Biogeography and Comparative Phylogenetics in Three Fish Species of the Eastern Guiana Shield

Bonnie Syme

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Ecology and Evolutionary Biology University of Toronto

Biogeography and Comparative Phylogeography in Three Fish Species of the Eastern Guiana Shield

Bonnie Syme Master of Science Department of Ecology and Evolutionary Biology University of Toronto

2018

ABSTRACT

Comparative phylogeography allows us to investigate the relative importance of species specific biological characteristics versus shared historical conditions on species diversification in a region by studying sympatric populations of different taxa. To examine species specific versus shared evolutionary trajectories of freshwater fishes in the Guiana Shield region of South America, I analyzed and compared the population structure of three co-distributed species of the weakly- electric fish genus Gymnotus using mitochondrial gene sequences (cytochrome b). Population analyses indicate that, generally, Gymnotus species show a lack of contemporary gene flow between drainages. The phylogenetic relationship of fish populations between drainages, however, is not congruent among species. These results suggest that, while historical geological events such as the formation of drainages are important for the diversification of freshwater fish species, individual biological attributes, such as dispersal ability, likely play an influential role as well.

Acknowledgments

First and foremost, this study would not have been possible without the assistance of colleagues who collected and generously provided the tissue samples used in this thesis.

Thank you to my supervisor, Dr. Nathan Lovejoy. Without his continuous support, positivity, and patience, in both the academic and personal aspects of this undertaking, I simply would not have been able to complete this project. His ability to both push me to my limits, as well as understand when I was uncomfortable with an aspect of the thesis, is something I appreciate beyond words. The timely completion of my thesis would also not have been possible without the support of the entire Lovejoy lab, whom I cannot thank enough. I owe a huge thanks to JP Fontenelle, for both helping to keep me sane with his endless wit and stories during long days in the office, and for being a boundless source of knowledge about all things phylogenetic and mapping and for always sharing that knowledge without hesitation;

Ahmed Elbassiouny, who patiently, and with a sense of humour, managed to take me from a clueless student with zero lab experience to a genetic mastermind (almost) and without whom I never would have come out of my shell and interacted with anyone at all, thanks for all those coffee breaks Ahmed; and finally to Katherine Balasingham, for being a comrade in learning how things work in the Lovejoy lab as a fellow newcomer at the time and for being a source of femininity in a lab otherwise dominated by men.

Thank you to my supervisory committee, Dr. Nicholas Mandrak and Dr. Marc Cadotte. Your feedback was invaluable.

Lastly, thanks to my friends and family, who continuously supported and encouraged me throughout this entire process. Erik, who was always there when I got frustrated, listened to my lamentations, and took me for walks when I lost motivation; my mother who would always pick up the phone when I needed her and who kept me on track; my father, who will always my role-model; and my brother who could always remind me that I could do this. Without them I would be nowhere.

iii

Table of Contents

Acknowledgments...... iii Table of Contents…………………………………………………………………………………iv

List of Tables ...... vi List of Figures ...... vii Chapter 1: INTRODUCTION...... 1 1.1 South American biogeography and the Guiana shield ...... 1 1.2 Comparative Phylogeography ...... 3 1.3 Gene flow and population genetic structure ...... 5 1.4 Range size and Genetic Structure ...... 5 1.5 Cryptic species ...... 6 1.6 Phylogeography and population structure of freshwater fishes of the Guianas ...... 7 1.7 Study taxon ...... 8 1.8 Objectives, Hypotheses and Predictions ...... 9 1.9 Significance ...... 11 Chapter 2: MATERIALS AND METHODS ...... 13 2.1 Mapping and Drainage Divisions ...... 13 2.2 Taxon Sampling ...... 14 2.3 DNA Extraction ...... 15 2.4 Polymerase Chain Reactions and Sequencing ...... 16 2.5 Sequence Alignments and Matrices ...... 17 2.6 Phylogenetic Analysis ...... 18 2.7 Haplotype Analysis ...... 18 2.8 Calculating Genetic and Geographic Distance Between Samples ...... 19 2.9 Statistical Correlation Analyses ...... 20 Chapter 3: RESULTS ...... 21 3.1 Phylogeny ...... 21 3.2 Population structure and phylogeography ...... 21 3.2.1 G. carapo occidentalis ...... 22 3.2.2 G. carapo carapo ...... 22 3.2.3 G. coropinae ...... 23 3.2.4 Gymnotus anguillaris ...... 25

3.3 Correlation between genetic distance and geographic distance ...... 25 3.4 Cryptic species ...... 27 Chapter 4: DISCUSSION ...... 28 4.1 Population structure of eastern Guiana Shield Gymnotus species ...... 28 4.2 Historical biogeography and comparative phylogeography of Gymnotus carapo, Gymnotus coropinae and Gymnotus anguillaris ...... 34 4.3 Relationship between range size and population structure ...... 38 4.4 Presence of cryptic species...... 40 4.5 Conclusions, Limitations and Future Directions ...... 41 References ...... 44 Tables ...... 56 Figures……………………………………………………………………………………………64

List of Tables

Table 1. Gymnotus specimens included in this study…………………………………………57

Table 2. Primers used in this study……………………………………………………………63

Table 3. Summary statistics for study taxa……………………………………………………63

List of Figures

Figure 1. Relative position (inset) and map of the Guiana Shield…………………...………….64

Figure 2. The drainages of the Guiana Shield of Guyana, Suriname and French Guiana from which study fish were collected………………………………………………………………….65

Figure 3. Hypothesized areas of movement between basins of the Guiana Shield……………..66

Figure 4. Generalized range of Gymnotus carapo, G. coropinae and G. anguillaris..…….……67

Figure 5. Collection sites of Gymnotus carapo from the Guiana Shield……………….……….68

Figure 6. Collection sites of Gymnotus coropinae from the Guiana Shield…………………….69

Figure 7. Collection sites of Gymnotus anguillaris from the Guiana Shield……………………70

Figure 8. River network map used to calculate geographic distance between samples…………71

Figure 9. Cytb gene tree showing relationships between study species included in the thesis…72

Figure 10. Cytb gene tree showing relationships between drainage populations of G. carapo occidentalis and G. carapo carapo………………………………………………………………73

Figure 11. Geographic drainage distribution of G. carapo occidentalis haplotypes……………75

Figure 12. G. carapo occidentalis haplotype network……………………………………….….76

Figure 13. Geographic drainage distribution of G. carapo carapo haplotypes…………………77

Figure 14. G. carapo carapo haplotype network…………………………………………….….78

Figure 15. Cytb gene tree showing the relationships between drainage populations of G. coropinae…………………………………………………………………………………….…..79

vii

Figure 16. G. coropinae haplotype networks...... 80

Figure 17. Geographic drainage distribution of G. coropinae haplotypes………………………81

Figure 18. Cytb gene tree showing the relationships between drainage populations of G. anguillaris………………………………………………………………………………………..74

Figure 19. G. anguillaris haplotype networks………………………………………………..…82

Figure 20. Geographic drainage distribution of G. anguillaris haplotypes………………..……83

viii

Chapter 1

INTRODUCTION

1.1 South American biogeography and the Guiana shield

The continent of South America has remarkable levels of biodiversity with a complicated evolutionary history. This biogeographically diverse continent contains five of the worlds biodiversity “hotspots” and is composed of a variety of different biomes and ecoregions (Myers et al. 2000, Morrone 2006). Historically, the origin of this high biodiversity has been of interest to both biogeographers and evolutionary biologists (Wallace 1853), and recent renewed focus on biodiversity origins has emerged due to the integration of molecular genetic tools (Riddle et al.

2008, Turchetto-Zolet et al. 2013). This region is particularly interesting to study biogeographically, as it was not covered by ice during the last period of major glaciation, allowing Neotropical species ample opportunity for habitat specialization and/or vicariance

(Cracraft and Prum 1988, Bush 1994, Hasbun et al. 2005, Brumfield and Edwards 2007, Mila et al. 2009). Neotropical rivers contain more than 6000 of the world's approximately 13,000 freshwater fish species (Reis et al. 2004). Historical changes in river connections and drainage patterns are thought to have contributed to this extreme level of diversification (Lundberg et al.

1998).

The Guiana shield is an approximately 1.7 billion-year-old Precambrian geological formation located in the northeastern part of South America, encompassing the south-eastern section of

Venezuela, parts of north-eastern Colombia, northern Brazil, and almost entirely covers the countries of Guyana, Suriname and French Guiana (Figure 1). Bounded to the north and east by the Orinoco River, to the south by the Amazon basin, and to the east by the Atlantic Ocean, the

2 region covers approximately 2 288 000 km2 of land (Hammond 2005). The shield is geologically complex, and contains widely varying elevations composed of lowlands (roughly 150-500 m above sea level (asl)) and uplands (roughly 500-1500 m asl) (Kok 2013). The Guiana shield is also the location of the tepuis, which are vertical-sided table mountains classified as being at least 1200 m asl, some of which rise up to 2800 m above sea level (Kok 2013).

Forty-seven major rivers currently contribute to the major Guiana drainages, and have gone through many changes throughout the history of the region (Figure. 2). The headwaters of the

Amazon, Orinoco, Essequibo and their predecessors have long been embedded in the Guiana shield and these rivers drain large parts of this region (Lujan and Armbruster 2011). The Berbice

River was once one of the largest rivers in the region, but has shrunk from its original due to geological changes in the area during periods of Andean uplift in the Miocene, and is now dwarfed by its former tributaries the Essequibo and the Corentijne to its northwest and southwest, respectively (Lujan and Armbruster 2011). The Mazaruni and Cuyuni rivers, tributaries of the Essequibo River, historically exited to the Atlantic via their own mouths, and were only recently linked to the Essequibo river (Lujan and Armbruster 2011). The

Tumucumaque Mountain range forms the southern borders of Suriname and French Guiana and north of this divide, in order from west to east, flow the Corentijne (68, 600 km2), Coppename

(21, 900 km2), Suriname (17, 200 km2), and Maroni (70, 000km2) rivers (Lujan and Armbruster

2011). Finally, draining the eastern slope of the eastern Guiana Shield is the Oyapock River (32,

900 km2), which forms the border between French Guiana and Brazil, and the Approuague River

(10, 250 km2) just to its northwest inside French Guiana (Lujan and Armbruster 2011). Smaller tributaries flow into many of these rivers, creating networks of freshwater systems within each of the drainages. A key geographical pattern is that most of these major rivers flow independently

3 into the Atlantic, with no inland freshwater connections between them. However, there are a few hypothesized exceptions to this lack of inland connectivity, based on biogeographic evidence

(Figure. 3, Lujan and Armbruster 2011 and sources within). One of these exceptions is the

Rupununi Portal, which is created via seasonal flooding of the Rupununi Savanna. This flooding creates a seasonal inland freshwater corridor between the Essequibo River and the Rio Branco (a tributary of the Amazon). Studies of many freshwater fishes, including Loricariids,

Hypostomines, Osteoglossum bicirrhosum, Arapaima gigas, Potamorrhaphis, and Cichla ocellaris, demonstrate the use of the Rupununi Portal as a dispersal route (Vari 1987, Sabaj et al.

2008, Lovejoy and Araujo 2000, Willis et al. 2007, Lujan and Armbruster 2011).

The wide range in elevations, complex freshwater river and stream networks, and the fact that the shield is covered by the largest stretch of undisturbed tropical rain forest in the world

(>90% undisturbed), make the Guiana Shield region one of the most biodiverse and unexplored areas on the planet (Huber and Foster 2003, Hammond, 2005). The region is home to at least

1168 species of freshwater fishes, 269 species of amphibians, 295 species of reptiles, 1004 bird species and 282 mammal species (Hollowell and Reynolds 2005, Vari et al. 2009). How and when this massive diversity arose is an area of considerable interest, and biogeographic analyses based on DNA sequences promise to shed light on diversification patterns and processes in this region.

1.2 Comparative Phylogeography

A refinement in the study of historical biogeography is the comparison of the population structure of broadly co-distributed species, which is commonly referred to as comparative phylogeography (Cracraft 1989, Avise 2000). Although phylogeographic studies have steadily shown the dominating influence of demographic and historical events on the formation of

4 contemporary patterns in the genetic structure of species populations, the fundamental goal of comparative phylogeography is to determine the relative importance of species-specific biological characteristics vs shared environmental conditions on lineage diversification in a region (Zink 1996, Starkey et al. 2003). Comparative phylogeography allows us to examine how shared historical situations have shaped the formation of lineages by studying co-distributed populations of different taxa.

Since similarly distributed taxa share a climatic and geological history, they should be challenged by the same restrictions to gene flow. Therefore, analogous patterns of contemporary biogeography suggest that extrinsic factors play a large role in contemporary diversity patterns due to similar responses of species to past geological and climatic events (Sullivan et al. 2000).

These spatially and temporally congruent patterns, across multiple independent species, indicates a shared history of responses to the same prevailing events (Rosen 1978, Nelson and Platnick

1981, Ronquist 1997, Bermingham and Moritz 1998). The alternative hypotheses, that species respond independently to shared Earth history events, arises from the idea that the intrinsic differences in biological attributes of the species would allow them to find different solutions to similar situations (Cunningham and Collins 1994, Bermingham and Martin 1998, Avise 2000,

Donoghue and Moore 2003, Gamble and Simmons 2008). Analogous patterns of phylogenetic structure across multiple species are particularly interesting because, while a genetic break within one species may occur by chance, similar genetic breaks across multiple species signifies a major barrier to gene flow (Kuo and Avise 2005). Comparative phylogeographic studies provide a key means of elucidating the relative influence of shared Earth history events on contemporary biodiversity and allow us to form a basis for historical inferences (Bermingham and Martin 1998, Avise 2000, Arbogast and Kanagy 2001, Hickerson et al. 2010).

1.3 Gene flow and population genetic structure

Studies of genetic population structure provide valuable insight for understanding species evolution, as they provide an indication of whether populations have embarked on separate evolutionary courses (strong genetic structuring), or whether they remain linked by gene flow

(weak genetic structuring). The geographic patterns of genetic structure within a species can provide valuable insight into both the historical and modern connectivity between populations

(Avise et al. 1987, Slatkin 1987, Avise 2000). This connectivity is affected by factors such as ecological and geographic impediments to movement, as well as the ability of individuals to disperse between populations (see section 1.4 below). Species capable of dispersal among habitat patches are generally widespread and show fairly weak genetic structuring, whereas the population structure of poor dispersers is comparatively strong and is more likely to be determined by surrounding landscapes features. Strong phylogeographic breaks, or sharp intraspecific genetic differences, occur where past and/or present barriers to dispersal allow continued genetic differentiation and prevent gene flow within a species (Avise et al 1987,

Wares 2002, Jacobs et al. 2004).

1.4 Range size and Genetic Structure

An organism’s ability to disperse is one of the most commonly proposed determinants of a species range (Hanski et al. 1993, Brown et al. 1996, Gaston 1996, 2003). Species with strong dispersal abilities are predicted to be able to overcome many of the geographic barriers that impose species range limits better than species with poor dispersal abilities. Hence, dispersal ability has been proposed as an explanation for range-size variation in terrestrial and marine systems and for a wide range of taxa, including insects (Gutierrez and Menendez et al. 1997,

Malmqvist 2000, Brandle et al. 2002), plants (Clerke et al. 2001, Lloyd et al. 2003, Lowry and

Lester 2006), fishes (Goodwin et al. 2005, Lester and Ruttenberg 2005, Mora and Robertson

2005) and mollusks (Paulay and Meyer 2006).

Species with individuals capable of dispersal among habitat patches generally show fairly weak genetic structuring, whereas the population structure of poor dispersers is relatively strong, and is more likely to be determined by surrounding landscape features (Papadopoulou et al.

2009). Therefore, if species with small ranges are indeed poor dispersers, then it is expected that they will also show strong genetic structuring between different populations due to the inability of individuals to regularly traverse between populations. The opposite should also hold true, if species have large ranges, because of strong dispersal ability, they may also be expected to have weak population genetic structure due to large amounts of gene flow occurring between populations.

1.5 Cryptic species

Taxonomists have made great strides in documenting the alpha-taxonomy of megadiverse tropical regions. However, nearly all of this work has been done using traditional morphological approaches and current assessments of biodiversity in the tropics may be underestimated because species-level evolutionary divergence in the genome are not always reflected in the phenotype

(Rusello et al. 2005, Bickford et al. 2007). This phenomenon is referred to as cryptic speciation.

Cryptic species have been detected across a range of taxa (e.g., Peppers and Bradley 2000,

Marks et al. 2002, Palma-Silva et al. 2009, Muellner et al. 2010, Scotti-Saintagne et al 2013a), and may be especially common in the tropics (Bickford et al. 2007). The current literature on cryptic species mainly focuses on birds, amphibians and reptiles (e.g., Fouquet et al. 2007,

Guergas et al. 2010, Fouquet et a. 2012, Gamble et al. 2012). The lack of studies on potential cryptic lineages in the neotropical ichthyofauna is surprising, as the confinement of fish lineages to waterways may increase the potential of genetic divergence. This knowledge gap should be addressed because maintaining an accurate taxonomy in a region is important for creating effective conservation efforts, especially for those focusing on individual species as representatives of distinct evolutionary histories (Mace 2004).

