DOCSLIB.ORG

Transient Suppression of Transgene Expression by Means of Antisense Oligonucleotides: a Method for the Production of Toxin-Transducing Recombinant Viruses

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transient Suppression of Transgene Expression by Means of Antisense Oligonucleotides: a Method for the Production of Toxin-Transducing Recombinant Viruses Gene Therapy (2002) 9, 358–362 2002 Nature Publishing Group All rights reserved 0969-7128/02 $25.00 www.nature.com/gt BRIEF COMMUNICATION Transient suppression of transgene expression by means of antisense oligonucleotides: a method for the production of toxin-transducing recombinant viruses Z Raykov1, V Legrand2, HE Homann2 and J Rommelaere1 1Program of Applied Tumor Virology, Abt F0100 and INSERM U375, Deutsches Krebsforschungszentrum, Heidelberg, Germany; and 2Transgene SA, Strasbourg, France Some of the therapeutic genes to be delivered by means of nant adenoviruses in 293T cells was found to be fully sup- recombinant adenoviruses code for toxic compounds. pressed as a result of adding of the NS gene to the vector Expression of these sequences can be deleterious to the genome. Yet, the production of NS-harboring hybrid adeno- complementation cells used for vector production, making it viruses could be rescued by treating the producer cells with often difficult to generate high-titer stocks of toxin-transduc- antisense oligonucleotides specific for the translation ing recombinant adenoviruses. In this work, we present a initiation region of the NS transcript. This rescue correlated novel strategy for the transient post-transcriptional down- with a striking reduction of NS RNA and protein levels in the regulation of toxic transgene expression during the vector complementation cells. These data provide proof of principle production phase, through the administration of phos- of the suitability of the antisense oligonucleotides strategy phorothioate-modified antisense oligodeoxyribonucleotides. for overcoming the interference of harmful transgenes with This method was successfully applied to the production of the production of adenoviral and other vectors. hybrid adenoviruses that contain the gene encoding the Gene Therapy (2002) 9, 358–362. DOI: 10.1038/sj/gt/3301660 cytotoxic parvoviral protein NS1. The generation of recombi- Keywords: phosphorothioate (PS); antisense oligodeoxyribonucleotide; adenovirus vector; parvovirus H-1; toxic NS protein At present, a large number of recombinant viruses are We therefore tried to combine the advantages of both being assessed in cancer gene therapy protocols, includ- vectors in chimeric adenovirus vectors that carry the par- ing adenovirus and parvovirus-based vectors. Auton- voviral expression cassette and should be amenable to omous parvoviruses are small non-enveloped nuclear- the high titer production of recombinant adenoviruses. replicating viruses containing a single-stranded DNA The investigation, however, had to face a major difficulty, genome with palindromic hairpin ends.1 The prototype namely the complete suppression of recombinant adeno- parvovirus minute virus of mice (MVM) and the closely viruses production as a result of the presence of the par- related virus H-1, have been shown to preferentially rep- voviral NS gene. The present report shows that this prob- licate and exert cytopathic effects in various oncogene- lem can be overcome by transfecting the packaging cells transformed cells while sparing their non-transformed with antisense oligonucleotides targeting specific counterparts in vitro and in vivo.2 Hence, MVM and H-1 sequences of NS transcripts. virus-based vectors have been constructed for cancer To construct adeno-parvovirus chimeras, two gene therapy purposes, which retain in particular the sequences from the H-1 parvoviral genome were inserted oncogene-responsive parvoviral expression cassette, into a first generation adenovirus 5-based vector. Both including the gene coding for the multifunctional inserts direct expression of the LacZ transgene under the (replicative, transactivating and cytotoxic) nonstructural control of the strong cell-cycle and oncogene-inducible5 protein 1 (NS1).3 Parvoviral vectors proved to be parvoviral promoter P4, either directly (Figure 1a, pAd- endowed with the capacity of parental viruses for tar- P4-lacZ) or through the transactivation of the parvovirus geting transformed cells on the level of gene expression,4 P38 promoter by the parvoviral NS1 protein (Figure 1a, yet their use is limited by the relative inefficiency of the pAd-P4-NS-P38-lacZ). In the latter construct, the NS gene systems for vector