J Am Soc Nephrol 12: 949–954, 2001 Electroporation-Mediated Gene Transfer that Targets Glomeruli

MICHIKO TSUJIE, YOSHITAKA ISAKA, HIROYUKI NAKAMURA, ENYU IMAI, and MASATSUGU HORI Department of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, Suita, Osaka, Japan.

Abstract. Electroporation has been applied to introducing DNA Japan (HVJ) liposome method, a luciferase reporter gene, into several organs; however, gene expression was localized pActLuc, was transferred into glomeruli by either electropora- around the injected area. Examined was the efficiency of tion or the HVJ liposome method. On day 4, electroporation intrarenal injection of DNA followed by in vivo electropora- resulted in higher glomerular luciferase activity than did the tion, using FITC-labeled oligodeoxynucleotides (FITC-ODN) HVJ liposome method. We also observed that co-transfection and plasmid DNA expressing ␤-galactosidase or luciferase. of pcEBNA, an expression vector for Epstein-Barr virus nu- FITC-ODN or expression vectors were injected into the left clear antigen, and poriP-cLuc, oriP-harboring vector, resulted renal artery; thereafter, the left kidney was electroporated in an eightfold higher luciferase gene expression than simple between a pair of tweezer-type electrodes. FITC-ODN were poriP-cLuc. No histologic damages were seen in glomeruli or transferred into all glomeruli, and transfected cells were iden- tubular epithelial cells. In conclusion, gene transfer into renal tified as mesangial cells. Four d after transfection of the artery followed by electroporation was an effective and simple pCAGGS-LacZ gene, ␤-galactosidase expression was observed strategy for gene transfer that targets glomerular mesangial in 75% of glomeruli. To compare the transfection efficacy by cells. electroporation with that by the hemagglutinating virus of

Gene therapy is now moving from experimental studies to method has become a widely used technique for in vitro clinical applications. It has opened new possibilities not only transfection. Recently, gene transfer by electroporation in vivo for the therapy of inherited diseases but also for new treatments was demonstrated to be effective for introducing DNA into of acquired diseases (1). For gene therapy, the gene transfer mouse muscle (5), mouse skin (6), chick embryos (7), rat liver method is often one of the limiting steps. In the field of (8), and murine melanoma (9). The combination of local DNA nephrology, the glomerular mesangial cell is a central region of injection and in vivo electroporation resulted in highly efficient the inflammatory response in the initiation and progression of gene expression, but the gene expression was observed in the various glomerular diseases. Successful gene transfer tech- limited area, where the injected DNA was distributed. To apply niques that target glomerular mesangial cells can provide a this simple gene transfer technique to the treatment of various powerful and attractive tool for revealing the mechanism of glomerular diseases, we should introduce therapeutic genes glomerular diseases and may be applicable to a therapeutic diffusely into glomeruli. Therefore, we attempted to develop a intervention in renal diseases. To this end, we and others have glomerulus-targeting electroporation in vivo: DNA injection examined several approaches; however, the conventional lipo- via renal artery followed by application of electric fields. somes and viral vectors limit the use for transferring genes into Electroporation is free from oncogenicity, immunogenicity, glomeruli (2,3). Therefore, several modified approaches have and cytotoxicity of viral vectors. In addition, combined gene been developed. transfer may be achieved easily by electroporation with a One of the simple nonviral methods of introducing genes is mixture of two or more genes. To confirm this hypothesis, we using electric pulses. In 1982, Neumann et al. (4) demonstrated examined whether combined gene transfer with an Epstein- that in vitro electroporation of cells in the presence of plasmid Barr virus nuclear antigen-1 (EBNA-1) expression vector DNA resulted in DNA transfer and expression. Since then, this could enhance the transgene expression in an origin of latent viral DNA replication (oriP)-harboring plasmid vector. Materials and Methods Received May 19, 2000. Accepted October 19, 2000. Correspondence