Coding Strategy of the Genome of Chilo Iridescent Virus

Total Page:16

File Type:pdf, Size:1020Kb

Coding Strategy of the Genome of Chilo Iridescent Virus Virology 286, 182–196 (2001) doi:10.1006/viro.2001.0963, available online at http://www.idealibrary.com on View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Analysis of the First Complete DNA Sequence of an Invertebrate Iridovirus: Coding Strategy of the Genome of Chilo Iridescent Virus Nurith J. Jakob, Kristin Mu¨ller, Udo Bahr, and Gholamreza Darai1 Institut fu¨r Medizinische Virologie, Universita¨t Heidelberg, Im Neuenheimer Feld 324, D-69120 Heidelberg, Federal Republic of Germany Received February 27, 2001; returned to author for revision March 20, 2001; accepted April 18, 2001 Chilo iridescent virus (CIV), the type species of the genus Iridovirus, a member of the Iridoviridae family, is highly pathogenic for a variety of insect larvae. The virions contain a single linear ds DNA molecule that is circularly permuted and terminally redundant. The coding capacity and strategy of the CIV genome was elucidated by the analysis of the complete DNA nucleotide sequence of the viral genome (212,482 bp) using cycle sequencing by primer walking technology. Both DNA strands were sequenced independently and the average redundancy for each nucleotide was found to be 1.85. The base composition of the viral genomic DNA sequence was found to be 71.37% AϩT and 28.63% GϩC. The CIV genome contains 468 open reading frames (ORFs). The size of the individual viral gene products ranges between 40 and 2432 amino acids. The analysis of the coding capacity of the CIV genome revealed that 50% (234 ORFs) of all identified ORFs were nonoverlapping. The comparison of the deduced amino acid sequences to entries in protein data banks led to the identification of several genes with significant homologies, such as the two major subunits of the DNA-dependent RNA polymerase, DNA polymerase, protein kinase, thymidine and thymidylate kinase, thymidylate synthase, ribonucleoside- diphosphate reductase, major capsid protein, and others. The highest homologies were detected between putative viral gene products of CIV and lymphocystis disease virus of fish (LCDV). Although many CIV putative gene products showed significant homologies to the corresponding viral proteins of LCDV, no colinearity was detected when the coding strategies of the CIV and LCDV-1 were compared to each other. An intriguing result was the detection of a viral peptide of 53 amino acid residues (ORF 160L) showing high homology (identity/similarity: 60.0%/30.0%) to sillucin, an antibiotic peptide encoded by Rhizomucor pusillus. Iridovirus homologs of cellular genes possess particular implications for the molecular evolution of large DNA viruses. © 2001 Academic Press Key Words: cytoplasmic DNA viruses; Iridoviridae; Chilo iridescent virus; insect iridescent virus type 6; DNA nucleotide and amino acid sequence alignment; computer analysis; protein alignment. INTRODUCTION considered a potential agent for biological control, since these viruses cause lethal infections in important pest Iridoviruses are large icosahedral cytoplasmic de- insect species (Kleespies et al., 1999; Hernandez et al., oxyriboviruses. A major characteristic of iridoviruses is their large icosahedral capsid and their replication and 2000). An advantage of CIV is that it can be easily grown assembly in cytoplasm. Members of the Iridoviridae fam- and propagated in cultured Choristoneura fumiferana ily have been isolated from poikilothermic animals, in- (CF-124) cells (Cerutti et al., 1981). The icosahedral virus cluding various insects and some cold-blooded verte- particle of CIV comprises a capsid, intermediate lipid brates. Iridoviruses are subdivided into four genera in- layer, and viral genome with a single linear double- cluding Iridovirus, Chloriridovirus, Lymphocystivirus, and stranded DNA molecule (212 kb), which was found to be Ranavirus (van Regenmortel et al., 2000). The type spe- circularly permuted and terminally redundant (Delius et cies for the genus Iridovirus is Chilo iridescent virus al., 1984; Schnitzler et al., 1987; Soltau et al., 1987; (CIV); an alternative name is insect iridescent virus type Fischer et al., 1990). This genomic feature is common to 6. CIV was isolated from the stem-boring