PROTEIN INTERACTIONS AT THE INNER NUCLEAR MEMBRANE
By
QIAN LIU
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2008
1
© 2008 Qian Liu
2
To my parents, for their unconditional love and support throughout the years
3
ACKNOWLEDGMENTS
First and foremost, I would like to thank my mentor, Dr. Brian Burke, who has provided me with an unforgettable graduate experience. I have come to respect Brian’s brilliance as a
scientist as well as his knowledge and understanding of things beyond. He also carries with him
a great sense of humor, which makes my graduate life much enjoyable. I especially appreciate
the immense patience he has exercised with me through the years and the support he has offered
as an advisor.
I would like to thank Kyle, for whom I have gained a great deal of respect and
appreciation. He has been a remarkable teacher, leader and motivator in my graduate study.
Moreover, he taught me a lot about knowledge of life and American culture. It is always fun to
talk with him and I have learned so much.
I would also like to thank my committee members (Steve Sugrue, John Aris and Jorg
Bungert) for offering their expertise, suggestions and support through my graduate experience. I
would especially like to acknowledge to Dr. Sugrue, who has served as an exceptional chair to
our department and challenged each of us through his vision and leadership.
I would like to thank the Sugrue, LuValle and Sarosi labs for constant exchange and use
of equipment and reagents as well as many hours of valuable discussion. I am grateful for all the
support and guidance I have received from everyone in the open lab, especially Daein (for being
a good friend and coworker), Janet (for teaching me American culture and pushing my limit for
better), Cuc (for being a considerate and inspiring friend who offers generous help), Caitlin (for
constant encouragement and support), Connie (for offering me help scientifically and socially),
Mo (for being a good friend in and out of the lab), Gus (for his wonderful friendship), Johnny
(for his help and constant vocal entertainment in the lab), Deby (for always being helpful in my
4
research), Lora, Jeff, Dustin Yong, Julie, Todd (for his computer assistance), Lynda (for always keeping things in order), Kim, Mary, PJ and also Susan Gardner.
Final thanks go to my close friends and family. I thank Rui, for her undying support and friendship from the other other end of the earth. I thank Qiong, for always being there for me, listening and giving me suggestions. I thank Shangli, Xiaolei, Zhiqun, for their amazing friendship. To Qing, Jian, Wei, Yao, Xin, Ye, for making my life warmer and more fun.
Most importantly, I cannot express gratitude enough for my parents, for always being there. I could never have come this far without them.
5
TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ...... 4
LIST OF TABLES ...... 8
LIST OF FIGURES ...... 9
LIST OF ABBREVIATIONS ...... 10
ABSTRACT ...... 14
CHAPTER
1 INTRODUCTION ...... 17
Introduction ...... 17 The Nuclear Envelope ...... 17 The Nuclear Pore Complexes ...... 19 The Nuclear Lamina ...... 20 Laminopathies ...... 23 Hutchinson-Gilford Progeria Syndrome (HGPS) ...... 27 Inner Nuclear Membrane Proteins ...... 31 Nesprin Targeting and SUN Domain Proteins ...... 32
2 FUNCTIONAL ASSOCIATION OF SUN1 WITH NUCLEAR PORE COMPLEXES ...... 43
Abstract ...... 43 Introduction ...... 43 Results ...... 47 Discussion ...... 56 Materials and Methods ...... 61
3 DYNAMICS OF LAMINA PROCESSING: IMPLICATIONS OF LOPINAVIR AND FTI-277 IN THE TREATMENT OF HIV AND PROGERIA ...... 77
Abstract ...... 77 Introduction ...... 77 Results ...... 80 Discussion ...... 85 Materials and Methods ...... 88
6
4 CONCLUSION ...... 98
Overview of Findings ...... 98 Significance ...... 100 Sun1 Can Be Involved in Nuclear Pore Membrane (NPM) Curvature, de Novo NPC Assembly and Defining Distinct Regions of Nuclear Periphery ...... 100 The Mechanisms of Nuclear Lamina Assembly Has Implications in the Clinical Use of both HIV Protease Inhibitors and Farnesyltransferase Inhibitors ...... 101 Future Work ...... 102 Functional Investigation of Sun1 ...... 102 Withdrawl of Lop and FTI-277 on Animal Models ...... 103
LIST OF REFERENCES ...... 105
BIOGRAPHICAL SKETCH ...... 125
7
LIST OF TABLES
Table page
1-1 Properties of representative inner nuclear membrane proteins ...... 42
8
LIST OF FIGURES
Figure page
1-1 Overview of nuclear envelope organization in a eukaryotic interphase cell...... 39
1-2 LaA Processing...... 40
1-3 Model for the LINC complex...... 41
2-1 Mammalian SUN protein family...... 67
2-2 Sun1 and Sun2 are segregated within the plane of the NE...... 68
2-3 Sun1, but not Sun2, is closely associated with NPCs as revealed by immuno-electron microscopy...... 69
2-4 Sun1 contains a single transmembrane domain...... 70
2-5 The Sun1 nucleoplasmic domain has overlapping NE localization motifs...... 72
2-6 Sun1 forms homotypic oligomers in vivo...... 73
2-7 Sun1 association with NPCs requires both the nucleoplasmic and lumenal domains...... 74
2-8 Perturbation of Sun1 affects NPC distribution...... 75
2-9 Sun1 topology and interactions...... 76
3-1 HIV PIs block LaA maturation, which is reversed rapidly following PI removal...... 91
3-2 Aberrant cellular phenotypes are recovered by 15 hours following Lop washout...... 92
3-3 Recovery of nuclear morphology following Lop washout requires mitosis...... 94
3-4 Lovastatin and FTI-277 lead to accumulation of nf-PreA on the NE, which undergoes gradual maturation following washout of Lov and FTI-277...... 95
3-5 Release from FTI-277 block leads to gradual maturation of nf-PreA and nf-LaAΔ50 and slow recovery of nuclear morphology in HGPS cells...... 96
3-6 Correction of cellular phenotypes in Saos2 cells caused by Lop with a combinatorial treatment of both FTI-277 and GGTI-2147 is reversed quickly upon washout of FTI- 277 and GGTI-2147 ...... 97
9
LIST OF ABBREVIATIONS
ABD Actin binding domain
AD-EDMD Autsomal dominant EDMD
ANC-1 Abnormal nuclear anchorage
BAF Barrier-to-autointegration factor
BMP Bone morphogenic protein bp Base pairs
C. `elegans Caenorhabditis elegans
CMT2B1 Charcot-Marie-Tooth type 2B1 disorder
D. melanogaster Drosophila melanogaster
DCM-CD1 Dilated cardiomyopathy with conduction defects
DMSO Dimethylsulfoxide
DNA Deoxyribonucleic acid
DSB Double strand breaks
DTT 1,4-dithiothreitol
EDMD Emery-Dreifuss Muscular Dystrophy
EM Electronic microscope f-PreA Farnesylated/carboxynethylated-PreA
FBS Fetal Bovine Serum
FPLD2 Dunnigan-type familial partial lipodystrophy
FRAP Fluorescence recovery after photobleaching
FTI Farnesyl transferase inhibitor
GCL Germ cell-less
GGTI Geranylgeranyltransferase inhibitor
10
GFP Green fluorescence protein
HAART Highly active anti-retroviral therapy
HGPS Hutchinson-Gilford progeria syndrome
HIV PIs Human immunodeficiency virus protease inhibitors
HP1 Heterochromatin protein 1
HRP Horse radish peroxidase
ICMT isoprenyl cysteine carboxymethyl transferase
IF Intermediate filament
INM Inner nuclear membrane
Kap Karyopherin
KASH Klarsicht, ANC-1, Syne homology kD Kilodalton
LaA LaminA
LaC LaminC
LAP Lamin A polypeptide
LBR Lamin B receptor
LEM LAP, emerin, MAN1
LGMD1B Limb-girdle muscular dystrophy type 1B
LINC Linker of nucleoskeleton and cytoskeleton
Lop Lopinavir
Lov Lovastatin
MAD Mandibuloacral dysplasia
MDa Megadalton
11
MEF Mouse embryonic fibroblasts
MT Microtubules
MuSK Muscle specific tyrosine kinase
NE Nuclear envelope
Nesp Nesprin
NespG Nesprin giant
Nesprin Nuclear envelope spectrin repeat
NET Nuclear envelope transmembrane protein
NLS Nuclear localization signal
NMJ Neuromuscular junction
NPC Nuclear pore complex
NPM Nuclear pore membrane
NUANCE Nucleus and actin connecting element
Nup Nucleoporin
ONM Outer nuclear membrane
PAGE Polyacrylamide gel electrophoresis
PBS Phosphate buffered saline
PCNA Proliferating cell nuclear antigen
PCR Polymerase chain reaction
PFA Paraformaldehyde
PIs Protease inhibitors
PNS Perinuclear space
PPARγ Nuclear peroxisome proliferators-activated receptorγ
12
PRD Plakin repeat domain
P-sites Phosphoacceptor sites
Rb Retinoblastoma protein
RD Restrictive dermopathy rER Rough endoplasmic reticulum
RNA Ribonucleic acid
RNAi RNA interference
SDS Sodium dodecyl sulphate
SPAG Sperm associated antigen
SPAG4L Spag4-like
SR Spectrin repeat
SREBP1 Sterol response element binding protein 1
SUN Sad1p,Unc-84
SUNC Sad1 and UNC-84 domain containing
Syne Synaptic nuclear envelope
TM Transmembrane
Tris Tris-(hydroxymethyl) aminomethane
TX-100 Triton X-100
WS Werner's syndrome
WT Wild type
X-EDMD X-linked EDMD
ZmpSte24 Zinc Metalloproteinase STE24
13
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
PROTEIN INTERACTIONS AT THE INNER NUCLEAR MEMBRANE
By
Qian Liu
December 2008
Chair: Brian Burke Major: Medical Sciences--Molecular Cell Biology
Physical connections between the nucleoskeleton and cytoskeleton were recently
uncovered, which we have previously defined as LINC (linker of nucleoskeleton and
cytoskeleton) complex. They form through interactions between the luminal domains of two
families of transmembrane proteins of the nuclear envelope (NE): Sun proteins and Nesprins.
Mammalian cells are known to contain at least five Sun proteins, within which, Sun1 and
Sun2 are ubiquitously expressed in mice and human. Though functionally similar, we discovered that Sun1 and 2 are segregated within the plane of the NE in both interphase and early telophase.
Immunofluorescence and immunoelectric microscopy further revealed that Sun1, but not Sun2 is intimately associated with nuclear pore complexes (NPCs). Though interaction with A type lamins has been confirmed, localization of Sun proteins is not lamin dependent. Topological analyses indicate that Sun1 is a type II integral protein of the INM. Localization of Sun1 to the
INM is defined by at least two discrete regions within its nucleoplasmic domain. However, association with NPCs is dependent on the synergy of both nucleoplasmic and lumenal domains.
Cells that are either depleted of Sun1 by RNA interference (RNAi) or that overexpress dominant- negative Sun1 fragments exhibit clustering of NPCs. Monitored by β-galactosidase-
14
glucocorticoid receptor fusion protein, the major transport function of NPCs is not affected.
Thus, Sun1 represents an important determinant of NPC distribution across the nuclear surface.
The nuclear lamina is a condensed intermediate filament network lining the INM. One of the major components of the nuclear lamina, laminA (LaA) undergoes multistep posttranslational processing involving farnesylation, carboxymethylation and cleavage by ZmpSte24.
By using HIV protease inhibitor Lopivinair (Lop), which is known to inhibit the function of ZmpSte24, we accumulated a considerable level of farnesylated preA on the NE with concomitant nuclear structural abnormalities. Release from the Lop block resulted in rapid LaA processing, with a slightly slower reversion of normal nuclear morphology. On the other hand, farnesyl-transferase inhibitor FTI-277 in combination of geranylgeranyl-transferase inhibitor
GGTI-2147 effectively blocked LaA maturation and accumulated non-farnesylated preA on the
NE in Saos2 cells. The aberrant cellular phenotypes caused by Lop can be corrected by a combinatorial treatment of FTI-277 and GGTI-2147. Release both drugs led to a quick rebound phenomenon. In Hutchinson-Gilford progeria syndrome (HGPS) cells, however, prenylation of
LaA and LaAΔ50 was largely blocked by FTI-277 alone. Both protein maturation and nuclear phenotype returned slowly after drug washout, suggesting a role of cell proliferation in the rate of recovery. Our observations indicate a more dynamic nature of the nuclear lamina, with implications for design of therapies for HIV patients and the ongoing clinical trial for children with HGPS.
Our study has characterized the topology, localization and interaction of Sun1, a major role player in coupling nucleus and cytoplasm. Furthermore it provides new insight into the role of
Sun1 in NPCs distribution and lays the foundation of future investigations for nuclear pore membrane (NPM) curvature, interphase NPCs assembly and heterochromatin organization.
15
What’s more, our study has charactered the dynamics of the nuclear lamina by using inhibitors
for processing enzymes of LaA. This discovery has important implications in the clinical uses of
Lopinivir and FTIs in the treatment of HIV and progeria.
16
CHAPTER 1 INTRODUCTION
Introduction
By definition, the eukaryotic cell partitions its genetic material into a separate
compartment, the nucleus. It has become increasingly obvious that the nucleus has an elaborate
organization that is key to maintaining many of its major functions. Several dynamic “domains”
or subnuclear bodies serve as sites of pre-mRNA splicing and transcription while the nucleolus is
involved in ribosome biosynthesis (Handwerger and Gall, 2006; Raska et al., 2006a; Raska et al.,
2006b). The most obvious architectural component of the nucleus is the nuclear envelope (NE)
(Figure 1-1). The NE comprises a double membrane that delineates the nucleus and serves as a
selective barrier between nuclear and cytoplasmic compartments. Protein components of the
nuclear membranes and the underlying scaffold, which is an intermediate filament network
called nuclear lamina, appear to be important in the regulation of gene expression by providing
anchoring sites for chromosome territories. Certain nuclear membrane proteins that are components of nuclear pore complexes (NPCs) are involved in the control of nucleo-cytoplasmic transport of macromolecules.
So far, 80 integral nuclear membrane proteins have been identified or characterized, within which, members of the newly identified nesprin and SUN protein families are now shown to be involved in the connection of cytoskeleton and nuclear lamina. This finding has implicated the
NE in more global functions, including influence in cytoplasmic mechanics and participation in nuclear positioning.
The Nuclear Envelope
In the 1950s, the application of the electron microscope to investigate the fine structure of
isolated interphase nuclei revealed that the NE is composed of two concentric lipid bilayers, the
17
inner and outer nuclear membranes (INM and ONM, respectively) (Callan and Tomlin, 1950;
Hartmann, 1953). The INM and ONM are separated by a fairly uniform lumen, between 20-40
nm wide, known as the perinuclear space (PNS) (Watson, 1955). Periodic annular junctions between the INM and ONM create aqueous channels that traverse the NE and are occupied by
NPCs, which are massive (~60 MDa) multi-protein complexes that dictate the bidirectional passage of macromolecules across the NE (Burke, 2006; Watson, 1955).
Despite their connections at the periphery of each NPC, the INM and ONM are biochemically distinct. The INM contains its own unique repertoire of integral membrane proteins, is ribosome free and maintains close contacts with chromatin (Wiese and Wilson,
1993). The ONM, the cytoplasmically opposed membrane, is continuous with the rough endoplasmic reticulum (rER) and, like the rER, is covered with ribosomes. In effect, the cisternal space of the ER communicates directly with the PNS. Only in recent years has it been established that proteins, some as big as 1000kD, reside in the ONM, but not in the peripherial
ER (Padmakumar et al., 2004; Zhen et al., 2002).
Beneath the INM is an intermediate filament network called nuclear lamina. In addition to
acting as a mechanical support for the interphase NE, the lamina also plays a role in chromatin organization and gene regulation. Mutations in lamins and lamin-binding proteins can cause a wide range of heritable or sporadic human diseases, which are collectively known as
laminopathies. Reduced nuclear resilience and inability to activate mechanosensitive genes
(Broers et al., 2004; Lammerding et al., 2006; Lammerding et al., 2005; Lammerding et al.,
2004b) in all kinds of laminopathies has highlighted another function of NE components in
influencing cytoskeletal organization and mechanotransduction (Tzur et al., 2006; Worman and
Gundersen, 2006).
18
The Nuclear Pore Complexes
The NPCs are octagonal multiprotein assemblies with their 8-fold axes perpendicular to
the plane of nuclear membranes (Akey and Radermacher, 1993; Hinshaw et al., 1992). Each
NPC consists of a massive central framework embracing a central channel with diameters of
~30-40nm (Dworetzky et al., 1988; Feldherr et al., 1984). On the cytoplasmic face, there are
eight flexible filaments that adopt a highly “kinked” conformation, yielding a length of approximately 35nm (Stoffler et al., 1999). The nucleoplasmic face of NPCs, on the other hand, features a dynamic basket-like structure composed of eight 100nm filaments joined at their tips
by a distal ring approximately 30-50 nm in diameter (Jarnik and Aebi, 1991).
Approximately 30 proteins are found within NPCs, collectively called nucleoporins (Nups)
(Cronshaw et al., 2002; Rout et al., 2000). Three of them, POM121, gp210 and NDC1, contain
transmembrane helices, and POM121 and NDC1 have been shown to play a role in NPC and NE
assembly (Antonin et al., 2005; Mansfeld et al., 2006; Rasala et al., 2008). Another characteristic
structure of some Nups is repetitive stretches of Phe-Gly residues, the so-called FG repeats. Most
of FG repeat Nups line the surface of aqueous channel and are involved in cargo transport (Rout
and Wente, 1994).
Numbering between 1,000 and 10,000 in a vertebrate somatic cell, the density and
distribution of NPCs are not random. Detergent and salt fractionation of rat liver nuclei isolated a
nuclear matrix containing NPCs attached to the nuclear lamina (Aaronson and Blobel, 1975;
Dwyer and Blobel, 1976). Mapping various green fluorescent protein (GFP) tagged Nups also
showed the static and immobile nature of NPCs, confirming their physical interaction with
intranuclear structures (Daigle et al., 2001; Rabut et al., 2004). On the other hand, there is a
highly dynamic aspect of nuclear pores. Several earlier reports demonstrated that the number of
NPCs increases during the cell cycle (Maul et al., 1971). Maeshima et al. also reported large
19
distinct “LaA/C rich” subdomains lacking nuclear pores on the nuclear surface in early cell cycle stages and that they gradually become dispersed in G1-S phase. Notably, either static or dynamic, all these observations suggest a role for the nuclear lamina in NPCs distribution.
However, it is unknown whether the interaction between NPCs and various lamin proteins is direct or through other protein mediators. The clarification of this question will enlarge our understanding of molecular interactions within the NE.
The major function of NPCs is cargo transport between nucleus and cytoplasm. Molecules smaller than 25-40 kDa can passively diffuse across the NPC; however, highly efficient
localization and all macromolecular transport require facilitated, energy dependent transport,
which are imposed largely by soluble receptors such as members of karyopherin (Kap)/importin
family. The directionality of Kap-mediated transport is exquisitely controlled by the small
GTPase Ran, whose nucleotide-bound state dictates cargo binding and release in a
compartmentalized manner (Fried and Kutay, 2003; Pemberton and Kay, 2005).
Several models have been proposed speculating on the mechanism for movement through
NPCs. All invoke facilitated diffusion controlled by association and disassociation of transport receptors with FG Nups. However, different Kaps require different subsets of FG domains, which allow the existence of multiple, nonequivalent transport pathways within each NPC.
The Nuclear Lamina
Underlying the INM is the nuclear lamina, a major structural element of the NE. It plays a
critical role in maintaining interphase nuclear morphology by providing mechanical stability and
determining the spatial arrangement of NPCs in the NE (Aebi et al., 1986a; Gerace and Burke,
1988; Liu et al., 2000; Mounkes et al., 2003; Ris, 1997; Schirmer and Gerace, 2004; Stuurman et
al., 1998a). The nuclear lamina has also been shown to be an important determinant in DNA
replication, transcription, chromatin organization and apoptosis (Burke, 2001; Glass et al.,
20
1993a; Goldman et al., 2002; Gruenbaum et al., 2000; Lazebnik et al., 1995; Liu et al., 2000;
Starr and Han, 2002; Starr et al., 2001; Zastrow et al., 2004). Many functions of the lamina involve interactions with INM proteins and a provision for anchoring chromatin at the nuclear periphery (Gerace and Burke, 1988).
The major components of nuclear lamina are members of the intermediate filament protein family known as nuclear lamins (Stuurman et al., 1998b). Two classes of lamins have been described in mammalian somatic cells, type A and type B. Alternate splicing of a single LMNA transcript yields at least four variants in type A lamins: lamins A (LaA), C, AΔ10 and C2
(Goldman et al., 2002; Lin and Worman, 1993; Mounkes et al., 2001). Type B includes lamin B1 and B2, which, in contrast, are encoded by separate genes, LMNB1 and LMNB2 (Fisher et al.,
1986; McKeon et al., 1986). Lamin B3 is expressed as a minor splice variant of LMNB2 and, similar to lamin C3, was found to be germ cell specific (Goldman et al., 2002; Mounkes et al.,
2003).
Like all intermediate filament proteins, nuclear lamins feature a central coiled-coil domain flanked by a non-helical N- and C- terminal domains. The coiled-coil region contributes to the formation of parallel dimers (Stuurman et al., 1998b). Additional head-to-tail and lateral
interactions result in the formation of higher-order structures such as filaments and paracrystals
(Aebi et al., 1986b; Heitlinger et al., 1991; Heitlinger et al., 1992). Distinguished from other
intermediate filaments, however, lamin proteins possess a nuclear localization signal (NLS) and
highly conserved phosphoacceptor sites (P-sites) in the head and tail domains (Kalderon et al.,
1984; Loewinger and McKeon, 1988). P-sites act as substrates for a protein kinase Cdk1 which
phosphorylates lamins at the end of prophase and promotes nuclear lamina disassembly in
mitosis (Dessev et al., 1990; Gerace and Blobel, 1980).
21
Additionally, LaA, B1 and B2 contain a special CaaX motif tail where C=cysteine, a=any
amino acid with an aliphatic side chain, X=any amino acid (Hancock et al., 1989). Shortly after
synthesis, all Caax motif lamins are farnesylated on the cysteine residue, proteolytically cleaved
to remove the aaX sequence and then carboxymethylated on the farnesylated cysteine (Kitten
and Nigg, 1991). While B type lamins remain permanently farnesylated, LaA is unique in that it
undergoes proteolytic cleavage 15 residues upstream from the farnesylated cysteine (Figure 1-2).
This cleavage is believed to occur soon after the incorporation of LaA into nuclear lamina
(Gerace et al., 1984). According to the previous reports, the release of aaX is the function of
either ZmpSte24 or Rce1 (Bergo et al., 2002; Corrigan et al., 2005). However, the second
cleavage is carried out solely by ZmpSte24 (Corrigan et al., 2005). Like the yeast homolog
Ste24p, ZmpSte24 is a zinc-dependent metalloproteases and is an ER-localized integral
membrane protein (Kumagai et al., 1999). Disruption of ZmpSte24 in fibroblasts can cause a striking accumulation of Pre-lamin A (PreA) on the NE (Leung et al., 2001). Lately, the saquinavir family of HIV aspartyl protease inhibitors, a component of “highly active antiretroviral therapy (HAART)”, has been found to inhibit the function of ZmpSte24 (Coffinier et al., 2007). Abnormal processing of lamin A might account for some side effects of this treatment (Caron et al., 2007; Clarke, 2007).
Lamins are classified by biochemical properties, expression pattern and sequence homology (Broers et al., 1997; Gruenbaum et al., 2000). A-type lamins have a neutral isoelectric point and their expression is developemetly regulated. In the mouse, they are absent from early embryonic cells with expression commencing midway through gestation (Mattout-Drubezki and
Gruenbaum, 2003; Rober et al., 1989; Zastrow et al., 2004). In certain cell types, LaA/C appear only after birth and some adult cells, most notably those of the immune and hematopoietic
22
system, never express these proteins (Rober et al., 1990; Rober et al., 1989). Lamina enriched in lamin A (an A-type variant) are the most stable and require harsh conditions to be solubilized
(Schirmer and Gerace, 2004). However, The presence of lamins in the interior of the nucleus has also been well documented (Goldman et al., 1992; Jagatheesan et al., 1999; Kumaran et al.,
2002; Neri et al., 1999). B-type lamins are characterized by an acidic isoelectric point and are ubiquitously expressed at all stages of differentiation in mammalian somatic cells (Burke et al.,
2001; Gerace and Burke, 1988; Mounkes et al., 2003; Nigg, 1989). Moreover, B-type lamins are crucial for cell survival at the organismal level (Sullivan et al., 1999), whereas A-type lamins have been identified as non-essential in mouse embryos and in HeLa cells which have been depleted of LaA by RNAi (Harborth et al., 2001; Sullivan et al., 1999).
Laminopathies
To date, at least 18 human diseases and syndromes with wide-ranging phenotypes have been linked to a plethora of inherited or de novo defects in proteins of the NE. The first of these to be demonstrated was Emery-Dreifuss Muscular Dystrophy (EDMD). In 1994, Bione et al showed that defects in a nearly ubiquitous INM protein, emerin, was responsible for X-linked
EDMD (Bione et al., 1994). The disease is characterized by muscle atrophy, flexion deformities of the elbows, and cardiac conduction defects (Emery, 1987). Interestingly, a phenotypically indistinguishable autosomal dominant form of EDMD (AD-EDMD) was later mapped to mutations in the LMNA gene (Bonne et al., 1999). Multiple diseases caused by defects in the genes that encode A type lamins and associated proteins, specifically referred to as laminopathies, have since been described. These include dilated cardiomyopathy with conduction defects (DCM-CD1) (Fatkin et al., 1999), limb-girdle muscular dystrophy type 1B
(LGMD1B) (Muchir et al., 2000), Dunnigan-type familial partial lipodystrophy (FPLD2) (Cao and Hegele, 2000a; Shackleton et al., 2000a; Speckman et al., 2000), mandibuloacral dysplasia
23
(MAD) (Novelli et al., 2002), autosomal recessive Charcot-Marie-Tooth type 2B1 disorder
(CMT2B1) (De Sandre-Giovannoli et al., 2002), Hutchinson-Gilford progeria syndrome (HGPS)
(De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003), restrictive dermopathy (RD) (Navarro
et al., 2004) and atypical Werner’s syndrome (WS) (Chen et al., 2003).
