Michael F. Buckley1,3,

1Department of Haematology and Genetics, South Eastern Area Laboratory Services, Sydney, NSW 2031, Australia, 2 Centre for Vascular Research, School of Medical Sciences, University of New South Wales, Sydney, NSW 2052, Downloaded from Australia, 3Department of Human Genetics, Radboud University Nijmegen Medical Centre, 6525 GA Nijmegen, The Netherlands, 4Department of Gastroenterology, Endocrinology, Metabolism and Adolescent Medicine, Institute of 5

Child Health, UCL, London WC1N 1EH, UK, Department of Physiology, Nijmegen Centre for Molecular Life Sciences, hmg.oxfordjournals.org Radboud University Nijmegen Medical Centre, 6525 GA Nijmegen, The Netherlands, 6Division of Immunology and Allergy, Children’s Hospital, Westmead, NSW 2145, Australia, 7Division of Pediatric Dermatology, British Columbia’s Children’s Hospital, Vancouver, BC, Canada V6H 3V4, 8Dermatology Associates of Kentucky, Lexington, KY 40509, 9 USA and Clinical and Molecular Genetics Unit, Institute of Child Health, UCL, London WC1N 1EH, UK at Biomedical Library Serials on July 13, 2011

Received January 26, 2009; Revised and Accepted March 26, 2009

Pigmented hypertrichotic dermatosis with insulin-dependent diabetes (PHID) syndrome is a recently described autosomal recessive disorder associated with predominantly antibody negative, insulin- dependent diabetes mellitus. In order to identify the genetic basis of PHID and study its relationship with glucose metabolism, we performed homozygosity mapping in ﬁve unrelated families followed by candidate gene sequencing. Five loss-of-function mutations were identiﬁed in the SLC29A3 gene which encodes a member of a highly conserved protein family that transports nucleosides, nucleobases and nucleoside analogue drugs, hENT3. We show that PHID is allelic with a related syndrome without diabetes mellitus, H syndrome. The interaction of SLC29A3 with insulin signaling pathways was then studied using an established model in Drosophila melanogaster. Ubiquitous knockdown of the Drosophila ortholog of hENT3, dENT1 is lethal under stringent conditions; whereas milder knockdown induced scutellar bristle phenotypes similar to those previously reported in the knockdown of the Drosophila ortholog of the Islet gene. A cellular growth assay showed a reduction of cell size/number which could be rescued or enhanced by manipulation of the Drosophila insulin receptor and its downstream signaling effectors, dPI3K and dAkt. In summary, inactivating mutations in SLC29A3 cause a syndromic form of insulin-dependent diabetes in humans and in Drosophila profoundly affect cell size/number through interactions with the insulin signaling pathway. These data suggest that further investigation of the role of SLC29A3 in glucose metabolism is a priority for diabetes research.

To whom correspondence should be addressed. Tel: þ31 243610712; Fax: þ31 243616658; Email: [email protected] †The authors wish it to be known that, in their opinion, the ﬁrst three authors should be regarded as joint First Authors.

INTRODUCTION and Akt (dAkt) (7). In contrast, negative regulation of the pathway has been shown to reduce growth (7). Although Mendelian inheritance of insulin-dependent diabetes We provide the first evidence that mutations in the human is rare, the characterization of gene mutations in families with SLC29A3 gene cause a Mendelian disorder associated with disorders such as transient neonatal diabetes and insulin-dependent diabetes mellitus and pigmented hypertri- maturity-onset diabetes of the young has contributed signifi- chotic skin lesions and show that it is allelic with H syndrome. cantly to our understanding of the genetic architecture of Furthermore, we show that the Drosophila ortholog of this glucose metabolism (1,2). We have recently described an auto- gene interacts with components of the insulin signaling somal recessive disorder characterized by the childhood onset pathway through the use of a developmental assay that is of pigmented hypertrichotic skin lesions associated with an indicative of alterations in cell growth or proliferation. 83% frequency of predominantly autoantibody negative insulin-dependent diabetes mellitus (PHID syndrome) (3,4). Overlapping dermatological features have been reported in a RESULTS childhood onset variant of polyneuropathy, organomegaly, endocrinopathy, M protein and skin changes (POEMS syn- Gene and mutation identification drome), and in a syndrome of hyperpigmentation, hypertricho- Analysis of the single nucleotide polymorphism (SNP) micro- sis, hepatosplenomegaly, heart anomalies, hearing loss, array genotypes from six patients with PHID identified a hypogonadism, low height and hyperglycemia (H syndrome) single common 1.4 Mb region of shared homozygosity (5,6). It is of interest that diabetes mellitus (DM) is observed within cytogenetic band 10q22.1, between SNPs rs10509321 at a very high frequency in the PHID cohort (five of six and rs1900515 (Fig. 1A). Inspection of the Ensembl and cases) compared with its absence among 15 cases of H syn- UCSC Genome Browsers demonstrated that the region Downloaded from drome. Children with PHID typically develop autoantibody- included 14 known and predicted genes: ADAMTS14, negative DM in late childhood or early puberty, presenting C10orf27, CDH23, EIF4EBP2, LRRC2, KIAA1274, NODAL, with diabetic ketoacidosis requiring on-going insulin NPFFR1, PCBD1, PPA1, PRF1, SLC29A3, SGPL1, UNC5B. therapy. Circulating insulin was not detectable and could not Positional candidate genes were selected for sequencing in hmg.oxfordjournals.org be induced in response to glucose administration, consistent order to identify pathogenic mutations (Fig. 1B). Five different with a defect of insulin production or secretion rather than homozygous mutations were identified in the SLC29A3 gene insulin resistance. Two affected siblings in one family also encoding the equilibrative nucleoside transporter 3 (Fig. 1C, developed severe exocrine pancreas insufficiency (4). In con- Table 1). Human ENT3 has been shown recently to be the at Biomedical Library Serials on July 13, 2011 trast, the phenotype of H syndrome includes severe clinodac- cause of H syndrome, an autosomal recessive disorder with tyly and deafness, which are absent in PHID (Supplementary overlapping skin features to PHID (6), indicating that these Material, Tables). The two disorders share in common the der- are allelic disorders. hENT3 belongs to a structurally unique matological features of patches and plaques of hyperpigmen- protein family of nucleoside and/or nucleobase transporters ted and hypertrichotic skin, the histological features of (13,14). The five homozygous mutations identified segregated polyclonal perivascular lymphohistiocytic infiltration with with the disease within each family and were not present in numerous plasma cells in the dermis and subcutis. over 100 Lebanese and Pakistani control chromosomes. Given the potential significance of the identification of a Two novel homozygous mutations predicted to cause pre- novel interactor with the insulin pathway, we determined the mature protein truncation were identified, a 1 bp deletion genetic basis of PHID syndrome and sought to identify c.940delT and a nonsense mutation c.1330G.T. The deletion whether the identified gene interacted with the insulin signaling causes a frame shift mutation p.Y314Tfs in transmembrane pathway through the use of an animal model. Drosophila domain 7 and is predicted to result in the substitution of trans- melanogaster was the chosen model owing to the availability membrane domains 8–11 with an irrelevant protein sequence of extensive genetic resources for stably altering the expression of 91 amino acids derived from an alternate reading frame. of genes of interest, and that components of the insulin signal- The nonsense mutation p.E444X is predicted to lead to prema- ing pathway are highly conserved and well-studied in flies (7). ture protein truncation with loss of part of the final cyto- Drosophila contains seven insulin-like peptides (dILPs), some plasmic domain and transmembrane domain 11 of hENT3. It of which are released into circulation in response to nutrients would appear unlikely that the either residual protein would (8,9). Studies of downstream insulin signaling components be capable of nucleoside transport function. have shown that this pathway is important in the regulation of Three homozygous missense mutations of SLC29A3 were nutrient metabolism and in the developmental response of identified to involve conserved amino acids (Table 1). The flies to fluctuations in nutrient availability (10–12). At the cel- first missense mutation involves Methionine116 in transmem- lular level, Drosophila insulin signaling components are brane domain 2, which is a hydrophobic amino acid in species important in the regulation of cellular growth and proliferation, as distantly related as humans and nematodes, with a large a function of insulin that is also conserved in humans, and basic amino acid, Arginine (p.M116R; Fig. 1C and E). The which is the basis for the developmental assay performed in Grantham score for this substitution is 91, which is classified this study. All of the dILPS have been shown to positively as a moderate change (15). Analysis using the SIFT prediction regulate growth during fly development (8,9), as have fly software also classifies this as a likely deleterious change (16). homologues of downstream insulin signaling components The introduction of a large basic amino acid into a transmem- including the Drosophila insulin receptor (dInR), the insulin brane domain would likely result in significant disruption of receptor substrate (chico), phosphoinositide-3-kinase (dPI3K) the hydrophobic nature of the domain and result in retention Human Molecular Genetics, 2009, Vol. 18, No. 12 2259 Downloaded from hmg.oxfordjournals.org at Biomedical Library Serials on July 13, 2011

Figure 1. Homozygosity mapping and mutation results in five PHID families. (A) Homozygosity mapping of chromosome 10. Red bars indicate heterozygous single nucleotide polymorphisms (SNPs); blue bars, an extended run of homozygous SNPs greater than would be predicted by chance; green bars, a run of homozygous SNPs but insufficient to meet criteria for significance. (B) Genes within the 1.4 Mb interval bounded by heterozygous SNPs rs10509321 (CII.3) and rs1900515 (DII.1). (C) SLC29A3 sequence electrophoretograms demonstrating homozygous mutations in five PHID families. (D) Protein structure prediction of hENT3 by SVMTM software. (E) Multispecies alignment of the second transmembrane and the C-terminal cytoplasmic domains of ENT3 protein (accession numbers: Homo sapiens, NP_060814.4; Canis lupus, XP_546152.2; Bos taurus, XP_580640.3; Mus musculus, NP_076085.1; monodelphus domesticus, XP_001344438.1; Gallus gallus, XP_421594.2; Gasterosteus aculeatus, ENSGACP00000006741; Takifugu rubipens, ENSTRUP00000028258; Drosophila mel- angaster, FBpp0077753; Caenorhabditis elegans, NP_501807.3). of the transporter protein within the endoplasmic reticulum, as The third missense change occurs at hENT3 amino acid has been demonstrated for other membrane proteins (17). residue 449, which is also located in the final putative intra- The second missense change is a recently reported Glycine cellular domain between transmembrane domains 10 and 11, to Arginine substitution at hENT3 amino acid 437 (p.G437R and involves the substitution of a Threonine by an Arginine Fig. 1C), which is located in the putative cytoplasmic (p.T449R). The amino acids encoded at this position in domain between transmembrane domains 10 and 11. This is hENT3 orthologs are small polar/uncharged or small hydro- the only mutation in the PHID cohort that is shared with the phobic residues (Fig. 1E). Substitution by arginine is associ- known mutations in H syndrome. Of particular interest is the ated with a Grantham score of 71 and is predicted by SIFT observation that this is the sole individual in the PHID as not to be tolerated. cohort who has not developed insulin-dependent DM. The p.G437R change involves the substitution of a large basic amino acid at a position where 41 members of the ENT RNA and protein studies in human cells family as distantly related as humans and Arabidopsis thaliana The cellular consequences of an hENT3 missense mutation encode a small hydrophobic amino acid (Fig. 1E) (18). The were studied in representative patient fibroblasts who had a Grantham difference for this change is 125 and is classified p.T449R mutation. Immunoblot analysis with antibodies to as a moderately radical change. different N-terminal peptides of human and mouse ENT3 2260 Human Molecular Genetics, 2009, Vol. 18, No. 12

Table 1. Mutation summary

Mutation NM_018344.4 Protein CCDS7310.1 Protein domain Predicted Mutation predictions Grantham SIFT c.347T.G p.Met116Arg Transmembrane Domain 2 Missense Hydrophobic to large basic 91 0.03 c.940delT p.Tyr314ThrfsX91 Transmembrane Domain 7 Frameshift – – c.1309G.A p.Gly437Arg Intra-cytoplasmic Domain Missense Small hydrophobic to large basic 125 12.0 c.1330G.T p.Glu444X Intra-cytoplasmic Domain Nonsense – – c.1346C.G p.Thr449Arg Intra-cytoplasmic Domain Missense Small polar to large basic 71 0.03 Downloaded from hmg.oxfordjournals.org

Figure 2. Analysis of a representative missense mutation in patient fibroblasts. (A) Immunoblot and (B) immunocytochemistry of hENT3 in fibroblasts from a at Biomedical Library Serials on July 13, 2011 patient with the T449R mutation and a control, demonstrating decreased intracellular expression of mutant hENT3 and accumulation of mutant hENT3 into LAMP-2-positive structures (arrows). hENT3 immunoblot signals were quantified after equalization for loaded protein using control b-actin levels. Control samples were set to 100% and relative expression levels for the patient expressed as a percentage of control levels. revealed a 52 kDa and a 58 kDa hENT3 band in patient and Drosophila studies control fibroblasts (Fig. 2A) likely representing the non- glycosylated and N-glycosylated forms of hENT3, respect- To determine whether SLC29A3 has a role in the insulin signal- ively. The level of hENT3-T449R protein in fibroblasts was ing pathway, we studied the effects of altering the expression of found to be significantly lower than that of hENT3 in the the Drosophila ortholog of SLC29A3 during fly development. control (30.1 + 17.5%, p ¼ 0.02). In order to address The ENT protein family is conserved in flies and consists of whether this decrease was due to altered stability of the three members with the Drosophila ortholog of hENT3 being hENT3 mRNA, real-time quantitative PCR of fibroblast dENT1 as determined by the reciprocal BLAST best hit mRNA was performed. hENT3 mRNA levels were reduced approach (see Supplementary Material, Table S3 and Fig. 1). to 34% (p ¼ 0.0006) of the average expression level in fibro- The two proteins show 29% amino acid identity and 53% blasts from eight unrelated healthy control individuals. The homology in an aligned region that includes the lysosomal reduced hENT3 protein level was also reflected in the targeting sequence and all 11 transmembrane regions (residues immunocytochemistry of control and patient cells (Fig. 2B). 26 to C-terminus). The expression of dENT1 was knocked The residual hENT3 protein showed an altered intracellular down by RNA-interference (RNAi) using the conditional distribution. In control cells, the hENT3 transmembrane UAS-GAL4 system in combination with different promoter protein localizes to intracellular membrane compartments, as (Gal4) lines (19,20). The efficiency of the UAS-Gal4 system previously described (14) (Fig. 2B). In contrast, the patient is temperature-dependent with greater induction of the dENT1 cells showed bright hENT3 foci that co-localized with RNAi achieved at 288Cthanat258C(21). LAMP-2 (lysosomal-associated membrane protein 2), a Ubiquitous knockdown of dENT1 using a strong marker of late endosomal/lysosomal compartments. The Act5C-Gal4 (25FO1) promoter at 288C resulted in 100% leth- accumulation of hENT3-T449R in LAMP-2-positive orga- ality during pupal and pharate adult stages (Fig. 3A). Quanti- nelles despite the overall reduction in protein levels suggests tative RT–PCR on knockdown larvae raised under these that there may also be a defect of cellular trafficking. Taken conditions revealed that dENT1 mRNA levels were reduced together a combination of decreased protein levels, accumu- by half compared with wild-type (wt) (Fig. 3B). When induc- lation of mutant hENT3 in late endosomal/lysosomal compart- tion of the dENT1 RNAi was reduced by raising the flies at ments and the likely impaired functionality of the mutant 258C, diminished viability was still apparent prior to adult- protein may underlie this disorder. hood (25.2% lethality, p ¼ 0.03). Further lethality occurred Human Molecular Genetics, 2009, Vol. 18, No. 12 2261 Downloaded from hmg.oxfordjournals.org at Biomedical Library Serials on July 13, 2011

Figure 3. Analysis of dENT1 knockdown and associated phenotypes. (A) UAS-dENT1RNAi/þ; Act5C(25FO1)-Gal4/þ (Act5C::dENT1RNAi) flies raised at 288C die at pupal (left) or pharate adult (right) stages. (B) Quantitative polymerase chain reaction (PCR) analysis shows that dENT1 RNAi-induced flies (middle bar) experience 50.5% reduction in dENT1 mRNA when compared with controls flies (left bar), while non-induced dENT1 RNAi flies (genotype UAS-dENT1RNAi/þ; CyO-GFP/þ) experience only a slight reduction (right bar). (C) Quantitative PCR analysis shows that dENT1 overexpression-induced flies (genotype UAS- ENT1/Act5C(25FO1)-Gal4) show a 10 fold increase in dENT1 mRNA (middle bar) when compared with controls (left bar), while dENT1 overexpression non-induced flies (genotype UAS-dENT1/CyO-GFP) show a reduction in dENT1 mRNA (right bar), likely because of the insertion of the EP2066 P-element into the 50 region of the gene. (D) Approximately half of Act5C::dENT1RNAi flies (left bar) raised a 258C die either before eclosion or within 3 days after eclosion and this phenotype could be rescued by overexpression of the dENT1 gene in the knockdown background (right bar, genotype UAS-dENT1RNAi/þ; Act5C(25FO1)-Gal4/UAS-ENT1). (E) Scutellar (Sc) bristle phenotypes at 258C with the ubiquitous driver Act5C(25FO1)-Gal4 in the absence/presence of UAS-dENT1RNAi. Arrows show abnormally short bristles (middle) and extra bristles (right). (F) MS1096-Gal4, UAS-dENT1RNAi flies show an up-curled wing phenotype (middle) when compared to MS1096-Gal4 controls (left). The severity of this phenotype can be increased by co-expression of a dominant-negative form of dPI3K to produce a strongly up-curled wing phenotype (right). after eclosion with 29% lethality observed within the first 3 Mild dENT1 knockdown flies that reached adulthood exhib- days, compared with 0% lethality of non-knockdown siblings ited abnormal sensory bristle development. Two sensory (Fig. 3D). bristle phenotypes were observed: abnormally short, thick To demonstrate that lethality was due specifically to the bristles as well as ectopic bristles (Fig. 3E). Despite the ubi- partial loss of dENT1, viability was rescued by dENT1 quitous knockdown, these phenotypes manifested exclusively re-expression with the same promoter, in the dENT1 RNAi on the scutellum, a posterior extension of the fly thorax that background. The Drosophila EP-line w1118;PfEPgEP2066 carries four sensory bristles in a highly stereotypical pattern, carries a transposon with an integrated UAS element that is and are similar to those previously reported with mutations inserted in the 50-UTR of the dENT1 gene. Larvae carrying of the Drosophila ortholog of the Islet gene (22). At least both the Act5C-Gal4 (25FO1) promoter in combination with one of the two abnormal bristle phenotypes was present in the EP2066 (UAS-dENT1) insertion show a 10-fold increase 58% of dENT1 knockdown flies (typically affecting the morin dENT1 mRNA levels (Fig. 3C). The presence of the over- phology of one or two bristles or generating one or two ectopic expression allele in the Act-Gal4-induced dENT1-RNAi back- bristles per scutellum, Fig. 3E), whereas variation of the ground rescued viability defects caused by dENT1 knockdown normal scutellar bristle pattern occurred in only 4% of (Fig. 3D). These data demonstrate that even partial loss of Act5C-Gal4 control siblings. Control flies that inherited the dENT1 has a deleterious effect on Drosophila development UAS-dENT1RNAi without the Gal4 promoter showed an and survival, with the percentage lethality being proportional increased, but low incidence of bristle phenotypes (18%) to the induction of dENT1 knockdown. suggesting that the RNAi transgene is active to a minor 2262 Human Molecular Genetics, 2009, Vol. 18, No. 12

Table 2. Genetic interaction between dENT1 and insulin signaling components in the ﬂy wing

Description Genetic elements Strongly Up-curled Wild-type Down-curled Strongly up-curled down-curled

Controls dENT1 knockdown ENT1RNAi 93.5 6.5 dInR overexpression UAS-InR 95.5 4.5 dPI3K overexpression UAS-PI3K 94.5 5.5 dAkt overexpression UAS-Akt 46.8 53.2 Overexpression of PI3K dominant negative UAS-PI3KDN 27.6 61.8 10.5 Genetic interactions Combination of dInR overexpression and dENT1 ENT RNAiþUAS-InR 82.5 17.5 knockdown Combination of dPI3K overexpression and dENT1 ENT RNAiþUAS-PI3K 13.5 59.5 27.0 knockdown Combination of dAKT overexpression and dENT1 ENT RNAiþUAS-Akt 92.3 7.7 knockdown Combinations of a dPI3K dominant negative allele and ENT RNAiþUAS-PI3KDN 100 dENT1 knockdown extent even in the absence of Gal4, in agreement with a mild DISCUSSION reduction in mRNA level detected in the quantitative RT– Downloaded from PCR experiments (Fig. 3B). The bristle phenotype could We have identified mutations in the equilibrative nucleoside also be rescued by UAS-dENT1 re-expression with an transporter 3 protein that are associated with an inherited syn- observed reduction from 58% to 32%. drome of insulin-dependent DM, and provide prima facie evi- dENT1 knockdown was then targeted to the wings, tissues dence that the Drosophila ortholog of this protein interacts hmg.oxfordjournals.org not essential for viability, to enable further study of inter- with the insulin signaling pathway. This is the first evidence actions with the insulin signaling pathway. The wing disk is that mutations in the human SLC29A3 gene can be associated an ectodermal-derived pouch consisting of dorsal and ventral with a diabetic phenotype. hENT3 is a 475-amino acid protein that transports hydro- epithelial sheaths, which give rise to the two surfaces of the at Biomedical Library Serials on July 13, 2011 adult wing blade (23). This system has been used to investi- philic nucleosides, nucleobases and nucleoside analogue gate insulin signaling component interactions, which are drugs across cell membranes (13,14). Indeed, hENT3 has known to regulate cell growth and proliferation (24). Knock- been demonstrated to bind nucleosides in vitro and transport down of dENT1 in the dorsal wing disc by genetic combi- nucleosides and nucleobases upon ectopic expression in nation of UAS-ENT1RNAi and the MS1096-Gal4 promoter Xenopus oocytes (14). Based on sequence homology, it is a line produced an up-curled wing phenotype in more than member of an ancient superfamily of nucleoside transport pro- 93% of animals (Fig. 3F, Table 2). This wing phenotype teins represented in a wide variety of taxa including mammals, was absent in control siblings that carried either the teleost fish, tunicates, insects, round worms and slime molds UAS-ENT1RNAi construct or the MS1096-Gal4 promoter con- (18,25). In contrast to other members of the ENT gene struct alone (Fig. 3F). The MS1096 promoter expresses Gal4 family which are predominantly expressed as integral in the dorsal sheath of the developing wing imaginal disc, plasma membrane proteins, hENT3 is an integral membrane thus an up-curled wing indicates reductions in cell size or protein mainly localizing to intracellular organelles (26). number in the targeted tissue. However, the subcellular localization of hENT3 has not We then tested whether components of the insulin signaling been definitively assigned with data indicating that hENT3 pathway were able to modify the dENT1 RNAi-induced may localize to acidic late endosomes, lysosomes and mito- up-curled wing phenotype. Ectopic over-expression of dInR, chondria (14,27). It has been proposed that hENT3 functions dPI3K and dAkt in the dorsal wing caused a down-curl of as a pH-dependent transporter of nucleosides across the lyso- the wing in 95.5%, 5.5% and 53.2% of flies, respectively somal membrane (14). The availability of a cytoplasmic pool (Table 2). Expression of dInR, dPI3K and dAkt in the presence of nucleosides is a key requirement for several cellular path- of dENT1 knockdown resulted in rescue of the dENT1 ways, notably for the nucleoside salvage pathway (13) and RNAi-induced up-curled wing phenotype, with 82.5%, in the generation of adenosine and guanosine triphosphates 59.5% and 92.3% of flies showing a wild-type phenotype, for cellular energy metabolism and signal transduction. respectively (Table 2). In contrast, inhibition of insulin signal- Ubiquitous loss of the Drosophila ortholog of SLC29A3 is ing through expression of a dominant negative form of PI3K semi-viable to lethal, depending on the degree of expression resulted in up-curled wings in 27.6% of flies (Table 2). knockdown. The observation that dENT1 knockdown When combined with ENT1 knockdown, 100% of progeny mutants die at multiple stages of development suggests that exhibited a strongly up-curled wing phenotype (Table 2; repre- this protein, rather than being required for a specific develop- sentative image in Fig. 3F). Taken together, these data are mental process, has crucial housekeeping or metabolic func- consistent with dENT1 being a positive promoter of cell size tions. When dENT1 expression was knocked down in the or number that acts synergistically with the insulin signaling dorsal wing disk, an up-curved wing phenotype resulted, indi- pathway. cating a reduction of cell size or proliferation in the dorsum of Human Molecular Genetics, 2009, Vol. 18, No. 12 2263 the wing. The counterpart phenotype of down-bending of the the allelic disorder H syndrome (deafness); however, the wing was also observed upon activation of positive regulators analysis of many additional cases will be required to investi- of insulin signaling in the dorsal wing (28): this has been gate this further. As the clinical management issues for demonstrated to be due to increased proliferation of cells in patients with PHID and H syndromes are significantly differ- that tissue. We show that ectopic expression of the insulin ent, we suggest that these disorders should be considered as receptor, dPI3K and dAKT is able to rescue the up-curved different allelic entities until further information is available. wing phenotype caused by dENT1 knockdown, generating a In summary, we have associated mutations in the SLC29A3 normal-shaped wing. A concordant result was obtained in gene with diabetes mellitus in humans and the insulin signal- which the dENT1 phenotype was exaggerated by over- ing pathway in Drosophila. The mechanistic basis of these expression of a dominant negative form of dPI3K. Taken findings remains to be determined. This is strong evidence together with the clinical findings of predominantly autoanti- supporting the investment of resources to further investigate body negative insulin-dependent DM in the majority of the the role of SLC29A3 and its orthologs in diabetes and patients in this cohort, these data support the hypothesis that glucose metabolism in model systems. SLC29A3 interacts with one or more components of the insulin signaling pathway. Despite human body hair and fly bristles sharing only MATERIALS AND METHODS limited functional features, ectopic bristles induced by loss Subjects of dENT1 expression are a striking phenotype in light of human hypertrichosis associated with PHID. Fly bristles The affected children were identified as a result of the publi- have been predominantly studied to learn about human hair cation of the clinical phenotype of PHID, principally by cell biology in the inner ear (29,30), but they also share direct contact with a senior clinician (J.P.). Consent for Downloaded from some features with body hair follicle cells, including their genetic testing was obtained following local clinical guide- differentiation from epithelial cells involving similar molecu- lines. Five unrelated families of diverse ethnic origins (one lar mechanisms such as Delta/Notch-mediated lateral inhi- North American Caucasian, one Indian, one Pakistani and bition (29,31). A role for dENT1 in the regulation of two Australian Lebanese) of which four were known to be hmg.oxfordjournals.org Drosophila bristle development has also been observed in consanguineous, were studied using SNP microarrays. other studies. In a large-scale Drosophila over-expression Families A–D were analyzed with a 50 K and two affected study, over-expression of dENT1 in proneural clusters siblings in family E with a 10 K SNP array. Regions of excess homozygosity were identified using an algorithm