1.6 Phylogeography and population structure of freshwater fishes of the Guianas

Phylogeographic studies of South American fishes are hampered by a lack of collections, which has led to a lack of studies. This problem, of amassing samples, has been particularly detrimental for conducting phylogeographic studies in the Guiana shield region, as most of this region is difficult to access, with few or no roads leading to important habitats. Biogeographic studies have been especially slowed by the scarcity of collections from headwaters throughout the Guiana Shield. Furthermore, most molecular phylogenetic studies that attempt to include

Guiana Shield populations, including those of Potamorrhaphis (Lovejoy and Araujo 2000), prochilontids (Turner et al. 2004, Moyer et al. 2005), and Cichla (Willis et al. 2007) are based on lowland taxa that are thought to be proficient dispersers, and are therefore less likely to resolve fine-scale biogeographic patterns within the Guiana Shield. Lujan and Armbruster (2011) provided biogeographic hypotheses for the Guiana shield region, but their review is based on the highly diverse loricariid catfishes and their species-level phylogeny is incomplete. Others (e.g.

Sidlauskas and Vari 2012, Vari and Ferraris 2009) consider areas of endemism across the shield region, but do not incorporate phylogenetic data.

A recent paper by Lehmberg et al. (accepted) examined upland and lowland specimens of the freshwater fish Gymnotus carapo in Guyana and Suriname and found that the rapids and waterfalls, which separate the lowland areas from the highlands, presented biogeographic boundaries for the fish. This thesis expands upon Lehmberg et al. (accepted) by examining and comparing the genetic structure of three Gymnotus species, spanning Guyana to French

Suriname, greatly expanding localities and allowing for a broader examination of the biogeography of the Guiana shield.

1.7 Study taxon

This study focuses on species of the genus Gymnotus, one of the most diverse genera from the teleost order Gymnotiformes. The Gymnotiformes is a clade of ostariophysan fishes that are most closely related to catfishes (Fink and Fink 1981, 1996). Most species produce distinct

Electric Organ Discharges (EODs), and these species-specific EODs makes them an ideal model organism for examining genetic, behavioural, and morphological diversification. Gymnotiformes are substantially more diverse than historically assumed, with the number of valid species increasing from 94 to 135 in the past 10 years (Fernandes-Matioli and de Almeida-Toledo 2001,

Albert and Crampton 2003, Crampton et al. 2004a,b, Albert and Crampton 2005). The Guianas-

Orinoco region of South America contains 32% of gymnotiform species, a disproportionately high species richness for its geographic size (Albert and Crampton 2005).

The genus Gymnotus is a good model for investigating the origins and evolution of species in the Neotropics (Albert and Crampton 2006, Lovejoy et al. 2010, Crampton et al. 2011).

Gymnotus is ecologically diverse, with species inhabiting a wide variety of aquatic habitats, and the genus occurs in all major river systems of the Neotropics (except the Maracaibo Basin),

9 ranging from the Pampas of Argentina to southeastern Chiapas, Mexico (Albert 2001, Albert and

Crampton 2005). The phylogeny of the 40+ species of Gymnotus is reasonably well understood

(Lovejoy et al, 2010; Crampton et al., 2013). Current Gymnotus distributions and phylogenies indicate an origin of the genus before the late Middle Miocene uplift of the northwestern Andes, making species of Gymnotus excellent model organisms with which to study historical biogeography of South America.

For this project, I investigate the phylogeography of three species of Gymnotus distributed in the eastern Guiana Shield region-- G. carapo, G. coropinae, and G. anguillaris, focusing on samples from the Atlantic draining rivers of Guyana, Suriname, and French Guyana. While these three species occur sympatrically in the Guiana shield region, they have distributions of differing sizes. G. anguillaris has the smallest range and has only been recorded in Guyana, Suriname and

French Guiana (Figure 4). The range of G. coropinae overlaps that of G. anguillaris, however it has also been found in Peru, Brazil and possibly Colombia (Figure 4). The most widely distributed of the study species is G. carapo, with a range that spans much of northern South

America (Figure 4). While I focus on specimens collected solely from the eastern Guiana shield region for my study, the differing overall distributions of these fishes provide predictions regarding phylogeographic patterns in these species.

1.8 Objectives, Hypotheses and Predictions

The overall goal of my thesis is to investigate the population structure and biogeography of

Gymnotus carapo, G. coropinae, and G. anguillaris species in the eastern Guianas region.

Investigations of these species should increase understanding of the complex biodiversity of the

Guiana shield region of South America, and provide insight regarding the relationship between range size and population structure.

Objective 1: Determine and compare phylogeographic and biogeographic patterns of eastern Guiana shield Gymnotus anguillaris, G. coropinae, and G. carapo.

I analyze sequence data from a mitochondrial gene (cytochrome b) for multiple individuals of each species distributed across the study region. I use multiple approaches to visualize and interpret the distribution of mitochondrial haplotypes across the landscape: phylogenetic trees, haplotype networks, and maps of haplotype distributions. Patterns of congruent phylogeographic and biogeographic structuring should indicate similar responses to shared historical geographic events (Donoghue and Moore 2003). This phenomenon is expected to be common in taxa that are both ecologically and phylogenetically similar, due to their co-dependence on similar habitats

(Bermingham and Martin 1998, Feldman and Spicer 2006). Although the strength of population genetic structuring may differ due to biological differences in dispersal ability, I believe that the overall geographic patterns of genetic structuring will be congruent between my study species due to a strong overarching role of similar responses by the species to historical events.

Objective 2: Determine whether population structure is correlated with overall species range size.

It has been suggested that taxa with large geographic ranges have superior dispersal abilities compared to taxa with small ranges (Lester and Ruttenberg 2005, Mora and Robertson 2005,

Lester 2007). If this is the case, then we should expect differences in genetic structure across species that have different range sizes. I hypothesize that the species with larger overall range sizes have less population structure (more gene flow) and species with smaller range sizes will

11 have more population structure (less gene flow). Thus, I predict that G. carapo should have the least population structure and G. anguillaris should have the most. I assess the geographic patterns in genetic structure using two approaches: (1) qualitative observations of haplotype sharing between different drainages, and (2) statistical examination of the correlation between geographic distance (river distance) and genetic distance.

Objective 3: Determine the presence of any cryptic species in eastern Guianas Gymnotus.

I suspect that that the diverse and complex geology of the eastern Guiana shield region has led to a long-term lack of gene flow between some populations, resulting in the origin of previously undetected cryptic species. I examine my molecular dataset for the presence of discrete genetic lineages that likely represent cryptic species.

1.9 Significance

As concern grows over the destruction of tropical rainforests, the consequences of climate change, and the global decline of species richness, it is essential that we attempt to better understand the scope and history of intensely biodiverse regions such as the tropical rainforests of South America (Laurance et al. 2002, De Silva et al. 2005, Laurance 2007, Rull and Vegas-

Vilarrubia 2006, Avise et al. 2008, Balakrishnan 205). Despite the rise in anthropogenic perturbations of aquatic and terrestrial ecosystems making the Amazonian region a priority for conservation efforts, biogeographical patterns among Neotropical fishes and the underlying forces that generated these patterns are still far from being understood (Myers et al. 2000,

Verissimo et al. 2002, Ferraz et al. 2003). While an increasing number of phylogeographic studies focusing on South America are being published, the number remains insufficient to promote the formation of conclusive hypotheses regarding the geographic history of the region.

This points to a crucial need for more historical biogeographic and phylogeographic studies to be conducted to assess how species responded to past changes and to predict how they may cope with current changes. Comparative phylogeography provides a means by which to assess the degree to which the members of a particular biotic assemblage have responded to past climatic and geographic events congruently or independently, providing a possible model with which to base how species will respond to current environmental disturbances (Avise 1992, 1998, Riddle

1996, 1998, Zink 1998). Furthermore, understanding congruencies in spatial patterns of genetic structuring among species can provide useful metrics for identifying regions of evolutionary significance to help prioritize regions for conservation as well as provides predictions about patterns of genetic variation for co-distributed taxa that have yet to be sampled (Moritz and Faith

1998, Moritz 2002). Thus, comparative phylogeography allows the integration of historical and ecological biogeography (Riddle 1996).

Chapter 2

MATERIALS AND METHDOS

2.1 Mapping and Drainage Divisions

Drainage basin data for South America were obtained from the USGS HydroSHEDS database and mapped using QGIS software. Drainages located in Guyana, Suriname and French

Guiana were then selected and visually inspected to ensure that recognized drainages did not exhibit inland connections between rivers and streams. Areas that had been outlined by

HydroSHEDS as distinct “drainages”, but that had inland riverine connections to other

“drainages” were combined and categorised as a single drainage. Therefore, in this study, drainages are classified as regions of river/stream connectivity in which freshwater fishes could reasonably be expected to disperse throughout, although barriers such as rapids and waterfalls could still exist as barriers within drainages. The fish samples that were available for this research had been collected on various expediations from a total of seventeen un-connected drainages. These drainages are referred to as Coppename, Oyapock, Commewijne/Maroni,

Mana, Approuague, Cottica, Essequibo/Mazaruni, Suriname River, Waini, Akawini, Demerara,

Rio-Branco, Berbice, Corentijne, Mahury, Surinamary and Saramacca drainages (Figure 2).

Elevations at which individuals were collected were categorized as either lowlands

(roughly 150-500m asl) or uplands (roughly 500-1500m asl) (Kok 2013). To determine into which elevational category each individual sample belonged to, the latitude and longitude of the collection site was plotted on a map using QGIS software and elevational maps acquired from

DivaGIS.

2.2 Taxon Sampling

Tissues of Gymnotus collected from the Guiana Shield region were obtained from various academic and museum collections in the Americas and Europe (Table 1). These tissues were collected over many collection trips undertaken by the Royal Ontario Museum, University of

Kansas Natural History Museum, Natural History Museum of Geneva, Florida Museum of

Natural History, Auburn Museum of Natural History, and Academy of Natural Sciences of

Drexel University. In total, tissues were obtained for 219 individuals of Gymnotus from drainages across the Guiana Shield (Table 1, Figure 5,6,7).

Samples of G. carapo were the most abundant, with tissue from 121 fish individuals collected from the river systems of Guyana, Suriname and French Guiana (Figure 5). Tissues were obtained from fishes located in all 17 of the recognized drainages in this study (Table 1).

The number of G. carapo tissues obtained from each drainage was not equal, with the most samples being collected from the Essequibo/Mazaruni drainage, while only one sample was collected from the Oyapock drainage. Tissues from fish in both the uplands of western Guyana and the lowlands were collected for G. carapo, as well as a single sample collected from the

Tafelberg tepui in Suriname. In a recent paper by Craig et al. (2017) Gymnotus carapo was divided into several subspecies based on morphological analysis of variation across the species range. According to Craig et al. (2017), two subspecies occur in eastern Guyanas region: G. carapo carapo (known from Atlantic coastal drainages of Suriname and French Guiana, the

Lucie, Suriname, and Corantijn rivers in Suriname, and all rivers of French Guiana) and G.

15 carapo occidentalis (known from the western Amazon basin in Brazil, Peru, the Cuyuni-

Mazaruni in the Essequibo basin of Guyana and the Napo basin in Ecuador). Furthermore,

Lehmberg et al. (accepted) showed that one mitochondrial and one nuclear gene indicate that these subspecies are genetically distinct. Thus, in this thesis, these two subspecies are treated as separate units.

Sixty nine tissues were obtained for G. coropinae. The majority of these samples were collected from Guyana and Suriname, with only two samples collected from French Guiana

(Figure 6). Tissue samples of G. coropinae were from collection sites located in nine of the seventeen recognized drainages, predominantly from the Essequibo/Mazaruni drainage (Table

1). The remaining samples had been collected from the Commewijne/Maroni, Cottica, Suriname

River, Rio-Branco, Berbice, Corentijne, and Saramacca drainages (Table 1). None of the G. coropinae tissue had been collected from fish located in the Guyana uplands.

Only 29 samples of G. anguillaris were found in the ichthyology tissue collections. These samples had been collected in rivers and streams from the Coppename, Oyapock,

Commewijne/Maroni, Mana, Approuague, Cottica, and the Essequibo/Mazaruni drainages

(Figure 7, Table 1). The bulk of G. anguillaris samples had been collected from fish located in

French Guiana and, particularly, from the Mana drainage. All G. anguillaris tissue samples had been collected from fish in lowland regions, with the exception of two samples collected from the Tafelberg tepui (Table 1).

2.3 DNA Extraction

Tissue extractions were executed with Qiagen DNEasy Blood and Tissue kits. The

Qiagen protocols for purification of total DNA from animal tissues (spin-column protocol) were

16 used. Elution of extracted DNA was repeated as recommended for maximum yield. Only a small portion of the available tissue was used for each extraction in order to allow for study replication.

Extracted DNA was stored in a freezer at -20 °C until it was needed for amplification.

2.4 Polymerase Chain Reactions and Sequencing

The mitochondrial gene cytochrome b (cytb) was amplified using Polymerase Chain

Reactions (PCR). Several features of mitochondrial DNA (mtDNA) make it particularly suitable for examining geographical distributions of evolutionary lineages such as uniparental inheritance, a relatively rapid rate of evolution, and rapid geographical sorting and genetic divergence of populations in the absence of gene flow (Avise et al. 1987, Brown et al. 1982).

The cytb gene is the most commonly used molecular marker for phylogeographic studies of fishes, and has been used previously to investigate population structure in Gymnotus carapo

(Lehmberg et al. accepted).

PCRs were conducted using 25 µL reaction volumes made up of 2.0 µL of extracted

DNA, 14.8 µL of de-ionized water (ddH2O), 2.5 µL of Taq polymerase buffer KCl-MgCl2. 2.0

µL MgCl2, 1.5 µL of 10 µM deoxyribonucleotide triphosphates (dNTPs), 1.0 µL of 10 µM forward primer, 1.0 µL of 10 µM reverse primer, and 0.2 µL of Taq polymerase. Universal vertebrate primers GLUDG.L and cytbR were the most commonly used in this project. Primers specific to Gymnotus were used for G. anguillaris tissue samples 10544, 10545, 11895, 10471,

12799, 12800 and 12809 that were difficult to amplify (see Table 2 for primers used).

Thermocycler conditions were conducted using the following protocol: 95 °C for 30s to denature

DNA, 50 °C for 60s to anneal DNA and 72 °C for 90s to elongate. This cycle was repeated 95 times, followed by 300s at 72 °C for further extension.

All PCR products were visualized using gel electrophoresis. Products were run on a 0.8% agarose gel preloaded with 2.5 µL of Amresco EZVision in-gel stain. 5.0 µL of DNA was pipette-mixed with 2.0 µL of Thermoscientific 6x loading dye. The electrophoresis was run for

30 minutes at 80 Volts and 70 milliAmperes.

To purify PCR products, 0.2 µL exonuclease I (EXOI) and 0.2 µL calf intestinal alkaline phosphatase (CIAP) were added to each sample and incubated at 37˚ C for 30 minutes. Samples were then heated to 80˚C for 15 minutes and cooled to room temperature. Purified product was then sent to SickKids Centre for Applied Genomics in Toronto for sequencing.

2.5 Sequence Alignments and Matrices

Forward and reverse sequences for each individual were imported into Geneious 6.1.7 and aligned using the highest sensitivity of the de novo assembly function. Sequences were then manually edited, and contigs were generated using the consensus between the forward and reverse sequences. Once contigs were generated for all individuals of all study species, multiple sequence alignments were performed using the CLUSTALW algorithm with the following parameters: gap opening cost of 10, gap extension cost of 20, and free end gaps imposed. Once the alignment was completed, the ends of the sequences were trimmed to provide a final alignment matrix of 1000 bp for 219 individuals. This alignment was then exported to Mesquite

(Maddison and Maddison 2017) in FASTA file format for editing. No insertions or deletions were noted. Multiple sequence alignments were also completed for each individual species separately using the above steps. Mesquite was used to convert the alignments to nexus and phylip file formats, which were then saved for use in phylogenetic and haplotype analyses.

2.6 Phylogenetic Analysis

For phylogenetic analyses, the complete cytb alignment containing all study species was used, with the addition of Gymnotus cylindricus as an outgroup.

This dataset was analysed using PartitionFinder (Lanfear et al. 2016) to determine the most appropriate partition schemes and model of molecular evolution for each partition, based on the Akaike Information Criterion (AIC). Based on PartitionFinders results, the gene was not partitioned for the phylogenetic analyses and the GTR+G+I model of molecular evolution was used for all three codon positions. Bayesian and maximum likelihood analyses were conducted using MrBayes (Huelsenbeck et al. 2001), and IQTree (Nguyen et al 2015, Hoang et al. 2017) respectively. The Bayesian analysis was run for 60 million generations, at which point the average standard deviation of split frequencies was below 0.01 indicating that the algorithm has settled around an optimal tree space. For the maximum likelihood analysis, a total of 100 searches were used to generate the best ML tree, and node support was estimated by 1000 bootstrap values.