The wide variety of clinical presentation of LMNA-associated diseases has raised the
question of how multiple mutations in a single gene can generate such a diverse range of diseases. Equally perplexing is that LMNA is expressed in most somatic cells, but frequently yields tissue-specific pathologies. This seemingly multi-faceted paradox has been addressed by two major theories, which are not necessarily mutually exclusive (Worman and Courvalin,
2004).
The Structural Hypothesis: One mechanism highlights the lamina and nuclear envelope as an architectural unit. Given that skeletal and cardiac muscle are especially subject to mechanical stress, disrupted nuclear structure support caused by LaA mutations is likely to be the pathology in EDMD, DCM and LGMD1B (Broers et al., 2004).
Mutations in the LMNA gene are frequently manifested as defects in nuclear morphology, including irregular shape and lobulations. Fibroblasts derived from Lmna-/- mice exhibit herniations in which INM proteins, B-type lamins, NPCs and chromatin are withdrawn from one pole of the nucleus (Roux and Burke, 2006; Sullivan et al., 1999). Studies using biomechanical techniques demonstrated that these fibroblasts show increased nuclear deformation, decreased mechanical stiffness, impaired mechanotransduction and increased susceptibility to nuclear rupturing when subjected to mechanical loads (Broers et al., 2004; Lammerding et al., 2004a).
On a molecular level, most mutations that cause neuromuscular phenotypes tend to affect the
24
structure of the hydrophobic core, potentially destabilizing or completely deleting the entire C-
terminal tail of LaA/C (Dhe-Paganon et al., 2002; Ostlund and Worman, 2003).
Beyond the nuclear boundaries, disruption of the lamina leads to disorganization of the
cytoskeleton and deformation of the cell as a whole (Broers et al., 2004). Lmna -/- cells display
abnormal actin networks and vimentin organization, which are important for cellular resilience
(Broers et al., 2004). Members of the newly identified nesprin and SUN protein family members
on the NE are likely to be involved in the integration of the nuclear and cytoplasmic compartments of the cell (Crisp et al., 2006). Desmin, an intermediate filament protein specific to muscle cells, is disorganized and detached from the nucleus in cardiomyocytes of Lmna-/- mice (Piercy et al., 2007). The disrupted cytoskeletal tension might impair force transmission and result in systolic contractile dysfunction.
The Gene Expression Model: Mutations in lamina proteins are also proposed to affect chromatin organization and alter cell-type specific gene expression patterns. The alpha-helical rod domains of LaA/ C contain chromatin binding sites. LaC, B1 and B2 also bind chromatin at their tail domains (Glass et al., 1993b). In vivo evidence has shown that approximately 500 genes interact with B-type lamins in Drosophila melanogaster. These genes were transcriptionally silent, late replicating, lacking in active histone marks and had a tendency to cluster in the genome, indicating a dynamic role for the lamina in chromatin organization and transcriptional regulation (Pickersgill et al., 2006). Indeed, altered heterochromatin distribution has been identified in emerin associated X-EDMD as well as LMNA-linked laminopathies, including AD-
EDMD, LGMD1B, FPLD, MAD and HGPS (Maraldi et al., 2006).
LaA and C also bind to RNA polymerase II, RNA splicing factors and a steadily increasing
number of known transcription factors such as autointegration factor (BAF), retinoblastoma
25
transcriptional regulator (RB) and sterol response element binding protein (SREBP1). BAF has two binding sites for dsDNA, and potentially regulate higher-order chromatin structure
(Bengtsson and Wilson, 2006). RB, on the other hand, after activated by dephosphorylation, induces transcriptional silencing at E2F-regulated loci, ultimately leading to reversible cell-cycle arrest (Flemington et al., 1993; Melcon et al., 2006). In lipodystrophic cells from MAD, FPLD and atypical Wemer syndrome, prelamin A accumulates at the NE colocalized with SREBP1.
This decreases the pool of SREBP1 to activate peroxisome proliferator activated receptor gamma
(PPARγ), and may impair pre-adipocyte differentiation (Capanni et al., 2005).
With its involvement in such diverse processes as chromatin organization and gene transcription, the lamina is intimately coupled to DNA replication and DNA damage repair.
Lmna–/- fibroblasts replicate their DNA at a slower rate, which can be rescued by over- expression of GFP-LaA (Johnson et al., 2004). In a recent study, Shumaker et al. have showed that the C-terminal non-α-helical domains of all lamins bind directly to proliferating cell nuclear antigen (PCNA), which is necessary for the processivity of DNA polymerase δ during the chain elongation phase of DNA replication (Lee and Hurwitz, 1990; Shumaker et al., 2008).
Accordingly, impaired DNA repair has also been reported in many progeroid syndromes (Lans and Hoeijmakers, 2006; Liu et al., 2005). Liu and colleagues has provided direct evidence of genomic instability in ZmpSte24-/- mice and in HGPS fibroblasts such as increased sensitivity to
DNA-damaging agents, increased numbers of chromosomal aberrations and a delayed response in the recruitment of DNA repair factors (Liu et al., 2005).
As mentioned previously, the structural hypothesis and gene expression model are not mutually exclusive. Lammerding et al. demonstrated that expression of the mechanosensitive genes egr-1and iex-1 was impaired in Lmna–/– fibroblasts (Lammerding et al., 2004b).
26
Additionally, the activity of NF-ĸB, a transcription factor that normally protects the cell from stress by responding to mechanical or cytokine stimulation, is reduced in Lmna-/- mouse fibroblasts, and thus contributes to the cell’s susceptibility to mechanical strain (Lammerding et al., 2004b).
The ambiguities on the etiology and tissue specificity of various laminopathies may be explained by the functional interactions between proteins concentrated within the NE. It is striking that mutations in two genes, encoding NE components known to interact, separately give rise to virtually the same disease. EDMD can be linked to mutations in both emerin and lamin
A; defects in Lap2α and lamin A lead to DCM (Bione et al., 1994; Bonne et al., 1999; Fatkin et al., 1999; Taylor et al., 2005). On the other hand, some diseases result from a combination of several protein defects. In C.elegans, depletion of emerin yielded no detectable phenotype, but was found to be synthetic lethal with the depletion of MAN1 (Brachner et al., 2005; Liu et al.,
2003). MAN1 and emerin bind directly to lamin A and to each other and are partially mislocalized from the NE when lamin A is lost from the NE (Clements et al., 2000; Liu et al.,
2003; Mansharamani and Wilson, 2005; Ostlund et al., 2006). Taken together, evidence gleaned from human diseases and animal models suggests there are complex interactions at the nuclear periphery involving nuclear and NE proteins as well as cytoplasmic components.
Hutchinson-Gilford Progeria Syndrome (HGPS)
Clinically recapitulating normal aging, one of the laminopathies, HGPS, has gained much recent attention. Several ageing-related features such as alopecia, loss of subcutaneous fat and premature atherosclerosis characterize this extremely rare and uniformly fatal disease. Patients usually die at a mean age of 12 years due to myocardial infarction or cerebrovascular accident
(Capell and Collins, 2006; DeBusk, 1972; Sarkar et al., 2001). Although several recessive
27
mutations have been reported to cause HGPS (Cao and Hegele, 2003; Fukuchi et al., 2004;
Kirschner et al., 2005; Plasilova et al., 2004; Verstraeten et al., 2006), the most common one is a de novo heterozygous silent substitution at codon 608 (G608G: GGC⇒GGT) of LMNA. This dominant mutation activates a cryptic splice donor site, ultimately creating a truncated PreA
(progerin or LaAΔ50), lacking the ZmpSte24 cleavage site at protein 647 but retaining the Caax box (De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003; Sevenants et al., 2005). Thus, progerin is permanently farnesylated and becomes irreversibly anchored in the NE.
HGPS cells are associated with significant changes in nuclear shape, including lobulation of the NE, thickening of the nuclear lamina, loss of peripheral heterochromatin, and clustering of nuclear pores. Compared to wild type (WT) LaA, progerin displays delayed targeting to the NE after mitosis and imposes a deleterious, stabilizing effect on the nuclear lamina. Additionally,
LaB1 is quantitatively reduced and mislocalized from the NE. Fluorescence resonance energy transfer (FRET) analysis indicated that an altered homopolymer segregation pattern of progerin and LaB1 (Delbarre et al., 2006; Goldman et al., 2004). Fibroblasts from patients with HGPS usually show a passage-dependent reduction in growth rate and lifespan in culture. They are hypersensitive to heat stress and exhibit broad epigenetic changes in histone methylation patterns that predate any nuclear shape changes (Paradisi et al., 2005; Shumaker et al., 2006).
In terms of disease mechanism, some authors hypothesized that alterations in nuclear structure, as well as the severity could be correlated to the toxic accumulation of farnesylated
PreA (Fong et al., 2004; Navarro et al., 2004). In such a case, a concentration-dependent dominant-negative effect of prelamin A would lead to disruption of lamin-related functions ranging from the maintenance of nuclear shape to regulation of gene expression and DNA replication.
28
Recent studies have shown that double-strand breaks (DSBs) typically accumulate in
HGPS cells and the resultant genome instability might contribute to premature aging (Liu et al.,
2005; Manju et al., 2006). DNA repair pathway defects were also observed. Liu et al. reported impaired recruitment of DNA repair factors to damage sites and abnormal colocalization of xeroderma pigmentosum group A (XPA) protein with DSBs in HGPS fibroblasts (Liu et al.,
2005; Liu et al., 2008). Furthermore, the association of progerin with NE membrane causes the impairment of mitosis and delays the progression of cell cycle (Dechat et al., 2007). Other evidences also show up such as alterations of epigenetic control, failure of stem cell growth, and altered regulation of gene expression (Dorner et al., 2006; Galderisi et al., 2006; Johnson et al.,
2004; Nitta et al., 2006; Shumaker et al., 2006).
Considering the pathophysiology of progeria might be the accumulation of farnesylated
PreA, several potential therapeutic strategies have emerged to target either the splicing defect or
the “toxic” farnesyl moiety of PreA.
Scaffidi and Misteli used antisense morpholino oligonucleotides specifically directed
against the aberrant exon 11–exon 12 junction contained in mutated pre-mRNAs to lower
progerin production (Scaffidi and Misteli, 2005). Alternatively, Huang and colleagues were able
to decrease mutated LMNA mRNAs expression levels by small interference RNA (Huang et al.,
2005). Notably, in both cases, nuclear blebbing was substantially ameliorated, indicating that the
reduction of progerin levels suffices to revert the abnormal nuclear morphology. However, at the
moment, these techniques seem to be difficult to apply to whole organisms.
On the other hand, based on the hypothesis that maintenance of the farnesyl moiety is one
of the major mediators of progerin toxicity, farnesyltransferase inhibitors (FTIs) have been used
as a potential strategy for HGPS. Since the early 1990s, FTIs have been in development for their
29
antineoplastic effects through inhibiting the farnesylation, and therefore activation of the
oncoprotein Ras (Basso et al., 2006). It was not long before FTIs were shown by several laboratories to have a dramatically beneficial effect in HGPS cells, preventing and even reversing the dysmorphic nuclear shapes and mislocalizing prelamin A away from the NE
(Capell et al., 2005; Glynn and Glover, 2005; Mallampalli et al., 2005; Toth et al., 2005; Yang et al., 2005). Further successes were also achieved in mouse models. Placing FTI in the drinking water of ZmpSte24-/- mice and Lmna HG/+ mice partially ameliorated the progeroid phenotype, resulting in reduced rib fractures, improved grip strength and decreased weight loss (Fong et al.,
2006; Yong and Hart, 1994).
However, the unique use of FTIs as a treatment for Progeria and related disorders is still a
matter of controversy. The first question concerns other farnesylated proteins such as LaB and
Ras proteins and downstream effects when their farnesylation is inhibited by FTIs (Rusinol and
Sinensky, 2006). The second concern comes from a possible alternative prenylation of PreA and progerin, i.e. geranyl-geranylation, bypassing the treatment with FTIs (Basso et al., 2006;
Rusinol and Sinensky, 2006). Furthermore, it has been shown that in HGPS and RD fibroblasts,
DNA damage checkpoints are persistently activated and that treatment of patients’ cells with a
FTI did not result in a reduction of DNA double-strand breaks and damage checkpoint signaling, although the treatment significantly reversed the aberrant nuclear shape (Liu et al., 2006). Even recently, Yang and his colleagues presented evidence that knocking mice expressing nonfarnesylatable progerin (Lmna(nHG/+) developed the same disease phenotypes observed in
Lmna(HG/+) mice, although the phenotypes were milder, which further suggests that the approach of farnesylation inhibition in treating HGPS may be limited (Yang et al., 2008).
30
On the other hand, several other molecules involved in cholesterol biosynthesis/prenylation
pathways also have therapeutic potentials. Statins inhibit the HMG-CoA reductase, the rate-
limiting enzyme of the mevalonate pathway of cholesterol synthesis and are known to induce an
inhibition of LaA maturation (Baker, 2005; Lutz et al., 1992; Sinensky et al., 1990). Amino-
biphosphonates (N-BPs) act as inhibitors of farnesyl-pyrophosphate synthase, thus reducing the synthesis of both geranyl-geranyl and farnesyl groups (Amin et al., 1992; Keller and Fliesler,
1999). Treatment with both statins and aminobisphosphonates has been shown to extend longevity in a mouse model of HGPS and they are currently under clinical study in France
(Varela et al., 2005)
Inner Nuclear Membrane Proteins
Until recently, only about a dozen integral membrane proteins were known to reside in the
NE. In 2005, a subtractive proteomics study of purified NE uncovered a catalogue of at least 50 additional putative NE transmembrane proteins (NETs) (Schirmer et al., 2005), the bulk of which appear to be enriched within the INM. The properties of many integral membrane proteins are
summarized in Table 1-1.
Most of those INM proteins interact with lamins and/or chromatin, which is generally
agreed to contribute to the structural stability of the NE and higher order organization of the
nucleus. Among those INM proteins that have already been characterized are the LEM domain
proteins: lamina associated polypeptide 2(LAP2), emerin and MAN1. This class of proteins
shares a common 43 amino acid domain that binds barrier to autointegration factor (BAF), a
DNA bridging protein nonspecific to sequence (Cai et al., 2001; Shumaker et al., 2001).
Moreover, LEM domain proteins have extensive interactions with regulator proteins; for
example, LAP2β and emerin interact with a transcription repressor, germ cell less (gcl) and
31
MAN1 binds Receptor-Smads 2/3, downstream effectors of the TGFβ and bone morphogenic
protein (BMP) signaling cascade (Holaska et al., 2003; Lin et al., 2005). Lamin B receptor
(LBR), on the other hand, provides an additional link to chromatin via its association with
heterochromatin protein 1α,γ (HP1α,γ), histones H3/H4 and epigenetically marked heterochromatin (Makatsori et al., 2004; Polioudaki et al., 2001; Ye et al., 1997; Ye and
Worman, 1996). Remarkably, vertebrate LBR possesses sterol C14 reductase activity and can
restore such activity to mutant yeast (Wagner et al., 2004). Emerin, LAP1 and LAP2 family
members, and LBR also exhibit an additional indirect attachment to chromatin via their
interactions with nuclear lamins (Burke and Stewart, 2002).
The targeting of INM proteins is considered to involve a process of selective retention that
depends on the interconnected nature of ER, ONM and INM (Gerace and Burke, 1988; Newport
and Forbes, 1987). Newly synthesized integral proteins move into the ONM by lateral diffusion
and gain access to the INM via membrane continuities of the NPCs. Only those proteins that are
capable of binding to stable nuclear components such as lamins or chromatin are subsequently
concentrated within the INM. Quantitative fluorescence recovery after photobleaching (FRAP)
analyses indicate that GFP-LBR and GFP-emerin diffused with unrestricted mobility in the ER
while the large fraction localized to the INM was virtually immobilized (Ellenberg and
Lippincott-Schwartz, 1999; Ostlund et al., 1999). In addition, emerin and MAN1 experienced
increases in mobility at the NE of Lmna-/- cells, indicating at least a partial dependence of
MAN1 and emerin on lamin A for retention at the INM (Ostlund et al., 2006).
Nesprin Targeting and SUN Domain Proteins
Recently, ONM-specific KASH domain proteins have been identified. KASH derives from
Klarsicht (Drosophila melanogaster), ANC-1 (C. elegans) and Syne-1 (mammal) homology
32
domain, which contains a transmembrane region and C-terminal residues lying within the PNS.
Other proteins, such as C. elegans Unc-83, ZYG-12 and Drosophila Msp-300/nesprin also
contain KASH domains.
The large NH2-terminal domains of ONM localized KASH proteins are central in bridging the communication gap between the nucleus and cytoskeletal components, namely actin, microtubules (MT) and intermediate filaments (IF), and play an important role in nuclear anchorage and positioning. ANC-1 is named after anchorage defective-1 and it contains two N- terminal calponin homology motifs, which comprise an actin-binding domain (ABD). Nuclei that are normally spaced apart float freely and aggregate in clusters in anc-1 mutants (Starr and Han,
2002). Similarly, Msp-300/nesprin has been found associated with actin filaments. Developing oocytes in germ-line Msp-300 null flies have a strong dumping phenotype caused by a lack of nurse cell nuclear anchorage (Yu et al., 2006).
Both the Drosophila Klarsicht and C. elegans ZYG-12 are known to link the nucleus and centrosome. Mutation of Klarsicht resulted in the failure of nuclear migration in photoreceptors, probably by interrupting the association between Klarsicht and MTs (Fischer et al., 2004;
Fischer-Vize and Mosley, 1994; Patterson et al., 2004). ZYG-12, on the other hand, is anchored at the NE via dimers of splice variants B and C. Their links to the centrosome are mediated by
ZYG-A (Malone et al., 2003). In ZYG-12 mutant worms, the centrosome detachment defect in the developing embryo resulted in death as a consequence of chromosome segregation defects
(Wilhelmsen et al., 2006).
Mammalian orthologs of ANC-1 and Msp-300 are two giant actin-binding proteins,
recently identified as type II integral membrane proteins of the ONM. Because they were
discovered in independent laboratories, they are variously termed nesprin 1 giant
33
(Nesp1G)/Enaptin/Syne-1/Myne-1 and nesprin 2 giant (Nesp2G)/NUANCE/Syne-2, with
predicted sizes of 1.1 MDa and 796 kD. (Apel et al., 2000; Mislow et al., 2002a; Padmakumar et
al., 2004; Zhang et al., 2001; Zhen et al., 2002). The giant nesprin (nuclear envelope spectrin repeat) proteins feature a paired calponin homology (CH) actin binding domain (ABD), a large
cytoplasmic domain containing multiple dystrophin related spectrin repeats, and a COOH-
terminal KASH domain. Spectrin repeats (SR) are composed of a bundle of three α-helices and may govern the length of the SR containing domain or confer elastic properties to the protein
(Djinovic-Carugo et al., 2002; Grum et al., 1999; Lenne et al., 2000). They are also found to help forming homo- and heterotypic dimers or regulating interactions with multiple proteins
(Djinovic-Carugo et al., 2002).
The giant nesprins arise from the nesprin 1 and nesprin 2 genes that encode a vast array of isoforms brought about by alternative splicing (Starr and Han, 2002; Zhang et al., 2001; Zhen et al., 2002). About 20 isoforms have been identified, ranging in size from 40kD to 1.1 MDa.
Immunogold EM has given us indications that nesprins are localized to both the INM and ONM
(Zhang et al., 2005; Zhang et al., 2001). Some of the smaller isoforms, such as nesprin 1α,
nesprin 2α, and nesprin 2β likely localize to the INM, given that they are known to bind to
emerin and lamin A/C (Mislow et al., 2002a; Mislow et al., 2002b; Zhang et al., 2005). Both
nesprins 1 and 2 are ubiquitously expressed, although some transcripts are more highly expressed
in cardiac, skeletal and smooth muscle (Zhang et al., 2005; Zhang et al., 2001; Zhen et al., 2002).
Nesprin 1 (originally named syne-1 for synaptic nuclear envelope) was first identified in a
yeast two-hybrid screen as a binding partner for muscle-specific tyrosine kinase (MuSK), a core
component of the post-synaptic membrane at the neuromuscular junction (NMJ) (Apel et al.,
2000). Meanwhile, the concentration of nesprin 1 on the envelopes of synaptic myonuclei is
34
significantly higher than in non-synaptic myonuclei, suggesting a role for nesprin 1 in anchorage of synaptic nuclei (Apel et al., 2000). Grady et al. created transgenic mice overexpressing a dominant-negative form of nesprin 1 consisting of only the conserved KASH domain (Grady et al., 2005). The dominant negative approach resulted in a substantial decrease in nuclei beneath
the NMJ in transgenic muscles with no effect on extrasynaptic nuclei. Overexpression of the
nesprin 2 KASH domain displayed a similar effect (Zhang et al., 2007). Furthermore, total
depletion of nesprin 1 abolished nuclei clustering under the NMJ and disrupted the organization
of non-synaptic nuclei in skeletal muscle and double depletion of nesprin 1 and 2 proved lethal
within 20 minutes of birth due apparently to respiratory failure (Starr, 2007; Zhang et al., 2007).
Recently, two more nesprin families have been discovered. Nesprin-3, which is smaller with the size of ~110 kDa, localizes only to the ONM. Nesprin-3 has two splice isoforms: α and
β. The N terminus of nesprin-3α binds to the ABDs of plectin, a member of the plakin family, which interacts with intermediate filament system (Leung et al., 2002; Wilhelmsen et al., 2005).
Nesprin 4, on the other hand, is found only in the secretary epithelia cells. It interacts with kinesin1 and might play a role in attaching nucleus to the basal membrane of the cell (Roux et al, submitted manuscript).
The identification of ONM-specific integral membrane proteins has raised the question of how these proteins are anchored in the NE (Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). Given that the ONM and ER membranes are contiguous, the problem remains what prevents ONM proteins from drifting into the peripheral ER. This issue was originally addressed in C. elegans when an INM protein, UNC-84 was required to recruit both ONM proteins ANC-1 and UNC-83 to the NE (Starr and Han, 2002; Starr et al., 2001). One of the defining feature of
UNC-84 is its C-terminal ~200 residues, with similarity to the Schizosaccharomyces pombe (S.
35
pombe) protein Sad1. This region is known as the SUN domain (Sad1p and UNC-84), which is
conserved over the course of evolution. Additionally, UNC-84 is predicted to have as many as nine hydrophobic domains, but how many actually span the INM is unknown (Tzur et al., 2006).
Though there is no proof of direct interaction between UNC-84 and Ce-Lamin, the NE
localization of UNC-84 is Ce-Lamin-dependent (Lee et al., 2002). Mutation of UNC-84 affected
nuclear migration and anchorage during development, which suggests that UNC-84 functions in
the same pathway as ANC-1 and UNC-83 (Malone et al., 1999; Starr and Han, 2002; Starr et al.,
2001). A second NE SUN domain protein in C. elegans, known as both SUN-1 and matefin, was necessary for NE attachment of ZYG-12 in germ line cells. Distinguished from UNC-83, the localization of SUN-1 to the NE was not dependent upon Ce-Lamin (Fridkin et al., 2004; Malone et al., 2003).
Based upon the above findings, the giant nesprins in mammalian cells could be anchored at the ONM in a manner analogous to ANC-1 in the C. elegans model. Thus, a role for a mammalian homolog to UNC-84 would be in order.
Mammalian cells are known to contain at least five SUN domain proteins: Suns 1-2, Sunc1
(Sun3), Spag4 (Sun4) and Spag4-like (Sun5). Suns 3-5, of which little are known, are testis specific (Shao et al., 1999; Xing et al., 2003). Suns 1 and 2, on the other hand, show ubiquitous gene expression patterns in both mouse and human (Ding et al., 2007). Each of the SUN proteins conforms to the same basic structure featuring an N-terminal domain followed by a block of hydrophobic amino acid residues, likely representing a transmembrane domain, and a C-terminal
SUN domain. Among those, Sun1 transcripts are present in multiple, alternatively spliced isoforms (Crisp et al., 2006).
36
The N-terminal domains of Sun1 and Sun2, which reside in the nucleoplasm, are sufficient to target them to the NE and also confer direct binding to A-type lamins. However, Sun1 and
Sun2 localization does not seem to be lamin A dependent (Crisp et al., 2006; Haque et al., 2006;
Hasan et al., 2006; Hodzic et al., 2004; Padmakumar et al., 2005). The C-terminal domains of
Sun1 and Sun2, which contains a coil-coil and SUN domain, on the other hand, reside in the
PNS, where they interact with KASH domain proteins, nesprin 1 and 2. The coil-coil region may
play a role in dimerization of SUN proteins (Crisp et al., 2006; Haque et al., 2006).
Dominant-negative mutants as well as knockdown of Sun1 and 2 destroyed NE
localization of nesprin 1 and 2 (Crisp et al., 2006; Padmakumar et al., 2005). In this way, Sun1
and 2 function as links in a molecular chain that connects actin cytoskeleton via nesprins to
lamins and other nuclear components. We have termed this assembly the LINC (linker of
nucleoskeleton and cytoskeleton) complex (Crisp et al., 2006) (Figure1-3). As alluded to
previously, cells from laminopathy patients exhibited reduced cytoplasmic resilience and an
inability to activate mechanosensitive genes. Given their role in nucleocytoplasmic coupling,
Sun1 and 2 might be the mediators of these effects. It is intriguing to further explore the extent
and nature of the interactions of LINC complex components. Furthermore, considering the
functional redundancy between Sun1 and 2, we wonder why nature requires two proteins to play
the same role. Identification of their differences will expand our understanding as to the LINC
complex.
In addition to mechanical linker, the LINC complex bridges the NE. According to Crisp et
al., double knockdown of Sun1 and 2 led to frequent expansion of the PNS and increased
separation of the INM and ONM. Meanwhile, other, non-mechanical roles of SUN domain
proteins are also emerging. For instance, Sun1 has been found to be involved in centrosome
37
association (Wang et al., 2006), decondensation of mitotic chromosomes (Chi et al., 2007), telomere attachment to the NE and gametogenesis in mice (Ding et al., 2007).
There are two major aims for this dissertation. The first goal is to determine the extent and nature of the interactions of LINC complex components and how these might affect LINC complex function. Our second objective is to investigate LaA processing as it relates to the basic biology of the NE, as well as ongoing therapeutic modalities for HIV-infected patients and children with HGPS.