(where the abovementioned differentiation from epithelial at Biomedical Library Serials on July 13, 2011 cells and lateral inhibition takes place) causes loss of adapted from Woods et al. (33), which calculated the sensory bristles (32), suggesting that dENT1 indeed functions number of contiguous homozygous SNPs required for signifi- as a crucial regulator of bristle development. Why ubiquitous cance in relation to degree of consanguinity for each individ- knockdown of dENT1 induces ectopic bristles only on the scu- ual. Some leeway was permitted for the presence of tellum remains elusive, but resembles scutellum-restricted heterozygous SNPs interrupting long homozygous segments bristle phenotypes caused by inactivation of the Drosophila to allow for signal miscalls and de novo mutations. Identity ortholog of the Lim-Homeodomain transcription factor by descent was defined as regions where this significance Islet-1, an essential regulator of pancreatic morphogenesis in reached a threshold of p , 0.001. humans (22). The human hypertrichosis phenotype also occurs in restricted, rather stereotyped areas, and not over Mutation analysis the entire body. The clinical phenotypes of PHID and H syndrome are dis- PCR and DNA sequencing primers for the genes in the region tinguished by the minimal overlap between mutations in the were designed based on Genbank reference sequences (primer PHID syndrome cohort (five different mutations in five sequences available on request). PCR was performed in 10 ml families) and those in H syndrome and POEMS (three with Invitrogen Platinumw PCR Supermix, 50 ng genomic mutations in 10 families) (see Supplementary Material, DNA, and 1.5 pmol of forward and reverse primers. Thermo- Tables). Phenotypic heterogeneity is an interesting and imper- cycling conditions were initial denaturation at 958C/3 min fol- fectly understood problem in genetics. It is clear that in some lowed by 31 cycles (528C/10 s, 568C/10 s, 608C/20 s, 728C/ instances it may arise owing to mutational class differences 30 s, 958C/30 s), and final extension 728C/7 min. PCR pro- (in-frame versus out-of-frame mutations, whole gene and ducts were cycle-sequenced and analyzed on an ABI 3130xl multi-exon deletions versus point mutations), or to variation Genetic Analyzer (Applied Biosystems, Foster City, CA, in mutation position with respect to functional domains of pro- USA). DNA sequence and mutation analyses were performed teins. In some instances identical mutations can give rise to using Mutation Surveyor v2.51 (SoftGenetics), Alamut v1.31e different clinical phenotypes, such as Pfeiffer or Crouzon syn- (Interactive Biosoftware), NNSPLICE 0.9 (34,35). drome both of which may be associated with mutations of c.1036T.C, c.1037G.A in FGFR2, suggesting that genetic background, functional redundancy and/or environmental Immunoblotting effects also contribute to the observed variation. We speculate Patient and control (wild-type) fibroblasts were cultured in that there may be genotype, genetic background or Dulbecco’s modification of Eagle’s medium supplemented environment-specific risks for the development of the dis- with 10% fetal bovine serum, glutamine, penicillin, streptomy- tinguishing clinical features of PHID (diabetes mellitus) and cin at 378Cin5%CO2. Protein samples were extracted from 2264 Human Molecular Genetics, 2009, Vol. 18, No. 12

104 human fibroblasts and subjected to immunoblotting as (UAS-PI3K), y1w1118;PfUAS-Pi3K92E.A2860Cg3 (UAS- described previously (36). The primary antibodies used were PI3KDN) were obtained from the Bloomington Drosophila a 1:1000 dilution of goat anti-Ent3 peptide antibodies (N18 Stock Centre, Indiana University, IN, USA. Flies were cul- or N20, Santa Cruz Biotechnology, Delaware, CA, USA). tured according to standard procedures and raised either at As secondary antibodies, 1:2000 horseradish peroxidase- 258Cor288C in order to enhance activity of the UAS-Gal4 conjugated rabbit anti-goat antibodies were used (Dako, system, as indicated (21,41). Glostrup, Denmark). For dENT1 knockdown, UAS-ENTRNAi/Y males were mated to heterozygous Act5C-Gal4 25FO1/CyO-GFP virgins yielding progenies of four genotypes, the expected ratios of which pro- Immunocytochemistry vided the basis for the evaluation of lethality. For evaluation Patient and control fibroblasts at 50% confluency were fixed of the bristle phenotype, we compared UAS-ENT1RNAi/þ; with 3% paraformaldehyde and immunocytochemistry per- Act5C-Gal4 25FO1/þ flies to UAS-ENT1RNAi/þ; CyO formed as described previously (37). Primary antibodies GFP/þ and male flies carrying either Act5C-Gal4 25FO1 or were 1:50 diluted goat anti-hEnt3, 1:100 diluted rabbit CyO GFP. For the rescue of dENT1-induced lethality/bristle anti-calnexin (a gift of I. Braakman, Utrecht, The Netherlands) phenotypes, UAS-ENT1RNAi/Y;UAS-ENT1/Sco males were or 1:200 diluted mouse anti-lysosome-associated membrane mated to Act5C-Gal4 25FO1/CyO-GFP females. The female protein 2 (LAMP-2; AbD Serotec, Oxford, UK). Secondary progeny of this cross had four different genotypes, which antibodies were 1:100 diluted goat anti-rabbit and goat anti- were used to establish the percentage lethality in RNAi-induced mouse, both conjugated to Alexa-594, or chicken anti-goat flies (genotype UAS-ENTRNAi;Act5C-Gal4/Sco) versus rescue antibodies conjugated to Alexa-488 (Invitrogen, Paisley, flies (genotype UAS-ENTRNAi; Act5C-Gal4/UAS-ENT1). The

UK). Images were obtained by confocal scanning microscopy bristle phenotypes were quantiﬁed in the latter and compared Downloaded from using an Olympus FluoView1000 microscope (Olympus with quantitative bristle phenotypes in the dENT1 knockdown Europa GMBH, Hamburg, Germany). experiments. For dENT1 insulin pathway interactions, MS1096-Gal4 and UAS-ENT1RNAi were recombined onto the same chromosome hmg.oxfordjournals.org Quantitative polymerase chain reaction to produce ﬂies with an up-curled wing phenotype. Flies Fibroblast total RNA was isolated from blood using the of the genotype w, MS1096 Gal4, UAS-ENT1RNAi/Y were PAXgene Blood RNA kit (QIAGEN, Venlo, The Netherlands) mated to females of the following genotypes (i) y1w1118; 1 1118 1 1118

following the manufacturer’s protocol. For analysis of dENT1 UAS-dInR, (ii) y w ;UAS-dAkt, (iii) y w ;UAS-PI3K, at Biomedical Library Serials on July 13, 2011 knockdown efficiency in Drosophila, RNA was extracted in (iv) y1w1118;UAS-PI3KDN and (v) w1118. Progeny were raised triplicate from third instar larvae of the following genotypes at 288C. Wing phenotypes were assigned to one of five differ- (i) w1118,UAS-ENT1RNAi/yw;Act-Gal4/þ, (ii) w1118/yw;Act- ent classes: strongly down-curled, down-curled, wild-type, Gal4/þ, (iii) w1118;UAS-ENT1/Act-Gal4, (iv) w1118;UAS- up-curled and strongly up-curled. ENT1/þ and (v) w1118,UAS-ENT1RNAi/yw using the RNA For the evaluation of lethality, bristle and wing phenotypes, Lipid Tissue mini kit (QIAGEN). RNA (0.5 mg) was reverse- more than 100 flies were evaluated per cross. transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, Veenendaal, The Netherlands) and purified using Nucleospin Extract II PCR clean-up kit (Macherey-Nagel, Du¨ren, Germany) according to the manufacturer’s protocols. SUPPLEMENTARY MATERIAL SYBR-Green-based qPCR analysis was performed on a 7500 Supplementary Material is available at HMG online. Fast Real-Time PCR System (Applied Biosystems) using Power SYBR Green PCR Master Mix (Applied Biosystems). Primers were developed by the primer3 program (http:// frodo.wi.mit.edu/cgi-bin/primer 3/primer3_www.cgi) and ACKNOWLEDGEMENTS validated as previously described (38). Differences in expression of a gene of interest between two samples were cal- The authors thank the families described for their support. culated by the comparative Ct or 2DDCt method (39,40).

Drosophila studies FUNDING The UAS-Gal4 system (20) and the following fly lines were This work was supported by grants from: Netherlands 1118 RNAi used: The w , UAS-ENT1 line and its genetic back- Organization for Scientific Research [VICI 865.07.002 to 1118 ground control w were obtained from the Vienna A.S., VIDI 016.096.346 to P.M.T.D.]; the Australian National Drosophila Research Centre, Austria (VDRC nos 49328 and Health and Medical Research Council - Biomedical Postdoc- 60000). The dorsal wing promoter-Gal4 line (MS1096-Gal4), toral Fellowship program (to TR); and a European Science 1 the ubiquitous promoter-Gal4 lines y w ;PfAct5C-GAL4g Directorate Marie Curie International Incoming Fellowship þ 25FO1/CyO, y (Act5C-Gal4 25FO1), the UAS-ENT1 line (to MFB). (w1118;PfEPgEP2066) and the insulin signaling stocks w1118;PfUAS-Akt1.Exelg2 (UAS-dAkt), y1w1118;PfUAS- Conflict of Interest statement. The authors wish to declare that InR.delg2 (UAS-dInR), y1w1118;PfUAS-Pi3K92E.Exelg3 they have no conflicts of interest. Human Molecular Genetics, 2009, Vol. 18, No. 12 2265

REFERENCES 22. Biryukova, I. and Heitzler, P. (2005) The Drosophila LIM-homeo domain protein Islet antagonizes pro-neural cell specification in the peripheral 1. Doria, A., Patti, M.E. and Kahn, C.R. (2008) The emerging genetic nervous system. Dev. Biol., 288, 559–570. architecture of type 2 diabetes. Cell Metab., 8, 186–200. 23. Fristrom, D., Wilcox, M. and Fristrom, J. (1993) The distribution of PS 2. Hattersley, A.T. (2006) Beyond the beta cell in diabetes. Nat. Genet., 38, integrins, laminin A and F-actin during key stages in Drosophila wing 12–13. development. Development, 117, 509–523. 3. Prendiville, J., Rogers, M., Kan, A., de Castro, F., Wong, M., Junker, A., 24. Rintelen, F., Stocker, H., Thomas, G. and Hafen, E. (2001) PDK1 Becknell, C. and Schultz, K. (2007) Pigmented hypertrichotic dermatosis regulates growth through Akt and S6K in Drosophila. Proc. Natl Acad. and insulin dependent diabetes, manifestations of a unique genetic Sci. USA, 98, 15020–15025. disorder? Pediatr. Dermatol., 24, 101–107. 25. Machado, J., Abdulla, P., Hanna, W.J., Hilliker, A.J. and Coe, I.R. (2007) 4. Hussain, K., Padidela, R., Kapoor, R.R., James, C., Banerjee, K., Harper, Genomic analysis of nucleoside transporters in Diptera and functional J., Wilson, L.C. and Hennekam, R.C. (2008) Diabetes mellitus, exocrine characterization of DmENT2, a Drosophila equilibrative nucleoside pancreatic deficiency, hypertrichosis, hyperpigmentation, and chronic transporter. Physiol. Genomics, 28, 337–347. inflammation. Confirmation of a syndrome. Pediatr. Diabetes, Epub ahead 26. Rose, J.B. and Coe, I.R. (2008) Physiology of nucleoside transporters, of print October 16. back to the future. Physiology (Bethesda), 23, 41–48. 5. Marina, S. and Broshtilova, V. (2006) POEMS in childhood. Pediatr. 27. Govindarajan, R., Leung, G.P.H., Zhou, M., Tse, C-M., Wang, J. and Dermatol., 23, 145–148. Unadkat, J.D. (2009) Facilitated mitochondrial import of anti viral 6. Molho-Pessach, V., Agha, Z., Aamar, S., Glaser, B., Doviner, V., Hiller, and anticancer nucleoside drugs by human equilibrative nucleoside N., Zangen, D.H., Raas-Rothschild, A., Ben-Neriah, Z., Shweiki, S. et al. transporter-3 (hENT3). Am. J. Physiol. Gastrointest. Liver Physiol., 296, (2008) The H syndrome, a genodermatosis characterized by indurated, G910–22. hyperpigmented, and hypertrichotic skin with systemic manifestations. 28. Montagne, J., Stewart, M.J., Stocker, H., Hafen, E., Kozma, S.C. and J. Am. Acad. Dermatol., 59, 79–85. Thomas, G. (1999) Drosophila S6 kinase, a regulator of cell size. Science, 7. Oldham, S., Bohni, R., Stocker, H., Brogiolo, W. and Hafen, E. (2000) 285, 2126–2129. Genetic control of size in Drosophila. Philos. Trans. R. Soc. Lond. B Biol. 29. Eddison, M., Le Roux, I. and Lewis, J. (2000) Notch signaling in the Sci., 355, 945–952.

development of the inner ear, lessons from Drosophila. Proc. Natl Acad. Downloaded from 8. Brogiolo, W., Stocker, H., Ikeya, T., Rintelen, F., Fernandez, R. and Sci. USA, 97, 11692–11699. Hafen, E. (2001) An evolutionarily conserved function of the Drosophila 30. Adam, J., Myat, A., Le Roux, I., Eddison, M., Henrique, D., insulin receptor and insulin-like peptides in growth control. Curr. Biol., Ish-Horowicz, D. and Lewis, J. (1998) Cell fate choices and the 11, 213–221. expression of Notch, Delta and Serrate homologues in the chick inner ear,

9. Ikeya, T., Galic, M., Belawat, P., Nairz, K. and Hafen, E. (2002) hmg.oxfordjournals.org parallels with Drosophila sense-organ development. Development, 125, Nutrient-dependent expression of insulin-like peptides from 4645–4654. neuroendocrine cells in the CNS contributes to growth regulation in 31. Millar, S.E. (2002) Molecular mechanisms regulating hair follicle Drosophila. Curr. Biol., 12, 1293–1300. 10. Britton, J.S., Lockwood, W.K., Li, L., Cohen, S.M. and Edgar, B.A. development. J. Invest. Dermatol., 118, 216–225. (2002) Drosophila’s insulin/PI3-kinase pathway coordinates cellular 32. Molnar, C., Lopez-Varea, A., Hernandez, R. and de Celis, J.F. (2006) A

metabolism with nutritional conditions. Dev. Cell, 2, 239–249. gain-of-function screen identifying genes required for vein formation in at Biomedical Library Serials on July 13, 2011 11. Kramer, J.M., Davidge, J.T., Lockyer, J.M. and Staveley, B.E. (2003) the Drosophila melanogaster wing. Genetics, 174, 1635–1659. Expression of Drosophila FOXO regulates growth and can phenocopy 33. Woods, C.G., Cox, J., Springell, K., Hampshire, D.J., Mohamed, M.D., starvation. BMC Dev. Biol., 3,5. McKibbin, M., Stern, R., Raymond, F.L., Sandford, R., Malik Sharif, S. 12. Gershman, B., Puig, O., Hang, L., Peitzsch, R.M., Tatar, M. and Garofalo, et al. (2006) Quantification of homozygosity in consanguineous R.S. (2007) High-resolution dynamics of the transcriptional response to individuals with autosomal recessive disease. Am. J. Hum. Genet., 78, nutrition in Drosophila, a key role for dFOXO. Physiol. Genomics, 29, 889–896. 24–34. 34. Hebsgaard, S.M., Korning, P.G., Tolstrup, N., Engelbrecht, J., Rouze, P. 13. Baldwin, S.A., Beal, P.R., Yao, S.Y., King, A.E., Cass, C.E. and Young, and Brunak, S. (1996) Splice site prediction in Arabidopsis thaliana J.D. (2004) The equilibrative nucleoside transporter family, SLC29. pre-mRNA by combining local and global sequence information. Nucleic Pflugers Arch., 447, 735–743. Acids Res., 24, 3439–3452. 14. Baldwin, S.A., Yao, S.Y., Hyde, R.J., Ng, A.M., Foppolo, S., Barnes, K., 35. Brunak, S., Engelbrecht, J. and Knudsen, S. (1991) Prediction of human Ritzel, M.W., Cass, C.E. and Young, J.D. (2005) Functional mRNA donor and acceptor sites from the DNA sequence. J. Mol. Biol., characterization of novel human and mouse equilibrative nucleoside 220, 49–65. transporters (hENT3 and mENT3) located in intracellular membranes. 36. Robben, J.H., Knoers, N.V. and Deen, P.M. (2004) Regulation of the J. Biol. Chem., 280, 15880–15887. vasopressin V2 receptor by vasopressin in polarized renal collecting duct 15. Grantham, R. (1974) Amino acid difference formula to help explain cells. Mol. Biol. Cell., 15, 5693–5699. protein evolution. Science, 185, 862–864. 37. Deen, P.M., Van Balkom, B.W., Savelkoul, P.J., Kamsteeg, E-J., Van 16. Ng, P.C. and Henikoff, S. (2001) Predicting deleterious amino acid Raak, M., Jennings, M.L., Muth, T.R., Rajendran, V. and Caplan, M.J. substitutions. Genome Res. , 11, 863–874. (2002) Aquaporin-2, COOH terminus is necessary but not sufficient for 17. de Mattia, F., Savelkoul, P.J., Bichet, D.G., Kamsteeg, E.J., Konings, I.B., routing to the apical membrane. Am. J. Physiol. Renal Physiol., 282, Marr, N., Arthus, M.F., Lonergan, M., van Os, C.H., van der Sluijs, P. F330–F340. et al. (2004) A novel mechanism in recessive nephrogenic diabetes 38. Mukhopadhyay, A., Nikopoulos, K., Maugeri, A., de Brouwer, A.P., van insipidus, wild-type aquaporin-2 rescues the apical membrane expression Nouhuys, C.E., Boon, C.J., Perveen, R., Zegers, H.A., Wittebol-Post, D., of intracellularly retained AQP2-P262L. Hum. Mol. Genet., 13, 3045–3056. van den Biesen, P.R. et al. (2006) Erosive vitreoretinopathy and 18. Acimovic, Y. and Coe, I.R. (2002) Molecular evolution of the Wagner disease are caused by intronic mutations in CSPG2/Versican equilibrative nucleoside transporter family, identification of novel family that result in an imbalance of splice variants. Invest. Ophthalmol. Vis. Sci., members in prokaryotes and eukaryotes. Mol. Biol. Evol., 19, 2199–2210. 47, 3565–3572. 19. Dietzl, G., Chen, D., Schnorrer, F., Su, K.C., Barinova, Y., Fellner, M., 39. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene Gasser, B., Kinsey, K., Oppel, S., Scheiblauer, S. et al. (2007) A expression data using real-time quantitative PCR and the 2(-Delta Delta genome-wide transgenic RNAi library for conditional gene inactivation in C(T)) method. Methods, 25, 402–408. Drosophila. Nature, 448, 151–156. 40. Pfaffl, M.W., Tichopad, A., Prgomet, C. and Neuvians, T.P. (2004) 20. Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as a Determination of stable housekeeping genes, differentially regulated means of altering cell fates and generating dominant phenotypes. target genes and sample integrity, BestKeeper–Excel-based tool using Development, 118, 401–415. pair-wise correlations. Biotechnol. Lett., 26, 509–515. 21. Brand, A.H. and Perrimon, N. (1994) Raf acts downstream of the EGF 41. Kramer, J.M. and Staveley, B.E. (2003) GAL4 causes developmental receptor to determine dorsoventral polarity during Drosophila oogenesis. defects and apoptosis when expressed in the developing eye of Drosophila Genes Dev., 8, 629–639. melanogaster. Genet. Mol. Res., 2, 43–47. JOP. J Pancreas (Online) 2009 Jul 6; 10(4):457-458.

LETTER

Mutations in the SLC29A3 Gene Are not a Common Cause of Isolated Autoantibody Negative Type 1 Diabetes

Emma L Edghill1, Shihab Hameed2, Charles F Verge2, Oscar Rubio-Cabezas1,3, Jesús Argente3, Zdenek Sumnik4, Petra Dusatkova4, Simon T Cliffe5,6, Raoul CM Hennekam7, Michael F Buckley5,8, Khalid Hussain7, Sian Ellard1, Andrew T Hattersley1

1Institute of Biomedical and Clinical Science, Peninsula Medical School. Exeter, United Kingdom. 2Sydney Children’s Hospital and School of Women’s and Children’s Health, University of New South Wales. Randwick, NSW, Australia. 3Department of Endocrinology, University Pediatric Hospital “Niño Jesús”; Department of Pediatrics, Autonomous University of Madrid and CIBER Physiopathology of Obesity and Nutrition, Institute “Carlos III”. Madrid, Spain. 4Department of Pediatrics, Second Faculty of Medicine, University Hospital Motol. Prague, Czech Republic. 5Laboratory Services, Department of Haematology and Genetics, South Eastern Area. Sydney, NSW, Australia. 6Centre for Vascular Research, School of Medical Sciences, University of New South Wales. Sydney, NSW, Australia. 7Department of Endocrinology, Great Ormond Street Hospital for Children NHS Trust and the Institute of Child Health, University College. London, United Kingdom. 8Department of Human Genetics, Radboud University Nijmegen Medical Centre. GA Nijmegen, The Netherlands

Dear Sir: positive for GAD autoantibodies. It is not known if milder mutations in the SLC29A3 gene can cause Recessive mutations in the SLC29A3 gene have autoantibody negative type 1 diabetes without recently been shown to result in diabetes [1, 2]. In the associated syndromic features. last year eleven families with the H syndrome The SLC29A3 gene encodes ENT3, a member of the (OMIM#612391) and five families with pigmented equilibrative nucleoside transporter family (SLC29), hypertrichosis with insulin dependent diabetes (PHID) which mediates intracellular trafficking of nucleosides have been described, resulting from seven different [6]. In man the SLC29A3 gene is most highly expressed recessive SLC29A3 mutations. The most common in uterus [7]. In vivo studies of the Drosophila feature in all but two cases is pigmented hypertrichosis. melanogatser ortholog of SLC29A3 (ENT1) have Hyperglycaemia is an overlapping feature of the two shown it interacts the insulin signalling pathway, syndromes although it is much rarer in the H syndrome although the molecular basis of the interaction has yet where it is present in 1/15 subjects [1, 3] compared to to be characterised [2]. In addition, it has been detected 5/6 subjects with PHID [2, 4, 5]. The median age of in total human pancreas but it is not known if it is diagnosis for diabetes was 12 years (range: 4-15 years), expressed in the exocrine component or in the islets all patients were insulin treated with only 1/5 testing [7]. In order to determine whether the SLC29A3 gene is Received June 10th, 2009 expressed in endocrine pancreas, we quantified Key words Diabetes Mellitus; Genes; Genetics; Infant, Newborn; SLC29A3 transcripts by real-time PCR in human islet, SLC29A3 protein, human pancreas and uterine RNA, relative to that of the Abbreviations PHID: pigmented hypertrichosis with insulin HNF4A gene, which has documented expression in the dependent diabetes beta cell [8]. B2M was used as an endogenous control. Correspondence Andrew T Hattersley Institute of Biomedical and Clinical Science, Peninsula Medical Probes to SLC29A3 mRNA were targeted to the exon School, Barrack Road, Exeter EX2 5DW, United Kingdom 5-6 junction of the SLC29A3 gene (NM_018344.4) and Phone: +44-1392.6806; Fax: +44-1392.406.767 were validated by standard curve analysis over eight E-mail: [email protected] 1.10 serial dilutions (r2 0.99). The expression levels of Document URL http://www.joplink.net/prev/200907/30.html B2M, HNF4A and SLC29A3 transcripts were calculated

JOP. Journal of the Pancreas - http://www.joplink.net - Vol. 10, No. 4 - July 2009. [ISSN 1590-8577] 457 JOP. J Pancreas (Online) 2009 Jul 6; 10(4):457-458. from average crossing points of triplicate samples, Contratos post Formacion Sanitaria Especializada” using the comparative Ct (ΔΔCt) method [9]. from the “Instituto de Salud Carlos III” (FIS Compared to uterine SLC29A3 mRNA levels there CM06/00013). S.E. is employed within the NIHR were 17% and 2% expression in the pancreas and islets funded Peninsula Clinical Research Facility and A.T.H. respectively (relative to B2M). Moreover SLC29A3 is a Wellcome Trust Research Leave Fellow mRNA makes up only a small proportion of the beta Conflict of interest None to declare cell transcriptome representing 0.4% of transcripts detected for HNF4A. Therefore SLC29A3 is detectable References in both exocrine and endocrine pancreas, although the expression is lower in the latter. 1. Molho-Pessach V, Agha Z, Aamar S, Glaser B, Doviner V, Hiller N, et al. The H syndrome: a genodermatosis characterized by Early-onset diabetes is a feature of both the H indurated, hyperpigmented, and hypertrichotic skin with systemic syndrome and PHID. We hypothesised that mutations manifestations. J Am Acad Dermatol 2008; 59:79-85, [PMID in the SLC29A3 gene could cause isolated diabetes in 18410979] children and screened 47 cases diagnosed at a median 2. Cliffe ST, Kramer JM, Hussain K, Robben JH, de Jong EK, de of 5 years (range: 1-16 years) with autoantibody Brouwer AP, et al. SLC29A3 gene is mutated in pigmented negative type 1 diabetes (antibodies tested at or soon hypertrichosis with insulin-dependent diabetes mellitus syndrome and interacts with the insulin signaling pathway. Hum Mol Genet after diagnosis; glutamic acid decarboxylase and/or 2009; 18:2257-65. [PMID 19336477] islet antigen 2), and without pigmented hypertrichosis. 3. Marina S, Broshtilova V. POEMS in childhood. Pediatr Mutations in the HNF1A, HNF4A, KCNJ11 and INS Dermatol 2006; 23:145-8. [PMID 16650224] genes were excluded by sequence analysis in all subjects. 4. Hussain K, Padidela R, Kapoor RR, James C, Banerjee K, Harper J, et al Diabetes mellitus, exocrine pancreatic deficiency, We amplified the 6 exons of SLC29A3 (primer hypertrichosis, hyperpigmentation, and chronic inflammation: sequences available on request), including the confirmation of a syndrome. Pediatr Diabetes 2009; 10:193-7. exon/intron boundaries and non-coding exon 1. We did [PMID 19175903] not identify any pathogenic SLC29A3 mutations, but 5. Prendiville J, Rogers M, Kan A, de Castro F, Wong M, Junker the common non-synonymous polymorphisms A, et al. Pigmented hypertrichotic dermatosis and insulin dependent rs2277257, rs780668, rs2252996, and rs2487068 were diabetes: manifestations of a unique genetic disorder? Pediatr Dermatol 2007; 24:101-7. [PMID 17461801] present at a minor allele frequency of 71%, 7%, 9% and 6%, respectively. 6. Baldwin SA, Beal PR, Yao SY, King AE, Cass CE, Young JD. The equilibrative nucleoside transporter family, SLC29. Pflugers We have shown that SLC29A3 is expressed in the Arch 2004; 447:735-43, [PMID 12838422] human islet and recessive mutations are likely to result in beta cell failure, however mutations in this gene are 7. Baldwin SA, Yao SY, Hyde RJ, Ng AM, Foppolo S, Barnes K, et al. Functional characterization of novel human and mouse not a common cause of isolated autoantibody negative equilibrative nucleoside transporters (hENT3 and mENT3) located in diabetes diagnosed in children under 17 years. intracellular membranes. J Biol Chem 2005; 280:15880-7. [PMID

15701636] Acknowledgements The authors thank Annet Damhuis 8. Harries LW, Locke JM, Shields B, Hanley NA, Hanley KP, and Jonathan Locke for excellent technical support. Steele A, et al. The diabetic phenotype in HNF4A mutation carriers is moderated by the expression of HNF4A isoforms from the P1 This work was supported in Exeter by the European promoter during fetal development. Diabetes 2008; 57:1745-52. Union (Integrated Project EURODIALSHM-CT-2006- [PMID 18356407] 518153 in the Framework Programme 6 (FP6) of the 9. Applied Biosystems. Relative Quantitation of Gene Expression. European-Community. Z.S. is supported by MHCR User Bulletin #2. ABI PRISM 7700 Sequence Detection System. grant 64203. O.R.C. is supported by an “Ayuda para 2001:11-5.

