Inhibition of Autotaxin with GLPG1690 Increases the Efficacy of Radiotherapy and Chemotherapy in a Mouse Model of Breast Cancer

Published OnlineFirst September 23, 2019; DOI: 10.1158/1535-7163.MCT-19-0386

MOLECULAR CANCER THERAPEUTICS | SMALL MOLECULE THERAPEUTICS

Inhibition of Autotaxin with GLPG1690 Increases the Efﬁcacy of Radiotherapy and Chemotherapy in a Mouse Model of Breast Cancer Xiaoyun Tang1,2, Melinda Wuest2,3, Matthew G.K. Benesch1,2,4, Jennifer Dufour3, YuanYuan Zhao5, Jonathan M. Curtis5, Alain Monjardet6, Bertrand Heckmann6, David Murray2,7, Frank Wuest2,3, and David N. Brindley1,2

ABSTRACT ◥ Autotaxin catalyzes the formation of lysophosphatidic acid, However, GLPG1690 decreased the uptake of 30-deoxy-30-[18F]- whichstimulatestumorgrowthandmetastasisanddecreasesthe fluorothymidinebytumorsandthepercentageofKi67-positive effectiveness of cancer therapies. In breast cancer, autotaxin is cells. This was also associated with increased cleaved caspase-3 secreted mainly by breast adipocytes, especially when stimulated and decreased Bcl-2 levels in these tumors. GLPG1690 decreased by inflammatory cytokines produced by tumors. In this work, we irradiation-induced C-C motif chemokine ligand-11 in tumors studied the effects of an ATX inhibitor, GLPG1690, which is in and levels of IL9, IL12p40, macrophage colony-stimulating phase III clinical trials for idiopathic pulmonary fibrosis, on factor, and IFNg in adipose tissue adjacent to the tumor. In responses to radiotherapy and chemotherapy in a syngeneic other experiments, mice were treated with doxorubicin every orthotopic mouse model of breast cancer. Tumors were treated 2 days after the tumors developed. GLPG1690 acted synergisti- with fractionated external beam irradiation, which was opti- cally with doxorubicin to decrease tumor growth and the per- mizedtodecreasetumorweightby approximately 80%. Mice centage of Ki67-positive cells. GLPG1690 also increased were also dosed twice daily with GLPG1690 or vehicle beginning 4-hydroxynonenal-protein adducts in these tumors. These at 1 day before the radiation until 4 days after radiation was results indicate that inhibiting ATX provides a promising adju- completed. GLPG1690 combined with irradiation did not vant to improve the outcomes of radiotherapy and chemotherapy decrease tumor growth further compared with radiation alone. for breast cancer.

Introduction lipid in human plasma (>200 mmol/L; ref. 3). LPA is a lipid growth factor, which signals through six G protein–coupled receptors. LPA Radiotherapy (RT), chemotherapy, and surgery account for most of promotes cell proliferation, survival, migration, and angiogenesis, and the first-line options for treating different stages of breast cancer. This generates inflammation (4, 5). The effects constitute the hallmarks of is done either alone or in combination with endocrine and/or targeted cancer progression (6, 7). therapy, depending on the characteristics of the tumor (1). However, ATX is secreted directly by melanoma, glioblastoma, and thyroid some tumors develop resistance and become refractory to RT and cancer cells (8, 9). However, breast cancer cells express very little chemotherapy. A critical barrier in dealing with this situation is the ATX (9, 10). The adjacent adipose tissue produces the major part of lack of drugs that reverse this resistance or block the survival signals ATX in human and mouse 4T1 breast tumors, which acts on the tumor from the tumor microenvironment (2). microenvironment in a paracrine manner to increase the levels of Autotaxin (ATX) is a secreted lysophospholipase D–like enzyme proinflammatory cytokines (11, 12). Inflammatory cytokines pro- that generates most of the extracellular lysophosphatidic acid (LPA) duced by tumors increase ATX secretion by breast adipocytes further from lysophosphatidylcholine (LPC), the most abundant phospho- and thus establish a vicious loop of inflammation-driven ATX production because the subsequent LPA stimulates the production of fl 1Department of Biochemistry, University of Alberta, Edmonton, Alberta, Canada. more in ammatory cytokines (13, 14). 2Cancer Research Institute of Northern Alberta, University of Alberta, Edmonton, Increasing evidence has identified enhanced ATX-LPA signaling as Alberta, Canada. 3Division of Oncologic Imaging, Department of Oncology, a major promoter of therapy resistance in cancers (15–17). ENPP2 University of Alberta, Edmonton, Alberta, Canada. 4Discipline of Surgery, (ATX) is the second most upregulated gene in breast cancer stem cells Faculty of Medicine, Memorial University of Newfoundland, St. John's, New- that are resistant to chemotherapy (18). We showed that LPA 5 foundland and Labrador, Canada. Department of Agricultural, Food and Nutri- decreases the cytotoxic effects of taxanes (19), tamoxifen (20), and tional Science, University of Alberta, Edmonton, Alberta, Canada. 6Galapagos RMV, Parc Biocitech, Romainville, France. 7Division of Experimental Oncology, doxorubicin (21) on breast cancer cells. This LPA effect depends on the Department of Oncology, University of Alberta, Edmonton, Alberta, Canada. upregulation of antioxidant proteins and multidrug resistance transporters (21), which protects cancer cells by decreasing oxidative Note: Supplementary data for this article are available at Molecular Cancer Therapeutics Online (http://mct.aacrjournals.org/). damage and by exporting chemotherapeutic drugs and toxic oxidation products (22). About 60% of breast cancer patients receive lumpec- Corresponding Author: David N. Brindley, University of Alberta, 357 Heritage – Medical Research Centre, Edmonton, Alberta T6G 2S2, Canada. Phone: 780-492- tomy followed by RT to the affected breast. The post RT-induced 2078; Fax: 780-492-3383; E-mail: [email protected] cytokine surge (23) produces fatigue in patients (24). We showed that the expressions of ATX, LPA , and LPA receptors, cyclooxygenase-2, Mol Cancer Ther 2020;XX:XX–XX 1 2 and multiple inflammatory cytokines are increased after irradiation of doi: 10.1158/1535-7163.MCT-19-0386 human breast adipose tissue (25). Ionizing radiation also induced ATX 2019 American Association for Cancer Research. and LPA2 receptor expression in rat small intestine epithelial cells (26),

AACRJournals.org | OF1

Tang et al.

