Using Polymerase Chain Reaction to Characterize Recent Prey Consumption by the Slender Running Crab Spider, Tibellus Simon (Araneae: Philodromidae)

Using polymerase chain reaction to characterize recent prey consumption by the slender running crab spider, Tibellus Simon (Araneae: Philodromidae)

Brandes Willem Struger-Kalkman

A Thesis Presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Environmental Sciences

Guelph, Ontario, Canada

ABSTRACT

USING POLYMERASE CHAIN REACTION TO CHARACTERIZE RECENT PREY

CONSUMPTION BY THE SLENDER RUNNING CRAB SPIDER, TIBELLUS SIMON

(ARANEAE: PHILODROMIDAE)

Brandes Struger-Kalkman Advisor: University of Guelph, 2015 Professor J.M. Schmidt

This thesis investigates the use of polymerase chain reaction (PCR) as a tool for characterizing the recent prey consumption of spiders. A methodology using PCR was developed to detect a 543-bp region of DNA from the cytochrome c oxidase subunit I gene of Drosophila suzukii (Matsumura). Feeding experiments involving slender running crab spiders, Tibellus

Simon spp., revealed the robust detection of target DNA from the extracts of Tibellus for up to

60 h after one D. suzukii was consumed. Further experiments showed that consuming multiple D. suzukii extended detection to 96 h in Tibellus. A field study demonstrated that the method detected recent predation by 31% of Tibellus collected in the field. However, an evaluation of the specificity of the method determined that modification is necessary for precisely identifying the prey of field spiders. Avenues of future research on spider predation in both the laboratory and field are discussed.

ACKNOWLEDGEMENTS

I am forever grateful to everyone that has helped to make this project a success. First and foremost, I want to thank my advisor, Dr. Jonathan Schmidt, and my co-advisor, Dr. Marc Habash. Jonathan, I thank you first for developing my interest in spiders. As you remember, I gave them no credit whatsoever until you opened my eyes to their potential. I also want to acknowledge your support, guidance, and criticism throughout this process, all of which have helped me develop my own critical thinking and broaden my views (by „turning things on their head‟). I wish to also highlight your wisdom and generosity, but most of all your patience, which knows no limits. Marc, I found your knowledge of the molecular side of this research to be very insightful. I thank you for helping me develop experiments to explore the intricacies of my work and for your input in developing this thesis. I also want to thank Dr. Alex Smith and Dr. Paul Sibley for their reviews of my thesis and for their contributions during my defense.

I want to thank Dr. Adam Chippindale and Dr. Justin Renkema for contributing Drosophila spp. with which we could rear spiders and conduct feeding experiments. I also give thanks to Gillian Ferguson (Ontario Ministry of Agriculture, Food, and Rural Affairs) for arranging sampling visits in Leamington greenhouses. This allowed me to gain some hands-on experience with spiders in crop systems. The spiders collected from these greenhouses will not go untested. I also need to thank Jonathan Gaiero, whose help was fundamental in developing my PCR assay. I want to thank Kiera Belley and Alicia Newman for their assistance both inside and outside of the laboratory. Both had a big hand in collecting and maintaining spiders as well as in rearing Drosophila. Without their efforts, research would have been far more challenging. I also want to thank you, Kiera, for our philosophical discussions and for your help with my molecular work.

I am so grateful to Amanda Poole for her dedication. Amanda, you kept my spirits up when they were sinking, you kept me aligned with my goal, and you enured my “creative process”. I am also grateful to Michael Tomascik for the same reasons and more. Mike, you and I spent a lot of time collecting, feeding, identifying, observing, and discussing our spiders. I have benefited both as a person and as an academic from our experiences and accomplishments throughout this endeavour. I wish you nothing but the best in life, friend, and let us not end our adventures yet.

iii

Ever since I was young, I have had a curiosity about bugs and I have my family to thank for helping me to develop this interest. My fascination with insects probably began one summer well over a decade ago when my brother Arih and I collected whatever insects we could catch and pinned them inside egg cartons. I owe everything to Arih; he has always been by my side and has always helped me to be the best I can be. I am also thankful for my mother and father, Klari Kalkman and Stephen Struger, who, both rooted in biology, provided a supportive environment in which I could continue to collect and study insects. I also want to acknowledge my grandparents, Wim and Janet Kalkman and John and Theresa Struger, for always encouraging my pursuit of entomology, whether it was by sending cards decorated with pictures of insects or by supplying jars in which I could keep specimens. I cannot mention everybody that has helped to support me, but I also want to acknowledge the Ellis family, Rebecca “Russ” David, the Monticello “family”, and Savannah Vince for their encouragement and support.

A special thank you goes to Dr. Gard Otis, whose expert advice made this entire thesis possible.

TABLE OF CONTENTS ACKNOWLEDGEMENTS iii TABLE OF CONTENTS v LIST OF TABLE viii LIST OF FIGURES ix ABBREVIATIONS x

CHAPTER 1. INTRODUCTION 1.1 Overview of the importance of spiders to agriculture 1 1.2 Choice of method to detect prey consumption by spiders 1.2.1 Evolving beyond observational methods 5 1.2.2 Discussion of detection methods 7 1.3 Molecular analysis of spider prey using PCR 1.3.1 Review of laboratory feeding assays 14 1.3.2 Summary of field studies with comparison to lab studies 27 1.3.3 Research gaps considered 33 1.4 Objectives and model organism choices 1.4.1 Research goals and objectives 35 1.4.2 Choice of detection method 36 1.4.3 Choice of model spider and prey 37 CHAPTER 2. MATERIALS AND METHODS 2.1 General protocols 2.1.1 Collection and maintenance of spiders 41 2.1.2 Collection and rearing of Drosophila 42 2.1.3 Feeding protocol 43 2.1.4 Molecular protocols 45 2.1.5 Statistical analysis 49 2.2 Suitability of selected primers for detecting prey DNA 2.2.1 Validation of DNA detection using selected primers 50 2.2.2 Specificity of the 543-bp PCR assay 52 2.2.3 Sensitivity of the 543-bp PCR assay 55

2.2.4 The detection of D. suzukii DNA in spiders 56 2.3 Optimizing the post-consumption detection of D. suzukii DNA in Tibellus using PCR 2.3.1 Effect of Tibellus sample storage on the detection of consumed D. suzukii DNA 60 2.3.2 Effect of thawing Tibellus on the detection of consumed D. suzukii DNA 61 2.3.3 Efficiency of extracting Tibellus DNA 61 2.3.4 Replicability of the PCR result 62 2.4 Application of the optimized PCR detection method to feeding and field experiments 2.4.1 The decay of a 543-bp region of D. suzukii DNA detected in Tibellus 63 2.4.2 Effect of multiple prey on the detection of D. suzukii DNA in Tibellus 67 2.4.3 Effect of scavenging on the detection of D. suzukii DNA in Tibellus 69 2.4.4 Screening field-collected Tibellus for prey DNA using the 543 bp PCR assay 70 CHAPTER 3. RESULTS AND DISCUSSION 3.1 Suitability of selected primers for detecting prey DNA 3.1.1 Validation of DNA detection using selected primers 71 3.1.2 Specificity of the 543-bp PCR assay 73 3.1.3 Sensitivity of the 543-bp PCR assay 80 3.1.4 The detection of D. suzukii DNA in spiders 83 3.2 Optimizing the post-consumption detection of D. suzukii DNA in Tibellus using PCR 3.2.1 Effect of Tibellus sample storage on the detection of consumed D. suzukii DNA 85 3.2.2 Effect of thawing Tibellus on the detection of consumed D. suzukii DNA 87 3.2.3 Efficiency of extracting Tibellus DNA 88 3.2.4 Replicability of the PCR result 90 3.3 Application of the optimized PCR detection method to feeding and field experiments 3.3.1 The decay of a 543-bp region of D. suzukii DNA detected in Tibellus 94 3.3.2 Effect of multiple prey on the detection of D. suzukii DNA in Tibellus 103 3.3.3 Effect of scavenging on detection of D. suzukii DNA in Tibellus 106 3.3.4 Screening field-collected Tibellus for prey DNA using the 543 bp PCR assay 109 CHAPTER 4. CONCLUSIONS 112 REFERENCES 117 APPENDIX I – LITERATURE SOURCES FOR PREY DETECTION METHODS 124 APPENDIX II – SPIDERS STUDIED USING POLYMERASE CHAIN REACTION 125

APPENDIX III – SPIDERS COLLECTED IN CANADIAN AGROECOSYSTEMS 129 APPENDIX IV – OCCURRENCES OF TIBELLUS SPECIES 130 APPENDIX V – SITES FOR THE COLLECTION OF SPIDERS 132 APPENDIX VI – PRELIMINARY EXPERIMENT TO DETERMINE OPTIMAL PRIMER CONCENTRATION FOR THE 543-BP PCR ASSAY 133 APPENDIX VII – RESULTS FOR IN SILICO AND IN VITRO SPECIFICITY TESTS 135 APPENDIX VIII – PRELIMINARY EXPERIMENT TO PROBE SENSITIVITY OF THE 543-BP PCR ASSAY 139 APPENDIX IX – PRELIMINARY EXPERIMENT TO EFFECT VARIATION IN BRIGHTNESS OF PCR RESULTS AMONG FED SPIDERS 140 APPENDIX X – RESULTS OF MULTIPLE-PREY FEEDING EXPERIMENTS 142

vii

LIST OF TABLES

Table 1.1 Molecular half-lives of prey DNA detected in two spider species using PCR...... 18 Table 1.2 Prey organisms consumed by spiders in laboratory feeding studies and detected using PCR...... 21 Table 1.3 Prey organisms consumed by spiders in agroecosystems and detected using PCR...... 31 Table 2.1 Spiders used in feeding experiments and screened using PCR for the consumption of Drosophila prey DNA...... 44 Table 2.2 Select mitochondrial cytochrome c oxidase subunit I gene primer pairs used for PCR...... 48 Table 2.3 Field Tibellus collected using sweepnets in roadside field margins located 70 in Wellington County, Ontario, Canada...... Table 3.1 Percentages of dilutions of Drosophila suzukii DNA that tested using the 543-bp PCR assay...... 81 Table 3.2 Proportion of Tibellus samples testing positive for Drosophila suzukii DNA using the 543-bp PCR assay...... 86 Table 3.3 Detection of a 543-bp Drosophila amplicon in Tibellus spiders fed one adult D. suzukii for 5 h in replicated PCR assays...... 93 Table 3.4 Results of the 543-bp PCR assay in detecting a single adult Drosophila suzukii from starved Tibellus spiders frozen at time intervals after a two or six hour consumption period...... 95 Table 3.5 Results of the 543-bp PCR assay using Tibellus spiders collected from grassy field margins in north Wellington County, Ontario in 2013...... 110 Table I.1 Literature sources for methods of detecting prey consumption in spiders. ... 124 Table II.1 Studies using PCR to detect the DNA of prey consumed by spiders...... 125 Table II.2 List of spiders in studies using PCR to determine the molecular half-life for a region of prey DNA...... 127 Table III.1 Summary of number of named spider species collected from agroecosystems across Canada...... 129 Table IV.1 Occurrences of Tibellus species from ecosystems in Canada and northern USA...... 130 Table IV.2 Occurrences of Tibellus in habitats when their frequency among spiders was >0.1%...... 131 Table V.1 Collection sites of spiders used in PCR assays...... 132 Table VII.1 Possible sources of non-specific amplification for 500F/R primers...... 135 Table VIII.1 Proportions of D. suzukii DNA, diluted in either water or the DNA of a starved Tibellus, in which a 543-bp region of D. suzukii DNA was detected using PCR...... 139 Table X.1 Results of 24 h multiple-prey feeding experiments...... 142

viii

LIST OF FIGURES

Figure 1.1 Number of laboratory studies using PCR to determine a molecular half-life for prey DNA consumed by spiders...... 16 Figure 1.2 Diversity of spiders collected from agroecosystems and screened for prey using PCR...... 28 Figure 1.3 Spider taxa collected in field studies to be assayed for prey DNA using PCR. 29 Figure 1.4 Locations of studies investigating spider consumption in the field using PCR...... 29 Figure 1.5 Head-on view of a penultimate male Tibellus sp. and dorsolateral view of a male Drosophila suzukii...... 40 Figure 2.1 Amplicon sizes and 3‟ locations of binding sites for four Drosophila primers along the cytochrome c oxidase subunit I gene of Drosophila yakuba...... 51 Figure 3.1 Efficiency of QIAGEN DNA extraction kit in extracting DNA from Tibellus spiders using three consecutive extractions...... 89 Figure 3.2 Results of PCR replicability tests...... 92 Figure 3.3 Molecular decay for a 543-bp amplicon of Drosophila suzukii DNA detected in the DNA extracted from Tibellus that had each consumed one fly for 2 h. 98 Figure 3.4 Molecular decay for a 543-bp amplicon of Drosophila suzukii DNA detected in the DNA extracted from Tibellus that had each consumed one fly for 6 h. 98 Figure 3.5 Results of field-collected Tibellus assayed using the 543-bp PCR assay...... 111 Figure VI.1 PCR amplification of genomic D. suzukii DNA using a range of 500F/R primer concentrations...... 133 Figure IX.1 PCR amplification of D. suzukii DNA from Tibellus fed one adult D. suzukii for 5 h...... 140

ABBREVIATIONS

2W „two weeks‟ 4W „four weeks‟ BLAST „Basic local alignment search tool‟ BOLD „Barcode of life data system‟ COI „cytochrome c oxidase subunit I‟ EtOH „ethanol‟ F1 „fed once‟ F2 „fed twice‟ GLM „generalized linear model‟ IPM „integrated pest management‟ MCA „monoclonal antibodies‟ MOTU „molecular operational taxonomic unit‟ NCBI „National center for biotechnology information‟ NEC „negative extraction control‟ NPC „negative PCR control‟ NGS „next generation sequencing‟ PC „positive control‟ PCR „polymerase chain reaction‟ qPCR „quantitative polymerase chain reaction‟ RAPD „random amplified polymorphic DNA‟ SE „standard error‟ SWD „spotted-wing drosophila‟ TAE „Tris base, acetic acid, ethylenediaminetetraacetic acid‟

1. INTRODUCTION

1.1 Overview of the importance of spiders to agriculture

Arthropods are major components of all terrestrial food webs and agroecosystems are not an exception. Although many are pests, a large number of other arthropods are beneficial to agriculture and may provide opportunities for the control of pests. Numerous beneficial arthropods occur naturally in the landscape and use of these existing, resident populations is characterized as conservation biological control. Conservation biological control can involve modifying agricultural landscapes to increase overall biodiversity and effect pest suppression

(Barbosa 1998). A common method is to increase the size and plant diversity of field margins, which has been shown to enhance the regulation of pests by augmenting the diversity and abundance of predators (Bianchi et al. 2006; van Alebeek et al. 2006; Holland et al. 2012).