JOP. Journal of the Pancreas - http://www.joplink.net - Vol. 10, No. 4 - July 2009. [ISSN 1590-8577] 458 European Journal of Medical Genetics 53 (2010) 309e313

Contents lists available at ScienceDirect

European Journal of Medical Genetics

journal homepage: http://www.elsevier.com/locate/ejmg

Short report Expanding the clinical spectrum of SLC29A3 gene defects

Ronen Spiegel a,b,c,*, Simon T. Cliffe d, Michael F. Buckley d,e, Yanick J. Crow f, Jill Urquhart f, Yoseph Horovitz b,c, Yardena Tenenbaum-Rakover c,g, William G. Newman f, Dian Donnai f, Stavit A. Shalev a,c a Genetic Institute, Ha’Emek Medical Center, Afula, Israel b Department of Pediatrics A, Ha’Emek Medical Center, Afula, Israel c Rappaport Faculty of Medicine, Technion e Israel Institute of Technology, Haifa, Israel d Dept of Haematology and Genetics, South Eastern Area Laboratory Services, The Prince of Wales & Sydney Children’s Hospitals, Sydney, Australia e Dept of Human Genetics, Radboud University Nijmegen Medical Centre, The Netherlands f Genetic Medicine, St Mary’s Hospital, Manchester Academic Health Sciences Centre (MAHSC), University of Manchester, UK g Pediatric Endocrine Unit, Ha’Emek Medical Center, Afula, Israel article info abstract

Article history: H syndrome and pigmented hypertrichosis with insulin dependent diabetes (PHID) are allelic autosomal Received 14 December 2009 recessive syndromes reported in the last year to be caused by mutations in the SLC29A3 gene, which Accepted 28 June 2010 encodes the equilibrative nucleoside transporter hENT3. Herein, we report three new patients from Available online 7 July 2010 a single family who present with phenotypes that associate features of both PHID and H syndrome. Genetic analysis of the SLC29A3 gene revealed that two affected sisters are compound heterozygotes for Keywords: the previously reported mutations p.G427S and p.G437R, while their nephew was homozygous for the SLC29A3 gene p.G437R mutation. In addition to this intra-familial genetic heterogeneity, these patients demonstrate Diabetes mellitus Autosomal recessive considerable phenotypic variability. One sister had clinical features consistent with classical PHID ’ Hyperpigmentation phenotype, while her nephew s features were in keeping with the diagnosis of H syndrome. The second Hypertrichosis sister displayed the most severe phenotype which combined diagnostic features from both syndromes. This patient also had features not described previously, including severe seronegative polyarthritis involving large and small joints, and hypogonadotropic hypogonadism. These manifestations may be additional characteristics of the growing clinical spectrum of SLC29A3 defects. This report emphasizes the complex genotype phenotype correlation in SLC29A3 disorders and suggests that other factors are relevant to disease manifestations and severity. Ó 2010 Elsevier Masson SAS. All rights reserved.

1. Introduction plaques with an underlying inflammatory cell infiltrate. H syndrome is characterized by additional features including Mutations in the SLC29A3 gene, also termed hENT3, have hepatosplenomegaly, cardiac anomalies, sensorineural hearing recently been reported to cause two allelic autosomal recessive loss, short stature, scrotal masses, hypergonadotropic hypo- syndromes, H syndrome and pigmented hypertrichosis with gonadism and hyperglycemia [9]. PHID patients typically present insulin dependent diabetes (PHID) [4,10]. The pathognomonic with antibody negative insulin-dependent diabetes mellitus hallmark of both syndromes is the presence of distinctive hyper- during childhood and have not been reported to have hearing loss pigmented, hypertrichotic indurated cutaneous patches and [7,13]. A clinical entity previously described as POEMS (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, skin disorders) in childhood shares features included in Abbreviations: IDDM, Insulin dependent diabetes mellitus; PHID, pigmented both H syndrome and PHID and may represent SLC29A3 defects hypertrichosis with insulin dependent diabetes; POEMS, polyneuropathy, organo- not confirmed genetically [8]. Both phenotypes are characterized megaly, endocrinopathy, monoclonal gammopathy, skin disorders; GAD, glutamic by elevated acute phase reactants, suggesting an abnormal regu- acid decarboxylase; ESR, erythrocyte sedimentation rate; CRP, C reactive protein. lation and/or activation of the immune system. * Corresponding author. Department of Pediatrics A and Genetic Institute, Ha’E- mek Medical Center, Afula, Israel. Tel.: þ972 4 6494216; fax: þ972 4 6494425. Herein, we describe three additional patients from a single E-mail addresses: [email protected], [email protected] (R. Spiegel). family who harbor SLC29A3 pathogenic mutations. Our report

1769-7212/$ e see front matter Ó 2010 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.ejmg.2010.06.012 310 R. Spiegel et al. / European Journal of Medical Genetics 53 (2010) 309e313 demonstrates an intra-familial allelic heterogeneity as well as Table 1 phenotypic variability that shed more light on the complex geno- Summary of clinical findings. type phenotype relations in SLC29A3 defects. Patient II-1 Patient II-2 Patient III-1 Sex Female Female Male 2. Clinical reports Age (years) 23y 28y 5y Height (centile) 142 cm (4SD) 157 cm (20) 105 cm (7) Skin changes Classical & Classical & Mild & localized The family is of Moslem Arab origin residing in a village in extended extended Northern Israel. The three affected individuals include two sisters Hearing loss Severe No Moderate-severe and their nephew. Their ages ranged between 5 and 28 years. The IDDM Yes Yes No family pedigree is illustrated in Fig. 1. The clinical data of the Proptosis Moderate No Moderate patients are summarized in Table 1. Arthropathy Yes No No Camptodactyly Severe Mild No Delayed puberty Yes No Not relevant 2.1. Patient II-1 ESR (mm/h) 80e120 70e120 64 CRP mg/dL 60e120 70e150 76 Polyclonal severe moderate mild The patient is a 23-year-old female. Her pregnancy and delivery gammopathy were unremarkable. Her psychomotor development was normal. ¼ ¼ ¼ She was first admitted at the age of two years for the investigation of SD standard deviation, ESR erythrocyte sedimentation rate, CRP C reactive protein. microcytic anemia. Her hemoglobin level on admission was 6.7 g/dL, iron level was 23 mg/dL (normal range 60e120 mg/dL). Bone marrow aspiration was consistent with iron deficiency and hemoglobin electrophoresis revealed sickle cell trait. At the age of four At the age of nine years she was admitted with new onset IDDM. years she was referred for the evaluation of hepatosplenomegaly and Insulin antibodies were elevated while glutamic acid decarboxylase dysmorphic features including bilateral exophthalmus, hyper- (GAD) and islet cell antibodies were absent. Her diabetes was telorism, flat and broad nasal bridge, upturned nares, prominent poorly controlled despite high daily insulin doses. An attempt to maxillary bone and gingival hypertrophy (Fig. 2B). In addition, she use an insulin pump failed due to the thickening of the skin. A year had relatively short and broad fingers, and camptodactyly (Fig. 2D). later she developed bilateral sensorineural hearing loss and At this time she was noted to harbor well demarcated, extended required the use of hearing aids. Echocardiogram demonstrated areas of thick and hyperpigmented skin with overlying hyper- moderate pericardial effusion without hemodynamic decompen- trichosis that involved mainly the lower abdomen, the genital area, sation, which resolved spontaneously over several months. arms, and legs with a remarkable sparing of the knees (Fig. 2A). At the age of 13 years, she presented with joint pain and expe- Abdominal ultrasound showed enlarged liver and spleen with rienced limited joint mobility resulting in an inability to walk normal homogenous texture and normal portal blood flow. Labora- independently more than several hundred meters. Additionally, tory investigation revealed 46,XX karyotype and skeletal survey was she suffered from progressive generalized morning stiffness. On unremarkable except for generalized osteopenia of the metacarpal examination she had marked loss of bilateral hip and shoulder fl and metatarsal bones. Metabolic screen was normal including motion together with exion deformities of the proximal inter- urinary mucopolysaccharide and oligosaccharide electrophoresis phalangeal phalanges (PIPs) and metacarpo-phalangeal (MCPs) and biochemical assays of lysosomal enzymes. Biopsy obtained from joints, in the absence of obvious effusion. Her ankles were warm e affected thigh skin showed intact epidermis with nonspecific and swollen with partial loss of tibia talar and subtalar motion. inflammatory changes of the dermis, characterized by lymphocytic Other joints were normal. An MRI scan of the hands showed fi and histiocytic infiltration of the deep dermis and intensive septal camptodactyly and subcutaneous edema of the ngers and palms. fl fibrosis of the subcutaneous fat. These findings were classed as septal She showed no improvement on non-steroidal anti-in ammatory panniculitis. Needle liver biopsy revealed microvesicular steatosis drugs and was treated with intra-articular steroid injections to the fl but a repeated biopsy three years later was unremarkable. in amed joints and subsequent oral methotrexate. Although initially she experienced some improvement in the range of motion of her ankles and hands with this regimen, there has been no reduction in the thickness of the skin and long term effects have not been successful, eventually leading to cessation of these medications. In addition to her poorly controlled diabetes mellitus, endocrinopathy also manifested, with short stature and hypogonadotropic hypogonadism. At 23 years her height is 141 cm (4SD below median height). Serum insulin growth factor 1 (IGF-1) at the age of 14 years was markedly reduced to 42 mg/dL (normal range 120e480 mg/dL) and stimulation studies of growth hormone (GH) with either arginine or clonidine were not responsive consistent with GH deficiency. She also displayed delayed puberty and gonadotropin releasing hormone (GnRH) stimulation test was performed which showed blunted increase of serum LH and FSH consistent with hypogonadotropic hypogonadism. Thyroid and adrenal function were normal. Cranial MRI scan was normal with normal signal and size of the pituitary gland. Over time her skin lesions progressed with further hyperpigmentation and thickening of the skin and involvement of previously unaffected body parts. In several areas the previous Fig. 1. Pedigree of the family. hypertrichosis was replaced by normal hirsute skin (Fig. 2C,E). R. Spiegel et al. / European Journal of Medical Genetics 53 (2010) 309e313 311

clinic for evaluation of hyperpigmented sclerodermoid-like skin patches with overlying hypertrichosis extending to the lower abdomen, genital region, anterior and inner aspects of both thighs and the upper arms. These lesions, which were non painful, had a progressive course over several years. Interestingly, in several areas the hypertrichosis was replaced by normal hirsute skin (Fig. 2G). On examination she showed ﬂat facies, gingival hypertrophy and mild brachydactyly. In contrast with her sister she had no organomegaly, no hearing impairment, and her joints were unaffected. In addition, she underwent normal puberty and her adult height was 157 cm (20th centile [target height 165 cm, 50th centile]). Laboratory studies showed persistently raised ESR and CRP of 70e100 mm/h and 70e150 mg/dL respectively. Immunologic studies showed mild polyclonal gammopathy and autoantibody panels were all negative.

2.3. Patient III-1

This 5-year-old child is the nephew of patients, II-1 and II-2. He ﬁrst presented at the age of 2.5 years for the evaluation of speech delay that was found to result from severe sensorineural hearing loss that required the installation of hearing aids. His height at the age of 5 years was 105 cm (7th centile). The rest of his physical examination revealed bilateral proptosis with mild facial coars- ening. The dorsum of his both feet was thickened up to the ankle level with mild hyperpigmentation but without hypertrichosis (Fig. 2F). Abdominal sonography showed a normally sized homogenous liver but mild splenomegaly with a normal homogenous texture. Laboratory tests showed normal serum glucose levels, increased ESR and CRP (64 mm/h and 76 mg/dL respectively). Serum IgG and IgA were both mildly elevated.

3. Methods

Prior to the identification of SLC29A3 as the cause of H syndrome [10], autozygosity mapping of affected individuals was undertaken using the Affymetrix 250k SNP array, as described previously [12]. Fig. 2. Characteristic dermatologic and clinical features. Patient II-1 at the age of 10 The coding region of the SLC29A3 gene (NM_001814.4) was years with extended areas of hyperpigmented, thickened, hypertrichotic skin distrib- screened for mutations by DNA sequencing, as previously uted over the legs, abdomen and arms with prominent sparing of the knees (A). Typical described [4]. facial features of this patient showing upturned nares, prominent maxillae and gingival hypertrophy (B). Patient II-1 at the age of 20 years showing the evolution of the cutaneous changes (CeE), and the typical hand changes with marked shortening of 4. Results palms and metacarpals, and associated camptodactyly (D). Feet of patient III-1 indicating thickened and mildly hyperpigmented skin up to the ankle level without Autozygosity mapping failed to define a region of homozygosity hypertrichosis (F). Typical demarcated hyperpigmented skin lesions overlying the legs and groins of patient II-2 (G). in the two affected siblings (II-1 and II-2) at chromosome 10q22 which contains SLC29A3. However, a 2 Mb region of homozygosity was present in their nephew at the 10q locus. Sequence analysis of fi Laboratory investigation revealed consistent and marked SLC29A3 identi ed two heterozygous point mutations in exon 6. fi > elevation of acute phase reactants including erythrocyte sedimen- The rst mutation is a nucleotide transition c.1279G A resulting in tation rate (ESR), ranging between 80 and 120 mm/h, (normal the missense amino acid substitution p.Gly427Ser. The second > values < 25 mm/h), C reactive protein (CRP), ranging between 65 mutation is the nucleotide transition c.1309G A causing the and 120 mg/dL (normal values < 5 mg/dL), non specific polyclonal missense amino acid substitution p.Gly437Arg. Patients II-1 and hypergammaglobulinemia with IgG levels of 2.5e2.8 g/dL (normal II-2 were compound heterozygotes for these mutations whereas range 0.7e1.8 g/dL) and hypoalbuminemia of 2.4 g/dL (normal patient III-1 was homozygous for the p.G437R mutation (Fig. 1). range 3.2e4.0 g/dL). Antibody screens for autoimmune diseases were negative. 5. Discussion

2.2. Patient II-2 H syndrome and PHID syndrome have been described as two autosomal recessive disorders, recently reported to be caused by This 28-year-old female, is the older sister of patient II-1. She mutations in the SLC29A3 gene encoding an equilibrative nucleo- ﬁrst presented with IDDM at the age of 12 years. Since then her side transporter hENT3 expressed in mitochondria [4,10]. The glucose levels were well controlled, with subcutaneous insulin cutaneous hallmark of both syndromes are progressive hyperpig- injections. Two years later she was referred to the dermatological mented, hypertrichotic, sclerodermatous skin lesions. 312 R. Spiegel et al. / European Journal of Medical Genetics 53 (2010) 309e313

PHID patients typically develop antibody negative IDDM within Palestinian Arab population in Israel many autosomal recessive the first or second decade of life [7,13]. In contrast, in the initial diseases are present at a high frequency within a limited region or report of H syndrome diabetes was not included among the diag- even in a single village [16] and it was for presumed distant relat- nostic criteria [9]. Nevertheless, later descriptions included either edness in the siblings’ parents that we undertook autozygosity hyperglycemia or overt diabetes in the clinical phenotype of H mapping. Therefore the geographic distribution of these two syndrome [3,10]. Moreover, H syndrome has been characterized by SLC29A3 mutations indicate that they originated from ancient multi system manifestations, including sensorineural hearing loss, founder ancestors [15] and may be more common among the cardiac abnormalities, hepatosplenomegaly, endocrinopathy (short general Arab population living in Israel and in the Palestinian stature, hypogonadism), genital abnormalities (scrotal masses, territories. Haplotype analysis of affected patients from the two micropenis, gynecomastia), exophthalmus and fixed flexion regions will be necessary to determine if these two recurrent contractures of the hands and feet resulting in various deformities SLC29A3 mutations represent ancient founder mutations or muta- such as hallux valgus and camptodactyly [8e11]. tion hotspots. Based on the above clinical descriptions, patient II-2 fits well Our report further emphasizes the previously reported clinical with the diagnostic categorization of PHID whereas patient III-1 variability even in patients who share the same pathogenic SLC29A3 complies with the H syndrome phenotype. Patient II-1 presented mutation(s) [3,10]. The suggested correlation of specific mutations with the most severe phenotype, and has features consistent with with discrete phenotype (either H syndrome or PHID) is likely to be the clinical diagnosis of both syndromes. Considering this striking more complex than previously thought [4]. There does not appear intra-familial variability with the previously reported clinical to be a simple relationship between the severity of tissue overlap, it now appears that PHID is not a distinct condition but involvement and the levels of SLC29A3 expression. Mitochondrial a milder form of SLC29A3 associated defects. Similar intra-familial disorders classically demonstrate greater variability in organ variability was recently reported by Broshtilova et al. They described involvement and disease severity than do autosomal recessive two siblings, the younger showed the full range manifestations of H disorders. The SLC29A3 gene encodes a pH-dependant equilibrative syndrome, whereas his older brother presented with only diabetes nucleoside transporter protein (hENT3) that is widely expressed mellitus. Both brothers were homozygous for the same mutation and is believed to play a role in nucleotide salvage. The hENT3 [3]. Hence, in addition to our report it now seems that intra-familial protein has been recently shown to be an integral membrane variability is a common finding in SLC29A3 disorders. protein of mitochondria [6], where it joins hENT1 as one the two Our report serves to further expand the clinical spectrum of these known nucleoside/nucleobase transporters of mitochondria. Given disorders with features not described previously. Hypergonadotropic hENT3’s role in nucleotide salvage and its expression in mito- hypogonadism was evident in several affected males with micro- chondria it is not an unexpected finding that multiple tissues are penis, variable degree of small testes, adult azoospermia and involved in disorders of this protein and therefore explain some of hormone studies demonstrating elevated gonadotropins with low the observed variation in these patients. There is at this time no serum testosterone [8,9].Inaddition,oneaffectedfemaleaged50 data to explain why some symptoms appear explicable on the basis years lacked secondary sexual signs but her hormonal profile was not of loss of SLC29A3 function (e.g. the sensorineural deafness, alter- reported [10]. In the current report, patient II-1 displayed delayed ations in insulin signaling) whereas the immunological findings puberty with low basal gonadotropins and unresponsive GnRh appear to relate to cellular proliferation and dysregulation of the stimulation study consistent with hypogonadotropic hypogonadism. immune response, although paradoxical autoimmunity is not Hypergonadotropic hypogonadism is the result of target organ failure uncommon in inherited immune disorders such as common vari- (male/female genitalia) as opposed to hypogonadotropic hypo- able immunodeficiency [1]. We speculate that other factors, either gonadism which is caused by either pituitary or hypothalamic failure genetic (for example modifier genes, tissue to tissue variation in [14]. High levels of SLC29A3 expression have been demonstrated in mitochondrial density and function), or environmental variation the gonads and in the uterus which explain the resulting hypo- play significant role in determining the inter-individual variation in gonadism when mutated ([2], supplementary on line materials). We tissue involvement and disease severity. More data from a larger speculate that the two different pathogenic mechanisms of hypo- cohort of patients should be accumulated to better understand gonadism in SLC29A3 defects are explained by hENT3 pleiotropy. genotype and phenotype in SLC29A3 associated disorders and their Non specific arthralgia was reported in five of six recently interaction. described patients. Although SLC29A3 confirmation was not carried, their clinical description is highly consistent with H syndrome [5]. Acknowledgements Our report further expands the spectrum of joint involvement in H syndrome. Patient II-1 displayed symmetric seronegative poly- We are grateful to the patients and their families. The study was arthritis involving both large and small joints. Interestingly, the funded by the NIHR Manchester Biomedical Research Centre. MF association of polyarthritis and persistently elevated acute phase Buckley is a recipient of a Marie Curie International Incoming reactants in this patient was highly suspicious for rheumatoid Fellowship from the European Science Directorate. arthritis and indeed this was her working diagnosis for several years. Hence, rheumatologic symptoms, speci fically arthritis should be References considered in the clinical spectrum of SLC29A3 related syndromes. We identified two different mutations in a single extended [1] S. Agarwal, C. Cunningham-Rundles, Autoimmunity in common variable fi e family. The two sisters were compound heterozygotes for the immunode ciency, Curr. Allergy Asthma Rep. 9 (2009) 347 352. [2] S.A. Baldwin, S.Y. Yao, R.J. Hyde, A.M. Ng, S. Foppolo, K. Barnes, M.W. Ritzel, p.G437R and p.G427S mutations whilst their nephew was homo- C.E. Cass, J.D. Young, Functional characterization of novel human and mouse zygous for the p.G437R mutation. These two mutations have been equilibrative nucleoside transporters (hENT3 and mENT3) located in intra- e found in nine separate families of Arab Muslim origin residing in cellular membranes, J. Biol. Chem. 280 (2005) 15880 15887. [3] V. Broshtilova, V. Molho-Pessach, Y. Ramot, A. Zlotogorski, Diabetes mellitus a small region near Jerusalem. The carrier rate of both mutations may be the earliest and sole manifestation of the H syndrome, Diabet. Med. 26 in this population was assessed to be 1% [10]. Our patients live in (2009) 1179e1180. a small village in Northern Israel more than 200 km away. The [4] S.T. Cliffe, J.M. Kramer, K. Hussain, J.H. Robben, E.K. de Jong, A.P. de Brouwer, E. Nibbeling, E.J. Kamsteeg, M. Wong, J. Prendiville, C. James, R. Padidela, family denied any genealogical relationships with the Arab families C. Becknell, H. van Bokhoven, P.M. Deen, R.C. Hennekam, R. Lindeman, from the Jerusalem area. It was previously shown that among the A. Schenck, T. Roscioli, M.F. Buckley, SLC29A3 gene is mutated in pigmented R. Spiegel et al. / European Journal of Medical Genetics 53 (2010) 309e313 313

hypertrichosis with insulin-dependent diabetes mellitus syndrome and mutations in the nucleoside transporter hENT3, Am. J. Hum. Genet. 83 (2008) interacts with the insulin signaling pathway, Hum. Mol. Genet. 18 (2009) 529e534. 2257e2265. [11] V. Molho-Pessach, J. Suarez, C. Perrin, C. Chiaverini, V. Doviner, E. Tristan- [5] M.A. El-Darouti, Hyperpigmented, hypertrichotic, and sclerodermoid plaques: Clavijo, I. Colmenero, F. Giuliano, A. Torrelo, A. Zlotogorski, The H syndrome: an unusual variant of Muckle-Wells syndrome, J. Am. Acad. Dermatol. 61 two novel mutations affecting the same amino acid residue of hENT3, (2009) 725e727. J. Dermatol. Sci. 57 (2010) 59e61. [6] R. Govindarajan, G.P. Leung, M. Zhou, C.M. Tse, J. Wang, J.D. Unadkat, Facili- [12] W. Newman, J. Clayton-Smith, K. Metcalfe, R. Cole, M. Tartaglia, tated mitochondrial import of antiviral and anticancer nucleoside drugs by F. Francesco Brancati, S. Morara, A. Novelli, X. Liu, K.A. Siminovitch, human equilibrative nucleoside transporter-3, Am. J. Physiol. Gastrointest. S. Mundlos, M. Tassabehji, G.C.M. Black, Geroderma Osteodysplastica maps Liver Physiol. 296 (2009) G910eG922. to a 4 Mb Locus on chromosome 1q24, Am. J. Med. Genet. A 146 (2008) [7] K. Hussain, R. Padidela, R.R. Kapoor, C. James, K. Banerjee, 3034e3037. J. Harper, L.C. Wilson, R.C. Hennekam, Diabetes mellitus, exocrine pancreatic [13] J. Prendiville, M. Rogers, A. Kan, F. de Castro, M. Wong, A. Junker, C. Becknell, deficiency, hypertrichosis, hyperpigmentation, and chronic inflammation: K. Schultz, Pigmented hypertrichotic dermatosis and insulin dependent dia- confirmation of a syndrome, Pediatr. Diabetes 10 (2009) 193e197. betes: manifestations of a unique genetic disorder? Pediatr. Dermatol. 24 [8] S. Marina, V. Broshtilova, POEMS in childhood, Pediatr. Dermatol. 23 (2006) (2007) 101e107. 145e148. [14] M.S. Rothman, M.E. Wierman, The role of gonadotropin releasing hormone in [9] V. Molho-Pessach, Z. Agha, S. Aamar, B. Glaser, V. Doviner, N. Hiller, normal and pathologic endocrine processes, Curr. Opin. Endocrinol. Diabetes D.H. Zangen, A. Raas-Rothschild, Z. Ben-Neriah, S. Shweiki, O. Elpeleg, Obes. 14 (2007) 306e310. A. Zlotogorski, The H syndrome: a genodermatosis characterized by indurated, [15] J. Zlotogora, Molecular basis of autosomal recessive diseases among the Pal- hyperpigmented, and hypertrichotic skin with systemic manifestations, J. Am. estinian Arabs, Am. J. Med. Genet. 109 (2002) 176e182. Acad. Dermatol. 59 (2008) 79e85. [16] J. Zlotogora, S. Barges, B. Bisharat, S.A. Shalev, Genetic disorders among Pal- [10] V. Molho-Pessach, I. Lerer, D. Abeliovich, Z. Agha, A. Abu Libdeh, estinian Arabs. 4: genetic clinics in the community, Am. J. Med. Genet. A 140 V. Broshtilova, O. Elpeleg, A. Zlotogorski, The H syndrome is caused by (2006) 1644e1646. BRIEF COMMUNICATIONS

Mutations in the gene encoding hVOD (Table 1) who met the clinical criteria for VODI (see Supplementary Methods online). The clinical correlates of immuno- the PML nuclear body protein deficiency included Pneumocystis jerovici infection, enteroviral infection or mucocutaneous candidiasis, but there was no evidence of Sp110 are associated with mycobacterial infection. Hepatic VOD was verified by biopsy in at least one individual in each sibship and was indistinguishable clinically immunodeficiency and hepatic and pathologically from the sinusoidal obstruction syndrome described after hematopoietic stem cell transplantation. veno-occlusive disease The B cell immunodeficiency was characterized by evolving severe Tony Roscioli1–3, Simon T Cliffe2, Donald B Bloch4, hypogammaglobulinemia, absent memory (CD19+ CD27+ IgD–) Christopher G Bell2, Glenda Mullan2, Peter J Taylor2, B cells and tonsillar lymph nodes, and circulating CD19+ B cell Maria Sarris5, Joanne Wang6, Jennifer A Donald7, numbers and percentages within the normal range. Absence of lymph Edwin P Kirk8,9, John B Ziegler9,10, Ulrich Salzer11, node germinal centers and tissue plasma cells have been noted as a http://www.nature.com/naturegenetics George B McDonald6, Melanie Wong12, Robert Lindeman2,5,13 consistent finding in autopsies that have been reported on 12 affected & Michael F Buckley1,2,13 individuals, consistent with a block in B cell differentiation (M.W., personal communication). The T cell immunodeficiency was char- We describe mutations in the PML nuclear body protein acterized by reduced numbers of memory (CD4+ CD45RO+ CD27–) Sp110 in the syndrome veno-occlusive disease with T cells (1–2%; normal is 440%) and low or reduced intracellular immunodeficiency, an autosomal recessive disorder T cell cytokine expression (IFNg,14% (reference range, 2530%); of severe hypogammaglobulinemia, combined T and IL2, 1–3% (12–32%); IL4 1–2% (4–7%) and IL10 1–2% (1–6%)) after B cell immunodeficiency, absent lymph node germinal stimulation with phorbol myristate acetate (PMA) and ionomycin. centers, absent tissue plasma cells and hepatic veno-occlusive CD4 and CD8 T cell numbers and percentages and T cell proliferation disease. This is the first report of the involvement of a assays were normal. nuclear body protein in a human primary immunodeficiency We performed homozygosity mapping in four affected individuals and of high-penetrance genetic mutations in hepatic and their parents from families A, B and C after obtaining approval from the relevant institutional ethics committees and informed Nature Publishing Group Group 200 6 Nature Publishing veno-occlusive disease.