2.7 Haplotype Analysis

Haplotype analyses were completed separately on each of the four study taxa. As described below (Results section 3.4), we determined that several samples initially identified as

Gymnotus anguillaris appear to actually represent an undescribed species referred to as

Gymnotus n.sp. CARO (Maxime, 2013). These G. n.sp. CARO samples were excluded from the

G. anguillaris haplotype analyses.

Nexus alignments were edited in Mesquite to ensure that sequence lengths were identical for each individual within each taxa, and ambiguity codes within sequences were changed to

19 unknowns (a requirement for the analyses conducted). This resulted in alignments containing sequence segments of 903 bp, 971 bp, and 864 bp for G. carapo subspecies, G. coropinae and G. anguillaris respectively. These edited alignments were then uploaded into PopART (Leigh and

Bryant 2015) for haplotype reconstruction and network analyses. For each species, a TCS network was computed (Clement et al. 2000). Nucleotide diversity was also calculated for each species within PopART.

Pie charts were made in Excel to illustrate the proportion of each haplotype present in each drainage for each species.

2.8 Calculating Genetic and Geographic Distance Between Samples

Using MEGA7 (Kumar et al. 2015), uncorrected pairwise distances between all sequences were calculated for each of the study taxa. These genetic distances were then saved as matrices for further analysis (see Tables 1A-4A in Appendix 1).

Geographic distances between all samples of each study taxon were calculated as the distance along freshwater pathways, rather than straight-line Euclidean distances. This geographic river distance is a more accurate measurement of geographic distance between samples, because of the requirement for fishes to disperse via aquatic pathways. River distances between individual samples were computed using a combination of mapping in QGIS and statistical programs in R. River network data was acquired for South America from the USGS

HydroSHEDS database. These data were mapped in QGIS, and the projection was set to

WGS84/ UTM zone 21N. A shape file containing the river networks of only the Guiana Shield region was imported into R. In R packages “rgdal” (Bivand et al. 2017) and “riverdist” (Tyers

2017) were used to create a continuous river network in which distance could be measured along.

All river segments that contain a sample must be connected to at least one other river segment for distance to be calculated between samples, and so connections between drainages were made via the Atlantic coast using the “rgdal” package in R. Only one inland connection was made between drainages-- a connection between the Rio-Branco and Essequibo drainages via the

Rupununi savannah, which provides seasonal connectivity between these river systems (Lovejoy and Araujo 2000, Turner et al. 2004, Willis et al. 2007, Albert and Reis 2011, De Souza et al.

2012). Figure 8 illustrates the final river network map used to calculate between sample river distance. Latitude and longitude coordinates of each individual fish were then converted into

UTM coordinates, with UTM zone set to 21N. These coordinates were uploaded into R, plotted onto the river network map, and the river distance between each individual sample was calculated. These geographic river distance values were then saved as matrices for further analyses (see Tables 5-8 in Appendix 1).

2.9 Statistical Correlation Analyses

Genetic distance matrices and geographic river distance matrices were uploaded into an R workspace separately for each of the four study taxa. Using the “vegan” package (Oksanen et al.

2017), a Procrustes analysis was conducted to determine the correlation between genetic and geographic distance. This was followed by the use of the PROTEST function to evaluate the significance of any correlation. Residuals of the Procrustes analysis were examined for each species to determine whether any specific sample was strongly influencing the outcome of the analysis.

Chapter 3

RESULTS

3.1 Phylogeny

Final maximum likelihood trees and Bayesian trees were created using a combined alignment of the cytb sequences collected from all three species of sample fish (Figure 9).

Sequences were 1023 base pairs in length, and 224 taxa were included in the alignment.

Within G. carapo, G. carapo occidentalis was found to be monophyletic (Figure 10).

However, G. carapo carapo was not monophyletic, with a clade of five "G. carapo carapo" individuals branching before the split of the rest of G. carapo carapo and G. carapo occidentalis

(Figure 10).

G. coropinae was found to be monophyletic, and this species clade exhibited a Bayesian posterior probability of 1 (Figure 9).

In specimens initially identified based on morphology as G. anguillaris, I detected deep genetic divergence between two well-supported and monophyletic lineages (Figure 9, Figure 18).

One of these lineages contains samples of G. anguillaris that have been conclusively identified as this species based on morphological identification, whereas the other lineage appears to be genetically distinct and is referred to as G. n sp. CARO for the remainder of this thesis (see section 3.4 below). These G. n. sp. CARO samples were removed from the G. anguillaris alignment for further analyses.

3.2 Population structure and phylogeography

Table 3 provides summary statistics for each fish taxon analyzed, including sample number, number of parsimony informative sites, number of haplotypes, and within-species nucleotide diversity.

3.2.1 G. carapo occidentalis

The tree of individuals within the subspecies Gymnotus carapo occidentalis (Figure 10) is mostly unresolved. Individuals do not form monophyletic lineages based on their drainage, with the exception of two individuals (10452 and 10453) from the Berbice drainage. These two individuals were collected from a lowland site, whereas nearly all other samples are from upland localities (Figure 10).

Within the G. carapo occidentalis subspecies, extensive haplotype sharing between drainage populations is evident (Figure 11). Haplotype 2CO appears to be the most prevalent haplotype in both the Essequibo/Mazaruni drainage as well as in the Rio-Branco drainage, and haplotype 3CO is found in the Berbice drainage as well as being the second most abundant haplotype in the Essequibo/Mazaruni drainage (Figure 11). None of the haplotypes found in these fishes appear to be distantly related, with the most divergent haplotype only differing from its closest relative by 4 nucleotide changes (Figure 12). No genetic population structuring is seen across the geographic distribution of the fishes within this subspecies.

3.2.2 G. carapo carapo

Similar to G. carapo occidentalis, no distinct clades based on drainage were observed for the G. carapo carapo (Figure 10). No apparent population structure can be perceived when phylogenetic relationships were examined between these fish; rather, individuals appear to be distributed throughout the phylogenetic tree regardless of drainage (Figure 10).

Haplotype analysis of G. carapo carapo revealed moderate levels of population structure with low levels of haplotype sharing among the populations of this subspecies (Figure 13). For example, haplotype 11CC is distributed across almost the entire study region and is found in fishes sampled from Guyana, Suriname and French Guiana (Demerara, Saramacca, Suriname

River, Commewijne/Maroni and Mahury drainages) (Figure 13,14). In many of these drainages, haplotype 11CC is either the only haplotype present in these populations, or is the most common haplotype found in the population (Figure 13). Haplotype 5CC also reveals evidence of further haplotype sharing between drainage populations. 5CC is the only haplotype present in the coastal drainage of Akawini and is also found in fishes from the Suriname River drainage population

(Figure 13). The Suriname River drainage appears to retain the largest number of haplotypes, with a total of 5 (Table 1). The remaining populations are all made up of single haplotypes

(Figure 13, 14). There appears to be little, if any, geographical patterns found within the haplotype network for G. carapo carapo, with haplotypes of varying relations to each other spread amongst drainages (Figure 14).

3.2.3 G. coropinae

The genetic relationships between drainage populations is much more apparent for G. coropinae than for either G. carapo occidentalis or G. carapo carapo. There appears to be strong geographic structuring of the genetic composition of the fish in the different drainage populations, resulting in very clear drainage-based monophyletic lineages (Figure 15). Both the haplotype network (Figure 16) as well as the phylogenetic tree (Figure 15) show similar patterns in relationships between populations located in different drainages. The earliest diverging lineages in the tree consist of a mixture of fish from the populations in the Essequibo/Mazaruni,

Rio-Branco and Berbice drainages, and one sample from the Commewijne/Maroni (Figure 15).

The next clade to diverge in the phylogenetic tree consists of only fish from the

Essequibo/Mazaruni drainage (Figure 15). This clade is sister to a large clade that includes samples from the Corantijne, Saramacca, Suriname River and Cottica. With the exception of the

Suriname River, which has a Cottica sample nested within it, each of these river systems appear to contain monophyletic lineages of haplotypes (Figure 15). All drainage population clades mentioned above are supported by Bayesian probability values > 90% (Figure 15).

There appears to be considerable genetic structure within G. coropinae, and very little haplotype sharing between drainages. While there are a large number of haplotypes found within this species (27), haplotypes found within the same drainage generally appear to be more closely related to each other than to haplotypes from other drainages (Figure 17). Furthermore, drainages that are located geographically close to each other often appear to have haplotypes that are closely related to each other (Figure 15, 16). Only 2 of these 27 haplotypes are shared between drainages, haplotype 27Co and haplotype 2Co (Figure 16, 17). Haplotype 27 is shared between the Rio-Branco and Berbice drainages, and haplotype 2Co is shared between the Suriname River

25 and Cottica drainage (Figure 16, 17). The population of fish sampled from the

Essequibo/Mazaruni drainage is comprised of the largest diversity of haplotypes (Table 1). Fish sampled from the same drainage frequently appear to be closely related to each other and form well-supported monophyletic lineages in most cases (Figure 15). An exception to this general trend is seen in the haplotypes sampled from the Essequibo/Mazaruni, Rio-Branco and Berbice drainages, as well as in the location of a single sample from the Cottica drainage being included in a clade made up entirely of fish from the Suriname River drainage (Figure 15).

3.2.4 Gymnotus anguillaris

In general, it was more challenging to assess relationships among G. anguillaris haplotypes in relation to river drainages, because fewer samples were available and some drainages (Oyapock, Approuague, Coppename) only had one or two samples. Despite this, we did find some monophyly in the haplotypes from particular river drainages (Figure 18).

However, exceptions were observed-- haplotypes from the Mana did not form monophyletic lineages, nor did haplotypes from the Commewijne drainage (Figure 18).

Gymnotus anguillaris showed deep levels of population structure and is the only study species in this thesis in which no evidence of haplotype sharing between drainages was observed.

All drainage populations appear to have their own haplotypes associated with them, and these different haplotypes often appear to be relatively diverged from haplotypes from other drainages

(Figure 18, 19). For example, haplotype 4A and 5A are both from fish sampled from the Cottica drainage population. These haplotypes have only diverged by 1 nucleotide from each other, however their divergence from the haplotypes from various other drainages is much larger (Figure

19). Interestingly, there is an exception from this tendency of closely related haplotypes to be from

26 the same drainage, that is evident in haplotypes 8A, 9A and 10A. These haplotypes are from the

Mana drainage, yet they appear to not be closely related to other haplotypes from the Mana drainage (1A and 2A) (Figure 18). This irregularity can also be observed by the interspersed location of fish sampled from the Commewijne and Approuague drainages with fish from the

Suriname River drainage in the phylogenetic tree (Figure 18). The population of G. anguillaris sampled from the Mana drainage contains the largest number of different haplotypes (Figure 20).

3.3 Correlation between genetic distance and geographic distance

In order to determine whether there was a significant correlation between the pairwise genetic distance between individuals within a species and the corresponding geographic river distance between individuals within the same species a Procrustes statistical analysis was run. A

Procrustes analysis requires the input of two matrices containing distance measurements for corresponding points. A Procrustes test revealed that while no significant correlation (m2 = 0.99, p = 0.41) was observed between geographical distance and genetic distance for the Guiana shield upland subspecies G. carapo occidentalis, a significant correlation (m2 = 0.78, p = 0.001) was found for its lowland sister taxa G. carapo carapo. There also appeared to be a significant correlation between geographic and genetic distance in G. coropinae fish (m2 = 0.82, p = 0.001).

The Procrustes test for G. anguillaris revealed a significant correlation between genetic and geographic distance (m2 = 0.76, p = 0.024). However, an examination of the residuals of this test suggested that two individuals, both fish that had been collected from high elevations on the

Tafelberg Tepui, were influencing the results more than the other samples (samples # 9802,

9944). To evaluate the influence of these samples, I removed them and re-ran the Procrustes test.

This resulted in an increased correlation between geographic and genetic distance (m2 = 0.58, p =

0.002) in G. anguillaris, with all remaining samples appearing to be affecting the results equally.

3.4 Cryptic species

Throughout the process of confirming species identifications, via placement of individual samples in phylogenetic trees made up of cytb sequences from other South American freshwater fishes, some sequences were not assignable to any of the nominal species considered in this study, despite their initial morphological identifications. For example, one sequence, initially labelled as Gymnotus carapo, appears to be more closely related to a new species of Gymnotus labelled as G. n.sp. XING in the Lovejoy lab database. These samples were removed from population structure analyses, and the specimens will be re-examined to confirm identifications.

Eight fish samples collected from Guyana and Venezuela, specifically the

Essequibo/Mazaruni drainage, were initially labelled as G. anguillaris. However, when these sequences were further analysed they were found to comprise a discrete, well-supported, monophyletic lineage highly diverged from all other G. anguillaris samples. These eight samples included a single specimen (AUM 36616, sample 2091) that had been examined in an unpublished morphology-based taxonomic review of Gymnotus (Maxime 2013) and provisionally identified as a new species named G. n.sp. CARO. Thus, we consider these eight specimens to represent G. n.sp. CARO, and we removed them from further analyses of G. anguillaris. According to analyses with additional Gymnotus species samples (not shown), it appears that the closest relative of G n.sp. CARO is, in fact, G. anguillaris.

Chapter 4

DISCUSSION

Combinations of historical and species-specific processes shape species population structure and, more fundamentally, species diversification, over time (e.g. Faber et al. 2009,

Stepien et al. 2009). However, the impact that these factors have on population structure is often difficult to discern based solely on observed patterns of genetic differentiation. The fundamental principles in comparative phylogeography hold that congruent spatial-genetic subdivisions among co-distributed species occur in response to a shared biogeographic history, whereas spatially incongruent genetic patterning generally reflects independent species responses as a result of biological differences (Arbogast and Kenagy 2001, Avise 2000, Bermingham and

Martin 1998, Hickerson et al. 2010, Sullivan et al. 2000, Donoghue and Moore 2003, Feldman and Spicer 2006, Bagely and Johnson 2014; refs. therein). Below, I discuss the population structure of four freshwater fish taxa located in the eastern Guiana Shield of South America and address the biological implications of congruent vs incongruent patterns in these genetic structures.

4.1 Population structure of eastern Guiana Shield Gymnotus species

I observed differences in population genetic structure among the four study taxa, supporting my initial hypothesis that these fishes would experience different levels of gene flow due to differences in their species-specific adaptations and dispersal abilities. G. anguillaris exhibited the strongest genetic structure of the four taxa examined, followed by G. coropinae.

The two subspecies of G. carapo, G. carapo occidentalis and G. carapo carapo, had the weakest genetic structure.

In the case of Gymnotus carapo occidentalis, the upland subspecies of G. carapo, the large amount of haplotype sharing between drainages, and lack of a significant correlation between genetic and geographic distance suggests that inter-drainage dispersal is common. A poorly resolved genetic network is consistent with Avise et al.’s (1987) type II phylogeographic hypothesis, which described a species with a life history conducive to dispersal and that occupies a range free of barrier to gene flow. However, drainages should theoretically isolate populations of freshwater fishes, and the extensive connectivity suggested by the large amount of haplotype sharing displayed between populations of G. carapo occidentalis implies instead that there is/was a freshwater connection between, the Essequibo/Mazaruni, Rio-Branco and Berbice drainages. Furthermore, the lack of genetic structure, and the small number of haplotypes found, is surprising as the region in which this subspecies occurs, the upland portion of the Guianas, is a landscape characterized by its varying elevations. These elevational differences contribute to the presence of a large number of waterfalls and rapids, all of which would be expected to act as barriers to gene flow (Hardman et al. 2002, Torrente-Vilara et al. 2011, Rahel 2007, Makert,

Schelly and Stiassny 2010; Lovejoy and de Araújo 2000). While these riverine barriers do affect gene flow between upland and lowland populations of Gymnotus carapo, maintaining the geographic separation of the two subspecies examined in this thesis (Lehmberg et al. accepted,

Craig et al. 2017), they do not appear to have a substantial affect on genetic population structure within just G. carapo occidentalis. One explanation for this lack of genetic structure is that G. carapo occidentalis is a very effective disperser and so is able to traverse these riverine barriers.

It is possible that the initial founding population of G. carapo, which overcame the barrier between lowland and upland elevations, did so based on adaptations providing them with superior dispersal abilities and which continue to allow these fish to spread easily throughout the

30 uplands. Another explanation for the small number of haplotypes found, is simply that there has not been enough time since the arrival of this subspecies in the region for much genetic differentiation to have occurred. Finally, it is possible that fine-scale genetic differences between fish drainage populations are not being captured with the use of only one gene, and that the addition of other molecular markers could provide further insight into the population structure of

G. carapo occidentalis.

Gymnotus carapo carapo exhibited a moderate level of genetic population structuring, indicative of some gene flow between drainage populations. Haplotype 11CC was distributed across five different drainages, suggesting dispersal of fish between these drainages (either recently or historically). Upon further investigation, it appears that the collection localities of the samples that exhibited the 11CC haplotype all occur within close relative proximity to the

Atlantic coast. Previously, it has been suggested that some species of freshwater fishes can disperse between the mouths of rivers in this region via “Atlantic corridors” (Renno et al. 1990,

1991, Lujan and Armbruster 2011). These corridors are regions relatively close to shore that are composed of a mixture of oceanic saltwater and freshwater expelled from the mouths of the major river systems emptying into the Atlantic Ocean. It is therefore possible that individuals of

G. carapo carapo utilize these corridors as dispersal routes between drainages, leading to the shared haplotypes observed between individuals located near the coasts of different drainages.