Spiders (Arachnida: Araneae) are among the most common predatory arthropods in terrestrial ecosystems (Foelix 2011). Arable land, including, but not limited to, the crop and its field margins, may be inhabited by many kinds of spiders (Young & Edwards 1990; Nyffeler &

Sunderland 2003; pers. obs. 2013). Even in agroecosystems seemingly devoid of other fauna, spiders may yet persist. For example, a species of comb-footed spider (Araneae: Theridiidae) was found in considerable numbers (maximum observed = 25 spiders per 30 m transect) during the growing season on webs spun beneath suspended plant troughs in cucumber greenhouses that had been cleansed with soap between growing seasons (pers. obs., 2013). Despite this, spiders were first recognized as important predators for integrative pest management (IPM) decisions in the early 1990‟s in China (Greenstone & Sunderland 1999). Since then, the management of

1 spiders beyond natural immigration is still not generally incorporated into IPM strategies. As a result, spiders often remain an unconsidered factor in biological control initiatives (e.g. Boiteau

1986, 2010; Kean et al. 2003; King et al. 2011; Bohan et al. 2013; Vandereycken et al. 2013), even though numerous field experiments have shown that spiders may restrain pest populations and reduce herbivory (Riechert & Lockley 1984; Nyffeler & Benz 1987; Riechert & Bishop

1990; Carter & Rypstra 1995; Nyffeler & Sunderland 2003). The overall lack of initiative in integrating spiders into IPM strategies is counterintuitive considering not only their ubiquity throughout terrestrial ecosystems but also the dietary breadth of most species.

Spiders possess a number of biological adaptations that make them successful predators in agroecosystems. All spiders produce a number of silks, some of which form an integral component of foraging behaviour in many species. About half of the extant spider species use silk to construct webs for capturing flying or falling prey. These web-constructing spiders also tend to use silk for rendering large prey relatively helpless and packaging prey for storage

(Blackledge et al. 2009; Ackermann 2012; Hormiga & Griswold 2014). The remaining spiders are referred to as cursorial or hunting spiders. Although these have abandoned web construction, they frequently rely on silk to assist with prey capture (Nentwig 1986; Dalton 2011; Foelix 2011;

Platnick 2014). Besides its use in predation, silk is used by all spiders to construct egg sacs and may also be used to build shelters and for aerial dispersal (Foelix 2011). In order to travel long distances, spiders point their abdomens towards the sky on a windy day, extrude silk strands of sufficient length and thickness to cause drag, and become airborne (Bell et al. 2005; Foelix

2011). This “ballooning” behaviour allows spiders to be carried by the wind and effectively displaced tens, hundreds, or even thousands of kilometres from their take-off point (Weyman

1993; Bell et al. 2005; Bonte & Lens 2007). As a consequence of this dispersal mechanism,

2 spiders are often some of the first predatory arthropods to accumulate in a field after sowing and are among the first to aggregate at pest infestations (Nyffeler & Sunderland 2003).

Partly due to the fact that ballooning spiderlings may arrive in locations with unknown prey availability, the metabolic physiology of spiders has evolved a number of mechanisms to cope with limited food availability (Wise 1993). Spiders are polyphagous obligate carnivores that liquefy their prey before ingestion (Collatz 1987; Cohen 1995). The vast majority of spiders subdue their prey using cocktails of paralytic venom (Maretić 1987; Casewell et al. 2013) and digestive enzymes begin to digest the prey. The stomach is shaped like a collapsed box and it is surrounded by muscles that squeeze or pull it apart to pump ingested material from the esophagus to the midgut. The midgut is where ingested prey is stored and broken down (Collatz

1987). It incorporates a highly developed network of absorptive tissues, called diverticula. These generally fill the space between abdominal organs, but may also arch around the cephalothorax and extend into the coxae of legs (Collatz 1987; King et al. 2008; Foelix 2011). The fact that some spiders may live more than 200 days without feeding has been attributed in part to the storage capabilities of the gut diverticula (Anderson 1974; Foelix 2011). Molecular detection of prey DNA has revealed that it can take more than a week for ingested prey DNA in spiders to degrade beyond the detection limits of the assay (Kobayashi et al. 2011; Virant-Doberlet et al.

2011). Generally, the period following ingestion in which prey DNA can still be detected from

DNA extracted from spiders is several hours if not days longer than the detection periods of the same prey DNA detected from the extracts of insects (e.g. Ma et al. 2005). Another physiological mechanism contributing to long digestion times in spiders is their low metabolic

-1 rates (0.6–90 µL O2·h ) (Anderson 1970, 1996). In the laboratory, some rates were measured to be about half that of other poikilothermic animals with similar mass (Anderson 1970, 1996).

Moreover, some spiders may depress metabolic rates by 30–40% when starved, clearly showing adaptation to sporadic food availability (Anderson 1974; Greenstone & Bennett 1980).

Another factor that makes spiders effective predators of pests is their ability to gorge themselves when prey densities are high. Unlike most arthropods, spiders have a flexible abdomen that is highly distensible and allows them to maximize consumption in times of high prey availability. Although maximizing prey consumption is associated with certain risks, such as increased susceptibility to predation (Pruitt & Krauel 2010), spiders consuming copious prey are more likely to survive times of low prey availability than spiders consuming less prey (Foelix

2011). Laboratory experiments have demonstrated that both web and hunting spiders may kill wastefully when webs or experimental cages, respectively, contain high numbers of prey (Samu

& Bíró 1993; Pruitt & Krauel 2010; Trubl et al. 2011). However, prey storage differs between hunting and web spiders, whereas web spiders may retain numerous wrapped prey in their webs for later consumption, the cursorial behaviour of hunting spiders lack this option. Instead, hunting spiders are limited to what they can subdue and carry using their mouthparts and pedipalps.

Overall, to understand how to best accommodate spiders into IPM strategies requires additional investigation into their foraging behaviours. Because spiders are polyphagous, they could be either beneficial, i.e. by consuming pests, or detrimental, e.g. by consuming other beneficials, for pest control in agroecosystems. Since so many hunting strategies exist, some spider species are likely to be more effective in targeting specific pests than other species.

Encouraging these spiders to thrive through habitat manipulation may increase predation and reduce crop damage. Alternately, other spiders may kill pollinators or inoculated biological

4 control agents and compromise the integrity of the system. Distinguishing between detrimental and beneficial spiders in agroecosystems drives the need to characterize the prey choice of spiders.

1.2 Methods to detect prey consumption by spiders

1.2.1 Introduction to foraging behaviour in spiders

Spiders use extra-oral digestion to liquefy their prey prior to ingestion, a technique common to some other arachnids, arthropods, and echinoderms, although it is rare throughout the rest of the animal kingdom (Cohen 1995). Although the vast majority of spiders use their fangs to envenom prey, the immobilizing neurotoxins that are injected play a negligible role in the digestion of prey. Instead, an array of digestive enzymes (e.g. lipase, carboxylic esterase, phosphoesterase, and nuclease; Mommsen 1978) are egested from the midgut diverticula of spiders and into the prey through the original puncture wounds (Foelix 2011). Spiders employ these enzymes to catalyze the internal breakdown of prey prior to ingestion. The liquefied prey contents are imbibed by the sucking action of the stomach (Collatz 1987). Although solid prey fragments may still be ingested during this process, filters in the oral cavity generally prevent the further ingestion of particles larger than 1 µm in diameter (Collatz 1987). These larger particles are later gathered into a bolus through the excretion of mucopolysaccharides from nearby glands and the bolus is jettisoned after feeding (Sittertz-Bhatkar 1980).

The complete lack of solid particulates differentiates an analysis of spider prey from the analysis of prey for other arthropods. For example, in many chewing predators, such as large

5 ground beetles (Insecta: Carabidae), the remains of consumed aphids, springtails, and plant material have been detected using gut dissection (Sunderland et al. 1987; Holopainen & Helenius

1992). For spiders, this is not an appropriate approach because no physically identifiable prey structures are ingested. An additional barrier to the identification of ingested material is that spiders highly degrade their food as it passes through the digestive tract. Spider excreta consist mainly of uric acid and the nucleic acid residues, guanine, adenine, and hypoxanthine (Anderson

1966; Collatz 1987; Foelix 2011), although recently published results of a molecular analysis demonstrate that prey DNA could be detected in the faeces of wolf spiders (Araneae: Lycosidae)

(Sint et al. 2015).

Many web spiders catch, wrap, and retain prey in their webs for extended periods of time.

This foraging behaviour permits one to track the quantity and diversity of prey captured over time (e.g. Nentwig 1980; Nyffeler & Benz 1988). The removal and identification of prey captured in webs can reveal important ecological information about spiders relevant to agriculture. For example, the matrix web-weaver, Cryptachaea riparia ([Blackwall, 1834] =

Achaeranea riparia, Theridion saxatile) (Araneae: Theridiidae), demonstrated stenophagy in its natural habitat by capturing mainly apterous ants (88-92% of observed prey) (Nørgaard 1956;

Nyffeler & Benz 1988). However, in winter wheat fields, C. riparia showed polyphagic feeding behaviour by also capturing aphids and winged hymenopterans in close proportion to ants

(Nyffeler & Benz 1988). Although the analysis of web contents can provide valuable insights into beneficial predation (e.g. aphids), interference predation (e.g. parasitoid wasps), or prey- switching behaviour between habitats, this method cannot be applied to the significant portion of cursorial spider species (Nentwig 1986).

1.2.2 Discussion of detection methods

To determine the most feasible method for characterizing prey consumption in cursorial spiders, I reviewed and evaluated five methods that are used to detect prey consumption in spiders (Appendix I, Table I.1). The five methods were grouped into three categories. The observational analysis category featured visual observation, which has been the traditional method of characterizing spider predation (Nyffeler et al. 1994b). The category of protein analysis included the use of monoclonal antibodies (MCA). This was selected because it is the protein-based technique most frequently used for identifying the prey of spiders and is currently the method with the highest specificity. The DNA analysis category included three methods for evaluation: standard polymerase chain reaction (PCR), multiplex PCR, and next generation sequencing (NGS). NGS and multiplex PCR both use the standard PCR technique, but differ from the latter in methodology and are able to detect more than a single taxon. NGS was selected because this method is also able to reveal many consumed species simultaneously, but without the limitation of a priori knowledge of prey being detected (Pompanon et al. 2012). However, there is comparatively little literature using NGS to address the prey species of spiders. Standard

PCR was chosen because together they are the most frequently used out of all the methods for detecting prey consumed by spiders.

1.2.2a Observational analysis

In contrast to the web spiders discussed previously, cursorial spiders have no way to store prey and instead generally consume a considerable portion of the prey contents before discarding

7 a prey corpse (e.g. Pollard 1989). To directly identify the prey of cursorial spiders, the most frequently used method has been to observe predation in the field (Nyffeler et al. 1994b;

Nyffeler 1999). This requires the chance observation of either the moment of prey capture or the process of the spider consuming its prey. The rate of prey capture for cursorial spiders in agroecosystems has been estimated to be approximately one prey per spider per day (Nyffeler et al. 1994a; Nyffeler 2000). As a result, the chances of encountering and directly observing hunting spiders feeding in agroecosystems is low and only about 10% of diurnal hunting spiders are observed in the field with prey at a given time (Nyffeler et al. 1994b; Nyffeler & Sunderland

2003), even though spiders may consume a single prey item for several hours (Foelix 2011).

Visual observation is useful because it is a simple method that may reveal meaningful data about how spiders subdue prey, a feature unique to this method. An additional asset of this method is that it is non-destructive and does not necessarily remove spiders from the system.

Furthermore, this method requires little preparation time aside from selecting sampling locations.

However, because several weeks of observation may be needed to observe an adequate number of spiders in the field, the total time needed to obtain sufficient data could extend to a few months. A second pitfall is that this method is impractical for nocturnally-active spiders. Another limitation to observational methods is the identification of spider prey. It can be challenging to obtain taxonomically precise data, which may limit the impact and interpretation of findings significantly (Symondson 2002). This method requires a good knowledge of taxonomic identification to obtain meaningful findings about the diversity of prey. In general, direct observation of prey consumption in spiders is sporadic, time-consuming, and inefficient. In agroecosystems, this may be simplified by looking for specific prey items, e.g. pests or beneficials. However, a major obstacle to making these observations is the requirement that the

8 observer be in close proximity to the predation event. As observers manoeuver through the field, they may easily disturb spider feeding and skew the results (Symondson 2002). Overall, visual observation is a potentially informative method that is ultimately limited in potential by the observational skills, visual acuity, and taxonomical knowledge of the observer.

Today, molecular methods are used more often than direct observation to detect consumed prey (Symondson 2012).One of the distinct advantages to molecular methods is that they can selectively identify a pest or pest species complex by using species-specific probes. Compared to observational methods, the use of specific probes increases the efficiency in producing data on pest predation rates of spiders in fields. The biggest advantage of using molecular methods is the longer window of prey detection, which is significantly more than the duration of the actual predation event. For example, DNA may be detected up to 12 days post-consumption

(Kobayashi et al. 2011). In conclusion, the use of molecular methods is more efficient and practical for detecting consumed prey than making field observations to attain equivalent results

(Symondson 2002).

1.2.2b Protein analysis

A number of protein-based methods have been available for the better part of a century, but many, such as the precipitin test, have become obsolete (Dempster 1960; Symondson 2002). The most selective and sensitive protein-based methods applied today utilize monoclonal antibodies

(MCAs) (Symondson 2002). This technique uses monoclonal lines of mammalian lymphocytes to produce antibodies selective for a single prey antigen (e.g. Wegener 1998). The development of a novel MCA targeting a single prey species may require several months(Symondson 2012).

However, if antibody colonies for a target species already exist, then time and resources are significantly reduced because colony upkeep is inexpensive (Symondson 2002; Fournier et al.

2008). This is most likely to be the case for recurring pests in agroecosystems.

The benefits of this method are three-fold. The maximum detection duration for prey antigens in spiders may last up one week (Harwood et al. 2004, 2005), the assay is very sensitive and can detect protein amounts in the range of 1–10 ng, or about 10-5 animal equivalents (Greenstone et al. 2014), and the specificity of MCAs remains unparalleled. This method is unique in being taxonomically and/or ontogenetically selective, meaning MCAs can be used to detect not only broad or narrow taxonomic ranges of prey, but particular prey life stages as well (Symondson

2002; Fournier et al. 2008). Detection of stage-specific proteins makes it possible for this method to draw more detailed conclusions about spider feeding behaviour. For example, antibodies specific to egg proteins have been used to detect if predators, including spiders, have consumed either gravid females or eggs of the glassy-winged sharpshooter, Homalodisca vitripennis

(Hemiptera: Cicadellidae), a pest responsible for transmitting bacterial plant pathogens (Fournier et al. 2008). In conclusion, MCAs is a robust method for detecting prey consumed by spiders.

1.2.2c DNA analysis

DNA analysis has blossomed over the last decade as the most fruitful method of characterizing trophic interactions (Symondson 2012; Symondson & Harwood 2014). Success has partly stemmed from biodiversity initiatives, such as the Barcode of Life Data System

(BOLD), which document biological diversity through sequencing DNA regions of organisms, a process known as DNA barcoding (Ratnasingham & Hebert 2007). Central to DNA analysis has

10 been the application of PCR, a cyclic DNA amplification process that exponentially copies a targeted DNA region (Mullis & Faloona 1987). Regions amplified through PCR are called amplicons which are bound on either side by a forward and a reverse primer (Palumbi 1996).