to Dr. Enyu Imai, Department of Internal Medicine and FITC-Labeled Oligodeoxynucleotides Therapeutics (A8), Osaka University Graduate School of Medicine, Suita The 15-base-long phosphorothioate oligodeoxynucleotides (ODN) 565-0871, Japan. Phone: 81-6-6879-3632; Fax: 81-6-6879-3639; E-mail: labeled with FITC (FITC-ODN) at the 5' end (5'-FITC-CGAGGGCG- [email protected] GCATGGG-3') were purchased from Bex (Tokyo, Japan). The ODN 1046-6673/1205-0949 were deprotected on the column, dried, resuspended in balanced salt Journal of the American Society of Nephrology solution (BSS; 140 mM NaCl, 5.4 mM KCl, 10 mM Tris-HCl [pH Copyright © 2001 by the American Society of Nephrology 7.6]), and quantified by spectrophotometer. 950 Journal of the American Society of Nephrology J Am Soc Nephrol 12: 949–954, 2001

Plasmid DNA liposome method (14,15). The glomeruli from pEBActLuc-transfected The CLaI-NarI fragment of p205 (10) (a kind gift from Dr. Bill rats were isolated by the sieving technique 4 d after transfection. The Sugden, University of Wisconsin, Madison, WI), which contains the transfection efficiency and the expression intensity of a luciferase oriP and triplet repeat (717 bp)-deleted EBNA-1 sequences, was gene in glomeruli were compared by using electroporation and the isolated and pEBc vector was constructed by cloning this fragment HVJ liposome method. into the BglII site of pcDNA3 (Invitrogen, San Diego, CA) by blunt- To examine the possibility of combined gene transfer, we intro- end ligation. It has already been reported that this truncated EBNA-1 duced 163 ␮gofporiP-cLuc gene with or without 121 ␮gofpcEBNA gave the most efficient replication of oriP-containing DNA (10). into glomeruli by electroporation. The glomerular luciferase activities Then, pEBAct was constructed by replacing the cytomegalovirus were analyzed 4 d after transfection. (CMV) promotor of pEBc with the chicken ␤-actin promotor derived from pAct-CAT (11). Luciferase gene was isolated from pGL2 pro- Electric Pulse Delivery and Electrodes motor vector (Promega, Madison, WI), and pEBActLuc was con- structed by cloning the luciferase gene at HindIII and BamHI sites of Electric pulses were delivered using an electric pulse generator pEBAct. pCAGGS-LacZ expression vector, in which ␤-galactosidase (Electro Square Porator T820M; BTX, San Diego, CA) connected to cDNA is driven by CMV enhancer and ␤-actin promoter, was kindly a switch box (MBX-4; BTX), and monitored using a graphic pulse provided by Dr. Jun-ichi Miyazaki (Osaka University Graduate analyzer (Optimizor 500; BTX). The shape of the pulse was a square School of Medicine, Osaka, Japan). pCMV-luciferase (pcLuc, 7.6 kb) wave, i.e., the voltage remained constant during the pulse duration. A was constructed by cloning the luciferase gene into pcDNA3 (Invitro- pair of tweezers were tipped with gold-plated stainless electrodes A ϫ gen, San Diego, CA) at the HindIII and BamHI sites. A truncated (oval shape adjusted against kidney; 15 mm 10 mm). Six pulses EBNA-1 sequence from p205 was cloned into the BamHI site of of the indicated voltage (25, 50, 75, or 100 V) were administered pcDNA3 to form pCMV-EBNA-1 (pcEBNA, 7.6 kb), and the oriP between the kidney at a rate of one pulse/s, with each pulse being 50 sequence was cloned into the BglII site of pcLuc to construct poriP- ms in duration. CMV-luciferase (poriP-cLuc, 10.2 kb). Immunofluorescence Microscopy Animals and In Vivo Transfection Via Renal Artery To identify the cells into which FITC-ODN were introduced, we stained the transfected kidneys with the monoclonal antibody OX-7, a To test the possibility of delivering a foreign gene into mesangial specific marker for rat mesangial cells (a kind gift from Dr. Ken-ichi cells by electroporation, we first tried to introduce FITC-ODN. Six- Isobe and Dr. Seichi Matsuo, Nagoya University, Nagoya, Japan). wk-old male Sprague-Dawley (SD) rats (Japan SLC, Inc., Cryostat sections (4-␮m slices) were incubated with OX-7, followed Hamamatsu, Japan), weighing approximately 150 g, were anesthe- by rhodamine-conjugated anti-mouse IgG (Chemicon International tized by intraperitoneal injection of pentobarbital (50 mg/kg) and Inc., Temecula, CA). Thus, transfected FITC-ODN and mesangial handled in a humane manner in accordance with the guidelines of the area were observed as green and red fluorescence, respectively. The