DOCSLIB.ORG

From Pupilla Muscorum (Linnaeus, 1758) (Pulmonata: Pupillidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
From Pupilla Muscorum (Linnaeus, 1758) (Pulmonata: Pupillidae) MORPHOLOGY, ECOLOGY AND DNA-BARCODING DISTINGUISH PUPILLA PRATENSIS (CLESSIN, 1871) FROM PUPILLA MUSCORUM (LINNAEUS, 1758) (PULMONATA: PUPILLIDAE) TED VON PROSCHWITZ1, CHRISTOFFER SCHANDER2,UWEJUEG3 AND SOLVEIG THORKILDSEN2 1Section of Invertebrate Zoology, Go¨teborg Natural History Museum, PO Box 7283, SE-40235 Go¨teborg, Sweden; 2Department of Biology, University of Bergen, PO Box 7800, 5020 Bergen, Norway; and 3Schweriner Allee 16, D-19288 Ludwigslust, Germany (Received 29 August 2006; accepted 13 February 2009) ABSTRACT The taxonomic identity of Pupilla pratensis (Clessin, 1871), normally considered to be an ecopheno- type of Pupilla muscorum (Linnaeus, 1758), was investigated using morphological, ecological and mol- ecular data (cytochrome c oxidase subunit I and cytochrome b). We conclude that these two forms represent distinct species. This underused combined approach proves to be a powerful tool in dis- tinguishing among closely related species within the genus Pupilla, and we suggest that it should be more widely adopted when sorting out complexes in other groups. INTRODUCTION We have therefore compared populations of pratensis with typical P. muscorum, both morphologically in terms of shell The genus Pupilla s. s. (Fleming, 1828) comprises some 20–30 characters, and genetically using sequences of the mitochon- species and is widely distributed throughout the northern drial genes cytochrome c oxidase subunit I (COI) and cyto- hemisphere – Europe, northernmost Africa, N. Asia and chrome b (CytB). Here we offer a redescription of the shell of North America (Zilch, 1959). The most common and wide- pratensis in comparison with related species of Pupilla, details of spread species is Pupilla muscorum (L., 1758), which inhabits its ecology and distribution, and an account of the molecular nearly the entire range of the genus (Ehrmann, 1933; Pilsbry, basis for the separation of pratensis from muscorum. 1948) and has proved to be important indicator species in eco- logical studies (e.g. Chappell et al., 1971; Jurickova´ & Kucera, 2005), especially in the study of climatic change (e.g. MATERIAL AND METHODS Rousseau, 1985, 1987; Rossignol, Moine & Rousseau, 2004; Specimens of Pupilla were collected from various locations and Moine, Rousseau & Antoine, 2005; Chlachula et al., 2007). transported live to the laboratory where they were measured to Pupilla muscorum is also the type species (Pupa marginata nearest 0.1 mm, determined to taxonomic group on the basis Draparnaud, 1801 ¼ P. muscorum) of the genus Pupilla. of shell morphology, and then fixed in 96% alcohol for DNA Pupilla muscorum is rich in forms and highly variable, as is the analysis. Voucher specimens from each locality and for each genus as a whole. Several authors have pointed out the need taxon were preserved dry in the collection of the Go¨ teborg for the taxonomic revision of Pupilla species and forms (e.g. Natural History Museum (GNM). Lozek, 1964). Pupilla muscorum var. pratensis was first described The material collected for sequencing is listed in Table 1. by Clessin (1871) based on material from Dinkelscherben in Additionally, more than 100 samples of Pupilla from Bavaria (Germany), where it occurred in wet peat meadows. Scandinavia were inspected by eye in order to confirm the Since then, however, the form has attracted little attention and stability of shell characters, and to obtain a broad picture of there are only scattered and brief references to it in the litera- the geographical and ecological distribution of the two forms. ture. Mostly, it has been referred to as an ecophenotype (e.g. A syntype of Pupilla pratensis from Dinkelscherben, Bavaria, Ehrmann, 