Lamiaceae) to the New World: a Case of Conﬂicting Phylogenies

Home , Acinos, Acinos alpinus, Bencomia, Blephilia hirsuta, Bystropogon, Clinopodium

Using Molecular Data to Test a Biogeographic Connection of the Macaronesian Genus Bystropogon (Lamiaceae) to the New World: A Case of Conﬂicting Phylogenies

JENNIFER L. TRUSTY,1,5 RICHARD G. OLMSTEAD,2 DAVID J. BOGLER,1,4 ARNOLDO SANTOS- GUERRA,3 and JAVIER FRANCISCO-ORTEGA1 1Department of Biological Sciences, Florida International University, University Park, Miami, Florida 33199 (correspondence) and Fairchild Tropical Garden, 11935 Old Cutler Road, Coral Gables, Florida 33156 2Department of Biology, University of Washington, P.O. Box 355325 Seattle, Washington 98195 3Jardıń de Aclimatacioń de La Orotava, Calle Retama, Nu´ mero. 2, Puerto de La Cruz, E-38400, Tenerife, Canary Islands, Spain 4Present address: The Missouri Botanical Garden, P.O. Box 299, St. Louis, Missouri 63166 5Author for correspondence (jtrust01@fiu.edu)

Communicating Editor: Lawrence A. Alice

ABSTRACT. Bystropogon (Lamiaceae) is endemic to the Macaronesian Islands and represents the best-known example of a putative phytogeographic connection between these islands and the New World. Previous morphological taxonomic studies suggested that this genus is closely related to the western South American Minthostachys. Phylogenetic analyses of nucleotide sequences of the internal transcribed spacers and 5.8S subunit of nuclear ribosomal DNA and the trnL gene and trnL-trnF spacer of the chloroplast genome for 33 of the 72 genera in the Mentheae tribe were performed. Maximum parsimony analysis of the combined data set resulted in 63 most parsimonious trees. The strict consensus tree of this analysis shows with moderate bootstrap support (74%) that Bystropogon is sister to the Old World taxa Acinos, Ziziphora,andClinopodium vulgare. When analyzed separately, the ITS and trnL/F data sets do not agree as to the sister group to Bystropogon, although none supports a sister relationship with Minthostachys. The cpDNA phylogeny strongly supports a relationship of Bystropogon with a clade of New World mint taxa (90% bootstrap value). Due to the apparent conﬂict between the chloroplast and nuclear characters observed in the phylogenies, we are not certain of the true biogeographic relationship of Bystropogon. Finally, in all analyses, all of the Mentheae genera sampled in this study form a monophyletic group (100% bootstrap value) and a derived clade of ten New World genera is found. These results contribute to our understanding of generic relationships within the tribe.

Bystropogon L’Her. and Cedronella Moench (Lami- Bo¨hle et al. 1996; Francisco-Ortega et al. 1997; Carval- aceae, Mentheae) are the only genera of mints that are ho and Culham 1998; Vargas et al. 1999; Helfgott et al. endemic to the Macaronesian Islands. The former is 2000; Percy and Cronk 2002). Most of these studies restricted to the Canary and Madeira archipelagos; the support a link between the Macaronesian flora and the latter contains a single species, Cedronella canariensis, Mediterranean basin. Examples are Argyranthemum found in the Azores, Canaries, and Madeira. Bystro- Sch. Bip. (Asteraceae ; Francisco-Ortega et al. 1997), the pogon has seven species that have radiated primarily Bencomia Webb and Berthel. alliance (Rosaceae; Helf- in the pine and laurel forests of Macaronesia (La Serna- gott et al. 2000), and Ixanthus Griseb. (Gentianaceae; Ramos 1984) and represents the best-known example Thiv et al. 1999). However, Macaronesian taxa have of a putative biogeographic connection between the also been found to have phylogenetic links with dis- Macaronesian and New World floras (Bramwell 1972; tant areas such as East and South Africa (reviewed in Sunding 1979). Several authors have indicated that Andrus et al. 2004), and East Asia. For instance, the Minthostachys (Benth.) Spach, a genus restricted to endemic genus Phyllis L. (Rubiaceae) is nested within a clade of East-South African genera (Bremer 1996; An- western South America with a predominant Andean derson et al. 2001) and the Macaronesian endemic Ilex distribution, is the closest relative of Bystropogon or is perado Aiton is nested within a clade of East Asian congeneric with it (L’Heritier 1788; Bentham 1834, species (Cueńod et al 2000; Manen et al. 2002). 1848; Spach 1840; Briquet 1897; Epling 1937; La Serna- Bystropogon and Cedronella are members of the Ne- Ramos and Wildpret 1976; Sunding 1979; La Serna- petoideae, the largest of the eight subfamilies of the Ramos 1984). Other New World genera that have been Lamiaceae (Cantino et al. 1992). Cantino et al. (1992) suggested by pollen morphology as closely related to recognized four tribes in the Nepetoideae: Elcholtzieae, Bystropogon are the Juan Fernandez Island endemic ge- Lavanduleae, Ocimeae, and Mentheae. The Mentheae nus Cuminia Colla and the North American Pycnanthe- is the largest of these, containing approximately 72 mum Michx. (Harley and Heywood 1992). genera, including both Bystropogon and Cedronella and In recent years there have been several molecular such economically important plants as mint (Mentha phylogenetic studies aiming to elucidate the biogeo- L.), oregano (Origanum L.), rosemary (Rosmarinus L.), graphical connections of Macaronesian plants (e.g., sage (Salvia L.), and thyme (Thymus L.). 702 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 703