Primers are strings of nucleotides that bind to specific DNA sequences to stimulate DNA replication of a specific target (Hoy 2013). Conservation rates of DNA sequences generally vary between organisms and genes, and the differences or similarities arising from mutations can be exploited during primer design to selectively amplify a taxon, whether a single species or an cluster of taxonomically-related individuals (Folmer et al. 1994; Zeale et al. 2011; Clare 2014).

Because DNA is ontogenetically stable, DNA analysis is unable to distinguish between life stages. Although DNA may be sexually selective, no efforts to date have been made to detect sex-specific DNA in predation assays.

Although a number of PCR offshoots now exist, most can be categorized as either standard

PCR (using only one primer pair) or multiplex PCR (≥2 primer pairs) (Hoy 2013). There are a few drawbacks to using standard PCR to identify the consumed prey of spiders. One is the assay duration because only one set of primers is used. To detect multiple prey requires each prey species to have a unique primer set and each spider sample must be assayed multiple times, at least once for each prey (e.g. Chapman et al. 2010). Assays can still be time-consuming and may take several weeks when screening large numbers of spiders even if a single prey species is targeted (Kobayashi et al. 2011). The only other significant limitation to PCR is the overall risk of error to the results. Errors in interpreting the results of DNA-based analyses may arise due to the occurrence of scavenging (rather than feeding on living target prey) (von Berg et al. 2012), secondary predation (target prey is consumed by a different predator that is in turn consumed by the spider being tested) (Sheppard et al. 2005; Hosseini et al. 2008), false negatives (Sint et al.

2011), or contamination during collection (King et al. 2012). In particular, scavenging and secondary predation are important potential sources of error in interpretation because they do not show evidence of directly consuming live prey, which is integral to pest control. Despite these drawbacks, at least one spider species may not scavenge whatsoever (see von Berg et al. 2012), false negatives may be reduced by retesting samples (Sint et al. 2011), and the effects of external contamination may be reduced by careful collection of spiders and the consistent use of negative controls (King et al. 2008).

An asset of standard PCR is the sensitivity of the method, with the detection of 10-7 animal equivalents possible (Greenstone et al. 2014). The method is also relatively simple to develop and apply. Online databases of DNA sequences provide a large pool of genetic data to guide primer design, allowing researchers to compare and contrast genetic codes in order to create taxon-specific or universal primers (Symondson 2002; Pompanon et al. 2012). The extent of and variation in taxonomic breadth amplified by universal primers have only recently been assessed and compared among different universal primer sets (Clarke et al. 2014). An important limitation is that broad universal primers are more likely to exclude derived individuals within the targeted taxa that have evolved DNA sequences that are differentiated enough at the primer-binding sites to preclude amplification. The size of the amplicon is also important because larger amplicons are typically degraded faster than smaller ones (Zaidi et al. 1999; Sint et al. 2011). Targeting small amplicons ranging between 100–350 bp, several studies have shown that the maximum detection durations for prey DNA in spiders may last up to 12 days(Ma et al. 2005; Hosseini et al. 2008; Monzó et al. 2010; Kobayashi et al. 2011). Overall, the level of specificity, long interval during which target DNA can be detected, and the low costs of PCR suggest it to be a feasible method for studying the prey of spiders.

Multiplex PCR follows the same protocol as standard PCR, but uses multiple primer pairs within a single reaction to screen predators for the consumption of multiple prey species belonging to different taxa. This approach can sacrifice some of the sensitivity compared to standard PCR since some amplicons may be preferentially amplified, potentially skewing the proportions of amplified products (Sint et al. 2012). The intricacies of coordinating several primer sets together may prove challenging during calibration, which detracts from the preparation time, total time, and simplicity of the method. However, once calibrated, multiplex systems provide an effective way to probe for multiple prey species. Two-step assays can be designed using multiplex PCR with an initial assay using taxonomically broad primers and a follow-up assay using secondary primer sets to identify the species of prey consumed (Sint et al.

2014). In general, multiplex PCR is a useful method for characterizing prey ingested by spiders.

Next generation sequencing (NGS) is the latest method stemming from PCR technology and a few different techniques already exist (Pompanon et al. 2012; Symondson 2012). This method uses universal or group-specific primers to amplify predator DNA in an initial PCR. The products are then cloned and sequenced to identify consumed prey species (Pompanon et al.

2012). This method is already changing approaches to molecular ecology. For example, scientists have had to create „molecular operational taxonomic units‟ (MOTUs) to account for unknown sequences of consumed prey DNA that are identified as species unique from sequences recorded by biodiversity-documenting initiatives like BOLD. Numerous MOTUs may appear in a single study making analyses more challenging and detracting from the simplicity of the method. In addition, NGS has the potential to detect hidden trophic relationships that infer indirect interactions, such as secondary or tertiary predation (Gómez-Polo et al. 2013), which increases the risk of error associated with this method. In the case of secondary or tertiary

13 predation, the method may detect the DNA of prey contained in the gut of an organism that has been consumed by the sample being tested. Because a large data set can be generated so quickly from NGS, more time is necessary to organize, handle, and interpret the findings. Overall, the application of NGS is as a means of characterizing the ingested prey of spiders is too complex and is beyond the scope of this thesis.

1.3 Molecular analysis of spider prey using PCR

1.3.1 Review of laboratory feeding assays

In total, I reviewed 39 studies that used PCR to detect and characterize prey consumption in spiders (Appendix II, Table II.1). In general, field studies were preceded by feeding assays conducted in the laboratory, which determined the molecular half-life of a target DNA sequence

(King et al. 2008). The molecular half-life of target DNA is defined as the point in time after prey ingestion at which prey DNA is detected in 50% of the assayed predators (Greenstone et al.

2014). The molecular half-life is a common element in molecular studies of trophic interactions and it is determined by conducting a molecular decay experiment. To quantify a molecular decay, spiders of a single species are each fed a single prey and are assayed at intervals after feeding for the presence of prey DNA (King et al. 2008). No less than 8–10 replicates per time point should be assayed to accommodate the many sources of error associated with predation, ingestion, and digestion (King et al. 2008).

Molecular decay experiments quantify the time during which the DNA of a particular prey can be detected from a particular predator under the specific conditions used in the laboratory.

This is important for interpreting field results because it sets a limit on the time since consumption of prey in which prey DNA is detected from predators. Furthermore, molecular half-lives can also be used to compare treatments when analyzing factors such as temperature

(Kobayashi et al. 2011) that may have an effect on detection. Here, an examination will be conducted on the results of 23 of the PCR studies in which a molecular half-life for a region of prey DNA in spiders was determined (Appendix II, Table II.2). The studies are compared and discussed in the context of a number of factors that affect the detection of prey DNA after ingestion, including spider species, prey species, number of prey consumed, duration of consumption, and duration of starvation prior to consumption. This review is intended to summarize what has already been accomplished and what major gaps exist in terms of characterizing prey consumption in spiders using PCR.

1.3.1a Feeding parameters

The first important factor to consider in prey detection is the predator, whose metabolic physiology determines how and at what rate prey DNA is digested. More closely related spider species may share similar physiologies (e.g. Mikulska 1970), and a handful of PCR studies have combined congeners in their assays assuming similarity in digestive physiology (Kuusk et al.

2008; Kuusk & Ekbom 2010; Kobayashi et al. 2011; Sint et al. 2011). Only seven spider families have been used to determine a molecular half-life (Figure 1.1), altogether representing only 6% of total spider family diversity (Platnick 2014). The most frequently used spiders for determining molecular half-lives of prey DNA have been wolf spiders (Lycosidae), which is a direct result of their regular occurrence and general abundance in agroecosystems (Ma et al.

2005; Kuusk et al. 2008; Kuusk & Ekbom 2010).

Other spider families that have been used more than once include money spiders

(Linyphiidae), long-jaw spiders (Tetragnathidae), and crab spiders (Thomisidae). These families represent the most common spider families inhabiting arable land (Young & Edwards 1990;

Nyffeler & Sunderland 2003). Further, four of the five most speciose spider families (Salticidae,

Linyphiidae, Araneidae, Theridiidae, and Lycosidae), according to Platnick (2014), are among the seven families that have been studied (Figure 1.1). The diversity of spider families for which molecular half-lives have been determined is an underrepresentation of the large number of families recorded in Canadian (23%) (Appendix III, Table III.1) and American agroecosystems

(<15%) (Young & Edwards 1990). In all of the studies of spiders used to determine molecular half-lives so far, none have demonstrated an incompatibility with the PCR technique and none have prevented the amplification of prey DNA.

4 Number of studies of Number

Spider families

Figure 1.1 – Number of laboratory studies using PCR to determine a molecular half-life for prey DNA consumed by spiders. Solid boxes are web-building families; stippled boxes are web-less hunting families.

In 18 of the 23 studies that determined a molecular half-life for prey DNA in spiders, just a single family of spiders was studied, although the family varied among studies. In five studies, molecular half-lives were compared between representatives from two spider families using a single prey species. Wolf spiders of the genus, Pardosa (Araneae: Lycosidae), were used in four of the studies. Although comparisons cannot be made between studies because different species of spider were used, within a study molecular half-life of prey DNA could be directly compared

(Table 1.1). The result in the study by Quan et al. (2011) was surprising because thomisids are thought to be sedentary and have shown reduced oxygen consumption rates relative to other spiders (Anderson 1996). It was hypothesized that this would result in reduced metabolic rates compared to wandering spiders, such as lycosids, and that prey DNA would persist longer than in spiders with higher metabolic rates. This suggests that the breakdown of DNA in the gut of the spider may occur at a rate independent of the oxygen consumption rate. Overall, the studies using multiple spider species from unrelated families demonstrated significant differences in the rate of breakdown of prey DNA as shown by the differences in molecular half-lives. However, because multiple species from each family of spiders were not compared, it is not possible to draw conclusions about trends in molecular half-lives across spider families.

Many studies provided incomplete information about the identities of the spiders used in molecular decay experiments. Taxonomy was always provided to at least to the family level, but reporting of the species, sex, and/or developmental stage of the spider was often incomplete.

Several studies only reported the species of the spiders used in their studies (Cassel-Lundhagen et al. 2009; Lundgren et al. 2009; Northam et al. 2011; Virant-Doberlet et al. 2011; Kerzicnik et al. 2012; Hagler & Blackmer 2013). Some studies reported neither sex nor stage, but instead

17 spiders were standardized in terms of either weight (Ma et al. 2005), length (Hosseini et al.

2008), or overall size (Kobayashi et al. 2011). The most frequent combination of sex and stage was adult females (Agustí et al. 2003; Sheppard et al. 2005; Kuusk & Ekbom 2010; Chapman et al. 2013). Juveniles were used in two instances, along (Greenstone & Shufran 2003) or with adults (Sint et al. 2011). The latter did not report if there was an effect of developmental stage on detection (Sint et al. 2011). With respect to sex, two studies assayed roughly equal proportions of adult males and females and both showed that sex produced no significant effect on detection

(Kuusk et al. 2008; Ekbom et al. 2014). Overall, findings indicate that prey DNA may be detected from all spiders and that sex has no apparent effect on detection.

Table 1.1 – Molecular half-life (T50) of prey DNA detected in two spider species using PCR. Amplicon Prey size (bp) Spider species 1 T50 Spider species 2 T50 Study (h) (h) Stenotus 246, 239a Pardosa agrarian 82 Tetragnatha spp.b 36 Kobayashi et al. (2011) rubrovittatus (Lycosidae) (Tetragnathidae) Plutella xylostella 275 Pardosa spp.c 72 Ebrechtella tricuspidata 36 Quan et al. (2011) (Thomisidae) Aphrodes makarovi 289 Pardosa amentata >120 Enoplognatha ovata 66 Virant-Doberlet et al. (Theridiidae) (2011) Aphrodes makarovi 348 P. amentata >120 E. ovata 73 Virant-Doberlet et al. (2011) Diuraphis noxia 227 Tetragnatha laboriosa 4 Pardosa sternalis 2 Kerzicnik et al. (2012) Sinella curviseta 180 Tennesseellum formicum 32 Glenognatha foxi 9. Chapman et al. (2013) (Linyphiidae) (Tetragnathidae) 5 a nested PCR b T. caudicula, T. extensa, T. maxillosa, and T. praedonia c P. astrigena, P. laura, and P. pseudoannulata

In determining a molecular half-life, it is commonplace to starve predators prior to consuming prey (King et al. 2008). Starvation is mainly used to ensure that predators have equal hunger levels and is assumed to facilitate processing of previously ingested DNA, thereby reducing the possibility of false positives. This is especially important in spiders since ingested prey remains may take days to digest. For example, in one study spiders contained detectable prey DNA for up

18 to 12 days after ingesting a single sorghum plant bug, Stenotus rubrovittatus (Hemiptera:

Miridae) (Kobayashi et al. 2011). This makes it clear that the starvation period needs to be adequate. In 43% of studies, spiders were starved for a period of ≥7 days. Less frequently, starvation lasted at least 14 days (Agustí et al. 2003; Sheppard et al. 2005; Traugott &

Symondson 2008; Kobayashi et al. 2011; Virant-Doberlet et al. 2011; Tian et al. 2012).

Another reason that the starvation period is an important consideration is that starved spiders show reduced metabolic rates (Anderson 1974). This suggests that anything ingested by starved spiders may be metabolized at a different rate compared to more recently satiated spiders

(Greenstone 1999). Indeed, based on the 23 molecular half-life studies (Appendix II, Table II.2) and ignoring other parameters (e.g. spider or prey species), a two-tailed t-test revealed that spiders that were starved for long periods of time (≥14 days) on average showed significantly longer molecular half-lives compared to spiders starved for short periods of time (<7 days) (n =

42, t = 3.3, df = 39, p = 0.0021). Despite this, no single study has yet made a comparison to see how the starvation period may affect target detection. In summary, starvation is an important parameter that may have an effect on detection, but has only been used as a means to reduce false positives.

Feeding duration is another important parameter because it limits the absolute amount of prey

DNA that can be ingested. Ingestion in spiders usually lasts several hours and prey remains begin breaking down within minutes of feeding as spider digestive enzymes are released into the lumen from secretory cells lining the midgut (Collatz 1987; Foelix 2011). Data on feeding duration is sparse, but one study on the web-spinning brown recluse spider, Loxosceles reclusa (Araneae:

Sicariidae), demonstrated that feeding duration generally lasted 3–10 h and also that there was

19 variation in terms of feeding duration between stages and sexes (Parks et al. 2006). Individual variation in feeding duration was also apparent considering one spider out of 56 consumed a single prey for nearly 24 h (Parks et al. 2006). Comparing the 12 of the 23 PCR half-life studies that reported the feeding duration of spiders, feeding durations ranged from as little as five minutes to as long as 3 h (Appendix II, Table II.2). The feeding duration had a significant impact on the molecular half-life of prey DNA (n = 20, χ² = 14.4, df = 1, p = 0.0001). Generally, spiders feeding for 2 or 3 h showed long molecular half-lives (>24 h) and spiders feeding for less than one hour showed relatively short molecular half-lives (<24 h). It remains unknown to what degree prolonged feeding (>3 h) affects the detection rates of prey DNA and similarly no laboratory experiments have compared the molecular half-lives of spiders feeding on prey for different durations.

