Systematic Botany (2004), 29(3): pp. 702±715 q Copyright 2004 by the American Society of Plant Taxonomists Using Molecular Data to Test a Biogeographic Connection of the Macaronesian Genus Bystropogon (Lamiaceae) to the New World: A Case of Con¯icting Phylogenies JENNIFER L. TRUSTY,1,5 RICHARD G. OLMSTEAD,2 DAVID J. BOGLER,1,4 ARNOLDO SANTOS- GUERRA,3 and JAVIER FRANCISCO-ORTEGA1 1Department of Biological Sciences, Florida International University, University Park, Miami, Florida 33199 (correspondence) and Fairchild Tropical Garden, 11935 Old Cutler Road, Coral Gables, Florida 33156 2Department of Biology, University of Washington, P.O. Box 355325 Seattle, Washington 98195 3JardõÂn de AclimatacioÂn de La Orotava, Calle Retama, Nu mero. 2, Puerto de La Cruz, E-38400, Tenerife, Canary Islands, Spain 4Present address: The Missouri Botanical Garden, P.O. Box 299, St. Louis, Missouri 63166 5Author for correspondence (jtrust01@®u.edu) Communicating Editor: Lawrence A. Alice ABSTRACT. Bystropogon (Lamiaceae) is endemic to the Macaronesian Islands and represents the best-known example of a putative phytogeographic connection between these islands and the New World. Previous morphological taxonomic studies suggested that this genus is closely related to the western South American Minthostachys. Phylogenetic analyses of nucleotide sequences of the internal transcribed spacers and 5.8S subunit of nuclear ribosomal DNA and the trnL gene and trnL-trnF spacer of the chloroplast genome for 33 of the 72 genera in the Mentheae tribe were performed. Maximum parsimony analysis of the combined data set resulted in 63 most parsimonious trees. The strict consensus tree of this analysis shows with moderate bootstrap support (74%) that Bystropogon is sister to the Old World taxa Acinos, Ziziphora,andClinopodium vulgare. When analyzed separately, the ITS and trnL/F data sets do not agree as to the sister group to Bystropogon, although none supports a sister relationship with Minthostachys. The cpDNA phylogeny strongly supports a relationship of Bystropogon with a clade of New World mint taxa (90% bootstrap value). Due to the apparent con¯ict between the chloroplast and nuclear characters observed in the phylogenies, we are not certain of the true biogeographic relationship of Bystropogon. Finally, in all analyses, all of the Mentheae genera sampled in this study form a monophyletic group (100% bootstrap value) and a derived clade of ten New World genera is found. These results contribute to our understanding of generic relationships within the tribe. Bystropogon L'Her. and Cedronella Moench (Lami- BoÈhle et al. 1996; Francisco-Ortega et al. 1997; Carval- aceae, Mentheae) are the only genera of mints that are ho and Culham 1998; Vargas et al. 1999; Helfgott et al. endemic to the Macaronesian Islands. The former is 2000; Percy and Cronk 2002). Most of these studies restricted to the Canary and Madeira archipelagos; the support a link between the Macaronesian ¯ora and the latter contains a single species, Cedronella canariensis, Mediterranean basin. Examples are Argyranthemum found in the Azores, Canaries, and Madeira. Bystro- Sch. Bip. (Asteraceae ; Francisco-Ortega et al. 1997), the pogon has seven species that have radiated primarily Bencomia Webb and Berthel. alliance (Rosaceae; Helf- in the pine and laurel forests of Macaronesia (La Serna- gott et al. 2000), and Ixanthus Griseb. (Gentianaceae; Ramos 1984) and represents the best-known example Thiv et al. 1999). However, Macaronesian taxa have of a putative biogeographic connection between the also been found to have phylogenetic links with dis- Macaronesian and New World ¯oras (Bramwell 1972; tant areas such as East and South Africa (reviewed in Sunding 1979). Several authors have indicated that Andrus et al. 2004), and East Asia. For instance, the Minthostachys (Benth.) Spach, a genus restricted to endemic genus Phyllis L. (Rubiaceae) is nested within a clade of East-South African genera (Bremer 1996; An- western South America with a predominant Andean derson et al. 2001) and the Macaronesian endemic Ilex distribution, is the closest relative of Bystropogon or is perado Aiton is nested within a clade of East Asian congeneric with it (L'Heritier 1788; Bentham 1834, species (CueÂnod et al 2000; Manen et al. 2002). 1848; Spach 1840; Briquet 1897; Epling 1937; La Serna- Bystropogon and Cedronella are members of the Ne- Ramos and Wildpret 1976; Sunding 1979; La Serna- petoideae, the largest of the eight subfamilies of the Ramos 1984). Other New World genera that have been Lamiaceae (Cantino et al. 1992). Cantino et al. (1992) suggested by pollen morphology as closely related to recognized four tribes in the Nepetoideae: Elcholtzieae, Bystropogon are the Juan Fernandez Island endemic ge- Lavanduleae, Ocimeae, and Mentheae. The Mentheae nus Cuminia Colla and the North American Pycnanthe- is the largest of these, containing approximately 72 mum Michx. (Harley and Heywood 1992). genera, including both Bystropogon and Cedronella and In recent years there have been several molecular such economically important plants as mint (Mentha phylogenetic studies aiming to elucidate the biogeo- L.), oregano (Origanum L.), rosemary (Rosmarinus L.), graphical connections of Macaronesian plants (e.g., sage (Salvia L.), and thyme (Thymus L.). 