The use of chloroplast DNA [cpDNA] restriction site sequence of Calamintha menthifolia Host but have included ITS sequences for Conradina etonia Kral and McCartney, Glechoma heder- analysis and nucleotide sequence data have aided in acea L., and Melissa officinalis L., which are absent from the trnL/F the recognition and recircumscription of the Lami- tree. Hyptis Jacq., Lavandula L., Orthosiphon Benth., and Plectranthus aceae and Verbenaceae as two monophyletic assem- L’He´r. (Lavanduleae and Ocimeae tribes) were chosen as the out- blages (Olmstead et al. 1992, 1993; Wagstaff and Olm- group for both ITS and combined analyses of the ITS and trnL/F data. This outgroup selection was made based on their basal po- stead 1997; Wagstaff et al. 1998). Molecular data also sition in the phylogenetic analysis of the trnL/F data set (see Re- have proven to be a valuable tool at lower taxonomic sults). The first 143 and last 59 bp of the ITS sequences of these levels. Studies below the family level have discovered Ocimeae and Lavanduleae taxa were excluded from analysis due to uncertainty of their alignment. The aligned data matrices are paraphyletic and/or polyphyletic groupings such as deposited in TreeBase Study accession (S1116, matrix accession the subfamilies Chloanthoideae and Viticoideae, the M1909-1911). Satureja L. complex, and Lamium L. (Wink and Kauf- DNA Extraction, PCR amplification, and Sequencing. DNA mann 1996; Cantino and Wagstaff 1998; Wagstaff et al. was extracted from either fresh or silica-gel dried material using the Qiagen DNeasy protocol (Qiagen, Ltd.). Both strands of the 1998). In all of these analyses, monophyly of subfamily nuclear ribosomal internal transcribed spacer (ITS) region includ- Nepetoideae and tribe Mentheae is well supported ing the 5.8S gene were amplified using primers ITS4 (White et al. (Kaufmann and Wink 1994; Wagstaff et al. 1995). With- 1990) and ITS5 (Downie and Katz-Downie 1996). The ITS region in tribe Mentheae, Monarda L., Mentha, Nepeta L., and of Melissa officinalis was amplified using primers 17SE and 26SE (Sun et al. 1994). PCR amplification conditions are described in Salvia have been the subject of molecular systematic Kim and Jansen (1994). Difficulty in amplifying the ITS1 region of analyses at the species level (Prather et al. 2002; Walker Clinopodium vulgare resulted in an incomplete sequence that is et al. 2002; Jamzad et al. 2003 ; Bunsawat et al., in missing the first 240 aligned bp. The chloroplast trnL gene and trnL-trnF intergenic spacer (trnL/ mss.). Despite their extraordinary economic impor- F) were amplified using the ‘C’ and ‘F’ primers according to the tance as perfumes, spices, medicinal drugs and horti- protocol described by Taberlet et al. (1991). Amplification of the cultural plants, no molecular phylogenetic analysis of trnL-trnF region of Ziziphora hispanica L. was performed with the the generic relationships within the Mentheae has yet ‘C’ primer (forward direction) and an internal primer designed for this study (primer JT3R, 5Ј CGACCATTTCCAAATGATAGCAT 3Ј). been published. Amplification with the regular trnL/F ‘C’ and ‘F’ primers for Z. In this paper we review the literature on the phy- hispanica yielded multiple bands. PCR products were cleaned us- logenetic connections of Macaronesian plants with the ing the QIAquick silica columns (Qiagen, Ltd.) according to the manufacturer’s protocol. The purified PCR products were cycle- New World and we also provide the first molecular sequenced in both directions using the ABI Prism Big Dye Ter- phylogenetic analysis of Mentheae in order to 1) elu- minator Cycle Sequencing Ready Reaction Kit (Applied Biosys- cidate the phylogenetic relationships of the endemic tems) with AmpliTaq DNA polymerase. The sequencing reactions Macaronesian genus Bystropogon; 2) test the hypothe- were conducted using the same primers that were used for the PCR amplifications. Dye-terminator reactions were carried out in sized sister relationship of Bystropogon to Minthostach- 10 ␮L reactions, diluted 50:50 using AmpliTaq FS buffer (Applied ys; and 3) provide insight into the phylogenetic rela- Biosystems) and amplified according to the manufacturer’s pro- tionships among the genera that comprise the Men- tocol. Cycle sequencing products were separated on an ABI 377 theae. automated sequencer at the Florida International University Se- quencing Center. In our study we have followed the Lamiaceae clas- Data Analysis. Sequences were assembled and edited using sification of Cantino et al. (1992). For members of the Sequencher 3.2 (Gene Codes Inc.) and aligned using Clustal X Satureja complex, we followed the taxonomic treat- (Thompson et al. 1997). The final alignment was adjusted manu- ally using Se-Al vers. 1 (A. Rambaut, University of Oxford, Ox- ments of Heywood and Richardson (1972) for the Old ford, United Kingdom). Regions of high sequence divergence World species, and Cantino and Wagstaff’s (1998) where alignment was ambiguous and those containing long mono- treatment of the New World species. nucleotide sequences were excluded from subsequent phylogenetic analyses (less than 3% of total number of characters). Less than 0.1% of data matrix cells were scored as missing. Gaps were coded MATERIALS AND METHODS as binary characters according to the ‘‘simple indel coding’’ meth- odology of Simmons and Ochoterena (2000). Plant Material. Details of the plant material, voucher infor- Phylogenetic parsimony analyses were performed with Fitch mation, and geographical distribution of the taxa sampled in this parsimony (equal weights, unordered; Fitch 1971). Initial heuristic study are listed in Table 1. In the trnL/F analysis, the ingroup searches (using the TBR and MULPARS options of PAUP*) with consists of 38 taxa representing Mentheae (31 genera), Ocimeae 1000 random taxon addition replicates were performed to look for (three), and Lavanduleae (one) (three of the four tribes of Nepe- multiple optimal tree islands (Maddison 1991). In order to mini- toideae). Three species of Bystropogon, B. canariensis, B. maderensis, mize the time searching on sub-optimal islands only 10 trees were and B. origanifolius, from the two sections currently recognized saved from each replicate. All trees from the original search were were included (La Serna -Ramos 1984). The ingroup also included used as starting trees in a second heuristic search with the same the three putative relatives of Bystropogon: Cuminia, Minthostachys, search and weighting criteria indicated above until a maximum of and Pycnanthemum. The ingroup comprised representatives from 10,000 trees were swapped. Phylogenetic support for each clade the New World (12 taxa) and the Old World (26 taxa). Lamium was evaluated through bootstrap analysis (Felsenstein 1985) of (Lamioideae) was chosen for the outgroup. In previous studies of 1000 replicates with one random sequence addition per replicate both rbcL and ndhF sequences and chloroplast restriction site data, and the TBR and MULPARS options (DeBry and Olmstead 2000). Lamium was near, but excluded from, the Nepetoideae (Kaufman In the trnL/F bootstrap analysis, the protocol was modified to save and Wink 1994; Wagstaff et al. 1995, 1998). only 20 trees per replicate due to computer memory limitations. Forty taxa including 33 of the 72 recognized Mentheae genera Constraint analyses were performed for all three data sets with were used for the ITS analysis. We were unable to amplify the ITS the three Bystropogon species constrained to be monophyletic with 704 SYSTEMATIC BOTANY [Volume 29

TABLE 1. List of plant material used in this study, with the geographical distribution of the genus (in parentheses), voucher information (botanical institutes where vouchers are deposited in parentheses), and Genbank accession numbers.

Acinos alpinus (L.) Moench. (Mediterranean) Ex hort. Orotava Bot. Gard., living accession 195-00, Santos-Guerra 20-6-2000 (ORT); ITS AY227141, trnL/F AY506594. Agastache foeniculum (Pursh) Kuntze (New World and Eastern Asia) Ex hort. Fairchild Tropical Gard., Trusty 29 (FTG); ITS AY506660, trnL/F AY506626. Blephilia hirsuta (Pursh) Benth. (North America) Ex hort. Univ. of Colorado, no voucher; ITS AY506641, trnL/F AY506605. Bystropogon canariensis (L.) L’ Her. (Canary Islands and Madeira) Pedro Alvarez, Tenerife, Santos-Guerra 7-6-1999 (ORT); ITS AY506634, trnL/F AY506597. Bystropogon maderensis Webb (Canary Islands and Madeira) Ribeiro Frio, Madeira, Fontinha and Roberto s. n. (MADJ); ITS AY506633, trnL/F AY506596. Bystropogon origanifolius L’ Her. (Canary Islands and Madeira) Mta. Poleos, Tenerife, Santos-Guerra 8-6-1999 (ORT); ITS AY506635, trnL/F AY506598. Calamintha menthifolia Host (Old World) Las Vueltas, La Palma, Santos-Guerra 12-2-2000 (ORT); ITS N. A., trnL/F AY506609. Cedronella canariensis (L.) Webb and Berth. (Canary Islands) Ex hort. Univ. of Ohio, Cantino 1295 (BHO); ITS AY506656, trnL/F AY506622. Clinopodium ashei (Weath.) Small (New and Old World) Lake Placid, Florida, Trusty 20 (FTG); ITS AY506643, trnL/F AY506607. Clinopodium vulgare L. (New and Old World) Ex hort. Orotava Bot. Gard., living accession 212- 00, Santos-Guerra 28-8-2000 (ORT); ITS AY506636, trnL/F AY506593. Conradina etonia Kral and McCartney (Southeastern United States) Volusa County, Florida, J. A. Churchill 91-200 (MSC); ITS AF369165, trnL/F N. A.. Cuminia fernandezia Colla (Juan Fernandez Islands, Chile) Masatierra, Juan Fernandez Islands, Stuessy and Soto 11914 (CONC); ITS AY506636, trnL/F AY506599. Dicerandra frutescens Shinners (Southeastern United States) Lake Placid, Florida, Trusty 22 (FTG); ITS AY506642, trnL/F AY506606. Dracocephalum moldavica L. (Eurasia) Ex hort. Fairchild Tropical Gard., Trusty 18 (FTG); ITS AY506659, trnL/F AY506625. Glechoma hederacea L. (Eurasia) Ex hort. Cornell Univ., no voucher; ITS AY506661, trnL/F N. A.. Hesperozygis spathulata Epling (Mexico to Brazil) Parana´; Serrinha, Brazil, Dusen 15165 (MSC); ITS AF369162, trnL/F AY506602. Horminum pyrenaicum L. (Southern Europe) Ex hort. Fairchild Tropical Gard., Trusty 28 (FTG); ITS AY506654, trnL/F AY506620. Hyptis emoryi Torr. (New World) Ex hort. Rancho Santa Ana Bot. Gard. living accession 11020, Olmstead 92-285 (WTU); ITS AY506664, trnL/F AY506629. Hyssopus seravschanicus (Dub.) Pazij (Eurasia) Royal Bot. Gard., Edinburgh, living accession 19840408, no voucher; ITS AY506657, trnL/F AY506623. Lallemantia peltata (L.) Fisch. and C.A. Mey. (Asia) Ex hort. Orotava Bot. Gard., living accession 199-00, Santos-Guerra 20-6-2000 (ORT); ITS AY506658, trnL/F AY506624. Lamium amplexicaule L. (Africa and Eurasia) Callejones, La Palma, Santos-Guerra 13-2-2000 (ORT); ITS N. A., trnL/F AY506631. Lavandula multifida L. (Atlantic Islands, Africa, India, Eurasia) Ex hort. Univ. of Colorado, Wagstaff 92-88 (WTU); ITS AY506665, trnL/F AY506630. Lycopus europaeus var. exaltatus (L. f.) Hook. f. (North America and Northern Europe) Ex hort. Fairchild Tropical Gard., Trusty 26 (FTG); ITS AY506652, trnL/F AY506618. Melissa officinalis L. (Eurasia) Ex hort. Fairchild Tropical Gard., Trusty 439 (FTG); ITS AY506650, trnL/F N. A.. Mentha rotundifolia (L.) Huds. (Temperate Old World) Wagstaff 88-026 (BHO); ITS AY506645, trnL/F AY506610. Micromeria hyssopifolia Webb. and Berthel. (Old World) Chıó, Tenerife, Canary Islands. Santos-Guerra 17-2-2000. (ORT); ITS AY227142, trnL/F AY506612. Minthostachys mollis (Kunth) Griseb. (Andean South America) Tulcan, Ecuador, Thomp- son and Rawlins 942 (BHO); ITS AY506638, trnL/F AY506601. Monarda fistulosa L. (North America) Ex hort. Univ. of Colorado, no voucher; ITS AY506639, trnL/F AY506603. Monardella hypoleuca A. Gray (Western North America) Ex hort. Univ. of Cali- fornia, Berkeley Bot. Gard. living accession 65-1096, no voucher; ITS AY506637, trnL/F AY506600. Nepeta grandiflora M. Bieb. (Eurasia and Africa) Ex hort. Fairchild Tropical Gard., Trusty 27 (FTG); ITS AY506655, trnL/F AY506621. Origanum vulgare L. (Eurasia) Las Vueltas, La Palma, Santos-Guerra 12-2-2000 (ORT); ITS AY506647, trnL/F AY506614. Orthosiphon stamineus Benth. (Old World tropical) Ex hort. Fairchild Tropical Gard., living accession 961538, Trusty 23 (FTG); ITS AY506663, trnL/F AY506628. Perovskia abrotanoides Karel (Middle East to India) Ex hort. Orotava Bot. Gard., living accession 200-00, Santos-Guerra 20-6- 2000 (ORT); ITS AY506648, trnL/F AY506615. Piloblephis rigida Raf. (Southeastern United States) Lake Placid, Florida, Trusty 21 (FTG); ITS AY506644, trnL/F AY506608. Plectranthus strigosus Benth. (Old World) Ex hort. Univ. of Colorado, no voucher; ITS AY506662, trnL/F AY506627. Prunella vulgaris L. (Eurasia) Ex hort. Orotava Bot. Gard., living accession 194-00, Santos- Guerra 20-6-2000 (ORT); ITS AY506653, trnL/F AY506619. Pycnanthemum incanum (L.) Michx. (North America) Bloomington, Indiana, Olmstead 90-06 (WTU); ITS AY506640, trnL/F AY506604. Rosmarinus officinalis L. (Mediterranean) Ex hort. Royal Bot. Gard, Madrid, living accession 1234-78, Barra 167 (MA); ITS AY506649, trnL/F AY506616. Salvia coccinea Etl. (Worldwide) Ex hort. Fairchild Tropical Gard., living accession 87395, Trusty 24 (FTG); ITS AY506651, trnL/F AY506617. Satureja hortensis L. (Europe) Ex hort. Fairchild Tropical Gard., Trusty 17 (FTG); ITS AY227143, trnL/F AY506611. Thymus vulgaris L. (Eurasia) Ex hort. Royal Bot. Gard., Madrid, living accession 1877-80, Fuertes s. n. (MA); ITS AY506646, trnL/F AY506613. Ziziphora hispanica L. (Mediterranean) Madrid, Spain, Sańchez-Mata and Gavilań 100 (MSC); ITS AF369166, trnL/F AY506595.