lepidopteran other iridoviruses too, such as frog virus 3 (FV3, type Chilo suppressalis (rice stem borer; Fukaya and Nasu, species of the genus Ranavirus; Goorha and Murti, 1982), 1966). As to biological relevance CIV is of particular lymphocystis disease virus (LCDV, type species of the economical and ecological importance, since it infects a genus Lymphocystivirus; Darai et al., 1983, 1985; Schnit- number of herbivore insects that cause immense dam- zler et al., 1990), and insect iridescent virus type 9 (Ward ages in agriculture, e.g., rice farming and stone fruits and Kalmakoff, 1987). Further biological and genomic (Smith, 1976). Consequently this insect iridovirus can be properties of CIV such as the virion structure, viral pro- teins, enzymatic activities (Cerutti and Devauchelle, 1980, Cerutti et al., 1981; Darai, 1982, 1985; and 1990), the 1 To whom correspondence and reprint requests should be ad- positions of at least six origins of replication, and repet- dressed. Fax: ϩ49-6221-56-4104. E-mail: [email protected]. itive DNA elements (Fischer et al., 1988a,b; Handermann 0042-6822/01 $35.00 Copyright © 2001 by Academic Press 182 All rights of reproduction in any form reserved. ANALYSIS OF THE GENOME OF Chilo IRIDESCENT VIRUS 183 et al., 1992; Sonntag and Darai, 1992; Stohwasser et al., nucleotide from each strand was determined with an 1993; Schnitzler et al., 1994a,b; Tidona and Darai, 1997) average redundancy of 1.85. The base composition of the have been reported. Furthermore some important viral viral genomic DNA sequence was found to be 71.37% genes have been identified and analyzed, including the AϩT and 28.63% GϩC, which is in agreement with val- major capsid protein, an evolutionarily highly conserved ues described previously (Delius et al., 1984). The com- viral protein, the largest subunit of the DNA-dependent plete DNA sequence was deposited with GenBank (Ac- RNA polymerase, the ATPase, and the DNA polymerase cession No. AF303741). The analysis of the viral DNA (Stohwasser et al., 1993; Schnitzler et al., 1994a,b; revealed the presence of numerous short direct, in- Sonntag et al., 1994a,b; Bahr et al., 1997; Tidona et al., verted, and palindromic repetitive DNA sequences. In 1998; Mu¨ller et al., 1999). addition three clusters of large repetitive DNA elements Recently we determined the complete DNA sequence were detected within the DNA sequences of the EcoRI of LCDV-1 (Tidona and Darai, 1997), which is the caus- CIV DNA fragments H and C (261R; 396L, 443R). The ative agent of lymphocystis disease in fish and belongs positions of two repetitive DNA elements are in agree- to the genus Lymphocystivirus within the Iridoviridae ment with the data reported previously (Fischer et al., family. This was the first complete DNA sequence of an 1988a,b, 1990). iridovirus genome. Several viral gene products with sig- nificant homologies to entries in protein data banks were Coding capacity of the CIV genome identified. However, a handicap in this analysis was the Computer-assisted analysis of the DNA sequence of lack of sequence information of other iridoviruses. The the CIV genome revealed the presence of 468 potential goal of the present study was the analysis of the coding open reading frames (ORFs) with coding capacities for capacity and strategy of the genome of this ecological polypeptides ranging from 40 to 2432 amino acids. The important insect iridovirus—Chilo iridescent virus—by analysis of the coding capacity of the CIV genome re- elucidation of the primary structure of the viral genome. vealed that 50% (234 ORFs) of all identified ORFs (468 ORFs) were nonoverlapping. The properties of 215 po- RESULTS AND DISCUSSION tential viral ORFs (Ͼ150 nucleotides), including 8 over- lapping ORFs, that were detected within the DNA nucle- Integrity of the viral genome organization otide sequence of the upper (R) and lower (L) DNA The organization of the viral genome and the integrity strands of CIV genome are summarized in Table 1. The of the genomic library of CIV (Schnitzler et al., 1987; classical or slightly modified canonical promoters and Soltau et al., 1987) were determined by PCR analysis and termination signals were found upstream and down- determination of the DNA nucleotide sequences of the stream of the start and termination codons of the majority terminal regions