Animal Committee of Osaka University. The left kidney and renal sections were also stained with an antibody to laminin, a specific artery were surgically exposed with a mid-line incision, and a 24- marker of basement membrane. The sections were incubated with a gauge catheter (Terumo, Tokyo, Japan) was inserted into the left renal rabbit polyclonal anti-laminin antibody (Monosan, Am Uden, The artery. After the proximal site of the abdominal aorta was clamped, Netherlands), followed by rhodamine-conjugated anti-rabbit IgG. The the left kidney was perfused with BSS via renal artery. We then green fluorescence of FITC and the red fluorescence of rhodamine infused FITC-ODN solution (50 ␮ ␮ gin500 l of BSS) into the left were taken by photomicrograph on the same film by double exposure. kidney via the catheter in a one-shot manner and clamped the renal vein immediately after injection. Thereafter, the left kidney was sandwiched between a pair of oval-shaped tweezer-type electrodes, X-Gal Staining and electric pulses were delivered (see below). After transfection, the The pCAGGS-LacZ–transfected rats were anesthetized by intra- catheter was removed and the puncture was fixed with Aronalfa peritoneal injection of pentobarbital and killed 4 d after transfection. (Toagosei Co. Ltd., Tokyo, Japan), and then the clamps were released. The glomeruli were isolated with the sieving technique and immersed FITC-ODN–transfected left kidneys or contralateral right kidneys in 1% glutaraldehyde in phosphate-buffered saline (PBS) for 1 h. The were removed 10 min after transfection, and 4-␮m-thick cryostat X-gal assay was performed as follows (13). Glomeruli were washed sections of unfixed snap-frozen specimens were examined by fluo- by PBS and then incubated at 37°C for4hinX-gal solution (PBS: 1 rescence microscopy (n ϭ 6). mg/ml X-gal, 5 mM K3Fe(CN)6,5mMK4Fe(CN)6, 2 mM MgCl2). To examine the efficiency of transgene expression in glomeruli, To stop the enzymatic reaction, we washed the glomeruli in water. 200 ␮gofpCAGGS-LacZ gene was transferred by electroporation as above. The pCAGGS-LacZ gene–transfected rats (n ϭ 4) were killed 4 d after transfection. The transfected left kidneys and contralateral PCR Analysis right kidneys were removed, and the glomeruli were isolated by the Using PCR analysis on isolated glomeruli, we examined further sieving technique. To avoid the effect of internal ␤-galactosidase whether the transfected pCAGGS-LacZ vector can exist in the glo- activity of tubular epithelial cells (12), we stained isolated glomeruli merulus 4 d after transfection. Glomerular DNA extracted from by X-gal staining (13). We extracted glomerular DNA from the pCAGGS-LacZ–transfected left kidneys or contralateral right kidneys remaining glomeruli to examine whether transfected pCAGGS-LacZ were subjected to PCR analysis using two primers specific for the vector can exist in the glomeruli. pCAGGS plasmid vector, GGAAAACCCTGGCGTTACCC and To compare the transfection efficiency of electroporation with that CGACCCAGCGCCCGTTGCAC, which yield 512-bp fragments. of the hemagglutinating virus of Japan (HVJ) liposome method, 200 The cycles were 94°C for 30 s, 55°C for 60 s, and 72°C for 60 s. After ␮g of luciferase expression plasmid DNA, pEBActLuc, was trans- 30 cycles, we analyzed the PCR product as well as pCAGGS-LacZ ferred into the left kidney by either electroporation or the HVJ plasmid vectors as positive control. J Am Soc Nephrol 12: 949–954, 2001 Electroporation-Mediated Gene Transfer 951

Luciferase Assay Results Glomerular luciferase activity was measured as reported by Wolff Gene Transfer into Mesangial Cells of Glomeruli et al. (16) with minor modification. Four d after transfection, four to To determine the possibility of transferring a foreign gene six rats were examined for glomerular luciferase activity. The trans- into glomeruli, we selectively infused FITC-ODN into the left fected left kidney was removed, and glomeruli were isolated by the kidney of normal rats via the renal artery and clamped the left graded sieving technique. Isolated glomeruli from luciferase gene– transfected kidney were homogenized in 50 ␮lof1ϫ cell lysis reagent renal vein immediately after infusion. Thereafter, the left kid- (Promega) and centrifuged. The supernatant of the lysate was exam- ney was electroporated between a pair of