which attenuated radiation-induced apoptosis by the subsequent rather than a supersaturating concentration of 4 mmol/L. This was activation of LPA signaling (27). Thus, the enhanced ATX-LPA– because the supraphysiologic concentrations of LPC would displace inflammatory cycle within the tumor microenvironment provides a GLPG1690 bound in vivo from ATX and artificially decrease the supportive mechanism for cancer cell survival against RT or chemo- estimated extent of inhibition. Briefly, 17 mL of plasma or 17 mLof therapy (3, 28, 29). This inflammatory cycle can be broken by buffer A (100 mmol/L Tris-HCl, pH 9.0; 500 mmol/L NaCl; 5 mmol/L inhibiting ATX (13). MgCl2; and 0.05% v/v Triton X-100) with 20% DMSO or 20% ATX inhibitors were developed over the last decade, and some DMSO containing 8 mmol/L GLPG1690 were mixed with 8 mLof have been studied for treating inflammatory diseases such as buffer A and preincubated at 37C for 30 minutes. Samples were then pulmonary fibrosis and chronic hepatitis (30). One of these ATX mixed with 25 mL of 600 mmol/L C14:0-LPC in buffer A and incubated inhibitors, GLPG1690 (Fig. 1A,IC50 130–220 nmol/L; Ki 15 for a further 2 hours at 37 C. After this, 20 mL samples of these against human ATX), succeeded in halting the progression of incubation mixtures were pipetted in duplicate into a 96-well plate idiopathic pulmonary fibrosis in phase IIa clinical trials (31, 32), and mixed with 90 mL/well of buffer C [88.3 mL Buffer B (100 mmol/L fi and it is now being tested in a phase III trial (33). Signi cantly, Tris-HCl, pH 8.5, and 5 mmol/L CaCl2), 0.58 mL of 10 mmol/L many therapeutics that are effective against fibrosis are also used Amplex Red, 0.12 mL of 1,000 U/mL horseradish peroxidase, 1 mL to improve cancer treatments (34). It was, therefore, important to of 50 U/mL choline oxidase]. Fluorescence was measured at Excitation establishifanATXinhibitorthatisinclinicaltrialsforfibrosis 544 nm/Emission 590 nm, and choline concentrations were calcu- has positive effects on the treatment of cancers. lated from a choline standard curve. The samples containing the This study tested GLPG1690 in combination with RT or chemo- excess of GLPG1690 in the assay served as a control to determine therapy in a syngeneic orthotopic 4T1 mouse model of breast cancer. ATX-dependent choline formation and account for any free choline This study provides novel information about how targeting ATX in in the plasma. The values for choline obtained in the presence of the tumor microenvironment can improve the efficacy of breast excess GLPG1690 were <5% of the values where no GLPG was cancer treatments. added, which validates the assay.

Measurement of LPA and sphingosine 1-phosphate Materials and Methods concentrations in mouse plasma Cell lines and reagents Plasma LPA and sphingosine 1-phosphate concentrations were Mouse 4T1 breast cancer cells, human Hs578T breast cancer measured as described previously (10). Briefly, plasma was treated fi 13 cells, and patient matching Hs578Bst stromal broblasts were from with labeled internal standards including C17:0-LPA and [ C2D2] the American Type Culture Collection. Cells were within 10 pas- S1P. Lipid phosphates were extracted into butan-1-ol. Lysophospho- sages and tested negative for Mycoplasma before use. Amplex red lipids were measured by liquid chromatography/tandem mass spec- (A12222) was from ThermoFisher Scientific. Horseradish peroxi- trometry with electrospray ionization in the negative ion mode using dase (77332) and choline oxidase (SAE0044) were from Millipore an Agilent 1200 series LC system coupled to a 3200 QTRAP mass Sigma. Rabbit anti-Ki67 (#9129), rabbit anti–Bcl-2 (#2876), and spectrometer (AB Sciex). The absolute amounts of S1P, sphinganine rabbit anti–caspase-3 (#9665) were from Cell Signaling Technology. 1-phosphate, C16:0-LPA, C18:0-LPA, C18:1-LPA, and C20:4-LPA Rabbit anti–4-hydroxynonenal (ab46545) antibody and rabbit anti– were determined from calibration curves using authentic standards. Bcl-2 (ab182858, for immunohistochemistry) were from Abcam. Levels of C18:2-LPA and C22:6-LPA were compared between treat- Rabbit anti-autotaxin antibody (ATX-102) was from Dr. Tim Clair ment and control samples based on the analyte to C17:0-LPA internal (NCI, Bethesda, MA; ref. 35). The UltRNA column purification kit standard peak area ratios. (G487), reverse transcription master mix (G490), and EvaGreen qPCR MasterMix (MasterMix-ER) were from Applied Biological Syngeneic mouse breast cancer model Materials Inc. GLPG1690 was provided by Galapagos NV. Female BALB/c mice, 8–10-week old (Strain Code 028), were from Charles River. They were maintained at 21 2C, 55 5% humidity, Radiation treatment of Hs578Bst fibroblasts and patient- and a standard 12-hour light–dark cycle. The mice had free access to matched Hs578T breast cancer cells standard laboratory diet (7001 Teklad 4% fat) and water. All proce- Hs578Bst stromal fibroblasts and the paired Hs578T breast cancer dures were performed in accordance with the Canadian Council of cells from the same patient were cultured in DMEM with 10% FCS. Animal Care as approved by the University of Alberta Animal Welfare Cells were approximately 80% confluent in 6-well plates and exposed Committee. 4T1 cells were cultured in DMEM with 10% FCS and then to 0.5, 0.75, 1.0, or 2.0 Gy of g-radiation at a dose rate of 1.18 Gy/min trypsinized and washed twice before being suspended in PBS at using a 60Co Gammacell irradiator (Atomic Energy of Canada Ltd.). 400,000 cells/mL. Cells were mixed with an equal volume of Matrigel After irradiation, cells were cultured in DMEM with 1% charcoal- (BD Biosciences), and 100 mL (20,000 cells) was injected using a treated FCS for another 24 hours. Collected conditioned media were 30-gauge needle into the second or fourth inguinal left mammary fat centrifuged and concentrated approximately 25-fold using an Amicon pad of the mice. Tumor size was measured using two orthogonal Ultra-0.5 Centrifugal Filter Unit with Ultracel-10 membrane caliper measurements, and tumor volume was estimated from width2 (UFC501096, EMD Millipore). length/2.

ATX activity assay in conditioned media and plasma GLPG1690 preparation, administration, and plasma levels ATX activity in conditioned media of cell culture and mouse plasma measurement was measured by determining choline release from LPC as reported GLPG1690 was ground into a ﬁne powder in a mortar and previously (10), but we made the assay more sensitive by using a suspended at 10 mg/mL in 0.5% methyl cellulose (Cat.182312500, ﬂuorescent detection for choline. For the assay in plasma, we used a Acros Organics). Mice were gavaged with 50 or 100 mg/kg relatively physiologic concentration of 300 mmol/L LPC in the assay GLPG1690 bid using 10 mL/kg body weight. Control mice received

Mol Cancer Ther; 2020 Molecular Cancer Therapeutics OF2

GLPG1690 Increases Efﬁcacy of Breast Cancer Therapy

the vehicle (0.5% methyl cellulose). Concentrations of GLPG1690 in threshold defined at 50% of radioactivity uptake. Mean standard- mouseplasmaweremeasuredusingaqualified LC-MS/MS bio- ized uptake values [SUVmean ¼ (measured radioactivity in the analytical method. The calibration, composed of height standards, ROI/mL tumor tissue)/(total injected radioactivity/mouse body ranged from 4 to 4,000 ng/mL, using a plasma volume of 10 mL. weight)] were calculated for each ROI. Basically, plasma proteins were precipitated with an excess of acetonitrile containing the internal standard (deuterated analogue Combination therapy using doxorubicin of GLPG1690) and, after centrifugation, the corresponding super- Doxorubicin treatment started at day 5 after the injection of cancer natant was diluted with water and injected on a C18 high perfor- cells when the tumors became palpable. There were four groups of mance liquid chromatography (HPLC) column. Analytes were tumor-bearing mice based on: (i) control mice (treatment with appro- eluted out of the HPLC system by increasing the percentage of the priate vehicles); (ii) mice treated with 4 mg/kg doxorubicin by i.p. organicmobilephase.AnAPI5500QTrapmassspectrometer injection on days 5 and 7; (iii) mice treated twice per day with (Sciex) operating in positive TurboIonSpray mode was used for 100 mg/kg GLPG1690; and (iv) mice treated twice per day with the detection and quantification of GLPG1690. Quality control GLPG1690 and with doxorubicin. The experiment was terminated samples were prepared at three concentrations in duplicate and at day 9, when tumors were isolated and weighed. The experimental were used for accepting or rejecting the whole analytical batch. schedule is illustrated in Fig. 6A.