of the cloned EcoRI CIV DNA fragments of the individual viral ORFs. However, due to the high AT (Bahr et al., 1997). Based on the data obtained from the content of the viral DNA molecule the identification of the analysis of the DNA nucleotide sequence of the individ- AT-rich transcriptional signals of individual viral ORFs is ual EcoRI DNA fragments further DNA oligonucleotide difficult. primers were constructed and used for amplification of the corresponding region of the viral genome by PCR. Relatedness of CIV gene products to other proteins These studies revealed that each PCR product pos- In analogy to other large DNA viruses of eukaryotes it sesses the corresponding EcoRI restriction site flanked was found that iridoviruses encode a number of cellular by adjacent EcoRI DNA fragments as determined by protein homologs. The majority of these proteins repre- physical mapping of the viral genome (Schnitzler et al., sent orthologues of cellular enzymes involved
Recommended publications
  • Artemia Spp., a Susceptible Host and Vector for Lymphocystis Disease Virus
    viruses Article Artemia spp., a Susceptible Host and Vector for Lymphocystis Disease Virus Estefania J. Valverde, Alejandro M. Labella, Juan J. Borrego and Dolores Castro * Departamento de Microbiología, Facultad de Ciencias, Universidad de Málaga, 29017 Málaga, Spain; [email protected] (E.J.V.); [email protected] (A.M.L.); [email protected] (J.J.B.) * Correspondence: [email protected]; Tel.: +34-952134214 Received: 8 May 2019; Accepted: 30 May 2019; Published: 1 June 2019 Abstract: Different developmental stages of Artemia spp. (metanauplii, juveniles and adults) were bath-challenged with two isolates of the Lymphocystis disease virus (LCDV), namely, LCDV SA25 (belonging to the species Lymphocystis disease virus 3) and ATCC VR-342 (an unclassified member of the genus Lymphocystivirus). Viral quantification and gene expression were analyzed by qPCR at different times post-inoculation (pi). In addition, infectious titres were determined at 8 dpi by integrated cell culture (ICC)-RT-PCR, an assay that detects viral mRNA in inoculated cell cultures. In LCDV-challenged Artemia, the viral load increased by 2–3 orders of magnitude (depending on developmental stage and viral isolate) during the first 8–12 dpi, with viral titres up to 2.3 102 × Most Probable Number of Infectious Units (MPNIU)/mg. Viral transcripts were detected in the infected Artemia, relative expression values showed a similar temporal evolution in the different experimental groups. Moreover, gilthead seabream (Sparus aurata) fingerlings were challenged by feeding on LCDV-infected metanauplii. Although no Lymphocystis symptoms were observed in the fish, the number of viral DNA copies was significantly higher at the end of the experimental trial and major capsid protein (mcp) gene expression was consistently detected.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Disease of Aquatic Organisms 105:1
    Vol. 105: 1–8, 2013 DISEASES OF AQUATIC ORGANISMS Published July 9 doi: 10.3354/dao02594 Dis Aquat Org Megalocytivirus infection in orbiculate batfish Platax orbicularis Preeyanan Sriwanayos1, Ruth Francis-Floyd1,2, Mark F. Stidworthy3, Barbara D. Petty1,2, Karen Kelley4, Thomas B. Waltzek5,* 1Program in Fisheries and Aquatic Sciences, School of Forestry Resources and Conservation, University of Florida, Gainesville, Florida 32653, USA 2Department of Large Animal Clinical Sciences, College of Veterinary Medicine, University of Florida, Gainesville, Florida 32610, USA 3International Zoo Veterinary Group, Station House, Parkwood Street, Keighley, West Yorkshire BD21 4NQ, UK 4Interdisciplinary Center for Biotechnology Research (ICBR), Cellomics Division, Electron Microscopy and Bio-imaging Core Laboratory, University of Florida, Gainesville, Florida 32611, USA 5Department of Infectious Diseases and Pathology, College of Veterinary Medicine, University of Florida, Gainesville, Florida 32608, USA ABSTRACT: Megalocytiviruses cause systemic disease in both marine and freshwater fishes, neg- atively impacting ornamental and food fish aquaculture. In this report, we characterize a megalo- cytivirus infection in a captive marine ornamental fish, the orbiculate batfish Platax orbicularis. Histologic examination revealed cytomegalic cells characterized by strongly basophilic granular intracytoplasmic inclusions within various organs. Transmission electron microscopy revealed icosahedral virus particles within the cytoplasm of cytomegalic cells consistent