38
(Stewart CL, Roux KJ and Burke B. Science. 2007; 318:1408-12)
Figure 1-1. Overview of nuclear envelope organization in a eukaryotic interphase cell. Some selected INM proteins, including lamina-associated polypeptides 1 and 2 (LAP1 and LAP2) and LBR, are shown; these proteins interact with HP1 and BAF and provide links to chromatin. The nuclear lamina, composed of A-type and B-type lamins, is thought to provide a structural framework for the NE. The INM and ONM are joined at the periphery of each NPC with the ONM being continuous with the ER, forming a continuous membrane system. Consequently, the PNS and ER lumen are continuous. The ONM is characterized by cytoskeleton-associated nesprin proteins that are tethered by SUN domain proteins in the INM.
39
Figure 1-2. LaA Processing. LaA is synthesized as the precursor protein prelamin A. PreA contains a C-terminal CaaX motif that accepts a farnesyl group added by the action of the enzyme, protein farnesyltransferase. Following farnesylation, the last three amino acids (-AAX) of PreA are cleaved by the endoprotease ZmpSte24 and the newly exposed cysteine is carboxyl-methylated. Subsequently, the terminal 15 amino acids of the maturing LaA are cleaved by ZmpSte24 and degraded, releasing the mature LaA. Arrows indicate cleavage sites.
40
Figure 1-3. Model for the LINC complex. Nuclear components, including lamins, bind to the INM SUN domain proteins. They, in turn, bind to the KASH domain of the ONM protein nesprins Giant Nesprin1, 2 interact with actin and Nesprin3, on the other hand, associate with plectin which links to intermediate filaments. Thus, the LINC complex establishes a physical connection between the nucleoskeleton and the cytoskeleton.
41
Table 1-1 Properties of representative inner nuclear membrane proteins Name Size Lamin binding Chromatin interactions Other properties
LAP1A 75kD A/B-type lamins
LAP1B 68kD A/B-type lamins Splice variant of LAP1A
LAP1C 57kD A/B-type lamins ? Type 2 membrane protein. 173 residue lumenal domain, 311 residue nucleoplasmic domain. Splice variant of LAP1A
LAP2β 50kD B-type lamins BAF, HA95 Type 2 membrane protein. Large 410 residue nucleoplasmic domain. LEM domain.
LAP2ε,δ,γ 38,43,46 kD Most likely B-type Probable chromatin Type 2 membrane proteins. Splice variants of LAP2 . Two lamins binding via BAF other splice variants, LAP2 are soluble proteins.
42 LBR 71kD B-type lamins HP1, HA95 Multi-spanning protein. Sterol C-14 reductase activity.
Emerin 29kD A-type lamins BAF Defects in emerin linked to Emery-Dreifuss muscular lamin B1 dystrophy. LEM domain.
Nurim 29kD Multi-spanning membrane protein
MAN1 82kD A/B type lamins Probable chromatin LEM domain; attenuates TGFβ signaling binding via BAF
Otefin 47kD Drosophila Dm lamin YA LEM domain
LUMA 45kD Multi-spanning
Lem2 56kD A/B-type lamins BAF LEM domain
CHAPTER 2 FUNCTIONAL ASSOCIATION OF SUN1 WITH NUCLEAR PORE COMPLEXES
Abstract
Sun1 and Sun2 are A-type lamin-binding proteins that in association with nesprins form a
link between the inner and outer nuclear membranes (INM and ONM) of mammalian nuclear
envelopes (NEs). Both immunofluorescence and immuno-electron microscopy reveal that Sun1,
but not Sun2, is intimately associated with nuclear pore complexes (NPCs). Topological analyses
indicate that Sun1 is a type II integral protein of the INM. Localization of Sun1 to the INM is
defined by at least two discrete regions within its nucleoplasmic domain. However, association
with NPCs is dependent on the synergy of both nucleoplasmic and lumenal domains. Cells that
are either depleted of Sun1 by RNAi or which overexpress dominant-negative Sun1 fragments
exhibit clustering of NPCs. The implication is that Sun1 represents an important determinant of
NPC distribution across the nuclear surface.
Introduction
The nuclear envelope (NE) is the selective barrier that defines the interface between the
nucleus and the cytoplasm (Burke and Stewart, 2002; Gruenbaum et al., 2005). Because it mediates molecular trafficking between these two compartments it plays an essential role in the maintenance of their biochemical identities. In addition to its transport function, the NE is also a key determinant of nuclear architecture, providing anchoring sites at the nuclear periphery for chromatin domains as well as for a variety of structural and regulatory molecules. A corresponding contribution to cytoplasmic structure has been described in which NE components may also influence cytoskeletal organization and mechanotransduction (Tzur et al., 2006;
Worman and Gundersen, 2006).
43
The NE is composed of several structural elements, the most prominent of which are the inner and outer nuclear membranes (INM and ONM). These are separated by the perinuclear space (PNS), a gap of 30-50nm. Annular junctions between the INM and ONM create aqueous channels that traverse the NE and which are occupied by nuclear pore complexes (NPCs). It is the NPCs that endow the NE with its selective transport properties (Tran and Wente, 2006).
The final major feature of the NE is the nuclear lamina, a thin (20-50nm) protein layer that is associated with both the INM and chromatin. The lamina is composed primarily of A- and B- type lamins, members of the intermediate filament (IF) protein family (Gerace et al., 1978). The lamins interact with components of the INM and NPCs as well as with chromatin proteins and
DNA (Zastrow et al., 2004). In this way, the lamina plays an important structural and organizational role at the nuclear periphery.
Despite their continuities, the INM and ONM are biochemically distinct. The ONM features numerous junctions with the peripheral ER to which it is functionally and compositionally similar. In contrast, the INM contains its own unique selection of integral proteins. Clearly, the INM, ONM and ER represent discrete domains within a single continuous membrane system. Accordingly, the PNS is a perinuclear extension of the ER lumen.
Localization of integral proteins to the INM involves a process of selective retention
(Ellenberg et al., 1997; Powell and Burke, 1990; Soullam and Worman, 1995). While, proteins that are mobile within the ER and ONM may gain access to the INM via the continuities at each
NPC, only proteins that interact with nuclear or other NE components are retained and concentrated. Recent reports suggest additional mechanisms may overlie this basic scheme.
(Ohba et al., 2004) showed that movement of integral proteins through the NPC membrane domain is energy dependent. Other studies suggest a role for the nuclear transport receptor
44
adaptor, karyopherin/importin-a in the transit of proteins to the INM (King et al., 2006; Saksena
et al., 2006).
Recognition of ONM-specific membrane proteins raises the question of what prevents
these proteins from escaping to the peripheral ER? In C. elegans, localization of Anc-1, an ONM
protein involved in actin-based nuclear positioning, requires Unc-84, an INM protein whose
retention is lamin-dependent (Lee et al., 2002; Starr and Han, 2002). These observations led to a
model in which Unc-84 and Anc-1 interact across the PNS via their lumenal domains, providing
a mechanism for the tethering of ONM proteins.
In mammals two large actin binding proteins, nesprin 1 Giant (nesp1G, 1,000kDa) and
nesprin 2 Giant (nesp2G, 800kDa), reside in the ONM (Apel et al., 2000; Mislow et al., 2002b;
Zhang et al., 2001; Zhen et al., 2002). The nesprins (also known as Syne 1 and 2) are related to
both Anc-1, and a Drosophila ONM protein, Klarsicht (Mosley-Bishop et al., 1999; Welte et al.,
1998), in that they contain a ~50 amino acid C-terminal KASH domain (Klarsicht, Anc-1, Syne
Homology) consisting of a single transmembrane anchor and a short segment of about 30-40
residues that resides within the PNS. A third ONM KASH-domain-containing protein, nesprin 3,
interacts with plectin, a large (466kDa) cytolinker (Wilhelmsen et al., 2005).
Unc-84 contains a ~200 amino acid C-terminal region that shares homology with Sad1p,
an S. pombe spindle pole body protein (Hagan and Yanagida, 1995). This sequence, known as
the SUN domain (for Sad1p, UNc-84) resides within the PNS. The human genome encodes five
SUN domain proteins. Two of these, Sun1 and Sun2, are lamin A-interacting proteins of the
INM with topologies similar to that of Unc-84 (Crisp et al., 2006; Haque et al., 2006; Hodzic et al., 2004).
45
Both Sun1 and Sun2 cooperate in tethering nesp2G in the ONM (Crisp et al., 2006; Haque
et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005). This tethering involves interactions
that span the PNS (Crisp et al., 2006), similar to that suggested for Unc84 and Anc-1. Unc84 also
tethers Unc-83, another ONM KASH domain protein (McGee et al., 2006). Competition between
nesprin 1 and 2 KASH domains (Zhang et al., 2007), suggests that nesp1G is similarly tethered.
In this way, Sun1 and 2 function as links in a molecular chain that connects the actin cytoskeleton, via nesprins, to lamins and other nuclear components. We have termed this assembly the “LINC complex” (for LInker of Nucleoskeleton and Cytoskeleton, (Crisp et al.,
2006). The fact that nesprin 3 binds plectin, a diverse cytolinker (Wilhelmsen et al., 2005),
indicates that there may be multiple isoforms of the LINC complex responsible for integrating
the nucleus with different components of the cytoskeleton.
As alluded to above, the NE can influence cytoplasmic mechanics and the responses of
cells to mechanical stress. Cells depleted of either A-type lamins or emerin, an INM protein,
exhibit reduced cytoplasmic resilience and an inability to activate mechanosensitive genes
(Broers et al., 2004; Lammerding et al., 2006; Lammerding et al., 2005; Lammerding et al.,
2004b). In humans, loss or mutation of either A-type lamins or emerin is associated with several
diseases (Muchir and Worman, 2004), including Emery-Dreifuss muscular dystrophy. It is not
hard to imagine that the LINC complex might be the mediator of these effects given its proposed
role in nucleocytoplasmic coupling.
Less clear is the extent and nature of the interactions of LINC complex components and
how these might affect LINC complex function. In the case of nesprins 1 and 2 versus nesprin 3
there are obvious differences in terms of actin versus plectin association. At the INM, the
situation with the Sun proteins is more ambiguous. We know that there is some degree of
46
functional redundancy between Sun1 and Sun2 with respect to nesprin 2 tethering. Furthermore,
we know that Sun1 and 2 can associate with lamin A but that this interaction is not required for
their localization. In this paper we further explore interactions of SUN proteins at the nuclear
periphery. In so doing we have been able to describe discrete regions within Sun1 that function
both in localization to the INM and in oligomerization. Most significantly, we are able to
demonstrate that Sun1 and Sun2 are segregated within the INM. While Sun2 displays a roughly
uniform distribution across the NE, Sun1 is concentrated at NPCs. Elimination of Sun1 or
overexpression of Sun1 mutants leads to NPC clustering. The inference is that Sun1, but not
Sun2, functions in the maintenance of the uniform distribution of NPCs. It also follows that certain LINC complex isoforms may mediate the differential association of cytoskeletal elements with NPCs versus NPC-free regions of the NE.
Results
Mammalian SUN proteins are encoded by at least five genes (Figure 2-1). Of these, only
Sun1 and Sun2 are widely expressed in somatic cells. Sun3 (Crisp et al., 2006; Haque et al.,
2006; Tzur et al., 2006), Sun4 (SPAG4) (Hasan et al., 2006; Shao et al., 1999) and Sun5
(SPAG4Like, unpublished observations) seem to be restricted largely to the testis. Each of the
SUN proteins conforms to the same basic structure featuring an N-terminal domain followed by a block of hydrophobic amino acid residues, likely representing a transmembrane (TM) domain,
and a C-terminal SUN domain. The relationships between these proteins are displayed in Figure
2-1. In the case of Sun1, the largest of the mammalian SUN proteins, the nucleoplasmic N-
terminal domain is composed of 350-400 amino acid residues (Crisp et al., 2006). All of the
sequence variants of Sun1 that arise through alternative splicing involve changes in this segment
of the molecule (Figure 2-1).
47
A prominent feature of Sun1 is the presence of four hydrophobic sequences, H1-H4, any
one of which could potentially function as a TM domain. Previously, we showed that H1, at
least, does not span the INM (Crisp et al., 2006). This conclusion was based upon a naturally
occurring splice isoform that is missing sequences encoded by exons 6, 7 and 8 (Sun1D221-344
(Dexons6-8)). This isoform lacks H1 yet displays appropriate NE localization and has the same topology within the INM as full length Sun1. Nevertheless, as will be expanded upon, while not a TM domain, H1 may still contribute to membrane association. Mouse Sun1 also contains a
predicted C2H2 zinc finger. Since this is absent from primate Sun1, its significance remains
unclear.
The C-terminal region of Sun1, like that of Sun2, consists of roughly 450 amino acid
residues and resides within the PNS. It contains a membrane proximal predicted coiled-coil and a
conserved distal SUN domain. The junction between these two features contains the KASH
binding site and is therefore essential for the tethering of ONM nesprins.
While Sun1 and Sun2 have obvious similarities in terms of domain organization and
topology, we noticed differences in their localizations within the NEs of multiple cell types. In
particular the distribution of Sun1 appears more punctate than that of Sun2 (Figure 2-2A). This
was evident by both immunofluorescence microscopy employing antibodies against the
endogenous proteins as well as by observations on exogenous Sun1 or Sun2 carrying a C- terminal green fluorescent protein (GFP) tag. A direct comparison of the two proteins indicates that they are largely segregated within the plane of the NE. Double label experiments employing
an antibody against Nup153, a NPC component, revealed that Sun1 but not Sun2 was concentrated at NPCs. This localization was confirmed by immunoelectron microscopy of HeLa
cells expressing either Sun1-GFP or Sun2-GFP (Figure 2-3A-C). Quantitative analysis revealed
48
that in the case of Sun1, gold particles were all clustered within 120nm of the NPC eight-fold
axis with a peak at 66nm +/-20nm (standard deviation; Figure 2-3D). Sun2, displayed a far
broader distribution with a median distance from the NPC eight-fold axis of 240nm +/-120nm
(Figure 2-3E). Only 8% of gold particles were within 120nm, and none within 66nm. Of
necessity, the scale in Figure 2-3E is five times that in Figure 2-3D.
Differential localization of Sun1 versus Sun2 is reflected in their behavior during mitosis.
Following NE breakdown, both proteins are dispersed throughout the cytoplasm, most likely in
ER membranes. During late anaphase/early telophase, as NE reassembly commences, re-
segregation of Sun1 and Sun2 occurs. Sun2 concentrates at a region of each newly separated
chromatin mass adjacent to one of the spindle poles. This “core” region (Figure 2-2B) of
chromatin is typically deficient in NPC reformation. The behavior of Sun2 mirrors that of
another INM protein, emerin, which also concentrates at the chromatin core at roughly the same
time (Maeshima et al., 2006). Sun1, in contrast, tends to be excluded from the core region and
instead concentrates on the lateral margins of the chromatid masses where NPC assembly is
initiated.
Localization of Sun1 to the INM involves determinants in both N- and C-terminal domains
(Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005; Wang et al.,
2006), although the relative contributions of these and how they might affect association with
NPCs is still unknown. In addition, while previous studies (Crisp et al., 2006; Haque et al., 2006;
Hasan et al., 2006; Padmakumar et al., 2005; Wang et al., 2006) have demonstrated that the TM
domain(s) of Sun1 is contained within the H2-4 region, they provide an ambiguous view of the
targeting properties of this segment of the molecule. We and others (Crisp et al., 2006;
Padmakumar et al., 2005) had proposed that Sun1 might be a multi-spanning protein with three
49
TM sequences corresponding to H2, H3 and H4. However, direct evidence to support such a model is lacking.
To better define Sun1 topology, we prepared a series of mutants containing different combinations of the H2, H3 and H4 hydrophobic sequences, all of which were found to confer some degree of membrane association. These mutants contained all or part of the N-terminal domain (residues 1-355) followed by one or more hydrophobic sequences and terminating with
GFP (Figure 2-4). At the N- and C–termini of certain of these chimeras we placed HA and Myc epitope tags respectively. These constructs were expressed by transfection in HeLa cells, which were subsequently treated with low concentrations of digitonin. Under these conditions the plasma membrane is permeabilized but the ER and nuclear membranes remain intact. The permeabilized cells were then incubated with proteinase K. During the course of this incubation,
Western blot analysis revealed that cytoplasmic (tubulin) and nuclear (lamin A/C, Nup153) proteins were degraded (proteinase K may enter the nucleus by degrading NPC proteins) while
ER lumenal and PNS proteins such as PDI were protected (Figure 2-4A). Triton X-100 (TX-100) permeabilization permitted digestion of all these proteins. In the case of the Sun1 chimeras, we determined the latency of the HA and Myc epitope tags by both SDS-PAGE analysis of immunoprecipitated, radiolabeled proteins and immunofluorescence microscopy (the latter on permeabilized but not proteinase treated cells) (Figure 2-4A and B, respectively). In some experiments we employed specific antibodies to monitor the latency of the GFP moiety (Figure
2-4C). The results reveal that the N-terminal HA tag is always exposed to the cytoplasm or nucleoplasm. In contrast the Myc tag or GFP becomes latent, i.e. it resides within the ER lumen/PNS, whenever the H4 sequence is present within the chimera. No combination of H2 and
H3 (either singly or together) would confer such latency. Conversely, neither H2 nor H3 could
50
affect the orientation of H4 and therefore the latency of the Myc tag or GFP. The only reasonable
conclusion is that while H2 and to a lesser extent, H3 may confer membrane association (see
Figure 2-4C), they do not cross the bilayer. Therefore, rather than being a multi-spanning protein
as previously suggested, Sun1 would appear to be a type II membrane protein with a single TM
domain represented by H4 (Figure 2-9).
With a better understanding of Sun1 topology, we next wished to identify NE and NPC
retention domains. To this end, we generated an extensive family of chimeric Sun1 proteins.
Since H4 appears to represents the sole TM domain, we sought to clarify the role of the other
hydrophobic sequences. Sun1N355, which contains the H1 sequence but lacks H2 and H3, was
found to localize to the NE (Haque et al., 2006). This is in contrast to the nucleoplasmic
localization of Sun1N355D221-343 (this corresponds to the exon 6-8 deletion) (Figure 2-5A) or
of Sun1N220 (Crisp et al., 2006), both of which lack any hydrophobic motif. When
Sun1N355D221-343 was extended to include the H2 domain (Sun1N380D221-343), NE
association was rescued (Figure 2-5A). Taking all of this data together, we can conclude that H1,
H2 and to a certain extent H3, are each sufficient to confer membrane association. However,
since the Sun1N220 region itself will accumulate readily within the nucleoplasm (Crisp et al.,
2006), these experiments do not reveal whether any of the hydrophobic sequences themselves
have intrinsic INM targeting activity.
To address this question we next examined the behavior of two additional H2 containing
fusion proteins, both tagged at the N-terminus with the Myc epitope (Figure 2-5A). The first of
these represented an N-terminal truncation lacking the initial 220 Sun1 residues but containing
H1 and H2 (Myc-Sun1 221-380) whereas the second was missing H1 in addition to the N-
terminal 220 residues (Myc-Sun1 261-380). The former localized to the NE, and to a lesser
51
extent to the peripheral ER. The latter, in contrast, was primarily ER-associated with little
concentration in the NE. The implication of these results is that a NE localization motif is
encoded by Sun1 residues 221-380. This region of the molecule must therefore share interactions with other nuclear or NE components.
We next examined whether the H2-H4 region alone has a role in NE targeting. When this sequence was fused to the N-terminus of GFP, it localized predominantly to the Golgi apparatus and cell surface, with little if any associated with the NE (Figure 2-5B). In contrast, a Sun1 N- terminal truncation consisting of the H2-H4 region followed by Sun1 lumenal domain
(H234Sun1L-GFP) localized efficiently to the NE (Padmakumar et al., 2005). We already know, however, that a soluble form of the Sun1 lumenal domain that is appropriately localized to the
ER lumen and PNS is itself insufficient for NE targeting (Crisp et al., 2006). There are at least
two explanations for these results. The first is that the lumenal domain does contain targeting
information but that it is only functional when the domain is appropriately oriented or tethered to
the ER or nuclear membranes. The second is that the H2-H4 hydrophobic region can direct
localization to the INM but that this only occurs in the context of the Sun1 lumenal domain. In
other words, the Sun1 lumenal domain can modify the behavior of the H2-H4 sequences. What we can rule out, however, is any suggestion that localization of H234Sun1L-GFP to the INM occurs by virtue of oligomerization with endogenous Sun1. Overexpression of H234Sun1L-GFP leads to displacement of endogenous Sun1 from the NE while itself concentrating in the NE
(Padmakumar et al., 2005)Roux, Liu and Burke, unpublished observations). Additionally, depletion of Sun1 by RNAi has no effect on H234Sun1L-GFP localization (Roux, Liu and
Burke, unpublished observations).
52
To further address these issues we replaced the H2-H4 hydrophobic region of both full
length Sun1 and H234Sun1L-GFP with the unrelated TM domain of Sun3 (to yield HA-
Sun1(S3TM) and S3TMSun1L-GFP respectively) (Figure 2-5B). As shown in Fig S2A, HA-
tagged Sun3 when expressed in HeLa cells localizes to the NE, but does not associate with
NPCs. Sun3 contains a single predicted TM domain that resides between residues 46 and 65. As
will become evident below, this sequence contains no intrinsic NE-targeting activity. Translation
of Sun3 in vitro in the presence of microsomes confirms that this sequence must function as a
TM domain with a type II orientation (data not shown).
HA-Sun1 (S3TM) behaved exactly like full length Sun1 in that it concentrated in the NE
(Figure 2-5B) in association with NPCs. S3TMSun1L-GFP in contrast, displayed little or no NE
localization and instead was found in the Golgi apparatus and at the cell surface (Figure 2-5B).
Evidently it is not retained in the nuclear membrane/ER system. Deletion of H2-H3 from
H234Sun1L (H4Sun1L-GFP) also resulted in loss of NE-association (Figure 2-5B). The implication then is that H2-H3 encodes a NE localization function. If this is the case, then attaching H2-H3 to the N-terminus of S3TMSun1L-GFP should lead to its accumulation at the
NE. Indeed we do observe a partial restoration of NE localization (Figure 2-5B).
It is evident from these results that while the H2-H3 sequence promotes localization to the
NE, its activity is strongly influenced by the Sun1 lumenal domain. This is despite the fact that
these regions of Sun1 reside on opposite sides of the INM. A possible explanation for this result
is that the targeting activity of H2-3 may be activated or enhanced by dimerization (or
oligomerization), perhaps leading to increased avidity for nuclear or INM-associated binding
partners. A prediction here is that the lumenal domain of Sun1 should mediate dimerization (or
oligomerization). This is borne out in transfection experiments where full length Sun1 was co-
53
expressed in HeLa cells with a variety of epitope tagged Sun1 deletion mutants (Figure 2-6).
Immunoprecipation analyses resulted in efficient co-precipitation of full length and mutant Sun1 only when the mutant form contained an intact lumenal domain. Further compelling evidence for lumenal domain mediated oligomerization was provided by immunofluorescence observations of
SS-HA-Sun1L-KDEL and S3TMSun1L. As described above, neither of these chimeric proteins
concentrates to any great extent in the NE. However, overexpression of full length Sun1 will
recruit both of these proteins to the NE. Taken together, these data clearly demonstrate that Sun1
homo-oligomerizes via lumenal domain interactions, most likely involving the predicted
membrane proximal coiled-coil.
Which Sun1 sequence elements are required for association with NPCs? Analysis of all of
the Sun1 constructs that we have prepared revealed that apart from wild type Sun1, only
Sun1D221-343 and Sun1 (S3TM) associated with NPCs (Figure 2-7A). Evidently association
with NPCs does not involve the H1 and H234 hydrophobic sequences acting in concert. To take
these analyses further, we prepared a pair of chimeras in which we swapped the Sun1 and Sun2
lumenal domains. In neither case could we observe NPC association (data not shown). Instead,
both recombinant proteins behaved like Sun2. Evidently both nucleoplasmic and lumenal
domains of Sun1 cooperate in conferring NPC-association.
So far we have shown that there are multiple determinants within the Sun1 nucleoplasmic
domain that can confer localization to the INM. Hasan et al. (2006) used FRAP analysis to show
that wild type Sun1 is relatively immobile within the INM. We performed similar analyses on a
subset of our Sun1 deletion mutants that localize to the NE (Figure 2-7B). In all cases these
mutants display enhanced mobility relative to wild type Sun1. Even deletion of the lumenal
domain, which appears to contain no intrinsic targeting function but does promote
54
oligomerization, leads to increased mobility within the INM. Thus while Sun1 does contain multiple autonomous features involved in localization, stable localization to the NE requires that all be present. These findings are reminiscent of our conclusion that multiple features within the
Sun1 molecule are required for NPC association.
What is the significance of Sun1 association with NPCs? Proteomic studies provide no evidence that Sun1 is an intrinsic component of the NPC (Cronshaw et al., 2002). However, in order to determine whether Sun1 might contribute to NPC functionality we examined nuclear transport in HeLa cells that had either been depleted of Sun1 by RNAi or which expressed Sun1 fragments, some of which resulted in a loss of endogenous NE-associated Sun1 (data not shown).
To accomplish this we took advantage of a GFP fusion protein bearing nuclear import and export signals (NLS-GFP-NES) and which shuttles between the nucleus and cytoplasm (Stade et al.,
1997). We also employed a hormone inducible nuclear import substrate consisting of beta- galactosidase fused to the glucocorticoid receptor (grb) (Bastos et al., 1996). Our results indicate that Sun1 has no significant role in the nuclear transport of proteins, either import or export.
Similarly, distribution of poly A (+) RNA revealed by in situ hybridization suggests that Sun1 makes little or no contribution to mRNA export (data not shown).
Sun1 depletion was not, however, without affect on pore complexes. We noticed that loss of Sun1 was always associated with an altered distribution of NPCs (Figure 2-8A) as well as altered nuclear shape (Figure 2-8C). In wild type cells, NPCs tend to be uniformly distributed across the nuclear surface. Following Sun1 depletion, NPC aggregates or clusters could be observed leaving NPC-free areas of varying sizes. This effect was Sun1-specific since depletion of Sun2 left NPC distribution unchanged.
55
This effect of Sun1 depletion on NPC aggregation could be emulated by overexpression of nucleoplasmic Sun1 deletion mutants in HeLa cells. Expression of these mutants often leads to a diminution in the amount of full length Sun1 at the NE (and hence at NPCs). A quantitative
analysis of NPC aggregation induced by both Sun1 depletion and Sun1 mutant expression is
displayed in Figure 2-8B.