702 2004] TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD 703 The use of chloroplast DNA [cpDNA] restriction site sequence of Calamintha menthifolia Host but have included ITS se- quences for Conradina etonia Kral and McCartney, Glechoma heder- analysis and nucleotide sequence data have aided in acea L., and Melissa of®cinalis L., which are absent from the trnL/F the recognition and recircumscription of the Lami- tree. Hyptis Jacq., Lavandula L., Orthosiphon Benth., and Plectranthus aceae and Verbenaceae as two monophyletic assem- L'HeÂr. (Lavanduleae and Ocimeae tribes) were chosen as the out- blages (Olmstead et al. 1992, 1993; Wagstaff and Olm- group for both ITS and combined analyses of the ITS and trnL/F data. This outgroup selection was made based on their basal po- stead 1997; Wagstaff et al. 1998). Molecular data also sition in the phylogenetic analysis of the trnL/F data set (see Re- have proven to be a valuable tool at lower taxonomic sults). The ®rst 143 and last 59 bp of the ITS sequences of these levels. Studies below the family level have discovered Ocimeae and Lavanduleae taxa were excluded from analysis due to uncertainty of their alignment. The aligned data matrices are paraphyletic and/or polyphyletic groupings such as deposited in TreeBase Study accession (S1116, matrix accession the subfamilies Chloanthoideae and Viticoideae, the M1909-1911). Satureja L. complex, and Lamium L. (Wink and Kauf- DNA Extraction, PCR ampli®cation, and Sequencing. DNA mann 1996; Cantino and Wagstaff 1998; Wagstaff et al. was extracted from either fresh or silica-gel dried material using the Qiagen DNeasy protocol (Qiagen, Ltd.). Both strands of the 1998). In all of these analyses, monophyly of subfamily nuclear ribosomal internal transcribed spacer (ITS) region includ- Nepetoideae and tribe Mentheae is well supported ing the 5.8S gene were ampli®ed using primers ITS4 (White et al. (Kaufmann and Wink 1994; Wagstaff et al. 1995). With- 1990) and ITS5 (Downie and Katz-Downie 1996). The ITS region in tribe Mentheae, Monarda L., Mentha, Nepeta L., and of Melissa of®cinalis was ampli®ed using primers 17SE and 26SE (Sun et al. 1994). PCR ampli®cation conditions are described in Salvia have been the subject of molecular systematic Kim and Jansen (1994). Dif®culty in amplifying the ITS1 region of analyses at the species level (Prather et al. 2002; Walker Clinopodium vulgare resulted in an incomplete sequence that is et al. 2002; Jamzad et al. 2003 ; Bunsawat et al., in missing the ®rst 240 aligned bp. The chloroplast trnL gene and trnL-trnF intergenic spacer (trnL/ mss.). Despite their extraordinary economic impor- F) were ampli®ed using the `C' and `F' primers according to the tance as perfumes, spices, medicinal drugs and horti- protocol described by Taberlet et al. (1991). Ampli®cation of the cultural plants, no molecular phylogenetic analysis of trnL-trnF region of Ziziphora hispanica L. was performed with the the generic relationships within the Mentheae has yet `C' primer (forward direction) and an internal primer designed for this study (primer JT3R, 59 CGACCATTTCCAAATGATAGCAT 39). been published. Ampli®cation with the regular trnL/F `C' and `F' primers for Z. In this paper we review the literature on the phy- hispanica yielded multiple bands. PCR products were cleaned us- logenetic connections of Macaronesian plants with the ing the QIAquick silica columns (Qiagen, Ltd.) according to the manufacturer's protocol. The puri®ed PCR products were cycle- New World and we also provide the ®rst molecular sequenced in both directions using the ABI Prism Big Dye Ter- phylogenetic analysis of Mentheae in order to 1) elu- minator Cycle Sequencing Ready Reaction Kit (Applied Biosys- cidate the phylogenetic relationships of the endemic tems) with AmpliTaq DNA polymerase. The sequencing reactions Macaronesian genus Bystropogon; 2) test the hypothe- were conducted using the same primers that were used for the PCR ampli®cations. Dye-terminator reactions were carried out in sized sister relationship of Bystropogon to Minthostach- 10 mL reactions, diluted 50:50 using AmpliTaq FS buffer (Applied ys; and 3) provide insight into the phylogenetic rela- Biosystems) and ampli®ed according to the manufacturer's pro- tionships among the genera that comprise the Men- tocol. Cycle sequencing products were separated on an ABI 377 theae. automated sequencer at the Florida International University Se- quencing Center. In our study we have followed the Lamiaceae clas- Data Analysis. Sequences were assembled and edited using si®cation of Cantino et al. (1992). For members of the Sequencher 3.2 (Gene Codes Inc.) and aligned using Clustal X Satureja complex, we followed the taxonomic treat- (Thompson et al. 1997). The ®nal alignment was adjusted manu- ally using Se-Al vers. 1 (A. Rambaut, University of Oxford, Ox- ments of Heywood and Richardson (1972) for the Old ford, United Kingdom).