In terms of taxonomic breadth, the prey used in feeding assays ranged considerably across studies with relatively little repetition of specific prey (Table 1.2). Generally, molecular studies of spider consumption focus on agricultural pests. Spider consumption of beneficials has also been investigated in a couple of studies (Li et al. 2011; Hagler & Blackmer 2013) as well as the consumption of alternative prey, such as Collembola (Agustí et al. 2003; Kuusk & Ekbom 2010;

Sint et al. 2011; Virant-Doberlet et al. 2011; Chapman et al. 2013). True bugs (Insecta:

Hemiptera) accounted for just over half of the total prey organisms that have been targeted using

PCR methods (Table 1.2). Considering pest hemipteran species alone, the taxonomic range extended over ten species from five families. In particular, aphids (Hemiptera: Aphididae) were used most frequently as prey with five species appearing in seven independent studies (two aphid species were targeted in a single study) (Greenstone & Shufran 2003; Sheppard et al. 2005;

Kuusk et al. 2008; Traugott & Symondson 2008; Li et al. 2011; Kerzicnik et al. 2012; von Berg

20 et al. 2012). Other pest organisms investigated more than once include the diamondback moth,

Plutella xylostella (Lepidoptera: Plutellidae), and the brown planthopper, Nilaparvata lugens

(Hemiptera: Delphacidae). Overall, the wide range of prey species that have been detected using

PCR confirms that this is a robust tool for detecting prey DNA consumed by spiders.

Table 1.2 – Prey organisms consumed by spiders in laboratory feeding studies and detected using PCR. Prey categorized into one of three roles in agroecosystems (pest, beneficial, or alternative prey). Sources are listed in Appendix II, Table II.1. Prey type/taxa Na Prey species targetedb Pests Hemiptera: 8 Rhopalosiphum maidis, R. padi (2), Sitobion avenae (3), Aphis Aphididae fabae, Diuraphis noxia Other Hemiptera 7 Stenotus rubrovittatus, Nilaparvata lugens (2), Laodelphax striatellus, Nephotettix bipunctatus, Bemisia tabaci, Lygus Hesperus Coleoptera 3 Meligethes aeneus, Diabrotica virgifera virgifera, Phyllotreta spp. Diptera 1 Ceratitis capitata Lepidoptera 4 Plutella xylostella (3), Chilo suppressalis Total 23 Beneficials Coleoptera 1 Collops vittatus Hemiptera 2 Cyrtorhinus lividipennis, Geocoris punctipes Hymenoptera 1 Lysiphlebus testaceipes Total 4 Alternative prey Collembola 3 Isotoma anglicana, Isotoma spp., Sinella curviseta Hemiptera 1 Aphrodes makarovi Orthoptera 1 Acheta domesticus Ephemeroptera 1 numerous; Order-specific Total 6 Grand total targets 33 a N = number of studies in which a prey taxon was targeted; totals in bold b parentheses indicate total number of studies if a prey was targeted in more than one study

The number of prey fed to spiders was one of the most consistent variables across studies. In most cases, spiders were fed just one prey item. It is important to standardize the number of prey within each study when determining a molecular half-life (King et al. 2008). This is because the molecular half-life of consumed prey DNA may be extended if more target prey is ingested (Ma

21 et al. 2005). In Ma et al. (2005), Lycosa wolf spiders (Araneae: Lycosidae) were fed either one or two fourth-instar larvae of the diamondback moth, P. xylostella. The interval during which a

275-bp region of nuclear P. xylostella DNA was detected was longer when spiders consumed two larvae. Although prey DNA was detected up to 120 h after ingestion in both treatments, prey

DNA was amplified from only 25% of spiders at this time point when just one larva was consumed. In stark contrast, all of the spiders consuming two larvae were positive 120 h after ingestion. When a single prey was consumed, the molecular half-life was estimated to be 96 h

(Ma et al. 2005). However, because all of the spiders consuming two prey were positive at all post-consumption time intervals, no decay of the amplicon was evident. Therefore, for spiders consuming two prey, no molecular half-life could be determined within the timeframe of the study, although it is understood to be greater than 120 h. In conclusion, these results demonstrated that the consumption of multiple target prey can significantly extend detection time.

The size of prey may also affect how much DNA is ingested, which in turn may affect detection rates. Generally for the 23 laboratory studies, prey sizes within each study were relatively standardized because usually only one prey species was investigated. Despite this, not one study compared the detection rates of DNA from individuals of the same prey species that differed significantly in size. However, two studies determined the molecular half-lives for the

DNA from multiple prey species that differed in size (Li et al. 2011; Hagler & Blackmer 2013).

In the more recent study, spiders from two closely-related families (Salticidae and Thomisidae) were combined for a feeding assay that used three different prey (Hagler & Blackmer 2013). The molecular half-lives for DNA detected from each of the prey ranged between 0–30 h for the three prey. One of the prey species, Bemisia tabaci (Hemiptera: Aleyrodidae), was detected in up to only 20% of the spiders at a given time. The consistently low level of detection was likely a

22 consequence of the small size of B. tabaci (~0.8 mm) relative to the other prey tested, which ranged up to 3 mm. It was not stated in this study if the feeding duration changed for each prey type and, moreover, prey were targeted using different primer sets that amplified different fragment sizes, altogether rendering any comparison between the prey types extremely challenging (Hagler & Blackmer 2013).

In the second study using multiple prey organisms, only one fragment size was targeted (650 bp) and, using a method called the ligase detection reaction, molecular probes specific to each prey were used to differentiate products amplified by PCR using universal primers (Li et al.

2011). Separate assays were used to detect the DNA of six prey species from individuals of the wolf spider, Pirata subpiraticus (Araneae: Lycosidae). From their results, I interpolated the molecular half-lives, which varied by prey and ranged 6–20 h. Although these were not tested for significant differences, the smallest prey organism, Sitobion avenae (Hemiptera: Aphididae), was about 2 mm and produced the shortest of the molecular half-life in spiders of 6 h. The largest prey, Chilo suppressalis (Lepidoptera: Crambidae) and Nephotettix bipunctatus (Hemiptera:

Cicadellidae), were about 5 mm and produced the longest half-lives of about 20 h. Similar to the former study, feeding duration for each prey was not reported, making it difficult to realistically compare results (Li et al. 2011). In summary, prey size appears to influence detection rates such that the DNA of larger prey can be detected for longer periods of time. However, it remains unclear if this is a result of the taxonomic difference between prey or of the biomass available for consumption.

1.3.1b Molecular parameters

Choice of DNA region, or the amplicon targeted for amplification, greatly influences the ability to detect prey DNA in the guts of predators. Before spiders were used in PCR gut-content analyses, insect predators were studied and it was with insects that two of the most important breakthroughs with respect to detecting prey DNA were discovered. First, at the outset of detecting consumed prey DNA using PCR, either random DNA fragments were amplified by random amplified polymorphic DNA (RAPD)-PCR or the DNA of nuclear genes were targeted

(Agustí et al. 1999, 2000; Zhang et al. 2007a). However, it was soon discovered that targeting multiple-copy genes, such as the mitochondrial cytochrome c oxidase subunit I (COI) gene, dramatically increased detection and prolonged the period during which the target DNA could be detected (Zaidi et al. 1999). This increase in detection is due to hundreds or thousands of copies of the mitochondrial genome present in each cell (King et al. 2008; Hoy 2013). Second, it was also shown early on that large amplicons, i.e. >800 bp, are unable to be amplified from insect predators, even if assayed immediately after prey consumption (Agustí et al. 1999, 2000; Zaidi et al. 1999). This lack of amplification happens because, once consumed, prey DNA molecules are constantly being degraded into smaller fragments from the activity of digestive enzymes (King et al. 2008). However, because spiders have lower metabolic rates compared to insects, the upper limits of amplicon size used to detect consumed prey DNA may be able to exceed 800 bp.

The size of amplicon detected in a PCR study of trophic interactions should be relatively small (100–300 bp) (King et al. 2008). Within these confines, only one study failed to determine a molecular half-life in spiders because of a lack of adequate amplification (Hagler & Blackmer

2013). As discussed in section 1.3.1a, amplification of the DNA of consumed B. tabaci failed to

24 exceed 20% in cursorial spiders. Although possibly a result of the small size of the prey, it could also be that the digestive enzymes of spiders were targeting a region inside the fragment (Hagler

& Blackmer 2013). Regardless, in the remaining studies I reviewed, prey DNA was detected in spiders for anywhere between a few hours to several days after ingestion (Appendix II, Table

II.2). Large amplicon sizes of 650 and 555 bp have been successfully amplified from the prey

DNA in spiders, resulting in molecular half-lives of 6–20 h using the former and at least 3 days using the latter (Li et al. 2011; Sint et al. 2011). Although no clear relationship between amplicon size and molecular half-life is evident, in studies that detected more than one amplicon size from the DNA of a single prey species, similar molecular half-lives were measured for all amplicons. In one case, two amplicon sizes that differed by about 200 bp, where one sequence was nested within the other, showed identical molecular half-lives in the spider, Pardosa cribata

(Monzó et al. 2010). This suggested that the amplicon size may not have necessarily had an effect on detection success, but that stochastic digestion may be the cause. Overall, it has been demonstrated that amplicon sizes of 100-650 bp can detect target prey DNA in PCR analyses of spider consumption.

The amount of predator DNA that is analyzed in a PCR may have a significant impact on the detection of target DNA (Palumbi 1996; King et al. 2008; Hoy 2013). In the studies reviewed, the amount of spider DNA added to PCR reactions ranged between 4–40% of the total reaction volume (Appendix II, Table II.2). Despite all but four studies reporting the volume of spider

DNA added, relatively few studies reported the concentration of spider DNA added to PCR reactions and so the quantity of spider DNA added was generally unknown. It is important to quantify the amount of predator DNA that is added to PCR reactions because too much DNA

25 may inhibit PCR (Hoy 2013). Of those reporting the concentrations of spider DNA, the range added to PCR reactions ranged between 40–500 ng (Ma et al. 2005; Hosseini et al. 2008; Quan et al. 2011; Hagler & Blackmer 2013). Therefore, using a volume of spider DNA within this range should not inhibit the PCR amplification of prey DNA.

Theoretically, as long as one molecule of target DNA is present, the appropriate PCR conditions should amplify DNA in an exponential manner. However, if the quantity of template

DNA is too low in a reaction, primers may bind together during the initial PCR cycles because of a low target DNA to primer ratio and effectively impede the total product from achieving its potential (Palumbi 1996; Hoy 2013). For the optimal amplification of desired products, 25–30 cycles is recommended by reagent manufacturers with a suggested extension to 40 cycles for low-copy targets (Promega Corp., 2012). From the spider predation studies I reviewed, the number of PCR cycles commonly ranged from 35 to 40 cycles (Appendix II, Table II.2), although some researchers used 45 or more (e.g. Chapman et al. 2013; Hagler & Blackmer 2013).

Generally, increasing the number of PCR cycles enhances detection because consumed prey

DNA is being continuously digested and the number of viable target copies is constantly decreasing (King et al. 2008). Based on the studies reviewed, between 35 and 50 PCR cycles should effectively amplify consumed prey DNA.

The final step in the PCR procedure may also influence detection in two ways. First, the method used to visualize PCR products may have a profound impact on prey DNA detection

(Sint et al. 2011). In their study, Sint et al. (2011) compared visualization methods by amplifying diluted target DNA and found that gels stained with ethidium bromide were the least sensitive.

Despite being used in most of the reviewed studies (68% of studies), ethidium bromide was only

26 able to detect 1/16th of the original DNA concentration. Instead, Sint et al. (2011) recommended using GelRed™ gel stain as a cheap, but highly sensitive alternative for the detection of amplified prey DNA since target DNA diluted to 1/128th of the original concentration could be visualized. Second is the volume of PCR product that is loaded into a gel for visualization.

Theoretically, if DNA is amplified in low quantities, using more volume for visualization should enhance detection. Only eight out of the 20 studies that used a visualization method specified the volume of product that was visualized (Appendix II, Table II.2). The values ranged 1–12 µL, which accounted for 2–48% of the total PCR reaction volume for each respective study.

Although entirely dependent on the amount of target DNA amplified, to be safe, a considerable portion of PCR product (≥3 µL or ≥20% of reaction volume) should be used to visualize prey

DNA, although technically as much product as possible could be used for visualization.

1.3.2 Summary of field studies with comparison to lab studies

I reviewed 32 field studies in which agroecosystem spiders were screened for the presence of consumed prey DNA using PCR (Appendix II, Table II.1). Generally, field studies applied the same PCR procedures that were developed for feeding assays. This section summarizes some of the different parameters that were used in field studies and comparisons are made to lab studies when applicable. To make the first comparison, the diversity of spiders assayed in field studies was considerably greater compared to the spider diversity in lab studies (see Figures 1.1 & 1.2).

Total diversity of spiders assayed in lab studies was low because generally a single spider species was selected to minimize variation whilst characterizing the molecular decay of prey

DNA using PCR. In contrast, field studies were generally driven by the intent of discovering

27 frequent predators of agroecosystem pests and most studies assayed every spider captured, regardless of species (Figure 1.3). In an effort to optimize the search for beneficial spiders, some field studies bottlenecked the diversity of spiders assayed to only the most commonly caught spiders and a few even honed their focus to just one spider species (Figure 1.3) (Ma et al. 2005;

Chapman et al. 2010; Monzó et al. 2010; Tian et al. 2012). Regarding the types of spiders assayed, hunting spiders were evaluated more frequently than web spiders and represented greater diversity (Figure 1.2). Similar to lab studies, wolf spiders (Lycosidae) were assayed the most frequently in field studies. In total, representatives from 20 spider families have been assayed in field studies.

5 Number studies of 0

Salticidae

Lycosidae Araneidae

Pisauridae

Mimetidae Zodariidae

Oxyopidae Dictynidae

Agelenidae

Theridiidae

Trachelidae

Thomisidae

Linyphiidae Clubionidae

Eutichuridae

Gnaphosidae

Amaurobiidae

Anyphaenidae

Philodromidae Tetragnathidae Spider family Figure 1.2 – Diversity of spiders collected from agroecosystems and screened for prey using PCR. Solid bars indicate web-building families; stippled bars are web-less cursorial hunter families.

Most field studies have been conducted in Europe (n = 12). Eight and five studies were conducted in North America and Asia, respectively (Figure 1.4). No Canadian studies have assessed prey consumption of field-collected spiders using PCR. Many field studies have been conducted in grain (n = 14) and brassica (n = 8) crops, while few have assessed spiders collected

28 from orchards (n = 4), meadows (n = 3), cotton (n = 2), or alfalfa (n = 1). Field margins often provide a significant source of spiders to agroecosystems (Dennis & Fry 1992; Kromp &

Steinberger 1992; Samu & Szinetár 2002). Despite this, only one study has assayed spiders collected from field margins (Virant-Doberlet et al. 2011). Overall, field studies have largely been concentrated on the spiders inhabiting crop fields.