Since Sun1 may act as a tether for ONM nesprins, it is possible that NPC aggregation is a
function of loss of nesprins rather than a loss of Sun1. To determine whether this might be the
case, we overexpressed a protein consisting of GFP fused to the KASH domain of either
nesprin1 or 2 (GFP-KASH1, 2) in HeLa cells. Overexpression of GFP-KASH1 or 2 leads to
displacement of nesprins 1 and 2 from the NE (Zhang et al., 2007). Treatment of cells in this way
was found to have no discernible effect on NPC distribution (data not shown). These data
suggest that Sun1 has a nesprin-independent role in the maintenance of the uniform distribution
of NPCs across the NE.
Discussion
Sun1 and Sun2 are of a pair of ubiquitous INM proteins that tether nesprins within the
ONM. Nesp1G and nesp2G contain N-terminal actin binding domains (Padmakumar et al., 2004;
Zhen et al., 2002), whereas nesprin 3 binds plectin, a versatile cytolinker (Wilhelmsen et al.,
2005). Thus, the SUN proteins represent links in a molecular chain that connects elements of the
cytoskeleton to components within the nucleus. We have previously referred to translumenal
Sun-nesprin pairs as LINC complexes (Crisp et al., 2006). Multiple LINC complex isoforms
likely exist given the apparent redundancy of Sun1 and Sun2 in tethering nesprins. In addition
we can identify at least four or five splice isoforms of Sun1 alone, further increasing the LINC
complex repertoire. The nesprins themselves (including nesprin 3) are also represented by
56
dozens of splice isoforms. Aside from nesp1G and nesp2G, the number of these that may be tethered by Sun proteins at the ONM remains unknown.
Previous studies indicated that KASH domain proteins play an important role in nuclear positioning in certain cell types (Grady et al., 2005; Malone et al., 2003; Mosley-Bishop et al.,
1999; Starr and Han, 2002; Starr et al., 2001; Yu et al., 2006). However, the existence of links spanning the NE have far broader implications than mere nuclear location, and present us with a mode (or modes) of nucleocytoplasmic coupling that may bypass NPCs. This notion is highlighted by biomechanical studies on Lmna-null fibroblasts which exhibit impaired mechanotransduction and decreased viability under mechanical strain (Broers et al., 2004;
Lammerding et al., 2006; Lammerding et al., 2005; Lammerding et al., 2004b). Induction of the mechanosensitive genes, iex-1 and egr-1, is attenuated, as is NF-kB-regulated transcription in response to either cytokine or mechanical stimulation. While nuclei in Lmna-null cells are both mechanically fragile and highly deformable a surprising finding of Lammerding and colleagues is that these cells also feature reduced cytoplasmic resilience. Given that both Sun1 and 2 interact with A-type lamins, it is possible that the LINC complex might mediate mechanotransduction and the lamin-dependent changes in cytoplasmic organization.
Retention of Sun1 and 2 in the INM is independent of A-type lamins in some cell types
(Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005). This implies that there have to be other nuclear or NE components that interact with and retain the
SUN proteins. Logically, based upon our studies here, there have to be at least two discrete regions within Sun1 sufficient for INM localization. Evidence for this can be seen in the differential effect of exogenous Suns 1 and 2 on each other. Sun2 will not significantly displace
Sun1 in HeLa cells. However, Sun1 can efficiently displace Sun2 from the INM (Crisp et al.,
57
2006), presumably by competition for a common binding partner or anchor . Therefore Sun1
likely has an additional binding partner(s) not shared with Sun2. This is perhaps most obvious
when considering that both of these proteins are segregated within the plane of the NE. While
Sun2 predominates in NPC-free regions, Sun1 is concentrated in the vicinity of NPCs, possibly
forming a halo around each NPC. The mechanisms of interaction with NPCs remains unknown.
However, it clearly requires contributions from both the nucleoplasmic and lumenal domains.
Our analyses suggest that there are at least two separate INM-targeting regions within the
Sun1 nucleoplasmic domain. The first lies between residues 1-260 and includes the H1 hydrophobic sequence. The second is immediately downstream of the H1 sequence and includes the H2 and H3 hydrophobic sequences. The bulk of this second targeting region is absent in the
Sun1D221-343 (i.e. the Dexon 6-8) splice isoform, although the H2 and H3 sequences are retained. Since Sun1D221-343 still colocalizes with NPCs, the bulk of this second targeting region cannot have an essential role in NPC association. The same is also true of the entire H234 region, which can be substituted by the Sun3 transmembrane domain without affecting NPC association.
While the H2-H3 hydrophobic sequence exhibits INM targeting activity, it is only functional in the context of molecules containing the lumenal domain. The lumenal domain has no intrinsic targeting properties but does promote oligomerization, most likely based upon coiled-coil homodimers. We would suggest that manifestation of the INM localization function of H2-H3 requires dimerization/oligomerization, perhaps leading to increased avidity for an NE or nuclear binding partner.
The Sun1 TM domain is contained within the region of the molecule defined by the H2-4 hydrophobic sequences. We and others had suggested that these might represent three TM
58
domains (Crisp et al., 2006; Padmakumar et al., 2005). Our current studies suggest that H2 and
H3 do not in fact span the INM leaving H4 as the only TM sequence within the Sun1 molecule
(Figure 2-9A). This view is reinforced by the existence of an apparent human Sun1 splice isoform (NM_25154) lacking sequences encoded by exons 6-9, and which is missing H2. Our conclusion is that Sun1 has the topology of a type II membrane protein.
While Sun1 has only a single membrane-spanning domain (H4), the three other hydrophobic sequences H1, H2 and H3 can confer membrane association. Nucleoplasmic domain constructs that contain at least one of the three, all become associated with the INM, whereas their absence leads to nucleoplasmic localization. It remains unclear whether these hydrophobic sequences interact directly with the INM lipid bilayer, or if association is mediated by other INM proteins. The former would appear the more likely since regardless of expression level, H1-, H2- or H3-containing proteins always appear membrane associated. The interaction of extended hydrophobic sequences such as H2-H3 with the lipid bilayer is not without precedent. For instance the tubular ER protein, reticulon 4, contains a 30-40 residue hydrophobic sequence that forms a hairpin, which dips into the cytoplasmic face of the ER lipid bilayer without crossing it (Voeltz et al., 2006).
The segregation of Sun1 and 2 within the plane of the NE and the association of Sun1 with
NPCs is quite striking. Could then Sun1 be an NPC component? The complement of mammalian
NPC subunits identified by Matunis and colleagues employing proteomic approaches does not include Sun1 (Cronshaw et al., 2002). However, the same is also true of the authentic vertebrate
NPC membrane protein, Ndc1 (Stavru et al., 2006). Perhaps Sun1’s additional associations with the nuclear lamina, and possibly chromatin, limits its co-extraction with NPC proteins.
Regardless, we can find no evidence that Sun1 contributes to nucleocytoplasmic transport and
59
consequently we feel that Sun1 is unlikely to represent an intrinsic NPC component. Instead, a
more reasonable scenario is that Sun1 is associated with the NPC periphery and may define a novel microdomain within the nuclear membranes, which in turn could blur the boundary between NPCs and the bulk of the NE (Figure 2-9B). The presence of Sun1, and by implication nesprins, at NPCs could provide a basis for older ultrastructural observations that cytoskeletal elements, particularly IFs frequently seem to contact pore complexes (Goldman et al., 1985).
The distribution of NPCs across the NE is not random. Rather, they are arrayed in a uniform (although not regular) fashion that is constrained by a minimum NPC separation (Maul,
1977). We have observed that depletion of Sun1 (but not Sun2) or overexpression of truncated forms of Sun1 lead to the formation of NPC aggregates or clusters. This suggests that Sun1 has a role in the maintenance of uniform NPC distribution across the nuclear surface. In mammalian cells, NPCs are largely immobile and maintain their relative positions over many hours (Daigle et al., 2001; Rabut et al., 2004). The implication is that NPC clusters in Sun1-depleted cells may arise during de novo NPC assembly as well as during post mitotic reassembly.
A-type lamins are also determinants of NPC distribution, since Lmna-null MEFs frequently feature clustered or aggregated NPCs (Sullivan et al., 1999). Furthemore, (Maeshima et al., 2006) have shown that A-type lamins strongly influence the distribution of NPCs and pore-free regions of the NE. It is important to bear in mind, however, that cells which normally lack A-type lamins, early embryonic cells for instance, do not display obviously clustered NPCs.
It follows that there must be additional mechanisms to define NPC distribution that predominate in certain cell types. Such mechanisms might potentially involve B-type lamins (Maeshima et al.,
2006).
60
Because Sun1 interacts with lamin A via the N220 region of its N-terminal domain (Crisp et al., 2006), it could function as an adaptor between the nuclear lamina and the NPC (Figure 2-
9). Of more significance is our observation that Sun1 has a preference for farnesylated pre-lamin
A. Given that pre-lamin A exists only transiently in normal cells, this raises the possibility that
Sun1 might function in the targeting and assembly of newly synthesized lamin A at the nuclear face of the INM. If this is the case, then given the localization of Sun1, NPCs could actually function as nucleation sites of A-type lamina assembly. Ultimately this may help define the distribution of NPCs. Our next goal will be to test this notion by determining whether there is a spatial relationship between A-type lamina assembly and NPCs. Regardless of the outcome of
these studies, it is becoming increasingly clear that there are complex networks of interactions at
the nuclear periphery involving NPCs, INM and ONM proteins and nuclear lamins. These interactions appear to define not only the organization of the NE but also determine cytoskeletal mechanics and perhaps mediate signaling between the nucleus and cytoplasm.
Materials and Methods
Cell Culture and Transfections: HeLa cells and mouse embryonic fibroblasts (MEFs),
both Lmna +/+ and Lmna –/– (Sullivan et al., 1999), were maintained in 7.5% CO2 and at 37°C
in DME (GIBCO BRL) plus 10% FBS (Hyclone), 10% penicillin/streptomycin (GIBCO BRL),
and 2 mM glutamine. Plasmid DNA was introduced into HeLa cells and MEFs by using the
Polyfect reagent as described previously (Crisp et al., 2005) or with the Lipofectamine2000
reagent (Invitrogen). To transfect a 3.5cm2 tissue culture dish of cells with Lipofectamine2000,
6µl transfection reagent or 2µg plasmid DNA were each added to separate 100µl volumes of
Optimem (Invitrogen) then combined and incubated at RT for 20 min. Subsequently the cell medium was replaced with serum-free DMEM and then the 200µl transfection mix added
61
dropwise and incubated at 37ºC for 1 h after which time the medium was replaced with
DMEM/10% FCS. Cells were analyzed 1-2 days later.
Generation of Tetracycline Inducible Stable Cell Lines: A HeLa cell line stably expressing a tetracycline repressor protein from a pcDNA6/TR plasmid (TRex-HeLa, Invitrogen) was transiently transfected with pcDNA4/TO plasmid (Invitrogen) containing murine Sun1GFP or human Sun2GFP. Following transfection cells were selected with zeocin (200 µg/ml) and stably expressing subclones were isolated. Stable cells were analyzed 24h after addition of tetracycline (1µg/ml).
Antibodies: The following antibodies were used in this study: The monoclonal antibodies
9E10 and 12CA5 against the myc, HA and GFP epitope tags were obtained from the American
Type Culture Collection, Covance and AbCam, respectively. Rabbit antibodies against the same epitopes were obtained from AbCam. Rabbit antibodies against Sun1 and 2 were previously described (Hodzic et al., 2004). Mouse monoclonal anti-nup153 (clone SA1) and anti- nucleoporin (clone QE5) were described previously (Bodoor et al., 1999; Pante et al., 1994).
Rabbit anti-emerin was a generous gift from Glenn Morris. Mouse anti-beta-galactosidase was from Promega (z3788). Mouse anti-PDI (ab2792) and anti-tubulin (ab7750) were from AbCam.
Goat anti-lamin A/C was obtained from Santa Cruz (sc6215). Secondary antibodies conjugated with AlexaFluor dyes were obtained from Invitrogen. Peroxidase-conjugated secondary antibodies were obtained from Biosource International.
Immunofluorescence Microscopy: For immunofluorescence microscopy cells were grown on glass coverslips and fixed in 3% formaldehyde (prepared in PBS from paraformaldehyde powder) for 10 min followed by a 5-min permeabilization with 0.2% TX-100.
Cells labeled with anti-Sun1 were fixed for 6 min in 3% formaldehyde and permeabilized for 15
62
min in 0.4% TX-100 in PBS. The cells were then labeled with the appropriate antibodies plus the
DNA-specific Höchst dye 33258. For experiments involving selective permeabilization, the cells
were first fixed in 3% formaldehyde. This was followed by permeabilization in 0.001% digitonin
in PBS on ice for 15 min (Adam et al., 1990). The cells were then labeled with appropriate primary and secondary antibodies. Specimens were observed using a Leica DMRB fluorescence microscope. Images were collected using a CDC camera (CoolSNAP HQ; Roper Scientific) linked to a Macintosh G4 computer running IPLab Spectrum software (Scanalytics). Image quantification was performed using IPLab software.
FRAP analysis: Fluorescence recovery after photobleaching experiments (FRAP) were performed on a Zeiss LSM 510 confocal microscope with a 63 x/ 1.4 N.A. oil objective. GFP was excited with the 488nm line of Ar laser and GFP emission monitored using a 505 nm longpath filter. Cells were maintained at 37˚C using a Nevtek ASI Air Stream incubator. In transfected cells a rectangular region typically 2-4um in height was bleached in three iterations using 488nm laser line at 100 % laser power. Cells were monitored at 5 second intervals for up to 300s. Data was normalized as described (Dundr et al., 2002; Phair et al., 2004) to take into account bleaching during the imaging phase. Recovery values are averages ± S.D from at least 5 cells from at least 2 independent experiments.
Immuno-electron Microscopy: Immuno-electron microscopy of Sun1 was performed by pre-embedding and labeling of the tetracycline-inducible cell line expressing Sun1-GFP. After fluorescence examination to verify GFP expression, cells were trypsinized and pelleted by centrifugation. The pellet was permeabilized with 0.1% TX-100 for 1 min in PBS, fixed with 3% paraformaldehyde in PBS for 10 min, followed by three washes with PBS. The fixed cells were then incubated with 2% BSA in PBS for 10 min, followed by incubation with the primary
63
polyclonal anti-GFP antibody ab290 (Abcam Inc.) for 1 h. After three times washing with 0.1 %
BSA in PBS, the cells were incubated with a secondary anti-rabbit IgG antibody conjugated to
10 nm gold particles (Ted Pella Inc) for 1 h, followed by three times washing in PBS. Cells were then fixed and prepared for embedding/thin section electron microcopy (Rollenhagen et al.,
2003).
In Situ Proteinase K Digestions: HeLa cells were transfected in triplicate for each construct. After transfection (24h) the cells were incubated in Met/Cys-free media for 45 minutes, followed by incubation in medium containing 50µCi 35S Met/Cys (MP Biomedical) for
1 h. After two rinses with ice cold PBS, one well was incubated in 4µg/ml proteinase K (PK)
(Sigma) in KHM buffer (110mM KOAc, 20mM Hepes, pH 7.4, 2mM MgCl2) for 45 minutes.
Another well was permeabilized with 24µM ice cold digitonin in KHM for 15 min followed by
4µg/ml PK digestion in KHM for 45 minutes. The third well was incubated with 4µg/ml PK for
45 min in 0.5% TX-100/KHM. Subsequently, PMSF was added to all wells to a final concentration of 40µg/ml. The first two wells were gently washed in KHM buffer with 40µg/ml
PMSF again to remove excess PK. Cells were lysed in 0.4% SDS, 2% TX-100, 400mM NaCl,
50mM Tris-HCL pH 7.4, 40µg/ml PMSF, 1mM DTT plus 2µg/ml pepstatin A and 1µg/ml leupeptin and passed through a 23 gauge needle 5 times prior to centrifugation for 10 min at
16,000Xg. Soluble proteins were immunoprecipitated with rabbit anti- myc or GFP by protein-
A-sepharose. Following 3 washes, proteins were incubated with sample buffer prior to separation by SDS-PAGE. Gels were stained with Coomassie brilliant blue, incubated with Amplify
(Amersham Biosciences) for 20 min prior to drying. Autoradiographs were obtained from dried gels. In parallel, a non-transfected cell lysate was analyzed by Western blot to validate the permeabilization and digestion conditions.
64
In vitro Translations: In vitro translations and proteinase K digestions were performed as described previously (Crisp et al., 2006).
Nuclear Transport Assays: To observe nuclear export a NES-GFP-NLS (NES-
MGNELALKLAGLDI and NLS-PKKKRKV, respectively) construct was transfected into HeLa cells, either alone or with other expression vectors. CRM1-dependent nuclear export was
inhibited by a 2h incubation with 10ng/ml leptomycin B. To assay nuclear import, HeLa cells
were transfected with a glucocorticoid receptor-beta-galactosidase fusion protein (grb) 24 h prior
to a 30-min incubation with 10µg/ml dexamethasone, to induce nuclear import of the fusion
protein (Bastos et al., 1996).
Plasmids: Full length murine Sun1 and human Sun2 were cloned as previously described
(Hodzic et al., 2004; Crisp et al., 2006) and used as a template for PCR mutagenesis to generate
Sun1 constructs described in this manuscript. Sun1-GFP and Sun2-GFP were cloned into the
tetracycline responsive pcDNA4/TO (Invitrogen). All other GFP-tagged Sun1 constructs were
cloned into pEGFP-N1 (BD Biosciences). HA-Sun1, HA-Sun1(Sun3TM), HA-Sun1(1-221),
myc-Sun1(221-380), myc-Sun1(261-380), were all generated in pcDNA3.1(-). NES-GFP-NLS
was created by PCR mutagenesis and inserted into pEGFP-N1. Sun2-RNAi plasmids were
obtained from OpenBiosystems. Sun1 RNAi was accomplished by cloning the following
sequences into pSilencer 3.1-H1 neo (Ambion)
5’GATCCGACCGGGATGGTGGACTTTCTCAAGAGAAAAGTCCACCATCCCGGTCTTTT
TTGGAAA3’ and
5’AGCTTTTCCAAAAAAGACCGGGATGGTGGACTTTTCTCTTGAGAAAGTCCACCATC
CCGGTCG3’ derived from open reading frame of human Sun1 using the pSilencer expression
vectors insert design tool (Ambion).
65
We would like to thank Dr. David Wilson (Department of Mathematics, University of
Florida) for advice on quantification of NPC clustering, and Dr. Manfred Lohka for insightful discussions at the Southern Alberta Nuclear Envelope meeting. This work was supported by grants from the NIH (to BB) and the Muscular Dystrophy Association (to DH).
66
Figure 2-1. Mammalian SUN protein family. Sun1 features four hydrophobic sequences H1-H4, each of roughly 20 amino acid residues. Its membrane-spanning domain is contained within the H2-H4 region. The Sun1 N-terminus, including H1, is nucleoplasmic. The C-terminal SUN domain resides in the PNS. Murine, but not primate, Sun1 contains a predicted C2H2 zinc finger. Several splice isoforms of mouse Sun1 have been identified which feature loss of sequences encoded by exons 6-8, including H1. Corresponding accession numbers are BAB29445 (Sun1Δ6-8), AAT90501 (Sun1Δ6), BAC29339 (Sun1Δ8). Four other mammalian SUN proteins are known. Sun2 is ubiquitously expressed, and localizes to the INM. Sun3 (SUNC1), Sun4 (SPAG4) and Sun5 (SPAG4L, accession number NP_542406) appear to be expressed primarily in testis (B. Burke, C. Stewart, M. Crisp and K. Roux, unpublished observations) When expressed in HeLa cells, Sun3 localizes to the NE while Sun4 (Hasan et al., 2006) and Sun5 (M. Crisp and B. Burke unpublished observations) localize primarily to the ER.
67
Figure 2-2. Sun1 and Sun2 are segregated within the plane of the NE. Immunofluorescence microscopy of HeLa cells stably expressing mouse Sun1-GFP or human Sun2-GFP employing anti-nucleoporin and anti-SUN protein antibodies. (A) Images of the nuclear surface reveal Sun1-GFP colocalization with Nup153. In contrast, the more diffuse Sun2-GFP is found in NPC-free regions. Endogenous Sun2 displays no colocalization with either NPCs, labeled with the anti-nucleoporin antibody QE5, or with with Sun1-GFP. Bar = 5µm. (B) At late anaphase to early telophase reforming nuclei exhibit a distinct distribution of NPC and NE components. Sun1-GFP localizes with Nup153 at the lateral margins of the mass of newly segregated chromatids and is absent from the Sun2 positive ‘core’ region. Bar = 4µm. These data suggest that Sun1 is closely associated with NPCs, a pattern which is established early in NE formation.
68
Figure 2-3 Sun1, but not Sun2, is closely associated with NPCs as revealed by immuno-electron microscopy. (A) Views of NPC cross-sections from tetracycline-induced HeLa cells expressing Sun1-GFP and which reveal gold particles close to NPCs. Sections of uninduced cells (B) display little or no gold labeling. (C) Images of NE cross-sections from HeLa cells expressing Sun2-GFP reveal gold particles in the perinuclear space but with no preferential association with NPCs. Immuno-gold labeling was performed using a polyclonal anti-GFP antibody and a secondary anti-rabbit IgG antibody conjugated to 10nm gold particles. Bars = 100 nm. c, cytoplasm; n, nucleus; arrowheads indicate gold particles. (D, E) Quantitative analysis of the distribution of gold particles from nuclear envelope cross-sections of HeLa cells expressing (D) Sun1-GFP or (E) Sun2-GFP. The position of gold particles, which is defined by horizontal distance (from the NPC eight fold axis) and vertical distance (from the central plane of the NE) was measured in cross-sectioned NEs (as in A and C) and plotted in a single dot graphic. Micrographs are provided as a visual reference for the position of the gold particles. Histograms for the distribution of gold particles for horizontal and vertical distances are shown on adjacent panels. A total of 88 and 92 gold particles were scored for D and E respectively. Because of the far broader distribution of Sun2-GFP, the scale in E is five times that in D.
69
Figure 2-4. Sun1 contains a single transmembrane domain. (A) Three Sun1 mutants containing the N-terminal domain followed by H2 , H2-3 and H2-4 respectively were tagged with HA at the N-terminus and GFP followed by a Myc epitope at the C-terminus. HeLa cells transfected with these constructs were labeled with 35S-Met/Cys, permeabilized with digitonin and incubated with proteinase K. After SDS lysis, immunoprecipitation with anti-Myc and SDS-PAGE analysis, only Sun1N455 retained a protected fragment of the predicted size for the GFP (~30kDa). Permeabilization with TX-100 resulted in complete protein degradation. Non- transfected cells served as a negative control while Sun1-GFP provided a positive control, with a 65-70kDa protected fragment. Western blot analysis was used to confirm the effectiveness of the digitonin permeabilization. Tubulin and lamins A/C were degraded following either digitonin or TX-100 permeabilization. In contrast, the ER lumenal protein, PDI, remained intact following digitonin permeabilization but was degraded after TX-100 treatment. (B) To further establish the orientation of these Sun1 constructs, 24h after transfection the HeLa cells were fixed and permeabilized with either digitonin or TX-100. Analyses focused on cells expressing sufficiently high levels of recombinant protein such that GFP fluorescence could be observed in both the NE and ER/cytoplasmic membranes. With digitonin permeabilization both Myc and HA epitopes were readily detected for HA-Sun1N380-GFP-Myc and HA- Sun1N415-GFP-Myc. In contrast, the HA but not C-terminal Myc epitope tag was accessible for HA-Sun1N455-GFP-Myc. In all cases both myc and HA tags were accessible after TX-100 permeabilization. (C) Three more C-terminal GFP tagged Sun1 constructs containing the first 220 residues of Sun1 fused to H3 or H3-4 as well as full length Sun1 lacking H2-3 (Sun1N220H3-GFP, Sun1N220H34-GFP, and Sun1DH23-GFP, respectively) were permeabilized as described above and labeled with anti-GFP antibodies. With digitionin permeabilization the presence of the H4 domain rendered the GFP moiety inaccessible to antibody. Taken together these results indicate that H4 serves as Sun1’s sole TM domain. Bars = 4μm.
70
71
Figure 2-5. The Sun1 nucleoplasmic domain has overlapping NE localization motifs. Immunofluorescence microscopy of HeLa cells transiently expressing Sun1 deletion constructs. (A) Sun1N355, a region previously identified as conferring NE localization, was further mutated based upon a natural splice isoform of Sun1 (Sun1N355∆221-343-GFP). This protein, which lacks the H1 domain, is predominantly nucleoplasmic. Upon the inclusion of H2 (Sun1N380∆221-343-GFP), it becomes NE associated. Deletion of the N-terminal 220 residues from the NE localized Sun1N380 (Myc-Sun1 221-380) fails to eliminate NE localization. However, extension of the deletion to include H1 (Myc-Sun1-261-380) results in an ER localization with little concentration in the NE. Bar = 5µm. (B) To examine the role of H2-H4 in localization of Sun1, H234-GFP was expressed in HeLa cells where it concentrates in the Golgi apparatus. This region (H2-4) of Sun1 was replaced with the TM domain of Sun3 (HA-Sun1(S3TM)) resulting in localization indistinguishable from full length Sun1. However, upon deletion of the nucleoplasmic domain (S3TMSun1L-GFP) the protein was found largely in the Golgi apparatus. Similarly, deletion of the H2 and H3 domain from H234Sun1L (H4Sun1L-GFP) led to loss of NE association with a predominantly ER localization. NE localization of Golgi-associated S3TMSun1L-GFP could be partially rescued by the addition of the H2-H3 sequence (H23(S3TM)Sun1L-GFP) to the N-terminus. Bar = 5µm. These data identify two overlapping regions of the Sun1 nucleoplasmic domain sufficient for NE targeting, H1-H2 and H2-H3. However, the latter is only functional in the context of a transmembrane sequence and the Sun1 lumenal domain.
72
Figure 2-6. Sun1 forms homotypic oligomers in vivo. To define the oligomerization state of Sun1 HA-Sun1 was co-transfected into HeLa cells with Sun1-GFP, Sun1N455-GFP, H234Sun1L-GFP and S3TMSun1L-GFP (A). All samples were labeled with 35S- Met/Cys and immunoprecipitated with anti-GFP antibodies. Full length HA-Sun1 was most efficiently co-precipitated with Sun1-GFP, followed by the lumenal then nucleoplasmic domain containing fusion proteins. (B) In vivo evidence of Sun1 oligomerization mediated by the lumenal domain was provided by co-transfection of Sun1-GFP or HA-Sun1 with SS-HA-Sun1L-KDEL or S3TMSun1L-GFP, respectively. Alone, these proteins localize predominantly to the ER or Golgi apparatus, respectively. Co-expression of full length Sun1 recruited both proteins to the NE. Thus Sun1 forms homotypic oligomers that independently involve the lumenal and to a lesser extent the nucleoplasmic domains. Bar = 6mm.