© written consent. We mapped VODI to chromosome 2q36.3-37.1. Hepatic veno-occlusive disease with immunodeficiency syndrome Fine-mapping studies identified a conserved haplotype of three (VODI, OMIM235550) is an autosomal recessive primary immuno- short tandem repeat (STR) markers spanning a genomic interval deficiency associated with hepatic vascular occlusion and fibrosis1. of 1.422 Mb (Fig. 1a,b) that contained the gene SP110 (encoding VODI has an estimated frequency of 1:2,500 live births in the Sydney 110-kDa Speckled). SP110 is an immunoregulatory gene expressed in Lebanese population, with 19 cases identified over a period of T and B lymphocytes, lymph nodes, spleen and liver2,3;therefore,we 30 years. VODI is associated with an 85% mortality if unrecognized screened its coding exons for mutations by DNA sequencing. and untreated with intravenous immunoglobulin and Pneumocystis Mutation screening (Supplementary Table 1 and Supplementary jerovici prophylaxis. The association of an immunodeficiency with Methods) identified a homozygous single-base deletion, 642delC hepatic veno-occlusive disease (hVOD) has not been recognized in (P214PfsX15), in exon 5 in affected individuals from families A–C other classes of immunodeficiency, suggesting that hVOD is not a and subsequently in family D (Fig. 1c). No living affected individuals secondary event but is a primary feature of VODI. were available from family E, but the consanguineous parents and We identified six children from five families of Lebanese ethnicity unaffected children were shown to share a heterozygous single-base who presented between 3–7 months of age with either a combined T deletion, 40delC (Q14SfsX25) in exon 2 on a different haplotype and B cell immunodeficiency and/or a personal or family history of background from families A–D. We confirmed that this mutation was

1Centre for Vascular Research, University of New South Wales, Sydney 2052, Australia. 2Molecular & Cytogenetics Unit, Department of Haematology and Genetics, Prince of Wales Hospital, Sydney 2031, Australia. 3Department of Molecular and Clinical Genetics, Royal Prince Alfred Hospital, University of Sydney, Sydney 2050, Australia. 4Center for Immunology and Inﬂammatory Diseases, Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02129, USA. 5School of Medical Sciences, University of New South Wales, Sydney 2052, Australia. 6Fred Hutchinson Cancer Research Center and University of Washington Schools of Medicine & Pharmacy, Seattle, Washington 98109, USA. 7Department of Biological Sciences, Macquarie University, Sydney 2109, Australia. 8Department of Medical Genetics, Sydney Children’s Hospital, Sydney 2031, Australia. 9School of Women’s & Children’s Health, University of New South Wales, Sydney 2052, Australia. 10Department of Immunology & Infectious Diseases, Sydney Children’s Hospital, Sydney 2031, Australia. 11Division of Rheumatology and Clinical Immunology, Medical Centre, University Hospital, Hugstetterstr. 55, 79106 Freiburg, Germany. 12Department of Immunology and Allergy, Children’s Hospital, Westmead 2145, Australia. 13These authors contributed equally to this work. Correspondence should be addressed to T.R. ([email protected]). Received 27 October 2005; accepted 14 March 2006; published online 30 April 2006; doi:10.1038/ng1780

620 VOLUME 38 [ NUMBER 6 [ JUNE 2006 NATURE GENETICS BRIEF COMMUNICATIONS

Table 1 Summary of clinical and laboratory data in the VODI families

Percentage circulating Serum Ig (g l–1) cells Tcell Age Memory T T cell PHA/ConA cytokine Individual Sex (months) Presentation IgM IgG IgA B T & B cells subsets Response production Current clinical state

A II.1 F 5 Immunodeficiency, 0.16 0.5 o0.07 N N – N N – Deceased; recurrent hVOD thrombocytopenia post HSCT and hVOD B II.1 M 7 Immunodeficiency 0.1 0.2 0.07 N N Decreased N N Impaired Well B II.2 F 6 Hepatosplenomegaly 0.09 o0.33 o0.07 17 58 Decreased N N Impaired Mild aminotransferase and ascites elevation C II.1 F 4 Hepatosplenomegaly 0.2 0.55 o0.07 8 79 Decreased N N Impaired Chronic liver disease and and thrombocytopenia portal hypertension D II.1 M 3 hVOD 0.05 o0.33 o0.07 23 79 Decreased N N Impaired Deceased; hemophagocytic syndrome post hepatic transplant for hVOD E I.1 M 3 Immunodeficiency & 0.05 0.8 o0.06 N N – N N – Deceased; enteroviral thrombocytopenia and Pneumocystis jerovici infection

PHA: phytohemagglutinin; ConA: concanavalin A; HSCT: hematopoietic stem cell transplantation. http://www.nature.com/naturegenetics homozygous in DNA extracted from archival tissue from EII.1. We did from 642delC homozygous patients compared with their heterozygous not detect either mutation in 50 unrelated Lebanese controls. In siblings and familial controls (Fig. 2j). We did not see any corre- addition, we did not detect any mutations in the coding regions of sponding changes in mRNA levels in the evolutionarily related, SP110 in 89 isolated cases of common variable immunodeficiency of physically adjacent genes SP100 and SP140. Long-range PCR per- European or Middle Eastern origin4. formed on random hexamer-primed cDNA generated from indivi- Sp110 nuclear staining was absent in EBV-transformed B lympho- duals with VODI and heterozygotes showed no evidence of exon cytes from an affected individual with the homozygous 642delC skipping (data not shown). These data are consistent with absence of mutation in exon 5. Sp100 staining was consistent with normal Sp110 without disruption of the PML nuclear body in individuals PML nuclear body numbers (Fig. 2a–h). Protein blot analysis using with VODI. a rat anti-Sp110 antiserum confirmed the absence of the two major Given the association between mutations in SP110 and hVOD, isoforms, Sp110b and Sp110c, in affected cell lines (Fig. 2i). A we were interested to determine if there was an association between quantitative TaqMan real-time PCR assay demonstrated significantly Sp110 alleles and the risk of hVOD after hematopoietic stem cell Nature Publishing Group Group 200 6 Nature Publishing

© reduced SP110 mRNA levels in B lymphoblastoid cell lines established transplantation. We performed a targeted SP110 SNP association study using 69 SNPs with an average inter- SNP distance of 0.826 kb in a cohort of 47 a Family A Family BFamily C Family D Family E affected individuals and 62 controls who had

D2S133 1 2 4 2 5 4 5 4 4 5 2 4 received standardized myeloablative condi- D2S2354 1 0 9 0 2 3 0 3 9 9 9 0 5 S2S362 2 1 2 1 2 1 2 1 4 1 2 3 3 2 3 2 tioning therapy .Measuresofassociation AFMA283YB1 3 1 2 1 3 1 1 1 4 1 2 4 4 2 4 2 AFMA289YE1 2 1 2 1 3 1 1 1 2 1 2 3 7 4 3 4 between hVOD and alleles of SP110 did not AFMB329WE9 5 4 3 4 1 4 4 4 1 4 3 2 2 5 3 5 AFM277WG9 3 2 4 2 3 2 3 2 4 2 1 2 2 3 1 3 reach statistical signiﬁcance. D2S396 9 6 8 6 7 6 7 6 9 6 7 6 na na na na AFMC004XH5 1 3 2 3 2 3 1 3 4 3 4 3 2 5 6 5 AFM324VC9 2 3 4 3 2 5 1 5 3 3 1 3 7 5 6 5 D2S206 6 2 8 2 0 5 8 3 6 5 8 9 D2S2202 8 8 7 8 6 6 6 6 6 6 6 6

D2S133 2 2 4 4 5 4 5 4 Figure 1 SP110 mapping and mutation analysis. D2S2354 0 0 3 3 9 0 9 0 S2S362 1 1 1 1 1 3 1 3 1 1 (a) Pedigree structure and haplotypes in the AFMA283YB1 1 1 1 1 1 4 1 4 1 1 AFMA289YE1 1 1 1 1 1 3 1 3 1 1 region 2q37.1 for ﬁve families with VODI. The AFMB329WE9 4 4 4 4 4 2 4 2 4 4 AFM277WG9 2 2 2 2 2 2 2 2 2 2 shaded haplotype shared by affected family D2S396 6 6 6 6 6 6 6 6 na na AFMC004XH5 3 3 3 3 3 3 3 3 3 3 members is oriented with centromere towards the AFM324VC9 3 3 5 5 3 3 3 3 3 3 top of the page. Individuals II.1 and II.2 in family D2S206 2 2 5 3 5 9 5 9 D2S2202 8 8 6 6 6 6 6 6 C and individual II.1 family B show the position b AFMB329WE9 D2S396 AFMACOO4XH5 AFM324VC9 of the centromeric and telomeric crossover FBX036 SP140 SP100 events. ‘na’ in families D and E indicates an STR 2q36.3 2q37.1 that was not analyzed. (b)GeneandSTR DNER TRIP12 SLC16A14 SP110 localizations within the minimal critical region. c (c) Partial SP110 DNA sequences for exons 5 Control Affected Heterozygote Control Affected Heterozygote (forward) and 2 (reverse) in normal controls, affected individuals and heterozygotes. The reference sequence used is GenBank accession number NM_080424, with base 1 assigned to SP110 exon 5 642delC, families A, B, C & D SP110 exon 2 40delC, family E the initiator ATG in exon 2.

NATURE GENETICS VOLUME 38 [ NUMBER 6 [ JUNE 2006 621 BRIEF COMMUNICATIONS

abcd and mice may be related to different mutational bases of disruption of SP110 and Ifi75 in the two species. Phenotypic variation due to allelic heterogeneity has numerous prece- dents12,13. Alternatively, the variation in +/– –/– SP110 DAPI SP110 DAPI immune phenotype may reflect species-spe- Anti-Sp110 Anti-Sp110 cific differences, as has been previously docu- efgh mented for the ZAP70 and ICOS genes14,15. In summary, this study indicates that SP110 has an important role in immunoprotective mechanisms against infectious organisms in +/– –/– SP110 DAPI SP110 DAPI humans. VODI presents with a T cell abnorm- Anti-Sp100 Anti-Sp100 ality and a defect in B cell differentiation bet- –/– +/+ 1.60 ween the stages of CD19 sIg-positive mature ijSP110 SP110 Carrier -Sp110a/c 1.40 Affected B cells and antibody secreting plasma cells, with resulting severe hypogammaglobuline- 97 - 1.20 mia. The failure of T cells from affected in- 1.00 -Sp110b dividuals to express IFNg, IL2 and IL4 and the 66 - 0.80 expression of low levels of IL10 in response to 0.60 PMA and ionomycin stimulation suggest

46 - expression Relative 0.40 either the abolition of transcriptional coactivation of these genes by SP110 or an effect 0.20 http://www.nature.com/naturegenetics secondary to a block in B cell maturation. The 0.00 mechanisms by which mutations in SP110 Total Sp110 Sp110b Sp110c Sp140 Sp100 lead to decreased T cell cytokine production, the failure of B cell differentiation and sinu- Figure 2 Functional consequences of SP110 mutations. (a–h) Indirect immunofluorescence analysis of Sp110 expression with a rat anti-human Sp110 polyclonal antiserum showing absent Sp110 nuclear soidal injury have yet to be elucidated. We staining and the presence of normal Sp100 nuclear body staining in an affected individual. Also shown hypothesize that SP110 not only has a role in are images of DAPI staining, demonstrating nuclear localization. (i) Protein blot showing absence of interferon-dependent transcription of genes Sp110 expression in EBV-transformed B cells from a homozygous affected individual versus a normal central to cytokine production and lympho- control. (j) Relative mRNA levels of total SP110, SP110b, SP110c, SP140 and SP100 in affected cyte differentiation but that it is also involved ¼ individuals (n 4) and a carrier (normalized to expression from a control individual ± 1 s.d.). in cytoprotection. This represents the first report of a human immunodeficiency syn- SP110,anSP100 gene family member with three isoforms, encodes drome associated with mutations in a nuclear body protein and the a 713-residue protein that has structural features consistent with a role identification of the molecular basis of a mendelian form of hVOD. Nature Publishing Group Group 200 6 Nature Publishing

© in transcriptional regulation, including a nuclear localization signal; SP100-like dimerization, plant homeobox, bromo and LXXLL-type Note: Supplementary information is available on the Nature Genetics website. nuclear hormone domains and Sp100/AIRE-1/NucP41/75 domains ACKNOWLEDGMENTS 6,7 (SAND) . Sp110 can also increase transcriptional activity from We thank the families with VODI for their participation, D. Reeves for retinoic acid response elements by binding to the retinoic acid histopathological interpretation and the financial support of the New South Wales receptor a (RARa), whereas the Sp110b isoform binds RARa and Health Research Infrastructure Grant, the Sydney Children’s Hospital Foundation, 7 the Australian National Health and Medical Research Council (NHMRC), an acts as a transcriptional corepressor . Sp110 is associated with the NHMRC postgraduate research scholarship (T.R.), the US National Institutes PML nuclear body, a macromolecular complex within the nucleus that of Health (J.W. and G.B.M.) and the Deutsche Forschungsgemeinschaft (U.S.). is deployed to areas of active host or viral DNA replication, transcription and repair8–10. In addition to the regulation of gene transcription, COMPETING INTERESTS STATEMENT the PML nuclear body is involved in other cellular processes such as The authors declare that they have no competing financial interests. apoptosis, cell cycle control and the immune response. Our data are Published online at http://www.nature.com/naturegenetics consistent with Sp110 having an important role in the immune Reprints and permissions information is available online at http://npg.nature.com/ response without being essential for PML nuclear body formation. reprintsandpermissions/ This study also extends previous findings on the role of the mouse SP110 orthologue, Ifi75, in the increased susceptibility to mycobacter- 1. Mellis, C. & Bale, P.M. J. Pediatr. 88, 236–242 (1976). 2. Watashi, K. et al. Mol. Cell. Biol. 23, 7498–7509 (2003). ial and listerial infections in C3HeB/FeJ inbred strain of laboratory 3. Bairoch, A. et al. Nucleic Acids Res. 33, D154–D159 (2005). mice11. Full-length transcripts of Ifi75 are absent in C3HeB/FeJ. No 4. Salzer, U. et al. Nat. Genet. 37, 820–828 (2005). abnormalities of T cell function, alveolar B cell numbers or expression 5. McDonald, G.B. et al. Blood 101, 2043–2048 (2003). 6. Kadereit, S. et al. J. Biol. Chem. 268, 24432–24441 (1993). of CD19, B220 or CD69 have been reported in C3HeB/FeJ. There is 7. Bloch, D.B. et al. Mol. Cell. Biol. 20, 6138–6146 (2000). also no evidence of hVOD in this strain; however, this was assessed in 8. Everett, R.D. Oncogene 20, 7266–7273 (2001). 9. Wang, J. et al. J. Cell. Biol. 164, 515–526 (2004). the context of mycobacterial infection rather than bone marrow 10. Everett, R.D. & Murray, J. J. Virol. 79, 5078–5089 (2005). ablative therapy (I. Kramnik, personal communication). Notably, the 11. Pan, H. et al. Nature 434, 767–771 (2005). full characterization of the C3HeB/FeJ Ifi75 genomic region, including 12. Kingston, H.M. et al. Lancet 2, 1200 (1983). 13. Park, W.J. et al. Hum. Mol. Genet. 4, 1229–1233 (1995). the genomic basis of the lack of full-length Ifi75 expression, has yet to 14. Elder, M.E. et al. J. Immunol. 166, 656–661 (2001). be defined. The discordance in the phenotypes observed in humans 15. Grimbacher, B. et al. Nat. Immunol. 4, 261–268 (2003).

622 VOLUME 38 [ NUMBER 6 [ JUNE 2006 NATURE GENETICS PRENATAL DIAGNOSIS Prenat Diagn 2007; 27: 674–676. Published online 17 May 2007 in Wiley InterScience (www.interscience.wiley.com) DOI: 10.1002/pd.1759

RESEARCH LETTER

The ﬁrst prenatal diagnosis for veno-occlusive disease and immunodeﬁciency syndrome, an autosomal recessive condition associated with mutations in SP110

Simon T. Cliffe1,2*, Melanie Wong3, Peter J. Taylor2,EziaRuga4, Bridget Wilcken5, Robert Lindeman2,6, Michael F. Buckley1,2 and Tony Roscioli1,2,7 1Centre for Vascular Research, University of New South Wales, Sydney, Australia 2Molecular and Cytogenetics Unit, Department of Haematology and Genetics, Prince of Wales Hospital, Sydney, Australia 3Department of Allergy, Immunology and Infectious Diseases, The Children’s Hospital at Westmead, Sydney, Australia 4Department of Pediatrics, University of Padova, Padova, Italy 5Western Sydney Genetics Program, Children’s hospital, Westmead, Australia 6School of Medical Sciences, University of New South Wales, Sydney, Australia 7Sydney South West Integrated Genetics Service, Royal Prince Alfred hospital, University of Sydney, Australia

Objectives We present the ﬁrst prenatal diagnosis of familial hepatic veno-occlusive disease with immunod- eﬁciency (VODI). Homozygous mutations in the gene SP110 are the genetic basis of VODI. The proband in this report presented at three months of age with hepatomegaly hepatic failure and was found to have hypogammaglobulinemia. He died one month after hepatic transplant at eight months of age due to hemophagocytic syndrome. DNA testing detected a homozygous truncating mutation in exon 5; SP110 c.642delC. Prenatal testing was offered to this family in a subsequent pregnancy.

Methods Chorion villus was sampled at 12 weeks’ gestation. DNA was extracted using standard techniques, and sequencing of SP110 exon 5 was performed using ﬂanking primers. Maternal contamination was excluded by examining STR markers in CVS and maternal DNA.

Results A heterozygous SP110 c.642delC mutation was detected in exon 5. This mutation was present in heterozygous form in both parents.

Conclusions The prenatal test result is predictive of a child with a normal immune and hepatic phenotype. This report presents the ﬁrst prenatal molecular diagnosis for VODI and shows the importance of molecular genetic research in not only deﬁning the aetiology of syndromes but also in assisting reproductive choices through the collaboration of genetic and feto-maternal services. Copyright  2007 John Wiley & Sons, Ltd.

KEY WORDS: Chorionic villus sample (CVS); veno-occlusive disease with immunodeﬁciency (VODI)

INTRODUCTION cytoreductive therapy; (3) a pattern of disease consistent with autosomal recessive inheritance; (4) onset prior to Familial Veno-Occlusive Disease with Immunodefi- the age of 12 months. Familial clusters of VOD may ciency (VODI, OMIM235550) is an autosomal recessive represent complications of ingested toxins rather than disorder whose aetiology has been identified recently a genetic aetiology, particularly if they occur in older as being due to mutations in the nuclear body pro- age groups and are not reported to be associated with tein SP110 (Roscioli et al., 2006). The clinical crite- immunodeficiency (Shah et al., 1987; Al-Hasany and ria employed to diagnose VODI include: (1) clinical Mohamed, 1970). The index of suspicion for VODI evidence of immunodeficiency including Pneumocystis should, however, be high particularly where a combined jerovici infection, mucocutaneous candidiasis, enterovi- immunodeficiency consistent with this diagnosis is asso- ral or cytomegalovirus infections; (2) hepatomegaly, ciated with VOD in a potentially consanguineous couple. evidence of hepatic failure or a histological diagnosis Twenty children from nine Australian Lebanese fam- of veno-occlusive disease (VOD; also known as sinu- ilies have been diagnosed with VODI over a period soidal obstruction syndrome) not explained by iatrogenic of 30 years. These patients with VODI presented at factors such as cyclophosphamide treatment or other 3–7 months with either a combined T and B cell immunodeficiency or VOD or with both. All known VODI patients in Australia have had hypogammaglobuline- *Correspondence to: Simon T. Cliffe, Molecular and Cytogenetics Unit, Department of Haematology and Genetics, Prince of Wales mia at presentation, with absent germinal centres and Hospital, Barker St Randwick, Sydney, Australia. plasma cells but normal T cell numbers suggestive of a E-mail: [email protected] B-cell maturation defect. VODI has a high mortality in

Copyright  2007 John Wiley & Sons, Ltd. Received: 1 January 2007 Revised: 26 March 2007 Accepted: 27 March 2007 Published online: 17 May 2007 FIRST PRENATAL DIAGNOSIS FOR CONDITIONS ASSOCIATED WITH MUTATIONS IN SP110 675 childhood, but if the child survives the acute presenting illness, the immunodeficiency responds favourably to regular intravenous immunoglobulin (IVIG) and pneumocystis prophylaxis (Roscioli et al., 2006). VODI was originally described in Australians of Lebanese origin by (Mellis and Bale, 1976). The majority of children who have been ascertained subsequent to this description have also been of Lebanese ethnic origin with a prevalence of VODI in the Sydney Lebanese population estimated to be 1 in 2500 (Roscioli et al., 2006). Two previous case reports of familial disorders resembling VODI have appeared in the literature. The first is a case report of two siblings with VOD in the Lebanese literature, but without mention of immunodeficiency (Firzli, 1978). The significance of this omission is, however, difficult to interpret, given the scarcity of diagnostic immunopathology investigations at that time. These families have not been available for molecular characterization. A further case report from Lebanon of two siblings of non-consanguineous Lebanese parents has been published, one of whom survived VODI with demonstrated humoral and cellular immune dysfunction (Etzioni et al., 1987). There are two sporadic cases of VODI known, one as a case report in the Spanish literature (Manzanares Lopez-Manzanares et al., 1992) and the second from Padua in northern Italy (Ruga, 2006). The prevalence of VODI in children of non-Lebanese origin has yet to be defined, but these sporadic cases indicate that the VODI phenotype is not specific to the Lebanese population. In previous work done by our group, the VODI candidate region was identified through homozygosity mapping and the genetic basis of the disorder was shown to be due to truncating mutations in the SP110 gene Figure 2—Sequencing of c.642delC in SP110 showing (a) Normal (Roscioli et al., 2006). SP110 (Speckled 110kDa), an sequence, (b) Parental heterozygotes, and (c) Homozygous truncating mutations interferon gamma inducible gene, was first recognized in 1993 (Kadereit et al., 1993). It encodes a full-length 713 amino acid protein containing a SAND-, plant We report the first molecular prenatal diagnosis for homeobox- and Bromo-domain, which are common VODI. The aim of this work was to provide prenatal features in modular proteins involved in chromatin- diagnosis for the second pregnancy of a woman whose mediated gene transcription (Bloch et al., 1996). The first child died of VODI complications in infancy. function of SP110 has not been fully characterized, Sequencing has demonstrated that the first child was however it is known to a nuclear protein with a role in homozygous for the c.642delC truncating mutation in the transcriptional coactivation of retinoic acid receptor- SP110. mediated pathways (Bloch et al., 2000, Watashi et al., 2003). SP110 is also one of a number of proteins that interact with the Promyelocytic Leukaemia Nuclear CASE REPORT body, which has probable roles in apoptosis, cancer protection, and in viral response (Wang et al., 1998a,b). The consultants are a first-cousin consanguineous couple of Lebanese origin. There was a significant family history with their first child, II.1, diagnosed with VODI (Figure 1) at age 3 months. II.1 presented initially to the accident and emergency department with hepatomegaly and signs of hepatic failure with presumed mucocutaneous candidiasis. Severe hypogammaglobulinemia was identified and the presence of VOD was detected on hepatic biopsy. The proband responded initially to treatment of presumed Pneumocystis jerovici infection, but subsequently required liver transplantation for VOD, and died post-transplant, having developed hemophagocytic syn- Figure 1—Pedigree showing proband (II.1) and patient (II.2) drome at the age of 8 months. The diagnosis of VODI