10 a 15 b

10 5

studies of Number

0 0 1 2 3 >3 1 2 3 4 5 >5 Families screened Species screened

Figure 1.3 – Spider taxa collected in field studies to be assayed for prey DNA using PCR. Spiders at (a) the family level and (b) the species level.

studies of Number 0 Europe North Asia Australia Middle East America Region Figure 1.4 – Locations of studies investigating spider consumption in the field using PCR.

With respect to the detection of prey DNA, in only one instance was there no detection of prey DNA for all field spiders that were tested (Northam et al. 2011). Although the results from the feeding assay conducted by Northam et al. (2011) showed detection of a 206-bp region of mayfly DNA until 192 h after consumption, the lack of detection from the field spiders suggested that the spiders were not consuming mayflies in the field. Several studies have shown detection rates of prey DNA below ≤5% in spiders (Monzó et al. 2010; Kobayashi et al. 2011; Boreau de

Roincé et al. 2012; Opatovsky et al. 2012; Traugott et al. 2012; Chapman et al. 2013; Hagler &

Blackmer 2013; Hagler et al. 2013; Furlong et al. 2014). However, the majority of studies reported detection rates between 5% and 50%. Detection rates above ≥50% were reported in several studies as well (Ma et al. 2005; Zhang et al. 2007a; Birkhofer et al. 2008; Li et al. 2011;

Öberg et al. 2011; Kuusk & Ekbom 2012; Opatovsky et al. 2012; Tian et al. 2012; Chapman et al. 2013). Considering target DNA was detected in spiders from all but one study, it is clear that

PCR is a robust tool for detecting consumed prey DNA in field spiders.

Since so many laboratory studies are prequels to field studies, many of the prey that are targeted are the same. However, as in spider diversity, the diversity of target prey organisms in field studies exceeded that of lab studies (Table 1.3). Although studies conducted in the laboratory generally focus on one or two prey organisms, field studies offer the potential to probe for multiple prey species. Most of the targeted prey were pests, of which aphids again played a significant role as well as lepidopterans. Collembolans were also targeted relatively frequently by PCR assays, indicating a growing interest in the alternative prey of agroecosystems.

Table 1.3 – Prey organisms consumed by spiders in agroecosystems and detected using PCR. Prey categorized into one of three roles in agroecosystems (pest, beneficial, or alternative prey). Sources can be located in Appendix II, Table II.1. Prey type/taxa Na Prey species targetedb Pests Hemiptera: 10 Aphididae spp. (4), Diuraphis noxia, Rhopalosiphum padi (2), Aphididae Sitobion avenae (3) Other Hemiptera 9 Bemisia tabaci (2), Homalodisca vitripennis, Laodelphax striatellus, Lygus spp., Nephotettix bipunctatus, Nilaparvata lugens (2), Stenotus rubrovittatus Lepidoptera 10 Chilo suppressalis, Crocidolomia pavonana, Cydia pomonella, Grapholita molesta, Pieris rapae (2), Plutella xylostella (4) Coleoptera 4 Diabrotica virgifera (2), Meligethes aeneus, Phyllotreta spp. Diptera 3 Brachycera spp., Ceratitis capitata, Mayetiola destructor Hymenoptera 2 Dendrocerus carpenteri, Trimorus spp. Total 38 Beneficials Hemiptera 2 Cyrtorhinus lividipennis, Geocoris spp. Hymenoptera 2 Aphidius spp., Ephedrus plagiator Coleoptera 1 Collops vittatus Total 5 Alternative prey Collembola 8 Collembola spp.(5), Entomobrya multifasciata, Isotoma anglicana, Lepidocyrtus cyaneus Hemiptera 1 Aphrodes makarovi Total 9 Grand total targets 52 a N = number of studies in which a prey taxon was targeted; totals in bold b parentheses indicate total number of studies if a prey was targeted in more than one study

It is important for field studies to use a collecting technique that reduces error. Theoretically,

PCR will amplify target DNA if one copy is present; therefore, it is important to minimize contamination during collection. Two studies have investigated the compatibility of PCR with collecting samples using a vacuum sampler. So far, opinions are conflicting about whether or not vacuum- or suction-sampling is a source of error. Suction-sampling may generate error because it presents an opportunity for spiders to come into contact with and/or begin feeding on other collected organisms (Chapman et al. 2010; King et al. 2012). In one study, detection rates from hand-collected spiders were compared to those collected by vacuum (Chapman et al. 2010). If

31 contamination was occurring during collection with the suction sampler, a difference in detection rates would have been expected. However, no differences were observed, which suggested that collection by suction does not generate a significant source of error (Chapman et al. 2010). In a follow-up study, however, King et al. (2012) used a different approach of releasing starved spiders into winter wheat or its field margin and immediately recovering them using a suction device. Spiders, other invertebrates, and debris were retrieved during this process and collembolan DNA was amplified from 7 out of 19 retrieved individuals. This result suggested that ectopic contamination or active predation occurring during collection may have caused false positives (King et al. 2012). Therefore, it is important for collecting methods to minimize the contact between spiders and potential prey to reduce false positives produced by PCR.

Another significant source of false positives in the molecular detection of prey DNA from field spiders is scavenging. Currently, no method of trophic analysis can discriminate between the consumption of live or dead prey (Symondson 2002). Scavenging behaviour in spiders has only recently been explored using PCR in one study. In their study, von Berg et al. (2012) placed a complex of predators, which included spiders, into a mesocosm (50 cm diameter, 35 cm height) together with 100 dead R. padi and at least 70 live aphids of a second species, Sitobion avenae

(Hemiptera: Aphididae). Out of the 21 predators added, three were spiders from two species belonging to different families. After 48 h, live predators were recovered and assayed for the presence of DNA from either aphid species. Because the vast majority of predators were recovered from the mesocosms, it was suggested that the likelihood of detection occurring due to secondary predation in this experiment was negligible. Overall, the wolf spider, Trochosa ruricola, ate only live prey (viviphagy). In contrast, the ground-dwelling long-jawed spider,

Pachygnatha degeeri (Araneae: Tetragnathidae), previously thought to be strictly viviphagous,

32 consumed both live and dead prey (von Berg et al. 2012). Characterizing the scavenging behaviour of spiders provides insight into which spiders are strictly viviphagous and thus more likely to contribute to effective pest control. However, scavenging remains a largely unstudied facet of spider ecology and can only be studied in controlled experiments.

1.3.3 Research gaps considered in this thesis

Developing PCR techniques for studying predation in arthropods commenced just prior to the turn of the 21st century (Agustí et al. 1999; Zaidi et al. 1999). The use of PCR to characterize the detection of prey DNA in spiders was an effort initiated by Greenstone & Shufran (2003). The goal of this thesis is to use PCR to characterize recent consumption in a spider common to an agroecosystem. In the present study, a cursorial spider from the running crab spider family,

Philodromidae Thorell 1870, was selected for two reasons. First, no representative of the

Philodromidae has been used to determine a molecular half-life for prey DNA. Using this family works to expand both the total number and diversity of spider families examined. Second,

Philodromidae is the only family of cursorial spiders that has been found in every agroecosystem survey across Canada (Appendix III; Table III.1). The capture of these spiders throughout

Canada using all methods of sampling suggests that representatives of this family occupy diverse niches and are widespread. This study is also the first to study exclusively male spiders in the lab.

In the wild, adult male spiders tend to wander in search of females (Foelix 2011) and, as a result, may encounter a greater diversity of prey. Alternately, such activity may lead to higher metabolic rates, which may increase the rate of DNA digestion relative to that in females (King et al. 2008).

Spiders in their penultimate stage were selected because at this developmental stage, the

33 pedipalps have differentiated sufficiently to distinguish males from females.

With respect to feeding parameters, previous studies have not considered the feeding history of spiders prior to molecular decay assays other than the length of the starvation period immediately preceding the experiment. To address this gap, two groups of spiders were fed at different frequencies for several weeks prior to determine the rate of molecular decay to evaluate the possible effect of feeding history on detection. In addition, no previous studies have examined the effect of different feeding durations using the same prey. In the present study, the rates of molecular decay of prey DNA were compared for spiders that had consumed a single prey for either 2 or 6 h.

With respect to the number of prey consumed, a single previous study has compared the detection rates of prey DNA among Lycosa sp. spiders (Araneae: Lycosidae) consuming more than one of the same prey species. The prey used in this study were final instar larvae of the diamondback moth, which grow to a maximum of 11 mm in length. The consumption of two target prey extended the molecular half-life, although not enough time groups were used to accurately determine a molecular half-life (Ma et al. 2005). The present study is the first to examine the effects of consuming more than two prey over a 24 h period on molecular decay rates.

Small amplicons (100-300 bp) have been well characterized in spiders in terms of detection since prey consumption, but only two PCR studies have used DNA fragments exceeding 400 bp.

The longest fragment tested to date was 650 bp, which was used to assess the molecular decays of several prey species in wolf spiders (Li et al. 2011). This study used an advanced PCR

34 technique that amplifies prey DNA using universal primers and then probes product fragments for species-specific sequences. The study found that detection was related to prey mass with smaller prey associated with faster rates of molecular decay (Li et al. 2011). A second study targeted a shorter 555 bp target sequence using species-specific primers to detect cricket DNA in wolf spiders (Sint et al. 2011). In the present study, a small 167 bp fragment and a large 555 bp fragment were targeted using a relatively small prey of about 2–3 mm in length. Scavenging is a poorly understood foraging behaviour in spiders that requires characterization across more species. In the current study, tests were conducted to determine whether Tibellus is necrophagous or strictly viviphagous.

1.4 Objectives and choice of model organism

1.4.1 Research goal and objectives

The goals of this thesis were to use PCR to characterize recent prey consumption in a spider commonly occurring in agroecosystems and to determine some of the factors that affect the detection of target DNA. To address these goals, three main objectives and a number of research questions were posed. The first objective was to determine if PCR is able to detect the DNA of D. suzukii after being consumed by Tibellus. The second objective was to determine the molecular decay rate of D. suzukii DNA in Tibellus. The final objective was to apply an optimized PCR assay to Tibellus collected from the field. These objectives led to research questions, which in turn led to experiments that have been organized into three groups: calibration, optimization, and application.

Method calibration experiments - Which primers can amplify the DNA of D. suzukii? - What is the specificity of the selected primers? - What is the sensitivity of PCR using the selected primers? - Can the selected primers detect D. suzukii DNA from Tibellus extracts after consumption? - Can D. suzukii DNA be detected from the legs of Tibellus after consumption? - Can D. suzukii DNA be detected from Tibellus extracts after contacting D. suzukii?

Method optimization experiments - Is a preservative necessary for storing fed Tibellus, i.e. before DNA extraction? - Is thawing of Tibellus following storage a necessary step in DNA extraction? - What percentage of DNA is initially extracted from Tibellus? - How reproducible is the PCR result?

Application experiments - What is the molecular decay rate of a 543-bp region of D. suzukii DNA in Tibellus? - Do different 4-month feeding regimes affect the decay rate of D. suzukii DNA in Tibellus? - Does the consumption of multiple D. suzukii change the molecular decay rate? - Does prolonged exposure to dead prey affect the detection rates? - Can the methodology be used to detect predation by Tibellus in the field?

1.4.2 Choice of detection method

In selecting a method for characterizing recent prey consumption in spiders, it was important that prey could be identified to species and that spiders could be assayed for the presence of prey in a reasonable timeframe. For the purposes of this research, standard PCR was the most feasible and versatile method available. In determining which prey spiders consume, PCR provides versatility with regard to specificity since primers can be designed to target specific species or a

36 broad section of the animal kingdom. For spiders in agroecosystems, this has proved to be a robust method, although the time required increases significantly with the number of prey species to be detected. Standard PCR has high sensitivity, and previous studies have shown that it may be more sensitive than multiplex PCR (Traugott & Symondson 2008; Sint et al. 2014).

Based on these considerations, standard PCR appeared to be the most practical method for characterizing prey consumed by spiders.

1.4.3 Choice of model spider and prey

Choice of spider species

By preying on a variety of pest species, spiders provide an important ecological service to a variety of agriculture industries, including ornamental floriculture, agroforestry, and fruit and vegetable production. However, there is significant variation in hunting strategies employed by spiders (Pekár et al. 2011), which implies that there is also significant variation in the diversity of prey hunted by spiders. As discussed in section 1.2.1, the spectrum of prey may also change for a given spider species depending on location and local diversity of prey (Nyffeler & Benz

1988). To start, a model spider family with the potential for the biological control of pests was selected by reviewing surveys of spider diversity in 13 agroecosystems throughout Canada and applying criteria to select a model spider species for this study.

The foremost criterion for selecting a model spider was that it had not been previously studied to determine a molecular half-life of prey DNA using PCR. Only seven families of spider have been used to determine molecular half-lives of consumed prey DNA using PCR (Figure 1.1). A second criterion was that the spider had to be a cursorial spider. Out of 13 Canadian

37 agroecosystems surveyed since 1956, 56% of the total spider families have been hunting spiders

(Appendix III, Table III.1). Because of this, a third criterion was that the cursorial spider must belong to a family occurring in as many Canadian agroecosystems as possible. The running crab spiders (Family: Philodromidae) were the only family of cursorial spiders that had representatives collected from all 13 agroecosystems (Appendix III, Table III.1).

Philodromidae are foliar sit-and-wait foragers that pursue prey in close proximity with high rapidity (Bristowe 1958; Comstock 1980; Dalton 2011). Philodromids have never been used before to characterize the molecular half-life of prey DNA and have only been screened in a single field study (Boreau de Roincé et al. 2013). In several of the Canadian spider surveys, philodromids were among the three most abundant spider species collected, including two systems in southern Ontario (Dondale 1956; Putman 1967; Hagley 1974; Dondale et al. 1979;

Sackett et al. 2008; Larrivée & Buddle 2009).

Spiders of the genus, Tibellus Simon 1875 (Araneae: Philodromidae) (Figure 1.5), commonly occur in tall grasses (Dondale & Redner 1978; Comstock 1980) and was observed by Wegener

(1998) to be the dominant spider in a phytocoenosis of couch grass, Elymus repens (L.) Gould

(Poales: Poaceae). Tibellus has been collected from numerous habitats including agroecosystems across Canada and northern USA (Appendix IV, Table IV.1). Furthermore, Tibellus comprised an appreciable portion of the spider diversity (>0.1%) collected from a number of regions around the world (Appendix IV, Table IV.2).

Tibellus were readily collected from roadside grassy margins of corn and soybean crop fields in Wellington County, Ontario, Canada using sweep nets. Two species were present at our

38 collecting sites, although they did not always occur together. Tibellus maritimus (Menge 1875) and T. oblongus (Walckenaer, 1802) are the only two members of this genus that commonly reside in southern Ontario (Dondale & Redner 1978; Platnick 2014). A third species, T. asiaticus

Kulczynski 1908, is known to occur sporadically throughout the province, but is rare in southern

Ontario (Dondale & Redner 1978) and was never found at the collection sites. Tibellus were easily cultured in the laboratory and readily accepted prey. Because they met all of the criteria,

Tibellus spiders were selected as the model spider.