    [Show full text]
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase
    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
    [Show full text]
  • The DNA Virus Invertebrate Iridescent Virus 6 Is a Target of the Drosophila Rnai Machinery
    The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery Alfred W. Bronkhorsta,1, Koen W. R. van Cleefa,1, Nicolas Vodovarb,2, Ikbal_ Agah Ince_ c,d,e, Hervé Blancb, Just M. Vlakc, Maria-Carla Salehb,3, and Ronald P. van Rija,3 aDepartment of Medical Microbiology, Nijmegen Centre for Molecular Life Sciences, Nijmegen Institute for Infection, Inflammation, and Immunity, Radboud University Nijmegen Medical Centre, 6500 HB Nijmegen, The Netherlands; bViruses and RNA Interference Group, Institut Pasteur, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3015, 75015 Paris, France; cLaboratory of Virology, Wageningen University, 6708 PB Wageningen, The Netherlands; dDepartment of Genetics and Bioengineering, Yeditepe University, Istanbul 34755, Turkey; and eDepartment of Biosystems Engineering, Faculty of Engineering, Giresun University, Giresun 28100, Turkey Edited by Peter Palese, Mount Sinai School of Medicine, New York, NY, and approved October 19, 2012 (received for review April 28, 2012) RNA viruses in insects are targets of an RNA interference (RNAi)- sequently, are hypersensitive to virus infection and succumb more based antiviral immune response, in which viral replication inter- rapidly than their wild-type (WT) controls (11–14). mediates or viral dsRNA genomes are processed by Dicer-2 (Dcr-2) Small RNA cloning and next-generation sequencing provide into viral small interfering RNAs (vsiRNAs). Whether dsDNA virus detailed insights into vsiRNA biogenesis. In several studies in infections are controlled by the RNAi pathway remains to be insects, the polarity of the vsiRNA population deviates strongly determined. Here, we analyzed the role of RNAi in DNA virus from the highly skewed distribution of positive strand (+) over infection using Drosophila melanogaster infected with Invertebrate negative (−) viral RNAs that is generally observed in (+) RNA iridescent virus 6 (IIV-6) as a model.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Genome Analysis of Ranavirus Frog Virus 3Isolated from American Bullfrog
    www.nature.com/scientificreports OPEN Genome analysis of Ranavirus frog virus 3 isolated from American Bullfrog (Lithobates catesbeianus) in South America Marcelo Candido 1*, Loiane Sampaio Tavares1, Anna Luiza Farias Alencar2, Cláudia Maris Ferreira3, Sabrina Ribeiro de Almeida Queiroz1, Andrezza Maria Fernandes1 & Ricardo Luiz Moro de Sousa1 Ranaviruses (family Iridoviridae) cause important diseases in cold-blooded vertebrates. In addition, some occurrences indicate that, in this genus, the same virus can infect animals from diferent taxonomic groups. A strain isolated from a Ranavirus outbreak (2012) in the state of Sao Paulo, Brazil, had its genome sequenced and presented 99.26% and 36.85% identity with samples of Frog virus 3 (FV3) and Singapore grouper iridovirus (SGIV) ranaviruses, respectively. Eight potential recombination events among the analyzed sample and reference FV3 samples were identifed, including a recombination with Bohle iridovirus (BIV) sample from Oceania. The analyzed sample presented several rearrangements compared to FV3 reference samples from North America and European continent. We report for the frst time the complete genome of Ranavirus FV3 isolated from South America, these results contribute to a greater knowledge related to evolutionary events of potentially lethal infectious agent for cold-blooded animals. Among the major viral pathogens, worldwide distributed and recent history, Ranavirus (Rv) is highlighted, on which, studies in South America remain limited. Rv are part of the family Iridoviridae that is divided into fve genera, of which three are considered more relevant by infectious severity in aquatic and semi-aquatic animals: Lymphocystivirus, Megalocytivirus and Rv. Tey are enveloped and unenveloped viruses, showing double-stranded DNA whose genome ranges from 103 to 220 kbp.