1933; Lohmander, 1955, 1956; Jaeckel, 1962). Germany (Fig. 1A) and a specimen from Kobyllno, Upper Lohmander (1956) also mentioned specimens which he Silesia, Poland (Fig. 1B) (both coll. Westerlund no. 2306, interpreted as intermediate between pratensis and typical GNM) were also studied. The studied samples of Pupilla alpicola P. muscorum. The rank of pratensis has been variously given as were collected from two localities in the Austrian Alps: ‘variety’, ‘form’ or ‘mutation’. In the latest comprehensive field Franz-Josef Ho¨ he (Carinthia) and Krahberg bei Landeck guide of the terrestrial molluscs from North and Central (Tyrol). Europe (Kerney, Cameron & Jungbluth, 1983) P. pratensis was DNA from specimens to be sequenced was extracted using not mentioned. It was not until the publication of the study by the DNeasy Kit (QIAgen), following the manufacturer’s Jueg (1997) on Pupilla material from the province of protocol for animal tissue, by crushing the entire animal in Mecklenburg-Vorpommern in north-eastern Germany, that an ependorph tube. The best results were obtained when the form attracted serious attention in recent times. As the ethanol in the tissue was allowed to evaporate prior to results of Jueg (1997) coincided with observations on mor- extraction, using RNase, and when the DNA was eluted using phology and ecology of the forms in Scandinavia, we decided the elution buffer provided with the kit. Extracted DNA was to study them more closely, using a combined approach invol- diluted 10Â in ddH O, and stored at 2208C prior to ving morphology, ecology and molecular data. 2 amplification. All PCRs were carried out in a final volume of 50 mlwith4ml of DNA template, 1 ml of each primer, 4 mldNTP,4ml10Â Correspondence: T. von Proschwitz; e-mail: [email protected] PCR buffer, 36.8 mlddH2O and 0.2 ml Taq DNA polymerase Journal of Molluscan Studies (2009) 75: 315–322. Advance Access Publication: 17 August 2009 doi:10.1093/mollus/eyp038 # The Author 2009. Published by Oxford University Press on behalf of The Malacological Society of London, all rights reserved T. VON PROSCHWITZ ET AL. Table 1. Material of Pupilla muscorum and Pupilla pratensis used in the molecular genetic studies. Locality Species Haplotypes of COI Haplotypes of CytB Number of specimens Borgunda, Va¨stergo¨tland, Sweden muscorum 1, 2, 3 1, 2, 3 30 Kla¨dner Plage, Mecklenburg-Vorpommern, Germany muscorum 4, 5 3 Heiterbachtal, Baden-Wu¨rttemberg, Germany muscorum 64 2 Kla¨dner Plage, Mecklenburg-Vorpommern, Germany pratensis 75 13 Lagmansro, O¨ stergo¨tland, Sweden pratensis 7, 8, 9 6, 7 15 Ombergsliden, Omberg, O¨ stergo¨tland, Sweden pratensis 10 8 1 Figure 1. A. Pupa (Pupilla) muscorum v. pratensis Clessin ¼ Pupilla pratensis (Clessin) Dinkelscherben, Bavaria, Germany. Syntype. (coll. Westerlund 2306, GNM). B. Pupilla pratensis, Kobyllno, Upper Silesia, Poland. (coll. Westerlund 2306, GNM). C. Pupilla pratensis, Ombergsliden, O¨ stergo¨ tland, Sweden. D–F. Pupilla pratensis, Kla¨ dner Plage, Mecklenburg-Vorpommern, Germany. G. Pupilla muscorum, Borgunda church, Va¨ stergo¨ tland, Sweden. H. Pupilla muscorum, Kla¨ dner Plage, Mecklenburg-Vorpommern, Germany. I. Pupilla alpicola, Franz-Josef Ho¨ he, Carinthia, Austria. Scale bar ¼ 1 mm. 316 SEPARATION OF TWO SPECIES OF PUPILLA Table 2. Number of specimens of each haplotype for COI and CytB SYSTEMATIC DESCRIPTION and GenBank accession numbers. Pupilla pratensis (Clessin, 1871) Haplotype no. Number of GenBank no. Pupilla species (Fig. 1A–F) specimens Pupa (Pupilla) muscorum var. pratensis Clessin, 1871: 101 COI 1 6 EF457915 muscorum (Dinkelscherben, Bavaria, Germany). Clessin, 1884: 246. COI 2 23 EF457916 muscorum Clessin, 1887: 256, fig. 155. Westerlund, 1871: 243–244. COI 3 1 EF457917 muscorum Westerlund, 1887: 121. COI 4 2 EF457918 muscorum Pupa muscorum var. pratensis—Goldfuss, 