either the Old World clade that includes Acinos Mill., Ziziphora L., cantly different from the strict consensus tree from the trnL/F data and Clinopodium vulgare, or to the New World assemblage con- set. taining the following ten taxa: Blephilia Raf., Cuminia, Dicerandra Benth., Hesperozygis Epling, Minthostachys, Monarda L., Monardella Benth., Piloblephis Raf., Pycnanthemum,andClinopodium ashei. RESULTS Search strategies were the same as described above. The incongruence length difference test (ILD) as implemented trnL/F Phylogenetic Analyses. The ﬁnal aligned in PAUP* vers. 4.0b10 (Swofford et al. 2002) was used to test matrix used for parsimony analyses was of 1047 DNA whether the two data sets differ from random partitions of the combined data set in order to explore the congruence of the ITS characters in length (42 ambiguously aligned charac- and trnL/F data sets (Farris et al. 1994). One thousand replicates ters were excluded from subsequent analyses) and in- were run with the following heuristic search strategy: one random cluded 13 coded gaps. Six of these gaps were phylo- sequence addition per replicate, TBR and MULPARS options, genetically informative. There were 260 variable char- keeping a maximum of 10,000 trees per replicate. Finally, the Tem- pleton test as implemented in PAUP* vers. 4.0b10 was used to test acters, with 45% (116) of these being parsimony-infor- whether the strict consensus tree from the ITS data set is signiﬁ- mative. Parsimony analysis yielded no explicit number 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 705

FIG. 1. Strict consensus tree from parsimony analysis of trnL/F data set (338 steps, CI ϭ 0.794 and RI ϭ 0.844). Numbers below branches are parsimony bootstrap values. Open circles indicate New World distribution and closed circles indicate Old World distribution. of most-parsimonious trees, since the maxtrees limit of contains the members of tribes Ocimeae and Lavan- 10,000 trees was reached. The strict consensus tree of duleae and is supported by a 64% bootstrap value. these 10,000 trees was confirmed by an inverse con- Within this clade the three genera of tribe Ocimeae straint search (Catalan et al. 1997). The trees found (Hyptis, Orthosiphon,andPlectranthus) form a mono- were of 388 steps each (CI ϭ 0.652; RI ϭ 0.844 exclud- phyletic group (67%). The second major clade includes ing uninformative characters). The strict consensus of all Mentheae genera and is supported with a 99% all trees is shown in Fig. 1. bootstrap value. A basal polytomy of eight lineages is Two major clades were identified in the strict con- found in this Mentheae clade. The largest of these, la- sensus tree of the trnL/F data set (Fig. 1). The first clade beled Clade A in Fig. 1, is a strongly-supported (99%) 706 SYSTEMATIC BOTANY [Volume 29