production available to date. Aden- was included to endow the chimeric viruses with NS1- ovirus vectors, in contrast, lack the oncotropism of parvo- dependent capacity both for preferential toxicity and acti- virus vectors, but can be produced in very large amounts. vation of therapeutic transgene expression in tumor cells. After transfection of the Ad-P4-lacZ construct into 293 or 293T complementation cells, recombinant virus was obtained. In contrast, the Ad-P4-NS-P38-lacZ construct Correspondence: J Rommelaere, Deutsches Krebsforschungszentrum, ATV-Abt F0100/INSERM U375, Postfach 101949, D-69009 Heidel- failed to yield detectable amounts of recombinant adeno- berg, Germany viruses after transfection into either type of packaging Received 9 August 2001; accepted 21 December 2001 cells (see below). This lack of adenovirus production can Transgene expression by antisense oligonucleotides Z Raykov et al 359 Figure 1 Structure of hybrid vector genomes and PS oligos. (a) The nuclear LacZ reporter gene was cloned into the H-1 virus P4-NS-P38 cassette under control of the P4 (pTG 4614) or P38(pTG 9323) promoter. This cassette consists of a BSHII–AgeI DNA fragment from pSR196 in which the palindromes and most of the VP-encoding gene (HindIII–HpaI DNA fragment) were deleted. The expression cassettes P4-NS-P38-lacZ Figure 2 Antisense PS oligo-induced inhibition of NS1 expression. (a) and P4-lacZ were inserted into the delE1 region of the delE1delE3 first Western blotting analysis of NS1 expression in cells transfected with NS1 generation adenovirus vector pTG 8590 (pAd5F314insGS in Santis G et al7) expressing plasmids in the presence or absence of PS oligos. The plasmids to generate pTG 4632 and pTG 4217, respectively. (b) The targeting anti- used were pSR19 (an infectious H-1 virus DNA clone) and pAd-P4-NS- sense phosphorothioated oligonucleotides (PS1-PS4) are aligned beneath P38-lacZ (a chimeric adeno-parvovirus DNA clone). 1.8 × 106 293T cells the NS transcript translation initiation (AUG) region. The sequences of were cotransfected (calcium phosphate method) in 10-cm Petri dishes with the antisense PS oligos are given at the bottom, together with PS5 6 (lane 1–7) or 15 (lanes 8 and 9) ␮g of DNA clone and 6 ␮g of indicated (unrelated sequence) and PS3-sense used as controls. PS oligos were syn- PS (corresponding to molar ratios of 1:400 and 1:600, respectively). Cells thesized by MWG Biotech, Ebersberg, Germany. were lysed by freezing and thawing in phosphate-buffered saline at day 3 (lanes 1–7) or 7 (lanes 8 and 9) following transfection. 10 ␮g of total protein were fractionated by 8% SDS-polyacrylamide gel electrophoresis, in all probability be assigned to the vector-driven blotted on to nitrocellulose membranes and probed with the NS1-specific Sp7 rabbit antiserum, using horseradish peroxidase-coupled anti-rabbit expression of the parvoviral NS1 protein in the trans- goat antibodies. ß-actin was used as a standard to control the specificity fected cells. Indeed, it has been shown previously that of inhibition. (b) Effect of PS oligos on the NS1-mediated induction of the NS1 protein is cytotoxic and interferes with a number EGFP reporter gene expression. 293T cell cultures grown on spot slides of intracellular processes.3,8,9 (Neolab, Heidelberg, Germany) up to a density of 5 × 103 cells per 0.5- These observations led us to reason that production of cm field, were cotransfected with 30 ng of pP4-NS-P38-EGFP and 30 ng adeno-parvoviruses may be achieved by inhibiting tem- of indicated PS (corresponding to 1:400 molar ratio). NS1 production led to the transactivation of promoter P38 and EGFP expression, which was porarily NS1 expression in packaging cells. Antisense quantified by microscopic counting of fluorescent cells. (c) Steady-state strategies have been successfully applied to inhibit infec- levels of NS1 transcripts in PS-treated cells. 293T cell cultures were tions with various viruses, including parvovirus MVM.10 cotransfected (+) or not (Ϫ) with the NS1-expressing plasmid pSR19 and The state-of-the-art points to synthetic modified oligo- the specific (PS3) or non-specific (PS5) oligonucleotide, as described in deoxyribonucleotides as especially practical, stable and panel (a). Total RNA was extracted and 1-␮g samples were treated with efficient antisense effectors.11 This prompted us to deter- DNase I, reverse-transcribed into cDNA and analyzed by quantitative PCR, using primers specific for NS1 or ß-actin sequences. Amplified DNA mine whether this antisense technology could be applied fragments (320 and 500 bp long for NS1 and for ß-actin, respectively) to transiently protect producer cells from the effects of were visualized by ethidium bromide staining after electrophoresis in 2% a toxic gene (NS1) after transfection of the recombinant agarose gel. NS1 primers: 5’agaacatagctcctagtaatg 3’ (reverse) and 5’tcc adenoviral vector genome into packaging cells. To this aaa aag aac aca ctt gg 3’ (forward); ß-actin primers: 5’cacgtcacacttcatgatcc end several antisense phosphorothioate oligonucleotides 3’ (reverse) and 5’atgtttgagaccttcaacac 3’ (forward). (PS) were designed for targeting the translation initiation region of the NS transcript (Figure 1b). The phos- phorothioate modification (replacing one of the non- reduce NS1 expression when