1883: 37. COI 5 1 EF457919 muscorum Pupilla muscorum f. pratensis—Steenberg, 1911: 174. Ehrmann, COI 6 2 EF457920 muscorum 1933: 46. Jaeckel, 1962: 98 [with authority Reinhardt, in error]. Jueg, 1997: 277–285. von Proschwitz, 1998: 40, 52 COI 7 14 EF457921 pratensis [as pratense]. von Proschwitz, 2001: 56. von Proschwitz, 2002: COI 8 7 EF457922 pratensis 16. Zettler et al., 2006: 133. COI 9 7 EF457923 pratensis Pupilla muscorum mut. pratensis—Pilsbry, 1921: 178, pl. 20: fig. 9. COI 10 1 EF457924 pratensis Pupilla muscorum pratensis—Lohmander, 1955: 53–54. CytB 1 16 EF457907 muscorum Lohmander, 1956: 47. CytB 2 4 EF457908 muscorum Pupa (Pupilla) muscorum var. madida Gredler [in part] Clessin, CytB 3 1 EF457909 muscorum 1876: 201–202. CytB 4 2 EF457910 muscorum Types examined: One syntype, Dinkelscherben, Bavaria, CytB 5 12 EF457911 pratensis Germany (leg. S. Clessin) (Fig. 1A) (coll. Westerlund no. CytB 6 6 EF457912 pratensis 2306, GNM) CytB 7 5 EF457913 pratensis CytB 8 1 EF457914 pratensis Material examined: Kobyllno, Upper Silesia, Poland (leg. O. Goldfuss) (Fig. 1B) (coll. Westerlund no. 2306, GNM); Kla¨ dner Plage, Meckenburg-Vorpommern, Germany (leg. U. Jueg); Ombergsliden, O¨ stergo¨ tland Sweden (leg. T. von Proschwitz); Lagmnasro, O¨ stergo¨ tland, Sweden (leg. T. von (Amersham Biosciences). We used the following temperature Proschwitz). profile: 968C 2 min (938C30s,478C 30 s and 728C 1 min) Â 40; In addition, the following material of other species was 728C 7 min; 48C hold. The primers used for COI were LCO examined for comparative purposes: P. muscorum: Kla¨ dner 1490 (GGTCAACAAATCATAAAGATATTGG) and HCO Plage, Meckenburg-Vorpommern, Germany (leg. U. Jueg); 2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer Heiterbachtal, Baden-Wu¨ rttemberg, Germany(leg. H.-J. et al., 1994). For comparison we also sequenced CytB for a Niederho¨ fer); Borgunda, Va¨ stergo¨ tland, Sweden (leg. T. von smaller number of specimens. For the CytB gene, the primers Proschwitz). Pupilla alpicola: Franz Josef-Ho¨ he, Carinthia,
Load more

Recommended publications
  • (Pulmonata: Vertiginidae) and Strobilops
    Records of the Hawaii Biological Survey for 2012. Edited by Neal L. Evenhuis & Lucius G. Eldredge. Bishop Museum Occasional Papers 114: 39 –42 (2013) Hawaiian land snail records : Lyropupa cookei Clench , 1952 (Pulmonata : Vertiginidae ) and Strobilops aeneus Pilsbry , 1926 (Pulmonata : Strobilopsidae ) CARl C. C HRiSTeNSeN Bishop Museum, 1525 Bernice Street, Honolulu, Hawai‘i 96817-2704, USA; email: [email protected] This note clarifies the status of two taxa of land snails that have been reported to occur in the Hawaiian islands. Lyropupa cookei Clench, 1952, is shown to be a synonym of Lyropupa anceyana Cooke & Pilsbry in Pilsbry & Cooke, 1920. The sole Hawaiian record for the North American Strobilops aeneus Pilsbry, 1926, is almost certainly based on a mislabeled specimen, and accordingly this species should be removed from the Hawaiian faunal list. Lyropupa cookei Clench , 1952 Lyropupa Pilsbry, 1900, is a genus of pupilloid land snails endemic to the Hawaiian islands. in their monograph of the genus, Pilsbry & Cooke (1920 in 1918–1920: 253–254, pl. 26, figs. 3, 6) published a description of “ Lyropupa anceyana C. & P., n. sp.,” based on specimens from ola‘a on the island of Hawai‘i held in the collections of Bishop Museum and the Academy of Natural Sciences of Philadelphia. They stated that their new species had previously been misidentified by Ancey (1904:124) as Lyropupa lyrata (Gould, 1843) . Several pages earlier, in their systematic treatment of that species, Pilsbry & Cooke (1918–1920: 235) had also set forth their conclusion that Ancey had misidenti - fied Gould’s species and stated that in fact Ancey’s “description of lyrata was based on specimens of an unnamed species for which the name L.