Copyright  2007 John Wiley & Sons, Ltd. Prenat Diagn 2007; 27: 674–676. DOI: 10.1002/pd 676 S. T. CLIFFE ET AL. was confirmed in the proband by the detection of a ACKNOWLEDGEMENTS homozygous truncating c.642delC mutation in exon 5 of SP110. This mutation was detected in heterozygous The authors wish to thank the family for participating form in both unaffected parents (Figure 2). in this study and SEALS molecular and cytogenetics The proband’s parents requested a genetic consul- laboratory for providing infrastructure. The work was tation to discuss the possibility of a prenatal diagno- supported by the Australian NHMRC and an NHMRC sis for VODI in the first trimester of their subsequent postgraduate research scholarship. pregnancy, II.2. The couple chose to pursue prenatal testing after fully informed consent was obtained. Chorionic villi were sampled at 12 weeks’ gestation, REFERENCES and fetal DNA was extracted using a standard technique. PCR oligonucleotide primers were designed that Al-Hasany M, Mohamed AS. 1970. Veno-occlusive disease of the flanked exon 5 of SP110, based on Genbank refer- liver in Iraq. Nine cases occurring in three bedouin families. Arch ence Sequence NM 080424 (primer sequences and PCR Dis Child 45: 722–724. conditions available from the authors on request) and Bloch DB, Delamonte SM, Guigaouri P, Filippov A, Bloch KD. 1996. Identification and characterization of a leukocyte-specific bidirectional sequencing of SP110 was performed. The component of the nuclear body. JBiolChem271: 29198–29204. prenatal test result detected a heterozygous c.642delC Bloch DB, Nakajima A, Gulick T, et al. 2000. Sp110 localizes to the mutation in exon 5 of SP110, predictive of a child with PML-Sp100 nuclear body and may function as a nuclear hormone a normal immune and hepatic phenotype. STR markers receptor transcriptional coactivator. MolCellBiol20: 6138–6146. Etzioni A, Benderly A, Rosenthal E, et al. 1987. Defective humoral in the CVS-extracted DNA were compared to maternal and cellular immune functions associated with venoocclusive alleles at 8 unlinked loci to exclude maternal contami- disease of the liver. J Pediatr 110: 549–554. nation. The karyotype was normal. Postnatal testing of Firzli SS. 1978. Veno-occlusive familial hepatic disease. J Pediatr 92: immune function was normal and the child has remained 862. well without any features of VODI. Kadereit S, Gewert DR, Galabru J, Hovanessian AG, Meurs EF. 1993. Molecular-cloning of 2 new interferon-induced, highly related nuclear phosphoproteins. JBiolChem268: 24432–24441. Manzanares Lopez-Manzanares J, Moreno Villares JM, Medina DISCUSSION Monzon C, et al. 1992. Veno-occlusive disease of the liver associated with humoral and cellular immunodeficiency. An Esp Pediatr 36: 314–316. Although the aetiology of VODI has only been described Mellis C, Bale PM. 1976. Familial hepatic venoocclusive disease with recently, the full clinical spectrum of the VODI pheno- probable immune deficiency. J Pediatr 88: 236–242. Roscioli T, Cliffe ST, Bloch DB, et al. 2006. Mutations in the gene type segregates perfectly with homozygous truncating encoding the PML nuclear body protein Sp110 are associated with mutations of SP110. The disorder is associated with immunodeficiency and hepatic veno-occlusive disease. Nat Genet significant morbidity and a 90% mortality even with 38: 620–622. treatment with intravenous immunoglobulin and pneu- Ruga EM, Guariso G, D’Antiga L, et al. 2006. Hepatic veno- mocystis prophylaxis. As the long-term efficacy of the occlusive disease with immunodeficiency syndrome: case report. In 12th Meeting of the European Society for Immunodeficiencies treatment is as yet unknown, and this family had already (ESID), Budapest. experienced the death of one affected child, they sought Shah PK, Chittora MD, Deo IN, Khangarot D, Vyas MM, Tak RS. prenatal diagnosis. This represents the first time molec- 1987. Veno-occlusive disease of liver—a familial episode. J Assoc ular prenatal testing has been provided for VODI via Phys India 35: 240–242. Wang ZG, Delva L, Gaboli M, et al. 1998a. Role of PML in cell analysis of SP110 mutations. growth and the retinoic acid pathway. Science 279: 1547–1551. The identification of the genetic basis of VODI has Wang ZG, Ruggero D, Ronchetti S, et al. 1998b. Pml is essential for made molecular prenatal diagnosis in an additional multiple apoptotic pathways. Nat Genet 20: 266–272. inherited immunodeficiency possible. Further investiga- Watashi K, Hijikata M, Tagawa A, Doi T, Marusawa H, Shimo- tions may extend the phenotype of immunodeficiencies tohno K. 2003. Modulation of retinoid signaling by a cytoplasmic viral protein via sequestration of Sp110b, a potent transcriptional where prenatal molecular diagnosis is able to be offered corepressor of retinoic acid receptor, from the nucleus. Mol Cell and the clinical spectrum of VODI may be clarified when Biol 23: 7498–7509. additional cases with clinical variability of disease are ascertained. This report describes a simple and effective method for diagnostic testing in a prenatal setting.

Copyright  2007 John Wiley & Sons, Ltd. Prenat Diagn 2007; 27: 674–676. DOI: 10.1002/pd Immune deﬁciencies, infection, and systemic immune disorders

Clinical, molecular, and cellular immunologic ﬁndings in patients with SP110-associated veno-occlusive disease with immunodeﬁciency syndrome

Simon T. Cliffe, BSc(Hons),a* Donald B. Bloch, MD, PhD,b* Santi Suryani, BSc(Hons), PhD,c Erik-Jan Kamsteeg, PhD,d Danielle T. Avery, BAppSci,c Umaimainthan Palendira, BSc(Hons), PhD,c Joseph A. Church, MD,e Brynn K. Wainstein, MBBS, FRACP,f Antonino Trizzino, MD,g Gerard Lefranc, PhD,h Carlo Akatcherian, MD,i Andre Megarbane, MD, PhD,j Christian Gilissen, PhD,d Despina Moshous, MD,k Janine Reichenbach, MD,l Siraj Misbah, MD,m Uli Salzer, PhD,n Mario Abinun, FRCP,o Peck Y. Ong, MD,e Polina Stepensky, MD,p Ezia Ruga, MD,q John B. Ziegler, MD, FRACP,f Melanie Wong, MBBS, PhD, FRACP,r Stuart G. Tangye, BSc(Hons), PhD,c Robert Lindeman, MBBS, PhD, FRACP,a Michael F. Buckley, MBChB, PhD, FRCPA, FRCPath,a and Tony Roscioli, MBBS, PhD, FRACPa,s Sydney, Australia, Boston, Mass, Nijmegen, The Netherlands, Los Angeles, Calif, Palermo and Padua, Italy, Montpellier and Paris, France, Beirut, Lebanon, Zurich, Switzerland, Oxford and Newcastle, United Kingdom, Freiburg, Germany, and Jerusalem, Israel

Background: Mutations in the SP110 gene result in infantile cytometry; assessments of B-cell function after stimulation with onset of the autosomal recessive primary immunodeficiency CD40 ligand, IL-21, or both; and differential gene expression disease veno-occlusive disease with immunodeficiency syndrome array studies of EBV-transformed B cells. (VODI), which is characterized by hypogammaglobulinemia, Results: We confirm the major diagnostic criteria and the T-cell dysfunction, and a high frequency of hepatic veno- clinical utility of SP110 mutation testing for the diagnosis of occlusive disease. VODI. Analysis of 4 new alleles confirms that VODI is caused by Objectives: We sought to further characterize the clinical reduced functional SP110 protein levels. Detailed B-cell features, B-lineage cellular immunologic findings, and molecular immunophenotyping demonstrated that Sp110 deficiency pathogenesis of this disorder in 9 patients with new diagnoses, compromises the ability of human B cells to respond to T cell– including 4 novel mutations from families of Italian, Hispanic, dependent stimuli and differentiate into immunoglobulin- and Arabic ethnic origin. secreting cells in vitro. Expression microarray studies have Methods: Methods used include clinical review; Sanger DNA identified pathways involved in B-lymphocyte differentiation sequencing of the SP110 gene; determination of transfected and macrophage function. mutant protein function by using immunofluorescent studies in Conclusion: These studies show that a range of mutations in Hep-2 cells; quantitation of B-cell subsets by means of flow SP110 that cause decreased SP110 protein levels and impaired

From athe Department of Haematology and Genetics, Prince of Wales Hospital, Sydney; Infrastructure support was provided by the Department of Haematology and Genetics, bthe Centre for Immunology and Inflammatory Diseases, Massachusetts General Hos- South Eastern Area Laboratory Services, Sydney, and the Department of Human pital, Boston and Harvard Medical School, Boston; cthe Immunology Program, Garvan Genetics, Radboud University, Nijmegen Medical Centre. D.B.B. is supported by a Institute of Medical Research and St Vincent’s Clinical School, University of New grant from the Massachusetts General Hospital. C.A. and A.M. were supported in part South Wales, Sydney; dthe Department of Human Genetics, Radboud University by the Research Council of the Saint Joseph University, Beirut. D.M. was supported by Nijmegen Medical Centre, Nijmegen; ethe Division of Clinical Immunology and the Robert A Good/Jeffrey Modell Fellowship in Transplantation and Immunodefi- Allergy, Childrens Hospital Los Angeles; fthe Department of Immunology & Infec- ciency. J.R. was supported by the Gebert Ruf€ Stiftung, Program Rare Diseases–New tious Diseases, Sydney Children’s Hospital; gPediatric Hematology Oncology, Ospe- Approaches, grant no. GRS-046/10. S.G.T. is an NHMRC Senior Research Fellow dale dei Bambini ‘‘G. Di Cristina,’’ ARNAS Civico, Palermo; hthe Institute of Human with research funding provided by NHMRC Program Grant no. 427620. M.F.B. is Genetics, CNRS, UPR 1142, and Universite Montpellier 2, Montpellier; ithe Depart- the recipient of a Marie Curie Fellowship (PIIF-GA-2008-221048) from the EU ment of Pediatrics, Hospital Hotel-Dieu^ de France, Saint Joseph University, Beirut; Science Directorate. T.R. is supported by an Australian NHMRC postdoctoral research jthe Medical Genetics Unit, Faculty of Medicine, Saint Joseph University, Beirut; fellowship. kFacultedeMedecine Rene Descartes, Universite Paris Descartes, Site Necker, Disclosure of potential conflict of interest: D. Moshous has received research support IFR94, Paris, and Assistance Publique–Hopitaux^ de Paris, Hopital^ Necker–Enfants from the Jeffrey Modell Foundation. J. Reichenbach has received research support Malades, Unite d’Immunologie et d’Hematologie Pediatriques, Paris; lthe Division from the Chronic Granulomatous Disorder Research Trust and Gebert Ruf€ Stiftung. of Immunology/Haematology/BMT and the Children’s Research Centre, University M. F. Buckley has received research support from the European Union Directorate of Children’s Hospital Zurich, and the Zurich Centre for Integrative Human Physiology Science. The rest of the authors declare they have no relevant conflicts of interest. (ZIHP), University of Zurich; mthe Department of Clinical Immunology, Oxford Received for publication August 9, 2011; revised January 19, 2012; accepted for publi- Centre for Clinical Immunology, John Radcliffe Hospital, Oxford; nthe Centre of cation February 21, 2012. Chronic Immunodeficiency (CCI), University Medical Center Freiburg and University Available online May 21, 2012. of Freiburg; othe Department of Paediatric Immunology, Newcastle General Hospital; Corresponding author: Michael F. Buckley, MBChB, PhD, FRCPA, Department of pPediatric Hematology-Oncology and BMT, Hadassah University Hospital, Jerusa- Haematology and Genetics, Prince of Wales Hospital, Barker Street, Randwick lem; qthe Department of Pediatrics, University of Padova, Padua; rthe Department 2031, Sydney, Australia. E-mail: [email protected]. of Allergy, Immunology and Infectious Diseases, the Children’s Hospital, Westmead, 0091-6749/$36.00 Sydney; and sthe School of Women and Children’s Health, Sydney Children’s Hospital Ó 2012 American Academy of Allergy, Asthma & Immunology and the University of New South Wales, Sydney. doi:10.1016/j.jaci.2012.02.054 *These authors contributed equally to this work.

735 736 CLIFFE ET AL J ALLERGY CLIN IMMUNOL SEPTEMBER 2012 late B-cell differentiation cause VODI and that the condition is not restricted to the Lebanese population. (J Allergy Clin Abbreviations used Immunol 2012;130:735-42.) BMT: Bone marrow transplantation CD40L: CD40 ligand Key words: Veno-occlusive disease with immunodeficiency, hypo- CMV: Cytomegalovirus gammaglobulinemia, SP110, B-cell development DAVID: Database for Annotation, Visualization and Integrated Discovery hVOD: Hepatic veno-occlusive disease IVIG: Intravenous immunoglobulin Familial veno-occlusive disease with immunodeficiency syn- SAM: Statistical Analysis of Microarrays drome (VODI; Online Mendelian Inheritance in Man [OMIM] VODI: Veno-occlusive disease with immunodeficiency syndrome 235550) is an autosomal recessive immunodeficiency syndrome with specific clinical features.1 The key features of VODI include (1) severe hypogammaglobulinemia, (2) clinical evidence of T-cell dysfunction, (3) hepatomegaly with evidence of hepatic determined in the peripheral blood of healthy donors and patients with failure or histologically proved hepatic veno-occlusive disease SP110 mutations after incubation with mAbs against CD20, CD10, and (hVOD) in the proband or a first-degree relative that is unex- CD27 and flow cytometry.5-7 The proportion of CD21lo and CD21hi transitional B cells, which correspond respectively to early and late populations plained by iatrogenic factors, (4) a pattern of disease transmission 8 consistent with autosomal recessive inheritance, and (5) onset of transitional B cells, were determined as previously described. The expression of immunoglobulin isotypes on naive and memory B cells was deter- before the age of 12 months. mined as previously described.9 B-cell function in patients with VODI with VODI is caused by mutations in the SP110 gene (see Fig E1 in this 1 SP110 mutations was analyzed by using several approaches. article’s Online Repository at www.jacionline.org). The role of First, total B cells were isolated from PBMCs collected from 3 patients with SP110 in patients with VODI was identified through homozygosity VODI and 5 control subjects by means of negative selection with DYNAL mapping in consanguineous families of Lebanese origin who were beads (Dynal Biotech, Oslo, Norway) achieving greater than 95% B-cell unable to form germinal centers, resulting in absent plasma cells purity. These were then cultured in vitro (approximately 10 3 103/200 mL) and hypogammaglobulinaemia.1 SP110 is a single-copy gene in hu- with recombinant CD40 ligand (CD40L) alone or together with IL-21 (50 mans; however, in all inbred strains of laboratory mice, it is part of a ng/mL; PeproTech, Rocky Hill, NJ). rearranged and amplified genomic region containing approximately Second, naive B cells were sort-purified from patients (n 5 3) and control 5 60 to 2000 copies of Sp110 and 20 adjacent genes.2-4 An important subjects (n 3) and then cultured as above. Secretion of IgM, IgG, and IgA was determined after 10 to 12 days of culture.10 consequence of this genomic rearrangement is that it has not yet been A detailed description of the molecular methods is provided in the Methods feasible to produce a genetic knockout of Sp110 by means of gene section in this article’s Online Repository at www.jacionline.org. targeting in mice. Currently, the only readily available means to understand the pathogenesis of VODI is through the analysis of SP110-deficient cells from patients with VODI. RESULTS VODI was described initially in patients of Lebanese descent, Clinical descriptions and the perception that VODI is restricted to that population means The clinical features of 9 newly ascertained children with that VODI might not be considered in patients with severe VODI were compared with the findings in 7 historical cases immunodeficiencies of other ethnic backgrounds. Here we extend (Table I). The age at presentation ranged from 2 to 11 months. The studies into VODI through the analysis of B-cell function in a presenting features included cytomegalovirus (CMV)–related larger cohort of patients with VODI, describing the phenotypes in 9 hepatitis (patient 1), respiratory distress (patient 2), fever and res- further patients, 4 of whom have novel mutations in SP110 (2 Ital- piratory symptoms (patient 4), and failure to thrive, respiratory ian, 1 Arabic, and 1 Hispanic). We present additional data on the distress, and diarrhea (patient 5), with neonatal testing before dis- cellular immunologic defect in patients with VODI, demonstrating 2 1 ease onset in 1 case (patient 3). Pathogen isolation included dis- an absence of CD10 CD27 B memory cells and intrinsic B-cell seminated CMV infection (hepatic, oropharyngeal, and vulval response to T-cell stimulation. Gene expression studies in patients’ in patient 1), rotavirus-related gastroenteritis, and respiratory B cells showed altered expression of several immunologic genes, Pneumocystis jiroveci (patients 4 and 5). Among the entire group suggesting additional studies into the biology of VODI. of 16 patients, clinical hepatosplenomegaly was detected in 12 patients at presentation. Results of hepatic biopsy in patient 1 were METHODS consistent with hVOD, and PCR of the hepatic biopsy material Subjects was positive for CMV. Patients with a clinical or immunologic presentation consistent with VODI Idiopathic cerebrospinal leukodystrophy was present in 3 of were tested for mutations in SP110. Mutations were identified in patients 1, 2, 16 patients (patients 5, 6, and 10), suggesting that this compli- 4, 5, and 10 to 16 at South East Area Laboratory Services, Sydney, Australia. cation should be sought in patients with VODI. The leukodys- Molecular studies in patient 3 were carried out at Hadassah University Hospi- trophy in patient 6 occurred after CMV-related gastroenteritis and tal, Jerusalem, Israel. Patients 6 to 9 were studied at the Hotel-Dieu^ de France resulted in lower limb paralysis that is resolving. Patients 5 and 10 Hospital and the Unit of Medical Genetics, Saint Joseph University, Beirut, had idiopathic central nervous system leukodystrophy. Unique Lebanon, in collaboration with the Laboratoire d’Immunogenetique Molecu- patient features included inappropriate antidiuretic hormone laire, Institut de Genetique Humaine, Montpellier, France. secretion (patient 5) and pulmonary fibrosis (patient 2). The mortality rate for VODI was previously reported as 100% Immunologic methods in the first year of life. In contrast, there have been only 3 deaths The frequencies of transitional (CD201CD101CD272), naive among the 8 newly ascertained patients older than 1 year, (CD201CD102CD272), and memory (CD201CD102CD271) B cells were representing a markedly improved prognosis with early J ALLERGY CLIN IMMUNOL CLIFFE ET AL 737 VOLUME 130, NUMBER 3

TABLE I. Clinical features of patients with SP110 mutations and their VODI-affected relatives SP110 Age of diagnosis and Patient mutation general/hepatic presenting features Other clinical and histologic findings Alive/deceased Patients reported in this study Patient 1, Italian c.319_325dup Age 11 mo: hepatosplenomegaly, Recovering from hVOD, well Alive exon 4 disseminated CMV infection, rotavirus-related gastroenteritis, vulvar abscesses, hVOD Patient 2, Italian c.66711dup Age 3 mo: hepatosplenomegaly, failure Hepatic biopsy consistent with Alive exon 5 to thrive, respiratory distress/lung sinusoidal dilatation and moderate fibrosis, diarrhea central vein and perivenular subsinusoidal fibrosis; stable with improvement Patient 3, Palestinian c.373del Age 3 mo: diagnosis of VODI Stable and well Alive age 2 mo Arabic exon 4 confirmed with cascade testing before illness onset; no hepatomegaly or liver function abnormalities Patient 4, Hispanic c.78_79delinsAT Age 5 mo: Hepatomegaly, fever, Recovered from hVOD, stable and well Alive exon 2 respiratory distress, pancytopenia Patient 5, Lebanese c.642del Age 3 mo: respiratory distress SIADH, idiopathic cerebrospinal Alive exon 5 leukodystrophy Patient 6, Lebanese c.642del Age 3 mo: chronic cough, diarrhea Raised PT from age 2 y, idiopathic left Alive age 21 y exon 5 hepatosplenomegaly noted at age frontal lobe white matter calcified 8 y, hVOD from age 12 y cyst at 7 y, delayed puberty to 18.5 y, blunted mammary development, irregular menses, epilepsy, CMV-related colitis, postdiarrheal encephalomyelitis with lower limb paralysis, cerebrospinal leukodystrophy, esophageal candidiasis, duodenal lymphocytic infiltrate at 8 y, treated regular IMIG 3 mo to 9 y and IVIG subsequently Patient 7, Lebanese c.642del Age 2 mo: chronic diarrhea, failure to Microcephaly, Hepatic biopsy Deceased, 11 mo diarrhea presumed thrive, middle ear and respiratory consistent with hVOD leading to septic shock infections, hepatosplenomegaly, thrombocytopenia Patient 8, Lebanese c.642del Age 5 mo: upper respiratory tract Hepatic biopsy consistent with hVOD Deceased, 3.5 y, diarrhea presumed illness, age 8 mo chronic diarrhea, leading to septic shock hepatomegaly, thrombocytopenia Patient 9, Lebanese c.642del Age 2 mo: ascites, hepatomegaly, Hepatic biopsy consistent with hVOD Deceased, 2.5 mo otitis, presumed anemia, thrombocytopenia diarrhea, pneumonia Previously reported patients* Patient 10 c.642del Age 5 mo: immunodeficiency, Left hemiparesis secondary to Deceased exon 5 thrombocytopenia, hVOD leukodystrophy, recurrent hVOD with GVHD after HSCT Patient 111 c.642del Age 4 mo: hepatosplenomegaly, ascites, Chronic liver disease, portal Deceased exon 5 hVOD, thrombocytopenia, hypertension posthepatic mucocutaneous candidiasis transplantation Patient 12 c.642del Age 7 mo: immunodeficiency Chronic lung disease secondary to Deceased (age 19 y) exon 5 recurrent aspiration Patient 13 c.642del Age 6 mo: hepatosplenomegaly, ascites, Well Alive exon 5 hVOD Patient 14 c.642del Age 3 mo: hepatosplenomegaly, ascites, Hemophagocytic syndrome after Deceased exon 5 hVOD hepatic transplantation Patient 15 c.40del Age 3 mo: immunodeficiency, Enteroviral and P jiroveci infection Deceased exon 2 thrombocytopenia, hepatosplenomegaly without definite evidence of hVOD Patient 16 c.642del Age 3 mo: hepatosplenomegaly, ascites, Pulmonary hemorrhage, multiorgan Deceased exon 5 hVOD failure

Modiﬁed from Roscioli et al.1 Although patients 6 to 12 are not known to be related, they are believed to share a recent common ancestor. Patients 10 to 13 were included in the initial homozygosity mapping analysis. IgA and IgM serum concentrations increased to the lower limit of normal while receiving IVIG. GVHD, Graft-versus-host disease; HSCT, hematopoietic stem cell transplantation; IMIG, intramuscular immunoglobulin; PT, prothrombin time; SIADH, syndrome of inappropriate secretion of antidiuretic hormone. *Patients 10 to 15 are, respectively, AII.1, BII.1, CII.1, CII.2, DII.1, and E from Roscioli et al1 plus an additional unreported patient (patient 16). 738 CLIFFE ET AL J ALLERGY CLIN IMMUNOL SEPTEMBER 2012

FIG 1. Coexpression of SP140 (A, D, and G, green), wild-type SP110 (B, red), and mutant SP110I27L (SP110leu; E and H, red). The merged fluorescence images in Fig 1, A and B, D and E, and G and H, are shown in panels C, F, and I, respectively. DAPI staining in Fig 1, C, F, and I, indicates the location of nuclei. recognition and treatment with intravenous immunoglobulin mutation. Quantitative PCR of SP110 mRNA extracted from a (IVIG) and P jiroveci prophylaxis. Patient 10 died after hVOD re- lymphoblastoid cell line from this patient showed a reduction in currence after bone marrow transplantation (BMT) at age 6 years. SP110B mRNA expression to levels of 38% 6 2.1% and a reduc- Two patients died after complications following hepatic trans- tion in SP110C expression to levels of 28% 6 4.4% compared plantation: patient 11 with chronic hepatic disease and portal hy- with those seen in control subjects, which is consistent with pertension and patient 14 with hemophagocytic syndrome. The 5 nonsense-mediated decay. patients who have survived are receiving P jiroveci pneumonia The novel allele in patient 2 causes the duplication of the final prophylaxis with cotrimoxazole and IVIG. Patients 1 and 4 re- base of exon 5, c.66711dup. The levels of SP110B and SP110C main stable on this treatment, whereas patients 2 and 5 have mRNA were reduced to 36% 6 2.7% and 66 6 1.9%, respec- shown slow improvement. Patient 6, having survived into adult- tively, compared with those of control subjects, which is consis- hood, has been treated with monthly IVIG and 300 mg of pentam- tent with this mutation acting as a frameshift mutation, with the idine di-isethionate at intervals of 6 to 8 weeks. Patient 3 comes introduction of a premature stop 4 codons 39 of the mutation from a family in which 2 of 3 children with VODI who were resulting in nonsense-mediated mRNA decay. BMT recipients were cured and have been long-term survivors. The mutation in patient 3 is a single base pair deletion in exon In an effort to further understand the specificity of the VODI 4, c.373del, which is predicted to result in a frameshift mutation, phenotype for SP110 mutations, this gene was sequenced in addi- p.(Thr125Leufs), with premature protein truncation occurring 3 tional patients with atypical but overlapping features of VODI. No codons 39 of the mutation. Patient mRNA was not available for SP110 mutations were detected in 5 additional patients with over- further analysis. lapping phenotypes referred for SP110 mutation screening. The Patient 4 has the first missense mutation in VODI, a deletion/ clinical features of this group are provided in the Results section insertion mutation, c.78_79delinsAT, involving the third base of in this article’s Online Repository at www.jacionline.org. codon 26 and the first base of codon 27, p.(Ile27Leu). The predicted substitution has a Grantham distance of 5 but is predicted to be damaging by using PolyPhen2 (score 5 0.949) SP110 mutation detection and validation because it is located within the highly conserved N-terminal Four novel homozygous SP110 mutations were detected in the SP100 domain.11-13 To test whether the mutant protein could still new VODI cohort, bringing the total number of known disease al- be incorporated into nuclear bodies, plasmids encoding SP110wt leles to 6 (Table I). The novel allele in patient 1 is a homozygous or SP110I27L were cotransfected with SP140wt into SP110- and 7-bp tandem duplication in exon 4, c.319_325dup, which is pre- SP140-nonexpressing Hep-2 cells.13 Coexpression of SP140wt dicted to cause a frame-shift mutation, p.(Ser109Trpfs), with (Fig 1, A, D,andG, green signal) and SP110wt (Fig 1, B, red signal) the introduction of a premature stop codon 5 codons 39 of the resulted in colocalization of both proteins in nuclear bodies. J ALLERGY CLIN IMMUNOL CLIFFE ET AL 739 VOLUME 130, NUMBER 3

TABLE II. Immunologic ﬁndings in 6 patients with VODI Patient no.* 1234 5 6 Age 11 mo 7 mo 1 wk 9 mo 7 mo 21 y Mutation in SP110 c.319_325dup c.66711dup c.373del c.78_79delinsAT c.642del c.642del IgG 139à 55à NN 83à 353§ 781§ IgA 15à 1à NN <7à 8à,§ <22à,§ IgM 24à 6à NN <7à 4à,§ <17.7à,§ Total lymphocyte count (3 109/L) 2.33à 4.8 5.0 2 1.83 0.28-0.7à,k CD3 (3 109/L) 1.8à 2.6 4.0 1.3à 0.58à 0.20-0.46à,k CD4 (3 109/L) 1.1à 3.6 3.0 0.74à 0.46à 0.11-0.23à,k CD8 (3 109/L) 0.68 1.1 0.9 0.58 0.13à 0.03-0.12àk CD19 (3 109/L) 0.21à 2.0 0.15à 1.1 1.13 0.05-0.15à,k NK cells CD16, CD56 (3 109/L) NA 0.1à 0.85 NA 0.05à 0.013-0.07à,k HLA-DR (3 109/L) 0.26 NA NA NA 0.04à (0.17-0.39) NA

NA, No result available; NN, neonatal. *Patient numbering follows that used in Table I. Reference sequence NM_080425.2. àLow value for age.15 §Receiving IVIG therapy: the immunoglobulin levels in patient 6 were measured immediately before immunoglobulin infusion and represent the mean of 7 observations. kRange of the values for 6 observations made between the ages of 15 and 21 years.