    [Show full text]
  • Overexpression of DNA Polymerase @Jsensitizes Mammalian Cells to 2',3'
    ICANCERRESEARCH57.I10-I 16,JanuaryI. I997J Overexpression of DNA Polymerase @JSensitizesMammalian Cells to 2',3'-Deoxycytidine and 3'-Azido-3' .deoxythymidine' Khalil Bouayadi, Jean-Sébastien Hoffmann, Pascal Fons, Michele Tiraby, Jean-Paul Reynes, and Christophe Cazaux2 Laboratoire de Microbiologic et de Génétique,UniversitéPaul Sabatier, 118 route de Narbonne, 31062 Toulouse cédex(K. B., P. F., C. C.]; Institut de Pharmacologic et Biologic Structurale. Centre National de Ia Recherche ScienujIque, UPR 9062, 205 route de Narbonne, 31077 Toulouse cédexfl. S. H.!; and Laboratoire CAYLA, ZI. Montaudran, 5 rue J. Rodier, 3/400 Toulouse (M. T., J. P. R.J ABSTRACT nator AZT-MP was also observed (10, 11). In vivo, AZT-MP is incorporated into cellular DNA (12), and it has been suggested that Mammalian DNA polymerase @3is a DNA repair enzyme expressed polymerase 13may play a role in this process (1 1). @ constitutively at a low level. In vitro, purified DNA polymerase (Pol) incorporates the nucleotide analogues 2'-3' deoxycytidine (ddC)-triphos AZT and ddC are antiviral agents currently used in the treatment phate and 3'-azido-3'-deoxythymidine (AZT)-triphosphate Into DNA, of AIDS. These chemotherapeutic drugs target HIV reverse tran causing chain termination. We have tested the possibility ofenhancing the scriptase which incorporates them into HIV DNA, terminating cytotoxicity of these chain terminators against mammalian cells by in DNA polymerization (13). In this study, we hypothesized that creasing the level of Pol (I. Chinese hamster ovary AA8 and murine overexpression of Pol f3, a cellular target of ddC and AZT, might melanoma B16 cell lines were stably transfected with rat pol fi cDNA render these analogues effective also against tumor cells.
    [Show full text]
  • The Lymphocystis Diseases in the Olive Flounder, Paralichthys Olivaceus
    Univ. j. zool. Rajshahi Univ. Vol. 26, 2007. pp. 59-62 ISSN 1023-6104 http://journals.sfu.ca/bd/index.php/UJZRU © Rajshahi University Zoological Society The lymphocystis diseases in the Olive flounder, Paralichthys olivaceus Mosharrof Hossain, Seok Ryel Kim and Myung Joo Oh* Division of Food Science and Aqualife Medicine, Chonnam National University Yeosu-550-749, Korea. Abstract: Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, affecting more than 100 teleost species worldwide. Characteristically, LCD is chronic, self limiting and species specific. The greatly hypertrophied cells, called lymphocystis tumor cells, typically occur on the skin, fins and oral region. Lymphocystis cells were ovoid to circular and varied in sizes ranging from 200-250 mm. The lymphocystis disease infected flounder have unsightly appearances that discourage the commercial values. A PCR detection technique was developed to amplify a fragment of LCDV major capsid protein gene (1347bp) which is shortcoming and useful. The PCR result proved that the LCD-virus replicated in the epidermis (fins and skin) not in the spleen, kidney, intestine or brain of Paralichthys olivaceus. Keyword: Lymphocystis disease, LCDV, PCR, Paralichthys olivaceus Introduction diseases have been isolated from more than 100 teleost Lymphocystis disease (LCD) is a chronic, self-limiting, species (Anders, 1989), however the infections and viral disease affecting many species of teleosts virus replication is unknown. LCDV has been studied worldwide. Freshwater, estuarine, and marine fish in for the different isolation and characterization warm-water, and cold-water environments are techniques (Iwamoto et al., 2002; Alonso et al., 2005; susceptible to this disease. In general, lymphocystis is a Cano et al., 2006) that helping shortcoming detection disease of more evolutionarily advanced species of of the disease and to take initiatives to a disease free teleosts, like perches, seabreams and flounders.