    [Show full text]
  • Pupillid Land Snails of Eastern North America*
    Amer. Malac. Bull. 28: 1-29 (2010) Pupillid land snails of eastern North America* Jeffrey C. Nekola1 and Brian F. Coles2 1 Department of Biology, University of New Mexico, Albuquerque, New Mexico 87131, U.S.A. 2 Mollusca Section, Department of Biodiversity, National Museum of Wales, Cathays Park, Cardiff CF10 3NP, U.K. Corresponding author: [email protected] Abstract: The Pupillidae form an important component of eastern North American land snail biodiversity, representing approx. 12% of the entire fauna, 25-75% of all species and individuals at regional scales, at least 30% of the species diversity, and 33% of individuals within any given site. In some regions pupillids represent 80-100% of total molluscan diversity within sites, notably in taiga, tundra, and the base-poor pine savannas and pocosins of the southeastern coastal plain. Adequate documentation of North American land snail biodiversity thus requires investigators to effi ciently collect and accurately identify individuals of this group. This paper presents a set of annotated keys to the 65 species in this family known to occur in North America east of the Rocky Mountains. The distinguishing taxonomic features, updated county-scale range maps, and ecological conditions favored by each are presented in hopes of stimulating future research in this important group. Key words: microsnail, biodiversity, ecology, biogeography, taxonomy For the last dozen years, our interests in terrestrial Adequate documentation of this diversity thus requires gastropod biodiversity have lead us individually and investigators to effi ciently collect and accurately identify collectively to observe molluscan communities over most of individuals from this family. Unfortunately, neither has been North America, ranging from central Quebec, Hudson’s Bay common.
    [Show full text]
  • Liste Rouge Mollusques (Gastéropodes Et Bivalves)
    2012 > L’environnement pratique > Listes rouges / Gestion des espèces > Liste rouge Mollusques (gastéropodes et bivalves) Espèces menacées en Suisse, état 2010 > L’environnement pratique > Listes rouges / Gestion des espèces > Liste rouge Mollusques (gastéropodes et bivalves) Espèces menacées en Suisse, état 2010 Publié par l’Office fédéral de l’environnement OFEV et par le Centre suisse de cartographie de la faune CSCF Berne, 2012 Valeur juridique de cette publication Impressum Liste rouge de l’OFEV au sens de l’art. 14, al. 3, de l’ordonnance Editeurs du 16 janvier 1991 sur la protection de la nature et du paysage Office fédéral de l’environnement (OFEV) (OPN; RS 451.1), www.admin.ch/ch/f/rs/45.html L’OFEV est un office du Département fédéral de l’environnement, des transports, de l’énergie et de la communication (DETEC). La présente publication est une aide à l’exécution de l’OFEV en tant Centre Suisse de Cartographie de la Faune (CSCF), Neuchâtel. qu’autorité de surveillance. Destinée en premier lieu aux autorités d’exécution, elle concrétise des notions juridiques indéterminées Auteurs provenant de lois et d’ordonnances et favorise ainsi une application Mollusques terrestres: Jörg Rüetschi, Peter Müller et François Claude uniforme de la législation. Elle aide les autorités d’exécution Mollusques aquatiques: Pascal Stucki et Heinrich Vicentini notamment à évaluer si un biotope doit être considéré comme digne avec la collaboration de Simon Capt et Yves Gonseth (CSCF) de protection (art. 14, al. 3, let. d, OPN). Accompagnement à l’OFEV Francis Cordillot, division Espèces, écosystèmes, paysages Référence bibliographique Rüetschi J., Stucki P., Müller P., Vicentini H., Claude F.