FIG. 2. One of the 504 most parsimonious trees from the ITS analysis (1095 steps, CI ϭ 0.503 and RI ϭ 0.628). Branches that collapse in the strict consensus tree are shown as dashed lines. Bootstrap values are below branches. Branch lengths located above the branches were determined using the DELTRAN option in PAUP* 4.0b10. Open circles indicate New World distribution and closed circles indicate Old World distribution. clade of 22 taxa from both the New and Old World. cluded nine coded gaps, six of which were phyloge- The remaining seven lineages contain 11 mainly Old netically informative. Fourteen characters were exclud- World genera and the largely New World genus Agas- ed due to ambiguities in alignment. There were 341 tache Gronov. Bystropogon and 10 New World genera variable characters, with 68% (232) of these being par- form a strongly supported clade (90%). The clade of simony-informative. The search yielded 504 equally Bystropogon and the New World genera is sister to the most-parsimonious trees of 1095 steps each (CI ϭ Old World species Clinopodium vulgare L., but this re- 0.434; RI ϭ 0.628 excluding uninformative characters). lationship is only moderately supported (68% boot- One of the 504 most-parsimonious trees is shown in strap support). Fig. 2. Branches that collapse in the strict consensus ITS Phylogenetic Analyses. The final aligned ITS tree are shown as dashed lines. matrix was 714 nucleotide positions in length and in- The ITS strict consensus tree supports a basal split 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 707 between two major clades within the Mentheae. The endemic to the Canary Islands or the Canary Islands Salvia Clade (49% bootstrap support) contains a rep- and Madeira (data compiled from Santos and Francis- resentative of Salvia as sister to 13 other genera. All of co 1990; Acebes-Ginove´s et al. 2001; Santos-Guerra these genera have their greatest diversity in the Old 2001). We have estimated that 65 of these genera also World, with the exception of the genus Agastache, have species in the New World (Mabberley 1997). Mo- which has the majority of species in the New World. lecular phylogenies are available for 14 of these 65 gen- Most nodes are only weakly supported with the ex- era (Table 2). ception of two clades. The first subclade (88%) con- Taxonomic studies have also suggested that Maca- tains a weakly supported assemblage of Agastache and ronesian species from the cosmopolitan genera Eu- Glechoma sister to a strongly supported clade (96%) in- phorbia L. (Euphorbiaceae) and Solanum L. (Solanace- cluding Dracocephalum, Hyssopus,andLallemantia.The ae), and from six Macaronesian endemic genera [i.e., second subclade (84%) contains Prunella as sister to the Bencomia, Bystropogon, Dendriopoterium Svent (Rosa- genera Horminum and Nepeta. The second major clade, ceae), Ixanthus, Marcetella Svent. (Rosaceae), and Peri- Clade A (76%), includes 22 of the 40 taxa sampled. The callis Webb and Berthel. (Asteraceae)] are related to first split within this clade weakly separates the genera New World taxa (Webster 1967; Bramwell 1978; La Ser- Micromeria, Origanum, Satureja,andThymus (49%) from na-Ramos 1984; Whalen 1984; Bain et al. 1995, 1997; the rest of the assemblage (89%). The second split sep- Meszaros et al. 1996). In addition, Pelletiera St. Hil. (Pri- arates Mentha as sister to a clade of 17 taxa (69%). This mulaceae) contains only two species, the Macaronesian clade of 17 taxa is divided into two groups. The first endemic P. wildpretti Va ld e´s and South American P. s e r - includes 11 New World genera (77%) and the second pyllifolia (Poiret) Webb and Berthel (Short 1988). A re- is composed of two clades, one with the three species cent molecular phylogenetic study found the Macaro- of Bystropogon (68%) as sister to a clade that includes nesian P. wildpretti to be sister to the Meditterranean the Old World taxa Acinos, Ziziphora,andClinopodium species Asterolinon linum-stellatum (L.) Duby, but this vulgare (80%). The relationship of Bystropogon to Old study did not include the New World taxon P. serpyl- World taxa is strongly supported with 86% bootstrap lifolia (Martins et al. 2003). It is worth noting that Val- support. de´s (1980) in the original description of P. wildpretti Combined Analyses. The Partition Homogeneity discussed the great morphological similarity between Test of the combined ITS and trnL/F data matrix did not these three species, which may obscure their taxonom- find any significant difference between the data sets (p ic relationships. ϭ 0.179). The final aligned matrix used for parsimony To date only three molecular phylogenies, for Sedum analysis was 1761 positions in length and included 56 L. (Crassulaceae), Pericallis,andPersea L. (Lauraceae) ambiguities and 22 coded gaps. There were 567 variable support a New World link for Macaronesian taxa. It characters, with 59% (336) of these being parsimony- was found that the Madeiran species of Sedum are sis- informative. Eight hundred and ten (810) equally most- ter to a clade of New World taxa (Van Ham and ’t Hart parsimonious trees of 1380 steps each were obtained (CI 1998) while Pericallis is reported to be sister to the ϭ 0.482; RI ϭ 0.679 excluding uninformative characters). North American genus Packera A´ .Lo¨ve and D. Lo¨ve One of the most parsimonious trees is shown in Fig. 3. Branches that collapse in the strict consensus tree are (Panero et al. 1999; Bain and Golden 2000). Rohwer shown as dashed lines. The topologies from the ITS data (2000) found that the Macaronesian endemic Persea and the combined data set are similar. The main differ- indica (L.) Spreng. is sister to the South American spe- ences between the ITS strict consensus tree and the cies P. lingue (Ruiz and Pav.) Nees., but this study only combined data set concern the support for some clades. included four species of Persea. In our study, the chlo- The first major clade described in the ITS tree (Fig. 2), roplast trnL/F region places the Macaronesian endemic the Salvia Clade, is paraphyletic in the combined anal- genus Bystropogon as sister to a large clade of New ysis and largely unresolved at its base (Fig. 3). In ad- World taxa, but this relationship is not corroborated by dition, the clade that includes Salvia—Perovskia—Ros- the ITS or combined data sets. marinus is sister to Clade A in the combined analysis Forty-five of the 65 genera that share species be- (53% bootstrap support). In contrast, Clade A is present tween Macaronesia and the New World have a wide- in nuclear, chloroplast, and combined analyses. The spread distribution and contain more than 100 species; clade that joins the Old World taxa Acinos, Ziziphora,and examples of these genera are: Carex L. (Cyperaceae, Clinopodium vulgare as sister to the three Bystropogon 2,000 spp.), Erigeron L. (Asteraceae, 150 spp.), Justicia species has a weaker support (bootstrap value 74%) L. (Acanthaceae, 600 spp.), Rubus L. (Rosaceae, 250 than with ITS alone (86%). spp.), Salvia (900 spp.), Senecio L. (Asteraceae, 1,250 spp.), Solanum (Solanaceae, 1,250 spp.), and Vicia L. DISCUSSION (Fabaceae, 150 spp.). Some of these genera are poorly Links Between the Macaronesian and New World understood taxonomically and it is unknown if they Floras. Approximately 621 species in 185 genera are are monophyletic. Therefore, it is uncertain if they can 708 SYSTEMATIC BOTANY [Volume 29

