SCIENTIFIC CORRESPONDENCE

in fulminant Wegener's granulomatosis Wegener's autoantigen decoded could be a result of enhanced granulocyte SIR-Autoantibodies directed against a elastase up to the 5' end and which differentiation. unique antigen in cytoplasmic granules of encodes part of a signal peptide, a D. E. JENNE human neutrophils ACPA are a disease- two-residue-long propeptide and the J. TSCHOPP specific marker for Wegener's granulo- amino-terminal 21 residues of mature Institute of Biochemistry, matosis, a systemic vasculitis complicated proteinase 3 as determined by protein University of Lausanne, 1 by myelo-monocyte proliferation • sequencing. CH-1066 Epalinges, Switzerland Because disease activity and autoantibody Myeloblastin is identical to proteinase­ J. LODEMANN titre are closely correlated, autoanti- 3. Several questions concerning biosyn­ 8. UTECHT bodies are regarded as an important thetic processing, subcellular targeting, W. L. GROSS pathogenetic factor in this disease. The normal tissue distribution, enzymatic Abteilung fur klinische Rheumatologie target antigen (Wegener's autoantigen) activities and site of action of the protein der Medizinischen Universitat was recently identified as proteinase 3 are thus readily answered'-". It seems zu Lubeck und Rheumaklinik, (ref. 2). In an attempt to resolve conflict- to have multiple biological activities, 0-2357 Bad Bramstedt, FRG ing amino-terminal sequences'·3 for microbicidal" and elastinolytic functions' the autoantigen, we re-examined and and a regulatory function during myelo­ extended the amino-terminal sequence monocytic cell differentiation'. Flying lemurs and (underlined in the figure) up to residue Human neutrophil elastase and pro­ position 21. Our revised proteinase 3 teinase 3/myeloblastin are closely related other animals sequence agrees with the sequence of p29 with neutral serine proteases of other SIR-Martin in News and Views1 recentlv and is identical to AGP7, a novel neutro- haematopoietic cell types, in particular drew attention to the new evidence2·'link­ phil serine protease of azurophil gran- with serine proteases of mast cells and ing the extinct paromomyids to the two ules', except for Gin 19 instead of Glu. with a family of lymphocyte granzymes" living species of dermopterans, or gliding To our surprise, we found that residues whose functions are not known. Messen- 'lemurs'. Although carefully defining the 15 to 21 of proteinase 3 were identical with ger RNA levels, synthesis and secretion characters that enabled him to exclude 1 • 59 this group of animals from the primates, TGAGCGGTGCTGCCCGAGCTGCGGAGATCGTGGGCGGGCACGAGGCGCAGCCACACTCC Martin did not help the reader to form any PR-3/MB S G A A R A A E I V G G H E A 0 P H S idea of what their relationships might be HNE G G T A L A S E I V G G R R A R P H A to other mammals. -3 t +1 +11 In fact, the living dermopterans share 60 several derived skeletal', neural', genital', CGGCCCTACATGGCCTCCCTGCAGATGCGGGGGAhCCCGGGCAGCCACTTCTG 112 immunological6 and biochemical' charac­ PR-3/MB R P Y M A S L 0 M R G N P G S H F C ters with primates and megabats (flying HNE W P F M V S L Q L R G G H F C +12 +21 +25 +29 foxes) which they do not share with other Revised nucleotide and amino acid sequence of proteinase 3 (PR-3), Wegener's autoantigen, orders of mammals. In other words, the and identity to myeloblastin (MB). PR-3 and human neutrophil elastase (HNE) are optimally new fossil evidence is consistent with our aligned with gaps inserted in HNE (-).Numbering of PR-3/MB (bottom line) starts with the first 'flying primate' proposal\ implicit in the residue of the mature protein as determined by protein sequencing (underlined). The eDNA first classification of primates by Linnaeus', shown was cloned by PCR amplification using the flanking 20mers (underlined) as primers. The