    [Show full text]
  • Ancient Climate As Inferred by Land Snails at the Brokenleg Bend Locality, Oklahoma
    LAND SNAILS 154 Ancient Climate as Inferred by Land Snails at the Brokenleg Bend Locality, Oklahoma Kathleen M. Snodgrass Faculty Sponsor: Dr. James Theler, Department of Sociology and Archaeology ABSTRACT This project is based on specifically identified terrestrial gastropod (land snail) shells recovered from a series of 12 sediment samples taken at the Brokenleg Bend Locality. Brokenleg Bend is a well-stratified, radiocarbon dated exposure located in Roger Mills County, Oklahoma. The 12 samples cover a temporal span from the Late Pleistocene (=Ice Age) into the Holocene (=Recent) Period. Changes in the relative abundance of individual gastropod species represented in the stratified sample series were used to infer that certain changes have taken place in that local environment and by extension the regional climate with (1) the maximum cold of the Late Pleistocene and (2) the shifts associated with the post-glacial Holocene. INTRODUCTION Certain environmental conditions, particularly temperature and precipitation, are factors which limit the geographic range of terrestrial gastropods. As animals that are limited by specific environmental paramenters certain gastropod species can be used as proxy indicators analogous to infer past environmental conditions and changes that have occurred in the climate/environment of an area over time. Gastropods can occur at a location due to a variety of reasons. They can be transported to a site by natural methods such as being airbourne, in the viscera of animals (Bobrowsky 1984:82 ; Klippel & Morey 1986:800), attached to the legs or feathers of birds, and as raparian drift (Bobrowsky 1984:81-82 ; Baerreis 1973:46). Gastropods deposited by raparian drift can simply be washed onto a site by themselves or attached to plant material such as logs and branches.
    [Show full text]
  • Ecological Groups of Snails – Use and Perspectives
    The subdivision of all central European Holocene and Late Glacial land snail species to ecological groups ecological Glacial Early Holocene Middle Holocene Late Holocene (sensu Walker at al 2012) modern immigrants comment group Acanthinula aculeata Acanthinula aculeata Acanthinula aculeata Acanthinula aculeata Acicula parcelineata Acicula parcelineata Aegopinella epipedostoma one sites Aegopinella nitens Aegopinella nitens Aegopinella nitidula Aegopinella nitidula few sites Aegopinella pura Aegopinella pura Aegopinella pura Aegopinella pura Aegopis verticillus Ecological groups of snails Argna bielzi Argna bielzi Bulgarica cana Bulgarica cana Carpathica calophana Carpathica calophana one site; undated Causa holosericea Causa holosericea Clausilia bidentata no fossil data Clausilia cruciata Clausilia cruciata Clausilia cruciata – use and perspectives Cochlodina laminata Cochlodina laminata Cochlodina laminata Cochlodina laminata Cochlodina orthostoma Cochlodina orthostoma Cochlodina orthostoma Cochlodina orthostoma Daudebardia brevipes Daudebardia brevipes Daudebardia rufa Daudebardia rufa Daudebardia rufa Daudebardia rufa Discus perspectivus Discus perspectivus Discus perspectivus 1 2 1 1 ) Lucie Juřičková , Michal Horsák , Jitka Horáčková and Vojen Ložek Discus ruderatus Discus ruderatus Discus ruderatus Discus ruderatus Ena montana Ena montana Ena montana Ena montana forest Eucobresia nivalis Eucobresia nivalis Eucobresia nivalis Faustina faustina Faustina faustina Faustina faustina Faustina faustina Faustina rossmaessleri Faustina
    [Show full text]
  • 293 – Les Noms Scientifiques Français Des Mollusques Continentaux De
    LES NOMS SCIENTIFIQUES FRANÇAIS DES MOLLUSQUES CONTINENTAUX DE FRANCE : processus d’ÉtABLISSEMENT d’une LISTE DE RÉFÉRENCE Benoît FONTAINE 1, Jean-Michel BICHAIN 2, Xavier CUCHERAT 3, Olivier GAR G OMINY 4 & Vincent PRIÉ 5 SUMMARY. — French scientific names of continental molluscs of France: process for establishing a list of reference. — In the biodiversity crisis context and with the increasing general awareness on this issue, conservation of small and poorly-known species is hampered by the fact they only have latine names. In order to communicate for biodiversity conservation, having French names is an advantage which is lacking in terrestrial and freshwater molluscs from France. To remedy this problem, we propose a list of French scientific names for this group, i.e. all species and subspecies known from France. We have listed existing names in legal documents, in usage and in the 18th and 19th centuries scientific literature. The resulting list being incomplete, we had to create new French names, following a series of recommendations adapted from similar works dealing with other taxonomic groups. We conclude by dealing with the issue of the legitimacy and validity of such names. The list of French scientific names is given as an appendix and is downloadable from internet. RÉSUMÉ. — Dans le contexte de la crise de la biodiversité et de la prise de conscience par le grand public des enjeux environnementaux, la conservation des espèces petites et méconnues est handicapée par le fait que ces espèces ne peuvent être désignées que par leur nom latin. Dans une optique de communication pour la préservation de la biodiversité, disposer de nom français est un atout qui fait défaut pour les mol- lusques terrestres et d’eau douce de France.