Further evidence of these Atlantic corridors is provided by shared haplotype 5CC, which is also distributed in multiple localities near the Atlantic coast. Interestingly, while 11CC is shared among drainages located in the eastern range of the region, 5CC is shared among fish collected from drainages in the western range, which suggests the separate use of eastern and western

Atlantic corridors (Figure 3). The genetic structure in the remaining samples of G. carapo

31 carapo suggest a lack of gene flow among drainages via any method other than through these

Atlantic corridors. Obligate freshwater fishes are expected to display greater levels of genetic differentiation and population subdivision than fishes that can tolerate salinity, due to the isolating nature of river systems (Ward et al. 1994). The ability of G. carapo carapo to disperse via Atlantic corridors is noteworthy, as traversing these waters necessitates the capability to survive in higher saline environments. The use of these corridors is not implied by the genetic structure of either G. coropinae, nor G. anguillaris, despite these species also having samples collected near the coast. This may suggest that G. carapo carapo is the only one of my study species with the ability to subsist, for a short time, in saltwater.

Strong population genetic structure was observed in G. coropinae, as well as a high correlation between genetic and geographic distance, suggesting very little gene flow between drainages. Many examples in the literature reveal that populations in different drainages evolve in isolation and display markedly different “assemblages” of alleles (e.g. Ward et al. 1994,

McGlashan and Hughes 2000). The only shared haplotypes observed in this species were confined to the Essequibo/Mazaruni, Rio-Branco and Berbice drainages, suggesting dispersal between these three drainages (similar patterns of dispersal were observed in G. carapo occidentalis, which will be further discussed in section 4.2). The complete lack of shared haplotypes between the remaining drainage populations indicates that the current assembly of the drainage systems, as well as saltwater, act as barriers to dispersal for this species. Each drainage contains many unique haplotypes, and haplotypes found within the same drainage are more closely related to each other than to haplotypes from other drainages (Fig. 16). This suggests that, even within drainage populations, there is not a large amount of gene flow between different tributaries allowing either bottleneck effects to occur or habitat specialization.

Furthermore, these monophyletic groups of haplotypes within a drainage population are generally most closely related to the haplotype groups of fish from neighbouring drainages. This pattern, of correlation between drainage geographic proximity and phylogenetic relatedness, suggests a historical series of one-way single dispersal events from drainage to neighbouring drainages, rather than a mass dispersal of fish from various drainages into others. Finally, the

Essequibo/Mazaruni drainage contains the highest haplotype diversity for G. coropinae. It is possible that this high haplotype diversity could be attributed to the large number of fish collected from this region; however, more fish were collected from the Suriname River drainage, which exhibits a lower number of unique haplotypes. I therefore suggest that the high levels of haplotypes found in this drainage are a result of the geological complexity of the region, as the

Essequibo/Mazaruni contains many waterfalls and rapids that could restrict within-drainage gene flow and allow diversification of haplotypes.

G. anguillaris demonstrates the strongest genetic structure of the study taxa in this thesis, apparent in both the complete lack of haplotype sharing between any of the drainages it inhabits as well as by the strong correlation found between genetic and geographic distance between individual fish. There appears to be a complete lack of contemporary gene flow between drainages, exhibited by the lack of haplotype sharing. A lack of gene flow is also apparent within the Cottica, Commewijne/Maroni and Mana drainages themselves, as they contain collection sites between which haplotypes are not shared. This pattern is characteristic of species with limited dispersal abilities. The null hypothesis for taxa distributed in rivers is that their genetic relationships should reflect current hydrological connections (Meffe and Vrijenhoek 1988,

Hurwood and Hughes 1998). If this null hypothesis is supported, then fishes from the same drainages are expected to be most closely related, and populations from adjacent drainages

33 should be most similar. However, unlike what was observed in G. coropinae, there does not appear to be a straightforward relationship between geographic proximity of localities/drainages and phylogenetic relatedness in G. anguillaris. In some cases, haplotypes found within the same drainage are not most closely related to one another, and haplotypes from individual drainages are not always most closely related to haplotypes from neighbouring drainages. This is particularly evident in the Mana drainage, where haplotypes are separated in the phylogenetic tree (Figure 18) and in the haplotype network (Figure 19). I propose that the relationships observed between drainage populations of G. anguillaris could be the result of rare multiple dispersal events of fish among drainages, followed by an overall lack of gene flow. Barriers to dispersal within drainages then segregated these newly arrived fish, leading to the persistence of unrelated haplotypes within drainages. Lovejoy and Araujo (2000) found similar patterns in freshwater needlefishes of the genus Potamorrhaphis of the Guianas, in which haplotypes from the same large river system were not each others closest relatives and relationships between haplotypes cut across drainages, suggesting that historical changes in river drainage patterns were largely responsible for the contemporary patterns of genetic structure observed.

The differences observed in population genetic structure between the four study taxa indicate that, despite apparently similar ecologies, morphologies, and close phylogenetic relatedness, intrinsic species-specific differences appear to play a strong role in the development of population structure in these freshwater fishes. Differences in the genetic structure of populations of freshwater fishes was also reported by Sharma et al. (2011), who found that populations of Rhadinocentrus ornatus and Hypseleotris compressa (fish with similar habitat requirements and distributions) showed dissimilar levels of genetic differentiation among different streams located in southern Australia. Sharma et al. (2011) hypothesized that these

34 dissimilar patterns in population structure resulted from differences in dispersal ability between the two species. Our study suggests, as did Sharma et al. (2011), that Avise’s (2000) proposal, that similarly distributed species should show similar genetic patterns due to shared historical process, may not be so easily applied. Rather, multiple species in the same habitats and with apparently similar life histories often exhibit different genetic patterns due to species specific biologies.

4.2 Historical biogeography and comparative phylogeography of Gymnotus carapo, Gymnotus coropinae and Gymnotus anguillaris

It is widely agreed that historical processes played an important role in the diversification of the lineages of present day species. Therefore, the genetic structure, of current populations is expected to reflect past events of population fragmentation as well as any subsequent contact

(Avise 1994). Phylogeography has become a powerful and popular approach to elucidate contemporary geographical patterns of evolutionary subdivisions between populations within species. In order to assess the importance of historical events in driving the diversification of freshwater species in the Guiana shield region, I compared the patterns of phylogeographic structure of Gymnotus carapo, G. coropinae and G. anguillaris.

The Cottica and Commewijne/Maroni drainages are the only ones from which samples of all three study taxa had been collected from. G. carapo carapo and G. coropinae both show evidence of gene flow occurring between the Cottica drainage and surrounding drainages, with shared haplotypes between drainage populations found in both species. G. anguillaris does not show any indication of gene flow occurring either out of nor into the Cottica drainage. The

Cottica drainage is a relatively small drainage that does not extend far inland. The observed

35 patterns in gene flow between the Cottica drainage and surrounding drainages suggests that the geography of this drainage allows some fish to traverse the relatively small distance between the mouth of this drainage and nearby ones (approx. 100km from the mouth of the Suriname River drainage). Interestingly, the only fish species that appears unable to traverse this small distance was G. anguillaris, which was hypothesized to have the weakest dispersal abilities based on its small range size. In the Commewijne/Maroni drainage, G. coropinae and G. anguillaris had haplotypes that were not observed in any other drainage, while G. carapo carapo from the

Commewijne/Maroni had a haplotype (11CC) that was widespread in other drainages.

A noteworthy similarity between G. carapo occidentalis and G. coropinae is the weak genetic structure between populations located in the Essequibo/Mazaruni, Rio-Branco and

Berbice drainages. These congruent patterns are suggestive of a consistent amount of gene flow occurring between these drainages. Such patterns are indicative of either permanent or semi- permanent connections between drainages, allowing the transfer of fish between drainages, regardless of fish dispersal ability. Many studies have found previous evidence of permanent/seasonal connections in the region via the Rupununi savannah, an area of seasonal flooding which allows movement of freshwater species between the otherwise unconnected drainages of the Rio-Branco and Essequibo (Albert and Reis 2011, De Souza et al. 2012). The presence of the Rupununi portal is strongly supported by many morphological and molecular phylogenetic studies of a variety of freshwater fishes, with very little, if any, differentiation being observed between fish of the same species found on either side of the portal (Lovejoy and

Araujo 2000, Turner et al. 2004, Willis et al. 2007, Sabaj et al. 2008, Albert and Reis 2011, De

Souza et al. 2012). An interesting observation is that even though these two taxa share congruent genetic patterns in the Essequibo/Mazaruni, Rio-Branco and Berbice drainages, almost all

36 specimens of G. carapo occidentalis were collected from the upland areas, while, despite ample sampling efforts, specimens of G. coropinae have never been collected from the uplands of the

Guiana Shield. Samples of G. coropinae have been collected from streams located directly at the base of the uplands; however, unlike G. carapo, G. coropinae individuals do not appear to be capable of traversing elevational barriers such as waterfalls and rapids. This agrees with the idea that G. carapo has better dispersal abilities than G. coropinae.

A congruent pattern of genetic structure observed between all three species, regardless of geographic overlap, is the general presence of phylogenetic breaks between the lowland drainages. This result was expected as riverine fish intraspecific genetic structure is typically clustered by river basin (Bernatchez and Wilson 1998, Katongo et al. 2005, Koblmuller et al.

2008). G. coropinae and G. anguillaris both exhibited no haplotype sharing, indicative of a complete lack of gene flow, between lowland drainages. And while two haplotypes were shared between drainage populations of G. carapo carapo, there was also evidence of drainage populations maintaining unique haplotypes, providing a moderate amount of spatially consistent genetic structuring. While there was no overlap in the collection sites of G. coropinae and G. anguillaris, which precludes direct comparison between these species, the similarity in patterns of phylogenetic breaks between drainages should not be ignored, especially when combined with the genetic structuring of the G. carapo carapo populations. Our results are similar to those found by Bartakova et al. (2015), who found congruent patterns of distinct genetic populations among three complexes of killifishes located in African savannah pools. Such congruent patterns of genetic structure are suggestive of the importance of historic factors in structuring contemporary freshwater fish species populations (Avise 2000). However, these similarities are not completely congruent, as indicated by the existence of shared haplotypes between drainages

37 in G. carapo carapo. This incongruence in genetic patterning highlights the importance of species specific attributes, in this case potentially dispersal ability, in structuring contemporary freshwater fish populations.

Species do not exhibit obvious similarities among biogeographic patterns in the lowland regions of the eastern Guiana shield. For example, G. coropinae and G. anguillaris exhibit dissimilar patterns of phylogenetic relationships between and among drainage populations (see also section 4.1). These dissimilarities are indicative of species specific patterns of dispersal between drainages. However, again a direct comparison cannot be made due to the lack of geographic overlap of the populations. It is therefore possible that the differences observed in drainage relationships between populations of G. anguillaris and G. coropinae could simply be attributed to differences in historical geologic/climatic events occurring in different regions of the Guiana shield. However, a study of frog species conducted in the eastern Guiana shield region revealed that, similarly to G. anguillaris and G. coropinae, frogs in this region exhibit distinct phylogeographic patterns (Fouquet et al. 2012). The similarity in results from Fouquet et al.’s (2012) direct comparisons between frog species phylogenetic patterns and my indirect comparisons between G. anguillaris and G. coropinae phylogenetic patterns suggests that, in the

Guiana shield, species-specific historical distributions, ecological tolerances to climatic disturbance and dispersal abilities are important in structuring lineage diversification.

Furthermore, direct comparisons of phylogenetic population structure between G. carapo carapo and G. coropinae and between G. carapo carapo and G. anguillaris, provide further evidence of species specific differences, with breaks appearing between different drainages in both comparisons. Additional support for incongruent population patterning of these species is

38 evidenced by the haplotype relationships, both between and within drainage populations, discussed above (see section 4.1).

The congruence in the presence of phylogenetic breaks between drainages in all study species indicates the importance of drainage formation and connectivity in structuring freshwater fish assemblages. However, incongruence in phylogenetic relationships between drainage populations of the study species suggest that species-specific biotic attributes play an important role in how dispersal events occur between drainages in freshwater fish assemblages. It is also possible that temporal factors could play a role in structuring the population genetic of species in a region, something that I did not investigate and so cannot discuss with confidence. This region went through extensive changes in drainage structure and connectivity during the Andean uplift of the Oligocene and Miocene (Lundberg et al. 1998). It is possible that the study species were diversifying during different periods of these changes; in which case, differences in the relationships of fish from different drainage populations would be expected.

4.3 Relationship between range size and population structure

An organism’s ability to disperse is a commonly proposed determinant of a species range

(Hanski et al. 1993, Brown et al. 1996, Gaston 1996, 2003). Dispersal ability has been proposed as an explanation for range size variation in both terrestrial and marine systems and for a wide range of taxa, including insects (Gutierrez and Menendez et al. 1997, Malmqvist 2000, Brandle et al. 2002), plants (Clerke et al. 2001, Lloyd et al. 2003, Lowry and Lester 2006), fish (Goodwin et al. 2005, Lester and Ruttenberg 2005, Mora and Robertson 2005) and mollusks (Paulay and

Meyer 2006). If this is the case, then we should expect differences in genetic structure across species that have different range sizes. While G. carapo, G. coropinae and G. anguillaris are

39 found sympatrically in the Guiana shield region, they have distributions of differing sizes. G. carapo exhibits the largest range, followed by G. coropinae and finally by G. anguillaris, with the smallest range of the three species (Figure 4).

In our study, G. anguillaris, the species with the smallest range, exhibited the strongest genetic structure, followed by G. coropinae, while the subspecies of G. carapo, the species with the largest range size, were found to have the weakest genetic structure. This correlation, between the study species range size and population genetic structure, supports our hypothesis that dispersal could be an explanation for the different levels of gene flow occurring between drainages for the three study species. Additional support was found from our statistical analysis, which found that G. anguillaris, the species with the smallest range, exhibited the strongest correlation between genetic and geographic distance, while G. carapo occidentalis, a subspecies of the taxon with the largest range size, exhibited no correlation between genetic and geographic distance. Furthermore, while G. carapo carapo did exhibit significant correlation between genetic and geographic distance, it also displayed the highest level of haplotype sharing of our three lowland taxa, which suggests that this species is a stronger disperser than both G. anguillaris and G, coropinae. A study by Papadopoulou et al. (2009) found striking differences in phylogeographical patterns in co-distributed species of tenebrionid beetles with lineage specific flying abilities, in which species which could fly over longer distances exhibited the least amount of genetic structuring. Moreover, in many species of marine fishes it has been found that dispersal ability, measured by length of larval phase, affects genetic population structure in patterns similar to what we observed in this study (Lester et al. 2007).

4.4 Presence of cryptic species

My genetic analysis suggests the presence of an undescribed species among samples that were identified in the field as Gymnotus anguillaris. These samples included a specimen that had been examined and identified as a potential new species (G. n.sp. CARO) by Maxime (2013), based on morphological features. I found that G. anguillaris and G. n.sp. CARO are genetically distinct, with reciprocally monophyletic haplotype groups. Also, the genetic divergence between the two lineages is greater than divergences observed within the species G. carapo and G. coropinae (Figure 9). Based on our samples, G. anguillaris and G. n.sp. CARO are distributed allopatrically, with G. anguillaris occurring in drainages including and east of the Coppename

(Suriname and French Guyana), and G. n.sp. CARO occurring in the Essequibo/Mazaruni drainages (Guyana and Venezuela) (Figure 7). The sum of this evidence supports the conclusion that G. n.sp. CARO is a valid new species that warrants formal description.

There are no specimens of G. n.sp. CARO or of G. anguillaris collected from the eastern and coastal regions of Guyana, nor throughout the western section of Suriname, suggesting that these two species have been spatially isolated for at least as long as the modern drainage systems of the Guiana shield have been in place. It is possible that G. n.sp. CARO might have originated via an uncommon long-range dispersal of ancestral G. anguillaris into western Guyana and

Venezuela, followed by subsequent adaptations to the varied elevations of the region. However, I believe it is more likely that the range of the ancestor of G. anguillaris/ G. n.sp. CARO extended across the combined distributions of the two current species, and that a historical vicariance event led to a western taxon G. n.sp. CARO and an eastern taxon G. anguillaris. Fouquet et al.

(2012) found a history of fragmentation/isolation within the eastern Guiana shield during the

Quaternary in 11 species of frogs, based on spatial and temporal concordance of genetic breaks

41 among populations. I wonder if an event could have occurred during this time that resulted in the origin of G. anguillaris and G. n.sp. CARO. Nevertheless, before hypotheses concerning the formation of G. n.sp. CARO are formulated, more sampling of the uplands of the Guiana shield and a more in depth genetic analysis should be conducted.