FIG. 3. One of the 814 most parsimonious trees from the combined analysis of trnL/F and ITS (1380 steps, CI ϭ 0.582 and RI ϭ 0.679). Branches that collapse in the strict consensus tree are shown as dashed lines. Bootstrap values are below branches. Branch lengths located above the branches were determined using the DELTRAN option in PAUP 4.0b10. Open circles indicate New World distribution and closed circles indicate Old World distribution. provide evidence for floristic links between Macaro- Clethra L. (Clethraceae, 64 spp.), Dracaena L. (Dracaen- nesia and the New World until their taxonomy is better aceae, 60 spp.), Maytenus Molina (Celastraceae, 200 understood. However, there are some small genera that spp.), and Myrica L. (Myricaceae, 55 spp.). These large hold potential for future phylogenetic studies. Exam- genera are found in the New World and in Macaro- ples of these are Cneorum L. (Cneoraceae, 3 spp), Cryp- nesia but either are poorly represented or do not have totaenia DC. (Apiaceae, 6 spp.), Descurainia Webb and any species in Europe or in the Mediterranean basin. Berthel. (Brassicaceae, 40 spp,), Fagonia L. (Zygophyl- Origin of Bystropogon. The ITS and combined laceae, 30 spp.), and Herniaria L. (Illecebraceae, 48 analyses support the monophyly of Bystropogon al- spp.). Other genera that deserve further studies are though with only moderate bootstrap support. We be- 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 709 lieve that trnL/F tree shows Bystropogon to be paraphy- though, Acinos, Ziziphora,andClinopodium vulgare are letic due to the fact that B. origanifolius shares an in- all Mediterranean taxa, none currently occurs in the sertion with Prunella while B. maderensis shares a gap Canary Islands or Madeira. In addition, this hybrid- with Mentha. These gap characters cause significant ization event would have had to occur before the ra- loss of resolution in a tree with so few characters avail- diation of Bystropogon in Macaronesia. Given the low able for the recognition of clades. probability of hybridization followed by extinction, we The ITS and trnL/F data sets support different re- feel that the incongruence of the two datasets is due to sults with respect to the sister relationship of Bystro- the high homoplasy of our ITS dataset. pogon, yet do not show significant conflict according to Biogeography of New World Mints. The ITS and the ILD test. In contrast, the Templeton Test did find chloroplast phylogenies recover a large clade of 11 significant differences between the strict consensus New World Mentheae genera. The close relationship of tree of the ITS data set and the strict consensus tree of New World genera is consistent with the findings of the trnL/F data set (p ϭ 0.002). We believe that this Prather et al. (2002) in their study of the North Amer- difference is due to homoplasy within the ITS data set. ican genus Monarda. Previous taxonomic treatments of The high level of homoplasy in our ITS data set is the Mentheae (e.g., Bentham 1876; Briquet 1895–1897; shown in the low bootstrap support for many clades Erdtman 1945; and Wunderlich 1967) have not recog- and the low CI (0.434) and RI values (0.628). In addi- nized a New World/Old World split. In his study of tion, all six ITS characters that unite Bystropogon with pollen morphology, Wagstaff (1992a) identified a Acinos, Ziziphora,andClinopodium vulgare, are highly group of eight New World Mentheae genera united by homoplastic (CI ϭ 0.369). In comparison, both of the the presence of hexacolpate, psilate pollen grains with cpDNA characters that unite Bystropogon to the New a semitectate structure. Our study included two of World mints lack homoplasy (CI ϭ 1.0). Although these eight genera (i.e., Cuminia and Minthostachys). Us- many ITS characters contain homoplasies, there are ing pollen data available for three other genera of the more than twice as many ITS than trnL/F characters New World clade reported in our study, when mapped (232 vs 116) in the combined data set. We suspect that onto the tree, we found that these traits had no obvious the sister relationship of Bystropogon in the combined pattern of relationship. Genera of the New World clade tree is a reflection of the ITS data swamping out the possess two kinds of pollen in addition to that de- trnL/F signal. The decrease in bootstrap support (to scribed above; Monardella Benth. has hexaporate, non- 74%) for the relationship of Bystropogon to the Old psilate pollen, hypothesized to be plesiomorphic in World the supports our position that homoplasy with- Mentheae, whereas Monarda and Blephilia Raf. have in the ITS data set may be obscuring the reconstruction both hexaporate and octoporate pollen (Wagstaff of the true phylogenetic history of this group. When 1992b). the three species of Bystropogon are constrained to In addition to the New World clade discussed above, monophyly with the Acinos—Ziziphora—Clinopodium the genera Agastache, Lycopus, Clinopodium L., and Sal- vulgare clade in the trnL/F tree, tree length increases via, included in our study, have species both in the by five steps. For the ITS and combined data sets, New and Old World. Recent phylogenetic analyses when the Bystropogon taxa were constrained to mono- show that the large genus Salvia is polyphyletic with phyly with the clade of ten New World taxa, tree some large clades restricted to the New or to the Old length increases by four and two steps respectively. World (Walker et al. 2002). Our phylogeny finds a sim- Thus, the absolute and proportional increase in tree ilar pattern for Clinopodium, with the North American length is greater for the cpDNA data than for the ITS species C. ashei as part of the New World clade while or combined data. the Mediterranean C. vulgare is sister to the Old World Due to the uncertainty introduced by the ITS data- genera Acinos and Ziziphora in the ITS phylogeny, and set, at this stage, we are not certain of the true biogeo- sister to the Bystropogon/New World clade in the chlo- graphic relationship of Bystropogon. Although there are roplast phylogeny. This biogeographic split may be many causes for incongruence between molecular data common in the Mentheae, but unfortunately, our anal- sets, the most common have been due to chloroplast yses did not include a New World species of Lycopus capture or hybridization events (Rieseberg 1995; Wolfe or an Old World Agastache. and Elisens 1995; Soltis and Soltis 2000). We do not Conflict and Agreements with Traditional Taxonomy. think that chloroplast capture has confounded the Three major classical works on Lamiaceae systematics trnL/F data in this study due to the fact that the po- have included a subtribal classification system (Ben- tential taxon involved (assuming no shared relatives tham 1876; Briquet 1895–1897; and Wunderlich 1967). are extinct) would have had to cross the gap of the These classifications all recognize a much smaller Men- Atlantic Ocean for Bystropogon to share chloroplast theae than the current circumscription we are using DNA with the New World taxa. It is unclear whether (Cantino et al. 1992). Bentham (1876) distributed the hybridization may be confounding our ITS data. Al- Mentheae sensu Cantino et al. into three tribes, while 710 SYSTEMATIC BOTANY [Volume 29 Relationship b tes-Aguilar et al. ´, 1997). Fuer ńod et al. (2000), Manem et al. (2002) (2002) (1999), Geada et al. (2002) Rohwer (2000) Panero et al. (1999) Ray (1995), Martins et al. (2003) Cue Chanderbali et al. (2001) Krupkin et al. (1996), Liston et al. Hileman et al. (2001) Torrell et al. (1999) Cerbah et al. (1998) b H. com- ¨ve support a connection between Macaronesia and the endemic RFLP data) P. lingue Malva – b enera endemic ing) ¨ve and Lo Lavatera Lo b Gouan is sister to the rest of is sister to the rest of the b is sister (based on ITS (L.) Chaub. and Bory. of mainland taxa Reference Asterolinon linum-stellatum Packera is nested within a clade of species and distribution the Macaronesian Phylogenetic relationship of (based on cpDNA RFLP data) nean species (based on ITS data) (Ruiz and Pav.) Nees. from South Africa and Madagascar species of the plex (based on cpDNA (L.) Duby a Meditteranean taxon. genus data) to the Mediterranean species L. maritima the genus East Asian species terranean species and oneyan Himala- species (based oncleotide cpDNA nu- sequenc nean species iterranean species cretensis Nested with a clade of Mediterra- L. phoenicea L. acerifolia Sister to North American I. canariensis I. perado Unresolved polytomy with one Medi- Sister to the east Mediterranean ´s Sister to (Svent. and species Duham. Sister to a clade with two Mediterra- C. Smith Sister to two Mediterranean species Poir. a Vent. Va l d e Cav. Unresolved polytomy with two Med- Cav. (Aiton) Baill. Sister to a clade with three species the study occurrence of this species in the Iberian Peninsula needs further investigation (Benedı included in Ait. (L.) Spreng. Sister to South American Macaronesian endemic taxa endemic Bramw.) Lack P. canariensis P. indica O. foetens L. phoenicea L. acerifolia P. wildpretti A. canariensis A. thuscula H. oligocephala I. canariensis I. perado owever, the with species in the Macaronesian Islands and in the New World. * G enera phere, S. and Macaronesia Madagascar, and Mascarene Is- lands Basin, California, Australia, and Macaronesia and North America America, Africa, Macaronesia, and the Hawaiian Islands Macaronesia Polynesia, New World, Europe, Middle East, North Africa,Africa, tropical and Macaronesia Worldwide distribution New World, Macaronesia, Africa, Macaronesia All 15 East Africa, Eurasia, Mediterranean Macaronesia and South America Mostly Northern hemis South America, Asia, Europe, and South East Asia, tropical Australia, molecular phylogenetic studies for g is also reported in southern Spain Andrews (1984); h Ilex perado a L. (Asteraceae), 60 Webb and Berthel. L. (Asteraceae), 250 St. Hil. (Primulaceae) 2. Summary of L. (Ericaceae), 11 spp. Europe, North Africa, Middle East, L. (Malvaceae), 18 number of species Distribution of genus L. (Lauraceae), 200 Aubl. (Lauraceae), 350 Genus and estimated L. (Pinaceae), 100 spp. North America, West Indies, Eurasia, L. (Aquifoliaceae), 500 ABLE spp. spp. 15 spp. T spp. 2 spp. spp. spp. spp. Persea Pericallis Pinus * Ocotea * Arbutus Lavatera Pelletiera supported by a bootstrap value less than 75%. New World. Artemisia Hypochaeris Ilex 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 711 Trusty et al. (in prep.) and Olmstead (2001) Johansson (1998) Eriksson and Donoghue (1997), Ronsted et al. (2002) Van Ham and ‘T Hart (1998) Olmstead and Palmer (1997), Bohs S. This Pachy- Sola- P. webbii and are sister to S. herculeum S. nigra. and endemic and the New S. nigra Escheveria S. nudum is sister to two Medi- is sister to and is sister to the West Sedum is sister to a clade with is sister to the clade of and is sister to a cosmopolitan of mainland taxa Reference b species and distribution the Macaronesian Phylogenetic relationship of asian species species is found inMediterranean, Europe, and the the Middle East maderensis num phytum two East African species of Mediterranean species Bohs are part of aEuropean clade and containing African both taxanested that in is a claderanean of species four Mediter- species terranean species a clade that includes aspecies of Mexican World genera S. maderensis S. palmensis S. fusiforme P. arborescens, P. famarae S. vespertilio S. triphyllum P. leiopelata P. subspathulata Pilg. 2. Continued. Willd. Unresolved polytomy with 11 Eur- species óud Poir. Lowe ¨we Lowe Ait. Link Lowe Svent. ABLE Aiton the study included in Barne T Macaronesian Webb and Berthel. endemic Sund. S. maderensis S. palmensis S. fusiforme Lo S. nudum P. arborescens P. famarae P. leiopetala P. subspathulata P. webbii R. cortusifolius S. lidii S. nava S. triphyllum S. vespertilio Worldwide distribution Worldwide distribution Worldwide distribution Worldwide distribution Worldwide distribution L. (Ranuncula- L. (Caprifoliaceae), L. (Solanaceae), 1700 L. (Plantaginaceae), number of species Distribution of genus L. (Crassulaceae), 280 Genus and estimated 15 spp. spp. 200 spp. ceae), 500 spp. spp. Sedum Sambucus * Plantago Ranunculus Solanum 712 SYSTEMATIC BOTANY [Volume 29