    [Show full text]
  • Diversity and Damage Assessment of Snail in Cultivated Crops of Neelabut Bagh Azad Jammu and Kashmir (Pakistan)
    Journal of Bioresource Management Volume 7 Issue 4 Article 11 Diversity and Damage Assessment of Snail in Cultivated Crops of Neelabut Bagh Azad Jammu and Kashmir (Pakistan) Abu ul hassan faiz Women University of Azad Jammu and Kashmir, Bagh, AJK, Pakistan, [email protected] Lariab Zahra Faiz Women University of Azad Jammu and Kashmir, Bagh, AJK, Pakistan Follow this and additional works at: https://corescholar.libraries.wright.edu/jbm Part of the Agricultural Economics Commons Recommended Citation faiz, A. h., & Faiz, L. Z. (2020). Diversity and Damage Assessment of Snail in Cultivated Crops of Neelabut Bagh Azad Jammu and Kashmir (Pakistan), Journal of Bioresource Management, 7 (4). DOI: 10.35691/JBM.0202.0157 ISSN: 2309-3854 online (Received: Nov 28, 2020; Accepted: Dec 15, 2020; Published: Dec 31, 2020) This Article is brought to you for free and open access by CORE Scholar. It has been accepted for inclusion in Journal of Bioresource Management by an authorized editor of CORE Scholar. For more information, please contact [email protected]. Diversity and Damage Assessment of Snail in Cultivated Crops of Neelabut Bagh Azad Jammu and Kashmir (Pakistan) © Copyrights of all the papers published in Journal of Bioresource Management are with its publisher, Center for Bioresource Research (CBR) Islamabad, Pakistan. This permits anyone to copy, redistribute, remix, transmit and adapt the work for non-commercial purposes provided the original work and source is appropriately cited. Journal of Bioresource Management does not grant you any other rights in relation to this website or the material on this website. In other words, all other rights are reserved.
    [Show full text]
  • European Glacial Relict Snails and Plants: Environmental Context of Their Modern Refugial Occurrence in Southern Siberia
    bs_bs_banner European glacial relict snails and plants: environmental context of their modern refugial occurrence in southern Siberia MICHAL HORSAK, MILAN CHYTRY, PETRA HAJKOV A, MICHAL HAJEK, JIRI DANIHELKA, VERONIKA HORSAKOV A, NIKOLAI ERMAKOV, DMITRY A. GERMAN, MARTIN KOCI, PAVEL LUSTYK, JEFFREY C. NEKOLA, ZDENKA PREISLEROVA AND MILAN VALACHOVIC Horsak, M., Chytry, M., Hajkov a, P., Hajek, M., Danihelka, J., Horsakov a,V.,Ermakov,N.,German,D.A.,Ko cı, M., Lustyk, P., Nekola, J. C., Preislerova, Z. & Valachovic, M. 2015 (October): European glacial relict snails and plants: environmental context of their modern refugial occurrence in southern Siberia. Boreas, Vol. 44, pp. 638–657. 10.1111/bor.12133. ISSN 0300-9483. Knowledge of present-day communities and ecosystems resembling those reconstructed from the fossil record can help improve our understanding of historical distribution patterns and species composition of past communities. Here, we use a unique data set of 570 plots explored for vascular plant and 315 for land-snail assemblages located along a 650-km-long transect running across a steep climatic gradient in the Russian Altai Mountains and their foothills in southern Siberia. We analysed climatic and habitat requirements of modern populations for eight land-snail and 16 vascular plant species that are considered characteristic of the full-glacial environment of central Europe based on (i) fossil evidence from loess deposits (snails) or (ii) refugial patterns of their modern distribu- tions (plants). The analysis yielded consistent predictions of the full-glacial central European climate derived from both snail and plant populations. We found that the distribution of these 24 species was limited to the areas with mean annual temperature varying from À6.7 to 3.4 °C (median À2.5 °C) and with total annual precipitation vary- ing from 137 to 593 mm (median 283 mm).