4.5 Conclusions, Limitations and Future Directions

In conclusion, genetic structure differs among eastern Guiana Shield populations of G. carapo, G. coropinae and G. anguillaris. This suggests that the amount of gene flow among populations of these fishes varies depending on species. Furthermore, I propose that levels of gene flow are contingent, at least in part, on species specific dispersal abilities, and that G. carapo has the highest dispersal ability of the study species. The dispersal abilities of G. coropinae and G. anguillaris are difficult to compare due to the lack of geographic overlap of these fishes, however, based on the strong correlation between genetic and geographic distance, it is possible that G. anguillaris is the poorer disperser. The hypothesis that freshwater fishes in

Guiana shield would show congruent patterns in genetic structure due to shared responses to historic events was neither strongly supported nor rejected. Congruent patterns among the study species were discovered, including a general lack of gene flow between drainage populations in the lowlands, and a large amount of gene flow occurring between populations in the

Essequibo/Mazaruni, Rio-Branco and Berbice drainages of G. carapo occidentalis and G. coropinae. However, incongruent patterns among species were also found-- such as many of the patterns of haplotype relationships between and within drainages. This mixture of congruent and incongruent responses suggests that while historical geological events, such as the formation of contemporary drainage systems, are important in structuring the modern diversity of freshwater fishes, biotic differences, such as dispersal ability, may play a central role.

Possible limitations arise when considering the conclusions drawn from this thesis with regards to the use of only one gene. It is possible that there were genetic details and differences that were missed by sequencing only cytb, and the addition more genes could have possibly allowed greater insight into the population genetic structure of the study species and the phylogenetic patterns that were found (particularly in G. carapo occidentalis, whose haplotypes did not resolve into well supported clades). However, a large proportion of comparative phylogeographic studies conducted to date have analysed a single gene, the majority of these using mtDNA as I did. This suggests that single gene studies hold merit and valid conclusions can be drawn. A further limitation concerning sampling, both with regards to sample size and the geographic distribution of samples. Relative to G. carapo and G. coropinae a very small number of samples were analyzed for G. anguillaris. This problem was further exacerbated when the seven samples of G. anguillaris that from Guyana were removed from further analysis because that they likely belong to a different species (G. n.sp. CARO. However, this issue was impossible to address as it occurred mid-experiment and there were no other samples of G. anguillaris available.

A next step needed to tease apart the relative importance of historic and biotic factors in contributing to the modern freshwater fish assemblages in the Guiana shield is to examine temporal relationships of these species to one another, and further analyze geological and climatic events that correspond to their divergence times. The collection of more G. anguillaris samples would also ease limitations associated with the small current sample size of this species, as well as shine light on whether this species does indeed not occur in the western portion of the

Guiana shield as is suggested by the current distribution of samples. Similarly, further collection of G. coropinae samples in the eastern portion of the Guiana shield would allow direct

43 comparisons between that species and G. anguillaris. Further investigations into the legitimacy of G. n.sp. CARO as a new species should be undertaken, a process that would be helped by further sampling of the Guiana uplands. Lastly, while I do believe the conclusions drawn from cytb merit value, sequencing another gene, especially a faster evolving nuclear gene, would strengthen these results and perhaps allow us to elucidate clearer relationships among populations within G. carapo.

References

Albert, J. S. 2001. Species diversity and phylogenetic systematics of american knifefishes (Gymnotiformes, Teleostei). Miscellaneous Publications, Museu of Zoology, University of Michigan:1–140. Albert, J. S., and W. G. R. Crampton. 2003. Seven new species of the Neotropical electric fish Gymnotus (Teleostei, Gymnotiformes) with a redescription of G. carapo (Linnaeus). Zootaxa 287:1. Albert, J.S. and R. Reis. 2011. Historical Biogeography of Neotropical Freshwater Fishes. Aragón, E., F. J. Goin, Y. E. Aguilera, M. O. Woodburne, A. A. Carlini, and M. F. Roggiero. 2011. Palaeogeography and palaeoenvironments of northern Patagonia from the Late Cretaceous to the Miocene: The Palaeogene Andean gap and the rise of the North Patagonian High Plateau. Biological Journal of the Linnean Society 103:305–315. Arbeláez-Cortés, E., Á. S. Nyári, and A. G. Navarro-Sigüenza. 2010. The differential effect of lowlands on the phylogeographic pattern of a Mesoamerican montane species (Lepidocolaptes affinis, Aves: Furnariidae). Molecular Phylogenetics and Evolution 57:658–668. Arbogast, B. S., and G. J. Kenagy. 2001. Comparative phylogeography as an integrative approach to historical biogeography. Journal of Biogeography 28:819–825. Avise, J. C., J. Arnold, R. M. Ball, E. Bermingham, T. Lamb, J. E. Neigel, C. A. Reeb, and N. C. Saunders. 1987. Intraspecific Phylogeography: The Mitochondrial DNA Bridge Between Population Genetics and Systematics. Annual Review of Ecology and Systematics 18:489– 522. Avise, J. C. 1992. Molecular population structure and the biogeographic history of a regional fauna: A case history with lessons for conservation biology. Oikos 63:62–76. Avise, J.C. 1994. Molecular Markers, Natural History, and Evolution. Chapman & Hall, New York. Avise, J.C. 2000. Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge. Avise, J. C., S. P. Hubbell, and J. Francisco. 2008. In the Light of Evolution, Volume II: Biodiversity and Extinction. Bagley, J. C., and J. B. Johnson. 2014. Phylogeography and biogeography of the lower Central American Neotropics: Diversification between two continents and between two seas. Biological Reviews 89:767–790. Bagley, J. C., and J. B. Johnson. 2014. Testing for shared biogeographic history in the lower Central American freshwater fish assemblage using comparative phylogeography: Concerted, independent, or multiple evolutionary responses. Ecology and Evolution 4:1686–1705.

Balakrishnan, R. 2005. Species concepts, species boundaries and species identification: A view from the tropics. Bartáková, V., M. Reichard, R. Blažek, M. Polačik, and J. Bryja. 2015. Terrestrial fishes: Rivers are barriers to gene flow in annual fishes from the African savanna. Journal of Biogeography 42:1832–1844. Bernatchez, L., and C. C. Wilson. 1998. Comparative phylogeography of Nearctic and Palearctic fishes. Molecular Ecology 7:431–452. Bickford, D., D. J. Lohman, N. S. Sodhi, P. K. L. Ng, R. Meier, K. Winker, K. K. Ingram, and I. Das. 2007. Cryptic species as a window on diversity and conservation. Trends in Ecolgy and Evolution 22: 148-155. Bivand R., T. Keitt and B. Rowlingson. 2017. rgdal: Bindings for the Geospatial Data Abstraction Library. R package version 1. 2-7.

Bonaccorso, E., A.G. Navarro-Siguenza, L.A. Sanchez-Gonzalez, A.T. Peterson and J. Garcia- Moreno. 2008. Genetic differentiation of the Chlorospingus ophthalmicus complex in Mexico and Central America. Journal of Avian Biology 39: 311–321. Brandle, M., S. Ohlschlager and R. Brandl. 2002. Range sizes in butterflies: correlation across scales. Evolutionary Ecology Research 4: 993–1004.

Brown, W. M., E. M. Prager, A. Wang, and A. C. Wilson. 1982. Mitochondrial DNA sequences of primates: Tempo and mode of evolution. Journal of Molecular Evolution 18:225–239. Brown, J.H., G. C. Stevens, and D. M. Kaufman. 1996. The geographic range: size, shape, boundaries, and internal structure. Annual Review of Ecological Systems 27: 597–623.

Brumfield, R. T., and S. V. Edwards. 2007. Evolution into and out of the Andes: A Bayesian analysis of historical diversification in Thamnophilus antshrikes. Evolution 61:346–367. Burney, C. W., and R. T. Brumfield. 2009. Ecology predicts levels of genetic differentiation in neotropical birds. The American naturalist 174:358–368. Cardoso, Y.P., and Montoya-Burgos, J.I. 2009. Unexpected diversity in the catfish Pseudancistrus brevispinis reveals dispersal routes in a Neotropical center of endemism: the Guyanas Region. Molecular Ecology 18: 947-964. Castoe, T. A., J. M. Daza, E. N. Smith, M. M. Sasa, U. Kuch, J. A. Campbell, P. T. Chippindale, and C. L. Parkinson. 2009. Comparative phylogeography of pitvipers suggests a consensus of ancient Middle American highland biogeography. Journal of Biogeography 36:88–103. Cheviron, Z. A., S. J. Hackett, and A. P. Capparella. 2005. Complex evolutionary history of a Neotropical lowland forest bird (Lepidothrix coronata) and its implications for historical hypotheses of the origin of Neotropical avian diversity. Molecular Phylogenetics and Evolution 36:338–357.

Clarke, P.J., R. A. Kerrigan, and C. J. Westphal. 2001. Dispersal potential and early growth in 14 tropical mangroves: do early life history traits correlate with patterns of adult distribution? Journal of Ecology 89: 648–659.

Clement, M., Q. Snell, P. Walke, D. Posada, K. Crandall. 2002. TCS: estimating gene genealogies. Proceedings of the 16th International Parallel Distributed Processing Symposium 2:184.

Cooke, G. M., N. L. Chao, and L. B. Beheregaray. 2009. Phylogeography of a flooded forest specialist fish from central Amazonia based on intron DNA: The cardinal tetra Paracheirodon axelrodi. Freshwater Biology 54:1216–1232. Corlett, R.T. 2011. Impacts of warming on tropical lowland rainforests. Trends in Ecology and Evolution 26: 606–613. Cracraft, J., and R. O. Prum. 1988. Patterns and processes of diversification: speciation and historical congruence in some Neotropical birds. Cracraft, J. 1989. Speciation and its ontology : The empirical consequences of alternative species concepts for understanding patterns and processes of differentiation. Page 16. Speciation and its Consequences. Craig, J. M., W. G. R. Crampton, and J. S. Albert. 2017. Revision of the polytypic electric fish Gymnotus carapo (Gymnotiformes, Teleostei), with descriptions of seven subspecies. Zootaxa 4318:401–438. Crampton WGR, Albert JS (2005) Evolution of electric signal diversity in the gymnotiform fishes. In: Collin SP, Kapoor BG, Ladich F, Moller P (eds), Fish Communication. New York: Science Publishers. Cunningham, C. W., and T. M. Collins. 1994. Developing model systems for molecular biogeography: Vicariance and interchange in marine invertebrates. Pages 405–433. Molecular Ecology and Evolution: Approaches and Applications. Da Silva, J. M. C., A. B. Rylands, and G. A. B. Da Fonseca. 2005. The fate of the Amazonian areas of endemism. Dawson, M. N. 2001. Phylogeography in coastal marine animals: Phylogeography a solution from California. Journal of Biogeography 28:723–736. Daza, J. M., T.A. Castoe, and C.L. Parkinson. 2010. Using regional comparative phylogeographic data from snake lineages to infer historical processes in Middle America. Ecography 33: 343–354. Demboski, J. R., K. D. Stone, and J. A. Cook. 1999. Further perspectives on the Haida Gwaii glacial refugium. Evolution 53:2008–2012. Donoghue, M. J., and B. R. Moore. 2003. Toward an integrative historical biogeography. Integrative and comparative biology 43:261–270.

Faber, J. E., J. Rybka, and M. M. White. 2009. Intraspecific Phylogeography of the Stonecat Madtom, Noturus flavus. Copeia 2009:563–571. Feldman, C. R., and G. S. Spicer. 2006. Comparative phylogeography in a community of reptiles: repeated patterns of cladogenesis and population expansion in California. Molecular Ecology 15:2201-2222. Fernandes-Matioli, F. M. C., and L. F. Almeida-Toledo. 2001. A molecular phylogenetic analysis in Gymnotus species (Pisces: Gymnotiformes) with inferences on chromosome evolution. Caryologia 54:23–30. Ferraz, G., G. J. Russell, P. C. Stouffer, R. O. Bierregaard, S. L. Pimm, and T. E. Lovejoy. 2003. Rates of species loss from Amazonian forest fragments. Proceedings of the National Academy of Sciences of the United States of America 100:14069–14073. Fink, S. V., and W. L. Fink. 1981. Interrelationships of the ostariophysan fishes (Teleostei). Zoological Journal of the Linnean Society 72:297–353. Fouquet, A., A. Gilles, M. Vences, C. Marty, M. Blanc, and N. J. Gemmell. 2007. Underestimation of species richness in neotropical frogs revealed by mtDNA analyses. PLoS ONE 2: e1109. Fouquet, A., B. P. Noonan, M. T. Rodrigues, N. Pech, A. Gilles, and N. J. Gemmell. 2012. Multiple quaternary refugia in the eastern guiana shield revealed by comparative phylogeography of 12 frog species. Systematic Biology 61:461–489. Fouquet, A., D. Loebmann, S. Castroviejo-Fisher, J. M. Padial, V. G. D. Orrico, M. L. Lyra, I. J. Roberto, P. J. R. Kok, C. F. B. Haddad, and M. T. Rodrigues. 2012. From Amazonia to the Atlantic forest: Molecular phylogeny of Phyzelaphryninae frogs reveals unexpected diversity and a striking biogeographic pattern emphasizing conservation challenges. Molecular Phylogenetics and Evolution 65:547–561. Gamble, T., G. R. Colli, M. T. Rodrigues, F. P. Werneck, and A. M. Simons. 2012. Phylogeny and cryptic diversity in geckos (Phyllopezus; Phyllodactylidae; Gekkota) from South America’s open biomes. Molecular Phylogenetics and Evolution 62:943–953. Gaston, K. J. 1996. Species-range-size distributions: patterns, mechanisms and implications. Trends in Ecology and Evolution. 11: 197–201.

Gaston, K.J. 2003. The Structure and Dynamics of Geographic Ranges. Oxford University Press, Oxford.

Geurgas, S. R., and M. T. Rodrigues. 2010a. The hidden diversity of Coleodactylus amazonicus (Sphaerodactylinae, Gekkota) revealed by molecular data. Molecular Phylogenetics and Evolution 54:583–593. González, M. a, J. R. Eberhard, I. J. Lovette, S. L. Olson, and E. Bermingham. 2003. Mitochondrial DNA Phylogeography of the bay wren (Troglodytidae: Thryothorus nigricapillus) complex. The Condor 105:228–238.

Goodwin, N.B., N.K. Dulvy, and J. D. Reynolds. 2005. Macroecology of live-bearing in fishes: latitudinal and depth range comparisons with egg-laying relatives. Oikos 110: 209–218. Graham, A. 2011a. The age and diversification of terrestrial New World ecosystems through Cretaceous and Cenozoic time. American Journal of Botany 98: 336–351. Gutierrez, D. and R. Menendez. 1997. Patterns in the distribution, abundance and body size of carabid beetles (Coleoptera: Caraboidea) in relation to dispersal ability. Joural of Biogeography: 24, 903–914.

Hammond, D. S. (ed.) 2005. Tropical Rainforests of the Guianan Shield CABI Publishing, Wallingford, UK. Hanski, I., J. Kouki, and A. Halkka. 1993. Three explanations of the positive relationship between distribution and abundance of species. In: Species Diversity in Ecological Communities: Historical and Geographical Perspectives (eds Ricklefs, R.E. and Schluter, D.). University of Chicago Press, Chicago, pp. 108–116.

Hardman, M., Page L.M., Sabaj M.H., Armbruster J.W., Knouft J.H. 2002. A comparison of fish surveys made in 1908 and 1998 of the Potaro, Essequibo, Demerara, and coastal river drainages of Guyana. Ichthyological Exploration of Freshwaters 13: 225–238. Hasbún, C. R., A. Gómez, G. Köhler, and D. H. Lunt. 2005. Mitochondrial DNA phylogeography of the Mesoamerican spiny-tailed lizards (Ctenosaura quinquecarinata complex): Historical biogeography, species status and conservation. Molecular Ecology 14:3095–3107. Hickerson, M. J., B. C. Carstens, J. Cavender-Bares, K. A. Crandall, C. H. Graham, J. B. Johnson, L. Rissler, P. F. Victoriano, and A. D. Yoder. 2010. Phylogeography’s past, present, and future: 10 years after Avise, 2000. Hoang, D.T., O. Chernomor, A. von Haeseler, B.Q. Minh, and L.S. Vinh. 2017. UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution.

Hollowell, T., and R. P. Reynolds. 2005. Checklist of the terrestrial vertebrates of the Guiana Shield. Bulletin of the Biological Society of Washington 13:106. Hoorn, C., J. Guerrero, G. A. Sarmiento, and M. A. Lorente. 1995. Andean tectonics as a cause for changing drainage patterns in Miocene northern South America. Huelsenbeck, J. P. and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754-755.

Huber, O. and N. Foster. 2003. Conservation priorities for the Guyana Shield. Washington (DC): Conservation International. Jacobs, D. K., T. A. Haney, and K. D. Louie. 2004. Genes, diversity, and geological process on the Pacific coast. Annual Review of Earth and Planetary Sciences 32:601–652.

Katongo, C., S. Koblmüller, N. Duftner, L. Makasa, and C. Sturmbauer. 2005. Phylogeography and speciation in the Pseudocrenilabrus philander species complex in Zambian Rivers. Hydrobiologia 542:221–233. Koblmüller, S., K. M. Sefc, N. Duftner, C. Katongo, T. Tomljanovic, and C. Sturmbauer. 2008. A single mitochondrial haplotype and nuclear genetic differentiation in sympatric colour morphs of a riverine cichlid fish. Journal of Evolutionary Biology 21:362–367. Kok, P .J. R. 2013. Islands in the sky: species diversity, evolutionary history, and patterns of endemism of the Pantepui Herpetofauna. Chapter 1. PhD Dissertation Leiden Univserity.