tweezer-type elec- ined for luciferase activity using Promega Luciferase Assay System trodes. Although the electrodes did not cover the overall sur- and a Lumat LB 9501 luminophotometer (EG&G Berthold, Wildbad, face of the kidney, FITC-ODN were present diffusely in all Germany). Glomerular luciferase activity of the transfected kidney glomeruli including the upper or lower pole in the transfected was corrected based on glomerular protein concentration, which was left kidneys (Figure 1A), whereas we observed no fluorescence determined by Bio-Rad protein assay system (Bio-Rad, Hercules, CA) in the contralateral right kidneys (Figure 1B). FITC-ODN were (17). The data were expressed by dividing corrected luciferase activity (luciferase/protein concentration) in glomeruli for each individual accumulated in the nuclei of the glomeruli (Figure 1A) and also transfected kidney. We repeated the experiments at least three times. were detected in some interstitial cells. Weak luminescence was observed in aggregation along the brush border membrane Statistical Analyses of tubular epithelial cells; however, FITC was not localized in All values are expressed as means Ϯ SEM. Statistical significance the nuclei (Figure 1C). Immunofluorescence staining with the (defined as P Ͻ 0.01) was evaluated using the one-way ANOVA. OX-7 antibody revealed that the FITC-ODN were accumulated

Figure 1. Representative fluorescence photomicrographs of FITC-labeled oligodeoxynucleotide (FITC-ODN)-transfected kidneys. FITC-ODN accumulated mainly in the nuclei of glomerular cells of the transfected left kidney. FITC-positive nuclei were also detected outside the tubular basement membrane stained by rhodamine-conjugated anti-laminin antibody (A). No fluorescence was observed in the contralateral right kidneys (B). Weak luminescence was observed in aggregation along the brush border membrane of tubular epithelial cells; however, FITC was not localized in the nuclei (C). To examine the cellular localization of the transfected ODN, we used OX-7, a specific monoclonal antibody for mesangial cells, and rhodamine-conjugated rabbit anti-mouse IgG to stain mesangial cells. FITC-positive nuclei (green) were seen mainly in the mesangial area (red) (D). The color of FITC-positive nuclei thus changed from green to yellow. Magnifications: ϫ100 in A and B; ϫ200 in C; ϫ400 in D. 952 Journal of the American Society of Nephrology J Am Soc Nephrol 12: 949–954, 2001 in the nuclei of mesangial area, where it is colored red in transfected pCAGGS-LacZ vector can exist in the glomerulus, Figure 1D. we analyzed glomerular DNA 4 d after pCAGGS-LacZ trans- fection. PCR analysis demonstrated that the pCAGGS vector Gene Expression in Glomeruli existed in transfected glomeruli but not in the glomeruli of the To examine the transgene expression by this gene transfer contralateral right kidneys (Figure 2C). method, we performed the X-gal staining on isolated glomeruli 4 d after pCAGGS-LacZ gene transfection. Four d after trans- Effect of Voltage on Transgene Expression fection, ␤-galactosidase expression was observed in 75% of To determine the optimal parameter of the electric field glomeruli (Figure 2A). No X-gal–positive glomeruli were ob- intensity, we perfused the left kidney with a luciferase reporter served in the normal rats (Figure 2B). To address whether the gene, pEBActLuc, and then the perfused kidney was electro- transferred with 25, 50, 75, and 100 electrode voltages. On day 4, luciferase activities were not significantly dependent on voltages 25 to 100 V (4.00 Ϯ 2.60 ϫ 105, 4.70 Ϯ 2.93 ϫ 105, 6.47 Ϯ 3.68 ϫ 105, and 8.71 Ϯ 7.58 ϫ 105 RLU/␮g glomer- ular protein at 25, 50, 75, and 100 V, respectively), although they tended to be increased in accordance with voltages (Figure 3A). We analyzed the relationship between glomerular lucif- erase activities and electric current on different voltages. How- ever, luciferase activities did not correlate significantly with electric current (luciferase activities versus electric current, r ϭ 0.10, P ϭ 0.23). On histologic examination, we observed little harmful effect on treated kidneys except small burns on the surface of the kidney in contact with electrodes. The burn injury became prominent at 100 V and less at 25 to 75 V. There was no histologic damage in glomeruli and tubular epithelial cells by electric pulses even at 100 V.