    [Show full text]
  • Radiocarbon Dating of Small Terrestrial Gastropod Shells in North America
    Quaternary Geochronology 5 (2010) 519–532 Contents lists available at ScienceDirect Quaternary Geochronology journal homepage: www.elsevier.com/locate/quageo Research Paper Radiocarbon dating of small terrestrial gastropod shells in North America Jeffrey S. Pigati a,*, Jason A. Rech b, Jeffrey C. Nekola c a U.S. Geological Survey, Denver Federal Center, Box 25046, MS-980, Denver CO 80225, USA b Department of Geology, Miami University, Oxford, OH 45056, USA c Department of Biology, University of New Mexico, Albuquerque, NM 87131, USA article info abstract Article history: Fossil shells of small terrestrial gastropods are commonly preserved in wetland, alluvial, loess, and glacial Received 26 May 2009 deposits, as well as in sediments at many archeological sites. These shells are composed largely of Received in revised form aragonite (CaCO3) and potentially could be used for radiocarbon dating, but they must meet two criteria 20 January 2010 before their 14C ages can be considered to be reliable: (1) when gastropods are alive, the 14C activity of Accepted 21 January 2010 their shells must be in equilibrium with the 14C activity of the atmosphere, and (2) after burial, their Available online 29 January 2010 shells must behave as closed systems with respect to carbon. To evaluate the first criterion, we conducted a comprehensive examination of the 14C content of the most common small terrestrial gastropods in Keywords: Radiocarbon North America, including 247 AMS measurements of modern shell material (3749 individual shells) from Land snails 46 different species. The modern gastropods that we analyzed were all collected from habitats on Limestone effect carbonate terrain and, therefore, the data presented here represent worst-case scenarios.
    [Show full text]
  • Rote Liste Weichtiere (Schnecken Und Muscheln)
    2012 > Umwelt-Vollzug > Rote Listen / Artenmanagement > Rote Liste Weichtiere (Schnecken und Muscheln) Gefährdete Arten der Schweiz, Stand 2010 > Umwelt-Vollzug > Rote Listen / Artenmanagement > Rote Liste Weichtiere (Schnecken und Muscheln) Gefährdete Arten der Schweiz, Stand 2010 Herausgegeben vom Bundesamt für Umwelt BAFU und vom Schweizer Zentrum für die Kartografie der Fauna SZKF/CSCF Bern, 2012 Rechtlicher Stellenwert dieser Publikation Impressum Rote Liste des BAFU im Sinne von Artikel 14 Absatz 3 der Verordnung Herausgeber vom 16. Januar 1991 über den Natur- und Heimatschutz (NHV; Bundesamt für Umwelt (BAFU) des Eidg. Departements für Umwelt, SR 451.1) www.admin.ch/ch/d/sr/45.html Verkehr, Energie und Kommunikation (UVEK), Bern. Schweizerisches Zentrum für die Kartografie der Fauna (SZKF/CSCF), Diese Publikation ist eine Vollzugshilfe des BAFU als Aufsichtsbehörde Neuenburg. und richtet sich primär an die Vollzugsbehörden. Sie konkretisiert unbestimmte Rechtsbegriffe von Gesetzen und Verordnungen und soll Autoren eine einheitliche Vollzugspraxis fördern. Sie dient den Vollzugs- Landschnecken: Jörg Rüetschi, Peter Müller und François Claude behörden insbesondere dazu, zu beurteilen, ob Biotope als schützens- Wassermollusken: Pascal Stucki und Heinrich Vicentini wert zu bezeichnen sind (Art. 14 Abs. 3 Bst. d NHV). in Zusammenarbeit mit Simon Capt und Yves Gonseth (CSCF) Begleitung BAFU Francis Cordillot, Abteilung Arten, Ökosysteme, Landschaften Zitierung Rüetschi J., Stucki P., Müller P., Vicentini H., Claude F. 2012: Rote Liste
    [Show full text]
  • The Malacostratigraphic Study of the Pleistocene Sediments Near Kislõd