When SP140wt and SP110I27L were coexpressed, SP140 was de- TABLE III. Immunophenotyping in patients with SP110 mutations tected in nuclear bodies (Fig 1, D), but only very low levels of and control subjects I27L I27L SP110 were detected (Fig 1, E). In rare cells SP110 was Transitional detected by using indirect immunofluorescence and was observed CD201 B cells (%) B cells (%) to colocalize with SP140 (Fig 1, D, E, and F, white arrow). These Transitional Naive Memory I27L results show that although the overall level of SP110 was Age (y) (%) (%) (%) CD21lo CD21hi markedly reduced in transfected cells, the residual SP110I27L Cases (patients with VODI) was capable of being imported into nuclear bodies. ; I27L 1 5 47.1 42.4 4.89 44.9 55.1 SP140 and SP110 were expressed in Hep-2 cells and 1* 5 17.2 74.7 4.06 60.4 39.6 cultured in the presence of the proteosome inhibitor MG132 to 4 3 44.9 51.4 1.09 55.5 44.5 I27L explore whether SP110 protein instability could account for 5 4.5 35 63.5 0.45 ND ND these findings.14 After 4 hours of exposure to MG123, SP110I27L 13 13 29.8 68.7 0.97 47.4 52.6 was easily detected in transfected cells (Fig 1, H, red signal), 13* 16 16.4 81.6 1.3 ND ND which is consistent with the SP110I27L protein being subject to en- Mean 31.7 63.7 2.1à 52.05 47.95 hanced proteosome degradation. These data suggest that marked SD 13.2 14.6 1.9 7.2 7.2 reductions in SP110 protein levels are the major pathogenic SE 5.3 6.0 0.76 3.6 3.6 Control subjects mechanism underlying VODI in this patient. 1 2.3 4.35 8.96 58.2 13.7 86.3 2 14 8.75 60.4 27.3 31.4 68.6 3 1.6 31.4 42.3 22.5 47.0 53.0 Immune phenotyping in patients with VODI 4 2.1 12.2 57.2 28.7 35.9 64.2 Comparisons were made for B- and T-cell subsets between 5 13.6 68.2 16.1 ND ND patients 1 and 6 (Table II).15 In contrast with a previous report, the 6 9.2 68.9 19.1 ND ND majority of patients with VODI had reduced circulating T-cell Mean 13.3 51 28.7 32.0 68.03 SD 9.5 22.7 15.2 13.8 13.8 numbers, B-cell numbers, or both for their age.16 Subsets of hu- SE 3.9 9.3 6.2 6.9 6.9 man B cells can be resolved by the differential expression of CD10, CD21, and CD27 and other cell-surface antigens into sub- ND, Not determined. à classes of transitional, naive, and memory B cells (Table III). The Significance testing: P < .05 and P < .01. *Samples collected from patients at different times. proportion of B cells that were memory cells was significantly reduced in patients with VODI compared with published reference ranges and age-matched control subjects (2.1% 6 0.8% vs 28.7% more mature population of CD21hi transitional cells (48.9% 6 6 6.2%, P 5 .0085). Analysis of the contracted population of 3.6% vs 68.0% 6 6.9%, P < .05) in patients with VODI (Table memory B cells in 2 patients with VODI demonstrated an absence III). Together, these findings suggest a specific role for SP110 of immunoglobulin isotype–switched cells (not shown). Thus mu- in the differentiation of naive B cells into memory B cells or tations in SP110 not only impair the generation of memory B cells the survival of these effector B cells. but also impair the ability of B cells to undergo immunoglobulin To extend the observations of a defect in memory B-cell class-switching. The distribution of subsets of transitional B cells generation in patients with VODI, we examined patients’ B cells was also altered, with a significant increase in the proportions of for their ability to undergo in vitro differentiation into the less mature CD21lo transitional B cells (52.1% 6 3.6% vs immunoglobulin-secreting cells. Comparison of total B cells 32.0% 6 6.9%, P < .05) and a corresponding decrease in the from healthy donors and patients with VODI revealed an 740 CLIFFE ET AL J ALLERGY CLIN IMMUNOL SEPTEMBER 2012

TABLE IV. Immunoglobulin secretion in response to CD40L 6 IL-21 Immunoglobulin secretion (ng/mL) Control subjects Patient 1 Patient 4 Patient 13 Total B cells CD40L 1 IL-21 CD40L 1IL-21 CD40L 1 IL-21 CD40L 1 IL-21 IgM 742 6 384 32,315 6 8,433 3.9 6 0.2 11,300 6 786 16.5 6 1.5 4,081 6 462 42.5 6 1.0 920 6 54 IgG 22 6 14 12,661 6 6,660 0.6 6 0.1 290 6 7.1 0 135 6 8 5.7 6 4.7 30.8 6 6.2 IgA 63 6 26 17,700 6 7,200 6.3 6 0 221 6 161 7.0 6 0.2 56.1 6 11.8 1.9 6 0.3 9.2 6 2.4

Control subjects Patient 1 Patient 5 Patient 13 Naive B cells CD40L 1 IL-21 CD40L 1 IL-21 CD40L 1 IL-21 CD40L 1 IL-21 IgM 18.7 6 9.8 4,087 6 2,245 2.5 6 0.2 541 6 42 4.8 6 2.7 4.8 6 2.7 5.6 6 0.5 222 6 19 IgG 0 13.3 6 8.4 0 1.7 6 1.5 0 0 0 0.27 6 0.04 IgA 0 105 6 36 0 0 0 0 0 0 impairment of B cells from patients with VODI to produce IgM from cultures stimulated with CD40L and CD40L/IL-21, respec- (6-fold reduced), IgG (>100-fold reduced), and IgA (>100-fold tively; however, only 2.2% and 8.6% of B cells from patients with reduced) in response to stimulation with CD40L and IL-21 VODI were viable at the time of harvest. Thus B cells harboring (Table IV). These differences did not simply reflect differences mutations in SP110 exhibit greatly diminished responses in vitro in the composition of the B-cell populations in control subjects compared with their healthy counterparts; this in part results from and patients because analysis of flow-sorted naive B cells gener- reduced survival and subsequent proliferation rather than the gene ated similar results, with naive B cells from patients with VODI mutation selectively abolishing the ability of naive B cells to un- producing 10-fold less IgM and being unable to produce IgA dergo differentiation into immunoglobulin-secreting cells. The (3/3 patients) and IgG (2/3 patients) in response to CD40L/ impaired survival and activation of B cells in vitro most likely ex- IL-21 (Table IV). The decreased ability of B cells from patients plains the hypogammaglobulinemia that is typical of patients with with VODI to secrete immunoglobulin after culture with VODI. This could also contribute to the memory B-cell deficiency CD40L/IL-21 was replicated in cultures with CD40L/CpG, in in these patients. which secretion of IgM by naive B cells from patients with VODI was also approximately 10-fold compared with that seen in naive B cells of healthy subjects (experiment 1: control sub- Expression microarray analysis of EBV-transformed jects, 2235 6 295 ng/mL IgM; patient 13, 254 6 7 ng/mL; exper- B-lymphoblastoid cells iment 2: control subjects, 1200 6 90 ng/mL IgM; patient 1, 88 6 The molecular pathogenesis of VODI is incompletely under- 16 ng/mL). These results were also independently confirmed in stood. Gene expression microarray studies were performed on patient 2 by the lack of increased immunoglobulin production EBV-transformed B cells from 4 patients with VODI who were from PBMCs cultured with an anti-CD40 mAb and IL-10. In sum- homozygous for the mutation c.642del together with 5 control mary, SP110 mutations compromise the intrinsic ability of B cells subjects. The Statistical Analysis of Microarrays (SAM) software to respond to T cell–dependent stimuli and differentiate into identified 216 known protein-encoding genes that showed greater immunoglobulin-secreting cells in vitro. than 1.5-fold expression differences between patients with VODI The compromised differentiation of naive B cells to and control subjects (see Fig E2 and Table E1 in this article’s On- immunoglobulin-secreting cells might well reflect a general line Repository at www.jacionline.org). Microarray results were defect in the activation and survival of B cells from patients validated by using a TaqMan Gene Expression Assay (AB Life with VODI, which would be consistent with the reduction in Technologies, Carlsbad, Calif) based on the mean case/control absolute numbers of lymphocytes in these patients. Naive B cells expression differences among 14 selected genes (r2 5 0.88). were isolated from the blood of patient 5, labeled with carboxy- Notably, CD27 and SP110 showed approximately 3- to 5-fold fluorescein succinimidyl ester, and then cultured with CD40L mRNA downregulation, whereas SP100 and SP140 showed nor- alone or together with IL-21 to investigate this further. After mal expression levels consistent with the known cause of VODI. 5 days, cell proliferation was determined by assessing dilution of The 216 differentially expressed protein-coding genes were carboxyfluorescein succinimidyl ester. Although IL-21 strongly analyzed by using the Database for Annotation, Visualization and promoted the expansion of normal naive B cells, the effects of Integrated Discovery (DAVID) version 6.7 software to identify IL-21 on the proliferation of B cells from patients with VODI functional annotations with multiple gene expression differ- were markedly reduced (ie, only 65% of B cells from patients ences.17,18 The most biologically relevant annotation cluster con- with VODI had entered division compared with >95% of normal tained differentially expressed immune system genes involved in naive B cells). Consistent with this reduced level of proliferation B- and T-cell activation/differentiation (P 5 .0065), the majority was a marked diminution in the frequency of naive B cells from of which were also present in the Resource of Asian Primary patients with VODI that underwent isotype switching to acquire Immunodeficiency Diseases (RAPID) database of known and expression of IgG in response to CD40L/IL-21 stimulation candidate primary immunodeficiency genes.19 A systematic search (<0.5% B cells from patients with VODI vs 2.3% normal naive of the RAPID database for differentially expressed genes identified B cells), a differentiation event that is linked to cell division.15 It 4 known genes (ADA, CIITA, SP110, and TNFRSF13C)and14 was also apparent from this analysis that a greatly reduced propor- candidate primary immune deficiency genes (IRAK3, REL, tion of naive B cells from patients with VODI survived in vitro. PTK2, TNFSF4, STK17B, RUNX1, CD83, ANXA5, HOXB7, LY9, Specifically, 33% and 61% of normal B cells were recovered ZBTB32, CD27, SIT1, and HLA-C), as well as 3 immunoregulatory J ALLERGY CLIN IMMUNOL CLIFFE ET AL 741 VOLUME 130, NUMBER 3 proteins (AIM2, IL12A, and CD84). Analysis of differentially reg- intrinsic inability of B cells to undergo isotype switching, as ulated genes identified many with roles either in late B-cell differ- seen in patients with hyper-IgM syndrome caused by mutations entiation or immunity to mycobacterial infections that are features in CD40LG or AICDA, or a T-cell defect of costimulation, as of SP110 deficiency in human subjects and a murine model, has been demonstrated for ICOS mutations in patients with respectively. common variable immunodeficiency and SH2D1A mutations in patients with X-linked lymphoproliferative syndrome. Naive B cells obtained from 3 patients with VODI secreted 20% of DISCUSSION the normal levels of IgM and 1% of the normal levels of IgG Until this point, the diagnosis of VODI has been confined to and IgA in response to CD40L plus IL-21 costimulation, which persons of Lebanese descent. The identification of 4 new alleles is consistent with a block in B-cell differentiation between naive from Italian, Arabic, and Hispanic patients both broadens the and ‘‘early’’ germinal center B cells and before the establishment mutation spectrum and indicates that the diagnosis of VODI of memory B cells.20 Therefore the molecular pathogenesis of should be considered in any child who presents with the combi- VODI most likely involves the disruption of a pathway affecting nation of hypogammaglobulinemia and hepatic disease. initial events underlying B-cell activation required for their entry Overall, the clinical findings in the 9 newly identified patients into germinal centers and subsequent differentiation and survival validate the previously published clinical guidelines for a VODI as effector memory and plasma cells. diagnosis.1 The majority of patients with SP110 mutations pre- Expression microarray studies provide a well-validated mech- sented before 6 months of age, except for a single patient (patient anism to characterize the molecular changes underlying cellular 1, c.319_325dup) who presented at 11 months of age. The im- phenotypes. This study demonstrated altered expression affecting mune phenotype was consistent between the 2 groups and charac- several late B-cell differentiation pathways. One involved a 3-fold terized by hypogammaglobulinemia in all, reduced memory decrease in the expression of CD27. It is of interest that several B cells with either a mild lymphopenia in the majority, or normal other members of the TNF receptor superfamily were also shown lymphocyte numbers. Virtually all patients had hepatic failure or to have altered expression patterns that might affect B-cell hepatomegaly at the time of presentation. A significant improve- function.21,22 TNFRSF13C/BAFFR was found to be downregu- ment in the VODI recovery rate from 20% in the initial group to lated approximately 2-fold. Binding of B cell–activating factor 100% in the recently identified group was identified. Similarly, a of the TNF family to its receptor encoded by the TNFRSF13C reduced mortality at a given age has been noted in the more recent gene delivers a powerful survival signal to B-cell receptor–posi- cohort. BMT has been curative in 2 of 4 children with VODI. tive B cells.23 The identification of 2- to 2.8-fold decreased These findings suggest that earlier disease recognition and im- expression for 2 members of the SLAM family in cells from pa- proved VODI management have resulted in reduced early mortal- tients with VODI, LY9 (SLAMF3/CD229) and CD84 (SLAMF5), ity and that BMT, when carried out early before disease onset, is also consistent with the failure of production of memory B cells might be successful. in patients with VODI because these molecules are expressed at A striking new finding is the presence of neurological abnor- increased levels on memory B cells compared with naive malities, notably cerebrospinal leukodystrophy in 3 (20%) B cells.24 In contrast, the gene encoding the T- and B-cell antigen patients with VODI. Patient 5 had a leukodystrophy of unknown CD83 demonstrated a 2.5-fold increase in its expression. Overex- cause, and patient 6 developed this complication after CMV- pression of CD83 has been associated with inhibition of late mat- related gastroenteritis. In patient 10 the initial diagnosis of uration of B cells.25 Toxoplasmosis or a porencephalic cyst was revised to being SP110 deficiency leads to supersusceptibility to mycobacterial more consistent with cerebrospinal leukodystrophy. We speculate infection in the C3HeB/FeJ murine strain, but patients with VODI that the frequency of cerebrospinal leukodystrophy might have do not appear to be at increased risk of mycobacterial diseases. been previously underestimated. Lung fibrosis of unknown cause Gene expression differences between cells from patients with was identified only in patient 2 (SP110 c.66711dupG). VODI and control cells, however, implicate SP110 deficiency in The range of mutational events that have been described in disturbances of IL-12/IFN-g pathways, which play pivotal roles patients with VODI has been significantly extended in this study in the resistance to mycobacterial infection.26 Expression of to include 3 new frameshift mutations and 1 missense mutation. IL12A encoding the IL-12 p35 subunit was reduced 5.7-fold either All reported mutations are homozygous, cluster within the first as the direct consequence of lack of SP110 expression or possibly part of the gene (exons 2, 4, and 5) and predicted to affect all indirectly as a result of the 5- to 10-fold increased expression of mRNA isoforms of SP110. The dinucleotide deletion/insertion IRAK3, both of which have been implicated in a reduction in mutation involves a highly conservative amino acid substitution the ability of macrophages to control mycobacterial infection.27 that nevertheless produces profound effects on SP110 protein sta- The 5.5-fold increased expression of REL, a member of the nu- bility. Therefore the key pathogenic event in the development of clear factor kB family of transcription factors, which is capable VODI in all cases reported to date appears to be a lack of fully of inducing IL-12 expression, might result from feedback initi- functional SP110 protein. ated by the reduction of IL-12. Annexin 5 also shows decreased The B-cell immunodeficiency seen in patients with VODI is expression in this dataset, possibly as a consequence of decreased characterized by hypogammaglobulinemia, absence of memory signaling through the IFN-g receptor as a result of decreased IFN- B cells, lymph node germinal centers, and tissue plasma cells but g production.28 Cells from patients with VODI have also been is distinguished from other defects of late B cells, such as hyper- shown to have a 5.8-fold reduction in AIM2 expression. AIM2 IgM syndrome and common variable immunodeficiency, by the is involved in sensing of intracellular pathogens through the bind- involvement of CD41 T memory cells. Here we have confirmed ing of bacterial/viral DNA and subsequent triggering of the cas- that patients with VODI have a severe deficiency of switched pase-1–mediated proinflammatory cytokines, which ultimately memory B cells. Such B-cell deficits might be due to either an leads to macrophage cell death.29 The extensive disturbance 742 CLIFFE ET AL J ALLERGY CLIN IMMUNOL SEPTEMBER 2012 seen in mediators of mycobacterial infection control in the differ- 6. Cuss AK, Avery DT, Cannons JL, Yu LJ, Nichols KE, Shaw PJ, et al. Expansion of ential gene expression studies suggests that SP110 deficiency in- functionally immature transitional B cells is associated with human- immunodeficient states characterized by impaired humoral immunity. J Immunol fluences pathways of mycobacterial resistance in both human 2006;176:1506-16. subjects and mice but that the genomic alteration of the Sp110 re- 7. Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. gion either alone or in combination with other genetically linked Predominant autoantibody production by early human B cell precursors. Science events might contribute to the supersusceptibility phenotype of 2003;301:1374-7. the C3HeB/FeJ murine strain. 8. Suryani S, Fulcher DA, Santner-Nanan B, Nanan R, Wong M, Shaw PJ, et al. Dif- ferential expression of CD21 identifies developmentally and functionally distinct In conclusion, the major findings in this report include confir- subsets of human transitional B cells. Blood 2010;115:519-29. mation of the major diagnostic criteria for VODI and the clinical 9. Ma CS, Hare NJ, Nichols KE, Dupre L, Andolfi G, Roncarolo MG, et al. Impaired utility of SP110 mutation testing in non-Lebanese patients with humoral immunity in X-linked lymphoproliferative disease is associated with de- hypogammaglobulinemia and hVOD. The discovery of 4 new dis- fective IL-10 production by CD41 T cells. J Clin Invest 2005;115:1049-59. 10. Ellyard JI, Avery DT, Phan TG, Hare NJ, Hodgkin PD, Tangye SG. Antigen-se- ease alleles confirms that the major pathogenetic mechanism for lected, immunoglobulin-secreting cells persist in human spleen and bone marrow. this disorder involves reduction of functional protein levels either Blood 2004;103:3805-12. because of frameshift mutation with premature truncation or pro- 11. Nicewonger J, Suck G, Bloch D, Swaminathan S. Epstein-Barr virus (EBV) SM tein instability. Patients with VODI have a greatly reduced ability protein induces and recruits cellular Sp110b to stabilize mRNAs and enhance to produce IgM but are also unable to switch to IgG or IgA, result- EBV lytic gene expression. J Virol 2004;78:9412-22. 12. Seeler JS, Marchio A, Sitterlin D, Transy C, Dejean A. Interaction of SP100 with ing in a susceptibility to opportunistic infections. Patients with HP1 proteins: a link between the promyelocytic leukemia-associated nuclear bod- VODI are unable to form germinal centers, resulting in a reduced ies and the chromatin compartment. Proc Natl Acad Sci U S A 1998;95:7316-21. frequency of memory B cells and hypogammaglobulinemia. The 13. Bloch DB, Nakajima A, Gulick T, Chiche JD, Orth D, de la Monte SM, et al. VODI B-cell phenotype is reminiscent of the primary immunode- Sp110 localizes to the PML-Sp100 nuclear body and may function as a nuclear hormone receptor transcriptional coactivator. Mol Cell Biol 2000;20:6138-46. ficiency disorders in which the formation of germinal center 14. Dallaporta B, Pablo M, Maisse C, Daugas E, Loeffler M, Zamzami N, et al. Pro- B cells is compromised. The T-cell immune profile in patients teasome activation as a critical event of thymocyte apoptosis. Cell Death Differ 1 1 2 with VODI shows the absence of CD4 /CD45RO /CD27 2000;7:368-73. memory T cells, which might contribute to T cell–dependant in- 15. Shearer WT, Rosenblatt HM, Gelman RS, Oyomopito R, Plaeger S, Stiehm ER, fection susceptibility, such as P jiroveci. Central memory and ef- et al. Lymphocyte subsets in healthy children from birth through 18 years of age: the Pediatric AIDS Clinical Trials Group P1009 study. J Allergy Clin Immunol fector memory functions are therefore impaired in both cell 2003;112:973-80. lineages; however, it is unclear whether the susceptibility to P jir- 16. Tangye SG, Avery DT, Hodgkin PD. A division-linked mechanism for the rapid gen- oveci is related to T- or B-cell impairment. Expression microarray eration of Ig-secreting cells from human memory B cells. J Immunol 2003;170:261-9. studies have identified pathways involved in changes in mRNA 17. Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, et al. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol levels of genes involved in B-lymphocyte differentiation and 2003;4:P3. macrophage function. Taken together, these studies have pro- 18. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of vided insight into some of the molecular changes underlying large gene lists using DAVID bioinformatics resources. Nat Protoc 2009;4:44-57. the observed VODI phenotypes and represent a rich source of ob- 19. Keerthikumar S, Raju R, Kandasamy K, Hijikata A, Ramabadran S, Balakrishnan servations for further investigation. L, et al. RAPID: Resource of Asian Primary Immunodeficiency Diseases. Nucleic Acids Res 2009;37:D863-7. 20. Tangye SG, Good KL. Human IgM1CD271 B cells: memory B cells or ‘‘mem- C.A., A.M., and G.L. are particularly indebted to the Lebanese patient and ory’’ B cells? J Immunol 2007;179:13-9. her parents for their continued cooperation. They acknowledge warmly also all 21. Agematsu K, Nagumo H, Oguchi Y, Nakazawa T, Fukushima K, Yasui K, et al. Generation of plasma cells from peripheral blood memory B cells: synergistic ef- the members of the Unit of Medical Genetics, Pediatrics and Immunology ^ fect of interleukin-10 and CD27/CD70 interaction. Blood 1998;91:173-80. Departments, Faculty of Medicine, Hospital Hotel-Dieu de France, Saint 22. Jacquot S, Kobata T, Iwata S, Morimoto C, Schlossman SF. CD154/CD40 and Joseph University, Beirut, Lebanon, for their invaluable help. CD70/CD27 interactions have different and sequential functions in T cell- dependent B cell responses: enhancement of plasma cell differentiation by CD27 Clinical implications: Infants with hypogammaglobulinemia signaling. J Immunol 1997;159:2652-7. and hVOD should be screened for mutations in the SP110 23. Mihalcik SA, Huddleston PM 3rd, Wu X, Jelinek DF. The structure of the TNFRSF13C promoter enables differential expression of BAFF-R during B cell gene, regardless of ethnic origin. ontogeny and terminal differentiation. J Immunol 2010;185:1045-54. 24. Romero X, Benitez D, March S, Vilella R, Miralpeix M, Engel P. Differential expression of SAP and EAT-2-binding leukocyte cell-surface molecules CD84, CD150 REFERENCES (SLAM), CD229 (Ly9) and CD244 (2B4). Tissue Antigens 2004;64:132-44. 1. Roscioli T, Cliffe ST, Bloch DB, Bell CG, Mullan G, Taylor PJ, et al. Mutations in 25. Breloer M, Kretschmer B, Luthje K, Ehrlich S, Ritter U, Bickert T, et al. CD83 is a the gene encoding the PML nuclear body protein Sp110 are associated with immu- regulator of murine B cell function in vivo. Eur J Immunol 2007;37:634-48. nodeficiency and hepatic veno-occlusive disease. Nat Genet 2006;38:620-2. 26. Al-Muhsen S, Casanova JL. The genetic heterogeneity of Mendelian susceptibility 2. Traut W, Rahn IM, Winking H, Kunze B, Weichehan D. Evolution of a 6-200 Mb to mycobacterial diseases. J Allergy Clin Immunol 2008;122:1043-53. long-range repeat cluster in the genus Mus. Chromosoma 2001;110:247-52. 27. Pathak SK, Basu S, Bhattacharyya A, Pathak S, Kundu M, Basu J. Mycobacterium 3. Weichenhan D, Kunze B, Winking H, van Geel M, Osoegawa K, de Jong PJ, et al. tuberculosis lipoarabinomannan-mediated IRAK-M induction negatively regulates Source and component genes of a 6-200 Mb gene cluster in the house mouse. Toll-like receptor-dependent interleukin-12 p40 production in macrophages. J Biol Mamm Genome 2001;12:590-4. Chem 2005;280:42794-800. 4. Agulnik S, Plass C, Traut W, Winking H. Evolution of a long-range repeat family 28. Leon C, Nandan D, Lopez M, Moeenrezakhanlou A, Reiner NE. Annexin V asso- in chromosome 1 of the genus Mus. Mamm Genome 1993;4:704-10. ciates with the IFN-gamma receptor and regulates IFN-gamma signaling. 5. Avery DT, Ma CS, Bryant VL, Santner-Nanan B, Nanan R, Wong M, et al. STAT3 J Immunol 2006;176:5934-42. is required for IL-21-induced secretion of IgE from human naive B cells. Blood 29. Alnemri ES. Sensing cytoplasmic danger signals by the inflammasome. J Clin Im- 2008;112:1784-93. munol 2010;30:512-9. J ALLERGY CLIN IMMUNOL CLIFFE ET AL 742.e1 VOLUME 130, NUMBER 3