73
Figure 2-7. Sun1 association with NPCs requires both the nucleoplasmic and lumenal domains. To define regions of Sun1 involved in NPC association, Sun1 mutants lacking either the lumenal (Sun1N455-GFP) or nucleoplasmic domains (H234Sun1L-GFP) were transiently expressed in HeLa cells (A). Neither Sun1 deletion mutant displayed obvious colocalization with Nup153. Bar = 1mm. (B) To further analyze the roles of various domains in Sun1 targeting and retention, FRAP analysis was performed on Sun1, Sun1N455, Sun1N380, Sun1N380D221-343, Sun1N380D221-355 and H234Sun1L, each bearing a GFP tag at the C-terminus. In contrast to full length Sun1-GFP, which is relatively immobile in the NE, fluorescence recovery occurred for all deletion proteins within a span of about 1min. Together these data indicate that it is the combination of the nucleoplasmic and lumenal domain that stabilizes Sun1 in the NE, potentially involving association with NPCs).
74
Figure 2-8. Perturbation of Sun1 affects NPC distribution. Immunofluorescence microscopy of HeLa cells 48h after SUN protein depletion by RNAi (A). Cells were double labeled with antibodies against Sun1 or Sun2 and Nup153. Loss of Sun1 was associated with altered nuclear morphology and changes in the distribution of NPCs. Magnification of the nuclear surface reveals large pore-free tracts in between clusters of NPCs. Nontransfected cells (Control) or Sun2 RNAi had no such effect. Expression of Sun1N455-GFP altered NPC distribution in a manner similar to Sun1 RNAi. Bar = 5mm. (B) To quantify the observed changes in NPC distribution, the relative standard deviation (stdev) of binned pixel intensity of anti-Nup153 fluorescence intensity across the projected nuclear surface, was calculated. All measurements were standardized relative to the nontransfected control, which was set at 0%. Sun1 RNAi and Sun1N455-GFP were most effective at inducing NPC clustering followed by H234Sun1L-GFP, myc-Sun1N220 and myc-Sun1 220-380. SS-HA-Sun1L-KDEL and Sun1-GFP had a minimal effect on NPC distribution. Lamin C served as a transfection control and induced no significant NPC clustering. N=7-18.(C) To quantify the altered nuclear morphology induced by Sun1 RNAi, ratio of projected nuclear area to perimeter was measured. RNAi of Sun1 led to a 35% reduction in this ratio over control cells, which were set to 100%. N=10-11.
75
Figure 2-9. Sun1 topology and interactions. Sun1 is envisaged as forming homodimers via interactions involving the membrane proximal coiled-coil within its C-terminal lumenal domain (A). Nucleoplasmic domain interactions may also contribute to homodimer formation. Sun1 functions as a tether for ONM nesprin proteins. Nesprins 1 and 2 provide links to the actin cytoskeleton while nesprin 3 binds plectin, a versatile cytolinker. Sun1 is associated with NPCs and in addition, its nucleoplasmic domain displays preferential binding to newly synthesized pre-lamin A (B). Sun1 may therefore provide a link between NPCs and the A-type lamins. In this way, Sun1- mediated nucleation of A-type lamina assembly may occur at NPCs.
76
CHAPTER 3 DYNAMICS OF LAMINA PROCESSING: IMPLICATIONS OF LOPINAVIR AND FTI-277 IN THE TREATMENT OF HIV AND PROGERIA
Abstract
The nuclear lamina is a condensed intermediate filament network lining the inner nuclear
membrane (INM). One of the major components of the nuclear lamina, laminA (LaA) undergoes
multistep posttranslational processing involving farnesylation, carboxymethylation and cleavage
by ZmpSte24. By using the HIV protease inhibitor Lopinavir (Lop), which is known to inhibit
ZmpSte24, we accumulated a considerable level of farnesylated prelaminA (PreA) on the nuclear
envelope (NE) with concomitant nuclear structural abnormalities. Release from the ZmpSte24
inhibition resulted in rapid LaA processing, with a more gradual reversion of normal nuclear morphology. On the other hand, farnesyl-transferase inhibitor FTI-277 in combination with geranylgeranyl-transferase inhibitor GGTI-2147 effectively blocked LaA maturation and
accumulated non-farnesylated preA on the NE in Saos-2 cells. The aberrant cellular phenotypes
caused by Lop can be corrected by a combinatorial treatment of FTI-277 and GGTI-2147;
however, washout of both the FTI and GGTI led to a phenotypic rebound. In Hutchinson-Gilford
progeria syndrome (HGPS) cells prenylation of LaA and LaAΔ50 was largely blocked by FTI-
277 alone. Both protein maturation and nuclear phenotype returned slowly after drug washout,
suggesting a role of cell proliferation in the rate of recovery. Overall, our observations suggest a highly dynamic nature of the nuclear lamina, with implications for the design of clinical therapy for HIV patients and the ongoing clinical trial for children with HGPS.
Introduction
The nuclear envelope (NE) is an extension of the endoplasmic reticulum (ER) that
surrounds the nuclear contents. A nuclear lamina made of intermediate filaments called lamins is
77
situated beneath the inner nuclear membrane (INM) in close association with the peripheral heterochromatin. Several diseases, with diverse phenotypes including progeria, lipodystrophy, muscular dystrophy and peripheral neuropathy, have all been associated with mutations of
LMNA, the gene encoding the A-type lamins (Burke and Stewart, 2002). Two common splice isoforms of LMNA encode the proteins lamin-A (LaA) and lamin-C (LaC) (Lin and Worman,
1993).
Unlike LaC, LaA undergoes multistep posttranslational processing involving 3-4 enzymes at the unique C-terminal CaaX box. First a farnesyltransferase adds a farnesyl moiety to the cysteine followed by cleavage of the last three amino acids (-aaXing) by either Rce1 or
ZmpSte24. Then the newly created C-terminus is carboxymethylated by isoprenylcysteine carboxymethyl transferase (ICMT) to generate farnesylated/carboxymethylated-PreA (f-PreA) that has a half-life of approximately 90 min prior to the final maturation step (Kitten and Nigg,
1991). ZmpSte24, a multipass membrane protein cleaves f-PreA 14 amino acids upstream of the
C-terminus, releasing the modified peptide to generate mature LaA (m-LaA) (Sinensky et al.,
1994). The processing of LaA appears to be sole function of ZmpSte24 (Corrigan et al., 2005).
Aberrant LaA processing has been implicated in at least two seemingly separate disorders, lipodystrophy and Hutchinson-Gilford progeria syndrome (HGPS).
A-type lamins have been implicated in both familial and acquired forms of lipodystrophy.
Mutations in LaA that predominantly alter charged residues on the surface of the Ig-fold region are associated with FPLD (Cao and Hegele, 2000b; Shackleton et al., 2000b). Characterized by peri-pubertal onset of subcutaneous fat loss from the extremities and trunk, FPLD patients also suffer metabolic disorders including hypercholesterolemia and type-II diabetes (Dunnigan et al.,
1974; Kobberling et al., 1975). Curiously, there have been reports of PreA accumulation in
78
fibroblast from FPLD patients despite the lack of an obvious mechanism (Capanni et al., 2005).
There have also been reports of PreA accumulation in cells from HIV-infected patients with acquired lipodystrophy from highly active antiretroviral therapy (HAART) (Caron et al., 2007).
In support of these claims, it has been shown that certain HIV protease inhibitors (PIs) used in
HAART can inhibit the activity of ZmpSte24, leading to f-PreA accumulation (Coffinier et al.,
2007). Furthermore, exogenous progerin has been reported to attenuate adipogenesis in human
mesynchymal stem cells (Scaffidi and Misteli, 2005). However, conclusive evidence for a direct
involvement of f-PreA accumulation in HAART-associated lipodystrophy has yet to be shown.
Incomplete LaA processing is most convincingly associated with the extremely rare
HGPS. Born seemingly healthy, HGPS patients exhibit a phenocopy of premature ageing around
1-2 years of age and die of cardiovascular-related illness by around 13 years of age (Capell and
Collins, 2006; DeBusk, 1972; Sarkar et al., 2001). Most HGPS mutations promote alternative
splicing of LaA that results in deletion of 50 aa near the C-terminus. This form of lamin, called
progerin, has lost the second cleavage site for ZmpSte24, causing abnormal retention of the
farnesylated and carboxymethylated C-terminus (De Sandre-Giovannoli et al., 2003; Eriksson et
al., 2003; Sevenants et al., 2005). The predominant hypothesis has been that the permanently
modified C-terminus is the toxic etiology of HGPS pathology (Fong et al., 2004; Navarro et al.,
2004). This concept is bolstered by the severe progeroid-like phenotype of restrictive dermopathy (RD) that results from mutations in ZmpSte24 leading to accumulation of f-PreA
(Navarro et al., 2005; Navarro et al., 2004). This hypothesis led to the therapeutic application of farnesyl-transferase-inhibitors (FTIs) to ameliorate the disease phenotype by inhibiting farnesylation of LaA, along with the approximately 100 genes predicted to encode CaaX-box proteins. In experiments with cells in vitro and mouse models, FTIs exhibited promising results,
79
with improved nuclear morphology, with weight gain and improved viability in mouse models
(Capell et al., 2005; Glynn and Glover, 2005; Mallampalli et al., 2005; Toth et al., 2005; Yang et
al., 2005). This led to the rapid establishment of a clinical trial for HGPS patients with the FTI,
lonafarnib. The outcome of this trial remains unreported.
The present situation led us to realize a deficit in the understanding of lamin processing
as it relates to the basic biology of the NE, as well as ongoing therapies for HIV-infected patients
and children with HGPS. In this study, we investigated the recovery rate for LaA processing
following accumulation of f-PreA by HIV-PI or nf-PreA by FTI-277 and lovastatin. We
discovered that accumulations of either form of f-PreA were rapidly processed within a few
hours suggesting a dynamic nuclear lamina with ample access to ZmpSte24 within the INM. In
contrast, nf-PreA accumulated by FTI treatment appeared resistant to processing in part due to
slow drug clearance and partially due to the requirement of cell division. These results may
change our view of the dynamic nature of the nuclear lamina, with implications for design of
therapies for HAART and the ongoing clinical trial for children with HGPS.
Results
To investigate the rate of LaA processing following release of proteolytic inhibitors, we first examined the efficacy of these inhibitors in accumulating f-PreA. Various HIV-PIs were tested for their ability to accumulate f-PreA by western blot (Figure 3-1A). Lopinavir (Lop) and
Nelfinavir are most effective, followed by Atazanavir. As compared to controls, there was no
evidence of considerable PreA accumulation with Indinavir or Tipranavir treatment. We
exclusively utilized Lop for the rest of our studies as it provided the best balance between
cellular toxicity and f-PreA accumulation.
In order to ascertain the relative processivity of PreA accumulated at the NE, Saos2 cells
were treated for 48 hours with Lop. As detected by anti-LaA/C immunoblots, 3 hours following
80
Lop washout approximately half of the accumulated PreA was processed to maturity and by 7 hours the levels approach that of the control (Figure 3-1B). Identical experiments were performed by anti-LaA/C immunoprecipitation from cells labeled overnight with 35S Cys/Met until 1 hour prior to lysis or Lop washout. These labeled lamins are predominantly NE- associated (Figure 3-1C). The rate of processing of the labeled LaA is similar to the total unlabeled LaA. As a final confirmation that our results to do not reflect turnover of accumulated
LaA in combination with de novo synthesis, protein synthesis was inhibited with cyclohexamide
1 hour prior to Lop washout. If anything, processing of LaA appears enhanced, presumable resulting from less newly synthesized PreA to compete for access to ZmpSte24 (data not shown).
Considering the half-time of LaA processing for newly made lamin A is 1.5-2 hrs, we consider this recovery remarkable for a stable filamentous network.
By indirect immunofluorescence, we observed the accumulation of PreA following Lop treatment and its disappearance following Lop washout (Figure 3-1C). After PI treatment, cells with accumulated PreA exhibited altered nuclear morphology characterized by irregular nuclear profiles with quantifiably decreased circularity (Figure 3-2A-C). In order to determine if accumulated LaA was responsible for the PI-induced irregular nuclear shape, we knocked out
LaA/C by RNAi. In cells with considerable loss of LaA/C we observed a more circular nuclear profile despite PI-treatment (Figure 3-2D, E), thus implicating f-PreA as the mediator of this aberrant nuclear morphology.
Another consequence of PI-treatment is the considerable accumulation of cytoplasmic
LaA/C observed adjacent to the spindles during metaphase and extranuclear in early G1, locations previously described for LaAΔ50 (Cao et al., 2007; Dechat et al., 2007). Interestingly, we observed a range of other NE proteins, including emerin, LaB1 (Figure 3-2G, J), sun-2 and
81
nesprin-3 (data not shown) were retained with the aberrant LaA/C aggregates well into metaphase and G1. Would these abnormal phenotypes recover as rapidly as the processing of
PreA? By 7hour after drug removal normal nuclear circularity had partially recovered and by
15hour completely returned to pre-treatment levels (Figure 3-2C). The abnormal PreA aggregates in metaphase and early G1 resolve in a similar time-course (Figure 3-2H, K).
These data suggest that time is needed for a structural reorganization of the nucleus and/or that the levels of f-PreA at the time of washout are in excess of those required to induce these cellular changes. To resolve this uncertainty, we first determined 5μΜ Lop was required to accumulate a similar level of PreA to that observed 7hour following Lop washout (Figure 3-3A).
We then compared the nuclear circularity and aberrant accumulations of LaA/C during metaphase and early G1 from cells treated with 5μM or 20μM Lop (Figure 3-3B). Clearly, 5μM
Lop was unable to induce a significant change in the nuclear circularity or LaA/C localization.
This left us with the possibility that cell division enhances recovery of a normal cellular phenotype following PI-washout. To test this hypothesis, cells were treated with mitomycin prior to PI-washout to prevent cell division. In these arrested cells, we observed no difference in the maturation rate of f-PreA (Figure 3-3C). However, we observed a significant delay in recovery of nuclear circularity 15hour after washout (Figure 3-3D), suggesting that postmitotic nuclear reassembly contributes to the recovery of circularity.
Having observed the rather rapid processivity of f-PreA accumulated at the NE, we next asked whether a lamina containing nf-PreA would be readily processed once farnesylated. To investigate the rate of LaA processing following release of farnesylation inhibitors, we first examined the efficacy of lovastatin (Lov) and FTI-277 in accumulating nf-PreA in cells. Both drugs were capable of accumulating PreA at the NE of Saos-2 cells treated for 48 hours (Figure
82
3-4A). Lovastatin is an HMG-CoA inhibitor that prevents, among other things, synthesis of
prenylation precursors. Following Lov washout the half-time of mature LaA recovery was ~7
hours as determined by pulse-chase analysis (Figure 3-4B). Similar studies with FTI-277, a
farnesyltranserase inhibitor, revealed a considerably slower recovery in LaA processing with a
recovery half-time of ~12 hours (Figure 3-4C). With either treatment, inhibition of new protein synthesis with cyclohexamide added at drug washout increased recovery of mature LaA.
Analysis of HDJ-2, another farnesylated protein, reveals that washout of Lov is rapid whereas the processing of LaA is delayed. However, in the case of FTI-277 washout, recovery of HDJ-2 farnesylation is slowed, but not as markedly so as the maturation of LaA. This suggests that that
FTI-277 is difficult to wash out and/or is irreversibly inhibiting farnesyltransferase. We repeated the same experiments with other peptidomic FTIs such as manumycinA, L-744, 832, and observed the same effect (data not shown).
Both of these inhibitors led to significant accumulation of the slower migrating nf-PreA, however lovastatin was considerably more effective than FTI-277. Recent evidence suggested that this may occur from considerable geranylgeranylation of LaA in the presence of FTI-277
(Varela et al., 2008). To explore this possibility, Saos-2 cells were treated with geranylgeranyl transferase inhibitor (GGTI)-2147 alone or in combination with FTI-277 (Figure 3-4D). Whereas the GGTI-alone was unable to inhibit maturation of LaA, and the FTI-alone was partially effective, only the combination of FTI and GGTI inhibited LaA maturation similar to Lov treatment. These results support the concept that farnesyltransferase inhibition can lead to considerable geranylgeranlyation and thus maturation of LaA.
As the recovery of mature LaA occurred largely within one cell cycle following washout of
FTI-277, we hypothesized that HGPS cells may suffer a phenotypic rebound following washout
83
of FTI. A lamina containing nonfarnesylated PreA and LaAΔ50 would be susceptible to rapid
farnesylation, potentially causing a phenotype more deleterious than evident prior to FTI
treatment. Skin fibroblasts from HGPS patients were treated with 10μM FTI-277 for 4 days,
during which time the farnesylation of LaA and LaAΔ50 was almost completely inhibited. We
confirmed that the slower migrating band, observed just below mature LaA, was non-
farnesylated LaAΔ50 with an exogenous epitope tagged LaAΔ50. Following washout of the
drug, both lamin A and LaAΔ50 exhibited a protracted return to a processed state that was not yet complete after three days. However, the recovery of HDJ-2 processing was much more rapid with a half-time less than 24 hours (Figure 3-5A). Phenotypically, the irregular circularity of the
HGPS nuclei that was ‘corrected’ by FTI treatment did return following by the third day following drug washout (Figure 3-5B, C). We attribute this prolonged recovery to the extremely slow proliferation we observed with these cells.
These results suggest that the recovery of toxic LaAΔ50 following FTI washout is relatively slow in slowly dividing cells; however, rapidly dividing cells may be much more susceptible. To investigate this possibility, we utilized Saos-2 cells treated for 48 hours with
20μM Lop to accumulate toxic PreA, which causes irregular nuclear profiles. The combinatorial treatment of Lop and FTI-277 was unable to completely inhibit the aberrant nuclear profiles, metaphase or cytoplasmic LaA aggregates; however this might be expected, as we know that
FTI-277 allows considerable LaA geranylgeranylation. To ensure a lack of prenylated LaA, we treated Saos-2 cells for 48 hours with Lop, FTI-277 and GGTI-2147. Indeed, this treatment largely inhibited the aberrant nuclear profiles caused by Lop treatment alone. Upon washout of both the FTI and GGTI while maintaining Lop treatment, the irregular nuclear profiles (Figure 3-
6A), metaphase and cytoplasmic aggregates (Figure 3-6B) increase dramatically, returning to
84
Lop-alone levels by 15 hours and rebounding past Lop-alone by 24 hours. In support of a
geranylgeranylated LaA population in these cells, washout of FTI, with maintenance of GGTI
and Lop treatment, exhibited a much more gradual return to the aberrant phenotype caused by
Lop-alone.
Discussion
In this study we have ascertained that a lamina containing considerable levels of
farnesylated PreA can be rapidly processed upon enzyme activation. The abnormal nuclear phenotype resulting from accumulated PreA is slower to resolve. However, reversion occurs
more rapidly in proliferative cells suggesting a need for structural reorganization of the lamina.
In the case of non-farnesylated PreA, FTI-277 washout is considerably slower than Lov and
requires the addition of a GGTI to prevent considerable geranylgeranylation of PreA. However, when slowly dividing HGPS fibroblasts were treated with FTI-277, prenylation of LaA and
LaAΔ50 was largely blocked. After washout of FTI-277 these cells required 3 days to reacquire their normally misshapened nuclear profiles and cytoplasmic lamin aggregates. When the rapidly diving Saos-2 cells were treated with Lop, FTI-27 and GGTI-2147 the prenylation inhibitors blocked the aberrant cellular phenotype from Lop treatment-alone. However, upon washout of the FTI and GGTI the cells rapidly rebounded to a more severely affected phenotype than occurs with Lop-alone. We attribute this to the accumulated nonprenylated PreA within the lamina rapidly shifting to a “toxic” prenylated population.
Our observations suggest that the nuclear lamina is readily accessible to processing enzymes such as the soluble farnesyltransferase and the integral membrane ZmpSte24, Rce1 and
ICMT. Thus, the lamina may in fact be quite dynamic. Previous studies utilizing FRAP analysis have described nuclear lamins as relatively immobile (Janicki and Spector, 2003). However, in
85
addition to relying on exogenous lamins with large N-terminal fusion proteins, this technique only accounts for rather large-scale movement of lamins within the nucleus. If lamins do form structures similar to other intermediate filaments, then it is hard to imagine how a lamina consisting of unprocessed PreA could be entirely accessible to the integral membrane processing enzymes such as ZmpSte24. If all of the C-terminal ‘tails’ that follow the Ig-like fold are assumed to be exposed on the surface of the filament then one could imagine it must be adjacent to the surface of the INM and capable of dynamic rolling to allow complete association with the processing enzymes. Or there could be focal assembly and disassembly of the lamin dimers that constitute the filaments. An alternative explanation would be the lack of a filamentous lamina, something not entirely impossible as the organization of the somatic nuclear lamina has never been observed or characterized.
The mechanism by which farnesylated PreA leads to HGPS or RD remains unknown, however there is considerable evidence that a shift in the ratio of farnesylated A-type lamins is pathological (Fong et al., 2004; Navarro et al., 2004). Previously, aberrant mitotic and post- mitotic aggregates of LaAΔ50 have been described with a suggested role in pathology (Cao et al., 2007; Dechat et al., 2007). We have observed identical results in ZmpSte24 null cells (our unpublished results). In this study, these findings have been expanded by identification of not only A-type in these aggregates, but also B-type lamins along with INM and ONM constituents such as sun-2, nesprin-2 and emerin. This suggests a possible mechanism by which aberrantly farnesylated lamins may be toxic, the displacement of NE constituents from the newly forming post-mitotic NE. This could perturb the organization of nuclear structures such as chromatin,
NPCs or how the nucleus organizes the cytoskeleton via the LINC-complexes.
86
A role for farnesylated PreA in the acquired lipodystrophy observed in many HIV patients
receiving HAART treatment has not been conclusively proven. However, there is considerable
circumstantial evidence that inhibition of ZmpSte24 by certain PIs may indeed contribute to this
lipodystophy (Caron et al., 2007; Caron et al., 2003). And although it is unclear when or how
PreA might induce lipodystrophy, its expression has been reported to inhibit adipogenesis in
human mesenchymal stem cells (Scaffidi and Misteli, 2005). The remarkably rapid recovery of
mature LaA following washout of Lop suggests that an alternative dosing strategy, allowing
short periods of PI withdrawal to permit LaA maturation, might reduce side effects.
We observed a slower recovery of LaA maturation following washout of FTI-277 or Lov
than for Lop. This may not be surprising as our readout of LaA maturation requires only
ZmpSte24 cleavage for Lop inhibition, whereas farnesylation, aaXing, carboxylmethylation and
ZmpSte24 cleavage all must occur following FTI-277 or Lov treatment. Furthermore, in the case
of ZmpSte24 there are no known substrates other than LaA, but there are ~30-100 other
substrates to compete for limited farnesylation, aaXing and carboxylmethylation enzymes.
Despite this obstacle, the rapidly dividing Saos-2 cells exhibit a marked negative rebound when
significant levels of nonfarnesylated PreA accumulated by treatment with FTI-277 and GGTI-
2147 were permitted to mature in the presence of Lop. Thus, we suggest that the reversibility of
lonafarnib, currently in a clinical trial for HGPS, be ascertained immediately. Furthermore, we
suggest that patients be informed of the potential risks associated with missing doses or rapid
termination of the treatment. Along these lines, gradually weaning patients from the drug at the
end of the trial should be considered. Otherwise these patients might suffer negative
consequences from a rapid accumulation of toxic prenylated PreA and LaAΔ50.
87
Materials and Methods
Reagents and Treatment: All HIV protease inhibitors were obtained from the National
Institutes of Health (NIH) AIDS Research and Reference Reagent Program
(www.aidsreagent.org/Index.cfm). Nelfinavir, Lopinavir, Atazanavir sulfate were prepared at a
stock solution at 20 mM in DMSO, Indinavir sulfate was prepared at 20 mM in water, and
Tipranavir (Aptivus) was prepared at 20 mM in ethyl acetate. The FTI-277 (Sigma, St. Louis,
MO) was prepared as a stock solution at 10 mM, Lov (Sigma, St. Louis, MO) was prepared at 10
mM and GGTI-2147 (Calbiochem, Gibbstown, NJ) was prepared at 20 mM. Unless otherwise
noted, Saos2 cells were treated with HIV PIs, Lov and GGTI-2147 at a dose of 20 μM, and with
FTI-277 at a dose of 10 μM for 48 hours. Control cells were incubated with the vehicle DMSO or ethyl acetate. HGPS fibroblasts were treated with FTI-277 at a dose of 10 μM for 4 days.
Cell Culture: Saos2 cells were maintained in 6% CO2 and at 37oC in DMEM (GIBCO
BRL) plus 10% FBS (Hyclone), and 10% penicillin/streptomycin (GIBCO BRL). Human HGPS fibroblasts were obtained from the Coriell Cell Repository (repository nos. AG01972, with the
G608G mutation) (http://locus.umdnj.edu/ccr) and maintained in 6% CO2 and at 37oC in DMEM
(GIBCO BRL) plus 15% FBS (Hyclone), 10% penicillin/streptomycin (GIBCO BRL) and 2x concentration of essential and non-essential amino acids. After removal of the reagents, cells were washed with PBS quickly for three times and original culture media three times, 10 minutes each.
Antibodies: The following antibodies were used in this study: the monoclonal antibody
against lamins A and C (XB10) has been described previously (Raharjo et al., 2001). The
monoclonal antibody SA1 against Nup153 was obtained from the American Type Culture
Collection, Covance. Rabbit anti-emerin was a gift from G. Morris (Robert Jones and Agnes
88
Hunt Orthopaedic Hospital, Oswestry, UK). Rabbit anti–lamins A and C (2032) was obtained
from Cell Signaling. Rabbit anti-laminB1 (ab16048) was purchased from Abcam. Goat anti–
lamin A and C (SC621), rabbit anti-lamin A (SC20680) and goat anti-laminA (SC6214) were
obtained from Santa Cruz Biotechnology, Inc. Mouse anti-HDJ 2 (MS-225) was obtained from
Thermo Scientific. Secondary antibodies conjugated with AlexaFluor dyes were obtained from
Invitrogen. Peroxidase-conjugated secondary antibodies were obtained from Biosource
International.