Load more

Recommended publications
  • Gene Use Restriction Technologies for Transgenic Plant Bioconfinement
    Plant Biotechnology Journal (2013) 11, pp. 649–658 doi: 10.1111/pbi.12084 Review article Gene use restriction technologies for transgenic plant bioconfinement Yi Sang, Reginald J. Millwood and C. Neal Stewart Jr* Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 1 February 2013; Summary revised 3 April 2013; The advances of modern plant technologies, especially genetically modified crops, are considered accepted 9 April 2013. to be a substantial benefit to agriculture and society. However, so-called transgene escape *Correspondence (fax 1-865-974-6487; remains and is of environmental and regulatory concern. Genetic use restriction technologies email [email protected]) (GURTs) provide a possible solution to prevent transgene dispersal. Although GURTs were originally developed as a way for intellectual property protection (IPP), we believe their maximum benefit could be in the prevention of gene flow, that is, bioconfinement. This review describes the underlying signal transduction and components necessary to implement any GURT system. Keywords: transgenic plants, Furthermore, we review the similarities and differences between IPP- and bioconfinement- transgene escape, male sterility, oriented GURTs, discuss the GURTs’ design for impeding transgene escape and summarize embryo sterility, transgene deletion, recent advances. Lastly, we go beyond the state of the science to speculate on regulatory and gene flow. ecological effects of implementing GURTs for bioconfinement. Introduction proposed (Daniell, 2002; Gressel, 1999; Moon et al., 2011), including strategies for male sterility (Mariani et al., 1990), Transgenic crops have become an integral part of modern maternal inheritance (Daniell et al., 1998; Iamtham and Day, agriculture and have been increasingly adopted worldwide (James, 2000; Ruf et al., 2001), transgenic mitigation (Al-Ahmad et al., 2011).
    [Show full text]
  • Widespread Gene Transfection Into the Central Nervous System of Primates
    Gene Therapy (2000) 7, 759–763 2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt NONVIRAL TRANSFER TECHNOLOGY RESEARCH ARTICLE Widespread gene transfection into the central nervous system of primates Y Hagihara1, Y Saitoh1, Y Kaneda2, E Kohmura1 and T Yoshimine1 1Department of Neurosurgery and 2Division of Gene Therapy Science, Department of Molecular Therapeutics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan We attempted in vivo gene transfection into the central ner- The lacZ gene was highly expressed in the medial temporal vous system (CNS) of non-human primates using the hem- lobe, brainstem, Purkinje cells of cerebellar vermis and agglutinating virus of Japan (HVJ)-AVE liposome, a newly upper cervical cord (29.0 to 59.4% of neurons). Intrastriatal constructed anionic type liposome with a lipid composition injection of an HVJ-AVE liposome–lacZ complex made a similar to that of HIV envelopes and coated by the fusogenic focal transfection around the injection sites up to 15 mm. We envelope proteins of inactivated HVJ. HVJ-AVE liposomes conclude that the infusion of HVJ-AVE liposomes into the containing the lacZ gene were applied intrathecally through cerebrospinal fluid (CSF) space is applicable for widespread the cisterna magna of Japanese macaques. Widespread gene delivery into the CNS of large animals. Gene Therapy transgene expression was observed mainly in the neurons. (2000) 7, 759–763. Keywords: central nervous system; primates; gene therapy; HVJ liposome Introduction ever, its efficiency has not been satisfactory in vivo. Recently HVJ-AVE liposome, a new anionic-type lipo- Despite the promising results in experimental animals, some with the envelope that mimics the human immuno- gene therapy has, so far, not been successful in clinical deficiency virus (HIV), has been developed.13 Based upon 1 situations.