METHODS Cell culture, mammalian cell transfection, Mutation screening and immunohistochemistry Primers were designed that flanked each of the 19 exons included in the Hep-2 cells were obtained from American Type Culture Collection SP110 mRNA isoform C (SP110C), as well as the alternately spliced exon (Manassas, Va) and maintained in Dulbecco modified Eagle medium 15a of SP110B (Fig E1). DNA was extracted from PBMCs by using standard supplemented with 10% FBS, penicillin (200 U/mL), and streptomycin (200 protocols or from paraffin-embedded tissue samples by using a Qiagen mg/mL). Plasmids encoding SP140 and SP110wt or SP110I27L were trans- DNeasy kit (Qiagen 69581, Holden, Germany). PCR was performed in a fected into Hep-2 cells by using the Effectene transfection system (Qiagen), 20-mL reaction volume containing 10 mL of AmpliTaq Gold PCR Master as directed by the manufacturer. The preparation of rabbit anti-SP140 and Mix (Invitrogen, Carlsbad, Calif), 100 ng of genomic DNA, and 5 pmol of rat anti-SP110 antisera was previously described.E1,E2 Species-specific and each of sense and antisense primers (primer sequences available on request). fluorescein- or rhodamine-conjugated secondary antisera were obtained The thermocycling conditions used were initial denaturation at 958C for 9 from Jackson ImmunoResearch Laboratories (West Grove, Pa). Cells were minutes followed by 32 amplification cycles (958C for 30 seconds, 528C fixed with 2% paraformaldehyde in PBS and permeabilized with 100% meth- for 10 seconds, 568C for 20 seconds, 608C for 20 seconds, and 728C for anol for immunofluorescent staining. Cells were stained with primary and sec- 1 minute) and a final extension of 728C for 7 minutes. Unincorporated ondary antisera, as previously described.E3 primers were removed from PCR products by means of incubation at 378C for 4 hours with 1 U of Shrimp Alkaline Phosphatase and 1U Exonuclease Microarray analyses (GE Lifesciences, Fairfield, Conn) and cycle sequenced according to stan- Cell lines from samples of 4 patients and 5 unrelated control subjects were dard protocols for BigDye Terminator version 3.1 (AB Life Technologies). cultured under the same tissue-culture conditions. The 4 patient cell lines were Sequencing products were analyzed on an ABI PRISM 3100xl Genetic An- derived from 2 unrelated patients and a sib pair, all of whom were homozygous alyzer (AB Life Technologies). for the Lebanese founder mutation c.642del. Total RNA was extracted from EBV-transformed B cells by using a QIAGEN RNeasy Mini Kit (catalog no. Mutation validation 74106) and were processed at the Australian Genome Research Facility (www. Cell culture. EBV-immortalized B-lymphoblastoid cell lines were agrf.org.au). Five hundred nanograms of total RNA was labeled with the Am- generated by using standard procedures and grown as suspension cultures in bion Total Prep RNA amplification kit (catalog no. IL1791), and the quantity RPMI 1640 (Gibco, Invitrogen, Carlsbad, Calif) supplemented with 25 mmol/ of labeled product was determined with an Agilent Bioanalyzer 2100 using the L HEPES, 10% heat-inactivated FBS, 100 U/mL penicillin, 100 mg/mL NanoChip protocol. Labeled RNA (1.5 mg) in 30 mL was hybridized to the Il- streptomycin, and 20 mmol/L L-glutamine and maintained in a humidified 5% lumina WG-6 Human version 2.0 microarray platform (containing 48,701

CO2 incubator at 378C. Cell cultures were split 1:3 every 5 to 7 days and har- probes targeting 42,648 transcripts; Illumina, San Diego, Calif) at 588C for vested for mRNA 48 hours after splitting. 16 hours on a rocking platform. After hybridization, nonspecifically bound RNA studies. Between 107 and 108 lymphoblastoid cells were washed RNA was removed according to the manufacturer’s instructions, and the spe- in PBS, pH 7.4, and total RNA was extracted with Trizol reagents (15596026; cifically bound Cy3-coupled RNA was detected with an Illumina BeadArray Invitrogen, Carlsbad, Calif), and quantified by means of UV spectroscopy. Reader. The BeadStudio software was used to convert the array signal for cDNA was generated by using the Superscript III First Strand Synthesis Sys- analysis. tem (18080051, Invitrogen) with 200 ng of starting RNA. Second-strand syn- Total RNA was isolated from cell cultures different than those used in the thesis was performed with RealMasterMix1ROX (Eppendorf 2200700). original microarray studies, converted to cDNA by using the Superscript III TaqMan Gene Expression Assays (AB Life Technologies) were performed ac- First-Strand Synthesis System (catalog no. 18080-051), and amplified by cording to the manufacturers’ instructions. means of RT-PCR with 10 mL of an Eppendorf RealMasterMix Probe ROX kit Quantitative PCR method. For the RNA experiments, TaqMan (Eppendorf AG, Hamburg, Germany), 1 mL TaqMan Probe and Primer mix, probes were selected that were specific to each SP110 isoform (Hs894000_m1 and 8 mL of cDNA. Quantitation was performed on a Corbett Research [SP110C], Hs185406_m1 [SP110B], Hs897925_m1 [SP110A], and Rotorgene RG-3000 (denaturation at 958C for 3 minutes and then 50 cycles of Hs893493_m1 [all SP110]), as well as to linked (Hs610654_m1 [SP140] 958C for 3 seconds and then 608C for 30 seconds). Each sample underwent 6 and Hs162109_m1 [SP100]) and unlinked (Hs99999902_m1 [RPLP0]) con- replications for each probe and was normalized against the ROX signal. Rel- 2DDCT trol genes. For the microarray validation, the expression of several transcripts ative expression ratios were calculated by using the 2 method for was quantitated to validate the results of the microarray in toto. Fourteen each of the endogenous housekeeping genes and then averaged. differentially expressed genes were selected, and their expression levels were measured by using TaqMan Gene Expression Assays (catalog no. Analysis of microarray data 4331182), with 3 published housekeeping genes as endogenous controls Measurable signals (Illumina Bead Studio detection P < .05) were de- GAPDH RPLP0 HPRT1 ( , Hs99999905_m1; , Hs99999902_m1; and , tected for 15,144 (35.5%) probes in cells from at least 2 cases and 3 control NDRG1 Hs99999909_m1). The targets were as follows: , Hs00608387_m1; subjects. Data were median normalized and analyzed by using the SAM CYP11A1 ADAMTS6 RNF144B , Hs00167984_m1; , Hs01058097_m1; , software to identify gene expression differences. Unlogged data were for- Hs00403456_m1; EMILIN1, Hs00170878_m1; DPYD, Hs00559279_m1; matted and manipulated with the SAM version 3.09 Addin for Microsoft RHOBTB3 STK17B MUM1 , Hs00208554_m1; , Hs00177790_m1; , Excel. The settings used included the 2-class unpaired response type, stan- BMPR2 COL4A3 Hs00213970_m1; , Hs00176148_m1; , Hs00184277_m1; dard analysis type, and T-statistic without median centering of arrays. One LAG3, Hs00158563_m1; FGFR, Hs100241111_m1; and CXCL16, thousand permutations of the data were performed with a minimum fold Hs00222859_m1. change threshold of 1.53 and a D value of 1.28, which yielded a predicted false discovery rate of 4.78%.E4 The list of differentially expressed genes PCR mutagenesis was analyzed with the DAVID software (http://niaid.abcc.ncifcrf.gov/). PCR mutagenesis was used to produce a cDNA that contained SP110 mu- DAVID recognized 216 (88.9%) of the 253 differentially expressed probes tations that mimicked the dinucleotide indel mutation in patient 4. The primers based on their Illumina probe ID as protein-encoding genes. DAVID used were 59-catgcaccagaagcttgggatc gcctatgcattacacaagccatttcc and its re- functional annotations were analyzed under the high-classification strin- verse complement, with the introduced mutations shown in italicized boldface gency option with the background assigned as the Illumina WG- font and the underlined base indicating an introduced silent HindIII restriction 6_V2_0_R4_11223189_A gene set. Enrichment P values represent 1/log10 site. Fidelity of the entire SP110 mutant cDNA was tested by means of DNA of the probability that the functional annotations would be clustered by sequence analysis. chance (cutoff P 5 1.30, equal to a probability of 0.05). 742.e2 CLIFFE ET AL J ALLERGY CLIN IMMUNOL SEPTEMBER 2012

RESULTS significant cellular immune defect. Hepatic disease in this patient Unconfirmed clinical cases with overlapping was investigated, and hVOD was identified. features The immune deficits in 4 of the 5 subjects included a Five additional patients of Swiss, French/Antillean, Turkish, predominantly T-cell lymphopenia with increased immunoglob- 5 ulin levels (Swiss patient); predominance of T lymphocytes (98% and English (n 2) origins were referred for SP110 mutation 1 1 analysis given overlapping phenotypes with VODI. No SP110 CD3 ), mostly CD4 (84%), with no signs of activated T cells mutations were detected in this group. Two patients presented (French-Antillean patient); severe hypogammaglobulinemia, in the neonatal period. The Swiss patient presented with neonatal normal T-cell subsets, with normal proliferative responses (En- hepatopathy, failure to thrive, CMV infection, and P jiroveci glish patient); and agammaglobulinemia, absent B cells, normal pneumonia. The French/Antillean patient who presented on day T-cell numbers, and severely impaired cytokine production and 6 of life had fever, abdominal distension, and hepatomegaly/in- a proliferation defect on mitogen stimulation (Turkish patient). creased hepatic artery resistance, which are thought to be consistent with hVOD. An English girl presented at 2 months of age with severe failure to thrive, and investigations detected P jiroveci in- REFERENCES fection and adenoviral and group B hemolytic streptococcal sep- E1. Madani N, Millette R, Platt EJ, Marin M, Kozak SL, Bloch DB, et al. Implication sis. Hepatic ultrasonography detected gallbladder wall thickening of the lymphocyte-specific nuclear body protein Sp140 in an innate response to human immunodeficiency virus type 1. J Virol 2002;76:11133-8. and collateral venous circulation, and a postmortem examination E2. Bloch DB, Nakajima A, Gulick T, Chiche JD, Orth D de la Monte SM, et al. detected sinusoidal congestion; however, hVOD was not present. Sp110 localizes to the PML-Sp100 nuclear body and may function as a nuclear The Turkish patient presented in childhood with severe recurrent hormone receptor transcriptional activator. Mol Cell Biol 2000;20:6138-46. respiratory tract infections with documented aspergilli, Mycobac- E3. Bloch DB, Yu JH, Yang WH, Graeme-Cook F, Lindor KD, Viswanathan A, et al. terium tuberculosis, CMV, and Crohn disease. The only adult re- The cytoplasmic dot staining pattern is detected in a subgroup of patients with primary biliary cirrhosis. J Rheumatol 2005;32:477-83. ferral was a 35-year-old Englishman with probable common E4. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied variable immunodeficiency but no infections to suggest a to ionizing radiation response. Proc Natl Acad Sci U S A 2001;98:5116-21. J ALLERGY CLIN IMMUNOL CLIFFE ET AL 742.e3 VOLUME 130, NUMBER 3

FIG E1. A model of the structure of SP110 showing the positions of VODI-associated mutations, the alternate splicing pattern of the gene, and the SP110 protein functional domains. 742.e4 CLIFFE ET AL J ALLERGY CLIN IMMUNOL SEPTEMBER 2012

FIG E2. SAM plot of the actual intensity data with the observed SAM score plotted against the ‘‘expected’’ SAM score. The line representing observed 5 expected is in black boldface, whereas the gray lines indicate the significance threshold based on a D value of 1.28. The plot shows significantly different upregulated genes in red (upper right) and significantly different downregulated genes in green (lower left) listed in Table E1. TABLE E1. List of 216 protein-encoding genes differentially expressed in cells from patients with VODI: Known and candidate primary immunodeficiency genes are highlighted 3 NUMBER 130, VOLUME IMMUNOL CLIN ALLERGY J Fold Gene Fold Fold Fold Gene symbol Illumina ID change t Test symbol Illumina ID change t Test Gene symbol Illumina ID change t Test Gene symbol Illumina ID change t Test Upregulated protein-encoding genes BAZ2B ILMN_20026 1.90 6.02E-04 EXOSC5 ILMN_6934 21.64 6.99E-03 TSPAN9 ILMN_30091 22.22 1.16E-02 FYTTD1 ILMN_5513 1.89 3.50E-03 STT3A ILMN_17585 21.65 4.25E-03 AMFR ILMN_138270 22.23 8.35E-03 IRAK3 ILMN_90041 9.61 3.62E-04 FHOD1 ILMN_14837 1.87 2.83E-02 GARS ILMN_16659 21.65 6.81E-04 ASNS ILMN_14195 22.24 2.71E-03 MYH11 ILMN_5070 8.24 1.37E-03 ABCC10 ILMN_4545 1.83 2.74E-03 C18ORF19 ILMN_17843 21.66 2.36E-03 NT5C3L ILMN_24101 22.26 1.20E-04 C4BPB ILMN_16247 7.71 1.60E-02 MARCH2 ILMN_137964 1.82 7.13E-03 PLEKHA7 ILMN_17656 21.66 2.94E-03 FAM119B ILMN_12426 22.28 3.21E-03 P2RX5 ILMN_10544 7.40 1.70E-02 FBXW7 ILMN_18088 1.81 1.11E-02 ARL5B ILMN_7087 21.66 9.75E-03 TMEM156 ILMN_13771 22.31 6.83E-03 SPINT2 ILMN_28039 5.56 1.20E-02 TMSB15A ILMN_138276 1.79 1.31E-02 GGH ILMN_9870 21.66 5.40E-03 DHRS2 ILMN_25760 22.32 7.06E-05 IRAK3 ILMN_25857 5.27 5.80E-03 POPDC2 ILMN_17743 1.77 2.84E-04 ARMET ILMN_28822 21.67 8.41E-03 BCAS4 ILMN_21706 22.33 2.36E-04 ROGDI ILMN_15661 4.98 5.21E-04 EXOC2 ILMN_3424 1.76 4.52E-04 C19ORF44 ILMN_21329 21.67 3.48E-03 SLC6A9 ILMN_8399 22.38 8.23E-04 HMHB1 ILMN_4838 4.69 1.40E-03 SUSD1 ILMN_29846 1.75 1.05E-03 OPLAH ILMN_11581 21.67 8.71E-03 SLC43A1 ILMN_20441 22.49 3.32E-04 ZEB2 ILMN_14685 4.65 1.31E-03 CUX1 ILMN_8630 1.74 1.22E-02 PDIA4 ILMN_4575 21.69 4.18E-04 LRIG3 ILMN_16293 22.74 1.02E-02 TRIB2 ILMN_1571 4.51 1.35E-02 ACP2 ILMN_3044 1.74 4.60E-03 SQSTM1 ILMN_22135 21.70 5.39E-03 WBP5 ILMN_3272 22.78 1.04E-02 VPS37B ILMN_18457 4.38 1.30E-02 PHF23 ILMN_20271 1.73 4.96E-03 AARS ILMN_29917 21.71 4.55E-03 CD84/SLAMf5 ILMN_16790 22.81 2.26E-03 C13ORF18 ILMN_19053 4.34 2.16E-04 SESN1 ILMN_5404 1.73 2.63E-03 GNPDA1 ILMN_29056 21.71 9.08E-03 TCEA3 ILMN_27218 22.96 3.38E-03 HIP1R ILMN_46681 3.90 2.48E-04 GNA15 ILMN_15421 1.72 5.62E-03 CDT1 ILMN_18895 21.72 8.05E-03 UPP1 ILMN_21817 23.01 1.37E-04 C21ORF91 ILMN_19108 3.88 1.45E-04 TM7SF3 ILMN_7797 1.69 2.92E-03 C21ORF57 ILMN_21121 21.73 3.30E-02 LRRC26 ILMN_41107 23.08 2.59E-03 DPYD ILMN_19002 3.82 7.16E-03 SUMF1 ILMN_15497 1.67 1.36E-03 C5orf45 ILMN_15322 21.73 8.49E-03 SLC45A3 ILMN_12972 23.12 2.00E-03 KCNMB4 ILMN_2977 3.74 1.03E-02 MKL1 ILMN_25866 1.61 2.96E-03 EMP3 ILMN_7403 21.75 1.08E-02 MANEAL ILMN_11393 23.14 5.09E-03 CFP ILMN_24742 3.70 8.03E-04 TMTC4 ILMN_1347 1.59 3.27E-03 FLCN ILMN_27063 21.76 4.12E-03 ZBTB32 ILMN_2617 23.17 8.68E-04 SLC4A11 ILMN_14571 3.65 7.40E-04 ADA ILMN_8067 1.57 1.42E-02 TBC1D3C ILMN_137028 21.76 5.38E-03 PKHD1L1 ILMN_18858 23.21 1.23E-02 ACOXL ILMN_6767 3.60 2.47E-03 C7ORF49 ILMN_9001 1.56 4.09E-03 PPP1R15A ILMN_1024 21.77 1.32E-03 LCE1D ILMN_24033 23.34 5.64E-04 RORA ILMN_114182 3.55 2.02E-02 PACS2 ILMN_22761 1.55 5.70E-03 RPL39L ILMN_26587 21.77 2.81E-02 CD27 ILMN_4066 23.36 5.53E-04 SEL1L3 ILMN_5957 3.37 3.56E-03 RSU1 ILMN_20461 1.55 1.34E-05 PDP2 ILMN_9168 21.77 8.55E-04 GPT2 ILMN_5354 23.37 1.09E-03 HNRPLL ILMN_4564 3.33 1.20E-02 MFSD6L ILMN_18512 1.53 8.32E-03 CDK2AP2 ILMN_7457 21.79 1.56E-02 PRSS16 ILMN_10360 23.38 1.27E-02 LBH ILMN_34703 3.31 5.39E-04 CERK ILMN_24122 1.52 4.02E-03 PKMYT1 ILMN_1154 21.82 1.15E-03 CYP11A1 ILMN_27808 23.46 3.54E-04 REL ILMN_10908 3.09 5.55E-03 SLC5A6 ILMN_880 1.52 4.90E-03 HMGCS1 ILMN_18980 21.83 1.55E-03 CTH ILMN_4045 23.47 2.66E-03 NFKBIZ ILMN_16362 3.08 4.94E-04 MGC16169 ILMN_16160 1.52 2.06E-03 CST3 ILMN_15664 21.86 1.02E-02 MSX1 ILMN_137891 23.67 3.67E-03 GSN ILMN_137841 2.87 1.32E-02 PPAPDC2 ILMN_4922 1.51 8.37E-03 ENO2 ILMN_15419 21.87 2.21E-03 LCE1E ILMN_138807 23.69 5.00E-03 NMT2 ILMN_7780 2.73 2.01E-02 Downregulated protein-encoding genes RNPC2 ILMN_20445 21.89 1.52E-03 CXORF57 ILMN_27534 23.71 8.07E-03 PTK2/FAK ILMN_20899 2.70 1.18E-03 HPCAL1 ILMN_11657 21.89 2.10E-03 ITIH1 ILMN_25855 23.83 1.39E-02 ITPR2 ILMN_13530 2.64 1.15E-02 SLC20A1 ILMN_7081 21.51 8.07E-04 SLC7A1 ILMN_22619 21.92 1.90E-03 SIT1 ILMN_18699 23.89 1.89E-04 TNFSF4/CD134L ILMN_8432 2.63 4.93E-03 CDCA7L ILMN_14646 21.51 3.57E-03 NUDT8 ILMN_14871 21.92 9.72E-05 TBC1D8 ILMN_13299 23.99 3.23E-04 STK17B/DRAK2 ILMN_24781 2.61 3.00E-02 CCDC104 ILMN_2409 21.52 2.24E-03 ZNF292 ILMN_38501 21.93 3.85E-03 CKAP4 ILMN_4432 24.19 3.38E-03 C20ORF108 ILMN_25852 2.60 5.45E-03 SPATA7 ILMN_2515 21.52 1.91E-03 BCKDHA ILMN_13270 21.94 3.94E-06 KCTD12 ILMN_18501 24.68 8.25E-04 ALDH2 ILMN_17598 2.59 6.53E-03 PGRMC1 ILMN_8714 21.52 4.07E-03 AFMID ILMN_5520 21.95 1.90E-03 SP110 ILMN_2801 24.75 1.95E-05 RUNX1 ILMN_19125 2.58 6.76E-03 PCK2 ILMN_18787 21.53 2.13E-03 RHOV ILMN_27155 21.96 2.24E-02 HLA-C ILMN_23822 25.45 2.26E-03 FAM105A ILMN_10775 2.58 7.48E-05 ANXA5 ILMN_26606 21.53 4.32E-03 SLC7A5 ILMN_25446 21.96 1.93E-02 IL12A ILMN_28240 25.71 2.30E-03 CSPG4 ILMN_1596 2.57 2.27E-02 HSP90B1 ILMN_27563 21.53 1.67E-03 SERPINE2 ILMN_1946 21.98 1.52E-02 PBX4 ILMN_11004 25.75 5.55E-03 CD83 ILMN_16705 2.56 2.56E-02 TMEM48 ILMN_26078 21.53 3.79E-03 ARHGEF17 ILMN_11064 21.98 3.57E-03 AIM2 ILMN_10231 25.82 2.59E-03 MIB1 ILMN_5164 2.37 7.78E-03 SNHG4 ILMN_15287 21.53 9.56E-03 HOXB7 ILMN_137246 21.98 4.25E-03 INHBE ILMN_7067 25.87 5.31E-04 AL ET CLIFFE ELL2 ILMN_15317 2.33 3.00E-02 EPS15L1 ILMN_20498 21.54 5.93E-03 TNFRSF13C/ ILMN_22155 22.00 1.08E-02 COL5A1 ILMN_139036 26.20 7.99E-03 BAFFR ALDH4A1 ILMN_10603 2.28 3.10E-03 BNIP1 ILMN_6602 21.55 6.29E-03 LY9/SLAMF3 ILMN_24363 22.01 1.94E-03 SCNN1B ILMN_28619 26.96 8.95E-03 MUM1 ILMN_23934 2.28 1.89E-02 HPS1 ILMN_2724 21.55 4.49E-03 POU5F1 ILMN_26895 22.03 4.69E-04 LCE1B ILMN_23910 27.03 1.21E-02

SDCCAG8 ILMN_24496 2.27 8.39E-03 SCD ILMN_25431 21.56 8.33E-03 FLT4 ILMN_28031 22.05 2.23E-03 PHGDH ILMN_5800 28.01 2.00E-06 742.e5 (Continued) TABLE E1. (Continued) 742.e6 Fold Gene Fold Fold Fold t t t t

Gene symbol Illumina ID change Test symbol Illumina ID change Test Gene symbol Illumina ID change Test Gene symbol Illumina ID change Test AL ET CLIFFE OSBPL3 ILMN_17721 2.16 5.12E-03 AVPI1 ILMN_9920 21.57 6.29E-03 SHMT2 ILMN_19915 22.05 1.35E-03 CYP4F3 ILMN_20221 28.18 6.76E-03 MLLT11 ILMN_21397 2.10 7.95E-03 PPP2R3B ILMN_5735 21.57 2.48E-03 ASAH1 ILMN_26236 22.08 2.49E-04 KCNMB2 ILMN_16032 28.39 2.31E-03 FAM89B ILMN_9389 2.09 3.08E-02 ANKRD13A ILMN_14148 21.57 3.31E-03 SELM ILMN_1005 22.11 1.39E-03 CXCL16 ILMN_29805 28.63 5.94E-03 C4ORF32 ILMN_18245 2.09 4.18E-03 PLP2 ILMN_21868 21.61 9.75E-03 FKBP11 ILMN_14765 22.14 8.55E-03 PRODH ILMN_17486 29.20 4.67E-03 CIITA ILMN_22738 2.08 2.34E-03 GSTM4 ILMN_3050 21.61 8.10E-03 APOBEC3B ILMN_5305 22.17 6.00E-04 UNQ2541 ILMN_16426 29.49 5.48E-04 RNF170 ILMN_24753 2.06 4.31E-03 SC65 ILMN_21605 21.61 2.99E-03 SLC3A2 ILMN_12826 22.17 5.03E-03 LYPD6B ILMN_5409 210.07 2.74E-03 F11R ILMN_29770 2.05 1.48E-02 FLJ21839 ILMN_137244 21.62 7.42E-04 SLC1A5 ILMN_29291 22.17 3.05E-04 EMR1 ILMN_12984 210.72 1.59E-03 JARID1B ILMN_14812 2.01 3.19E-03 UAP1L1 ILMN_20654 21.63 1.21E-02 TRIB3 ILMN_21257 22.18 2.75E-03 NDUFA4L2 ILMN_11091 214.01 9.29E-03 CXXC4 ILMN_11813 1.99 1.87E-04 PGM3 ILMN_14773 21.63 3.76E-02 ANG ILMN_13716 22.19 1.21E-03 TIAM2 ILMN_9891 218.63 3.06E-03 KMO ILMN_10994 1.92 2.75E-03 LILRA6 ILMN_27203 21.63 4.77E-04 EIF4EBP1 ILMN_6626 22.21 2.00E-03 SFMBT2 ILMN_5290 1.90 4.85E-03 XPOT ILMN_22427 21.63 5.84E-03 C6ORF223 ILMN_9341 22.22 7.40E-03 LEG LNIMMUNOL CLIN ALLERGY J ETME 2012 SEPTEMBER

ÔØ ÅÒÙ×Ö ÔØ

Hepatic Veno-occlusive Disease with Immunodeﬁciency (VODI): First Reported Case in the U.S. and Identiﬁcation of a Unique Mutation in the Gene Encoding a PML Nuclear Body Protein, Sp110

Tiffany Wang, Peck Ong, Tony Roscioli, Simon T. Cliffe, Joseph A. Church

PII: S1521-6616(12)00191-X DOI: doi: 10.1016/j.clim.2012.07.016 Reference: YCLIM 7026

To appear in: Clinical Immunology

Received date: 28 February 2011 Accepted date: 28 July 2012

Please cite this article as: Tiffany Wang, Peck Ong, Tony Roscioli, Simon T. Cliffe, Joseph A. Church, Hepatic Veno-occlusive Disease with Immunodeficiency (VODI): First Reported Case in the U.S. and Identification of a Unique Mutation in the Gene Encoding a PML Nuclear Body Protein, Sp110, Clinical Immunology (2012), doi: 10.1016/j.clim.2012.07.016

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT

Hepatic Veno-occlusive Disease with Immunodeficiency (VODI): First Reported Case in the U.S.

and Identification of a Unique Mutation in the Gene Encoding a PML Nuclear Body Protein,

Sp110.