RT with small-animal “image-guided” radiation research Cytokine measurement platform Tumors and tumor adjacent adipose tissues were homogenized 4T1 tumors were allowed to grow for 9 days when tumor sizes with RIPA buffer containing 1% (v/v) of protease inhibitor reached approximately 3 3to4 4 mm. GLPG1690 treatment cocktail (P8340, Millipore Sigma). Supernatants were collected was then started using 100 mg/kg via oral gavage at 12-hour and cytokine concentrations were measured using Multiplexing intervals. On day 10, fractionated RT was started for 5 consecutive LASER Bead Technology by Eve Technologies as reported days to deliver a daily dose at 7.5 Gy. RT was performed using previously (38). small-animal “image-guided” radiation research platform (SARRP; Xstrahl Inc.) with 220 kVp X-rays and 13 mA using 2 beams and a Real-time PCR 10-mm round-shaped collimator with isocenter positioned at the mRNA levels were determined by real-time PCR using cyclo- center of the tumor. RT doses were calculated using cone beam philin A as reference mRNA. Primers for LPP1 are F: 50GGTCAAA- computed tomography images measured with the SARRP and the AATCAACTGCAG30 and R: 50 TGGCTTGAAGATAAAGTGC30. integrated MuriPlan software after contouring the tumor shape and Primers for LPP2 are F: 50 TGGCCAAGTACATGATTGG30 and R: defining the isocenter. Mice were anesthetized with isoflurane in 50 AGCAGCCGTGCCCACTTCC30. Primers for LPP3 are F: 50 100% oxygen for each session. After finishing RT, treatment with CCCGGCGCTCAACAACAACC30 and R: 50 TCTCGATGATGA- GLPG1690 continued until the experiment was terminated on day GGAAGGG30.PrimersforLPA1areF:50 CTATGTTCGCCAG- 19 after injecting cancer cells. At this point, the animals were AGGACTATG30 and R: 50 GCAATAACAAGACCAATCCCG30. sacrificed and the tumors were separated from surrounding tissue, Primers for LPA2 are F: 50 CACACTCAGCCTAGTCAAGAC30 surgically removed, blotted, and weighed. The experimental sched- and R: 50 GTACTTCTCCACAGCCAGAAC30. Primers for LPA3 ule is illustrated in Fig. 2A. are F: 50 GCCCGGTGTGCAATAAAA30 and R: 50 CTTAAAAG- CCCCAGAAGTGATG30. Primers for LPA6 are F: 50 CACATCTG- Preclinical PET experiments in vivo AATAGCAAAGGCG30 and R: 50 TGAACATGCACCCGTACA- The 4T1 tumor–bearing mice from the RT study (described G30. Primers for ATX are F: 50CATTTATTGGTGGAACGCAGA30 above) were analyzed on day 4 during RT therapy as well as 4 days and R: 50CTACAAAAACAGTCTGCATGC30. after finishing RT. Mice were anesthetized by isoflurane in 100% oxygen. Mice were injected in the tail vein with 5 to 8 MBq of IHC and Western blotting [18F]FLT in 100 to 150 mL saline using a needle catheter. [18F]FLT IHC was performed on 5-mm paraffin-embedded tumor sections was synthesized at the cyclotron facility of the Cross Cancer using the Dako LSAB þ Universal Kit (K0679; Dako Corp.) Institute (Edmonton, AB, Canada) according to the procedure of according to the manufacturer's instructions and visualized using Machulla (36), using a TracerLab-FX–automated synthesis unit Dako Envisionþ rabbit HRP (K4002). Antigen retrieval was per- (GE Healthcare) and 5-O-(4,4-dimethoxytrityl)-2,3-anhydrothymi- formed by microwaving hydrated slides in a plastic pressure cooker dine (ABX GmbH) as a precursor (37). Radioactivity in the injected for 20 minutes in 10 mmol/L citric acid (pH 6.0). Images were solution in a 0.5 mL syringe was determined with a dose calibrator acquired using a Zeiss Axioskop 2 imaging system (Carl Zeiss (AtomlabTM 300, Biodex Medical Systems), which was cross- Canada). At least 6 images were taken to get an average value for calibrated with the scanner. After injection, mice were allowed to each sample. Tumor tissue was homogenized in RIPA buffer with regain consciousness for about 40 minutes before anesthetizing protease inhibitors followed by centrifugation to collect the super- them again. Then they were immobilized in the prone position into natants. Proteins (60 mg) were separated by SDS-PAGE, and the center field of view of a preclinical INVEON PET scanner immunoblots were analyzed by Odyssey infrared imaging system (Siemens Preclinical Solutions). Acquisition data were collected in (LI-COR Biosciences). three-dimensional list mode for 10 minutes, which was at approximately 60 minutes after injection. Results were processed and Statistical analysis reconstructed using maximum a posteriori algorithm. The image Results are expressed as mean SEM for the numbers of mice files were further processed using the ROVER v2.0.51 software used to obtain samples of tumors and tissues. The Student t test or (ABX GmbH). Masks for defining three-dimensional regions of one-way ANOVA with a post hoc test was used to assess statistical interest (ROI) over tumor tissue were defined and the ROI's with a significance.

www.aacrjournals.org Mol Cancer Ther; 2020 OF3

Tang et al.

Results decrease plasma ATX activity beyond about 5 hours (Fig. 1B). How- GLPG1690 decreased ATX activity and LPA concentration in ever, 100 mg/kg of GLPG1690 decreased ATX activity by >80% for plasma approximately 10 hours. This was because GLPG1690 was effectively Experiments were performed to establish a suitable therapeutic dose eliminated from the plasma of the mice after about 10 hours (Fig 1C). of GLPG1690 (Fig. 1A) in mice. Mice were treated with 50 or We, therefore, administered a second dose of 100 mg/kg at 12 hours 100 mg/kg of GLPG1690 for 5 days, and ATX activity was measured each day, and this maintained a decrease in plasma ATX activity by during the ﬁfth day of treatment. The 50 mg/kg dose was insufﬁcient to >70% at 24 hours (Fig. 1B).

Figure 1. GLPG1690 inhibited ATX activity and decreased LPA concentration in plasma. A, The structure of GLPG1690. B, Mice were treated for 5 days with a daily dose of 50 mg/kg or with 100 mg/kg GLPG1690 every 12 hours. The time point at 0 hour was obtained from mice that were treated with the vehicle for 5 days. Blood was collected by a terminal cardiac puncture at the times indicated from the ﬁrst dose of GLPG1690 on day 5. For the 24-hour time point for the mice treated with 100 mg/kg GLPG1690, the second dose was given at 12 hours. C, Plasma concentrations of GLPG1690 from the mice treated with 100 mg/kg GLPG1690. The second curve, which is indicated, is the proﬁle expected from repeating the dose at 12 hours. D–J, Plasma concentrations of different molecular species of LPA and of S1P and sphinganine 1-phosphate from the mice treated with 100 mg/kg GLPG690. n ¼ 5 mice for the control and 3 mice in each treated group. , P < 0.05; , P < 0.01; , P < 0.001 compared with 0 hour for the lysophospholipids.