    [Show full text]
  • Recombinant DNA and Elements Utilizing Recombinant DNA Such As Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology
    Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written by Amy B. Vento and David R. Gillum Office of Environmental Health and Safety University of New Hampshire June 3, 2002 Introduction Recombinant DNA (rDNA) has various definitions, ranging from very simple to strangely complex. The following are three examples of how recombinant DNA is defined: 1. A DNA molecule containing DNA originating from two or more sources. 2. DNA that has been artificially created. It is DNA from two or more sources that is incorporated into a single recombinant molecule. 3. According to the NIH guidelines, recombinant DNA are molecules constructed outside of living cells by joining natural or synthetic DNA segments to DNA molecules that can replicate in a living cell, or molecules that result from their replication. Description of rDNA Recombinant DNA, also known as in vitro recombination, is a technique involved in creating and purifying desired genes. Molecular cloning (i.e. gene cloning) involves creating recombinant DNA and introducing it into a host cell to be replicated. One of the basic strategies of molecular cloning is to move desired genes from a large, complex genome to a small, simple one. The process of in vitro recombination makes it possible to cut different strands of DNA, in vitro (outside the cell), with a restriction enzyme and join the DNA molecules together via complementary base pairing. Techniques Some of the molecular biology techniques utilized during recombinant DNA include: 1.
    [Show full text]
  • REVIEW Gene Therapy
    Leukemia (2001) 15, 523–544 2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu REVIEW Gene therapy: principles and applications to hematopoietic cells VFI Van Tendeloo1,2, C Van Broeckhoven2 and ZN Berneman1 1Laboratory of Experimental Hematology, University of Antwerp (UIA), Antwerp University Hospital (UZA), Antwerp; and 2Laboratory of Molecular Genetics, University of Antwerp (UIA), Department of Molecular Genetics, Flanders Interuniversity Institute for Biotechnology (VIB), Antwerp, Belgium Ever since the development of technology allowing the transfer Recombinant viral vectors of new genes into eukaryotic cells, the hematopoietic system has been an obvious and desirable target for gene therapy. The last 10 years have witnessed an explosion of interest in this Biological gene transfer methods make use of modified DNA approach to treat human disease, both inherited and acquired, or RNA viruses to infect the cell, thereby introducing and with the initiation of multiple clinical protocols. All gene ther- expressing its genome which contains the gene of interest (= apy strategies have two essential technical requirements. ‘transduction’).1 The most commonly used viral vectors are These are: (1) the efficient introduction of the relevant genetic discussed below. In each case, recombinant viruses have had material into the target cell and (2) the expression of the trans- gene at therapeutic levels. Conceptual and technical hurdles the genes encoding essential replicative and/or packaging pro- involved with these requirements are still the objects of active teins replaced by the gene of interest. Advantages and disad- research. To date, the most widely used and best understood vantages of each recombinant viral vector are summarized in vectors for gene transfer in hematopoietic cells are derived Table 1.
    [Show full text]
  • Gene Therapy and Genetic Engineering: Frankenstein Is Still a Myth, but It Should Be Reread Periodically
    Indiana Law Journal Volume 48 Issue 4 Article 2 Summer 1973 Gene Therapy and Genetic Engineering: Frankenstein is Still a Myth, but it Should be Reread Periodically George A. Hudock Indiana University - Bloomington Follow this and additional works at: https://www.repository.law.indiana.edu/ilj Part of the Genetics and Genomics Commons Recommended Citation Hudock, George A. (1973) "Gene Therapy and Genetic Engineering: Frankenstein is Still a Myth, but it Should be Reread Periodically," Indiana Law Journal: Vol. 48 : Iss. 4 , Article 2. Available at: https://www.repository.law.indiana.edu/ilj/vol48/iss4/2 This Article is brought to you for free and open access by the Law School Journals at Digital Repository @ Maurer Law. It has been accepted for inclusion in Indiana Law Journal by an authorized editor of Digital Repository @ Maurer Law. For more information, please contact [email protected]. GENE THERAPY AND GENETIC ENGINEERING: FRANKENSTEIN IS STILL A MYTH, BUT IT SHOULD BE REREAD PERIODICALLY GEORGE A. HUDOCKt Biotechnology and the law are far removed from each other as disciplines of human intellect. Yet the law and my own discipline, genetics, have come together in many courtrooms concerning such matters as paternity, and they will continue to intersect with increasing frequency as the visions of 100 years ago become the reality of today. This article examines the implications of recent research for human genetic therapy and genetic engineering, and suggests some guidelines for legal regulation of genetic technology. The following discussion derives from three premises which I view as basic: (1) that which is currently possible in genetic engineering, and in fact has already been done, is generally underestimated; (2) what may be possible in the near future is quite commonly overesti- mated; (3) regulation of the application of genetic technology is possible and will not be overwhelmingly complicated.