Briquet (1895–1897) divided it into 10 and Wunderlich that is composed of Mentha and the 16 taxa that are (1967) into 12. Although there is considerable agree- sister to Mentha, is supported by three indels. ment among all of these systems, the major differences Three robust groups (with Ͼ75% bootstrap support) are in rank and the generic composition of the groups have been identified within Clade A in all three anal- (Cantino 1992). The results of the morphological and yses. The first one is comprised of Origanum and Thy- molecular data analyses that led to recircumscription mus. The second group consists of Acinos and Ziziphora. of the tribal taxonomy of these traditional works did Lo´pez-Gonza´lez and Bayer (1988) already suggested not include a subtribal classification (Cantino et al. that these two latter genera are closely related, because 1992). they share similar stamen and calyx morphology. The Although we have only sampled approximately half third group is comprised of 11 New World genera (and of the genera of Mentheae sensu Cantino et al. (1992), Bystropogon in the chloroplast tree) and no known mor- our data offer new insights into the phylogenetic re- phological synapomorphies are known for this group. lationships within the tribe. Despite the differences in Our data give preliminary insights into the relation- resolution between trees, in general, all three data sets ships within the Mentheae. The Mentheae are a tradi- yielded similar topologies with the exception of the tionally complex group and extensive sampling of the aforementioned case of Bystropogon. Due to the greater tribe must be undertaken to interpret the true biogeo- number of characters, the combined tree provides the graphic and morphological relationships among the most insight into the relationships among these basal genera. In addition, greater sampling of species within taxa. Four main clades can be identified. The first groups will allow for the detection of poly- and para- clade, strongly supported in all analyses, consists of phyletic genera and aid in the recognition of true the genera Agastache, Dracocephalum, Hyssopus,andLal- monophyletic groups. THE SATUREJA OMPLEX Satureja lemantia. Agastache, Dracocephalum and Lallemantia have C . The genus s. l. is a large complex of approximately 225 species that has been considered to be closely related by previous au- been treated as one genus (Briquet 1895–1897) or as thors but Hyssopus had been placed in its own subtribe many as 17 genera (Doroszenko 1985). Our study con- by both Briquet (1895–1897) and Wunderlich (1967). tained six taxa from the Satureja complex (i.e., Acinos, Four insertions or deletions (indels) support the close Calamintha, Clinopodium, Micromeria,andSatureja s. s.). relationship of Dracocephalum, Hyssopus,andLalleman- These taxa do not form a monophyletic group in either tia. The second clade includes Horminum, Nepeta,and the nuclear or the chloroplast trees. In fact, despite Prunella and corresponds well with the previously rec- their morphological similarity, none of the genera are ognized tribe Nepeteae, which is consistently defined found to be closely related as no two genera are sister morphologically by most Labiatae taxonomists (e.g., to one another in our molecular analysis. Bentham 1876; Wunderlich 1967). Two morphological In a previous cpDNA study (Wagstaff et al. 1995), synapomorphies support this clade: the calyx has 15 Acinos, Calamintha, and the New World Satureja species parallel nerves and didynamous stamens (Wagstaff formed a polytomy along with nine other New World 1992b). This clade is not found in the trnL/F tree. genera (Wagstaff et al. 1995). The addition of the trnL/ The third clade consists of Rosmarinus, Perovskia,and F and ITS molecular data has greatly enhanced the res- Salvia. This clade is found in only in the combined olution within this clade and support the recognition analysis and is moderately supported with a bootstrap of the generic status of Acinos, Calamintha, Micromeria, value of 72%. These three taxa were placed in the tribe and Satureja s. s. Salvieae by Bentham (1876) but in separate tribes and even separate subfamilies in other morphological treat- ACKNOWLEDGEMENTS. This research was supported by start- ments. Our data confirm previous cpDNA phylogenies up funds allocated to JFO from the Tropical Biology Program of where these three taxa were found to be phylogeneti- Florida International University (TBP-FIU). Jennifer Trusty re- cally related (Kaufman and Wink 1995; Wagstaff et al. ceived a research assistantship from TBP-FIU and an EPA STAR Fellowship. Javier Francisco-Ortega received a summer research 1995). The ITS phylogeny suggests that Melissa may be grant from the Provost Office of FIU. This paper represents a pub- related to this clade. lished contribution of the joint graduate program of Tropical Plant The fourth clade, labeled Clade A, is a large assem- Systematics recently established by FIU and Fairchild Tropical blage of 22 taxa found in chloroplast, nuclear and com- Garden (FTG). This is contribution 70 of the TBP-FIU. We would like to thank the following people who graciously provided us bined phylogenies and is strongly supported in all with plant material: B. Baldwin, P. Cantino, J. Fuertes, E. Menges, trees. However we have not been able to find any mor- A. Prather, A. Prina, and S. Sa-Fontinha. Lawrence Alice and T. phological synapomorphy for this clade. This large Collins provided us with interesting discussions. We would like clade also was recovered by Wagstaff et al. (1995) with to thank J. Barber and A. Prather for critically reviewing the man- some sampling differences in their study of restriction uscript. This paper is dedicated to the late Bertram Zuckerman, historian of FTG and key person in the recent history of our gar- site data of the chloroplast genome, but with weak sup- den. Bert Zuckerman represents an outstanding generation of pro- port (bootstrap value 56%). Within Clade A, the clade fessional and amateur botanists who made possible the dream of 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 713 developing FTG. Talking with Bert about the expeditions, research Labiatae. Pp. 27–37 in Advances in Labiate science, ed. R. M. and professional achievements of David Fairchild represent one of Harley and T. Reynolds. Kew: Royal Botanic Gardens Press. the most memorable experiences had by JFO and JT as newcomers ——— and S. J. WAGSTAFF. 1998. A reexamination of North Amer- to FTG. ican Satureja s. l. (Lamiaceae) in light of molecular evidence. Brittonia 50: 63–70. ———, R. M. HARLEY, and S. J. WAGSTAFF. 1992. Genera of La- LITERATURE CITED biatae: status and classification. Pp. 511–522 in Advances in Labiate Science, ed. R. M. Harley and T. Reynolds. Kew: Royal ACEBES-GINOVE´ S, J. R., M. DEL-ARCO-AGUILAR,A.GARC´ıA-GALLO, Botanic Gardens Press. ´ ´ M. C. LEON-ARENCIBIA,P.L.PEREZ-DE-PAZ,O.RODR´ıGUEZ- CARVALHO,J.A.andA.CULHAM. 1998. Conservation status and DELGADO,andW.WILDPRET-DE-LA-TORRE. 2001. Pteridophy- preliminary results on the phylogenetics of Isoplexis (Lindl.) ta, Spermatophyta. Pp. 98–140 in Lista de especies silvestres de Benth. (Scrophulariaceae) an endemic Macaronesian genus. Canarias. Hongos, plantas y animales terrestres, ed. I. Izquierdo- Boletim do Museo Municipal do Funchal Suplemento 5: 109–127. Zamora, J. L. Martıń-Esquivel, N. Zurita-Pe´rez and M. Are- CATALAN, M. P., E. A. KELLOGG, and R. G. OLMSTEAD. 1997. Phy- chavaleta Hernańdez. Santa Cruz de Tenerife: Consejerıá de logeny of Poaceae subfamily Pooideae based on chloroplast Polı´tica Territorial y Medio Ambiente, Gobierno de Canarias. ndhF gene sequences. Molecular Phylogenetics and Evolution 8: ANDERSON, C. L., J. H. E. ROVA, and L. ANDERSSON. 2001. Molec- 150–166. ular phylogeny of the tribe Anthospermeae (Rubiaceae): sys- CERBAH,M.,T.SOUZA-CHIES,M.J.JUBIER,B.LEJEUNE, and S. SIL- tematic and biogeographic implications. Australian Systematic JAK-YAKOVLEV. 1998. Molecular phylogeny of the genus Hy- Botany 14: 231–244. pochaeris using internal transcribed spacers of nuclear rDNA: ANDREWS, S. 1984. A reappraisal of Ilex aquifolium and I. perado inference for chromosomal evolution. Molecular Biology and (Aquifoliaceae). Kew Bulletin 39: 141–154. Evolution 15: 345–354. ANDRUS,N.,J.TRUSTY,A.SANTOS-GUERRA,R.K.JANSEN,andJ. CHANDERBALI,A.S.,H.VAN-DER-WERFF, and S. S. RENNER. 2001. FRANCISCO-ORTEGA. 2004. Using molecular phylogenies to Phylogeny and historical biogeography of Lauraceae: evi- test phytogeographical links between East/South Africa— dence from the chloroplast and nuclear genomes. Annals of Southern Arabia and the Macaronesian islands—A review, the Missouri Botanical Garden 88: 104–134. and the case of Vierea and Pulicaria section Vieraeopsis (Aster- CUENOUD, P., M. A. D. MART´ıNEZ,P.A.LOIZEAU,R.SPICHIGER,S. aceae). Taxon 53: 333–346. ANDREWS,andJ.F.MANEN. 2000. Molecular phylogeny and BAIN,J.F.andJ.L.GOLDEN. 2000. A phylogeny of Packera (Sene- biogeography of the genus Ilex L. (Aquifoliaceae). Annals of cioneae; Asteraceae) based on internal transcribed spacer re- Botany 85: 111–122. gion sequence data and a broad sampling of outgroups. Mo- DEBRY,R.W.andR.G.OLMSTEAD. 2000. A simulation study of lecular Phylogenetics and Evolution 16: 331–338. reduced tree-search effort in bootstrap resampling analysis. ——— and J. WALKER. 1995. A comparison of the pollen wall ul- Systematic Biology 49: 171–179. trastructure of aureoid and non-aureoid Senecio species (As- DOWNIE,S.R.andD.S.KATZ-DOWNIE. 1996. A molecular phy- teraceae) in North America. Plant Systematics and Evolution logeny of Apiaceae subfamily Apoideae: evidence from nu- 195: 199–207. clear ribosomal DNA internal transcribed spacer sequences. ———, B. S. TYSON,andD.F.BRAY. 1997. Variation in pollen wall American Journal of Botany 83: 234–251. ultrastructure in New World Senecioneae (Asteraceae), with EPLING, C. 1937. Synopsis of the South American Labiatae. Feddes special reference to Packera. Canadian Journal of Botany 75: 730– 735. Repertorium Specierum Novarum Regni Vegetabilis 85: 162–168. ERDTMAN, G. 1945. Pollen morphology and plant taxonomy. IV BENED´,ı C. 1997. Ilex L. Pp. 182–185 in Flora Ibe´rica , Vol. 8, ed. S. Castroviejo, C. Aedo, C. Benedı´, M Laıńz, F. Muńõz-Garmen- Labiatae, Verbenaceae and Avicenniaceae. Svensk Botanisk Tid- dia, G. Nieto-Feliner and J. Paiva. Real Jardıń Botańico, skrift Utgifven af Svenska Botaniska Foreningen 39: 279–285. C.S.I.C, Madrid. ERIKSSON,T.andM.J.DONOGHUE. 1997. Phylogenetic relationships of Sambucus and Adoxa (Adoxoideae, Adoxaceae) based BENTHAM, G. 1834. Labiatarum, genera et species, Fasc. 4. London: J. Ridgway and Sons. on nuclear ribosomal ITS sequences and preliminary mor- ———. 1848. Labiatae. Pp. 27–603 in Prodomus Systematis Naturalis. phological data. Systematic Botany 22: 555–573. ¨ ¨ Regni Vegetabilis, ed. A. P. De Candolle. Paris: Victoris Masson. ———, M. KALLERSJO,A.G.KLUGE, and C. BULT. 1994. Testing ———. 1876. Labiatae. Pp. 1160–1223 in Genera plantarum, Vol. 2, significance of incongruence. Cladistics 10: 315–319. eds. G. Bentham and J. D. Hooker. London: Reeve and Co. FELSENSTEIN, J. 1985. Confidence limits on phylogenies: an ap- BO¨ HLE, U-R., H. H. HILGER, a nd W. F. M ARTIN. 1996. Island colo- proach using bootstrap. Evolution 39: 783–791. nization and evolution of the insular woody habit in Echium FITCH, W. M. 1971. Toward defining the course of evolution: min- L. (Boraginaceae). Proceedings of the National Academy of Sci- imum change for a specific topology. Systematic Zoology 20: ences USA 93: 11740–11745. 406–416. BOHS,L.andR.G.OLMSTEAD. 2001. A reassessment of Normania FRANCISCO-ORTEGA, J., A. SANTOS-GUERRA,A.HINES, and R. K. and Triguera (Solanaceae). Plant Systematics and Evolution 228: JANSEN. 1997. Molecular evidence for a Mediterranean origin 33–48. of the Macaronesian endemic genus Argyranthemum (Aster- BRAMWELL, D. 1972. Endemism in the flora of the Canary Islands. aceae). American Journal of Botany 84: 1595–1613. Pp. 141–159 in Taxonomy, phytogeography and evolution, Vol. 2, FUERTES-AGUILAR, J., M. F. RAY,J.FRANCISCO-ORTEGA,A.SANTOS- ed. D. H. Valentine. London: Academic Press. GUERRA, and R. K. JANSEN. 2002. Molecular evidence from ———. 1978. Contribucioń a la biogeografıá de las islas Canarias. chloroplast and nuclear markers for multiple colonization of Botańica Macarone´sica 14: 3–34. Lavatera (Malvaceae) in the Canary Islands. Systematic Botany BREMER, B. 1996. Phylogenetic studies within Rubiaceae and re- 27: 74–83. lationships to other families based on molecular data. Opera HARLEY,R.M.andC.A.HEYWOOD. 1992. Chromosome numbers Botanica Belgica 7: 33–50. in tropical American Labiatae. Pp. 211–246 in Advances in La- BRIQUET, J. 1895–1897. Labiatae. Pp. 183–375 in Die Natu¨rlichen biate Science,. ed. R. M. Harley and T. Reynolds. Kew: Royal Pflanzenfamilien, ed. A. Engler and K. Prantl. Leipzig: Verlag Botanic Gardens. von Wilhelm Engelmann. HEYWOOD, V. H. and I. B. K. RICHARDSON. 1972. Labiatae. Pp. 126– CANTINO, P. D. 1992. Toward a phylogenetic classification of the 192 in Flora Europaea, Vol. 3, ed. T. G. Tutin, V. H. Heywood, 714 SYSTEMATIC BOTANY [Volume 29