Transfection Efficacy To compare the transfection efficacy by electroporation with that by the HVJ liposome method, pEBActLuc was transferred into glomeruli by either electroporation with 75 V or the HVJ liposome method. On day 4, the electroporation-mediated gene transfer technique resulted in significantly higher glomerular luciferase activity than did the HVJ liposome method (6.47 Ϯ 3.68 ϫ 105 versus 1.18 Ϯ 0.24 ϫ 105 RLU/␮g glomerular protein, electroporation versus HVJ liposome method, P ϭ 0.02; Figure 3B).

Combination Gene Transfer To enhance the expression of transgene, poriP-cLuc, with or without pcEBNA, was introduced into glomeruli by electropo- ration. EBNA-1 has been reported to bind the oriP sequence and enhance gene expression (18). Combination gene transfer of poriP-cLuc with pcEBNA resulted in an eightfold higher level of glomerular luciferase activity than poriP-cLuc without pcEBNA (5.30 Ϯ 1.00 ϫ 105 versus 0.70 Ϯ 0.36 ϫ 105 RLU/␮g glomerular protein, respectively; P Ͻ 0.01; Figure 3C). Figure 2. ␤-galactosidase activity in glomeruli. The X-gal staining was performed on isolated glomeruli 4 d after pCAGGS-LacZ gene ␤ Discussion transfection. (A) -galactosidase expression was observed in 75% of In the present study, we first demonstrated that in vivo glomeruli. (B) No X-gal–positive glomeruli were observed in the electroporation provides an efficient approach for glomerulus- normal rats. (C) PCR analysis demonstrated that the pCAGGS vector existed in transfected glomeruli but not in the glomeruli of the untrans- targeted gene transfer. By using electroporation, we observed fected contralateral right kidneys. Lane 1, molecular weight marker; lanes FITC-ODN diffusely in all glomeruli. X-gal staining showed 2 through 5, glomerular DNA from pCAGGS-LacZ–transfected left that ␤-galactosidase expression was observed in 75% of glo- kidney; lanes 6 through 9, glomerular DNA from the untransfected right meruli. This broad distribution of gene transduction was dis- kidney; lane 10, positive control; lane 11, negative control. tinguished from the expression in the previous reports concern- J Am Soc Nephrol 12: 949–954, 2001 Electroporation-Mediated Gene Transfer 953

ing electroporation. Gene transfer and expression have been reported to occur only around the area where the needle- injected DNA was disseminated, as reported in muscle (5), liver (8), melanoma (9), and so forth. We assume that the key to our efficient gene transfer to glomeruli lies on the following two points: (1) DNA solution was distributed diffusely in the kidney by injection via renal artery, and (2) electric pulses could efficiently affect the DNA-injected kidney with the use of tweezer-type electrodes. In our experiments, we infused DNA into the renal artery and immediately clamped the renal vein until the application of electric fields so that renal blood vessels were filled with DNA solution. As the glomerular capillaries have abundant fenestra- tions, a large volume of DNA solution can also enter the mesangial area through these fenestrations. In addition, we used a pair of oval-shaped tweezer-type electrodes. Although these electrodes could not cover the overall surface of the kidney, FITC-ODN were accumulated in the nuclei of the glomeruli. Because the kidney is a well conductor of electric pulses, it seemed to be affected diffusely by electric fields. Goto et al. (19) reported that the electric field in the “larger” tumor mass created by needle-type electroporation and the needle-injected DNA solution would become more inhomoge- neous, leading to patchy expression of the transgene. We also examined the transfection efficiency with a pair of small round-shaped electrodes or needle-type electrodes; however, these electrodes resulted in less luciferase activity than the oval-shaped electrodes (data not shown). Compared with the previous reports, it is expected that the uniform electric field in the kidney created by the tweezer-type electrode and DNA injection via the renal artery would induce homogeneous ex- pression of the transgene. Therefore, a well-adjusted electrode that fits to the shape of the kidney seems to