    [Show full text]
  • Intramuscular Electroporation Delivery of IFN- Gene Therapy for Inhibition of Tumor Growth Located at a Distant Site
    Gene Therapy (2001) 8, 400–407 2001 Nature Publishing Group All rights reserved 0969-7128/01 $15.00 www.nature.com/gt RESEARCH ARTICLE Intramuscular electroporation delivery of IFN-␣ gene therapy for inhibition of tumor growth located at a distant site S Li, X Zhang, X Xia, L Zhou, R Breau, J Suen and E Hanna Department of Otolaryngology/Head and Neck Surgery, University of Arkansas School of Medicine, 4001 W Capital Avenue, Little Rock, AR 72205, USA Although electroporation has been shown in recent years to 2 or endostatin gene, also delivered by electro-injection. The be a powerful method for delivering genes to muscle, no increased therapeutic efficacy was associated with a high gene therapy via electro-injection has been studied for the level and extended duration of IFN-␣ expression in muscle treatment of tumors. In an immunocompetent tumor-bearing and serum. We also discovered that the high level of IFN-␣ murine model, we have found that delivery of a low dose of expression correlated with increased expression levels of reporter gene DNA (10 ␮g) to muscle via electroporation the antiangiogenic genes IP-10 and Mig in local tumor under specific pulse conditions (two 25-ms pulses of 375 tissue, which may have led to the reduction of blood vessels V/cm) increased the level of gene expression by two logs of observed at the local tumor site. Delivery of increasing doses magnitude. Moreover, administration of 10 ␮g of interferon (10–100 ␮g) of IFN-␣ plasmid DNA by injection alone did (IFN)-␣ DNA plasmid using these parameters once a week not increase antitumor activity, whereas electroporation for 3 weeks increased the survival time and reduced squam- delivery of increasing doses (10–40 ␮g) of IFN-␣ plasmid ous cell carcinoma (SCC) growth at a distant site in the DNA did increase the survival time.
    [Show full text]
  • HD-Guidance Document Gene Therapy/GMO Environmental Data
    HD-Guidance document Gene Therapy/GMO Environmental Data Guidance document for the compilation of the documentation on possible risks for humans and the environment in support of applications for the authorisation to carry out clinical trials of somatic gene therapy and with medicines containing genetically modified microorganisms (environmental data) In accordance with Articles 22, 35 and Annex 4 ClinO by Swiss Agency for Therapeutic Products (Swissmedic), Federal Office for Public Health (FOPH), Federal Office for the Environment (FOEN), Swiss Expert Committee for Biosafety (SECB) Contents 1 Summary .....................................................................................................................................2 2 Decision tree regarding the compilation of environmental data documentation ................... 3 3 Preliminary remarks / legal basis ..............................................................................................4 4 Definition of genetically modified microorganisms (GMOs) ....................................................5 5 Environmental data documentation ..........................................................................................5 5.1 General information ............................................................................................................................... 5 5.2 Determining and evaluating the risks for humans and the environment (risk assessment) ......... 6 5.2.1 Guidance for the risk assessment ...................................................................................................