N. A. Burges, D. H. Valentine, S. M. Walters, and D. A. Webb. OLMSTEAD,R.G.andJ.D.PALMER. 1997. Implications for the phy- Cambridge: Cambridge University Press. logeny, classification, and biogeography of Solanum from HELFGOTT,D.M.,J.FRANCISCO-ORTEGA,A.SANTOS-GUERRA,and cpDNA restriction site variation. Systematic Botany 22: 19–29. B. B. SIMPSON. 2000. Biogeography and breeding system evo- ———, B. BREMER,K.SCOTT,andJ.D.PALMER. 1993. A parsimony lution of the woody Bencomia alliance (Rosaceae) in Maca- analysis of the Asteridae sensu lato based on rbcL sequences. ronesia based on ITS Sequence data. Systematic Botany 25: 82– Annals of the Missouri Botanical Garden 80: 700–722. 97. ———, K. M. SCOTT,andJ.D.PALMER. 1992. A chloroplast DNA HILEMAN, L. C., M. C. VASEY,andV.T.PARKER. 2001. Phylogeny phylogeny for the Asteridae: implications for the Lamiales. and biogeography of the Arbutoideae (Ericaceae): implica- Pp. 19–25 in Advances in Labiate Science. ed. R. M. Harley and tions for the Madrean-Tethyan hypothesis. Systematic Botany T. Reynolds. Kew: Royal Botanic Gardens Press. 26: 131–143. PANERO,J.L.,J.FRANCISCO-ORTEGA,R.K.JANSEN, and A. SANTOS- JAMZAD, Z., M. W. CHASE,M.INGROUILLE,M.S.J.SIMMONDS,and GUERRA. 1999. Molecular evidence for multiple origins of A. JALILI. 2003. Phylogenetic relationships in Nepeta L. (Lam- woodiness and a New World biogeographic connection of the iaceae) and related genera based on ITS sequence data. Taxon Macaronesian Island endemic Pericallis (Asteraceae: Seneci- 52: 21–32. oneae). Proceedings of the National Academy of Sciences USA 96: JOHANSSON, J. T. 1998. Chloroplast DNA restriction site mapping 13886–13891. and the phylogeny of Ranunculus (Ranunculaceae). Plant Sys- PERCY, D. M. and Q. C. B. CRONK. 2002. Different fates of island tematics and Evolution 213: 1–19. brooms: contrasting evolution in Adenocarpus, Genista,andTe - KAUFMANN,M.andM.WINK. 1994. Molecular systematics of the line (Genisteae, Fabaceae) in the Canary Islands and Madeira. Nepetoideae (Family Labiatae): phylogenetic implications American Journal of Botany 89: 854–864. from rbcL gene sequences. Verlag der Zeitschrift fu¨r Naturfor- PRATHER, L. A., A. K. MONFILS,A.L.POSTO, and R. A. WILLIAMS. schung 49: 635–645. 2002. Monophyly and phylogeny of Monarda (Lamiaceae): ev- KIM, K.-J. and R. K. JANSEN. 1994. Comparisons of phylogenetic idence from the internal transcribed spacer (ITS) region of hypothesis among different data sets in dwarf dandelions nuclear ribosomal DNA. Systematic Botany 27: 127–137. (Krigia): additional information from internal transcribed RAY, J. 1995. Systematics of Lavatera and Malva (Malvaceae, Mal- spacers sequences of nuclear DNA. Plant Systematics and Evo- veae)—a new perspective. Plant Systematics and Evolution 198: lution 190: 157–185. 29–53. KRUPKIN,A.B.,A.LISTON, and S. H. STRAUSS. 1996. Phylogenetic RIESEBERG, L. H. 1995. The role of hybridization in evolution: old analysis of the hard pines ( Pinus subgenus Pinus, Pinaceae) wine in new skins. American Journal of Botany 82: 944–953. from chloroplast DNA restriction site analysis. American Jour- ROHWER, J. G. 2000. Toward a phylogenetic classification of the nal of Botany 83: 489–498. Lauraceae: evidence from matK sequences. Systematic Botany LA SERNA-RAMOS, I. E. 1984. Revisioń del geńero Bystropogon 25: 60–71. L’He´r., nom. cons. (Lamiaceae-Stachyoideae): endemismo de RONSTED, N., M. W. CHASE,D.C.ALBACH, and M. A. BELLO. 2002. la regioń macarone´sica. Phanerogamarum Monographiae 18: 1– Phylogenetic relationships within Plantago (Plantaginaceae): 380. evidence from nuclear ribosomal ITS and plastid trnL-F se- ——— and W. WILDPRET. 1976. Iniciacioń al estudio biosistema´tico quence data. Botanical Journal of the Linnean Society 139: 323– del geńero Bystropogon L’Her. en el archipie´lago canario. Vi- 338. eraea 6: 77–102. SANTOS,A.andJ.FRANCISCO. 1990. Endemismos macarone´sicos L’HERITIER, C. L. 1788. Sertum anglicum. Paris: Petri-Francisci Didot. en las Islas Canarias: estado de conservacioń. Pp. 191–196 in LISTON, A., W. A. ROBINSON,D.PINERO, and E. R. ALVAREZ-BUYL- Conservation techniques in botanic gardens, ed. E. Hernańdez- LA. 1999. Phylogenetics of Pinus (Pinaceae) based on nuclear Bermejo, M. Clemente and V. Heywood. Champaign, Illinois: ribosomal DNA internal transcribed spacer region sequences. Molecular Phylogenetics and Evolution 11: 95–109. Koeltz Scientific Books. SANTOS-GUERRA, A. 2002. Flora vascular nativa. Pp. 185–192 in LO´ PEZ-GONZA´ LEZ,G.andE.BAYER. 1988. El geńero Ziziphora L. (Labiatae) en el Mediterrańeo Occidental y sus relaciones con Naturaleza de las Islas Canarias. Ecologıá y conservacioń, ed. J. M. Acinos Miller. ¿Parentesco o convergencia? Lagascalia 15(extra): Fernańdez-Palacios and J. L. Martıń-Esquivel. Santa Cruz de 49–64. Tenerife: Turquesa. LOPEZ,G.G.,K.KAMIYA, and K. HARADA. 2002. Phylogenetic re- SHORT, M. J. 1988. A note on Pelletiera St. Hil. (Primulaceae) in lationships of Diploxylon pines (subgenus Pinus) based on Macaronesia. Bocagiana 122: 1–3. plastid sequence data. International Journal of Plant Sciences SIMMONS,M.P.andH.OCHOTERENA. 2000. Gaps as characters in 163: 737–747. sequence-based phylogenetic analyses. Systematic Biology 49: MABBERLEY, D. J. 1997. The plant book. 2nd edition. Cambridge: 369–381. Cambridge University Press. SPACH, E. 1840. Histoire naturelle des vegetaux phanerogames,Vol. 9. MADDISON, D. R. 1991. The discovery and importance of multiple Paris: Librairie Encyclopedique de Poret. islands of most-parsimonious trees. Systematic Zoology 40: SUN, Y., D. Z. SKINNER,G.H.LIANG, and S. H. HULBERT. 1994. 315–328. Phylogenetic analysis of Sorghum and related taxa using in- MANEN, J. F., M. C. BOULTER,andY.NACIRI-GRAVEN. 2002. The ternal transcribed spacer sequences of ribosomal DNA. The- complex history of the genus Ilex L. (Aquifoliaceae): evidence oretical and Applied Genetics 80: 26–32. from the comparison of plastid and nuclear DNA sequences SUNDING, P. 1979. Origins of the Macaronesian flora. Pp. 13–40 in and from fossil data. Plant Systematics and Evolution 235: 79– Plants and islands, ed. D. Bramwell. London: Academic Press. 98. SWOFFORD, D. L. 2002. PAUP*: Phylogenetic analysis using parsi- MARTINS, L., C. OBERPRIELER, and F. H. HELLWIG. 2003. A phylo- mony (*and other methods). Version 4.0b10. Sunderland: Sin- genetic analysis of Primulaceae s. l. based on internal tran- auer Associates. scribed spacer (ITS) DNA sequence data. Plant Systematics and TABERLET, P., L. GIELLY,G.PUATOU,andJ.BOUVET. 1991. Universal Evolution 237: 75–85. primers for amplification of three non-coding regions of chlo- MESZAROS,S.,J.DE-LAET, and E. SMETS. 1996. Phylogeny of tem- roplast DNA. Plant Molecular Biology 17: 1105–1109. perate Gentianaceae: a morphological approach. Systematic TORRELL,M.,N.GARCIA-JACAS,A.SUSANNA,andJ.VALLES. 1999. Botany 21: 153–168. Phylogeny in Artemisia (Asteraceae, Anthemideae) inferred 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 715