be ideal for in vivo electroporation. FITC-ODN filtrated by glomerular basement membrane were also detected in association with the brush border mem- brane, as previously reported (20,21). However, the lumines- cence observed at the brush border membrane was weak com- pared with that in glomeruli. In addition, FITC-ODN were localized in the nuclei of glomerular cells 10 min after trans- fection; however, we could not find the nuclear localization in tubular epithelial cells. As it was reported that intravenously injected ODN were not totally degenerated after being phago- cytosed by the proximal tubules (22), antisense ODN gathered along the brush border may have an effect in tubular cells. We, however, need to introduce ODN directly into the nuclei by Figure 3. Luciferase activity in glomeruli. (A) We transferred escaping from the cytoplasmic granules (endosome and lyso- pEBActLuc by electroporation with 25, 50, 75, or 100 V. Luciferase somes) (23), because the effects of antisense ODN normally activities were observed to be dependent on the voltages at 25 to 100 are dependent on RNase H-mediated degradation of the target V, although there were no significant differences. However, small RNA. Therefore, our observation that ODN were accumulated burns were observed at 100 V on the surface in contact with elec- in the nuclei of glomerular cells but not tubular epithelial cells trodes. (B) pEBActLuc was transferred into glomeruli by either elec- suggests that antisense ODN could have effects only in glo- troporation or the hemagglutinating virus of Japan (HVJ) liposome method. On day 4, electroporation resulted in higher glomerular merular cells. ␤ luciferase activity than did the HVJ liposome method; *, P Ͻ 0.05. Rols et al. (9) showed that a -galactosidase can be ex- (C) Combined gene transfer of poriP-cLuc with pcEBNA resulted in pressed in 4% of transfected cells by a direct needle injection an eightfold higher level of glomerular luciferase activity than poriP- of the plasmid followed by electroporation in the melanoma. In cLuc only; **, P Ͻ 0.01. the present study, the glomerular ␤-galactosidase or luciferase 954 Journal of the American Society of Nephrology J Am Soc Nephrol 12: 949–954, 2001 gene expression was observed in 75% of glomeruli, whereas 9. Rols MP, Delteil C, Golzio M, Dumond P, Cros S, Teissie J: In FITC-ODN were introduced into all glomeruli. Several expres- vivo electrically mediated protein and gene transfer in murine sion steps might reduce the number of X-gal–positive glomer- melanoma. Nat Biotechnol 16: 168–171, 1998 uli. We reported that the HVJ liposome-mediated gene transfer 10. Yates JL, Warren N, Sugden B: Stable replication of plasmids method allows us selective gene delivery into the glomeruli, derived from Epstein-Barr virus in various mammalian cells. Nature 313: 812–815, 1985 mainly mesangial cells, while its expression is limited to 35% 11. Fregien N, Davidson N: Activating elements in the promoter of glomeruli (14,15). Overall, in vivo electroporation with region of the chicken beta-actin gene. Gene 48: 1–11, 1986 intrarenal-arterial DNA injection was more effective than the 12. Kitamura M, Taylor S, Unwin R, Burton S, Shimizu F, Fine LG: HVJ liposome method. Gene transfer into the rat renal glomerulus via a mesangial cell Gene transfer by electroporation, which uses plasmid DNA vector: Site-specific delivery, in situ amplification, and sustained as the vector, has several advantages over the conventional expression of an exogenous gene in vivo. J Clin Invest 94: gene transfer method using viral vectors. In addition, prepara- 497–505, 1994 tion of a large quantity of highly purified plasmid DNA is easy 13. Lanford RE, White RG, Dunham RG, Kanda P: Effect of basic and inexpensive. Furthermore, we made a device to prolong the and nonbasic amino acid substitutions on transport induced by expression of transgene with an EBV replicon-based plasmid, simian virus 40 T-antigen synthetic peptide nuclear transport containing the latent viral DNA oriP and EBNA-1 (24).We signals. Mol Cell Biol 8: 2722–2729, 1988 14. Isaka Y, Fujiwara Y, Ueda N, Kaneda Y, Kamada T, Imai E: emphasize that combination gene therapy can be planned and Glomerulosclerosis induced by in vivo transfection of transform- performed easily and simply in the same manner as for single- ing growth factor-beta or platelet-derived growth factor gene into gene therapy, merely by mixing more than one therapeutic the rat kidney. J Clin Invest 92: 2597–2601, 1993 plasmid. Gene transfer can be repeated without apparent im- 15. Akagi Y, Isaka Y, Arai M, Kaneko T, Takenaka M, Moriyama T, munologic responses to the DNA vector. It is unlikely that Kaneda Y, Ando A, Orita Y, Kamada T, Ueda N, Imai E: recombination events occur with the cellular genome, elimi- Inhibition of TGF-beta 1 expression by antisense oligonucleo- nating the risk of the insertional mutagenesis possibly associ- tides suppressed extracellular matrix accumulation in experimen- ated with the use of viral vectors. The usefulness and safety tal glomerulonephritis. Kidney Int 50: 148–155, 1996 will have to be assessed for further application of in vivo 16. Wolff JA, Williams P, Acsadi G, Jiao S, Jani A, Chong W: electroporation to humans. The improvement to this method Conditions affecting direct gene transfer into rodent muscle in may provide a new approach to gene therapy for human dis- vivo. Biotechniques 11: 474–485, 1991 17. Schleicher E, Wieland OH: Evaluation of the Bradford method eases. In conclusion, we believe that we have demonstrated for protein determination in body fluids. J Clin Chem Clin that electroporation is highly efficient in transferring into glo- Biochem 16: 533–534, 1978 meruli and that it may present fewer obstacles for clinical 18. Sugden B, Warren N: A promoter of Epstein-Barr virus that can applications. function during latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection. J Virol 63: 2644–2649, 1989 References 19. Goto T, Nishi T, Tamura T, Dev SB, Takeshima H, Kochi M, 1. Crystal RG: Transfer of genes to humans: Early lessons and Yoshizato K, Kuratsu J, Sakata T, Hofmann GA, Ushio Y: obstacles to success. Science 270: 404–410, 1995 Highly efficient electro-gene therapy of solid tumor by using an 2. Imai E, Isaka Y: Strategies of gene transfer to the kidney. Kidney expression plasmid for the herpes simplex virus thymidine kinase Int 53: 264–272, 1998 gene. Proc Natl Acad Sci USA 97: 354–359, 2000 3. Fine LG: Gene transfer into the kidney: Promise for unravelling 20. Rappaport J, Hanss B, Kopp J, Copeland TD, Bruggeman LA, disease mechanisms, limitations for human gene therapy [Edito- Coffman TM, Klotman PE: Transport of phosphorothioate oli- rial]. Kidney Int 49: 612–619, 1996 gonucleotides in kidney: Implications for molecular therapy. 4. Neumann E, Schaefer-Ridder M, Wang Y, Hofschneider PH: Kidney Int 47: 1462–1469, 1995 Gene transfer into mouse lyoma cells by electroporation in high 21. Noiri E, Peresleni T, Miller F, Goligorsky MS: In vivo targeting electric fields. EMBO J 1: 841–845, 1982 of inducible NO synthase with oligodeoxynucleotides protects 5. Aihara H, Miyazaki J: Gene transfer into muscle by electropo- rat kidney against ischemia. J Clin Invest 97: 2377–2383, 1996 ration in vivo. Nat Biotechnol 16: 867–870, 1998 22. Oberbauer R, Schreiner G, Meyer T: Renal uptake of an 18-mer 6. Titomirov AV, Sukharev S, Kistanova E: In vivo electroporation phosphorothioate oligonucleotide. Kidney Int 48: 1226–1232, and stable transformation of skin cells of newborn mice by 1995 plasmid DNA. Biochim Biophys Acta 1088: 131–134, 1991 23. Wanger R: Gene inhibition using antisense oligodeoxynucleoti- 7. Muramatsu T, Shibata O, Ryoki S, Ohmori Y, Okumura J: des. Nature 372: 333–335, 1994 Foreign gene expression in the mouse testis by localized in vivo 24. Tsujie M, Isaka Y, Nakamura H, Akagi Y, Kaneda Y, Ueda gene transfer. Biochem Biophys Res Commun 233: 45–49, 1997 Naohiko, Imai Enyu, Hori M: Prolonged transgene expression in 8. Heller R, Jaroszeski M, Atkin A, Moradpour D, Gilbert R, glomeruli using an EB virus replicon vector system combined Wands J, Nicolau C: In vivo gene electroinjection and expression with AVE type HVJ liposomes. J Am Soc Nephrol 10: 449A, in rat liver. FEBS Lett 389: 225–228, 1996 1999