    [Show full text]
  • Askbio Announces IND for LION-101, a Novel Investigational AAV Gene
    AskBio Announces IND for LION-101, a Novel Investigational AAV Gene Therapy for the Treatment of Limb-Girdle Muscular Dystrophy Type 2I/R9 (LGMD2I/R9), Cleared to Proceed by U.S. FDA -- LGMD2I/R9 is a Rare Form of Muscular Dystrophy with No Approved Therapies – -- First-in-Human Phase 1/2 Clinical Study Expected to Begin Dosing in 1H 2022 – Research Triangle Park, N.C. – May 25, 2021 – Asklepios BioPharmaceutical, Inc. (AskBio), a wholly owned and independently operated subsidiary of Bayer AG, announced that the U.S. Food & Drug Administration (FDA) has cleared its Investigational New Drug (IND) application for LION-101 to proceed in a Phase 1/2 clinical study. LION-101 is a novel recombinant adeno-associated virus (rAAV) based vector being developed as a one-time intravenous infusion for the treatment of patients with Limb-Girdle Muscular Dystrophy Type 2I/R9 (LGMD2I/R9). LION-101 will be evaluated in a first-in-human Phase 1/2 multicenter study to evaluate a single intravenous (IV) infusion in adult and adolescent subjects with genotypically confirmed LGMD2I/R9. AskBio plans to initiate dosing for the LION-101 Phase 1/2 clinical study in the first half of 2022. “In preclinical mouse models, LION-101 therapy demonstrated both dose-dependent efficacy and tolerability, providing a clear approach to study this novel AAV vector in first-in-human trials,” said Katherine High, MD, President, Therapeutics, AskBio. “Currently there are no approved therapies for LGMD2I/R9, and with limited treatment options that only address symptoms of the disease, the patient burden is profound.
    [Show full text]
  • Human Gene Therapy (Part 6 Of
    Background on Genetic Diseases 13 Background on genetic diseases Chromosomes and inheritance ual. The relative importance of genetic and envi- ronmental influences varies in both patients and Higher organisms package their DNA into seg- diseases. Some medical conditions, such as auto- ments called chromosomes. Each chromosome is mobile accidents or war wounds, may have large composed of one very long stretch of DNA that environmental and very small genetic contribu- is bound to various proteins and other molecules. tions. Most diseases have a mixture of genetic and There are two copies of each of 22 chromosomes environmental contributions (Harsanyi, 1981). In in the cells of a human. In addition, there are two several disorders, such as Huntington or Tay- sex chromosomes. Females have two ‘(X” chromo- Sachs diseases, the influence of a single gene is somes and males have one “X” and one “Y. ” In nor- so large that the disorders are called genetic mal human cells, therefore, there are 46 chromo- diseases. somes: 2 sex chromosomes and 2 copies of each of 22 other chromosomes (these non-sex chromo- somes are called autosomes). SINGLE GENE TRAITS, OR MENDELIAN TRAITS When traits or diseases are primarily deter- The 46 discrete aggregates of DNA and attached mined by a single gene, they obey the relatively protein that comprise the chromosomes are main- simple laws of inheritance first specified by tained inside the nucleus of somatic cells. In germ Gregor Mendel, a monk who lived in the last cen- cells, in contrast, a specialized phenomenon called tury and whose interests in agriculture led him meiosis takes place.
    [Show full text]
  • The Landscape of Non-Viral Gene Augmentation Strategies for Inherited Retinal Diseases
    International Journal of Molecular Sciences Review The Landscape of Non-Viral Gene Augmentation Strategies for Inherited Retinal Diseases Lyes Toualbi 1,2, Maria Toms 1,2 and Mariya Moosajee 1,2,3,4,* 1 UCL Institute of Ophthalmology, London EC1V 9EL, UK; [email protected] (L.T.); [email protected] (M.T.) 2 The Francis Crick Institute, London NW1 1AT, UK 3 Moorfields Eye Hospital NHS Foundation Trust, London EC1V 2PD, UK 4 Great Ormond Street Hospital for Children NHS Found Trust, London WC1N 3JH, UK * Correspondence: [email protected]; Tel.: +44-207-608-6971 Abstract: Inherited retinal diseases (IRDs) are a heterogeneous group of disorders causing progres- sive loss of vision, affecting approximately one in 1000 people worldwide. Gene augmentation therapy, which typically involves using adeno-associated viral vectors for delivery of healthy gene copies to affected tissues, has shown great promise as a strategy for the treatment of IRDs. How- ever, the use of viruses is associated with several limitations, including harmful immune responses, genome integration, and limited gene carrying capacity. Here, we review the advances in non-viral gene augmentation strategies, such as the use of plasmids with minimal bacterial backbones and scaffold/matrix attachment region (S/MAR) sequences, that have the capability to overcome these weaknesses by accommodating genes of any size and maintaining episomal transgene expression with a lower risk of eliciting an immune response. Low retinal transfection rates remain a limita- tion, but various strategies, including coupling the DNA with different types of chemical vehicles (nanoparticles) and the use of electrical methods such as iontophoresis and electrotransfection to aid Citation: Toualbi, L.; Toms, M.; Moosajee, M.