Mol Cancer Ther; 2020 Molecular Cancer Therapeutics OF4

GLPG1690 Increases Efﬁcacy of Breast Cancer Therapy

LPA concentrations in the plasma were also measured over 24 hours RT with GLPG1690 did not change tumor weight compared with RT on the fifth day of treatment with 100 mg/kg of GLPG1690 every alone. Ki67 was determined by IHC to measure cell division in the 12 hours. This dosing regimen decreased the plasma concentrations of tumors. RT decreased the percentage of Ki67-positive cells, and this LPA with chain lengths of C16:0, C18:1, C18:2, C20:4, and C22:6 by was decreased further by RT in combination with GLPG1690 (Fig. 2D; about >80% after 3 hours and by >50% at 24 hours (Fig. 1D–I). The Supplementary Fig. S2A). plasma concentrations of C18:0-LPA were also decreased, but with an Besides postmortem tissue analysis, noninvasive PET imaging with apparently different profile and less extensively (Fig. 1E). This prob- [18F]FLT was used to allow for treatment monitoring in vivo. Ther- ably resulted from the generation of some of the C18:0-LPA by apeutic effects were measured at day 4 during fractionated RT and fi phospholipase A2 activities (39). Although the sphingolipid analogue 4 days after nishing RT (Fig. 2A). Figure 3 shows representative PET of LPA, sphingosine 1-phosphate (S1P), can be generated by ATX (40), images during and after RT as well as quantified radiotracer uptake this does not occur to a significant extent in vivo and thus S1P and results as determined as standardized uptake values analyzed from the sphinganine 1-phosphate (SA1P) concentrations were not decreased PET imaging results. During RT, there was a very strong and signif- by GLPG1690. icant decrease in [18F]FLT uptake from SUV 2.32 0.19 to 0.84 0.05, Based on these results, we chose a dose of 100 mg/kg of GLPG1690 which was not reduced further by GLPG1690 (Fig. 3A and C). at 12-hour intervals for further experiments to ensure adequate However, tumor uptake of [18F]FLT at 4 days after the RT was decreases in ATX activity and LPA concentrations. completed was significantly decreased further by GLPG1690 when it was combined with the RT: SUVRT 0.95 0.05 versus GLPG1690 enhances the inhibition of cancer cell proliferation SUVRTþGLPG1690 0.73 0.08 (Fig. 3B and D). This was indicative in vivo by irradiation of a positive effect in decreasing cell division in the tumors by blocking To establish tumors in mice and to study the effect of RT, we used ATX activity after the completion of RT. our established syngeneic orthotopic model where 4T1 breast cancer The major part of ATX in breast tumors is produced by adipose cells derived from a Balb/c mouse were injected into the second tissue adjacent to the tumors in a paracrine mode (3, 13, 43), and mammary fat pads of a Balb/c mouse. It was important to have an irradiation stimulates ATX expression in cultured breast adipose intact immune system rather than using a xenograft model because RT tissue (25). Relatively little is known about how ATX production and kills cancer cells by damaging DNA. The resulting cell debris and LPA signaling changes in the tumor microenvironment upon irradi- released proteins cause inflammation and enhance the immune elim- ation. We found that irradiation significantly decreased LPP1 and ination of cancer cells (41, 42). Tumors were established by allowing increased LPA1 mRNA, but did not change ATX mRNA level in them to grow for 9 days when they were palpable and could be tumors (Fig. 4A, D, and H). Inhibiting ATX activity with GLPG1690 fi distinguished by CT imaging using the SARRP system. To establish signi cantly increased mRNA levels of LPP2, LPA3, LPA6, and ATX in a suitable radiation dose and regimen, experiments were performed tumors (Fig. 4B, F, G, and H). The increase in ATX mRNA is using different fractions of RT at 7.5 Gy. Three fractions of RT with an consistent with our previous work using another ATX inhibitor, accumulated dose of 22.5 Gy decreased tumor size by an average of ONO-8430506, which was predicted to decrease feedback inhibition 55% at 5 days from the first fraction of RT. For the present experiments, on ATX by lowering LPA levels (14). we increased the RT to five fractions of 7.5 Gy (37.5 Gy of accumulated We also performed IHC on a tumor sample which contained some dose) to achieve more effective tumor control. The protocol is illus- adjacent adipose tissue, and found that ATX was mainly expressed in trated in Fig. 2A, and it was well tolerated with no significant effect on the tumor-adjacent adipose rather than in the tumor (Supplementary the body weights of the mice (Supplementary Fig. S1A). Five daily Fig. S3). Surprisingly, the IHC results indicated that irradiation or fractions of 7.5 Gy of RT decreased tumor growth and weight GLPG1690 did not affect ATX levels significantly in the tumors or in significantly by approximately 80%. GLPG1690 alone had no signif- tumor-adjacent adipose tissue (Supplementary Fig. S4A and S4B). icant effect after 10 days of treatment (Fig. 2B and C). Combination of Considering that ATX is secreted protein, the IHC results may not

Figure 2. Effects of RT and GLPG1690 on breast tumor growth. A, Illustration of experiment using RT and GLPG1690 in mouse 4T1 breast tumor model. B, RT with or without GLPG1690 (GLPG) significantly decreased tumor growth. C, RT with or without GLPG1690 (GLPG) significantly decreased tumor weight at day 19 after injection of cancer cells. D, RT significantly decreased the percentage of Ki67-positive cells in tumors at day 19, which was decreased further by combination with GLPG1690. n ¼ 5 mice for control, n ¼ 6 mice other groups. , P < 0.05 compared with control.

www.aacrjournals.org Mol Cancer Ther; 2020 OF5

Tang et al.

Figure 3. Effects of RT and GLPG1690 on [18F]FLT uptake by tumors. A and B, Representative static coronal [18F]FLT-PET images after 60 minutes postinjection during and after RT (7.5 Gy 5 fractions). C and D, Quantitative [18F]FLT tumor uptake under the different experimental conditions as SUV from 5 or 6 mice in the control group and n ¼ 6 mice in other groups. , P < 0.05; , P < 0.01; , P < 0.001.