Choice of prey species Three criteria were applied to the selection of a prey species for Tibellus. First, the prey had to be of preferred prey size for Tibellus so that it would be easily accepted when provided to spiders.

Tibellus more frequently accepts flying insects that are <70% of Tibellus body size (Nentwig

1986; Nentwig & Wissel 1986). Second, the prey had to be easily reared in abundance for conducting feeding experiments in the laboratory. The final criterion was that the prey species be a pest in Canadian agroecosystems. The spotted-wing drosophila, Drosophila suzukii

(Matsumura 1931) (Diptera: Drosophilidae) (Figure 1.5), was selected because it fit the selection criteria. Drosophila suzukii is within the preferred prey size range of Tibellus, growing to a maximum of about 3.5 mm (Walsh et al. 2011). This is approximately half the size of mature male Tibellus, which grow to either 6 or 7 mm depending on the species (Dondale & Redner

1978). It is also relatively easy to rear D. suzukii in abundance in the laboratory with maturation occurring about 1–1½ weeks after eggs are laid (Lee et al. 2011). Finally, the importance of D. suzukii to agriculture is that this pest has dispersed and established throughout most of North

America and Europe (Hauser 2011; Ometto et al. 2013; Cini et al. 2014). Unlike other drosophilids, which oviposit on fallen fruit, D. suzukii females possess a serrated ovipositor that

39 they use to penetrate fresh or ripening fruit (Mitsui et al. 2006). Observation by Mitsui et al.

(2006) showed that this fly generally oviposited only single eggs in cherry and that the eggs were randomly distributed within the crop. D. suzukii may lay over 100 eggs in its lifetime (Lee et al.

2011), and if each egg is laid in its own fruit, crop loss may be devastating. As an example of the incredible impact these pests may have, D. suzukii has caused up to 80% yield losses in strawberry (Lee et al. 2011).

b a

Figure 1.5 – Frontal view of a penultimate male Tibellus sp. (a) (Photo: Tomascik) and dorsolateral view of a male Drosophila suzukii (b) (Photo: Hauser).

2. MATERIALS AND METHODS

2.1 General protocols

2.1.1 Collection and maintenance of spiders

During the summer and fall of 2013 and 2014, Tibellus spp. (Araneae: Philodromidae) were collected from roadside field margins in Wellington County, Ontario, Canada (Appendix V,

Table V.1). Collection sites consisted of phytocoenoses of couch grass, Elymus repens (L.)

Gould (Poales: Poaceae), that were adjacent to field crops including corn, soy, wheat, or leys.

Spiders were collected by sweep netting along 150–200 m transects and sweeping approximately

10–50 times through the vegetation encountered during 10–30 paces. Spiders were placed individually into either 12 mL Fisherbrand™ conical-bottom tubes (Fisher Scientific Inc.,

Ottawa, Canada) or 2 mL micro-centrifuge tubes (Fisher Scientific) to prevent cannibalism during transportation to the laboratory. Spiders were housed individually in Petri dishes (100 mm diameter x 25 mm depth; Fisher Scientific Inc.) that were lined with a paper towel triangle occupying approximately half of the dish. A saturated cotton swab (size: 2–3 cm, dry) was provided for hydration on the other half of the dish. Spiders were generally maintained under ambient laboratory conditions (22.6 °C; 20% RH). Photoperiods ranged between 16:8 L:D in summer and 10:14 L:D in winter. Tibellus collected during the fall of 2013 were kept in a temperature-controlled chamber at different conditions (17 °C; 12:12 L:D) until the end of

February 2014. Maintaining Tibellus at a low temperature slowed metabolism during rearing, but acclimation over a week at room temperature prior to experiments probably restored metabolic

41 rates (Anderson 1970). Spiders were fed 2–5 Drosophila adults approximately every two weeks and prey remains were removed if mouldy or after seven days. A handful of collected Tibellus were identified immediately if adults or after moulting to maturity in the laboratory. Tibellus were identified to species using the key provided by Dondale and Redner (1978).

2.1.2 Collection and rearing of Drosophila

Prey were mainly adult spotted-wing “drosophila” (SWD), Drosophila suzukii (Matsumura

1931) (Diptera: Drosophilidae). SWD were obtained from a laboratory colony established

September 2012 at the University of Guelph, Guelph, Ontario, Canada with individuals collected from an infested commercial raspberry and blackberry farm near Halton Hills, Ontario, Canada

(N43°34‟43‟‟; W79°57‟38‟‟). Occasionally, if SWD numbers were insufficient for either maintaining spiders or providing enough flies for feeding experiments, Drosophila melanogaster

Meigen 1830 was used as a substitute because of similarity in body size and overall genetic composition (Chiu et al. 2013). D. melanogaster were collected locally using banana-baited flask traps in our lab at the University of Guelph (N43°52‟94‟‟; W80°22‟71‟‟). SWD and D. melanogaster were reared separately, but in the same following manner. Drosophila experienced the same ambient laboratory conditions and photoperiods as spiders. Drosophila were reared in

100 x 25 mm plastic Petri dishes that were filled halfway with a dietary medium consisting of cornmeal (125 g), white sugar (200 g), nutritional yeast (70 g), agar (45 g), methyl paraben (3.3 g) dissolved in 95% ethanol (EtOH; 33.3 mL), and 1M propionic acid (17.7 mL) mixed in 2.8 L deionized water. This diet was both a suitable substrate for oviposition and a food source for both larvae and adults. A few adults of each sex were enclosed in Petri dishes to encourage

42 reproduction. After oviposition, Petri dishes were placed into Plexiglas® cages (26 x 26 x 26 cm) with mesh sleeves for transporting Petri dishes, replenishing the water supply, and removing adult flies. Petri dish lids were generally kept closed while larvae grew to prevent competition for food from all of the adult flies. After 7–10 days, Petri dish lids were opened to encourage the emerging adult progeny to disperse. New diets were added to the cage every 3–4 days. Once every one or two weeks some adults from each colony were isolated in Petri dishes with fresh diet to ensure propagation of the colonies. In addition, deionized water was misted into cages every 2–3 days. A 63 x 8 mm Petri dish lid packed with cotton that was saturated weekly and renewed biweekly was provided as a water source.

2.1.3 Feeding protocol

The following general protocol was used for feeding experiments. At least seven days before feeding experiments, all visible prey remains were removed and spiders were starved to facilitate the degradation of any residual DNA in their guts and promote feeding during experiments.

Penultimate male Tibellus were transferred individually into clean Petri dishes (100 x 25 mm) set up as described (section 2.1.1) to minimize the risk of spiders coming into contact with D. suzukii DNA. Throughout the feeding experiment, Tibellus were maintained at the ambient laboratory and photoperiod conditions already described (section 2.1.1). Water was added to cotton swabs either one day or immediately prior to feeding to ensure sufficient moisture in the

Petri dishes through the duration of feeding experiments. Adult male and female Drosophila flies were selected at random from colony cages using a pooter. Flies were introduced into Petri dishes by first isolating them in the pipette-tip chamber of a single-tube pooter (chamber capped

43 by mesh) and then blowing them under the lifted edge of the Petri dish lid. For experiments where Tibellus were fed multiple D. suzukii, flies were also added to Petri dishes without spiders to monitor background fly mortality. All Tibellus provided D. suzukii were given a fixed period of time for consumption. This “consumption period” was initiated either when a spider captured a fly or when D. suzukii was provided to the last spider in a feeding assay. After feeding, forceps were used to remove prey remains. The removal of prey marked the end of feeding and the start of the digestion period, represented by t, and at this time, t = 0. Spiders were frozen either immediately (i.e. at t = 0) or at specific time points following the consumption period. Only spiders that killed at least one fly were used in PCR assays. All spiders were frozen in their Petri dishes for 2–3 h at -20 °C. Prior to DNA extraction, frozen spiders were transferred to 2 mL micro-centrifuge tubes (hereafter “tubes”). When DNA was not extracted immediately, tubes were filled with enough 95% EtOH to submerge each spider (0.5–1 mL) and then were stored at

-20 °C to reduce the degradation of D. suzukii DNA within Tibellus. Some parameters varied among the experiments, which are summarized below in Table 2.1.

Table 2.1 – Spiders used in feeding experiments and screened using PCR for the consumption of Drosophila prey DNA. Experiment codes correspond to section numbers within the methods and materials. Experiment Spider Fed Unfed Starvation prior # prey Feeding Digestion duration(s)* code species spiders controls to feeding (days) provided duration prior to freezing (hours) (N) (hours) 2.2.4a Tibellus 6 2 7 1 226 0, 12, 24 Tetragnatha 1 1 11 1 2 0 2.3.1 Tibellus 32 n/a 1 4–6 0 2.3.2 Tibellus 9 32 1 5 0 2.3.4 Tibellus 5 32 1 5 0 2.4.1a Tibellus 57 6 7 1 2 0, 12, 24, 48, 72, 96, 120 2.4.1b Tibellus 40 5 14 1 6 0, 12, 24, 36, 48, 60 35 5 28 1 6 0, 12, 24, 36, 48, 60 2.4.2a Tibellus 8 7 5 24 120, 240 2.4.2b Tibellus 9 11 10 24 24, 48, 72, 96, 144 10 8, 2 10, 10 24, 24 24, 48, 72, 96, 144 2.4.3 Tibellus 9 7 15 24 0, 12, 72 10 14 10 24 0, 12, 72 10 14 15 24 0, 12, 72 Total 241 19 * in some experiments, multiple durations of digestion were tested

2.1.4 Molecular protocols

2.1.4a DNA extraction

Arthropod DNA was extracted using the DNeasy® Blood and Animal Tissue Kit (QIAGEN

Inc., Mississauga, Canada) according to the manufacturer‟s protocol with minor modifications.

Arthropods were handled one at a time in order to control contamination. First, 180 µL of Buffer

ATL and 20 µL of Proteinase K were added to new 2 mL tubes using micropipettes to prepare for lysis. For each tube, new micropipette tips were used to add reagents to minimize carryover contamination. After transferring Proteinase K, the micropipette tip was used to handle arthropods and transfer them from storage tubes to lysis tubes. Arthropods were handled quickly to minimize thawing. For Tibellus, the micropipette tip was used to first guide Tibellus onto a

Kimwipe (Kimberly-Clark Corp., Texas, USA) under a dissecting microscope to determine carapace width and/or length as well as to identify the species. The legs of cursorial spiders are generally thick compared to web spiders, and so legs were then removed from Tibellus using the micropipette tip to eliminate a significant proportion of spider tissue. This would theoretically increase the prey DNA to spider DNA ratio and enhance the detection of D. suzukii DNA in

Tibellus. Tibellus were then transferred to lysis tubes and the prosoma of each Tibellus was crushed using the micropipette tip. To detect carryover contamination, after every eighth arthropod, the next tube was designated as a negative extraction control (NEC) and consisted solely of reagents. After transferring each arthropod to a lysis tube, these were immediately capped and vortexed for 15 s. Arthropods were then lysed for 24 h in a shaking water bath incubating at 56 °C and were removed briefly 1–3 times throughout to be vortexed for 10 s.

Lysed arthropods were stored for up to 40 days at ambient laboratory temperature. To continue extracting DNA, tubes were vortexed for 15 s before and after pipetting into each tube

200 µL each of anhydrous EtOH and the second buffer, Buffer AL. After the final vortex, the contents of each tube were pipetted into provided DNeasy Mini spin columns that were nested in disposable 2 mL collection tubes (QIAGEN Inc.). Samples were centrifuged at 8000 rpm for 1 min using a Sorvall Legend Micro 17 Centrifuge (Fisher Scientific Inc.). The collection tube was discarded and spin columns were placed in new collection tubes. Buffer AW1 (500 µL) was added and spin columns were centrifuged for 1 min at 8000 rpm. The collection tube was replaced with a new collection tube once more and Buffer AW2 (500 µL) was added. Spin columns were centrifuged for 3 min at 17 000 rpm and the collection tube was discarded. This time, the collection tube was replaced with a sterile tube and the elution buffer, Buffer AE (200

µL), was added to spin columns. Tubes were incubated at room temperature for 1 min. To elute

DNA, spin columns were centrifuged for 1 min at 8000 rpm. To ensure DNA was properly extracted, the DNA concentration of a 2 µL subsample was quantified for each extraction using a

NanoDrop 2000 UV-Vis Spectrophotometer (Fisher Scientific Inc.). A concentration value of 10 ng·µL-1 was set as the benchmark for successful extractions of Tibellus and those showing concentrations below this cut-off were omitted from analysis. After determining DNA concentration, extracts were stored at -20 °C until PCR. Hereafter, unless otherwise stated, samples refer to DNA extracts assayed using PCR and a Tibellus sample refers to the extract of a

Tibellus that 1) has consumed D. suzukii.

2.1.4b PCR

PCR reagents and samples, i.e. DNA extractions, were thawed on ice. Micropipettes were used to add set volumes of reagents and sample DNA. Reaction volumes always totalled 25 µL.

Reagents for an entire PCR assay were combined beforehand in a tube and included 2X GoTaq®

Green Master Mix (12.5 µL) (Promega Corp., Madison, USA), nuclease-free water (hereafter

“NF water”; 9.5 µL) (QIAGEN Inc.), and 500 nM forward and reverse primer (1 µL each)

(Fisher Scientific Inc.). The concentration of primers in a PCR had been previously determined in a preliminary PCR assay (Appendix VI). Once combined, the reagents were vortexed briefly before being individually pipetted into sterile 0.2 mL PCR tubes (Fisher Scientific Inc.). The

DNA used in reactions from samples is called template DNA. Samples were vortexed briefly and

1 µL of template DNA was pipetted individual reaction tubes. The caps of PCR tubes were sealed after the addition of each sample to PCR tubes to minimize contamination.

To detect possible contamination, each PCR run included a negative PCR control (NPC), in which water replaced template DNA. To determine positive results, PCR runs included a sample reference of genomic D. suzukii DNA (2–18 ng), which served as a positive control (PC). The volume of template DNA added to PCRs to make positive controls was always standardized at 1

µL. Reaction tubes were centrifuged at <4000 rpm for 2–4 s to ensure all of the reaction components were combined at the bottom of the tube prior to PCR. If a sample was negative, it was rerun in a second PCR assay, but the volume of template DNA assayed was increased to 10

µL per sample. In this case, the volume of water added was reduced to 0.5 µL per sample.

PCR was conducted using a C1000TM Thermal Cycler (Bio-Rad Laboratories Inc.,

Mississauga, Canada). Up to 28 PCR tubes were placed into individual wells in a 48-well block.

The cycling conditions for PCR followed the protocol of the manufacturer of GoTaq® master mix. Here the conditions for the 543-bp PCR assay are described. PCR commenced by heating samples at 95 °C for two minutes to activate the enzyme necessary for DNA replication. This initial step was followed by 40 cycles of a denaturation phase at 95 °C for 30 s, an annealing phase at 50 °C for 30 s, and an extension phase at 72 °C for 60 s. Annealing temperatures varied among primer pairs and were calculated by subtracting 5 °C from the primer with the lowest melting point out of a pair of primers (listed in Table 2.2). To conclude PCR, a final extension step lasted 5 minutes. After PCR, reaction tubes were cooled to 4 °C until visualization.