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • Direct Induction of Gj-Specific Transcripts Following Reactivation of the Cdc28 Kinase in the Absence of De Novo Protein Synthesis
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Direct induction of Gj-specific transcripts following reactivation of the Cdc28 kinase in the absence of de novo protein synthesis Nicholas J. Marini and Steven I. Reed* The Scripps Research Institute, Department of Molecular Biology, La Jolla, California 92037 USA In Saccharomyces cerevisiae, the genes encoding the HO endonuclease, G,-specific cyclins CLNl and CLN2, as well as most proteins involved in DNA synthesis, are periodically transcribed with maximal levels reached in late G,. For HO and the DNA replication genes, cell cycle stage-specific expression has been shown to be dependent on the Cdc28 kinase and passage through START. Here, we show that cells released from cdc28*^ arrest in the presence of cycloheximide show wild-type levels of induction for HO, CLNl, and CDC9 (DNA ligase). Induction is gradual with a significant lag not seen in untreated cells where transcript levels fluctuate coordinately with the cell cycle. This lag may be due, at least in part, to association of the Cdc28 peptide with Gj cyclins to form an active kinase complex because overexpression of CLN2 prior to release in cycloheximide increases the rate of induction for CDC9 and HO. Consistent with this, release from pheromone arrest (where CLNl and CLN2 are not expressed) in cycloheximide shows no induction at all, Transcriptonal activation of CDC9 is likely to be mediated through a conserved promoter element also present in genes for other DNA synthesis enzymes similarly cell cycle regulated. The element contains an intact Mlul restriction enzyme recognition site (consensus ~5'-A/TPuACGCGTNA/T-3'), Insertion of a 20-bp fragment from the CDC9 promoter (containing a Mlul element) upstream of LacZ confers both periodic expression and transcriptional induction in cycloheximide following release from cdc28"' arrest.
    [Show full text]
  • Comparative Analysis of Transcriptional Regulation Patterns: Understanding the Gene Expression Profile in Nucleocytoviricota
    pathogens Review Comparative Analysis of Transcriptional Regulation Patterns: Understanding the Gene Expression Profile in Nucleocytoviricota Fernanda Gil de Souza †,Jônatas Santos Abrahão * and Rodrigo Araújo Lima Rodrigues *,† Laboratório de Vírus, Departamento de Microbiologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais 31270-901, Brazil; [email protected] * Correspondence: [email protected] (J.S.A.); [email protected] (R.A.L.R.) † These authors contributed equally to this work. Abstract: The nucleocytoplasmic large DNA viruses (NCLDV) possess unique characteristics that have drawn the attention of the scientific community, and they are now classified in the phylum Nucleocytoviricota. They are characterized by sharing many genes and have their own transcriptional apparatus, which provides certain independence from their host’s machinery. Thus, the presence of a robust transcriptional apparatus has raised much discussion about the evolutionary aspects of these viruses and their genomes. Understanding the transcriptional process in NCLDV would provide information regarding their evolutionary history and a better comprehension of the biology of these viruses and their interaction with hosts. In this work, we reviewed NCLDV transcription and performed a comparative functional analysis of the groups of genes expressed at different times of infection of representatives of six different viral families of giant viruses. With this analysis, it was possible to observe
    [Show full text]