Immunofluorescence Microscopy: For immunofluorescence microscopy, cells were
grown on glass coverslips and fixed in 3% paraformaldehyde (prepared in PBS from PFA
powder) for 10 min followed by a 15-min permeabilization with 0.4% TX-100. Cells labeled
with anti-Lamin A (SC6214, Santa Cruz) were fixed and permeabilized for 4 min in methanol at
4oC. The cells were then labeled with the appropriate antibodies plus the DNA-specific Hoechst dye 33258. Specimens were observed using a fluorescence microscope (DMRB; Leica). Images were collected using a CCD camera (CoolSNAP HQ; Roper Scientific) linked to a computer
(G4; Macintosh) running IPLab Spectrum software (Scanalytics). Image quantification was performed using IPLab software.
Immunoblots and Gel Electrophoresis: Cells grown in 35-mm tissue culture dishes were washed once in PBS and lysed in SDS-PAGE sample buffer (0.2 M Tris pH 8.8, 5 mM EDTA pH 8.0 and 1 M sucrose). Protein samples were resuspended by sonication, fractionated on polyacrylamide gels (6 or 7%) and transferred onto nitrocellulose filters (usually BA85;
Schleicher and Schuell) using a semidry blotting apparatus manufactured by Hoeffer Scientific
Instruments Inc. Filters were blocked and labeled with primary antibodies and peroxidase-
89
conjugated secondary antibodies exactly as previously described (Burnette, 1981). Blots were
developed using ECL and exposed to X-OMAT film (Kodak) for appropriate periods of time.
Pulse-chase and Immunoprecipitation: Subconfluent 35-mm dishes of Saos2 cells, either untreated or treated with DMSO, Lopinavir, Lovastatin, or FTI-277 for 48 hours, were incubated in 90% DMEM (GIBCO BRL) plus 9% FBS (Hyclone), and 10% L-cystine and L-methionine free media (MP Biolabs) with 25 µCi 35S Translabel (MP Biolabs). After 18 hours, Saos2 cells were washed once with PBS and overlaid with non-radioactive DMEM (GIBCO BRL) plus 10%
FBS (Hyclone) and original treated reagents. After one hour, Saos2 cells were washed twice with
PBS and either incubated in DMEM with 10% FBS for an additional 1 to 24 hours or lysed
immediately. For cell lysis, cells were washed three times in PBS and incubated in 800 µl lysis
buffer (50 mM Tris-HCl, pH 9, 500 mM sodium chloride, 0.4% sodium dodecyl sulfate (SDS),
2% Triton X-100) with 1:1,000 CLAP (10 mg/ml in DMSO each of chymostatin, leupeptin,
antipain, and pepstatin) on ice for 5 minutes. The cells were then scraped off with a rubber
policeman and sheared eight times through a 26-gauge needle. After centrifugation for 10
minutes at 10,000 g, the supernatant was incubated overnight at 4°C with 5 µl Goat anti-
laminA/C (Santa Cruz) and protein G–Sepharose beads. At the end of this period, the beads were
collected by brief centrifugation and washed three times in lysis buffer and once in wash buffer
(50 mM Tris-HCl, pH 7.4, 50 mM sodium chloride). Finally, the beads were suspended in SDS-
PAGE sample buffer, heated to 95°C for 5 min, and analyzed by SDS-polyacrylamide gel
electrophoresis (PAGE). The gels were stained with Coomassie blue R-250, impregnated with
Amplify (GE Healthcare), dried, and exposed to X-OMAT film (Kodak).
90
Figure 3-1. HIV PIs block LaA maturation, which is reversed rapidly following PI removal. (A) Probed with PreA specific and LaA/C antibodies, immunoblot of extracts from Saos2 cells treated with vehicle (DMSO), Tip, Nel, Ata, Ind and Lop reveals different levels of f-PreA accumulation. (B) Immunoblot of extracts from Saos2 cells treated with Lop followed by washout indicates that half time of LaA maturation is approximately 3 hours. The processing rate of the overnight 35S Cys/Met labeled LaA following Lop washout is similar. (C) Immunofluorescence microscopy of Saos2 cells double labeled with the antibodies again PreA and Nup153. PreA is accumulated on the NE after Lop treatment and disappears following Lop washout. All images are taken at the same exposure time and in the merged images, DNA, revealed by staining with Hoechst dye, is shown in blue. Bar, 15μm
91
Figure 3-2. Aberrant cellular phenotypes are recovered by 15 hours following Lop washout. (A) Immunofluorescence microscopy of Saos2 cells. Altered interphase nuclear morphology and abnormal accumulation of LaA/C and emerin in the cytoplasm are exhibited after Lop treatment and recovered by 15 hours following Lop washout. (B) The aberrant cytoplasmic aggregates after Lop treatment contain LaB1, partially if not all colocalized with LaA/C. (C) Nuclear circularity following Lop washout is measured and quantified in ImageJ. (D) Double labeled with antibodies against LaA/C and LaB1, Saos2 cells exhibit normal nuclear morphology after Lop treatment following LaA/C RNAi. (E) Nuclear circularity in both mock and LaA/C RNAi treated cells is shown. (F) Nuclear components such as LaA/C, emerin and LaB1 are diffusive in metaphase. (G) Lop treatment leads to aberrant aggregation of LaA/C around metaphase chromosomes. Emerin and LaB1 are also retained in these aggregates. (H) Measurements of percentage of cells with metaphase aggregates indicate that mitotic abnormality recovers by 15 hours after Lop washout. (I) LaA/C, emerin and LaB1 localize on the NE in early G1. (J) Lop treatment leads to aberrant aggregation of LaA/C in the cytoplasm in early G1. These aggregates also contain emerin and LaB1. (K) Measurements of percentage of cells with early G1 aggregates indicate that recovery of cytoplasmic abnormality is approximately 15 hours after Lop washout. Bar, 5μm
92
93
Figure 3-3. Recovery of nuclear morphology following Lop washout requires mitosis. (A) Probed with LaA/C antibody, immunoblot of Saos2 cells treated with increased concentrations of Lop from 0 to 40 μM reveals increased PreA accumulation in parallel. (B) Measurements of interphase nuclear circularity, percentage of cells with metaphase and early G1 aggregates reveal that the effects of 5μM Lop differs significantly from 20μM Lop, with similar level to vehicle (DMSO) control. (C) Accumulated PreA in Lop treated cells complete its maturation by 7 hours following drug washout. Mitomycin treatment prior to Lop removal does not affect PreA processing rate. (D) Measurement of nuclear circularity indicates that mitomycin delays recovery of aberrant nuclear shape at 15 hours following Lop washout.
94
Figure 3-4. Lovastatin and FTI-277 lead to accumulation of nf-PreA on the NE, which undergoes gradual maturation following washout of Lov and FTI-277. (A) Immunofluorescence microscopy of Saos2 cells reveals significant accumulation of nf-PreA on the NE after a treatment of Lov or FTI-277. DNA, revealed by staining with Hoechst dye, is shown at bottom column. Bar, 5μm (B) Immunoblot of extracts from Saos2 cells treated with Lov followed by washout indicates that half time of PreA maturation is approximately 7 hours. Cyclohexamide chase upon release from Lov block exhibites a faster maturation. Accumulated non-farnesylated HDJ-2 gains complete farnesylation by 2 hours following Lov washout. Processing rate of overnight 35S Cys/Met labeled LaA following Lov removal is similar to unlabeled total population. (C) Similar experiments are conducted with FTI-277 instead of Lov. Half time of PreA maturation following FTI-277 washout is approximately 20 hours in total population, 7 hours with cyclohexamide chase and 12 hours in overnight 35S Cys/Met labeled population. HDJ-2 is farnesylated with a faster rate than LaA processing upon FTI-277 washout. (D) Immunoblot of extracts of Saos cells probed with LaA antibody. In contrast to the half block of FTI-277 treatment, a combinatorial treatment of FTI-277 and GGTI-2147 as well as Lov alone lead to complete accumulation of non-prenylated PreA.
95
Figure 3-5. Release from FTI-277 block leads to gradual maturation of nf-PreA and nf-LaAΔ50 and slow recovery of nuclear morphology in HGPS cells. (A) FTI-277 treatment for 96 hours completely block LaA and LaAΔ50 processing. Accumulated PreA and LaAΔ50 reach maturation over 72 hours following FTI-277 washout. SCJO cells transfected with HA tagged LaAΔ50 reveal size shift between f- LaAΔ50 in control cells and nf- LaAΔ50 in FTI-277 treated cells. HDJ-2 exhibits faster processing rate upon FTI-277 washout with a complete farnesylation at 48 hours. (B) Immunofluorescence microscopy of HGPS cells indicates that remedy of nuclear shape by FTI-277 is reversed by 72 hours following FTI-277 removal. Bar 10μm (C) Measurement of nuclear circularity in HGPS cells following FTI-277 washout is shown.
96
Figure 3-6. Correction of cellular phenotypes in Saos2 cells caused by Lop with a combinatorial treatment of both FTI-277 and GGTI-2147 is reversed quickly upon washout of FTI- 277 and GGTI-2147. (A) Labeled with LaA/C antibody, immunofluorescence microscopy of Saos2 cells reveals that combination of FTI-277 and GGTI-2147 instead of FTI alone rectify aberrant nulclear morphology and abnormal nucleoplasmic aggregation caused by Lop. Release of FTI and GGTI leads to a rapid phenotypic rebound. (B) Measurements of nuclear circularity and percentage of cells with metaphase and early G1 aggregates reveal that corresponding cellular phenotypes are reversed by 24 hours following FTI-277 washout and 15 hours following FTI-277 and GGTI-2147 washout.
97
CHAPTER 4 CONCLUSION
Overview of Findings
Physical connections between the nucleoskeleton and cytoskeleton were recently uncovered, which we have previously defined as LINC complex (Crisp et al., 2006). They form through interactions between the luminal domains of two families of transmembrane proteins of the NE: Sun proteins and Nesprins (Starr and Han, 2002; Starr et al., 2001). Multiple LINC complex isoforms likely exist given the presence of dozens of nesprin splice isoforms and the apparent redundancy of Sun1 and 2 in tethering nesprins. In addition, we can identify at least four or five splice isoforms of Sun1 alone, further increasing the LINC complex repertoire.
According to the selective retention model, INM proteins are concentrated at the NE through interactions with nuclear components such as lamins and chromatin. Though the association with A type lamins has been confirmed, localization of SUN proteins is not lamin dependent (Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005).
Interestingly, Sun1 can efficiently displace Sun2 from the INM, not vice versa. Therefore, Sun1 likely has an additional binding partner(s) that is not shared with Sun2. Furthermore, we have identified two separate INM-targeting regions within the Sun1 nucleoplasmic domain. In terms of the four known hydrophobic sequences within Sun1, only one of these functions as a membrane-spanning domain. In contrast to its nucleoplasmic domain, the lumenal domain of
Sun1 has no intrinsic targeting properties. However, it does promote oligomerization, most likely based upon coiled-coil homodimers.
Although functionally redundant, Sun1 and 2 are segregated within the plane of the NE.
Sun2 predominates in NPC-free regions. In contrast, Sun1 is concentrated in the vicinity of
NPCs, possibly forming a halo around each NPC. The complement of mammalian NPC subunits
98
identified by proteomic approaches does not include Sun1 (Cronshaw et al., 2002). Perhaps
Sun1's additional associations with the nuclear lamina and possibly chromatin limit its coextraction with NPC proteins. Regardless, we can find no evidence that Sun1 contributes to nucleocytoplasmic transport. However, depletion of Sun1 (but not Sun2) or overexpression of truncated forms of Sun1 lead to the formation of NPC aggregates or clusters. This suggests that
Sun1 has a role in the maintenance of the uniform NPC distribution across the nuclear surface.
The nucleoplasmic end of the LINC complex connects the nuclear lamina, which is a condensed intermediate filament network lining the INM. Previous studies utilizing FRAP analysis have demonstrated that the nuclear lamina is highly stable during interphase (Janicki and Spector, 2003). However, our observations through laminA processing suggest that the nuclear lamina may in fact be more dynamic than is currently appreciated.
By using the HIV protease inhibitor Lop, which is known to block LaA maturation through inhibition of ZmpSte24, we accumulated a considerable level of farnesylated PreA on the NE with concommittant nuclear structural abnormalities. Release from Lop block resulted in rapid
LaA processing, with a slightly slower reversion of normal nuclear morphology.
We also used a variety of drugs to block prenylation of newly synthesized LaA. Inhibition of LaA farnesyltion in Saos-2 cells using the farnesyl-transferase inhibitor FTI-277 was only slowly reversible upon washout. A significant percentage of LaA in FTI treated cells became geranylgeranylated. Thus complete inhibition of LaA prenylation required the additional inclusion of a GGTI. Inhibition of LaA prenylation could also be accomplished employing lovastatin, an inhibitor of isoprenoid biosynthesis. In contrast to FTI-227, lovastatin treatment was rapidly reversible. Combinatorial treatment of cells with FTI-277 and GGTI-2147 were able to correct the aberrant cellular phenotype caused by Lop. Removal of both drugs led to a rapid
99
rebound phenomenon. In HGPS cells, however, prenylation of LaA and LaAΔ50 was largely
blocked by FTI-277 alone. Both protein maturation and nuclear phenotype returned slowly after
drug washout, suggesting a role of cell proliferation in the rate of recovery.
Significance
The discovery of close association between Sun1 and NPCs is striking, however, we feel that Sun1 is unlikely to represent an intrinsic NPC component. Instead, a more reasonable
scenario is that Sun1 is associated with the NPC periphery and may define a novel microdomain
within the nuclear membranes, which, in turn, could blur the boundary between NPCs and the
bulk of the NE. On the other hand, our observations that the nuclear lamina is fully accessible to
processing enzymes suggests a more dynamic nature of lamina organization than had previously
been thought. This discovery has important implications in the clinical uses of lopinavir and FTIs
in the treatment of HIV and progeria.
Sun1 Can Be Involved in Nuclear Pore Membrane (NPM) Curvature, de Novo NPC Assembly and Defining Distinct Regions of Nuclear Periphery
Previous observation in our lab revealed that breakage of LINC complexes by co-depletion of Sun1 and Sun2 causes frequent expansion of the PNS (Crisp et al., 2006). Therefore, LINC complex does maintain the separation between inner and outer nuclear membranes. Considering the adjacent location of Sun1 to NPCs, Sun1 and associated nesprin family might play a role in stabilizing the curvature of the NPM as well. Additional evidence for this comes from Sun1 topology. According to the previous study, reticulon4A/NogoA maintains ER curvature through hydrophobic hairpins inserted into loosely packed lipids (Voeltz et al., 2006). Similarly, Sun1 contains three non-transmembrane hydrophobic domains. These bulky amphipathic helices could account for the formation and/or maintenance of highly curved NPM.
100
Mammalian cells amplify the number of NPCs in interphase to prepare for a new cell
division. A likely hypothesis is that a convergence and fusion of the outer and inner nuclear
membrane would form a hole into which the NPC would assemble. However, the factors that
could mediate the approximation of the two membranes are currently unknown. Similar to
vesicle or viral fusion, transmembrane proteins residing on either one or both membrane sides of
the NE could be involved. Sun1-nesprin pairs are the only known protein connections that cross
the PNS. Therefore they can be considered as prime candidates to fulfill this function. As we
mentioned previously, the lumenal domain of Sun1 has a complex organization. Conformational
changes resulting from related regulatory signals could trigger convergence of the INM and
ONM.
The nuclear periphery has been regarded as a site of transcriptional repression and silencing, with heterochromatin localizing adjacent to the INM (Cremer et al., 2003; Croft et al.,
1999). However, more evidence has emerged suggesting a role for NPCs in gene regulation. For instance, Casolari and colleagues showed that several actively transcribed genes involved in essential cell processes such as ribosomal biogenesis and glycolysis were associated with NPCs
(Casolari et al., 2004). In this case, we might wonder how the NE organizes those repressive and
active regions. In addition, NPCs are responsible for molecular trafficking between the nucleus
and cytoplasm, which requires relatively “loose” environment. Thus, it is necessary to keep
condensed heterochromatin from the openning of NPCs. Sun1, with its distinct localization,
might act as the boundary between NPCs and the bulk of the NE.
The Mechanisms of Nuclear Lamina Assembly Has Implications in the Clinical Use of both HIV Protease Inhibitors and Farnesyltransferase Inhibitors
Our observations that the nuclear lamina is readily accessible to processing enzymes
suggest a more dynamic nature of lamina organization. Though it is unclear how farnesylated
101
PreA induces lipodystrophy, there is considerable circumstantial evidence that the side effects associated with HIV patients receiving HAART treatment result from Zmpste24 inhibition.
Considering remarkably rapid preA processing following Lopinavir washout, switching to an alternative cocktail containing PIs that do not inhibit Zmpte24, or allowing short periods of PI withdrawal to permit PreA maturation is recommended.
In terms of FTI-277+GGTI-2147/FTI-277 removal, there is a significant discrepancy in the recovery rates of Saos2 versus HGPS cells. Considering the dramatic growth difference between these two cell lines, it is possible that release from FTI-277 block requires cell proliferation.
Other explanations can be that Saos2 and HGPS cells have different farnesyltransferase levels or different numbers of substrates for farnesyltransferase, which affects the reversibility of the enzymes. Other FTIs such as manumycin-A and L-744, 832 gave us similar results. As we all know, lonafarnib is in use in a current clinical trial for progeria. It’s suggested that the reversibility of lonafarnib should be ascertained. If the release is rapid, gradually weaning patients from the drug at the end of the trial should be considered. Otherwise these patients might suffer negative consequences from a quick accumulation of toxic prenylated PreA and LaAΔ50.
Future Work
Functional Investigation of Sun1
Ding and colleagues have shown that disruption of Sun1 in mice prevents telomere attachment to the NE, efficient homolog pairing, and synapsis formation in meiosis (Ding et al.,
2007). Thus, MEFs from those homozygous or heterozygous Sun1 knockout mice can be used as an efficient tool to analyze the possible functions of Sun1 mentioned above.
Our previous study revealed the expansion of the PNS following Sun1/2 double RNAi, which, however, did not occur upon Sun1 RNAi alone (Crisp et al., 2006). Given the functional redundancy between Sun1 and Sun2, Sun2 might compensate for Sun1 in this case. Another
102
explanation is that RNAi can only lead to partial knockdown of the protein. In terms of the role
of Sun1 in shaping the NPM, we can observe Sun1-/- MEFs by thin section electron microscopy
(EM) and measure the curvature of NPM. Overexpression of a truncated Sun1 protein excluding
the three non-transmembrane hydrophobic domains will in turn suggest if these domains are
involved in this function.
Dendra2 is an irreversible green-to-red photoswitchable fluorescent protein with a fast
maturation and brighter fluorescence than GFP/RFP. To address the role of Sun1 in interphase
NPC assembly, we can knockout Sun1 through RNAi in Hela cells stably expressing Dendra2-
POM121 or introduce Dendra-POM121 into Sun1-/- MEFs. Photoswitching the pre-existing
NPCs to red will permit us to track the de novo assembly of NPCs through live cell imaging
since they will exhibit green fluorescence.
To explore the function of Sun1 in the organization of heterochromatin, we can take
advantage of indirect immunofluorescence microscopy by using the antibody again HP1 or
watch the struction of heterochromatin directly under EM in Sun1-/- MEFs.
Withdrawl of Lop and FTI-277 on Animal Models
The fact that Lop washout leads to a quick reversion of LaA maturation and cellular phenotypes stimulates my interest in testing this effect in mice. According to Prot and his
colleagues, lopinavir-ritonavir-treated mice rapidly developed symptoms of lipodystrophy such
as hypertriglyceridemic and loss of white adipose tissue (Prot et al., 2006). We can remove those
mice from Lop treatment and investigate any deleterious effects.
On the other hand, we observed a significant discrepancy in the recovery rate of Saos2 versus HGPS cells upon washout of prenylation inhibitors. This may be due to the dramatic growth difference between these two cell lines. As we know, within a mammalian organism cell from different organs exhibit wildly different proliferation rates, making it necessary to test the
103
effect of FTI washout in a mouse model for HGPS. Previous studies have shown that FTI- treatment improves the survival of progeroid mice, benefiting body weight with reduction of spontaneous rib fractures (Yang et al., 2008). We can remove these mice from FTI-treatment to investigate any deleterious phenotypic rebound.
104
LIST OF REFERENCES
Aaronson, R., and G. Blobel. 1975. Isolation of nuclear pore complexes in association with a lamina. Proc. Natl. Acad. Sci. USA. 72:1007-1011.
Aebi, U., J. Cohn, L. Buhle, and L. Gerace. 1986. The nuclear lamina is a meshwork of intermediate-type filaments. Nature. 323:560-4.
Akey, C.W., and M. Radermacher. 1993. Architecture of the Xenopus nuclear pore complex revealed by three dimensional cryo-electron microscopy. J. Cell Biol. 122:1-20.
Amin, D., S.A. Cornell, S.K. Gustafson, S.J. Needle, J.W. Ullrich, G.E. Bilder, and M.H. Perrone. 1992. Bisphosphonates used for the treatment of bone disorders inhibit squalene synthase and cholesterol biosynthesis. J Lipid Res. 33:1657-63.
Antonin, W., C. Franz, U. Haselmann, C. Antony, and I.W. Mattaj. 2005. The integral membrane nucleoporin pom121 functionally links nuclear pore complex assembly and nuclear envelope formation. Mol Cell. 17:83-92.
Apel, E.D., R.M. Lewis, R.M. Grady, and J.R. Sanes. 2000. Syne-1, a dystrophin- and Klarsicht- related protein associated with synaptic nuclei at the neuromuscular junction. J Biol Chem. 275:31986-95.
Baker, S.K. 2005. Molecular clues into the pathogenesis of statin-mediated muscle toxicity. Muscle Nerve. 31:572-80.
Basso, A.D., P. Kirschmeier, and W.R. Bishop. 2006. Lipid posttranslational modifications. Farnesyl transferase inhibitors. J Lipid Res. 47:15-31.
Bastos, R., A. Lin, M. Enarson, and B. Burke. 1996. Targeting and function in mRNA export of nuclear pore complex protein Nup153. J. Cell Biol. 134:1141-1156.
Bengtsson, L., and K.L. Wilson. 2006. Barrier-to-autointegration factor phosphorylation on Ser- 4 regulates emerin binding to lamin A in vitro and emerin localization in vivo. Mol Biol Cell. 17:1154-63.
Bergo, M.O., P. Ambroziak, C. Gregory, A. George, J.C. Otto, E. Kim, H. Nagase, P.J. Casey, A. Balmain, and S.G. Young. 2002. Absence of the CAAX endoprotease Rce1: effects on cell growth and transformation. Mol Cell Biol. 22:171-81.
Bione, S., E. Maestrini, S. Rivella, M. Mancini, S. Regis, G. Romeo, and D. Toniolo. 1994. Identification of a novel X-linked gene responsible for Emery-Dreifuss muscular dystrophy. Nat Genet. 8:323-7.
Bodoor, K., S. Shaikh, D. Salina, W.H. Raharjo, R. Bastos, M. Lohka, and B. Burke. 1999. Sequential recruitment of NPC proteins to the nuclear periphery at the end of mitosis. J Cell Sci. 112:2253-64.
105
Bonne, G., M.R. Di Barletta, S. Varnous, H.M. Becane, E.H. Hammouda, L. Merlini, F. Muntoni, C.R. Greenberg, F. Gary, J.A. Urtizberea, D. Duboc, M. Fardeau, D. Toniolo, and K. Schwartz. 1999. Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nat Genet. 21:285-8.
Brachner, A., S. Reipert, R. Foisner, and J. Gotzmann. 2005. LEM2 is a novel MAN1-related inner nuclear membrane protein associated with A-type lamins. J Cell Sci. 118:5797-810.
Broers, J.L., B.M. Machiels, H.J. Kuijpers, F. Smedts, R. van den Kieboom, Y. Raymond, and F.C. Ramaekers. 1997. A- and B-type lamins are differentially expressed in normal human tissues. Histochem Cell Biol. 107:505-17.
Broers, J.L., E.A. Peeters, H.J. Kuijpers, J. Endert, C.V. Bouten, C.W. Oomens, F.P. Baaijens, and F.C. Ramaekers. 2004. Decreased mechanical stiffness in LMNA-/- cells is caused by defective nucleo-cytoskeletal integrity: implications for the development of laminopathies. Hum Mol Genet. 13:2567-80.
Burke, B. 2001. Lamins and apoptosis: a two-way street? J Cell Biol. 153:F5-7.
Burke, B. 2006. Cell biology. Nuclear pore complex models gel. Science. 314:766-7.
Burke, B., L.C. Mounkes, and C.L. Stewart. 2001. The nuclear envelope in muscular dystrophy and cardiovascular diseases. Traffic. 2:675-83.
Burke, B., and C.L. Stewart. 2002. Life at the edge: the nuclear envelope and human disease. Nat Rev Mol Cell Biol. 3:575-85.
Cai, M., Y. Huang, R. Ghirlando, K.L. Wilson, R. Craigie, and G.M. Clore. 2001. Solution structure of the constant region of nuclear envelope protein LAP2 reveals two LEM- domain structures: one binds BAF and the other binds DNA. Embo J. 20:4399-407.
Callan, H.G., and S.G. Tomlin. 1950. Experimental studies on amphibian oocyte nuclei. I. Investigation of the structure of the nuclear membrane by means of the electron microscope. Proc R Soc Lond B Biol Sci. 137:367-78.
Cao, H., and R. Hegele. 2000. Nuclear lamin A/C R482Q mutation in canadian kindreds with Dunnigan-type familial partial lipodystrophy. Hum Mol Genet. 9 109-12.
Cao, H., and R.A. Hegele. 2003. LMNA is mutated in Hutchinson-Gilford progeria (MIM 176670) but not in Wiedemann-Rautenstrauch progeroid syndrome (MIM 264090). J Hum Genet. 48:271-4.
Cao, K., B.C. Capell, M.R. Erdos, K. Djabali, and F.S. Collins. 2007. A lamin A protein isoform overexpressed in Hutchinson-Gilford progeria syndrome interferes with mitosis in progeria and normal cells. Proc Natl Acad Sci U S A. 104:4949-54.
106
Capanni, C., E. Mattioli, M. Columbaro, E. Lucarelli, V.K. Parnaik, G. Novelli, M. Wehnert, V. Cenni, N.M. Maraldi, S. Squarzoni, and G. Lattanzi. 2005. Altered pre-lamin A processing is a common mechanism leading to lipodystrophy. Hum Mol Genet. 14:1489-502.