accurately reflect the real abundance and localization of ATX in Effects of GLPG1690 in combination with RT in controlling the tumors because this can be affected by the extent of diffusion and secretion of cytokines, chemokines, and growth factors cell surface binding of ATX (44). We also measured ATX activity in Tumors and the surrounding adipose tissue were isolated separately patient-matching Hs578Bst tumor-associated fibroblasts and Hs578T on day 19 of the experiment (Fig. 2A). This was 5 days after the breast cancer cells treated with different doses of g-radiation. ATX completion of the RT and about 12 hours after the last dose of activity in Hs578Bst fibroblasts was increased by approximately 2-fold GLPG1690. The levels of CCL2, CCL5, CXCL11, GM-CSF, and TNFa after 0.75 or 1 Gy g-radiation as expected, whereas ATX activity in in tumors were induced by RT (Supplementary Fig. S6). GLPG1690 Hs578T cancer cells showed no response to g-radiation (Supplemen- treatment significantly decreased concentrations of IL3, IFNg, and LIF tary Fig. S5). This result demonstrates that stromal fibroblasts in breast in the tumors compared with the control (Supplementary Fig. S6). The tumor microenvironment could also be a source of ATX production RT-induced increase in CCL11 in tumors was reversed by GLPG1690 after RT in addition to adipose tissue (25). (Fig. 6A). RT increased the level of M-CSF in adipose tissue adjacent to the GLPG1690 in combination with RT increases apoptosis in tumors tumor, which was reversed by GLPG1690 (Fig. 6E). The levels of IL9, as measured ex vivo IL12 p40, and IFNg in tumor-adjacent adipose tissue were not To analyze the effects of GLPG1690 on RT further, we determined significantly affected by RT, but these levels were decreased by the levels of Bcl-2, which is a protein that promotes cell division and GLPG1690 compared with the irradiated mice (Fig. 6B–D). Changes protects against apoptosis. The levels of Bcl-2 were significantly of other cytokines in the tumor-adjacent adipose tissue are shown in decreased by RT, but these were not decreased further by the com- Supplementary Fig. S7. bination of GLPG1690 (Fig. 5A and B). The IHC results indicated that Bcl-2 is expressed in both the tumor and tumor-adjacent adipose tissue GLPG1690 and doxorubicin synergistically inhibit breast tumor (Supplementary Fig. S3). RT and the combination of GLPG1690 growth decreased Bcl-2 levels in tumors (Supplementary Fig. S4C), which is We also studied the effects of blocking ATX on the efficacy of in consistent with the Western blotting results. RT alone appeared to doxorubicin in the 4T1 breast tumor model. The experimental design increase the levels of cleaved caspase-3, and this was statistically is illustrated in Fig. 7A. Tumors became palpable on day 5 after the significant when combined with GLPG1690 treatment (Fig. 5C). injection of cancer cells into the fourth mammary fat pad, and the mice

Mol Cancer Ther; 2020 Molecular Cancer Therapeutics OF6

GLPG1690 Increases Efﬁcacy of Breast Cancer Therapy

Figure 4. Effects of RT and GLPG1690 on mRNA levels of LPPs, LPA receptors, and ATX in tumors. A–C, mRNA levels of LPP1, LPP2, and LPP3. D–G, mRNA levels of LPA1, LPA2, LPA3, and LPA6. H, mRNA level of ATX. , P < 0.05; , P < 0.01; , P < 0.001 for 5 control mice and 6 mice in experimental groups.

were then treated with doxorubicin and/or GLPG1690. Doxorubicin produced mainly by the inflamed adipose adjacent to the tumors (13). (4 mg/kg on days 5 and 7) with or without the treatment with The importance of targeting ATX is emphasized by the fact that GLPG1690 (100 mg/kg every 12 h) was well tolerated, and there was irradiation activates ATX-LPA–inflammatory signaling in breast adi- no significant effect on the body weights of the mice (Supplementary pose tissue (25), which then generates prosurvival signals for cancer Fig. S1B). Doxorubicin and GLPG1690 alone were not sufficient to cells to become refractory to RT (26, 27). Blocking ATX and the decrease tumor growth and weight. However, doxorubicin combined subsequent LPA signaling provides a novel strategy for breast cancer with GLPG1690 significantly decreased tumor growth and weight by therapy through eliminating the supportive mechanism in the tumor approximately 30% (Fig. 7B and C). It also significantly decreased the microenvironment. The ATX inhibitor, GLPG1690, was successful in percentage of Ki67-positive cells (Fig. 7D; Supplementary Fig. S2B). phase IIa trials in halting the progression of idiopathic pulmonary Part of the cytotoxic effect of doxorubicin on cancer cells is by fibrosis (31, 32), and it is now being tested in a phase III trial (33). It causing oxidative stress. LPA protects cancer cells from doxorubicin- was, therefore, important to study if blocking ATX with GLPG1690 induced oxidative damage by decreasing the accumulation of toxic leads to increased effectiveness of RT as well as chemotherapy, because oxidation products (21). We measured the 4-hydroxynonenal these effects of GLPG1690 could be tested readily in breast and other (4-HNE)–labeled proteins to determine the extent of lipid peroxida- cancer patients. tion. The levels of proteins conjugated with 4-HNE were significantly During the present study, we investigated the interactions of increased in the tumors when GLPG1690 was combined with doxo- precision RT with ATX inhibition in the syngeneic orthotopic 4T1 rubicin (Fig. 7E and F). mouse breast tumor model. The SARRP with integrated computer tomography imaging is designed to deliver focused irradiation to tumors in small rodents, which allowed us to irradiate mouse tumors Discussion with high precision (0.5 mm) while minimizing peripheral tissue The present study investigated the effects of targeting ATX as a damage, as is done clinically. In our mouse model, this irradiation neoadjuvant therapy for breast cancer. ATX in breast cancers is regimen of five daily fractions of 7.5 Gy achieved an approximately

www.aacrjournals.org Mol Cancer Ther; 2020 OF7

Tang et al.

Figure 5. Effects of RT and GLPG1690 on Bcl-2 and cleaved caspase-3 levels in tumors. A, RT with ﬁve daily fractions of 7.5 Gy or GLPG1690 treatment (100 mg/kg, every 12 hours) increased cleavage of caspase-3 and decreased Bcl-2 levels in tumors. B and C, Quantiﬁcation of Western blotting for Bcl-2 and cleaved caspase-3. Samples from n ¼ 5 control mice and n ¼ 6 mice for other groups. , P < 0.05.

80% decrease in tumor size. Although RT was already effective on its the completion of the RT. [18F]FLT is phosphorylated and trapped in own in strongly decreasing tumor cell proliferation, combination with cells (45) by thymidine kinase 1 which is elevated during the S phase of GLPG1690 did signiﬁcantly decrease cell proliferation further in the the cell cycle (46). [18F]FLT-PET imaging allows us to measure tumor as measured through [18F]FLT uptake and Ki67 staining after proliferation noninvasively in a whole tumor in vivo in a three-

Figure 6. Effects of RT and GLPG1690 on levels of inﬂammatory cytokines in tumors and tumor-adjacent adipose. Protein levels of CCL11 (A) in tumors and protein levels of IL9 (B), IL12 p40 (C), IFNg (D), and M-CSF (E) in tumor-adjacent adipose tissue (TA) with or without ﬁve daily fractions of 7.5 Gy X rays and/or GLPG1690 (100 mg/kg, every 12 hours). Samples from n ¼ 5 control mice and n ¼ 6 mice for other groups. , P < 0.05.