Kuo, C. H., and J. C. Avise. 2005. Phylogeographic breaks in low-dispersal species: The emergence of concordance across gene trees. Genetica 124:179–186. Lanfear, R., F.B. Frandsen, A.M. Wright, T Senfeld, B. Calcott. 2016. PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular biology and evolution. Laurance, W. F. 2007. Have we overstated the tropical biodiversity crisis? Trends in Ecology & Evolution 22:65–70. Laurance, W. F., G. Powell, and L. Hansen. 2002. A precarious future for Amazonia. Trends in Ecology and Evolution 251–252 Lehmberg, E. S., A. A. Elbassiouny, D. D. Bloom, H. López-Fernández, W.G.R. Crampton, and N. R. Lovejoy. Accepted. Fish biogeography in the "Lost World" of the Guiana Shield: Phylogeography of the weakly electric knifefish Gymnotus carapo (Teleostei: Gymnotidae). Journal of Biogeography.

Leigh, J.W., D. Bryant D. 2015. PopART: Full-feature software for haplotype network construction. Methods Ecol Evol 6:1110–1116. Lester, S. E., and B. I. Ruttenberg. 2005. The relationship between pelagic larval duration and range size in tropical reef fishes: a synthetic analysis. Proceedings. Biological sciences / The Royal Society 272:585–91. Lester, S. E., B. I. Ruttenberg, S. D. Gaines, and B. P. Kinlan. 2007. The relationship between dispersal ability and geographic range size. Ecology Letters 10: 745-758. Littmann, M.W., Burr, B.M. and Buitrago-Suarez, U.A. 2001 A new cryptic species of Sorubim cuvier from the upper and middle Amazon Basin. Proceedings of the Academy of Natural Sciences of Philadelphia 151: 87–93. Lloyd, K.M., J.B. Wilson, and W.G. Lee. 2003. Correlates of geographic range size in New Zealand Chionochloa (Poaceae) species. Journal of Biogeography 30: 1751–1761.

Lourie, S. A., D. M. Green, and A. C. J. Vincent. 2005. Dispersal, habitat differences, and comparative phylogeography of Southeast Asian seahorses (Syngnathidae: Hippocampus). Molecular Ecology 14:1073–1094.

Lovejoy, N. R., and M. L. G. De Araújo. 2000. Molecular systematics, biogeography and population structure of Neotropical freshwater needle shes of the genus Potamorrhaphis. Molecular Ecology 9:259–268. Lowry, E. and S.E. Lester. 2006. The biogeography of plant reproduction: potential determinants of species range sizes. Journal of Biogeography 33: 1975–1982.

Lujan, N.K., and J.W. Armbruster. 2011. The Guiana Shield. In: Albert and Reis (Eds), Historical Biogeography of Neotropical Freshwater Fishes. Los Angeles, University of California Press, pp.211 - 222.

Lundberg, J. G. 1993. African-South American freshwater fish clades and continental drift: problems with a paradigm. In: Goldblatt P (ed), Biological Relationships Between Africa and South America. New Haven: Yale University Press, pp. 156–199.

Lundberg, J. G., L. G. Marshall, J. Guerrero, B. Horton, M. C. S. L. Malabarba, and F. Wesselingh. 1998. The stage for neotropical fish diversification a history of tropical south american rivers. Lundberg, J.G., 1998. The temporal context for the diversification of neotropical fishes. In: Malabarba, L.R., Reis, R.E., Vari, R.P., Lucena, Z.M.S., Lucena, C.A.S. (Eds.), Phylogeny and Classification of Neotropical Fishes. EDIPUCRS, Porto Alegre, Brasil, pp. 48–68. Mace, G. M. 2004. The role of taxonomy in species conservation. Philosophical transactions of the Royal Society of London. Series B, Biological Sciences 359:711–9. Maddison, W.P. and D.R. Maddison. 2017. Mesquite: a modular system for evolutionary analysis. Version 3.31. Malmqvist, B. 2000. How does wing length relate to distribution patterns of stoneflies (Plecoptera) and mayflies (Ephemeroptera)? Biological Conservation: 93 271–276.

Marks, B. D., S. J. Hackett, and A. P. Capparella. 2002. Historical relationships among Neotropical lowland forest areas of endemism as determined by mitochondrial DNA sequence variation within the Wedge-billed Woodcreeper (Aves: Dendrocolaptidae: Glyphorynchus spirurus). Molecular Phylogenetics and Evolution 24:153–167. Markert, J. A., R. C. Schelly, and M. L. Stiassny. 2010. Genetic isolation and morphological divergence mediated by high-energy rapids in two cichlid genera from the lower Congo rapids. BMC Evolutionary Biology 10:149. McGlashan, D. J., and J. M. Hughes. 2000. Reconciling patterns of genetic variation with stream structure, earth history and biology in the Australian freshwater fish Craterocephalus stercusmuscarum (Atherinidae). Molecular Ecology 9:1737–1751. Melo, B.F., Ochoa, L.E., Vari, R.P., Oliveira, C. 2016. Cryptic species in the Neotropical fish genus Curimatopsis (Teleostei, Characiformes). Zoologica Scripta 45: 650-658.

Mila, B., R. K. Wayne, P. Fitze, and T. B. Smith. 2009. Divergence with gene flow and fine- scale phylogeographical structure in the wedge-billed woodcreeper, glyphorynchus spirurus, a neotropical rainforest bird. Molecular Ecology 18:2979–2995. Miller, M. J., E. Bermingham, J. Klicka, P. Escalante, F. S. R. do Amaral, J. T. Weir, and K. Winker. 2008. Out of Amazonia again and again: episodic crossing of the Andes promotes diversification in a lowland forest flycatcher. Proceedings. Biological sciences / The Royal Society 275:1133–42. Mora, C., and D. R. Robertson. 2005. Causes of latitudinal gradients in species richness: A test with fishes of the Tropical Eastern Pacific. Ecology 86:1771–1782. Mora, C. and D. R. Robertson. 2005. Factors shaping the range-size frequency distribution of the endemic fish fauna of the tropical eastern Pacific. Journal of Biogeography 32: 277–286.

Moritz, C., and D. P. Faith. 1998. Comparative phylogeography and the identification of genetically divergent areas for conservation. Molecular Ecology 7:419–429. Morrone, J. J. 2004. Panbiogeografía, componentes bióticos y zonas de transición. Revista Brasileira de Entomologia 48:149–162. Muellner, A.N., T.D. Pennington, A.V. Koecke, and S.S. Renner. 2010. Biogeography of Cedrela (Meliaceae, Sapindales) in Central and South America. American Journal of Botany 97: 511–518. Museum, O., and V. Zoology. 2002. Strategies to Protect Biological Diversity and the Evolutionary. Systematic Biology 51:238–254. Myers, N., N. Myers, R. a Mittermeier, R. a Mittermeier, G. a B. Fonseca, G. a B. Fonseca, J. Kent, and J. Kent. 2000. Biodiversity hotspots for conservation priorities. Nature 403:853– 8. Nelson, G. and N. Platnick. 1981. Systematics and Biogeography: Cladistics and Vicariance. Columbia University Press, New York. Nguyen L.T., H.A. Schmidt, A. von Haeseler, and B.Q. Minh. 2015. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution 32:268-274.

Oksanen J., F. G. Blanchet, M. Friendly, R. Kindt, P. Legendre, D. McGlinn, P.R. Minchin, R. B. O'Hara, G. L. Simpson, P. Solymos, M. H. H. Stevens, E. Szoecs and H. Wagner. 2017. vegan: Community Ecology Package. R package version 2.4-3.

Palma-Silva, C., Lexer, C., Paggi, G.M., Barbara, T., Bered, F. and Bodanese-Zanettini, M.H. 2009. Range-wide patterns of nuclear and chloroplast DNA diversity in Vriesea gigantea (Bromeliaceae), a neotropical forest species. Heredity 103: 503–512. Papadopoulou, A., I. Anastasiou, B. Keskin, and A. P. Vogler. 2009. Comparative phylogeography of tenebrionid beetles in the Aegean archipelago: The effect of dispersal ability and habitat preference. Molecular Ecology 18:2503–2517.

Paulay, G. and C. Meyer. 2006. Dispersal and divergence across the greatest ocean region: do larvae matter? Integrative Comparative Biology 46: 269–281.

Pennington, R. T., and C. W. Dick. 2004. The role of immigrants in the assembly of the South American rainforest tree flora. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 359:1611–1622. Peppers, L. L., and R. D. Bradley. 2000. Cryptic Species in Sigmodon Hispidus : Evidence From Dna Sequences. Journal of Mammalogy 81:332–343. Piggott, M. P., N. L. Chao, and L. B. Beheregaray. 2011. Three fishes in one: Cryptic species in an Amazonian floodplain forest specialist. Biological Journal of the Linnean Society 102:391–403. Rahel, F. J. 2007. Biogeographic barriers, connectivity and homogenization of freshwater faunas: It’s a small world after all. Reis, R.E., Kullander, S.O. & Ferraris, C.J. 2004. Checklist of freshwater fishes of South and Central America. Edipucrs, Porto Alegre.

Reis, R. E. 2013. Conserving the freshwater fishes of South America. International Zoo Yearbook 47:65–70. Riddle, B. R. 1996. The historical assembly of continental biotas: Late Quaternary range- shifting, areas of endemism, and bio-geographic structure in the North American mammal fauna. Ecography 21:437–442. Riddle, B. R., M. N. Dawson, E. A. Hadly, D. J. Hafner, M. J. Hickerson, S. J. Mantooth, and A. D. Yoder. 2008. The role of molecular genetics in sculpting the future of integrative biogeography. Progress in Physical Geography 32:173–202. Riddle, B. R., D. J. Hafner, L. F. Alexander, and J. R. Jaeger. 2000. Cryptic vicariance in the historical assembly of a Baja California Peninsular Desert biota. Proceedings of the National Academy of Sciences 97:14438–14443. Riginos, C., and B. C. Victor. 2001. Larval spatial distributions and other early life-history characteristics predict genetic differentiation in eastern Pacific blennioid fishes. Proceedings of the Royal Society B: Biological Sciences 268:1931–1936. Robertson, J. M., M. C. Duryea, and K. R. Zamudio. 2009. Discordant patterns of evolutionary differentiation in two Neotropical treefrogs. Molecular Ecology 18:1375–1395. Ronquist, F. 1997. Dispersal-vicariance analysis: A new approach to the quantification of historical biogeography. Systematic Biology 46:195–203. Rosen, D. E. 1978. Vicariant Patterns and Historical Explanation in Biogeography. Systematic Zoology 27:159. Rull, V., and T. Vegas-Vilarrúbia. 2006. Unexpected biodiversity loss under global warming in the neotropical Guayana Highlands: A preliminary appraisal. Global Change Biology 12:1– 9.

Rull, V. 2008. Speciation timing and neotropical biodiversity: the Tertiary–Quaternary debate in the light of molecular phylogenetic evidence. Molecular Ecology 17: 2722–2729. Russello, M. A, S. Glaberman, J. P. Gibbs, C. Marquez, J. R. Powell, and A. Caccone. 2005. A cryptic taxon of Galápagos tortoise in conservation peril. Biology letters 1:287–90.

Schneider, C. J., M. Cunningham, and C. Moritz. 1998. Comparative phylogeography and the history of endemic vertebrates in the Wet Tropics rainforests of Australia. Molecular Ecology 7:487–498. Scotti-Saintagne, C., C. W. Dick, H. Caron, G. G. Vendramin, V. Troispoux, P. Sire, M. Casalis, A. Buonamici, R. Valencia, M. R. Lemes, R. Gribel, and I. Scotti. 2013. Amazon diversification and cross-Andean dispersal of the widespread Neotropical tree species Jacaranda copaia (Bignoniaceae). Journal of Biogeography 40:707–719. Sharma, S., and J. M. Hughes. 2011. Genetic structure and phylogeography of two freshwater fishes, Rhadinocentrus ornatus and Hypseleotris compressa, in southern Queensland, Australia, inferred from allozymes and mitochondrial DNA. Journal of Fish Biology 78:57– 77. Sidlauskas, B.L. and R.P. Vari. 2012. Diversity and distribution of anostomoid fishes (Teleostei: Characiformes) throughout the Guianas. Cybium 36: 71-103. Sistrom, M. J., N. L. Chao, and L. B. Beheregaray. 2009. Population history of the Amazonian one-lined pencilfish based on intron DNA data. Journal of Zoology 278:287–298. Slatkin, M. 1989. Detecting small amounts of gene flow from phylogenies of alleles. Genetics 121:609–612. Slatkin, M., and W. P. Maddison. 1989. A cladistic measure of gene flow inferred from the phylogenies of alleles. Genetics 123:603–613. Smith, S. A., and E. Bermingham. 2005. The biogeography of lower Mesoamerican freshwater fishes. Journal of Biogeography 32:1835–1854 De Souza, L. S., J. W. Armbruster, and D. C. Werneke. 2012. The influence of the Rupununi portal on distribution of freshwater fish in the Rupununi district, Guyana. Cybium 36:31– 43. Starkey, D. E., H. B. Shaffer, R. L. Burke, M. R. Forstner, J. B. Iverson, F. J. Janzen, A. G. Rhodin, and G. R. Ultsch. 2003. Molecular systematics, phylogeography, and the effects of Pleistocene glaciation in the painted turtle (Chrysemys picta) complex. Evolution 57:119– 128. Streicher, J. W., A. J. Crawford, and C. W. Edwards. 2009. Multilocus molecular phylogenetic analysis of the montane Craugastor podiciferus species complex (Anura: Craugastoridae) in Isthmian Central America. Molecular Phylogenetics and Evolution 53:620–630.

Stepien, C. A., D. J. Murphy, R. N. Lohner, O. J. Sepulveda-Villet, and A. E. Haponski. 2009. Signatures of vicariance, postglacial dispersal and spawning philopatry: Population genetics of the walleye Sander vitreus. Molecular Ecology 18:3411–3428.

Sudhir Kumar, Glen Stecher, and Koichiro Tamura (2015) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Molecular Biology and Evolution. Sullivan, J., E. Arellano, and D. S. Rogers. 2000. Comparative Phylogeography of Mesoamerican Highland Rodents: Concerted versus Independent Response to Past Climatic Fluctuations. The American Naturalist 155:755–768. Torrente-Vilara, G., J. Zuanon, F. Leprieur, T. Oberdorff, and P. A. Tedesco. 2011. Effects of natural rapids and waterfalls on fish assemblage structure in the Madeira River (Amazon Basin). Ecology of Freshwater Fish 20:588–597. Turchetto-Zolet, A. C., F. Pinheiro, F. Salgueiro, and C. Palma-Silva. 2013. Phylogeographical patterns shed light on evolutionary process in South America. Turner, T. F., M. V. McPhee, P. Campbell, and K. O. Winemiller. 2004. Phylogeography and intraspecific genetic variation of prochilodontid fishes endemic to rivers of northern South America. Journal of Fish Biology 64:186–201. Tyers, M. 2017. riverdist: River Network Distance Computation and Applications. R package version 0.14.0.

Unmack, P. J., A. P. Bennin, E. M. Habit, P. F. Victoriano, and J. B. Johnson. 2009. Impact of ocean barriers, topography, and glaciation on the phylogeography of the catfish Trichomycterus areolatus (Teleostei: Trichomycteridae) in Chile. Biological Journal of the Linnean Society 97:876–892. Vari, R.P., and Weitzman, S.H. 1990. A review of the phylogenetic biogeography of the freshwater fishes of South America. In: Vertebrates in the Tropics (eds Peters G, Hutterer R), pp. 381–394. Alexander Koenig Zoological Research Institute and Zoological Museum, Bonn. Vari, R. P. and Malabarba, L. R. 1998. Neotropical ichthyology: an overview. In L. R. Malabarba, R. E. Reis, R. P. Vari, Z. M. Lucena and C. A. Lucena (Eds) Phylogeny and Classification of Neotropical Fishes (pp. 1–12). Porto Alegre: Edipucrs. Vari, R. P., C. J. Ferraris, Jr., A. Radosavljevic, and V. A. Funk. 2009. Checklist of the freshwater fishes of the Guiana Shield. Bulletin of the Biological Society of Washington 17:95. Vergara, J., M. D. L. M. Azpelicueta, and G. Garcia. 2008. Phylogeography of the Neotropical catfish Pimelodus albicans (Siluriformes: Pimelodidae) from r??o de la Plata basin, South America, and conservation remarks. Neotropical Ichthyology 6:75–85. Veríssimo, A., M. A. Cochrane, and J. Souza C. 2002. National forests in the Amazon. Science 298:1478.