Capell, B.C., and F.S. Collins. 2006. Human laminopathies: nuclei gone genetically awry. Nat Rev Genet. 7:940-52.
Capell, B.C., M.R. Erdos, J.P. Madigan, J.J. Fiordalisi, R. Varga, K.N. Conneely, L.B. Gordon, C.J. Der, A.D. Cox, and F.S. Collins. 2005. Inhibiting farnesylation of progerin prevents the characteristic nuclear blebbing of Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A. 102:12879-84.
Caron, M., M. Auclair, B. Donadille, V. Bereziat, B. Guerci, M. Laville, H. Narbonne, C. Bodemer, O. Lascols, J. Capeau, and C. Vigouroux. 2007. Human lipodystrophies linked to mutations in A-type lamins and to HIV protease inhibitor therapy are both associated with prelamin A accumulation, oxidative stress and premature cellular senescence. Cell Death Differ. 14:1759-67.
Caron, M., M. Auclair, H. Sterlingot, M. Kornprobst, and J. Capeau. 2003. Some HIV protease inhibitors alter lamin A/C maturation and stability, SREBP-1 nuclear localization and adipocyte differentiation. Aids. 17:2437-44.
Casolari, J.M., C.R. Brown, S. Komili, J. West, H. Hieronymus, and P.A. Silver. 2004. Genome- wide localization of the nuclear transport machinery couples transcriptional status and nuclear organization. Cell. 117:427-39.
Chen, L., L. Lee, B.A. Kudlow, H.G. Dos Santos, O. Sletvold, Y. Shafeghati, E.G. Botha, A. Garg, N.B. Hanson, G.M. Martin, I.S. Mian, B.K. Kennedy, and J. Oshima. 2003. LMNA mutations in atypical Werner's syndrome. Lancet. 362:440-5.
Chi, Y.H., K. Haller, J.M. Peloponese, Jr., and K.T. Jeang. 2007. Histone acetyltransferase hALP and nuclear membrane protein hsSUN1 function in de-condensation of mitotic chromosomes. J Biol Chem. 282:27447-58.
Clarke, S.G. 2007. HIV protease inhibitors and nuclear lamin processing: getting the right bells and whistles. Proc Natl Acad Sci U S A. 104:13857-8.
Clements, L., S. Manilal, D.R. Love, and G.E. Morris. 2000. Direct interaction between emerin and lamin A. Biochem Biophys Res Commun. 267:709-14.
Coffinier, C., S.E. Hudon, E.A. Farber, S.Y. Chang, C.A. Hrycyna, S.G. Young, and L.G. Fong. 2007. HIV protease inhibitors block the zinc metalloproteinase ZMPSTE24 and lead to an accumulation of prelamin A in cells. Proc Natl Acad Sci U S A. 104:13432-7.
Corrigan, D.P., D. Kuszczak, A.E. Rusinol, D.P. Thewke, C.A. Hrycyna, S. Michaelis, and M.S. Sinensky. 2005. Prelamin A endoproteolytic processing in vitro by recombinant Zmpste24. Biochem J. 387:129-38.
107
Cremer, M., K. Kupper, B. Wagler, L. Wizelman, J. von Hase, Y. Weiland, L. Kreja, J. Diebold, M.R. Speicher, and T. Cremer. 2003. Inheritance of gene density-related higher order chromatin arrangements in normal and tumor cell nuclei. J Cell Biol. 162:809-20.
Crisp, M., Q. Liu, K. Roux, J.B. Rattner, C. Shanahan, B. Burke, P.D. Stahl, and D. Hodzic. 2006. Coupling of the nucleus and cytoplasm: role of the LINC complex. J Cell Biol. 172:41-53.
Croft, J.A., J.M. Bridger, S. Boyle, P. Perry, P. Teague, and W.A. Bickmore. 1999. Differences in the localization and morphology of chromosomes in the human nucleus. J Cell Biol. 145:1119-31.
Cronshaw, J.M., A.N. Krutchinsky, W. Zhang, B.T. Chait, and M.J. Matunis. 2002. Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol. 158:915-27.
Daigle, N., J. Beaudouin, L. Hartnell, G. Imreh, E. Hallberg, J. Lippincott-Schwartz, and J. Ellenberg. 2001. Nuclear pore complexes form immobile networks and have a very low turnover in live mammalian cells. J Cell Biol. 154:71-84.
De Sandre-Giovannoli, A., R. Bernard, P. Cau, C. Navarro, J. Amiel, I. Boccaccio, S. Lyonnet, C.L. Stewart, A. Munnich, M. Le Merrer, and N. Levy. 2003. Lamin a truncation in Hutchinson-Gilford progeria. Science. 300:2055.
De Sandre-Giovannoli, A., M. Chaouch, S. Kozlov, J.M. Vallat, M. Tazir, N. Kassouri, P. Szepetowski, T. Hammadouche, A. Vandenberghe, C.L. Stewart, D. Grid, and N. Levy. 2002. Homozygous defects in LMNA, encoding lamin A/C nuclear-envelope proteins, cause autosomal recessive axonal neuropathy in human (Charcot-Marie-Tooth disorder type 2) and mouse. Am J Hum Genet. 70:726-36.
DeBusk, F.L. 1972. The Hutchinson-Gilford progeria syndrome. Report of 4 cases and review of the literature. J Pediatr. 80:697-724.
Dechat, T., T. Shimi, S.A. Adam, A.E. Rusinol, D.A. Andres, H.P. Spielmann, M.S. Sinensky, and R.D. Goldman. 2007. Alterations in mitosis and cell cycle progression caused by a mutant lamin A known to accelerate human aging. Proc Natl Acad Sci U S A. 104:4955- 60.
Delbarre, E., M. Tramier, M. Coppey-Moisan, C. Gaillard, J.C. Courvalin, and B. Buendia. 2006. The truncated prelamin A in Hutchinson-Gilford progeria syndrome alters segregation of A-type and B-type lamin homopolymers. Hum Mol Genet. 15:1113-22.
Dessev, G.N., C. Iovcheva-Dessev, and R.D. Goldman. 1990. Lamin dimers. Presence in the nuclear lamina of surf clam oocytes and release during nuclear envelope breakdown. J Biol Chem. 265:12636-41.
Dhe-Paganon, S., E.D. Werner, Y.I. Chi, and S.E. Shoelson. 2002. Structure of the globular tail of nuclear lamin. J Biol Chem. 277:17381-4.
108
Ding, X., R. Xu, J. Yu, T. Xu, Y. Zhuang, and M. Han. 2007. SUN1 is required for telomere attachment to nuclear envelope and gametogenesis in mice. Dev Cell. 12:863-72.
Djinovic-Carugo, K., M. Gautel, J. Ylanne, and P. Young. 2002. The spectrin repeat: a structural platform for cytoskeletal protein assemblies. FEBS Lett. 513:119-23.
Dorner, D., S. Vlcek, N. Foeger, A. Gajewski, C. Makolm, J. Gotzmann, C.J. Hutchison, and R. Foisner. 2006. Lamina-associated polypeptide 2alpha regulates cell cycle progression and differentiation via the retinoblastoma-E2F pathway. J Cell Biol. 173:83-93.
Dundr, M., U. Hoffmann-Rohrer, Q. Hu, I. Grummt, L.I. Rothblum, R.D. Phair, and T. Misteli. 2002. A kinetic framework for a mammalian RNA polymerase in vivo. Science. 298:1623- 6.
Dunnigan, M.G., M.A. Cochrane, A. Kelly, and J.W. Scott. 1974. Familial lipoatrophic diabetes with dominant transmission. A new syndrome. Q J Med. 43:33-48.
Dworetzky, S.I., R.E. Lanford, and C.M. Feldherr. 1988. The effects of variations in the number and sequence of of targeting signals on nuclear uptake. J. Cell Biol. 107:1279-1287.
Dwyer, N., and G. Blobel. 1976. A modified procedure for the isolation of a pore complex lamina fraction from rat liver nuclei. J. Cell Biol. 70:581-591.
Ellenberg, J., and J. Lippincott-Schwartz. 1999. Dynamics and mobility of nuclear envelope proteins in interphase and mitotic cells revealed by green fluorescent protein chimeras. Methods. 19:362-72.
Ellenberg, J., E.D. Siggia, J.E. Moreira, C.L. Smith, J.F. Presley, H.J. Worman, and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and reassembly in living cells: targeting of an inner Nuclear membrane protein in interphase and mitosis. J. Cell Biol. 138:1193-1206.
Emery, A.E. 1987. X-linked muscular dystrophy with early contractures and cardiomyopathy (Emery-Dreifuss type). Clin Genet. 32:360-7.
Eriksson, M., W.T. Brown, L.B. Gordon, M.W. Glynn, J. Singer, L. Scott, M.R. Erdos, C.M. Robbins, T.Y. Moses, P. Berglund, A. Dutra, E. Pak, S. Durkin, A.B. Csoka, M. Boehnke, T.W. Glover, and F.S. Collins. 2003. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature. 423:293-8.
Fatkin, D., C. MacRae, T. Sasaki, M.R. Wolff, M. Porcu, M. Frenneaux, J. Atherton, H.J. Vidaillet, Jr., S. Spudich, U. De Girolami, J.G. Seidman, C. Seidman, F. Muntoni, G. Muehle, W. Johnson, and B. McDonough. 1999. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N Engl J Med. 341:1715-24.
Feldherr, C., E. Kallenbach, and N. Schultz. 1984. Movement of a karyophilic protein through the nuclear pores of oocytes. J. Cell Biol. 99:2216-2222.
109
Fischer, J.A., S. Acosta, A. Kenny, C. Cater, C. Robinson, and J. Hook. 2004. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168:1385-93.
Fischer-Vize, J.A., and K.L. Mosley. 1994. Marbles mutants: uncoupling cell determination and nuclear migration in the developing Drosophila eye. Development. 120:2609-18.
Fisher, D.Z., N. Chaudhary, and G. Blobel. 1986. cDNA sequencing of nuclear lamins A and C reveals primary and secondary structural homology to intermediate filament proteins. Proc. Natl. Acad. Sci. USA. 83:6450-6454.
Flemington, E.K., S.H. Speck, and W.G. Kaelin, Jr. 1993. E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product. Proc Natl Acad Sci U S A. 90:6914-8.
Fong, L.G., J.K. Ng, J. Lammerding, T.A. Vickers, M. Meta, N. Cote, B. Gavino, X. Qiao, S.Y. Chang, S.R. Young, S.H. Yang, C.L. Stewart, R.T. Lee, C.F. Bennett, M.O. Bergo, and S.G. Young. 2006. Prelamin A and lamin A appear to be dispensable in the nuclear lamina. J Clin Invest. 116:743-52.
Fong, L.G., J.K. Ng, M. Meta, N. Cote, S.H. Yang, C.L. Stewart, T. Sullivan, A. Burghardt, S. Majumdar, K. Reue, M.O. Bergo, and S.G. Young. 2004. Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice. Proc Natl Acad Sci U S A. 101:18111-6.
Fridkin, A., E. Mills, A. Margalit, E. Neufeld, K.K. Lee, N. Feinstein, M. Cohen, K.L. Wilson, and Y. Gruenbaum. 2004. Matefin, a Caenorhabditis elegans germ line-specific SUN- domain nuclear membrane protein, is essential for early embryonic and germ cell development. Proc Natl Acad Sci U S A. 101:6987-92.
Fried, H., and U. Kutay. 2003. Nucleocytoplasmic transport: taking an inventory. Cell Mol Life Sci. 60:1659-88.
Fukuchi, K., T. Katsuya, K. Sugimoto, M. Kuremura, H.D. Kim, L. Li, and T. Ogihara. 2004. LMNA mutation in a 45 year old Japanese subject with Hutchinson-Gilford progeria syndrome. J Med Genet. 41:e67.
Galderisi, U., M. Cipollaro, and A. Giordano. 2006. The retinoblastoma gene is involved in multiple aspects of stem cell biology. Oncogene. 25:5250-6.
Gerace, L., and G. Blobel. 1980. The nuclear envelope lamina is reversibly depolymerized during mitosis. Cell. 19:277-87.
Gerace, L., A. Blum, and G. Blobel. 1978. Immunocytochemical localization of the major polypeptides of the nuclear complex-lamina fraction: interphase and mitotic distribution. J. Cell Biol. 79:546-566.
110
Gerace, L., and B. Burke. 1988. Functional organization of the nuclear envelope. Annu Rev Cell Biol. 4:335-74.
Gerace, L., C. Comeau, and M. Benson. 1984. Organization and modulation of nuclear lamina structure. J. Cell Sci. Suppl. 1:137-160.
Glass, C.A., J.R. Glass, H. Taniura, K.W. Hasel, J.M. Blevitt, and L. Gerace. 1993. The alpha- helical rod domain of human lamins A and C contains a chromatin binding site. Embo J. 12:4413-24.
Glynn, M.W., and T.W. Glover. 2005. Incomplete processing of mutant lamin A in Hutchinson- Gilford progeria leads to nuclear abnormalities, which are reversed by farnesyltransferase inhibition. Hum Mol Genet. 14:2959-69.
Goldman, A.E., R.D. Moir, M. Montag-Lowy, M. Stewart, and R.D. Goldman. 1992. Pathway of incorporation of microinjected lamin A into the nuclear envelope. J Cell Biol. 119:725-35.
Goldman, R., A. Goldman, K. Green, J. Jones, N. Lieska, and H.Y. Yang. 1985. Intermediate filaments: possible functions as cytoskeletal connecting links between the nucleus and the cell surface. Ann N Y Acad Sci. 455:1-17.
Goldman, R.D., Y. Gruenbaum, R.D. Moir, D.K. Shumaker, and T.P. Spann. 2002. Nuclear lamins: building blocks of nuclear architecture. Genes Dev. 16:533-47.
Goldman, R.D., D.K. Shumaker, M.R. Erdos, M. Eriksson, A.E. Goldman, L.B. Gordon, Y. Gruenbaum, S. Khuon, M. Mendez, R. Varga, and F.S. Collins. 2004. Accumulation of mutant lamin A causes progressive changes in nuclear architecture in Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A. 101:8963-8.
Grady, R.M., D.A. Starr, G.L. Ackerman, J.R. Sanes, and M. Han. 2005. Syne proteins anchor muscle nuclei at the neuromuscular junction. Proc Natl Acad Sci U S A. 102:4359-64.
Gruenbaum, Y., A. Margalit, R.D. Goldman, D.K. Shumaker, and K.L. Wilson. 2005. The nuclear lamina comes of age. Nat Rev Mol Cell Biol. 6:21-31.
Gruenbaum, Y., K.L. Wilson, A. Harel, M. Goldberg, and M. Cohen. 2000. Review: nuclear lamins--structural proteins with fundamental functions. J Struct Biol. 129:313-23.
Grum, V.L., D. Li, R.I. MacDonald, and A. Mondragon. 1999. Structures of two repeats of spectrin suggest models of flexibility. Cell. 98:523-35.
Hagan, I., and M. Yanagida. 1995. The product of the spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J Cell Biol. 129:1033- 47.
Hancock, J.F., A.I. Magee, J.E. Childs, and C.J. Marshall. 1989. All ras proteins are polyisoprenylated but only some are palmitoylated. Cell. 57:1167-1177.
111
Handwerger, K.E., and J.G. Gall. 2006. Subnuclear organelles: new insights into form and function. Trends Cell Biol. 16:19-26.
Haque, F., D.J. Lloyd, D.T. Smallwood, C.L. Dent, C.M. Shanahan, A.M. Fry, R.C. Trembath, and S. Shackleton. 2006. SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to provide a physical connection between the nuclear lamina and the cytoskeleton. Mol Cell Biol. 26:3738-51.
Harborth, J., S.M. Elbashir, K. Bechert, T. Tuschl, and K. Weber. 2001. Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Sci. 114:4557-65.
Hartmann, J.F. 1953. An electron optical study of sections of central nervous system. J Comp Neurol. 99:201-49.
Hasan, S., S. Guttinger, P. Muhlhausser, F. Anderegg, S. Burgler, and U. Kutay. 2006. Nuclear envelope localization of human UNC84A does not require nuclear lamins. FEBS Lett. 580:1263-8.
Heitlinger, E., M. Peter, M. Häner, A. Lustig, U. Aebi, and E.A. Nigg. 1991. Expression of chicken lamin B2 in Eschericia coli: characterization of its structure, assembly and molecular interactions. J. Cell Biol. 113:485-495.
Heitlinger, E., M. Peter, A. Lustig, W. Villiger, E.A. Nigg, and U. Aebi. 1992. The role of the head and tail domain in lamin structure and assembly: analysis of bacterially expressed chicken lamin A and truncated B2 lamins. J Struct Biol. 108:74-89.
Hinshaw, J.E., B.O. Carragher, and R.A. Milligan. 1992. Architecture and design of the nuclear pore complex. Cell. 69:1133-1141.
Hodzic, D.M., D.B. Yeater, L. Bengtsson, H. Otto, and P.D. Stahl. 2004. Sun2 is a novel mammalian inner nuclear membrane protein. J Biol Chem. 279:25805-12.
Holaska, J.M., K.K. Lee, A.K. Kowalski, and K.L. Wilson. 2003. Transcriptional repressor germ cell-less (GCL) and barrier to autointegration factor (BAF) compete for binding to emerin in vitro. J Biol Chem. 278:6969-75.
Huang, S., L. Chen, N. Libina, J. Janes, G.M. Martin, J. Campisi, and J. Oshima. 2005. Correction of cellular phenotypes of Hutchinson-Gilford Progeria cells by RNA interference. Hum Genet. 118:444-50.
Jagatheesan, G., S. Thanumalayan, B. Muralikrishna, N. Rangaraj, A.A. Karande, and V.K. Parnaik. 1999. Colocalization of intranuclear lamin foci with RNA splicing factors. J Cell Sci. 112 ( Pt 24):4651-61.
Janicki, S.M., and D.L. Spector. 2003. Nuclear choreography: interpretations from living cells. Curr Opin Cell Biol. 15:149-57.
112
Jarnik, M., and U. Aebi. 1991. Toward a more complete 3-D structure of the nuclear pore complex. J. Struct. Biol. 107:291-308.
Johnson, B.R., R.T. Nitta, R.L. Frock, L. Mounkes, D.A. Barbie, C.L. Stewart, E. Harlow, and B.K. Kennedy. 2004. A-type lamins regulate retinoblastoma protein function by promoting subnuclear localization and preventing proteasomal degradation. Proc Natl Acad Sci U S A. 101:9677-82.
Kalderon, D., B.L. Roberts, W.D. Richardson, and A.E. Smith. 1984. A short amino acid sequence able to specify nuclear location. Cell. 39:499-509.
Keller, R.K., and S.J. Fliesler. 1999. Mechanism of aminobisphosphonate action: characterization of alendronate inhibition of the isoprenoid pathway. Biochem Biophys Res Commun. 266:560-3.
King, M.C., C.P. Lusk, and G. Blobel. 2006. Karyopherin-mediated import of integral inner nuclear membrane proteins. Nature. 442:1003-7.
Kirschner, J., T. Brune, M. Wehnert, J. Denecke, C. Wasner, A. Feuer, T. Marquardt, U.P. Ketelsen, P. Wieacker, C.G. Bonnemann, and R. Korinthenberg. 2005. p.S143F mutation in lamin A/C: a new phenotype combining myopathy and progeria. Ann Neurol. 57:148-51.
Kitten, G.T., and E.A. Nigg. 1991. The CaaX motif is required for isoprenylation, carboxy methylation and nuclear membrane association of lamin B2. J. Cell Biol. 113:13-24.
Kobberling, J., B. Willms, R. Kattermann, and W. Creutzfeldt. 1975. Lipodystrophy of the extremities. A dominantly inherited syndrome associated with lipatrophic diabetes. Humangenetik. 29:111-20.
Kumagai, H., Y. Kawamura, K. Yanagisawa, and H. Komano. 1999. Identification of a human cDNA encoding a novel protein structurally related to the yeast membrane-associated metalloprotease, Ste24p. Biochim Biophys Acta. 1426:468-74.
Kumaran, R.I., B. Muralikrishna, and V.K. Parnaik. 2002. Lamin A/C speckles mediate spatial organization of splicing factor compartments and RNA polymerase II transcription. J Cell Biol. 159:783-93.
Lammerding, J., L.G. Fong, J.Y. Ji, K. Reue, C.L. Stewart, S.G. Young, and R.T. Lee. 2006. Lamins A and C but not lamin B1 regulate nuclear mechanics. J Biol Chem. 281:25768-80.
Lammerding, J., J. Hsiao, P.C. Schulze, S. Kozlov, C.L. Stewart, and R.T. Lee. 2005. Abnormal nuclear shape and impaired mechanotransduction in emerin-deficient cells. J Cell Biol. 170:781-91.
Lammerding, J., R.D. Kamm, and R.T. Lee. 2004a. Mechanotransduction in cardiac myocytes. Ann N Y Acad Sci. 1015:53-70.
113
Lammerding, J., P.C. Schulze, T. Takahashi, S. Kozlov, T. Sullivan, R.D. Kamm, C.L. Stewart, and R.T. Lee. 2004b. Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J Clin Invest. 113:370-8.
Lans, H., and J.H. Hoeijmakers. 2006. Cell biology: ageing nucleus gets out of shape. Nature. 440:32-4.
Lazebnik, Y.A., A. Takahashi, R.D. Moir, R.D. Goldman, G.G. Poirier, S.H. Kaufmann, and W.C. Earnshaw. 1995. Studies of the lamin proteinase reveal multiple parallel biochemical pathways during apoptotic execution. Proc Natl Acad Sci U S A. 92:9042-6.
Lee, K.K., D. Starr, M. Cohen, J. Liu, M. Han, K.L. Wilson, and Y. Gruenbaum. 2002. Lamin- dependent localization of UNC-84, a protein required for nuclear migration in Caenorhabditis elegans. Mol Biol Cell. 13:892-901.
Lee, S.H., and J. Hurwitz. 1990. Mechanism of elongation of primed DNA by DNA polymerase delta, proliferating cell nuclear antigen, and activator 1. Proc Natl Acad Sci U S A. 87:5672-6.
Lenne, P.F., A.J. Raae, S.M. Altmann, M. Saraste, and J.K. Horber. 2000. States and transitions during forced unfolding of a single spectrin repeat. FEBS Lett. 476:124-8.
Leung, C.L., K.J. Green, and R.K. Liem. 2002. Plakins: a family of versatile cytolinker proteins. Trends Cell Biol. 12:37-45.
Leung, G.K., W.K. Schmidt, M.O. Bergo, B. Gavino, D.H. Wong, A. Tam, M.N. Ashby, S. Michaelis, and S.G. Young. 2001. Biochemical studies of Zmpste24-deficient mice. J Biol Chem. 276:29051-8.
Lin, F., J.M. Morrison, W. Wu, and H.J. Worman. 2005. MAN1, an integral protein of the inner nuclear membrane, binds Smad2 and Smad3 and antagonizes transforming growth factor- beta signaling. Hum Mol Genet. 14:437-45.
Lin, F., and H.J. Worman. 1993. Structural organization of the human gene encoding nuclear lamin A and nuclear lamin C. J Biol Chem. 268:16321-6.
Liu, B., J. Wang, K.M. Chan, W.M. Tjia, W. Deng, X. Guan, J.D. Huang, K.M. Li, P.Y. Chau, D.J. Chen, D. Pei, A.M. Pendas, J. Cadinanos, C. Lopez-Otin, H.F. Tse, C. Hutchison, J. Chen, Y. Cao, K.S. Cheah, K. Tryggvason, and Z. Zhou. 2005. Genomic instability in laminopathy-based premature aging. Nat Med. 11:780-5.
Liu, J., K.K. Lee, M. Segura-Totten, E. Neufeld, K.L. Wilson, and Y. Gruenbaum. 2003. MAN1 and emerin have overlapping function(s) essential for chromosome segregation and cell division in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 100:4598-603.
114
Liu, J., T. Rolef Ben-Shahar, D. Riemer, M. Treinin, P. Spann, K. Weber, A. Fire, and Y. Gruenbaum. 2000. Essential roles for Caenorhabditis elegans lamin gene in nuclear organization, cell cycle progression, and spatial organization of nuclear pore complexes. Mol Biol Cell. 11:3937-47.
Liu, Y., A. Rusinol, M. Sinensky, Y. Wang, and Y. Zou. 2006. DNA damage responses in progeroid syndromes arise from defective maturation of prelamin A. J Cell Sci. 119:4644- 9.
Liu, Y., Y. Wang, A.E. Rusinol, M.S. Sinensky, J. Liu, S.M. Shell, and Y. Zou. 2008. Involvement of xeroderma pigmentosum group A (XPA) in progeria arising from defective maturation of prelamin A. Faseb J. 22:603-11.
Loewinger, L., and F. McKeon. 1988. Mutations in the nuclear lamin proteins resulting intheir aberrant assembly in the cytoplasm. EMBOJ. 7:2301-2309.
Lutz, R.J., M.A. Trujillo, K.S. Denham, L. Wenger, and M. Sinensky. 1992. Nucleoplasmic localization of prelamin A: implications for prenylation-dependent lamin A assembly into the nuclear lamina. Proc Natl Acad Sci U S A. 89:3000-4.
Maeshima, K., K. Yahata, Y. Sasaki, R. Nakatomi, T. Tachibana, T. Hashikawa, F. Imamoto, and N. Imamoto. 2006. Cell-cycle-dependent dynamics of nuclear pores: pore-free islands and lamins. J Cell Sci. 119:4442-51.
Makatsori, D., N. Kourmouli, H. Polioudaki, L.D. Shultz, K. McLean, P.A. Theodoropoulos, P.B. Singh, and S.D. Georgatos. 2004. The inner nuclear membrane protein lamin B receptor forms distinct microdomains and links epigenetically marked chromatin to the nuclear envelope. J Biol Chem. 279:25567-73.
Mallampalli, M.P., G. Huyer, P. Bendale, M.H. Gelb, and S. Michaelis. 2005. Inhibiting farnesylation reverses the nuclear morphology defect in a HeLa cell model for Hutchinson- Gilford progeria syndrome. Proc Natl Acad Sci U S A. 102:14416-21.
Malone, C.J., W.D. Fixsen, H.R. Horvitz, and M. Han. 1999. UNC-84 localizes to the nuclear envelope and is required for nuclear migration and anchoring during C. elegans development. Development. 126:3171-81.