from nuclear ribosomal DNA (ITS) sequences. Taxon 48: 721– WALKER, J., K. J. SYSTMA, and M. WINK. 2002. Salvia (Lamiaceae) 736. is not monophyletic: implications for the systematics, radia- VALDE´ S, B. 1980. A new species of Pelletiera (Primulaceae) from tion, and ecological specializations of Salvia and subf. Nepe- Macaronesia. Candollea 35: 641–648. toideae. Conference Abstracts. Botany 2002. (www.2002. VAN HAM,R.C.H.J.andH.T’HART. 1998. Phylogenetic rela- botanyconference.org). tionships in the Crassulaceae inferred from chloroplast DNA WEBSTER, G. L. 1967. The genera of Euphorbiaceae in the south- restriction-site variation. American Journal of Botany 85: 123– eastern United States. Journal of the Arnold Arboretum 48: 363– 134. 430. VARGAS, P., C. M. MORTON, and S. L. JURY. 1999. Biogeographic WHALEN, M. D. 1984. Conspectus of species groups in Solanum patterns in Mediterranean and Macaronesian species of Sax- subgenus Leptostemonum. Gentes Herbarum 12: 179–282. ifraga (Saxifragaceae) inferred from phylogenetic analyses of WHITE,T.J.,T.BRUNS,S.LEE,andJ.TAYLOR. 1990. Ampliﬁcation ITS sequences. American Journal of Botany 86: 724–734. and direct sequencing of fungal ribosomal RNA genes for WAGSTAFF, S. J. 1992a. A phylogenetic interpretation of pollen phylogenetics. Pp. 315–322 in PCR protocols: a guide to methods morphology in tribe Mentheae (Labiatae). Pp. 113–124 in Ad- and application, ed. M. Innis, D. Gelfand, J. Sninsky, and T. vances in Labiate science, ed. R. M. Harley and T. Reynolds. White. San Francisco: Academic Press. Kew: Royal Botanic Gardens Press. WINK,M.andM.KAUFMANN. 1996. Phylogenetic relationships be- ———. 1992b. Phylogeny and character evolution in subfamily Nepe- tween some members of the subfamily Lamioideae (Family toideae (Labiatae). Ph. D. dissertation, Ohio University, Athens, Ohio. Labiatae) inferred from nucleotide sequences of the rbcL gene. Botanica Acta 109: 139–148. ——— and R. G. OLMSTEAD. 1997. Phylogeny of Labiatae and Ver- benaceae inferred from rbcL sequences. Systematic Botany 22: WOLFE,A.D.andW.J.ELISENS. 1995. Evidence of chloroplast 165–179. capture and pollen-mediated gene ﬂow in Penstemon sect. ———, L. HICKERSON,R.SPANGLER,P.A.REEVES, and R. G. OLM- Peltanthera (Scrophulariaceae). Systematic Botany 20: 395– STEAD. 1998. Phylogeny in Labiatae s. l., inferred from cp- 412. DNA sequences. Plant Systematics and Evolution 209: 265–274. WUNDERLICH, R. 1967. Ein Vorschlag zu einer natu¨rlichen Glied- ———, R. G. OLMSTEAD,andP.D.CANTINO. 1995. Parsimony erung der Labiaten auf Grund der Pollenkorner, der Same- analysis of cpDNA restriction site variation in subfamily Ne- nentwicklung und des reifen Samens. Oesterreichisches Botan- petoideae (Labiatae). American Journal of Botany 87: 886–892. ische Zeitschrift 114: 383–483.