Table 2.2 – Select mitochondrial cytochrome c oxidase subunit I (COI) gene primer pairs used for PCR. Namea Length Sequenceb (5‟-3‟) Annealing Full Source (bp) temperature amplicon used (°C) sizec (bp) Universal primers UnivF 30 AGATATTGGAACWTTATATTTTATTTTTGG 50/54 211 Zeale et al. 2011 UnivR 24 WACTAATCAATTWCCAAATCCTCC Zeale et al. 2011 Drosophila-specific primers 500F 20 CCAGCTGGAGGAGGAGATCC 50 543 Palumbi 1996 500R 23 CCAGTAAATAATGGGTATCAGTG Gleason et al. 1997 122F 22 TACCTGGATTYGGRATRATTTC 50-59d 167 Lewis et al. 2005 122R 23 GCTCGTGTATCAACGTCTATWCC Lewis et al. 2005 a names for this study, not names by original authors; „F‟ indicates forward primer while „R‟ indicates reverse primer b symbols according to IUPAC c according to D. yakuba COI gene, as in Gibson et al. (2011), and encompassing fragment and primers d first a PCR assay was conducted at estimated optimal annealing temperature (52 °C), which was followed by a temperature-gradient PCR from 50-52 °C and a second temperature-gradient PCR from 52-59 °C

2.1.4c Visualization

Gels for electrophoresis were prepared by heating 1 g agarose in 50 mL of 1X Tris-Acetate-

Ethylenediaminetetraacetic acid (TAE) buffer using a microwave for 70–75 seconds. After cooling a little, 5 µL of SYBR® Safe gel stain (10 000x concentrate in dimethyl sulfoxide;

Fisher Scientific Inc.) was pipetted into the mixture. The flask was swirled to mix the contents and then these were poured into an acrylic gel mould that was stoppered at each open side by pressurized rubber. Two combs were appended across the gel mould to create two rows of 15 wells each. Because the gel stain is light sensitive, the gel was set underneath one or more layers of tin foil used to block out as much light as possible. Gels were set for at least a half hour.

When ready to be loaded with PCR products, gels were placed into a Power Pac™ Basic horizontal electrophoresis system (Bio-Rad Laboratories Inc.) and submerged in 1X TAE buffer.

PCR products were stored on ice in a rack for PCR tubes. A minimum of one well per row consisted of a DNA ladder (2–5 µL; 100 bp or 1 kb; Fisher Scientific Inc.). The remaining wells were filled with the PCs, NPCs, NECs, and samples that made up the PCR run. For each sample,

5 µL of PCR product was pipetted directly into an individual well. Electrophoresis was run for about 30 min at 100V. DNA bands were visualized and photographed under UV using Quantity

One® 1-D analysis software version 4.1.1 (Bio-Rad Laboratories Inc.) in conjunction with a

USB camera (Bio-Rad Laboratories Inc.).

2.1.5 Statistical analysis

Means, standard error, and two-tailed t-tests were conducted using Microsoft® Excel version

14.0 (Microsoft Corp., Mississauga, Canada). Logistic regressions were used to analyze factors affecting the PCR detection of D. suzukii DNA consumed by Tibellus. These were conducted using a generalized linear model (GLM), the logit binary model (sensu Kuusk et al. 2008).

Statistical analyses were conducted using JMP® statistical software version 10.0.0 (SAS

Institute Inc., Toronto, Canada). The confidence level for significance was p ≤ 0.05.

2.2 Suitability of selected primers for detecting prey DNA

2.2.1 Validation of DNA detection using selected primers

2.2.1a Validation of universal primers for detecting arthropod DNA

This experiment was conducted to determine if the extraction process maintained the integrity of arthropod DNA so that it could be amplified by PCR. To ensure that the DNA of Tibellus and

D. suzukii could be amplified and detected, the first pair of primers used was a set of universals

(Table 2.2). The primers, UnivF and UnivR, had been designed by Zeale et al. (2011) to amplify a 211-bp fragment of the barcode region of the COI gene from the DNA of 10 insect orders and

1 arachnid order commonly occurring in the diets of bats. Considering these primers had been developed to detect insect and arachnid DNA, the assay was expected to detect the presence of

DNA from Tibellus and D. suzukii samples. In this experiment, the UnivF/R primers were used to detect the presence of DNA from two Tibellus samples (180 and 243 ng) and two D. suzukii samples (5 and 18 ng). DNA was extracted from the four arthropods as well as two NECs using the extraction protocol previously described (2.1.4a). PCR was used to assay samples as described in section 2.1.4b with the following exceptions. The annealing temperature was set to

54 °C, the extension step lasted 30 s, and only 35 PCR cycles were used. There were no positive

PCR controls because this was a validation experiment. Visualization followed the protocol described in section 2.1.4c.

2.2.1b Validation of primers for detecting Drosophila DNA

The purpose of these PCR assays was to amplify and detect DNA from the COI gene of D. suzukii samples using four primers (Table 2.2). Primers were selected from COI primers listed in a comprehensive review of dipteran primers which have been used to study the molecular ecology of fly families (Gibson et al. 2011). Three conditions were identified for selecting primers to detect Drosophila DNA: (1) primers amplify the COI gene because it is a high-copy gene, which increases the likelihood of DNA being detected once consumed by a predator (King et al. 2008); (2) primers be tailored to Drosophila; and (3) targetable amplicon sizes be larger than 100 bp and smaller than 600 bp. From the total of six primers that fit the conditions, four were selected to be used in PCR assays for the detection of D. suzukii DNA (Table 2.2). The primers were first configured such that one pair, 122F/R, targeted a small region (167 bp) nested within the relatively large region (543 bp) targeted by the second pair, 500F/R (Figure 2.1).

708 bp – barcoding region

Figure 2.1 – Amplicon sizes and 3‟ locations of binding sites for four Drosophila-specific primers (122F, 122R, 500F, and 500R) along the cytochrome c oxidase subunit I (COI) gene region. Numbers outside the gene diagram represent nucleotide position relative to the Drosophila yakuba genome; black blocks represent primer locations; arrows indicate the direction of transcription; mtDNA = mitochondrial DNA outside of COI region. Amplicon sizes depicted at bottom for the combinations 122F/R and 500F/R as well as for the COI barcoding region.

To determine if either primer pair could amplify appropriately-sized fragments of the D.

51 suzukii COI gene, the two Drosophila-specific primer pairs, 122F/R and 500F/R, were used in parallel PCR runs that assayed the same samples of D. suzukii tested previously (section 2.2.1a).

The PCR protocol described in section 2.2.1a was adopted for these assays with the exception of the annealing temperature, which varied by primer pair (Table 2.2). The first annealing temperature tested for the 122F/R primers was 52 °C, which was estimated as in section 2.1.4b.

The 122F/R primers were further used to assay D. suzukii samples in two additional PCR runs, which each tested a range of annealing temperatures. In the first additional assay, the 122F/R primers were used to amplify D. suzukii DNA at annealing temperatures ranging between 50 and

51.5 °C and the second assay used annealing temperatures ranging 52 to 59 °C. In addition to the current configurations of the Drosophila-specific primers, alternate primer combinations were also used to assay D. suzukii samples. The combinations, 500F/122R and 122F/500R, were expected to amplify products of 246 and 464 bp, respectively, from the Drosophila COI gene.

The PCR protocol for the alternate primer combinations was identical to that described in section

2.1.4b. Results were visualized using the protocol described in 2.1.4c.

2.2.2 Specificity of the 543-bp PCR assay

2.2.2a Selectivity of 500F and 500R primers in silico

To evaluate the selectivity of the 500F/R primers, the theoretical specificity of the 500F and

500R primers was probed by conducting an in silico search of the primer sequences in a COI database. The forward primer (500F) was originally modified by Palumbi (1996) to match the

DNA sequences of Drosophila (Gibson et al. 2011). Similarly, the reverse primer, 500R, had

52 been designed by Gleason et al. (1997) to study phylogenies of Drosophila species (Gibson et al.

2011). Each primer sequence was independently assessed for selectivity by accessing the

National Centre for Biotechnology Information (NCBI) COI database and searching the primer sequence using an updated version of the Basic Local Alignment Search Tool (BLAST),

BLASTN version 2.2.32 (Altschul et al. 1990, 1997). The NCBI database of COI sequences was accessed on 17 September 2015 and the alignment software located a maximum of 20 000 sequences from the COI database that significantly matched 500F or 500R. Significant matches were determined by the expect value (E), which is a parameter of BLAST that describes the number of hits “expected” to result by chance when searching a database of a given size. Smaller values reflect higher significance in matching primer sequences. Therefore, using a maximum threshold of E = 1, the top 1000 or so results of the most significant matches to each primer were compiled into a list and the top 100 from these are reported in Appendix VII. Results from the

BLAST searches for each primer were then combined to reveal taxa that possessed COI sequences with a high likelihood of amplification by PCR when using the 500F/R primers together.

2.2.2b Selectivity of 500F/R primers in vitro

To test the specificity of the 543-bp PCR assay in vitro, various arthropods were collected in the field and brought back to the lab. On 23 September 2014, a sweep net was used to collect arthropods from an E. repens-dominated roadside field margin adjacent to corn (N43°27‟39‟‟;

W80°16‟30‟‟). Arthropods were placed into individual tubes and totalled about 60 unique specimens (Appendix VII). Arthropods were maintained in tubes for up to 2 h during collection

53 and then euthanized using 1–1.5 mL of 95% EtOH. After handling each of the arthropods in this manner, two additional tubes were filled with 95% EtOH (2 mL) to detect possible sources of contamination (e.g. from handling). Samples were kept on ice until they were brought back to the lab. In the laboratory, samples were frozen at -20 °C. In addition to field-collected specimens, six arthropods were selected from those being reared in the lab to be assayed. Laboratory specimens that were assayed included one male and one female D. suzukii as well as one D. melanogaster, which were obtained from laboratory colonies of each species in the manner previously described (section 2.1.2); one house cricket, Acheta domesticus (Orthoptera: Gryllidae), which was obtained from a local pet store; and two Tibellus spp., starved for 14 days. The arthropods from the laboratory were isolated, placed in ethanol, and frozen in the same manner as the field- collected specimens. Samples were maintained at -20 °C until DNA extraction.

The protocol described in section 2.1.4a was used to extract DNA except that arthropods were not crushed. Between one and five legs were removed from most of the arthropods to be extracted. When possible, the rest of the body was retained intact for identification purposes.

Two field-collected arthropods underwent whole-body extractions, both lepidopteran larvae. It was assumed that the removal of legs would destroy the integrity of these specimens. In addition to these two arthropods, whole-body extractions were also conducted on the arthropods reared in the lab. PCR using the 543-bp PCR assay was performed on all samples as described in section

2.1.4b. For samples where only legs were used for DNA extraction, 10 µL of sample was used as template DNA for PCR. If no amplification occurred using the 500F/R primers for samples with low concentrations of DNA (<50 ng·µL-1), a second PCR was performed using the universal primer pair, which was used to confirm the presence of amplifiable DNA.

2.2.2c Selectivity of 500F/R primers against potential sources of contamination

To identify possible sources of contamination from the feeding assay and subsequent storage,

DNA extractions were conducted on two spider moults (extracted as one sample), a piece of cotton, and a piece of paper towel obtained from Petri dishes used to house Tibellus. To detect contamination from storage, 95% EtOH (1 µL; n = 1) and random subsamples of the ethanol used to store spiders (1 µL; n = 7) were also subject to DNA extraction. To detect contamination in the steps around the start of DNA extraction, unused pipette tips (n = 3) were also tested by washing their outsides with lysis reagents. DNA extractions and PCRs followed the protocols outlined in sections 2.1.4a and 2.1.4b, although samples of the ethanol used to store spiders were tested twice with PCR. The visualization protocol previously described was used (section 2.1.4c).

2.2.3 Sensitivity of the 543-bp PCR assay

In a non-replicated preliminary experiment, PCR using the 500F/R primers, or the 543-bp

PCR assay, was able to detect 0.05 pg of genomic D. suzukii DNA (4.93 ± 0.06 ng·μL-1) when diluted in water (Appendix VIII, Table VIII.1). A second treatment diluted D. suzukii DNA in the DNA extracted from starved Tibellus spiders to determine if predator DNA would compete with D. suzukii DNA as a substrate for primer binding sites and prevent amplification of D. suzukii DNA. The preliminary experiment showed detection at 0.05 pg of D. suzukii DNA when it had been diluted in the DNA of a starved Tibellus (16.7 ± 0.2 ng·μL-1) (Appendix VIII).

However, the DNA concentration of this Tibellus sample was very low and did not reflect the range of DNA extracted from Tibellus.

To determine the detection limit of the 543-bp amplicon of D. suzukii DNA, replicated dilutions of D. suzukii DNA (5–10 ng·µL-1) were made and assayed using the 543-bp PCR assay.

Serial dilutions (1:9) were made in 2 mL tubes using two treatments. Dilutions were made in either nuclease-free water or DNA extracted from Tibellus spiders (n = 18; mean DNA concentration = 73.1 ± 38.1 ng·μL-1). Dilutions were prepared by combining 10 µL of target

DNA (D. suzukii DNA) and 90 µL of diluent. Each dilution was vortexed for 2–5 seconds before proceeding to the next dilution step. From the undiluted D. suzukii sample (5–10 ng·µL-1 = 1 D. suzukii equivalent), six dilution steps were made so that the concentration of D. suzukii DNA at the final dilution step was 5–10 fg·µL-1 (10-6 D. suzukii equivalents). Each dilution step in each treatment was replicated 4–6 times. For statistical analysis, treatment and dilution step were tested separately using GLMs to determine factors that affected detection success. A t-test was conducted ad hoc to compare the proportions of samples testing positive at 0.5–1 pg D. suzukii

DNA (10-4 dilution step) between the treatments.

2.2.4 The detection of D. suzukii DNA in spiders

2.2.4a Post-consumption detection of D. suzukii DNA in whole-body extractions of Tibellus

To determine if the 543-bp PCR assay could detect D. suzukii DNA consumed by spiders,

DNA was extracted from spiders that had recently been fed. Tibellus were collected as described in 2.1.1, but reared in Ziploc® containers (125 mm length x 125 mm width x 50 mm height).

Paper towel was used to cover the bottom of containers and one or two rigid plant stems were provided as perches. Damp cotton swabs for moisture were placed in upturned vial lids (approx.

10 x 10 mm), which isolated moisture and discouraged mould growth. To initiate the feeding assay, spiders were provided two D. suzukii for 24 h, after which visible prey remains were removed using forceps. Following this, Tibellus were starved for one week prior to the experiment. For the feeding assay, D. suzukii fed to spiders were placed in a -20 °C freezer for two minutes in order to immobilize them and make it easy to manipulate them with forceps.

Each of six Tibellus spiders was offered a single prey via forceps (sensu Kobayashi et al. 2011).