Malone, C.J., L. Misner, N. Le Bot, M.C. Tsai, J.M. Campbell, J. Ahringer, and J.G. White. 2003. The C. elegans hook protein, ZYG-12, mediates the essential attachment between the centrosome and nucleus. Cell. 115:825-36.
Manju, K., B. Muralikrishna, and V.K. Parnaik. 2006. Expression of disease-causing lamin A mutants impairs the formation of DNA repair foci. J Cell Sci. 119:2704-14.
Mansfeld, J., S. Guttinger, L.A. Hawryluk-Gara, N. Pante, M. Mall, V. Galy, U. Haselmann, P. Muhlhausser, R.W. Wozniak, I.W. Mattaj, U. Kutay, and W. Antonin. 2006. The conserved transmembrane nucleoporin NDC1 is required for nuclear pore complex assembly in vertebrate cells. Mol Cell. 22:93-103.
115
Mansharamani, M., and K.L. Wilson. 2005. Direct binding of nuclear membrane protein MAN1 to emerin in vitro and two modes of binding to barrier-to-autointegration factor. J Biol Chem. 280:13863-70.
Maraldi, N.M., G. Lattanzi, C. Capanni, M. Columbaro, E. Mattioli, P. Sabatelli, S. Squarzoni, and F.A. Manzoli. 2006. Laminopathies: a chromatin affair. Adv Enzyme Regul. 46:33-49.
Mattout-Drubezki, A., and Y. Gruenbaum. 2003. Dynamic interactions of nuclear lamina proteins with chromatin and transcriptional machinery. Cell Mol Life Sci. 60:2053-63.
Maul, G. 1977. Nuclear pore complexes: elimination and reconstruction during mitosis. J. Cell Biol. 74:492-500.
Maul, G.G., J.W. Price, and M.W. Lieberman. 1971. Formation and distribution of nuclear pore complexes in interphase. J. Cell Biol. 51:405-418.
McGee, M.D., R. Rillo, A.S. Anderson, and D.A. Starr. 2006. UNC-83 IS a KASH protein required for nuclear migration and is recruited to the outer nuclear membrane by a physical interaction with the SUN protein UNC-84. Mol Biol Cell. 17:1790-801.
McKeon, F.D., M.W. Kirschner, and D. Caput. 1986. Homologies in both primary and secondary structure between nuclear envelope and intermediate filament proteins. Nature. 319:463- 468.
Melcon, G., S. Kozlov, D.A. Cutler, T. Sullivan, L. Hernandez, P. Zhao, S. Mitchell, G. Nader, M. Bakay, J.N. Rottman, E.P. Hoffman, and C.L. Stewart. 2006. Loss of emerin at the nuclear envelope disrupts the Rb1/E2F and MyoD pathways during muscle regeneration. Hum Mol Genet. 15:637-51.
Mislow, J.M., J.M. Holaska, M.S. Kim, K.K. Lee, M. Segura-Totten, K.L. Wilson, and E.M. McNally. 2002a. Nesprin-1alpha self-associates and binds directly to emerin and lamin A in vitro. FEBS Lett. 525:135-40.
Mislow, J.M., M.S. Kim, D.B. Davis, and E.M. McNally. 2002b. Myne-1, a spectrin repeat transmembrane protein of the myocyte inner nuclear membrane, interacts with lamin A/C. J Cell Sci. 115:61-70.
Mosley-Bishop, K.L., Q. Li, L. Patterson, and J.A. Fischer. 1999. Molecular analysis of the klarsicht gene and its role in nuclear migration within differentiating cells of the Drosophila eye. Curr Biol. 9:1211-20.
Mounkes, L., S. Kozlov, B. Burke, and C.L. Stewart. 2003. The laminopathies: nuclear structure meets disease. Curr Opin Genet Dev. 13:223-30.
Mounkes, L.C., B. Burke, and C.L. Stewart. 2001. The A-type lamins: nuclear structural proteins as a focus for muscular dystrophy and cardiovascular diseases. Trends Cardiovasc Med. 11:280-5.
116
Muchir, A., G. Bonne, A.J. van der Kooi, M. van Meegen, F. Baas, P.A. Bolhuis, M. de Visser, and K. Schwartz. 2000. Identification of mutations in the gene encoding lamins A/C in autosomal dominant limb girdle muscular dystrophy with atrioventricular conduction disturbances (LGMD1B). Hum Mol Genet. 9:1453-9.
Muchir, A., and H.J. Worman. 2004. The nuclear envelope and human disease. Physiology (Bethesda). 19:309-14.
Navarro, C.L., J. Cadinanos, A. De Sandre-Giovannoli, R. Bernard, S. Courrier, I. Boccaccio, A. Boyer, W.J. Kleijer, A. Wagner, F. Giuliano, F.A. Beemer, J.M. Freije, P. Cau, R.C. Hennekam, C. Lopez-Otin, C. Badens, and N. Levy. 2005. Loss of ZMPSTE24 (FACE-1) causes autosomal recessive restrictive dermopathy and accumulation of Lamin A precursors. Hum Mol Genet. 14:1503-13.
Navarro, C.L., A. De Sandre-Giovannoli, R. Bernard, I. Boccaccio, A. Boyer, D. Genevieve, S. Hadj-Rabia, C. Gaudy-Marqueste, H.S. Smitt, P. Vabres, L. Faivre, A. Verloes, T. Van Essen, E. Flori, R. Hennekam, F.A. Beemer, N. Laurent, M. Le Merrer, P. Cau, and N. Levy. 2004. Lamin A and ZMPSTE24 (FACE-1) defects cause nuclear disorganization and identify restrictive dermopathy as a lethal neonatal laminopathy. Hum Mol Genet. 13:2493- 503.
Neri, L.M., Y. Raymond, A. Giordano, S. Capitani, and A.M. Martelli. 1999. Lamin A is part of the internal nucleoskeleton of human erythroleukemia cells. J Cell Physiol. 178:284-95.
Newport, J.W., and D.J. Forbes. 1987. The nucleus: structure, function, and dynamics. Annu Rev Biochem. 56:535-65.
Nigg, E.A. 1989. The nuclear envelope. Curr Opin Cell Biol. 1:435-40.
Nitta, R.T., S.A. Jameson, B.A. Kudlow, L.A. Conlan, and B.K. Kennedy. 2006. Stabilization of the retinoblastoma protein by A-type nuclear lamins is required for INK4A-mediated cell cycle arrest. Mol Cell Biol. 26:5360-72.
Novelli, G., A. Muchir, F. Sangiuolo, A. Helbling-Leclerc, M.R. D'Apice, C. Massart, F. Capon, P. Sbraccia, M. Federici, R. Lauro, C. Tudisco, R. Pallotta, G. Scarano, B. Dallapiccola, L. Merlini, and G. Bonne. 2002. Mandibuloacral dysplasia is caused by a mutation in LMNA- encoding lamin A/C. Am J Hum Genet. 71:426-31.
Ohba, T., E.C. Schirmer, T. Nishimoto, and L. Gerace. 2004. Energy- and temperature- dependent transport of integral proteins to the inner nuclear membrane via the nuclear pore. J Cell Biol. 167:1051-62.
Ostlund, C., J. Ellenberg, E. Hallberg, J. Lippincott-Schwartz, and H.J. Worman. 1999. Intracellular trafficking of emerin, the Emery-Dreifuss muscular dystrophy protein. J Cell Sci. 112 ( Pt 11):1709-19.
117
Ostlund, C., T. Sullivan, C.L. Stewart, and H.J. Worman. 2006. Dependence of diffusional mobility of integral inner nuclear membrane proteins on A-type lamins. Biochemistry. 45:1374-82.
Ostlund, C., and H.J. Worman. 2003. Nuclear envelope proteins and neuromuscular diseases. Muscle Nerve. 27:393-406.
Padmakumar, V.C., S. Abraham, S. Braune, A.A. Noegel, B. Tunggal, I. Karakesisoglou, and E. Korenbaum. 2004. Enaptin, a giant actin-binding protein, is an element of the nuclear membrane and the actin cytoskeleton. Exp Cell Res. 295:330-9.
Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abraham, A.A. Noegel, J. Gotzmann, R. Foisner, and I. Karakesisoglou. 2005. The inner nuclear membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nuclear envelope. J Cell Sci. 118:3419-30.
Pante, N., R. Bastos, I. McMorrow, B. Burke, and U. Aebi. 1994. Interactions and three- dimensional localization of a group of nuclear pore complex proteins. J Cell Biol. 126:603- 17.
Paradisi, M., D. McClintock, R.L. Boguslavsky, C. Pedicelli, H.J. Worman, and K. Djabali. 2005. Dermal fibroblasts in Hutchinson-Gilford progeria syndrome with the lamin A G608G mutation have dysmorphic nuclei and are hypersensitive to heat stress. BMC Cell Biol. 6:27.
Patterson, K., A.B. Molofsky, C. Robinson, S. Acosta, C. Cater, and J.A. Fischer. 2004. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol Biol Cell. 15:600-10.
Pemberton, T.J., and J.E. Kay. 2005. The cyclophilin repertoire of the fission yeast Schizosaccharomyces pombe. Yeast. 22:927-45.
Phair, R.D., P. Scaffidi, C. Elbi, J. Vecerova, A. Dey, K. Ozato, D.T. Brown, G. Hager, M. Bustin, and T. Misteli. 2004. Global nature of dynamic protein-chromatin interactions in vivo: three-dimensional genome scanning and dynamic interaction networks of chromatin proteins. Mol Cell Biol. 24:6393-402.
Pickersgill, H., B. Kalverda, E. de Wit, W. Talhout, M. Fornerod, and B. van Steensel. 2006. Characterization of the Drosophila melanogaster genome at the nuclear lamina. Nat Genet. 38:1005-14.
Piercy, R.J., H. Zhou, L. Feng, A. Pombo, F. Muntoni, and S.C. Brown. 2007. Desmin immunolocalisation in autosomal dominant Emery-Dreifuss muscular dystrophy. Neuromuscul Disord. 17:297-305.
Plasilova, M., C. Chattopadhyay, P. Pal, N.A. Schaub, S.A. Buechner, H. Mueller, P. Miny, A. Ghosh, and K. Heinimann. 2004. Homozygous missense mutation in the lamin A/C gene causes autosomal recessive Hutchinson-Gilford progeria syndrome. J Med Genet. 41:609- 14.
118
Polioudaki, H., N. Kourmouli, V. Drosou, A. Bakou, P.A. Theodoropoulos, P.B. Singh, T. Giannakouros, and S.D. Georgatos. 2001. Histones H3/H4 form a tight complex with the inner nuclear membrane protein LBR and heterochromatin protein 1. EMBO Rep. 2:920-5.
Powell, L., and B. Burke. 1990. Internuclear exhchange of an inner nuclear membrane protein (p55) in heterokaryons: in vivo evidence for the association of p55 with the nuclear lamina. J. Cell Biol. 111:2225-2234.
Prot, M., L. Heripret, N. Cardot-Leccia, C. Perrin, M. Aouadi, T. Lavrut, R. Garraffo, P. Dellamonica, J. Durant, Y. Le Marchand-Brustel, and B. Binetruy. 2006. Long-term treatment with lopinavir-ritonavir induces a reduction in peripheral adipose depots in mice. Antimicrob Agents Chemother. 50:3998-4004.
Rabut, G., V. Doye, and J. Ellenberg. 2004. Mapping the dynamic organization of the nuclear pore complex inside single living cells. Nat Cell Biol. 6:1114-21.
Rasala, B.A., C. Ramos, A. Harel, and D.J. Forbes. 2008. Capture of AT-rich chromatin by ELYS recruits POM121 and NDC1 to initiate nuclear pore assembly. Mol Biol Cell. 19:3982-96.
Raska, I., P.J. Shaw, and D. Cmarko. 2006a. New insights into nucleolar architecture and activity. Int Rev Cytol. 255:177-235.
Raska, I., P.J. Shaw, and D. Cmarko. 2006b. Structure and function of the nucleolus in the spotlight. Curr Opin Cell Biol. 18:325-34.
Ris, H. 1997. High-resolution field-emission scanning electron microscopy of nuclear pore complex. Scanning. 19:368-75.
Rober, R.A., H. Sauter, K. Weber, and M. Osborn. 1990. Cells of the cellular immune and hemopoietic system of the mouse lack lamins A/C: distinction versus other somatic cells. J Cell Sci. 95 ( Pt 4):587-98.
Rober, R.A., K. Weber, and M. Osborn. 1989. Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development. 105:365-78.
Rollenhagen, C., P. Muhlhausser, U. Kutay, and N. Pante. 2003. Importin beta-depending nuclear import pathways: role of the adapter proteins in the docking and releasing steps. Mol Biol Cell. 14:2104-15.
Rout, M.P., J.D. Aitchison, A. Suprapto, K. Hjertaas, Y. Zhao, and B.T. Chait. 2000. The yeast nuclear pore complex: composition, architecture, and transport mechanism. J Cell Biol. 148:635-51.
Rout, M.P., and S.R. Wente. 1994. Pores for thought: nuclear pore complex proteins. Trends Cell Biol. 4:357-365.
119
Roux, K.J., and B. Burke. 2006. From pore to kinetochore and back: regulating envelope assembly. Dev Cell. 11:276-8.
Rusinol, A.E., and M.S. Sinensky. 2006. Farnesylated lamins, progeroid syndromes and farnesyl transferase inhibitors. J Cell Sci. 119:3265-72.
Saksena, S., M.D. Summers, J.K. Burks, A.E. Johnson, and S.C. Braunagel. 2006. Importin- alpha-16 is a translocon-associated protein involved in sorting membrane proteins to the nuclear envelope. Nat Struct Mol Biol. 13:500-8.
Sarkar, P.K., C. D'Souza, and S. Ballantyne. 2001. Treatment of aneurysmal subarachnoid haemorrhage in elderly patients. J Clin Pharm Ther. 26:247-56.
Scaffidi, P., and T. Misteli. 2005. Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome. Nat Med. 11:440-5.
Schirmer, E.C., L. Florens, T. Guan, J.R. Yates, 3rd, and L. Gerace. 2005. Identification of novel integral membrane proteins of the nuclear envelope with potential disease links using subtractive proteomics. Novartis Found Symp. 264:63-76; discussion 76-80, 227-30.
Schirmer, E.C., and L. Gerace. 2004. The stability of the nuclear lamina polymer changes with the composition of lamin subtypes according to their individual binding strengths. J Biol Chem. 279:42811-7.
Sevenants, L., C. Wouters, A. De Sandre-Giovannoli, H. Devlieger, K. Devriendt, J.J. van den Oord, K. Marien, N. Levy, and M.A. Morren. 2005. Tight skin and limited joint movements as early presentation of Hutchinson-Gilford progeria in a 7-week-old infant. Eur J Pediatr. 164:283-6.
Shackleton, S., D.J. Lloyd, S.N. Jackson, R. Evans, M.F. Niermeijer, B.M. Singh, H. Schmidt, G. Brabant, S. Kumar, P.N. Durrington, S. Gregory, S. O'Rahilly, and R.C. Trembath. 2000. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat Genet. 24:153-6.
Shao, X., H.A. Tarnasky, J.P. Lee, R. Oko, and F.A. van der Hoorn. 1999. Spag4, a novel sperm protein, binds outer dense-fiber protein Odf1 and localizes to microtubules of manchette and axoneme. Dev Biol. 211:109-23.
Shumaker, D.K., T. Dechat, A. Kohlmaier, S.A. Adam, M.R. Bozovsky, M.R. Erdos, M. Eriksson, A.E. Goldman, S. Khuon, F.S. Collins, T. Jenuwein, and R.D. Goldman. 2006. Mutant nuclear lamin A leads to progressive alterations of epigenetic control in premature aging. Proc Natl Acad Sci U S A. 103:8703-8.
Shumaker, D.K., K.K. Lee, Y.C. Tanhehco, R. Craigie, and K.L. Wilson. 2001. LAP2 binds to BAF.DNA complexes: requirement for the LEM domain and modulation by variable regions. Embo J. 20:1754-64.
120
Shumaker, D.K., L. Solimando, K. Sengupta, T. Shimi, S.A. Adam, A. Grunwald, S.V. Strelkov, U. Aebi, M.C. Cardoso, and R.D. Goldman. 2008. The highly conserved nuclear lamin Ig- fold binds to PCNA: its role in DNA replication. J Cell Biol. 181:269-80.
Sinensky, M., L.A. Beck, S. Leonard, and R. Evans. 1990. Differential inhibitory effects of lovastatin on protein isoprenylation and sterol synthesis. J Biol Chem. 265:19937-41.
Sinensky, M., K. Fantle, M. Trujillo, T. McLain, A. Kupfer, and M. Dalton. 1994. The processing pathway of prelamin A. J. Cell Sci. 107:61-67.
Soullam, B., and H.J. Worman. 1995. Signals and structural features involved in integral membrane protein targeting to the inner nuclear membrane. J. Cell Biol. 130:15-27.
Speckman, R.A., A. Garg, F. Du, L. Bennett, R. Veile, E. Arioglu, S.I. Taylor, M. Lovett, and A.M. Bowcock. 2000. Mutational and haplotype analyses of families with familial partial lipodystrophy (Dunnigan variety) reveal recurrent missense mutations in the globular C- terminal domain of lamin A/C. Am J Hum Genet. 66:1192-8.
Stade, K., C.S. Ford, C. Guthrie, and K. Weis. 1997. Exportin 1 (Crm1p) is an essential nuclear export factor. Cell. 90:1041-50.
Starr, D.A. 2007. Communication between the cytoskeleton and the nuclear envelope to position the nucleus. Mol Biosyst. 3:583-9.
Starr, D.A., and M. Han. 2002. Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science. 298:406-9.
Starr, D.A., G.J. Hermann, C.J. Malone, W. Fixsen, J.R. Priess, H.R. Horvitz, and M. Han. 2001. unc-83 encodes a novel component of the nuclear envelope and is essential for proper nuclear migration. Development. 128:5039-50.
Stavru, F., B.B. Hulsmann, A. Spang, E. Hartmann, V.C. Cordes, and D. Gorlich. 2006. NDC1: a crucial membrane-integral nucleoporin of metazoan nuclear pore complexes. J Cell Biol. 173:509-19.
Stoffler, D., B. Fahrenkrog, and U. Aebi. 1999. The nuclear pore complex: from molecular architecture to functional dynamics. Curr Opin Cell Biol. 11:391-401.
Stuurman, N., S. Heins, and U. Aebi. 1998. Nuclear lamins: their structure, assembly, and interactions. J Struct Biol. 122:42-66.
Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, C.L. Stewart, and B. Burke. 1999. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J Cell Biol. 147:913-20.
121
Taylor, M.R., D. Slavov, A. Gajewski, S. Vlcek, L. Ku, P.R. Fain, E. Carniel, A. Di Lenarda, G. Sinagra, M.M. Boucek, J. Cavanaugh, S.L. Graw, P. Ruegg, J. Feiger, X. Zhu, D.A. Ferguson, M.R. Bristow, J. Gotzmann, R. Foisner, and L. Mestroni. 2005. Thymopoietin (lamina-associated polypeptide 2) gene mutation associated with dilated cardiomyopathy. Hum Mutat. 26:566-74.
Toth, J.I., S.H. Yang, X. Qiao, A.P. Beigneux, M.H. Gelb, C.L. Moulson, J.H. Miner, S.G. Young, and L.G. Fong. 2005. Blocking protein farnesyltransferase improves nuclear shape in fibroblasts from humans with progeroid syndromes. Proc Natl Acad Sci U S A. 102:12873-8.
Tran, E.J., and S.R. Wente. 2006. Dynamic nuclear pore complexes: life on the edge. Cell. 125:1041-53.
Tzur, Y.B., K.L. Wilson, and Y. Gruenbaum. 2006. SUN-domain proteins: 'Velcro' that links the nucleoskeleton to the cytoskeleton. Nat Rev Mol Cell Biol. 7:782-8.
Varela, I., J. Cadinanos, A.M. Pendas, A. Gutierrez-Fernandez, A.R. Folgueras, L.M. Sanchez, Z. Zhou, F.J. Rodriguez, C.L. Stewart, J.A. Vega, K. Tryggvason, J.M. Freije, and C. Lopez-Otin. 2005. Accelerated ageing in mice deficient in Zmpste24 protease is linked to p53 signalling activation. Nature. 437:564-8.
Varela, I., S. Pereira, A.P. Ugalde, C.L. Navarro, M.F. Suarez, P. Cau, J. Cadinanos, F.G. Osorio, N. Foray, J. Cobo, F. de Carlos, N. Levy, J.M. Freije, and C. Lopez-Otin. 2008. Combined treatment with statins and aminobisphosphonates extends longevity in a mouse model of human premature aging. Nat Med. 14:767-72.
Verstraeten, V.L., J.L. Broers, M.A. van Steensel, S. Zinn-Justin, F.C. Ramaekers, P.M. Steijlen, M. Kamps, H.J. Kuijpers, D. Merckx, H.J. Smeets, R.C. Hennekam, C.L. Marcelis, and A. van den Wijngaard. 2006. Compound heterozygosity for mutations in LMNA causes a progeria syndrome without prelamin A accumulation. Hum Mol Genet. 15:2509-22.
Voeltz, G.K., W.A. Prinz, Y. Shibata, J.M. Rist, and T.A. Rapoport. 2006. A class of membrane proteins shaping the tubular endoplasmic reticulum. Cell. 124:573-86.
Wagner, N., D. Weber, S. Seitz, and G. Krohne. 2004. The lamin B receptor of Drosophila melanogaster. J Cell Sci. 117:2015-28.
Wang, Q., X. Du, Z. Cai, and M.I. Greene. 2006. Characterization of the structures involved in localization of the SUN proteins to the nuclear envelope and the centrosome. DNA Cell Biol. 25:554-62.
Watson, M.L. 1955. The nuclear envelope: its structure in relation to cytoplasmic membranes. J Biophys Biochem Cytol. 1:257-70.
Welte, M.A., S.P. Gross, M. Postner, S.M. Block, and E.F. Wieschaus. 1998. Developmental regulation of vesicle transport in Drosophila embryos: forces and kinetics. Cell. 92:547-57.
122
Wiese, C., and K.L. Wilson. 1993. Nuclear membrane dynamics. Curr Opin Cell Biol. 5:387-94.
Wilhelmsen, K., M. Ketema, H. Truong, and A. Sonnenberg. 2006. KASH-domain proteins in nuclear migration, anchorage and other processes. J Cell Sci. 119:5021-9.
Wilhelmsen, K., S.H. Litjens, I. Kuikman, N. Tshimbalanga, H. Janssen, I. van den Bout, K. Raymond, and A. Sonnenberg. 2005. Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin. J Cell Biol. 171:799-810.
Worman, H.J., and J.C. Courvalin. 2004. How do mutations in lamins A and C cause disease? J Clin Invest. 113:349-51.
Worman, H.J., and G.G. Gundersen. 2006. Here come the SUNs: a nucleocytoskeletal missing link. Trends Cell Biol. 16:67-9.
Xing, X.W., L.Y. Li, J.J. Fu, W.B. Zhu, G. Liu, S.F. Liu, and G.X. Lu. 2003. [Cloning of cDNA of TSARG4, a human spermatogenesis related gene]. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai). 35:283-8.
Yang, S.H., M.O. Bergo, J.I. Toth, X. Qiao, Y. Hu, S. Sandoval, M. Meta, P. Bendale, M.H. Gelb, S.G. Young, and L.G. Fong. 2005. Blocking protein farnesyltransferase improves nuclear blebbing in mouse fibroblasts with a targeted Hutchinson-Gilford progeria syndrome mutation. Proc Natl Acad Sci U S A. 102:10291-6.
Yang, S.H., X. Qiao, L.G. Fong, and S.G. Young. 2008. Treatment with a farnesyltransferase inhibitor improves survival in mice with a Hutchinson-Gilford progeria syndrome mutation. Biochim Biophys Acta. 1781:36-9.
Ye, Q., I. Callebaut, A. Pezhman, J.C. Courvalin, and H.J. Worman. 1997. Domain-specific interactions of human HP1-type chromodomain proteins and inner nuclear membrane protein LBR. J Biol Chem. 272:14983-9.
Ye, Q., and H.J. Worman. 1996. Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1. J Biol Chem. 271:14653-6.
Yong, D.L.-Y., and G.W. Hart. 1994. Purification and characterization of an O-glcNAc selective N-acetyl-β-D-glucosaminidase from rat spleen cytosol. J. Biol. Chem. 269:19321-19330.
Yu, J., D.A. Starr, X. Wu, S.M. Parkhurst, Y. Zhuang, T. Xu, R. Xu, and M. Han. 2006. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev Biol. 289:336-45.
Zastrow, M.S., S. Vlcek, and K.L. Wilson. 2004. Proteins that bind A-type lamins: integrating isolated clues. J Cell Sci. 117:979-87.
123
Zhang, Q., C.D. Ragnauth, J.N. Skepper, N.F. Worth, D.T. Warren, R.G. Roberts, P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2005. Nesprin-2 is a multi-isomeric protein that binds lamin and emerin at the nuclear envelope and forms a subcellular network in skeletal muscle. J Cell Sci. 118:673-87.
Zhang, Q., J.N. Skepper, F. Yang, J.D. Davies, L. Hegyi, R.G. Roberts, P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2001. Nesprins: a novel family of spectrin-repeat-containing proteins that localize to the nuclear membrane in multiple tissues. J Cell Sci. 114:4485-98.
Zhang, X., R. Xu, B. Zhu, X. Yang, X. Ding, S. Duan, T. Xu, Y. Zhuang, and M. Han. 2007. Syne-1 and Syne-2 play crucial roles in myonuclear anchorage and motor neuron innervation. Development. 134:901-8.
Zhen, Y.Y., T. Libotte, M. Munck, A.A. Noegel, and E. Korenbaum. 2002. NUANCE, a giant protein connecting the nucleus and actin cytoskeleton. J Cell Sci. 115:3207-22.
124
BIOGRAPHICAL SKETCH
Born and raised in Shandong Jinan, China, Qian Liu is the daughter of Xiaoquan Wang
and Zhaoxiang Liu. She graduated from Experimental High School (Jinan, China). She then went
on to study medicine in Shandong University, College of Medicine (China) where she received a
Bachelor of Medicine degree in 2002. After graduating, she continued her medical education in a
master program in the Department of Cardiology, Internal medicine. In the fall of 2003, Qian
entered the Interdisciplinary Program for Biomedical Sciences at the University of Florida where
she later joined the lab of Brian Burke in the Department of Anatomy and Cell Biology to pursue her doctoral degree.
125