Mol Cancer Ther; 2020 Molecular Cancer Therapeutics OF8

GLPG1690 Increases Efﬁcacy of Breast Cancer Therapy

Figure 7. GLPG1690 increases the efficiency of doxorubicin in mouse model of breast cancer. A, Illustration of experiment using combination therapy with doxorubicin and GLPG1690 in mouse 4T1 breast tumor model. B and C, Doxorubicin (4 mg/- kg, once every 2 days) in combination with GLPG1690 (100 mg/kg, every 12 hours) significantly decreased tumor growth and weight. D, Doxorubicin combined with GLPG1690 significantly decreased the percentage of Ki67-positive cells in tumors. E and F, Doxorubicin combined with GLPG1690 significantly increased 4-HNE-protein adducts in tumors. n ¼ 6 mice from each group; , P < 0.05 and , P < 0.01 compared with control.

dimensional region of interest. This is not possible in classical biopsy PF-8380 increased the sensitivity of heterotopic glioblastomas to RT in samples, which need to be collected through invasive procedures (46). mice (48, 49). The work was not performed with focused irradiation, Furthermore, tumors are highly heterogeneous, and the elevated and inflammatory responses were not recorded. BrP-LPA and PF-8380 uptake of [18F]FLT occurs mainly in cancer cells, which proliferate are unlikely to be introduced into the clinic, but GLPG1690 and an more actively than the stromal cells and necrotic areas (47). Therefore, LPA1 receptor antagonist BMS986020 are in clinical trials for pulmo- using [18F]FLT-PET imaging to determine cell proliferation distin- nary fibrosis. This work could be extended to test their utilities as guishes if the tumors have an immediate functional response to a adjuvants to improve the efficacy of RT. treatment. This does not necessarily lead to a shrinkage in tumor size Chronic inflammation is widely recognized as one of the “hall- because there should be less of an effect on the high percentage of marks” of cancer (3, 7, 50), and inflammation is augmented by stromal cells and necrotic tissue within the tumor and because many irradiation (23), which may be associated with irradiation-induced anticancer treatments evoke a cytostatic rather than a cytotoxic fibrosis. Although we did not detect fibrosis in the present study response. Indeed, treatment with GLPG1690 did not decrease tumor because of the short observation time after RT, blocking ATX with weight more than the effect of RT alone. The effects of combination GLPG1690 decreased the concentrations of CCL11, IL9, IL12 p40, therapy are in agreement with enhancement in apoptosis in the tumors M-CSF, and IFNg in tumors or tumor-adjacent adipose tissue of as indicated by increased cleavage of caspase-3 and decreased Bcl-2 irradiated mice. This is understandable because we previously reported levels. Our results are compatible with previous work in which ATX that breast tumors and irradiation cause inflammation in adjacent was inhibited with BrP-LPA (also a pan-LPA receptor antagonist) or adipose tissue. Importantly, these proinflammatory cytokines are

www.aacrjournals.org Mol Cancer Ther; 2020 OF9

Tang et al.

closely related to the pathogenesis of pulmonary fibrosis (51–53). clinical trials such that it could be readily tested as a novel adjuvant to fi fi Activation of LPA1 receptors drives brosis in several brotic improving the treatment of cancers. conditions (54–56), and consequently, blocking LPA formation with GLPG1690 should theoretically attenuate the development of irradi- Disclosure of Potential Conflicts of Interest fi ation-induced brosis as it does in the case of idiopathic pulmonary A. Monjardet is Team Leader DMPK at Galapagos. B. Heckmann is Project fibrosis (31, 32). Leader/Director at Galapagos and has an expert testimony with warrants. No Chemotherapy with doxorubicin, tamoxifen, and taxanes is potential conflicts of interest were disclosed by the other authors. mainline treatment for breast cancer, and LPA protect cancer cells from the cytotoxic effects of these treatments (15, 21). We reported Authors’ Contributions that treating mice with the ATX inhibitor, ONO-8430506, inhibited Conception and design: M.G.K. Benesch, B. Heckmann, D.N. Brindley breast tumor growth by approximately 60% for about 9 days in the Development of methodology: X. Tang, M.G.K. Benesch, J.M. Curtis, F. Wuest, 4T1 mouse model of breast cancer (10). Combination of ONO- D.N. Brindley 8430506 with doxorubicin increased the effectiveness in decreasing Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): M. Wuest, M.G.K. Benesch, J. Dufour, Y. Zhao, A. Monjardet, tumor growth and lung metastasis (21). One caveat with these D. Murray, D.N. Brindley observations is that ATX inhibition was initiated on the day after Analysis and interpretation of data (e.g., statistical analysis, biostatistics, injection of the 4T1 cancer cells and before the tumors had computational analysis): X. Tang, M. Wuest, M.G.K. Benesch, A. Monjardet, established. This would not be the case in the clinical management F. Wuest, D.N. Brindley of patients. For the present work, we adopted a more stringent Writing, review, and/or revision of the manuscript: X. Tang, M. Wuest, protocol of starting the treatments after the tumors had become M.G.K. Benesch, A. Monjardet, D. Murray, F. Wuest, D.N. Brindley Administrative, technical, or material support (i.e., reporting or organizing data, palpable and well established. GLPG1690 also enhanced the effects constructing databases): X. Tang, D.N. Brindley of doxorubicin in controlling tumor growth. Doxorubicin creates Study supervision: D.N. Brindley significant oxidative stress in tumors, and this contributes to its cytotoxicity toward cancer cells (21). LPA counteracts this effect by Acknowledgments increasing the expression of antioxidant proteins and multidrug The authors wish to thank Blake Lazurko and David Clendening from the resistance transporters, which export doxorubicin and toxic oxida- Edmonton Radiopharmaceutical Center (ERC) for 18F production on a biomed- tion products from cancer cells (21). These actions contribute to the ical cyclotron. The authors also acknowledge Ali Akbari (ERC) and Cody observed decreases in the production of reactive oxygen species in Bergman (Department of Oncology, University of Alberta) for radiosynthesis of 18 mitochondria (57, 58). In the present studies, we did not observe a [ F]FLT, as well as Dan McGinn (Vivarium Cross Cancer Institute) for support- significant decrease in Nrf2 expression after treatment with ing animal work and use of the SARRP system. In addition, the authors wish to thank Galapagos NV and the Canadian Cancer Society Research Institute GLPG1690 as we had expected from our previous work with the for supporting this study. ATX inhibitor, ONO-8430506. However, blocking LPA signaling The work was supported by grants from Galapagos NV and an innovation grant through ATX inhibition with GLPG1690 did increase the levels of (INNOV15-2) from the Canadian Cancer Society Research Institute (to D.N. the toxic oxidation product 4-HNE indicating increased oxidative Brindley). damage. This was accompanied by an increased vulnerability of cancer cells to doxorubicin-induced killing. The costs of publication of this article were defrayed in part by the payment The present results together with previous work show that inhibit- of page charges. This article must therefore be hereby marked advertisement in ing ATX and subsequent LPA signaling in tumor microenvironment accordance with 18 U.S.C. Section 1734 solely to indicate this fact. could provide a novel adjuvant therapy to improve the outcomes from RT and chemotherapy in breast cancer patients. Importantly, this work Received April 9, 2019; revised August 7, 2019; accepted September 13, 2019; was conducted with GLPG1690, which has progressed to phase III published first September 23, 2019.