    [Show full text]
  • Bt Corn Produc
    STATE OF MAINE DEPARTMENT OF AGRICULTURE, CONSERVATION AND FORESTRY BOARD OF PESTICIDES CONTROL 28 STATE HOUSE STATION UGUSTA AINE PAUL R. LEPAGE A , M 04333 WALTER E. WHITCOMB GOVERNOR COMMISSIONER To: Board of Pesticides Control Members From: Mary Tomlinson, Pesticides Registrar/Water Quality Specialist RE: Bt Corn Products with Pending Maine Registration Status Date: July 19, 2017 ****************************************************************************** Monsanto Company and Dow AgroSciences LLC have requested registration of several new Bt corn products. The new active ingredient (unique identifier 87411-9) is a dsRNA transcript comprising a DvSnf7 inverted repeat sequence which matches that from the Western corn rootworm. dsRNA transcript comprising a DvSnf7 inverted repeat sequence derived from Diabrotica virgifera virgifera, and the genetic material necessary for its production (vector PV-ZMIR10871) in MON 87411 corn (OECD Unique Identifier MON-87411-9)………………………..≤ 0.00000044%* MON 87411 also contains CP4 EPSPS protein (5-enolpyruvylshikimate-3-phosphate synthase) and the genetic material (vector PV-ZMIR10871) necessary for its production in corn event MON 87411…...≤ 0.036%*. The EPSPS protein confers tolerance to glyphosate. Products designed for the propagation of commercial seed have no spatial refuge which is typical of these types of products. SmartStax PRO Enlist requires a 5% non-Bt corn refuge, unless used for seed propagation, and SmartStax PRO Enlist Refuge Advanced contains a 5% interspersed refuge. The 2015 EPA Registration Decision (RED) and USDA Draft Environmental Assessment for Mon 87411 are attached for your review. The question posed to the Board is, are these products substantially different from currently registered Bt corn products? If so, what further review is recommended? The labels for the products under consideration are attached for your review.
    [Show full text]
  • Transgenic Animals
    IQP-43-DSA-4208 IQP-43-DSA-6270 TRANSGENIC ANIMALS An Interactive Qualifying Project Report Submitted to the Faculty of WORCESTER POLYTECHNIC INSTITUTE In partial fulfillment of the requirements for the Degree of Bachelor of Science By: _________________________ _________________________ William Caproni Erik Dahlinghaus August 24, 2012 APPROVED: _________________________ Prof. David S. Adams, PhD WPI Project Advisor ABSTRACT A transgenic animal contains genes not native to its species. The use of these animals in research and medicine has dramatically increased our understanding of genetics and disease modeling. This IQP aims to provide an overview of the technical development and applications of transgenic animals, as well as the ethical, legal, and societal ramifications of creating these animals. Finally, this IQP will draw conclusions from the research performed and the information gathered. 2 TABLE OF CONTENTS Signature Page …………………………………………..…………………………….. 1 Abstract …………………………………………………..……………………………. 2 Table of Contents ………………………………………..…………………………….. 3 Project Objective ……………………………………….....…………………………… 4 Chapter-1: Transgenic Animal Technology …….……….…………………………… 5 Chapter-2: Applications of Transgenics in Animals …………..…………………….. 19 Chapter-3: Transgenic Ethics ………………………………………………………... 32 Chapter-4: Transgenic Legalities ……………………..………………………………. 43 Project Conclusions...…………………………………..….…………………………… 53 3 PROJECT OBJECTIVES The objective of this project was to research and present a multifaceted view of transgenics, including the technology itself and its effects on mankind. Chapter one offers an overview of the different methods for creating and testing transgenic animals. Chapter two provides information on how the different types of transgenic animals are used, and how they affect our daily lives. Chapter three presents the many ethical issues surrounding this controversial technology, and its impact on society. Chapter four describes the legal issues regarding this emerging technology and the patenting of life.
    [Show full text]