Ward, R. D., M. Woodwark, and D. O. F. Skibinski. 1994. A comparison of genetic diversity levels in marine, freshwater, and anadromous fishes. Journal of Fish Biology 44:213–232. Wares, J. P. 2002. Community genetics in the Northwestern Atlantic intertidal. Molecular Ecology 11: 1131-1144. Weir, J. T., E. Bermingham, M. J. Miller, J. Klicka, and M. A. González. 2008. Phylogeography of a morphologically diverse Neotropical montane species, the Common Bush-Tanager (Chlorospingus ophthalmicus). Molecular Phylogenetics and Evolution 47:650–664. Willis, S. C., M. Nunes, C. G. Montaña, I. P. Farias, G. Ortí, and N. R. Lovejoy. 2010. The Casiquiare river acts as a corridor between the Amazonas and Orinoco river basins: Biogeographic analysis of the genus Cichla. Molecular Ecology 19:1014–1030. Zink, R. M. 2002. Methods in Comparative Phylogeography, and Their Application to Studying Evolution in the North American Aridlands. Integrative and Comparative Biology 42:953– 959.

Tables

Table 1. Gymnotus specimens collected from the Guiana shield and included in this study.

Genus Species Tissue Catalogue Country Latitude Longitude Drainage Haplotype Collection ID Number Site (see Figures 5- 7) Gymnotus anguillaris 9802 KU41321 Suriname 3.927 -56.188 Coppename 11A 8 Gymnotus anguillaris 9944 KU41321 Suriname 3.927 -56.188 Coppename 11A 8 Gymnotus anguillaris 10544 ROM Suriname 5.53 -54.425 Cottica 5A 15 100941 Gymnotus anguillaris 10545 ROM Suriname 5.53 -54.425 Cottica 4A 15 100941 Gymnotus anguillaris 10882 MHNG French Guiana 3.282 -52.21 Oyapock 12A 55 2682.021 Gymnotus anguillaris 10883 MHNG French Guiana 3.282 -52.21 Oyapock 12A 55 2682.021 Gymnotus anguillaris 10884 MHNG French Guiana 5.313 -53.954 Commewijne/Maroni 7A 51 2682.089 Gymnotus anguillaris 10886 MHNG French Guiana 4.589 -53.405 Mana 8A 17 2699.076 Gymnotus anguillaris 10887 MHNG French Guiana 4.589 -53.405 Mana 9A 17 2699.080 Gymnotus anguillaris 10888 MHNG French Guiana 4.589 -53.405 Mana 8A 17 2699.080 Gymnotus anguillaris 10891 MHNG French Guiana 4.603 -53.417 Mana 9A 17 2700.015 Gymnotus anguillaris 10892 MHNG French Guiana 4.603 -53.417 Mana 9A 17 2700.015 Gymnotus anguillaris 10893 MHNG French Guiana 4.603 -53.417 Mana 8A 17 2700.018 Gymnotus anguillaris 10902 MHNG French Guiana 4.05 -52.7 Approuague 6A 19 2723.071 Gymnotus anguillaris 10903 MHNG French Guiana 5.407 -53.582 Mana 10A 52 2734.081 Gymnotus anguillaris 10904 MHNG French Guiana 5.407 -53.582 Mana 10A 52 2734.081 Gymnotus anguillaris 10905 MHNG French Guiana 5.31 -53.049 Mana 1A 52 2736.027 Gymnotus anguillaris 10906 MHNG French Guiana 5.31 -53.049 Mana 2A 52 2736.027 Gymnotus anguillaris 10928 MHNG Suriname 3.178 -55.419 Commewijne/Maroni 3A 48 2743.064 Gymnotus anguillaris 10929 MHNG Suriname 3.178 -55.419 Commewijne/Maroni 3A 48 2743.064 Gymnotus anguillaris 12799 ROM Suriname 5.53 -54.425 Cottica 5A 15 100941 Gymnotus anguillaris 12800 ROM Suriname 5.53 -54.425 Cottica 4A 15 100941 Gymnotus anguillaris 2091 AUM Venezuala 5.743 -61.403 Essequibo/Mazaruni N/A 57 (CARO) 36616 Gymnotus anguillaris 12818 ROM Guyana 5.185 -59.042 Essequibo/Mazaruni N/A 56 (CARO) 96968 Gymnotus anguillaris 11888 still in Guyana 5.439 -59.404 Essequibo/Mazaruni N/A 26 (CARO) Guyana Gymnotus anguillaris 11889 still in Guyana 5.439 -59.404 Essequibo/Mazaruni N/A 26 (CARO) Guyana Gymnotus anguillaris 11891 still in Guyana 5.475 -59.438 Essequibo/Mazaruni N/A 26 (CARO) Guyana Gymnotus anguillaris 11892 still in Guyana 5.475 -59.438 Essequibo/Mazaruni N/A 26 (CARO) Guyana Gymnotus anguillaris 11893 still in Guyana 5.475 -59.438 Essequibo/Mazaruni N/A 26 (CARO) Guyana

Gymnotus anguillaris 11895 still in Guyana 5.475 -59.438 Essequibo/Mazaruni N/A 26 (CARO) Guyana Gymnotus carapo 10916 MHNG suriname 5.244 -55.101 Suriname River N/A 26 (revised to 2744.019 GnpXING) Gymnotus carapo carapo 6998 UF 180165 Suriname 5.452 -55.245 Suriname River 11CC 12 Gymnotus carapo carapo 6999 UF 180175 Suriname 5.582 -54.233 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7000 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 5CC 15 Gymnotus carapo carapo 7001 UF 180169 Suriname 5.245 -55.101 Suriname River 11CC 13 Gymnotus carapo carapo 7003 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7004 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7005 UF 180169 Suriname 5.245 -55.101 Suriname River 5CC 13 Gymnotus carapo carapo 7006 UF 180165 Suriname 5.452 -55.245 Suriname River 13CC 12 Gymnotus carapo carapo 7007 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7008 UF 180169 Suriname 5.245 -55.101 Suriname River 5CC 13 Gymnotus carapo carapo 7009 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7010 UF 180165 Suriname 5.452 -55.245 Suriname River 11CC 12 Gymnotus carapo carapo 7011 UF 180173 Suriname 5.452 -55.245 Suriname River 11CC 12 Gymnotus carapo carapo 7012 UF 180169 Suriname 5.245 -55.101 Suriname River 5CC 13 Gymnotus carapo carapo 7013 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7014 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 7016 UF 180173 Suriname 5.587 -54.285 Commewijne/Maroni 11CC 15 Gymnotus carapo carapo 8767 ROM Guyana 7.7 -59.233 Waini coast 9CC 1 66503 Gymnotus carapo carapo 9801 KU41319 Suriname 3.92 -56.201 Coppename 17CC 8 Gymnotus carapo carapo 9810 ROM Guyana 7.429 -58.677 Akawini coast 5CC 2 87338 Gymnotus carapo carapo 9820 ROM Guyana 6.735 -58.303 Demerara coast 10CC 3 87381 Gymnotus carapo carapo 9951 ROM66503 Guyana 7.7 -59.233 Waini coast N/A 1 Gymnotus carapo carapo 9977 ROM87338 Guyana 7.429 -58.677 Akawini coast 5CC 2 Gymnotus carapo carapo 9988 ROM87338 Guyana 7.429 -58.677 Akawini coast 5CC 2 Gymnotus carapo carapo 9989 ROM87030 Guyana 4.906 -58.25 Berbice 2CC 33 Gymnotus carapo carapo 10456 ROM98188 Suriname 5.098 -57.144 Corentijne 6CC 5 Gymnotus carapo carapo 10457 ROM98188 Suriname 5.098 -57.144 Corentijne 6CC 5 Gymnotus carapo carapo 10458 ROM98188 Suriname 5.098 -57.144 Corentijne 6CC 5 Gymnotus carapo carapo 10459 ROM98188 Suriname 5.098 -57.144 Corentijne 1CC 5 Gymnotus carapo carapo 10460 ROM98188 Suriname 5.098 -57.144 Corentijne 6CC 5 Gymnotus carapo carapo 10461 ROM98188 Suriname 5.098 -57.144 Corentijne 7CC 5 Gymnotus carapo carapo 10462 ROM98188 Suriname 5.098 -57.144 Corentijne 4CC 5 Gymnotus carapo carapo 10595 ROM Guyana 6.354 -55.76 Demerara 11CC 4 100079 Gymnotus carapo carapo 10878 MHNG French Guiana 4.359 -52.329 Mahury 11CC 18 2666.035 Gymnotus carapo carapo 10880 MHNG Suriname 3.908 -55.577 Suriname River 14CC 9 2673.054 Gymnotus carapo carapo 10881 MHNG French Guiana 3.102 -52.346 Oyapock 3CC 20 2681.033 Gymnotus carapo carapo 10889 MHNG French Guiana 4.603 -53.401 Mana 8CC 17 2700.011 Gymnotus carapo carapo 10890 MHNG French Guiana 4.603 -53.401 Mana 8CC 17 2700.011 Gymnotus carapo carapo 10896 MHNG Suriname 2.366 -56.766 Corentijne 18CC 6 2703.079 Gymnotus carapo carapo 10899 MHNG Suriname 2.024 -56.086 Corentijne 18CC 7 2703.082 Gymnotus carapo carapo 10900 MHNG French Guiana 4.05 -52.7 Approuague 15CC 19 2723.065 Gymnotus carapo carapo 10901 MHNG French Guiana 4.05 -52.7 Approuague 15CC 19 2723.065 Gymnotus carapo carapo 10907 MHNG French Guiana 5.311 -53.049 Surinamary 16CC 16 2736.028 Gymnotus carapo carapo 10908 MHNG French Guiana 5.311 -53.049 Surinamary 16CC 16 2736.028 Gymnotus carapo carapo 10909 MHNG Suriname 5.325 -55.485 Saramacca 11CC 11 2737.007 Gymnotus carapo carapo 10910 MHNG Suriname 5.325 -55.485 Saramacca 11CC 11 2737.007 Gymnotus carapo carapo 10914 MHNG Suriname 5.45 -55.233 Suriname River 11CC 12 2737.096

Gymnotus carapo carapo 10917 MHNG Suriname 5.244 -55.101 Suriname River 19CC 13 2744.019 Gymnotus carapo carapo 10919 MHNG Suriname 4.445 -55.764 Saramacca 12CC 10 2752.096 Gymnotus carapo carapo 10920 MHNG Suriname 4.445 -55.764 Saramacca 12CC 10 2752.096 Gymnotus carapo carapo 10925 MHNG Suriname 2.355 -56.788 Corentijne N/A 6 2703.080 Gymnotus carapo carapo 10930 MHNG French Guiana 4.359 -52.329 Mahury 11CC 18 2666.035 Gymnotus carapo carapo 10931 MHNG French Guiana 4.359 -52.329 Mahury 11CC 18 2666.030 Gymnotus carapo carapo 10932 MHNG French Guiana 4.359 -52.329 Mahury 11CC 18 2666.030 Gymnotus carapo carapo 12801 ROM Guyana 6.354 -58.241 Demerara 11CC 4 100079 Gymnotus carapo carapo 12810 ROM Suriname 4.445 -55.76 Saramacca 12CC 10 102427 Gymnotus carapo carapo 12811 ROM Suriname 4.445 -55.76 Saramacca 12CC 10 102427 Gymnotus carapo carapo 12812 ROM Suriname 4.445 -55.76 Saramacca 12CC 10 102427 Gymnotus carapo carapo 12813 ROM Suriname 4.445 -55.76 Saramacca 12CC 10 102427 Gymnotus carapo carapo 12814 ROM Suriname 4.445 -55.76 Saramacca 12CC 10 102427 Gymnotus carapo carapo 12815 ROM Suriname 4.445 -55.76 Saramacca 12CC 10 102427 Gymnotus carapo carapo 12816 ROM Suriname 5.574 -54.424 Cottica 11CC 14 102538 Gymnotus carapo 9805 ROM Guyana 5.476 -60.78 Essequibo/Mazaruni 3CO 23 occidentalis 83812 Gymnotus carapo 9806 ROM Guyana 5.936 -60.615 Essequibo/Mazaruni 3CO 21 occidentalis 83885 Gymnotus carapo 9811 ROM Guyana 5.936 -60.615 Essequibo/Mazaruni 3CO 21 occidentalis 83885 Gymnotus carapo 9815 ROM Guyana 5.36 -60.372 Essequibo/Mazaruni N/A 24 occidentalis 83714 Gymnotus carapo 9816 ROM Guyana 4.933 -59.8 Essequibo/Mazaruni 2CO 29 occidentalis 89937 Gymnotus carapo 9817 ROM Guyana 4.906 -58.25 Berbice 3CO 33 occidentalis 83812 Gymnotus carapo 9819 ROM Guyana 5.708 -60.361 Essequibo/Mazaruni 3CO 22 occidentalis 89575 Gymnotus carapo 9821 ROM Guyana 5.36 -60.372 Essequibo/Mazaruni 3CO 24 occidentalis 83714 Gymnotus carapo 9947 ROM Guyana 4.933 -59.8 Essequibo/Mazaruni 2CO 29 occidentalis 89937 Gymnotus carapo 9948 ROM Guyana 2.829 -59.809 Rio-Branco 5CO 31 occidentalis 96022 Gymnotus carapo 9949 ROM83812 Guyana 5.476 -60.78 Essequibo/Mazaruni 3CO 23 occidentalis Gymnotus carapo 9950 ROM83812 Guyana 5.476 -60.78 Essequibo/Mazaruni 3CO 23 occidentalis Gymnotus carapo 9978 ROM83714 Guyana 5.36 -60.372 Essequibo/Mazaruni 3CO 24 occidentalis Gymnotus carapo 9983 ROM83812 Guyana 5.476 -60.78 Essequibo/Mazaruni 3CO 23 occidentalis Gymnotus carapo 10027 ROM94993 Guyana 5.011 -59.637 Essequibo/Mazaruni N/A 28 occidentalis Gymnotus carapo 10028 ROM94993 Guyana 5.011 -59.637 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10030 ROM94993 Guyana 5.011 -59.637 Essequibo/Mazaruni N/A 28 occidentalis Gymnotus carapo 10031 ROM95035 Guyana 5.007 -59.632 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10032 ROM95035 Guyana 5.007 -59.632 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10033 ROM95035 Guyana 5.007 -59.632 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10034 ROM95035 Guyana 5.007 -59.632 Essequibo/Mazaruni 2CO 28 occidentalis

Gymnotus carapo 10035 ROM95051 Guyana 5.008 -59.637 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10036 ROM95051 Guyana 5.008 -59.637 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10037 ROM95051 Guyana 5.008 -59.637 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10038 ROM95051 Guyana 5.008 -59.637 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10039 ROM95071 Guyana 5.07 -59.654 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10040 ROM95071 Guyana 5.07 -59.654 Essequibo/Mazaruni 2CO 28 occidentalis

Gymnotus carapo 10041 ROM95088 Guyana 5.109 -59.636 Essequibo/Mazaruni 2CO 28 occidentalis Gymnotus carapo 10042 not in Guyana 5.275 -59.516 Essequibo/Mazaruni 1CO 27 occidentalis ROM collections Gymnotus carapo 10043 not in Guyana 5.275 -59.516 Essequibo/Mazaruni 2CO 27 occidentalis ROM collections Gymnotus carapo 10452 ROM97383 Guyana 4.157 -58.177 Berbice 4CO 32 occidentalis Gymnotus carapo 10453 ROM97383 Guyana 4.157 -58.177 Berbice 4CO 32 occidentalis Gymnotus carapo 11921 AUM Guyana 4.714 -60.022 Rio-Branco 2CO 30 occidentalis 67504 Gymnotus carapo 11922 AUM Guyana 4.714 -60.022 Rio-Branco 2CO 30 occidentalis 67504 Gymnotus carapo 11923 AUM Guyana 4.719 -60.016 Rio-Branco 2CO 30 occidentalis 67092 Gymnotus carapo 11924 AUM Guyana 4.719 -60.016 Rio-Branco 2CO 30 occidentalis 67092 Gymnotus carapo 11925 AUM Guyana 4.719 -60.016 Rio-Branco 2CO 30 occidentalis 67092 Gymnotus carapo 11926 AUM Guyana 4.719 -60.016 Rio-Branco 2CO 30 occidentalis 67092 Gymnotus carapo 11927 AUM Guyana 4.719 -60.009 Rio-Branco 2CO 30 occidentalis 67109 Gymnotus carapo 11928 AUM Guyana 4.719 -60.009 Rio-Branco 2CO 30 occidentalis 67109 Gymnotus carapo 11929 AUM Guyana 4.719 -60.009 Rio-Branco 2CO 30 occidentalis 67109 Gymnotus carapo 11930 AUM Guyana 4.719 -60.009 Rio-Branco 2CO 30 occidentalis 67109 Gymnotus carapo 11931 AUM Guyana 5.066 -59.972 Rio-Branco 2CO 25 occidentalis 67122 Gymnotus carapo 11932 AUM Guyana 5.106 -59.988 Rio-Branco 2CO 25 occidentalis 67135 Gymnotus carapo 11933 AUM Guyana 5.106 -59.988 Rio-Branco 2CO 25 occidentalis 67135 Gymnotus carapo 11934 AUM Guyana 5.106 -59.988 Rio-Branco 2CO 25 occidentalis 67135 Gymnotus carapo 11935 AUM Guyana 5.106 -59.988 Rio-Branco 2CO 25 occidentalis 67135 Gymnotus carapo 11936 AUM Guyana 5.106 -59.988 Rio-Branco 2CO 25 occidentalis 67135 Gymnotus carapo 11937 AUM Guyana 5.106 -59.988 Rio-Branco 2CO 25 occidentalis 67135 Gymnotus carapo 11938 AUM Guyana 5.084 -59.988 Rio-Branco 2CO 25 occidentalis 67122 Gymnotus carapo 11939 AUM Guyana 5.084 -59.988 Rio-Branco 2CO 25 occidentalis 67122 Gymnotus carapo 11940 AUM Guyana 5.084 -59.988 Rio-Branco 2CO 25 occidentalis 67122 Gymnotus carapo 11941 AUM Guyana 5.087 -59.988 Rio-Branco 2CO 25 occidentalis 67168 Gymnotus carapo 11942 AUM Guyana 5.087 -59.988 Rio-Branco 2CO 25 occidentalis 67168 Gymnotus carapo 11943 AUM Guyana 5.087 -59.988 Rio-Branco 2CO 25 occidentalis 67168

