The Lung-Specific Proteome Defined by Integration of Transcriptomics And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
Age-Driven Developmental Drift in the Pathogenesis of Idiopathic Pulmonary Fibrosis
BACK TO BASICS INTERSTITIAL LUNG DISEASES | Age-driven developmental drift in the pathogenesis of idiopathic pulmonary fibrosis Moisés Selman1, Carlos López-Otín2 and Annie Pardo3 Affiliations: 1Instituto Nacional de Enfermedades Respiratorias Ismael Cosío Villegas, Mexico city, Mexico. 2Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Instituto Universitario de Oncología, Universidad de Oviedo, Oviedo, Spain. 3Facultad de Ciencias, Universidad Nacional Autónoma de México, Mexico city, Mexico. Correspondence: Moisés Selman, Instituto Nacional de Enfermedades Respiratorias, Tlalpan 4502, CP 14080, México DF, México. E-mail: [email protected] ABSTRACT Idiopathic pulmonary fibrosis (IPF) is a progressive and usually lethal disease of unknown aetiology. A growing body of evidence supports that IPF represents an epithelial-driven process characterised by aberrant epithelial cell behaviour, fibroblast/myofibroblast activation and excessive accumulation of extracellular matrix with the subsequent destruction of the lung architecture. The mechanisms involved in the abnormal hyper-activation of the epithelium are unclear, but we propose that recapitulation of pathways and processes critical to embryological development associated with a tissue specific age-related stochastic epigenetic drift may be implicated. These pathways may also contribute to the distinctive behaviour of IPF fibroblasts. Genomic and epigenomic studies have revealed that wingless/ Int, sonic hedgehog and other developmental signalling pathways are reactivated and deregulated in IPF. Moreover, some of these pathways cross-talk with transforming growth factor-β activating a profibrotic feedback loop. The expression pattern of microRNAs is also dysregulated in IPF and exhibits a similar expression profile to embryonic lungs. In addition, senescence, a process usually associated with ageing, which occurs early in alveolar epithelial cells of IPF lungs, likely represents a conserved programmed developmental mechanism. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Quantigene Flowrna Probe Sets Currently Available
QuantiGene FlowRNA Probe Sets Currently Available Accession No. Species Symbol Gene Name Catalog No. NM_003452 Human ZNF189 zinc finger protein 189 VA1-10009 NM_000057 Human BLM Bloom syndrome VA1-10010 NM_005269 Human GLI glioma-associated oncogene homolog (zinc finger protein) VA1-10011 NM_002614 Human PDZK1 PDZ domain containing 1 VA1-10015 NM_003225 Human TFF1 Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) VA1-10016 NM_002276 Human KRT19 keratin 19 VA1-10022 NM_002659 Human PLAUR plasminogen activator, urokinase receptor VA1-10025 NM_017669 Human ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like VA1-10029 NM_017699 Human SIDT1 SID1 transmembrane family, member 1 VA1-10032 NM_000077 Human CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) VA1-10040 NM_003150 Human STAT3 signal transducer and activator of transcripton 3 (acute-phase response factor) VA1-10046 NM_004707 Human ATG12 ATG12 autophagy related 12 homolog (S. cerevisiae) VA1-10047 NM_000737 Human CGB chorionic gonadotropin, beta polypeptide VA1-10048 NM_001017420 Human ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) VA1-10050 NM_197978 Human HEMGN hemogen VA1-10051 NM_001738 Human CA1 Carbonic anhydrase I VA1-10052 NM_000184 Human HBG2 Hemoglobin, gamma G VA1-10053 NM_005330 Human HBE1 Hemoglobin, epsilon 1 VA1-10054 NR_003367 Human PVT1 Pvt1 oncogene homolog (mouse) VA1-10061 NM_000454 Human SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) -
140503 IPF Signatures Supplement Withfigs Thorax
Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network. -
Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7, -
Transcriptomic Profiles of High and Low Antibody Responders to Smallpox
Genes and Immunity (2013) 14, 277–285 & 2013 Macmillan Publishers Limited All rights reserved 1466-4879/13 www.nature.com/gene ORIGINAL ARTICLE Transcriptomic profiles of high and low antibody responders to smallpox vaccine RB Kennedy1,2, AL Oberg1,3, IG Ovsyannikova1,2, IH Haralambieva1,2, D Grill1,3 and GA Poland1,2 Despite its eradication over 30 years ago, smallpox (as well as other orthopox viruses) remains a pathogen of interest both in terms of biodefense and for its use as a vector for vaccines and immunotherapies. Here we describe the application of mRNA-Seq transcriptome profiling to understanding immune responses in smallpox vaccine recipients. Contrary to other studies examining gene expression in virally infected cell lines, we utilized a mixed population of peripheral blood mononuclear cells in order to capture the essential intercellular interactions that occur in vivo, and would otherwise be lost, using single cell lines or isolated primary cell subsets. In this mixed cell population we were able to detect expression of all annotated vaccinia genes. On the host side, a number of genes encoding cytokines, chemokines, complement factors and intracellular signaling molecules were downregulated upon viral infection, whereas genes encoding histone proteins and the interferon response were upregulated. We also identified a small number of genes that exhibited significantly different expression profiles in subjects with robust humoral immunity compared with those with weaker humoral responses. Our results provide evidence that differential gene regulation patterns may be at work in individuals with robust humoral immunity compared with those with weaker humoral immune responses. Genes and Immunity (2013) 14, 277–285; doi:10.1038/gene.2013.14; published online 18 April 2013 Keywords: Next-generation sequencing; mRNA-Seq; vaccinia virus; smallpox vaccine INTRODUCTION these 44 subjects had two samples (uninfected and vaccinia Vaccinia virus (VACV) is the immunologically cross-protective infected). -
Whole-Exome Sequencing of Metastatic Cancer and Biomarkers of Treatment Response
Supplementary Online Content Beltran H, Eng K, Mosquera JM, et al. Whole-exome sequencing of metastatic cancer and biomarkers of treatment response. JAMA Oncol. Published online May 28, 2015. doi:10.1001/jamaoncol.2015.1313 eMethods eFigure 1. A schematic of the IPM Computational Pipeline eFigure 2. Tumor purity analysis eFigure 3. Tumor purity estimates from Pathology team versus computationally (CLONET) estimated tumor purities values for frozen tumor specimens (Spearman correlation 0.2765327, p- value = 0.03561) eFigure 4. Sequencing metrics Fresh/frozen vs. FFPE tissue eFigure 5. Somatic copy number alteration profiles by tumor type at cytogenetic map location resolution; for each cytogenetic map location the mean genes aberration frequency is reported eFigure 6. The 20 most frequently aberrant genes with respect to copy number gains/losses detected per tumor type eFigure 7. Top 50 genes with focal and large scale copy number gains (A) and losses (B) across the cohort eFigure 8. Summary of total number of copy number alterations across PM tumors eFigure 9. An example of tumor evolution looking at serial biopsies from PM222, a patient with metastatic bladder carcinoma eFigure 10. PM12 somatic mutations by coverage and allele frequency (A) and (B) mutation correlation between primary (y- axis) and brain metastasis (x-axis) eFigure 11. Point mutations across 5 metastatic sites of a 55 year old patient with metastatic prostate cancer at time of rapid autopsy eFigure 12. CT scans from patient PM137, a patient with recurrent platinum refractory metastatic urothelial carcinoma eFigure 13. Tracking tumor genomics between primary and metastatic samples from patient PM12 eFigure 14. -