Authors names: Tiffany Wanga, Peck Ongb, Tony Rosciolic,d,e, Simon T. Cliffec & Joseph A.

Churchb

Authors’ institutions: Divisons of a General Pediatrics and b Clinical Immunology and Allergy, Children’s Hospital Los Angeles, Keck School of Medicine, University Southern California, 4650 West Sunset Boulevard, Los Angeles, CA 90027, USA; cDepartment of Haematology and Genetics, Prince of Wales Hospital, Sydney; dDepartment of Molecular and Clinical Genetics, Royal Prince Alfred Hospital, University of Sydney; e Department of Human Genetics, Radboud University Nijmegen Medical Centre, 6525 GA Nijmegen, The Netherlands

Running title: Veno-occlusive Disease with Immunodeficiency

Correspondence to: Joseph A. Church, M.D. Clinical Immunology and Allergy Children’s Hospital Los Angeles 4650ACCEPTED Sunset Blvd., MS# 75 MANUSCRIPT Los Angeles, CA 90027, USA

Phone: +1 323 361 2501 Fax: +1 323 361 1191 E-mail: [email protected]

ACCEPTED MANUSCRIPT

ABSTRACT

Familial hepatic veno-occlusive disease with immunodeficiency (VODI, OMIM235550), a rare form of severe combined immune deficiency, was first described in Australian Lebanese patients as being associated with homozygous mutations in SP110, a gene encoding a PML nuclear body-associated protein. We present the first case of confirmed VODI in the United States, and identify the first novel missense mutation in SP110.

The 3-year-old daughter of Hispanic parents without known consanguinity presented at age 5 months with fever, hepatomegaly, and pancytopenia. Her brother died at age 3 months from hepatic failure of undetermined etiology. Initial T- and B-cell counts were low, but eventually normalized. Serum IgG and IgM levels were low for age. Lymphoproliferation to mitogens and allogenic B-cells was normal, but absent to tetanus and candida antigens. Serum antibody levels against pneumococcal, Hib and tetanus antigens were low. Liver biopsies at ages 5 and 9 months were consistent with hepatic veno- occlusive disease or hVOD (also known as sinusoidal obstruction syndrome or SOS) and broncho- alveolar lavage detected Pneumocystis jiroveci. The patient recovered from her acute disease and has been clinically stable onACCEPTED immunoglobulin replacement MANUSCRIPT therapy and trimethoprim-sulfamethoxazole prophylaxis. T-Cell receptor excursion circle (TREC) analysis suggests that VODI will not be detected by newborn screening for severe combined immunodeficiency that relies on this assay.

DNA was obtained from the patient, 4 siblings, and both parents, and SP110 was sequenced. The first missense mutation, a homozygous deletion/insertion variation in exon 2 (NM_080424.2(SP110):c.78_79delinsAT) was detected in the patient. This novel mutation segregated in the heterozygous state in other living unaffected family members. The mechanism by which this SP110 mutation associates with VODI is consistent with the normal length mutated SP110 protein being subject to enhanced proteosome degradation resulting in marked reductions in SP110 protein.

ACCEPTED MANUSCRIPT

Keywords: Veno-occlusive disease, Sinusoidal obstruction syndrome, Immunodeficiency, Sp110,

VODI

1) INTRODUCTION:

Familial hepatic veno-occlusive disease with immunodeficiency (VODI) was first described in 1976 in an Australian Lebanese population [1]. There have been few subsequent cases of VODI reported [2] and none from the Western Hemisphere. In 2006, homozygous mutations in the promyelocytic leukemia (PML) nuclear body protein, Sp110, were identified in patients with VODI [3]. The PML nuclear body has been reported to be involved in apoptosis, gene regulation, antiviral responses, proteolysis, DNA repair, and tumor suppression [4]. However, little is known about the specific functions of Sp110 and how mutations in SP110 cause VODI. We present the first case of confirmed

VODI in the United States. Molecular genetic testing detected the first missense mutation, a novel homozygous SP110 di-nucleotide mutation in the patient which was present in heterozygous form in her parents and four siblings. The unique clinical and laboratory features of this rare form of severe combined immune deficiency are described here in detail. ACCEPTED MANUSCRIPT

2) CASE REPORT + RESULTS

A now six-year-old Hispanic-American female was admitted to hospital at age 5 months with fever and pallor. A firm liver edge was palpable 4cm below the right costal margin. Laboratory studies revealed anemia (Hgb 8.0g/dL, Hct 25.8%), thrombocytopenia (71K/uL), neutropenia (ANC 340mg/mL), hypoalbuminemia (2.7g/dL), elevated transaminases (AST 578U/L, ALT 190U/L), and an elevated

CRP (2.6mg/dL). Chest x-ray was consistent with interstitial disease and the patient became hypoxic. ACCEPTED MANUSCRIPT

Antibiotics were started for presumed bacterial pneumonia. Cultures for bacterial and fungal agents were negative. CBC showed 31% blasts and LDH was elevated; bone marrow biopsy was consistent with recovery from viral myelosuppression. Specific antigen or PCR assays for human immunodeficiency virus type 1, hepatitides A, B, and C, varicella and parvovirus were negative. The patient gradually improved and was discharged with a diagnosis of viral myelosuppression.

One week later, she was readmitted with daily fevers to 102°F and hepatosplenomegaly, anemia (Hgb

9.3g/dL, Hct 31.1%) and thrombocytopenia (29 K/uL). Liver function tests showed increasing transaminase levels (AST 1051U/L, ALT 320U/L) and hypoalbuminemia. A coagulopathy was present with elevated PT and PTT. CT scan showed massive hepatic enlargement with multiple diffuse hypodensities possibly related to leukemia, lymphoma or glycogen storage disease. Malignancy, metabolic storage disease, hemophagocytic lymphohistiocytosis (HLH) and macrophage activation syndrome (MAS) were considered, but not supported by additional investigations.

Open liver biopsy results showed marked centrivenular congestion and hemorrhagic necrosis, consistent with hepatic veno-occlusive disease (hVOD). The patient developed worsening hypoxia and broncho-alveolar lavage was positive for Pneumocystis jiroveci. Immunological investigations showed ACCEPTED MANUSCRIPT low T- and B-cell counts initially, but these eventually increased (Table 1). Serum IgG and IgM levels were low for age (Table 1). Lymphoproliferation to mitogens and allogenic B-cells was normal, but initially absent to tetanus and candida antigens. Red blood cell adenosine deaminase and purine nucleoside phosphorylase were normal; CD40 and HLA antigens A, B, C, and DR were expressed normally on peripheral blood mononuclear cells. Natural killer cell and cytotoxic T-cell functions were normal. Serum antibody levels to pneumococci, Haemophilus influenzae type b (Hib), and tetanus and diphtheria toxins were low (normal levels provided by respective clinical laboratories). A single dose of intravenous immunoglobulin (IVIG) was administered, and the patient was discharged home without ACCEPTED MANUSCRIPT a definitive etiology for her liver dysfunction and undefined immunodeficiency.

The patient was re-admitted at age 9 months for upper gastrointestinal bleeding secondary to portal hypertension, anemia and thrombocytopenia. Percutaneous liver biopsy was again consistent with

VOD/SOS with variably fibrotic central veins associated with striking focal centrilobular congestion.

T-cell counts had increased from her prior visit, but serum IgG, IgA, and IgM had decreased (Table 1).

Tetanus, Hib, and pneumococcal antibody titers showed poor responses to reimmunization (Table 1).

Upon stabilization the patient was discharged with a clinical diagnosis of primary combined immunodeficiency and resolving hVOD.

The family history was significant in that a brother died 13 years earlier at age 3 months of age from idiopathic liver failure. Although the patient’s parents were not aware of consanguinity, they both originated from an isolated municipality in central Mexico. The patient’s brother and three sisters are in good health.

With IRB approval and parental informed consent, blood samples from the patient, both parents and four siblings were sent to the South Eastern Area Laboratory in Sydney, Australia, for DNA sequencing ACCEPTED MANUSCRIPT of SP110 [3]. The entire coding region of 19 exons was sequenced and no truncating mutations were identified. A homozygous dinucleotide insertion/deletion missense mutation

NM_080424.2(SP110):c.78_79delinsAT was identified. This involves the silent third base of codon 26

(GCC>GCA, both of which encode alanine) and the adjacent first base of codon 27 (ATA>TTA, isoleucine to leucine) [p.Ile27Leu]. The affected residue lies within the Sp100-like domain of Sp110, which mediates the interaction between Sp110, Sp140, and Sp100 [5-8] (Figure 1). In contrast to all other mutation-proven cases of VODI, this represents the first missense mutation described in this immunodeficiency. This mutation co-segregated with disease in this family and is present in ACCEPTED MANUSCRIPT heterozygous form in both parents and all four siblings, consistent with an autosomal recessive inheritance pattern (Figure 2). This mutation occurs in a region that is highly conserved among 17 species, as well as between Sp110, Sp140, and Sp100.

Previous VODI patients had frameshift mutations that lead to reduction in full-length Sp110 levels.

Our patient’s VODI likely has a significantly different mechanism although affecting the same protein.

Sp110 mRNA was present in patient cells, and expression of her mutated Sp110 in Hep-2 cells was markedly reduced compared to wild type Sp110. Further, it was shown that this was likely caused by protosome degredation of the normal length mutant protein. [9]

Although antigen-specific lymphoproliferative responses to tetanus and candida antigens normalized by

40 months, serum IgA and IgM levels and memory and switched memory B-cells remained low (Table

1). The proportions of CD4+, CD8+, NK, and NKT cells that expressed intracellular IFNγ and TNFα

(following in vitro stimulation with phorbol myristate acetate, ionomycin and brefeldin A, Diagnostic

Immunology Laboratory, Cincinnati Childrens Hospital Medical Center) were decreased initially in all four cell types but remained low only in CD8 + T-cells (Table 2),. T-cell receptor excision circle

(TREC) quantitation (ViraCor-IBT Laboratories, Lee's Summit, MO) was normal (>6,000 per 106 ACCEPTED MANUSCRIPT cells).

Currently, at six years of age, the patient is at the 25th percentiles for height and weight. She is developing normally, and is clinically stable on monthly IVIG infusions and trimethoprim- sulfamethoxazole prophylaxis against Pneumocystis jiroveci.

3) DISCUSSION ACCEPTED MANUSCRIPT

Although hVOD has been described in other forms of immunodeficiency [10], it is most often observed in the context of bone marrow or hematopoietic stem cell transplantation (BMT/HSCT) [11]. The entity hepatic veno-occlusive disease with immune deficiency was first described in 1976 in six

Australian children of Lebanese ancestry [1]. The occurrence of this disorder in three pairs of siblings

(4 girls, 2 boys), of which two pairs were born to consanguineous parents suggested autosomal recessive inheritance. All six of these patients presented with hepatomegaly and ascites, and four of the six had Pneumocystis jiroveci pneumonia (PJP). Of the five patients tested, all had hypogammaglobulinemia, absent germinal centers, and absent or rare plasma cells on examination of the spleen, lymph nodes and intestinal lymphoid tissue at autopsy. Percutaneous liver biopsies, performed in three patients, were consistent with hVOD/SOS. A detailed review of the clinical and laboratory features of 20 patients with VODI is available [12]. Of these, 12 presented with hepatic failure, 12 developed PJP, only four recovered from their initial VOD/SOS, and 18 have died. In the patients tested, severe hypogammaglobulinemia was noted in all, as were normal T-, B-, and NK-cell numbers despite the occurrence of PJP, which is characteristic of severe T-cell deficiency [13]. Our patient presented with hVOD/SOS at five months of age, developed PJP shortly thereafter, and was subsequently shown to have hypogammaglobulinemia, normal T-cell numbers but poor antigen-specific lymphoproliferative responses and reduced intracellular cytokine expression. “Atypical” severe ACCEPTED MANUSCRIPT combined immune deficiency (SCID) was diagnosed until the association between VODI and mutations in SP110 was demonstrated.

In 2006, Roscioli et al., [3] reported the association of VODI with mutations in the gene that encodes the promyelocytic leukemia (PML) nuclear body protein Sp110, which is expressed primarily in leukocytes. The PML nuclear body is a macromolecular complex that plays critical roles in gene transcription regulation, apoptosis, cell cycle control, DNA repair, and responses to interferons and virus infection [4,14,15]. Roscioli et al. defined VODI as an autosomal recessive primary ACCEPTED MANUSCRIPT immunodeficiency associated with hVOD/SOS as a primary event and described criteria required for the diagnosis: severe hypogammaglobulinemia and evidence of T-cell dysfunction including PJP and mucocutaneous candidiasis; biopsy evidence of hVOD not explained by other factors in the affected individual or first degree relative; a pattern of disease consistent with autosomal recessive inheritance and onset prior to age of 12 months.

Currently, SP110 is the only gene associated with VODI. Prior to the present case, three VODI- associated mutations in SP110 had been identified: c.40delC, c.642delC3 and c.319_325dupGGTGCTT [16], the first two in Australian-Lebanese, the third in an Italian child. Each causes a frame shift with consequent protein truncation. Our patient’s mutation is unique and it does not affect translation of a protein product. Other mechanisms resulting in SP110 deficiency are likely.

Importantly, the presence of normal TREC in our patient suggests that VODI will not be detected by new born screening for T-lymphesemia that utilizes the TREC assay.

Effective management of VODI patients depends on early recognition of the syndrome and initiation of

IVIG therapy that appears to markedly reduce the recurrences of hVOD/SOS [3,7]. The mechanism of ACCEPTED MANUSCRIPT this effect is unknown, although in a mouse model of sickle cell disease, IVIG prevents hVOD/SOS by inhibiting leukocyte adhesion and the interactions between sickle erythrocytes and adherent leukocytes

[17]. A similar process might be postulated between leukocyte interactions with altered hepatic sinusoidal cells.

Finally, BMT/HSCT may seem like an appropriate treatment as it would very likely reverse the immunologic dysfunction [18]. Further, as hepatic sinusoidal cells are derived from bone marrow precursors [19], full correction of the clinical phenotype may be possible. Patients who have received ACCEPTED MANUSCRIPT bone marrow and liver transplants for VODI have done poorly, however [11]. hVOD/SOS is a known complication of BMT/HSCT and appears directly related to the chemotherapeutic conditioning regimen, particularly busulfan [20,21], required to permit engraftment under the circumstance of intact allogeneic T-cell responses and NK-cell function. The risk for hVOD/SOS likely would be much greater in VODI patients who are genetically predisposed to this complication.

One of our patient’s siblings displays HLA identity to the patient, and this could facilitate transplantation without intense conditioning. Further, prophylactic treatment with defibrotide, which has been reported to be effective in prevention and treatment of VOD/SOS in pediatric HSC transplantation [22,23], may reduce the chance of VOD/SOS in the present case. However, given the recorded poor outcome after BMT/HSCT and hepatic transplantation in VODI, we cannot recommend these therapies at this time in VODI patients. PJP prophylaxis and immunoglobulin replacement therapy will be maintained indefinitely as a treatment strategy in the absence of other treatment modalities.

Our patient illustrates that although rare, VODI is present outside the Australian Lebanese and

European populations and should be considered in any patient with combined immunodeficiency and ACCEPTED MANUSCRIPT severe hepatic disease. It is likely that newborn screening for SCID with a TREC assay will not identify infants with this disorder.

ACCEPTED MANUSCRIPT

4) REFERENCES [1] C. Mellis, P. Bale, Familial hepatic venoocclusive disease with probable immune deficiency, J. Pediatr. 88 (1976) 236- 42. [2] A. Etzioni, A. Benderly, E. Rosenthal, V. Shehada, L. Auslander, N. Lahat, S. Pollack, Defective humoral and cellular immune functions associated with veno-occlusive disease of the liver, J. Pediatr. 110 (1987) 549-54. [3] T. Roscioli, S.T. Cliffe, D.B. Bloch, C.G. Bell, G. Mullan, P.J. Taylor, et al., Mutations in the gene encoding the PML nuclear body protein Sp110 are associated with immunodeficiency and hepatic veno-occlusive disease, Nat. Genet. 38 (2006) 620-22. [4] G. Dellaire, D.P. Bazett-Jones, PML nuclear bodies: dynamic sensors of DNA damage and cellular stress, BioEssays 26 (2004) 963-77. [5] J.S. Seeler, D. Marchino, C. Sitterlin, C. Transy, A. Dejean, Interaction of PS100 with HP1 proteins: a link between the promyelocytic leukemia-associated nuclear bodies and the chromatin compartment, ProcNnt Acad Sci: 95 (1998) 7316- 6146. [6] T. Sternsdof, K. Jensen, R. Berthold, H. Will, The nuclear dot protein SP100 characterization of domains necessary for dimeriztion, subcellular localization, and modification by small ubiquitin-like modifiers*, J.BioChem:247:18 (1999) 12555- 12566. [7] D.B. Bloch, A.Nakajima, T. Gulick, J.D. Chiche, D. Orth, S.M. deLaMonte, K.D. Bloch, Sp110 localizes to the PML- Sp100 nuclear body and may function as a nuclear hormone receptor transcriptional coactivator, Mol.Cell. Biol: 20 (2000) 6138-6146. [8] J. Nicewonger, G. Suck, D. Bloch, S. Swaminathan, Epstein-Barr (EBV) SM protein induces and recruits cellular Sp110b to stabilize mRNAs and enhance EBV lytic gene expression, J.Virol: 70:17 (2004) 9412-22. [9] S.T. Cliffe, D.B. Bloch, S. Suryani, E.J. Kamsteeg, D.T. Avery, U. Palendirna, et al., Clinical, molecular, and cellular immunologic findings in patients with SP110-associated veno-occlusive disease with immunodeficiency syndrome, Alr.Clin.Imm.(2012) Epub adhead of print. [10] N. Srisirirojanakorn, M.J. Finegold, G.S. Gopalakrishna, W.J. Klish, Hepatic veno-occlusive disease in ataxia- telangiectasia, J. Pediatr. 134 (1999) 786-88. [11] S. Hasegawa, K. Horibe, T. Kawabe, K. Kato, S. Kojima, T. Matsuyama, et al., Veno-occlusive disease of the liver after allogeneic bone marrow transplantation in children with hematologic malignancies: incidence, onset time and risk factors, Bone Marrow Transplant 22 (1998) 1191-97. [12] T. Roscioli, J.B. Ziegler, M. Buckley, M. Wong, Hepatic veno-occlusive disease with immunodeficiency, Gene Reviews, http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=vodi. Last accessed August 9, 2010. [13] K. Sepkowitz, Opportunistic infections in patients with and patients without acquired immunodeficiency syndrome, Clin. Infect. Dis. 34 (2002) 1098-1107. [14] T. Regad, M.K. Chelbi-Alix, Role and fate of PML nuclear bodies in response to interferon and viral infections, Oncogene 20 (2001) 7274-86. [15] D.B. Bloch, A. Nakajima, T. Gulick, J.D. Chiche, D. Orth, S. De La Monte, et al., Sp110 localized to the PML-Sp100 nuclear body and may function as a nuclear hormone receptor transcriptional coactivator, Mol. Cell. Biol. 20 (2000) 6138- 46. [16] E.M. Ruga, G. Guariso, L.D. Antiga, M. Guido, M. Fassan, R.D. Elia, J.B. Ziegler, T. Roscioli, S.T. Cliffe, M.F. Buckley, L. Zancan, Hepatic veno-occlusive disase with immunodeficincy syndorme case report, 12th Meeting of the European Society for ImmunodeficienciesACCEPTED (2006) MANUSCRIPT [17] A. Turhan, P. Jenab, P. Bruhns, J. Ravetch, B. Coller, P. Frenette, Intravenous immune globulin prevents venular vaso- occlusion in sickle cell mice by inhibiting leukocyte adhesion and the interactions between sickle erythrocytes and adherent leukocytes, Blood 103 (2004) 2397-2400. [18] A. Gennery, A. Cant, Advances in hematopoietic stem cell transplantation for primary immunodeficiency, Immunol. Allergy Clin. N. Am. 28 (2008) 439-56. [19] R. Harb, G. Xie, C. Lutzko, Y. Guo, X. Wang, C. Hill, Bone marrow progenitor cells repair rat hepatic sinusoidal endothelial cells after liver injury, Gastroenterology 137 (2009) 704-12. [20] S. Cesaro, M. Pillon, E. Talenti, T. Toffolutti, E. Calore, G. Tridello, et al., A prospective survey on incidence, risk factors and therapy of hepatic veno-occlusive disease in children after hematopoietic stem cell transplantation, Haematologica 90 (2005) 1396-1404. [21] M. Gharib, S. Bulley, J. Doyle, R. Wynn, Venous occlusive disease in children, Thromb. Res. 118 (2006) 27-38. [22] S.R. Bulley, B. Strahm, J. Doyle, L.L. Dupuis, Defibrotide for the treatment of hepatic veno-occlusive disease in children, Pediatr. Blood Cancer 48 (2007) 700-04. [23] A. Qureshi, L. Marshall, D. Lancaster, Defibrotide in the prevention and treatment of veno-occlusive disease in autologous and allogeneic stem cell transplantation in children, Pediatr. Blood Cancer 50 (2008) 831-32. ACCEPTED MANUSCRIPT

Figure Legends

Figure 1: SP110 sequence analysis of patient and family members. The entire coding region of 19 exons was sequenced and a dinucleotide alteration was found in exon 2, in the Sp100-like domain of SP110, which mediates the interaction between Sp110, Sp140, and Sp100. This mutation was present in homozygous form in our patient, and in heterozygous form in both parents and four unaffected siblings.

Figure 2: Sp110 mutation inheritance pattern in patient and family members

I.1 Father, Sp110 c.78_79CA>AT heterozygote I.2 Mother, Sp110 c.78_79CA>AT heterozygote II.1 Brother #1, died at age 3 months from liver failure 13 years prior to patient’s birth II.2 Brother #2, Sp110 c.78_79CA>AT heterozygote II.3 Sister #1, Sp110 c.78_79CA>AT heterozygote II.4 Sister #2, Sp110 c.78_79CA>AT heterozygote II.5 Patient, Sp110 c.78_79CA>AT homozygote II.6 Sister #3, Sp110 c.78_79CA>AT heterozygote

ACCEPTED MANUSCRIPT ACCEPTED MANUSCRIPT

Table 1: Sequential B-cell and T-cell subsets and functions in a patient with veno-occlusive disease and immunodeficiency.

Age (months) Reference Ranges 6 9 22-24 28 40 44 ≤ 9 ≥ 36 CD19+ /mm3 B-cells 270 1135 843 597 679 411 850-3800 500-1800 CD19+ IgM/D+ CD27- B-cells --- 91 96 --- 98 99 75-95 54-88 (naïve) (%) CD19+ IgM/D+ CD27+ B-cells --- 1 1 --- 1 <1 4-20 8-37 (switched) (%) CD19+ IgM/D- CD27+ B-cells --- 9 3 --- 1 1 1-12 5-21 (switched memory) (%) IgG (mg/dL) 127 83 332a 550a 710a 970a 208-868 423-1090 IgA (mg/dL) 39 <7 <7 <7 <7 <7 11-89 22-157 IgM (mg/dL) 20 <7 <4 <4 <4 <4 32-120 45-190 Ab responses: Tetanus (IU/mL) 0.08 0.09b ------0.1-2.9 (normal 0.1-2.9) H. influenzae b (mcg/mL) 0.17 0.11b ------1.0-10.0 (normal 1.0-10.0) Pneumococcus (7 serotypes) all < 1.0 all < 1.0b ------> 2.0 (mcg/mL) CD3+ T-cells/mm3 252 1278 --- 1290 1731 1588 3000-8000 1350-4100 CD4+ T-cells/mm3 122 744 --- 743 1159 944 1800-5000 800-2400 CD8+ T-cells/mm3 127 584 --- 476 782 666 950-2800 400-1700 LPAc responses: ACCEPTED MANUSCRIPT Phytohemaglutinin 425 ------359 13 146 S.I.d >40

Pokeweed mitogen 57 ------527 38 371 S.I.d >40

Tetanus antigen 1 ------9 18 S.I.d >5 (normal S.I.d >5) Candida antigen 1 ------4 54 S.I.d >5 (normal S.I.d >5) aWhile receiving immunoglobulin replacement therapy bFollowing immunizations x3 ACCEPTED MANUSCRIPT

cLPA = Lymphoproliferation assay dSI = Stimulation index (the ratio of counts per minute (CPM) of tritiated thymidine incorporated into cellular DNA in stimulated cultures/CPM in cellular DNA in unstimulated cultures)

ACCEPTED MANUSCRIPT ACCEPTED MANUSCRIPT

Table 2: Intracellular cytokine production in a patient with veno-occlusive disease and immunodeficiency. Patient* (%) Reference Range (%) IFNγ+ CD4+ cells 5, 9 8-24 TNFα+ CD4+ cells 27, 59 39-67 IFNγ+ CD8+ cells 6, 8 20-48 TNFα+ CD8+ cells 2, 11 17-61 IFNγ+ NK cells 42. 54 48-80 TNFα+ NK cells 21, 47 23-73 IFNγ+ NKT cells 10, 17 18-64 TNFα+ NKT cells 8, 39 23-73

*Patient was studied at two and five years of age.

ACCEPTED MANUSCRIPT ACCEPTED MANUSCRIPT

Highlights:  In this report we describe the first U.S. case of hepatic venoocclusive disease with immunodeficiency (VODI).

 Hepatic disease in early infancy preceded evidence of immune compromise.

 Immunologic studies revealed immunoglobulin and antibody deficiencies, failure to develop switched memory B-cells, and reduced T-cell intracellular interferon- production.

 A unique mutation in the gene encoding a PML nuclear body protein, SP110, was identified.

ACCEPTED MANUSCRIPT