Gymnotus carapo 11944 AUM Guyana 5.087 -59.988 Rio-Branco 2CO 25 occidentalis 67168 Gymnotus carapo 11945 AUM Guyana 5.087 -59.988 Rio-Branco 2CO 25 occidentalis 67168 Gymnotus carapo 11946 AUM Guyana 5.044 -59.977 Rio-Branco 2CO 25 occidentalis 67177 Gymnotus coropinae 2035 ANSP Guyana 3.114 -59.776 Rio-Branco 27Co 42 179126 Gymnotus coropinae 2036 AUM Guyana 3.114 -59.775 Rio-Branco 28Co 42 35848 Gymnotus coropinae 2037 ANSP Guyana 6.378 -58.674 Essequibo/Mazaruni 24Co 35 179127 Gymnotus coropinae 2038 ANSP Guyana 6.378 -58.674 Essequibo/Mazaruni 24Co 35 179127 Gymnotus coropinae 6969 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6970 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6971 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6972 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6973 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6974 UF 180168 Suriname 5.452 -55.245 Suriname River 3Co 12 Gymnotus coropinae 6975 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6976 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6977 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6978 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6979 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6980 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6981 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6982 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6983 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6984 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6986 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6987 UF 180168 Suriname 5.452 -55.245 Suriname River 1Co 12 Gymnotus coropinae 6988 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 6989 UF 180168 Suriname 5.452 -55.245 Suriname River 2Co 12 Gymnotus coropinae 9808 ROM87029 Guyana 4.906 -58.25 Berbice 26Co 33 Gymnotus coropinae 9812 RO87029 Guyana 4.906 -58.25 Berbice 25Co 33 Gymnotus coropinae 9952 ROM91312 Guyana 5.395 -59.533 Essequibo/Mazaruni 20Co 37 Gymnotus coropinae 10446 ROM97298 Guyana 4.158 -58.177 Berbice 27Co 32 Gymnotus coropinae 10447 ROM97298 Guyana 4.158 -58.177 Berbice 27Co 32 Gymnotus coropinae 10448 ROM97320 Guyana 4.157 -58.177 Berbice 27Co 32 Gymnotus coropinae 10449 ROM97320 Guyana 4.157 -58.177 Berbice 27Co 32 Gymnotus coropinae 10450 ROM97320 Guyana 4.157 -58.177 Berbice 27Co 32 Gymnotus coropinae 10451 ROM97320 Guyana 4.157 -58.177 Berbice 27Co 32 Gymnotus coropinae 10454 ROM97383 Guyana 4.157 -58.177 Berbice 27Co 32 Gymnotus coropinae 10455 ROM97408 Guyana 5.252 -58.07 Berbice 23Co 34 Gymnotus coropinae 10463 ROM97475 Guyana 6.121 -60.344 Essequibo/Mazaruni 18Co 41 Gymnotus coropinae 10464 ROM97475 Guyana 6.121 -60.344 Essequibo/Mazaruni 18Co 41 Gymnotus coropinae 10465 TISSUE Guyana 6.339 -60.368 Essequibo/Mazaruni 13Co 39 ONLY Gymnotus coropinae 10466 ROM97566 Guyana 6.327 -60.367 Essequibo/Mazaruni 19Co 39 Gymnotus coropinae 10467 ROM97566 Guyana 6.327 -60.367 Essequibo/Mazaruni 13Co 39 Gymnotus coropinae 10468 ROM97566 Guyana 6.327 -60.367 Essequibo/Mazaruni 19Co 39 Gymnotus coropinae 10472 ROM97604 Guyana 6.143 -60.062 Essequibo/Mazaruni 14Co 38 Gymnotus coropinae 10473 ROM97649 Guyana 6.452 -60.584 Essequibo/Mazaruni 17Co 40 Gymnotus coropinae 10474 ROM97649 Guyana 6.452 -60.584 Essequibo/Mazaruni 17Co 40 Gymnotus coropinae 10475 ROM97584 Guyana 6.454 -60.585 Essequibo/Mazaruni 17Co 40 Gymnotus coropinae 10476 ROM97584 Guyana 6.454 -60.585 Essequibo/Mazaruni 19Co 40 Gymnotus coropinae 10879 MHNG Suriname 3.909 -55.583 Suriname River 5Co 9 2673.029 Gymnotus coropinae 10894 MHNG Suriname 2.351 -56.809 Corentijne 11Co 43 2703.077 Gymnotus coropinae 10895 MHNG Suriname 2.406 -56.933 Corentijne 12Co 43 2703.078 Gymnotus coropinae 10897 MHNG Suriname 2.014 -56.158 Corentijne 12Co 7 2703.081 Gymnotus coropinae 10898 MHNG Suriname 2.014 -56.158 Corentijne 12Co 7 2703.081 Gymnotus coropinae 10911 MHNG Suriname 5.325 -55.485 Saramacca 7Co 11 2737.022 Gymnotus coropinae 10912 MHNG Suriname 5.325 -55.485 Saramacca 6Co 11 2737.022

Gymnotus coropinae 10913 MHNG Suriname 4.383 -55.35 Suriname River 2Co 44 2737.085 Gymnotus coropinae 10915 MHNG Suriname 5.316 -54.834 Cottica 2Co 46 2743.094 Gymnotus coropinae 10918 MHNG Suriname 5.165 -55.193 Suriname River 4Co 45 2745.029 Gymnotus coropinae 10921 MHNG Suriname 4.428 -55.764 Saramacca 10Co 10 2752.092

Gymnotus coropinae 10922 MHNG Suriname 4.428 -55.764 Saramacca 9Co 10 2752.092 Gymnotus coropinae 10923 MHNG Suriname 4.291 -55.803 Saramacca 9Co 10 2755.035 Gymnotus coropinae 10924 MHNG Suriname 4.291 -55.803 Saramacca 9Co 10 2755.035 Gymnotus coropinae 10927 MHNG French Guiana 2.938 -54.172 Commewijne/Maroni 15Co 47 uncat Gymnotus coropinae 11885 still in Guyana 5.406 -59.539 Essequibo/Mazaruni 20Co 37 Guyana Gymnotus coropinae 11886 still in Guyana 5.406 -59.539 Essequibo/Mazaruni 20Co 37 Guyana Gymnotus coropinae 11887 still in Guyana 5.422 -59.459 Essequibo/Mazaruni 21Co 37 Guyana Gymnotus coropinae 11894 still in Guyana 5.493 -59.404 Essequibo/Mazaruni 16Co 37 Guyana Gymnotus coropinae 12806 ROM Suriname 4.295 -55.805 Saramacca 9Co 10 102322 Gymnotus coropinae 12807 ROM Suriname 4.295 -55.805 Saramacca 9Co 10 103059 Gymnotus coropinae 12808 ROM Suriname 4.295 -55.805 Saramacca 8Co 10 103059 Gymnotus coropinae 12817 ROM Guyana 5.185 -59.042 Essequibo/Mazaruni 22Co 36 96968

Table 2. Primers used in this study. Primer Primer Sequence 5’ – 3’ Source GLUDGL CGAAGCTTGACTTGAARAACCAYCGTT Palumbi et al. 1991 CYTBR CTCCGATCTTCGGATTACAAG Palumbi et al. 1991

GLUDGL.GYM AGACCTATGACTTGAAAAACCATCGTTG Lehmberg et al. (accepted) JOHNNY5.CYTBR GCTGAAGATGGGAGTTAAACCC Lehmberg et al. (accepted)

Table 3. Summary statistics for G. carapo occidentalis, G. carapo carapo, G. coropinae and G. anguillaris.

G. carapo G. carapo carapo G. coropinae G. occidentalis anguillaris Sample number 50 59 69 22 Parsimony informative 2 28 82 71 sites Number of haplotypes 5 19 27 12 Nucleotide Diversity 0.00044 0.081 0.3 0.009

Figures

Figure 1. Relative position (inset) and map of the Guiana Shield (adapted from Fouquet et al. 2012). The region is outlined in white and divided into the western and eastern sub-regions.

lected.

Mahur y

Surinama ry

k Oyapoc

Mana

Cottic a

a Saramacc

Commewijne/Maron i

Corentijne Demerara

Berbic e

Akawain i

Wain i

Branco -

Essequibo/Mazaruni Rio

The drainages of the Guiana Shield of Guyana, Suriname and French Guiana from which the fish included in this thesis were col inSuriname this thesis Guiana and included from fish which the of Shield the Guyana, of Guiana French drainages The

. 2

Figure

Figure 3. Hypothesized areas of movement between basins of the Guiana Shield (adapted from Lujan and Armbruster 2011).

Gymnotus carapo carapo Gymnotus carapo occidentalis

Figure 4. Generalized range of Gymnotus carapo (top), G. coropinae (middle) and G. anguillaris (bottom). The range of G carapo is further divided to illustrate the speculative ranges of the subspecies G. carapo occidentalis and G. carapo carapo (data acquired from Crampton and Albert 2003, Craig et al. 2017, and Lovejoy lab samples).

1 2 3

4 21 22 15 23 12 14 16 24 27 5 11 25 28 33 13 29 17 30 10 18 32 8 9 19

20 31 6

Figure 5. Collection sites of Gymnotus carapo from the Guiana Shield. Sites at which G. carapo occidentalis were collected are dark blue, sites at which G. carapo carapo were collected are light blue. Both G. carapo occidentalis and G. carapo carapo were collected from sites 32 and 33. Information on specific coordinates can be found in Table 1.

40 39 35 38 41 37 12 11 36 34 46 33 45

10 44 32 9

47 42 43

Figure 6. Collection sites of Gymnotus coropinae from the Guiana Shield. Information on specific coordinates can be found in Table 1.

26 15 51 52 56

8 19

48 55

Figure 7. Collection sites of Gymnotus anguillaris from the Guiana Shield. Sites from which the proposed G. n.sp. CARO samples were collected from are red (see Cryptic Species section in Results). Information on specific coordinates can be found in Table 1.

Figure 8. River network map used to calculate geographic distance between individual samples. Coastal connections between river mouths were manually added in order to create a continuous system. An inland connection between the Rio Branco River and the Essequibo River (circled in red) was made based on previous literary support for a seasonal freshwater connection in this location (Rupanuni Canal).

G. cylindricus

0.89 G. carapo occidentalis

0.92 1

1 G. carapo carapo

G. anguillaris 1 1 1 1 G. n.sp CARO

1 G. coropinae

Figure 9. Cytb gene tree showing relationships between the study species included in this thesis. Bayesian posterior probabilities are shown on major clades. Branch lengths are proportional to molecular evolution.

_2CO _2CO _3CO _2CO _N/A _2CO _2CO _2CO _2CO _2CO _2CO _2CO _N/A _2CO _2CO _2CO _2CO _2CO _2CO _2CO _1CO _2CO _2CO _2CO _2CO _2CO _2CO _N/A _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _2CO _3CO _3CO _3CO _3CO _3CO _3CO _3CO _3CO _3CO _4CO _4CO _5CO _11CC _12CC _12CC _12CC _12CC _12CC _12CC _13CC _12CC _14CC _12CC _11CC _11CC _16CC _16CC _5CC _11CC _15CC _15CC _11CC _11CC _11CC _11CC _11CC _11CC _10CC _11CC _11CC _11CC _11CC _11CC _11CC _11CC _11CC _11CC _11CC _11CC _8CC _4CC _5CC _8CC _5CC _9CC _N/A _5CC _5CC _6CC _6CC _6CC _6CC _7CC _2CC _2CC _5CC _11CC _11CC _3CC _18CC _18CC _18CC _19CC _17CC FigureFigure 10. 10. Cyt Cytb geneb gene tree tree showing showing relationships relationships between among drainage individuals populations of Gymnotus of Gymnotus carapo carapo occidentalis and occidentalisGymnotus and carapo Gymnotus carapo carapo. Bayesian carapo posterior. Bayesian probabilities posterior probabilities are shown onare majorshown clades. on major Colours clades. represent drainages.

. .

haplotypes

Gymnotus carapo occidentalis carapo Gymnotus

of drainage distribution Geographic

. . 11

Figure

3CO

1CO 2CO

4CO

5CO

Figure 12. Gymnotus carapo occidentalis haplotype network. Colours represent drainages from which fish exhibiting the haplotype in question were collected from, larger circles indicate that a larger number of fish exhibited that particular haplotype, and dashes along network lines represent base pair changes between cytb sequences.

C 3

11C C

15C

C 16C

11C

C 8C

11CC

13CC

C 17C

haplotypes

2CC

Gymnotus carapo carapo carapo carapo Gymnotus

5CC

C 9

Geographic drainage distribution of of distribution drainage Geographic . .

Figure1

3CC 13CC

1CC 4CC 12CC 14CC 2CC 10CC 11CC

15CC 5CC 6CC 9CC

7CC

16CC

8CC

17CC

18CC

19CC

Figure 14. Gymnotus carapo carapo haplotype network. Colours represent drainages from which fish exhibiting the haplotype in question were collected from, larger circles indicate that a larger number of fish exhibited that particular haplotype, and dashes along network lines represent base pair changes between cytb sequences.

_3Co _2Co _2Co _2Co _2Co _2Co _2Co _2Co _1Co 1 _2Co _2Co _2Co _2Co _2Co _2Co _2Co _2Co 0.99 _2Co _2Co 1 _2Co 0.99 _2Co _4Co _3Co _5Co 0.99 _9Co _10Co 0.89 _9Co _9Co 1 _9Co _9Co 1 1 _8Co 1 _7Co _6Co 0.85 _12Co _12Co 1 _12Co _11Co _17Co 0.94 _17Co _17Co _18Co 1 _18Co 0.99 _19Co _19Co 1 _19Co 0.98 _16Co 1 _13Co 0.99 _13Co _14Co 0.74 _20Co 1 _20Co _20Co _21Co _15Co 0.63 _28Co _27Co _26Co _27Co _27Co 0.84 1 _27Co _27Co _27Co 0.79 _27Co _27Co _22Co 1 _24Co 0.91 _24Co _23Co _25Co

Figure 15. Cytb gene tree showing relationships among individuals of Gymnotus coropinae. Bayesian posterior probabilities are shown on major clades. Colours represent drainages.

1Co 78

2Co

7Co 3Co 4Co

6Co

5Co

8Co 9Co 15Co

10Co 11Co

12Co

13Co

14Co 16Co 17Co

19Co

18Co

20Co

21Co

22Co 23Co 24Co 28Co

25Co

27Co

26Co

Figure 16. Gymnotus coropinae haplotype network. Colours represent drainages from which fish exhibiting the haplotype in question were collected from, larger circles indicate that a larger number of fish exhibited that particular haplotype, and dashes along network lines represent base pair changes between cytb sequences.

15Co

2Co

haplotypes 12Co

27Co 28Co

Gymnotus coropinae Gymnotus

of drainage distribution Geographic

. . 7

Figure1

0.67 _8A _8A _8A 0.99 _9A _9A _9A _7A _10A 0.64 _10A _4A 0.62 _4A _5A 1 _5A _12A _12A 0.94 _6A 9944_Ganguillaris_Coppename_11A 1 9802_Ganguillaris_Coppename _11A _1A _2A _3A _3A 1 1 0.96 1

Figure 18. Cytb gene tree showing relationships among individuals of Gymnotus anguillaris. Bayesian posterior probabilities are shown on major clades. Colours represent drainages.

3A 1A

2A Coppename

Oyapock Commewinje/Maroni Mana Approuague Cottica Essequibo/Mazaruni SurinameRiver

Waini

Akawini Demerara Rio-Branco Berbice Corentijne Mahury Surinamary

5A Saramacca 4A

7A 12A 6A

8A 9A 10A

11A

Figure 19. Gymnotus anguillaris haplotype network. Colours represent drainages from which fish exhibiting the haplotype in question were collected from, larger circles indicate that a larger number of fish exhibited that particular haplotype, and dashes along network lines represent base pair changes between cytb sequences.

haplotypes

11A

Gymnotusanguilaris

Geographic drainage distribution of of drainage distribution Geographic . .

Figure