References 1. Paridaens R, Biganzoli L, Bruning P, Klijn JG, Gamucci T, Houston S, et al. 7. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell 2011; Paclitaxel versus doxorubicin as first-line single-agent chemotherapy for 144:646–74. metastatic breast cancer: a European Organization for Research and Treat- 8. Benesch MG, Ko YM, Tang X, Dewald J, Lopez-Campistrous A, Zhao YY, et al. ment of Cancer Randomized Study with cross-over. J Clin Oncol 2000;18: Autotaxin is an inflammatory mediator and therapeutic target in thyroid cancer. 724–33. Endocr Relat Cancer 2015;22:593–607. 2. Tigyi GJ, Yue J, Norman DD, Szabo E, Balogh A, Balazs L, et al. Regulation of 9. Brindley DN, Beneasch MGK, Murph MM. Autotaxin: an enzymatic tumor cell - microenvironment interaction by the autotaxin-lysophosphatidic augmenter of malignant progression linked to inflammation. Croatia: acid receptor axis. Adv Biol Regul 2019;71:183–93. INTECH;2014. 3. Benesch MG, Ko YM, McMullen TP, Brindley DN. Autotaxin in the crosshairs: 10. Benesch MG, Tang X, Maeda T, Ohhata A, Zhao YY, Kok BP, et al. Inhibition taking aim at cancer and other inflammatory conditions. FEBS Lett 2014;588: of autotaxin delays breast tumor growth and lung metastasis in mice. FASEB J 2712–27. 2014;28:2655–66. 4. Mazereeuw-Hautier J, Gres S, Fanguin M, Cariven C, Fauvel J, Perret B, et al. 11. Volden PA, Skor MN, Johnson MB, Singh P, Patel FN, McClintock MK, et al. Production of lysophosphatidic acid in blister fluid: involvement of a lysopho- Mammary adipose tissue-derived lysophospholipids promote estrogen receptor- spholipase D activity. J Invest Dermatol 2005;125:421–7. negative mammary epithelial cell proliferation. Cancer Prev Res (Phila) 2016;9: 5. Sloan EK, Priceman SJ, Cox BF, Yu S, Pimentel MA, Tangkanangnukul V, et al. 367–78. The sympathetic nervous system induces a metastatic switch in primary breast 12. Schmid R, Wolf K, Robering JW, Strauss S, Strissel PL, Strick R, et al. ADSCs cancer. Cancer Res 2010;70:7042–52. and adipocytes are the main producers in the autotaxin-lysophosphatidic 6. Schafer M, Werner S. Cancer as an overhealing wound: an old hypothesis acid axis of breast cancer and healthy mammary tissue in vitro. BMC Cancer revisited. Nat Rev Mol Cell Biol 2008;9:628–38. 2018;18:1273.