Like Transmembrane Γ Evolved From
Mast Cell α and β Tryptases Changed Rapidly during Primate Speciation and Evolved from γ-Like Transmembrane Peptidases in Ancestral Vertebrates This information is current as of September 25, 2021. Neil N. Trivedi, Qiao Tong, Kavita Raman, Vikash J. Bhagwandin and George H. Caughey J Immunol 2007; 179:6072-6079; ; doi: 10.4049/jimmunol.179.9.6072 http://www.jimmunol.org/content/179/9/6072 Downloaded from References This article cites 34 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/179/9/6072.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Mast Cell ␣ and  Tryptases Changed Rapidly during Primate Speciation and Evolved from ␥-Like Transmembrane Peptidases in Ancestral Vertebrates1 Neil N. Trivedi, Qiao Tong, Kavita Raman, Vikash J. Bhagwandin, and George H. -
Downloaded 18 July 2014 with a 1% False Discovery Rate (FDR)
UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer Permalink https://escholarship.org/uc/item/0t47b9ws Author Spiciarich, David Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Professor Matthew B. Francis Professor Amy E. Herr Fall 2017 Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer © 2017 by David Spiciarich Abstract Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich Doctor of Philosophy in Chemistry University of California, Berkeley Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Changes in glycosylation have long been appreciated to be part of the cancer phenotype; sialylated glycans are found at elevated levels on many types of cancer and have been implicated in disease progression. However, the specific glycoproteins that contribute to cell surface sialylation are not well characterized, specifically in bona fide human cancer. Metabolic and bioorthogonal labeling methods have previously enabled enrichment and identification of sialoglycoproteins from cultured cells and model organisms. The goal of this work was to develop technologies that can be used for detecting changes in glycoproteins in clinical models of human cancer. -
Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades. -
Supplementary Table 1: Differentially Methylated Genes and Functions of the Genes Before/After Treatment with A) Doxorubicin and B) FUMI and in C) Responders Vs
Supplementary Table 1: Differentially methylated genes and functions of the genes before/after treatment with a) doxorubicin and b) FUMI and in c) responders vs. non- responders for doxorubicin and d) FUMI Differentially methylated genes before/after treatment a. Doxo GENE FUNCTION CCL5, CCL8, CCL15, CCL21, CCR1, CD33, IL5, immunoregulatory and inflammatory processes IL8, IL24, IL26, TNFSF11 CCNA1, CCND2, CDKN2A cell cycle regulators ESR1, FGF2, FGF14, FGF18 growth factors WT1, RASSF5, RASSF6 tumor suppressor b. FUMI GENE FUNCTION CCL7, CCL15, CD28, CD33, CD40, CD69, TNFSF18 immunoregulatory and inflammatory processes CCND2, CDKN2A cell cycle regulators IGF2BP1, IGFBP3 growth factors HOXB4, HOXB6, HOXC8 regulation of cell transcription WT1, RASSF6 tumor suppressor Differentially methylated genes in responders vs. non-responders c. Doxo GENE FUNCTION CBR1, CCL4, CCL8, CCR1, CCR7, CD1A, CD1B, immunoregulatory and inflammatory processes CD1D, CD1E, CD33, CD40, IL5, IL8, IL20, IL22, TLR4 CCNA1, CCND2, CDKN2A cell cycle regulators ESR2, ERBB3, FGF11, FGF12, FGF14, FGF17 growth factors WNT4, WNT16, WNT10A implicated in oncogenesis TNFSF12, TNFSF15 apoptosis FOXL1, FOXL2, FOSL1,HOXA2, HOXA7, HOXA11, HOXA13, HOXB4, HOXB6, HOXB8, HOXB9, HOXC8, regulation of cell transcription HOXD8, HOXD9, HOXD11 GSTP1, MGMT DNA repair APC, WT1 tumor suppressor d. FUMI GENE FUNCTION CCL1, CCL3, CCL5,CCL14, CD1B, CD33, CD40, CD69, immunoregulatory and inflammatory IL20, IL32 processes CCNA1, CCND2, CDKN2A cell cycle regulators IGF2BP1, IGFBP3, IGFBP7, EGFR, ESR2,RARB2