that an early branch of the 'primate' tree arrows above the eDNA sequence mark the two Gs missing in ref. 5. The arrow below the protein gave rise to the megabats via the inter­ sequences indicates the likely cleavage site of signal peptidase. The two following residues mediate, gliding dermopterans. Semantic form a short propeptide as in other members of the granzyme protease family". Conflicting precision in the definition of primates is amino-acid residues at positions 11, 14 and 19, and an extra residue after position 13 of 24 admirable, but in the present case it has PR-3/MB have been reported . obscured a fascinating relationship: that the amino-terminal seven residues of I are regulated by specific external the closest sister group of the living myeloblastin, a serine protease whose (immunological) activation signals at primates is a monophyletic lineage complementary DNA has been cloned from certain stages of differentiation. These comprising megabats and dermopterans promyelocytic leukaemia HL60 cells'. lineage-restricted neutral serine proteases (both those living and the extinct paro­ Inhibition of myeloblastin expression may also represent important extracyto­ momyids). by antisense oligonucleotides induces plasmic regulators of cellular proliferation J.D. PmiGREW terminal differentiation of monocyte­ and terminal differentiation in the Vision, Touch and Hearing Research granulocyte precursor cells and growth haematopoietic system. Indeed, there is Centre, arrest'. Starting at Met+ 15 (see figure), evidence that murine granzyme A can The University of Queensland, about half of the published myeloblastin act as an autocrine growth factor with Queensland 4072, sequence is the same as human neutrophil mitogenic activity for X-ray-induced T-cell Australia elastase along the entire sequence and has lymphomas'. 1. Martin, R.D. Nature345, 291-292 (1990). a strikingly well-conserved active-site Because most autoantibodies against 2. Beard, K.C. Nature345, 340-341 (1990). region. Although experimental evidence proteinase 3/myeloblastin interfere with 3. Kay, R.F., Thorington, R.W.·&Houde, P. Nature345, 342- 343 (1990). for the functional integrity of the catalytic its enzymatic function (data not shown), 4. Pettigrew, J.D. eta/. Phil. Trans. R. Soc. B325, 489-559 triad was provided, the leader peptide, excessive neutrophilic leukocytosis seen (1989). propeptide and the functionally important 5. Smith, J.D., Madkour, G. in Proc. 5th Int. Bat Res. Conf. (eds Wilson, D.E. & Gardner, A.L.) 347-365 (Texas Tech, amino terminus by comparison to the 1. Nolle, B. eta/. Ann. intern. Med.111, 28-40 (1989). Lubbock, 1980). elastase is completely missing. 2. Ludemann, J., Utecht, B. & Gross, W. L. J. exp. Med.171, 6. Cronin, J.E. & Sarich, V.M. in Comparative Biology and 357-362 (1990). Evolutionary Relationships of Tree Shrews (ed. Luckett, We reanalysed the published 5' 3. Niles, J.L. eta/. Blood74, 1888-1893 (1989). W.P.) 293-312 (Plenum, New York, 1980). sequence between base positions 21 and 4. Wilde, C.G. et a/. J. bioi. Chern. 265, 2038-2041 7. Baker, R.J., Honeycutt, R.L. & Van Den Bussche, R.A. (1990). 1990 in Festschrift for Karl Koopman (in the press). 92 by sequencing PCR-amplified eDNA 5. Bones, D. eta/. Ce//59, 959-968 (1989). 8. Linnaei, C. Systema naturae per regna tria naturae, and found two additional Gs (sec figure), 6. Jenne, D.E. & Tschopp, J. lmmun. Rev. 103, 53-71 secundum calsses, ordines, genera, species, cum charac• which extends the open reading frame (1989). teribus, differentiis, synonymis, locis. Tomas I. Editio 7 Bogenberger, J. & Haas, M. Oncogene Res. 3, 301-312 Decima, Reformata. Holmlae, lmpensis direct (Laurentii of myeloblastin and its similarity to the (1988). Salvii, Stockholm, 1758). 520 NATURE · VOL 346 · 9 AUGUST 1990 © 1990 Nature Publishing Group