Mol Cancer Ther; 2020 Molecular Cancer Therapeutics OF10

GLPG1690 Increases Efﬁcacy of Breast Cancer Therapy

13. Benesch MG, Tang X, Dewald J, Dong WF, Mackey JR, Hemmings DG, et al. 33. Maher TM, Kreuter M, Lederer DJ, Brown KK, Wuyts W, Verbruggen N, Tumor-induced inflammation in mammary adipose tissue stimulates a vicious et al. Rationale, design and objectives of two phase III, randomised, cycle of autotaxin expression and breast cancer progression. FASEB J 2015;29: placebo-controlled studies of GLPG1690, a novel autotaxin inhibitor, in 3990–4000. idiopathic pulmonary fibrosis (ISABELA 1 and 2). BMJ Open Respir Res 14. Benesch MG, Zhao YY, Curtis JM, McMullen TP, Brindley DN. Regulation of 2019;6:e000422. autotaxin expression and secretion by lysophosphatidate and sphingosine 34. Chen D. Dually efficacious medicine against fibrosis and cancer. Med Sci (Basel) 1-phosphate. J Lipid Res 2015;56:1134–44. 2019;7. doi: 10.3390/medsci7030041. 15. Samadi N, Bekele RT, Goping IS, Schang LM, Brindley DN. Lysophosphatidate 35. Murata J, Lee HY, Clair T, Krutzsch HC, Arestad AA, Sobel ME, et al. induces chemo-resistance by releasing breast cancer cells from taxol-induced cDNA cloning of the human tumor motility-stimulating protein, auto- mitotic arrest. PLoS One 2011;6:e20608. taxin, reveals a homology with phosphodiesterases. J Biol Chem 1994;269: 16. Sun Y, Nam JS, Han DH, Kim NH, Choi HK, Lee JK, et al. Lysophosphatidic acid 30479–84. induces upregulation of Mcl-1 and protects apoptosis in a PTX-dependent 36. Machulla H-J, Blocher A, Kuntzsch M, Piert M, Wei R, Grierson JR. Simplified manner in H19-7 cells. Cell Signal 2010;22:484–94. labeling approach for synthesizing 30-Deoxy-30-[18F]fluorothymidine 17. Yu S, Murph MM, Lu Y, Liu S, Hall HS, Liu J, et al. Lysophosphatidic acid ([18F]FLT). J Radioanal Nuclear Chem 2000;243:843. receptors determine tumorigenicity and aggressiveness of ovarian cancer cells. 37. Desilva A, Wuest M, Wang M, Hummel J, Mossman K, Wuest F, et al. J Nat Cancer Inst 2008;100:1630–42. Comparative functional evaluation of immunocompetent mouse breast 18. Gupta PB, Onder TT, Jiang G, Tao K, Kuperwasser C, Weinberg RA, et al. cancer models established from PyMT-tumors using small animal PET Identification of selective inhibitors of cancer stem cells by high-throughput with [(18)F]FDG and [(18)F]FLT. Am J Nucl Med Mol Imaging 2012;2: screening. Cell 2009;138:645–59. 88–98. 19. Samadi N, Gaetano C, Goping IS, Brindley DN. Autotaxin protects MCF-7 breast 38. Tang X, Wang X, Zhao YY, Curtis JM, Brindley DN. Doxycycline cancer and MDA-MB-435 melanoma cells against Taxol-induced apoptosis. attenuates breast cancer related inflammation by decreasing plasma Oncogene 2009;28:1028–39. lysophosphatidate concentrations and inhibiting NF-kappaB activation. 20. Clarke N, Arenzana N, Hai T, Minden A, Prywes R. Epidermal growth factor Mol Cancer 2017;16:36. induction of the c-jun promoter by a Rac pathway. Mol Cell Biol 1998;18: 39. Li H, Zhao Z, Wei G, Yan L, Wang D, Zhang H, et al. Group VIA phospholipase 1065–73. A2 in both host and tumor cells is involved in ovarian cancer development. 21. Venkatraman G, Benesch MG, Tang X, Dewald J, McMullen TP, FASEB J 2010;24:4103–16. Brindley DN. Lysophosphatidate signaling stabilizes Nrf2 and increases 40.ClairT,AokiJ,KohE,BandleRW,NamSW,PtaszynskaMM,etal. the expression of genes involved in drug resistance and oxidative Autotaxin hydrolyzes sphingosylphosphorylcholinetoproducetheregulator stress responses: implications forcancertreatment.FASEBJ2015; of migration, sphingosine-1-phosphate. Cancer Res 2003;63:5446–53. 29:772–85. 41. Schaue D, Micewicz ED, Ratikan JA, Xie MW, Cheng G, McBride WH. Radiation 22. Benesch MGK, Yang Z, Tang X, Meng G, Brindley DN. Lysophosphatidate and inflammation. Semin Radiat Oncol 2015;25:4–10. signaling: the tumor microenvironment's new nemesis. Trends Cancer 2017;3: 42. Lumniczky K, Candeias SM, Gaipl US, Frey B. Editorial: radiation and the 748–52. immune system: current knowledge and future perspectives. Front Immunol 23. Schaue D, Kachikwu EL, McBride WH. Cytokines in radiobiological responses: a 2017;8:1933. review. Radiat Res 2012;178:505–23. 43. Benesch MG, Tang X, Venkatraman G, Bekele RT, Brindley DN. Recent 24. Bower JE, Ganz PA, Tao ML, Hu W, Belin TR, Sepah S, et al. Inflammatory advances in targeting the autotaxin-lysophosphatidate-lipid phosphate phos- biomarkers and fatigue during radiation therapy for breast and prostate cancer. phatase axis in vivo. J Biomed Res 2016;30:272–84. Clin Cancer Res 2009;15:5534–40. 44. Fulkerson Z, Wu T, Sunkara M, Kooi CV, Morris AJ, Smyth SS. Binding of 25. Meng G, Tang X, Yang Z, Benesch MGK, Marshall A, Murray D, et al. autotaxin to integrins localizes lysophosphatidic acid production to platelets Implications for breast cancer treatment from increased autotaxin production and mammalian cells. J Biol Chem 2011;286:34654–63. in adipose tissue after radiotherapy. FASEB J 2017;31:4064–77. 45. Shields AF, Grierson JR, Dohmen BM, Machulla HJ, Stayanoff JC, Lawhorn- 26. Balogh A, Shimizu Y, Lee SC, Norman DD, Gangwar R, Bavaria M, et al. The Crews JM, et al. Imaging proliferation in vivo with [F-18]FLT and positron autotaxin-LPA2 GPCR axis is modulated by gamma-irradiation and facilitates emission tomography. Nat Med 1998;4:1334–6. DNA damage repair. Cell Signal 2015;27:1751–62. 46. Bollineni VR, Kramer GM, Jansma EP, Liu Y, Oyen WJ. A systematic review on 27. Deng W, Balazs L, Wang DA, Van Middlesworth L, Tigyi G, Johnson LR. [(18)F]FLT-PET uptake as a measure of treatment response in cancer patients. Lysophosphatidic acid protects and rescues intestinal epithelial cells from Eur J Cancer 2016;55:81–97. radiation- and chemotherapy-induced apoptosis. Gastroenterology 2002;123: 47. Huang T, Civelek AC, Li J, Jiang H, Ng CK, Postel GC, et al. Tumor 206–16. microenvironment-dependent 18F-FDG, 18F-fluorothymidine, and 18F- 28.St-CoeurPD,FergusonD,MorinPJr.,TouaibiaM.PF-8380andclosely misonidazole uptake: a pilot study in mouse models of human non-small cell related analogs: synthesis and structure-activity relationship towards auto- lung cancer. J Nucl Med 2012;53:1262–8. taxin inhibition and glioma cell viability. Arch Pharm (Weinheim) 2013;346: 48. Schleicher SM, Thotala DK, Linkous AG, Hu R, Leahy KM, Yazlovitskaya EM, 91–7. et al. Autotaxin and LPA receptors represent potential molecular targets for the 29. Samadi N, Bekele R, Capatos D, Venkatraman G, Sariahmetoglu M, Brindley radiosensitization of murine glioma through effects on tumor vasculature. DN. Regulation of lysophosphatidate signaling by autotaxin and lipid phosphate PLoS One 2011;6:e22182. phosphatases with respect to tumor progression, angiogenesis, metastasis and 49. Bhave SR, Dadey DY, Karvas RM, Ferraro DJ, Kotipatruni RP, Jaboin chemo-resistance. Biochimie 2011;93:61–70. JJ, et al. Autotaxin Inhibition with PF-8380 enhances the radiosen- 30. Nikolaou A, Kokotou MG, Limnios D, Psarra A, Kokotos G. Autotaxin sitivity of human and murine glioblastoma cell lines. Front Oncol 2013; inhibitors: a patent review (2012–2016). Expert Opin Ther Pat 2017;27: 3:00236. 815–29. 50. Colotta F, Allavena P, Sica A, Garlanda C, Mantovani A. Cancer-related 31. Maher TM, van der Aar EM, Van de Steen O, Allamassey L, Desrivot J, Dupont S, inflammation, the seventh hallmark of cancer: links to genetic instability. et al. Safety, tolerability, pharmacokinetics, and pharmacodynamics of Carcinogenesis 2009;30:1073–81. GLPG1690, a novel autotaxin inhibitor, to treat idiopathic pulmonary fibrosis 51. Mangieri D, Corradi D, Martorana D, Malerba G, Palmisano A, Libri I, et al. (FLORA): a phase 2a randomised placebo-controlled trial. Lancet Respir Med Eotaxin/CCL11 in idiopathic retroperitoneal fibrosis. Nephrol Dial Transplant 2018;6:627–35. 2012;27:3875–84. 32. Desroy N, Housseman C, Bock X, Joncour A, Bienvenu N, Cherel L, et al. 52. Baran CP, Opalek JM, McMaken S, Newland CA, O'Brien JM Jr, Hunter MG, Discovery of 2-[[2-Ethyl-6-[4-[2-(3-hydroxyazetidin-1-yl)-2-oxoethyl]piperazin- et al. Important roles for macrophage colony-stimulating factor, CC chemokine 1-yl]-8-methyli midazo[1,2-a]pyridin-3-yl]methylamino]-4-(4-fluorophenyl)thi- ligand 2, and mononuclear phagocytes in the pathogenesis of pulmonary fibrosis. azole-5-carbonitrile (GLPG1690), a first-in-class autotaxin inhibitor undergoing Am J Respir Crit Care Med 2007;176:78–89. clinical evaluation for the treatment of idiopathic pulmonary fibrosis. J Med Chem 53. Segel MJ, Izbicki G, Cohen PY, Or R, Christensen TG, Wallach-Dayan 2017;60:3580–90. SB, et al. Role of interferon-gamma in the evolution of murine

www.aacrjournals.org Mol Cancer Ther; 2020 OF11

Tang et al.

bleomycin lung fibrosis. Am J Physiol Lung Cell Mol Physiol 2003;285: 56.GanL,XueJX,LiX,LiuDS,GeY,NiPY,etal.Blockadeoflysopho- L1255–62. sphatidic acid receptors LPAR1/3 ameliorates lung fibrosis induced by 54. Rancoule C, Espenel S, Trone JC, Langrand-Escure J, Vallard A, Rehailia- irradiation. Biochem Biophys Res Commun 2011;409:7–13. Blanchard A, et al. Lysophosphatidic acid (LPA) as a pro-fibrotic and pro- 57. Rogers LC, Davis RR, Said N, Hollis T, Daniel LW. Blocking LPA-dependent oncogenic factor: a pivotal target to improve the radiotherapy therapeutic index. signaling increases ovarian cancer cell death in response to chemotherapy. Oncotarget 2017;8:43543–54. Redox Biol 2018;15:380–6. 55. Rancoule C, Pradere JP, Gonzalez J, Klein J, Valet P, Bascands JL, et al. 58. You L, Ren J, Yang B, Regenstein J, Zhao M. Antifatigue activities of loach protein Lysophosphatidic acid-1-receptor targeting agents for fibrosis. Expert Opin hydrolysates with different antioxidant activities. J Agric Food Chem 2012;60: Investig Drugs 2011;20:657–67. 12324–31.

Mol Cancer Ther; 2020 Molecular Cancer Therapeutics OF12

Inhibition of Autotaxin with GLPG1690 Increases the Efficacy of Radiotherapy and Chemotherapy in a Mouse Model of Breast Cancer

Xiaoyun Tang, Melinda Wuest, Matthew G.K. Benesch, et al.

Mol Cancer Ther Published OnlineFirst September 23, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-19-0386

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2019/09/20/1535-7163.MCT-19-0386.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2019/12/17/1535-7163.MCT-19-0386. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.