    FOLIA HISTORICO-NATURALIA MUSEI MATRAENSIS 2016 40: 7–15 The malacostratigraphic study of the pleistocene sediments near Kislõd LEVENTE FÛKÖH Abstract: The malacological material excavated near Kislõd (Veszprém County, Hungary) in 1969 by E. Horváth the late paleobotanist of the Savaria Museum, Szombathely. The identified material became part of the Quartermalacological collection of the Mátra Museum. The revision activities that are presently in process have made it possible for this material, which was only presented briefly earlier (SZABÓ 1982), to be introduced in detail. On the basis of the fauna analysis we may attempt to set up a malacostratigraphic classification of the sediments and their faunas. Regarding the species composing the fauna, the Pleistocene classification is obvious. Introduction The site can be found to the south of Kislõd, Veszprém County, on the area of a pasture, which is bordered by the Vashámor Woods from the west (Fig. 1). In the southern front of the Torna Stream, Old Hill, built up from Neogene sediments, emerges with its steep river-walls. Just Fig. 1. The geographical position of the segment made in 1969 7 Fig. 2. Sediments revealed by a gully (site visit, 1964, photo by E. Horváth) Fig. 3. The profile in the gully, excavated in 1969 (photo by E. Horváth) 8 like the area of the pasture, the hill itself is eroded by deep gullies of different sizes. The Pleistocene layers, which had been settled on Miocene gravel bed, were revealed by these gullies (Figs 1, 2). The sediments of the site are approximately 60–70 metres above the Torna Stream level, which means they are about 350 metres above sea level.
    [Show full text]
  • BASTERIA, 123-143, Oxychilus
    BASTERIA, Vol. 61: 123-143, 1998 Oxychilus mortilleti (Pfeiffer, 1859): a redescription (Pulmonata, Zonitidae) G. Manganelli & F. Giusti Dipartimento di Biologia Evolutiva dell'Universita di Siena, Via P.A. Mattioli 4, 1-53100 Siena, Italy The taxonomic and nomenclatural of status Oxychilus mortilleti (Pfeiffer, 1859) is revised. O. mortilleti is a medium-sized Oxychilus species which canonly be distinguished from similar shelled, sympatric species [O. cellarius(Müller, 1774), O. draparnaudi(Beck, 1837), and O. adamii (Westerlund, 1886)], on the basis of the following anatomical characters: penis divided into proximal and distal constriction about three distal parts by (1), proximal penis times as long as penis (2), terminal, constricted part (‘bottle-neck’) of proximal penis long, slender, straight (occasionally slightly bent) (3), penis sheath covering almost entire distal penis (4). At present, O. mortilleti is only known from southern central Europe (Austria, Czech Republic and the Alps). In the Alps, confirmed records exist only for Ticino (Switzerland), Piedmont, Lombardy and Venetum (Italy). Key words: Gastropoda, Pulmonata, Zonitidae, Oxychilus mortilleti, redescription, taxonomy, nomenclature, Italy. INTRODUCTION Ten species of Oxychilus are reported from the Alps: O. adamii (Westerlund, 1886), O. alliarius (Miller, 1822), Oxychilus cellarius (Miiller, 1774), O. clarus (Held, 1838), O. depressus (Sterki, 1880), O. draparnaudi (Beck, 1837), O. glaber (Rossmassler, 1835), O. helveticus (Blum, 1881), O. mortilleti (Pfeiffer, 1859), and O. polygyra (Pollonera, 1885) (Riedel, 1980; Kerney et al., 1979, 1983; Falkner, 1990; Manganelli et al., 1995). Some of these species are well known because they have been redescribed recently: O. cellarius and O. draparnaudi by Giusti & Manganelli (1997), O. clarus by Giusti et al.
    [Show full text]