All spiders accepted flies as prey immediately. Pairs of Tibellus were frozen after 2 h, 16 h, and

26 h of feeding. An additional pair of starved spiders was frozen at the same time as the first two spiders. These unfed spiders served as negative controls to test the selectivity of the 500F/R

Drosophila-specific primers, and to determine if one week of starvation was sufficient to empty

Tibellus guts of amplifiable target DNA.

Because of a lack of Tibellus used in the literature, there was no evidence to suggest whether or not Tibellus DNA would interfere with the PCR amplification of consumed DNA. However, spiders from the genus Tetragnatha Latreille 1804 (Araneae: Tetragnathidae) have been used in several PCR studies and do not inhibit the detection of prey DNA consumed by spiders (e.g.

Kobayashi et al. 2011; Kerzicnik et al. 2012). To confirm this, I applied the same protocol to two

Tetragnatha spiders. However, no effort was made to remove prey remains since Tetragnatha masticate their prey. Tetragnatha were starved for 11 d prior to the experiment. For the feeding assay, one Tetragnatha was offered a single D. suzukii by forceps and allowed to feed for 2 h.

The second spider was starved to serve as a negative control. Both spiders were frozen immediately following the 2 h feeding period.

DNA extractions of Tibellus and Tetragnatha were conducted as described in section 2.1.4a,

57 except that the spiders were frozen for 3 h. PCR followed the protocol outlined in section 2.1.4b with the exception that only 35 PCR cycles were used and the extension phase only lasted 30 s.

The visualization protocol used was described in section 2.1.4c.

2.2.4b Post-consumption detection of D. suzukii DNA from extractions of Tibellus legs

To determine if spider legs could contain or be contaminated with Drosophila DNA that could be amplified by PCR, DNA was extracted from the legs of nine spiders that had recently been fed. Tibellus were collected, housed, and maintained as described in section 2.1.1. Eight were fed using the protocol outlined in section 2.1.3 and given 2 h to consume a single D. suzukii.

The other spider physically contacted, but did not consume a D. suzukii. This spider and four of the spiders that consumed prey were frozen immediately. The remaining four spiders that had consumed D. suzukii were allowed to digest their prey for various durations following feeding

(one each at 12, 48, 96, and 120 h), after which these were also frozen. Before DNA extraction, between one and three legs was removed from each spider and both the spider and its legs had their DNA extracted following the protocol outlined in 2.1.4a except legs were never crushed.

PCR and visualization were conducted as described previously (sections 2.1.4b-c). DNA extracted from the spider bodies was used as positive controls to which the DNA extracted from legs could be directly compared.

2.2.4c Post-contact detection of D. suzukii DNA from whole-body extractions of Tibellus

To evaluate if spiders physically contacting target DNA was a source of error, DNA was extracted from spiders that had touched but not consumed D. suzukii. Eight Tibellus were collected, housed, and maintained as previously described (section 2.1.1). Forceps were used to smear a live D. suzukii onto the forelimbs and clypei of each spider. Besmeared Tibellus were given at least 2 h to groom and potentially ingest D. suzukii DNA. Spiders were halved and frozen either 12 h or 24 h after the devoted 2 h grooming period. Molecular methods followed the protocols previously described (section 2.1.4).

In addition, three spiders were used as sensitivity controls for D. suzukii DNA using the 543- bp PCR assay. Each had died during the course of feeding experiments. These spiders were included in this section because they may have physically contacted D. suzukii. The first spider perished before prey addition. It was agitated in a Petri dish with approximately 80 D. suzukii corpses for about 10 s. This sample was intended to be a positive control for D. suzukii contaminating the exterior of a Tibellus. The other two spider deaths may have resulted from moulting complications and these occurred after the addition of a live D. suzukii to each respective Petri dish. The two flies were left with spiders for 6 h and then were released. After the exposure to D. suzukii, all Tibellus were frozen at -20 °C. These Tibellus were treated the same as besmeared Tibellus with respect to the molecular methods.

2.3 Optimizing the post-consumption detection of D. suzukii DNA in Tibellus using PCR

2.3.1 Effect of Tibellus sample storage on the detection of consumed D. suzukii DNA

This experiment compared spider samples with or without ethanol preservative to determine the effect of ethanol storage on the detection of D. suzukii DNA using the 543-bp PCR assay.

Tibellus were captured, housed, and reared as previously described (section 2.1.1). The experiment was initiated by providing each Tibellus with one D. suzukii in the manner described in section 2.1.3. Those capturing the fly within 150 minutes (N = 32) were given 4–6 h to feed.

Three spiders served as controls and their DNA was extracted immediately. The remaining 29 spiders were frozen for 2 h and then transferred into tubes. Fourteen were suspended in 95%

EtOH, called the ethanol treatment and the other 15 received no preservative, called the free treatment. A single pair of forceps was used to guide spiders into tubes. To avoid crossover contamination, forceps were sterilized with 95% EtOH and flamed in between handling each sample. Three samples per treatment were stored at -20 °C for 1, 7, 14, 30, or 180 days prior to

DNA extraction. The ethanol treatment at 180 days had only two samples. All of the molecular methods followed the protocols described in section 2.1.4. The preservative treatment and duration of storage were tested using GLMs to determine their effects on the detection of consumed prey DNA using the 543-bp PCR assay.

2.3.2 Effect of thawing Tibellus on the detection of consumed D. suzukii DNA

To determine the effect of thawing spiders on the detection of consumed D. suzukii DNA using PCR, I compared spiders that were thawed to those left frozen until DNA extraction. Nine spiders were captured, housed, and reared as previously described (section 2.1.1). Each Tibellus was fed two D. suzukii for 24 h. Prey remains were then removed and Tibellus starved for 32 d.

After this, each Tibellus was provided one D. suzukii as described in section 2.1.3 except that spiders were frozen after 5 h of feeding. Tibellus were then preserved in 95% EtOH and stored at

-20 °C for 32 days. At the time of DNA extraction, spiders were split into two treatment groups.

Thawing of samples prior to DNA extraction was recommended by the manufacturer. Thus, four

Tibellus served as controls and were thawed for 0.5 h to make up the thawed treatment. The remaining five Tibellus made up the frozen treatment, and these remained frozen until immediately prior to extraction. Molecular methods used the protocols previously described in section 2.1.4.

2.3.3 Efficiency of extracting Tibellus DNA

The efficiency of the DNeasy® kit in extracting Tibellus DNA was investigated to determine the proportion of DNA extracted from a given sample. A secondary purpose of this experiment was to determine if the detection of consumed prey DNA would change over successive extractions. Tibellus were captured, housed, and reared as previously described (section 2.1.1).

Two Tibellus were starved 28 d and remained unfed. Four Tibellus were starved 14 d and then fed a single D. suzukii using the feeding protocol (section 2.1.3). Spiders provided prey were

61 given 6 h to feed. Two fed spiders were frozen immediately after prey consumption along with the two starved spiders. The remaining two spiders fed D. suzukii were frozen 12 h after consumption. After samples had been frozen for at least 2 h, DNA was extracted using the protocol described previously (section 2.1.4a). However, instead of discarding tubes containing the remains of spiders after lysis, new reagents were added to tubes and the process began anew.

Each sample was subject to two further extractions for a total of three extractions conducted on each sample. Each extraction involved two NECs and the lysis tubes used for these were recycled throughout all three extractions as well. Mean concentrations of DNA for each successive extraction were compared using t-tests to determine which extraction (i.e. first, second, or third) recovered the greatest amount of DNA. DNA concentrations for each successive extraction, as determined by spectrophotometric analysis, were combined for each sample to determine the total DNA extracted from each Tibellus. Samples of Tibellus were then assayed for each successive extraction using the 543-bp PCR assay to determine if successive

DNA extractions had an effect on the detection of consumed D. suzukii DNA. PCR was conducted as described in section 2.1.4b, except template DNA was standardized at 10 µL.

Visualization followed the protocol described in section 2.1.4c.

2.3.4 Replicability of the PCR result

The consistency of PCR in replicating the same result from a given sample was assessed by using the 543-bp PCR assay to detect D. suzukii DNA from replicates of Tibellus extracts. Two groups of Tibellus samples (N = 10) that tested positive in a preliminary experiment using the

543-bp PCR assay (Appendix IX) were replicated in further assays. Group A consisted of the

62 five Tibellus from the frozen treatment of a previous experiment (section 2.3.2). Group B consisted of five Tibellus treated the same as the thawed treatment from the same prior experiment, except samples were frozen for only 3 h instead of 32 days. The purpose of this alteration was to generate as much variation as possible in the strength of the detection signal of

D. suzukii DNA from group B samples. Results from the preliminary assay reflected this desire

(see Appendix IX, Figure IX.1), and motivated this experiment.

In this experiment, each of the samples from group B was assayed in quintuplicate in a single run of the 543-bp PCR assay. For comparison, group A samples were assayed in a second run of the 543-bp PCR assay, but in quadruplicate. A follow-up assay for group B samples used 10 µL of template DNA and was assayed this time in quadruplicate. The PCR protocol followed the protocol described in section 2.1.4b, visualization for each assay followed the protocol described in section 2.1.4c, and each PCR assay was run on its own gel. For statistical analysis, treatment

(frozen vs. thawed) and time spent frozen could not be isolated since values for both parameters alternated between the two groups. Instead, based on the consistency of D. suzukii DNA detection from samples in the preliminary assay, groups A and B were identified as being

„consistent‟ and „variable‟, respectively. Detection for the two groups was analyzed using a

GLM logit analysis to determine the effect of signal consistency on PCR replicability. It was expected that the increased variability in group B samples would reduce the replicability of the

PCR result compared to group A samples. For group B spiders, template volume was also analyzed using a GLM analysis to determine its effect on PCR replicability.

2.4 Application of the optimized PCR detection method to feeding and field experiments

2.4.1 The decay of a 543-bp region of D. suzukii DNA detected in Tibellus

2.4.1a The molecular decay of D. suzukii DNA in Tibellus after a 2 h consumption period

The molecular decay is the length of time following consumption that D. suzukii DNA can be detected from samples of Tibellus consuming a single D. suzukii using the 543-bp PCR assay.

This experiment was used to measure a molecular half-life for the detection of a 543-bp region of

D. suzukii DNA in Tibellus samples. This molecular decay experiment used 57 immature

Tibellus spiders of both sexes and various medium-to-late juvenile instars that had been otherwise captured, housed, and reared as previously described (section 2.1.1). Spiders were each fed using the protocol detailed in section 2.1.3 with the exception that spiders were fed by offering them a single adult D. suzukii using forceps. Each fed Tibellus was permitted a maximum of 2 h for consumption. After this duration, digestion time, or t, began. Eight fed

Tibellus were frozen immediately after consumption (t = 0) as controls in which minimal digestion occurred and from which D. suzukii DNA should be readily detected using PCR. After these spiders were frozen, the bodies of all D. suzukii flies were removed from the Petri dishes of all fed Tibellus using forceps.

The remaining fed spiders were randomly grouped into time groups, which were allowed to digest D. suzukii for either 12, 24, 48, 72, 96, or 120 h following the consumption of D. suzukii.

Each time group comprised of eight Tibellus except for the last time group, which consisted of nine Tibellus. DNA was extracted from Tibellus after 2 h freezing for Tibellus experiencing

64 digestion times up to and including the 48 h group. For Tibellus digesting D. suzukii for more than 48 h, spiders were guided into tubes after freezing and stored in 95% EtOH for 7 months at -

20°C before DNA extraction. In addition to spiders, three D. suzukii adults were selected to serve as positive controls for the PCR assay. These were also stored at -20 °C in 95% EtOH in tubes until DNA extraction. The DNA of all arthropods was extracted following the protocol outlined in section 2.1.4a. The 543-bp PCR assay described in section 2.1.4b was used to screen Tibellus samples for the presence of D. suzukii DNA. The visualization of PCR products followed the protocol previously described (section 2.1.4c). A binomial logit model was used to analyze the molecular decay and determine the molecular half-life of the 543-bp amplicon of D. suzukii

DNA in Tibellus. The absence or presence of D. suzukii DNA was the dependent variable. The digestion time was the independent variable.

2.4.1b Effect of feeding regime on the molecular decay of D. suzukii DNA in Tibellus

A second molecular decay experiment was designed to determine if the molecular half-life would be different between spiders maintained at different feeding frequencies for an extended period of time. About 110 Tibellus were split evenly into two treatment groups that were fed different regimes for four months. One group was fed every two weeks (2W) and the second every four weeks (4W). The feeding regime for both treatments was scheduled so that the feeding experiment fell on the day when both groups would normally be fed together. Thus, the

2W and 4W groups were starved for 14 and 28 days, respectively, prior to the start of the experiment. Ninety Tibellus were delivered a single D. suzukii using the feeding protocol already described (section 2.1.3). Feeding began when Tibellus captured the provided D. suzukii prey

65 and lasted for 6 h. Only Tibellus capturing prey within 180 minutes were used. Tibellus were checked every 15 minutes throughout the consumption period. Following this period (t = 0), flies were removed using forceps whether or not Tibellus had dropped their prey. Once flies were removed, six fed Tibellus from each feeding regime were frozen along with ten starved spiders

(five 2W individuals, three 4W individuals, and two non-regime Tibellus starved for 48 days), which served as unfed controls. The remaining spiders were arranged randomly into the time groups, which were given 12, 24, 36, 48, and 60 h to digest D. suzukii. Time groups consisted of

11-13 Tibellus individuals (5-7 Tibellus/regime/time group). Samples frozen for 2 h were transferred into tubes and preserved in 95% EtOH until DNA extraction. The molecular methods used were the protocols previously described (section 2.1.4).

The molecular decay of each treatment was statistically analyzed using the same model as the foregoing experiment, but with additional statistical tests. First, separate binomial logit analyses were used to determine if the either of the independent variables, species of Tibellus (T. maritimus or T. oblongus), stage of Tibellus (adult or juvenile), or regime treatment (TW or FW) had an effect on the duration of feeding. This was considered an important variable that could have an effect on the detection of D. suzukii DNA using PCR. It was important that neither the species nor stage of Tibellus had an effect on feeding duration, so that the regime treatment variable could be isolated for analyzing the effect of regime treatment on detection. Second, regime treatment was used as an independent variable in a binomial logit analysis to determine if it had an effect on the detection of D. suzukii DNA using PCR. The null hypothesis was that there would be no effect of regime treatment on the detection of D. suzukii DNA. Third, the variables feeding duration and digestion time were also assessed using binomial logit analyses to determine their effects on the detection of D. suzukii DNA. These analyses were conducted

66 individually for both regime treatments as well as all fed Tibellus. Lastly, regime treatment was tested using a binomial logit analysis to see if there was an effect on the detection of D. suzukii

DNA in unfed Tibellus. The detection results for the unfed Tibellus were also compared with the detection results from the unfed Tibellus of the first molecular decay experiment.

2.4.2 Effect of multiple prey on the detection of D. suzukii DNA in Tibellus

2.4.2a Effect of multiple prey on the detection of D. suzukii DNA in Tibellus

All experiments up to this point used a single fly to feed spiders. It was unknown how the consumption of multiple prey affected the detection rates of D. suzukii DNA in Tibellus samples.

Eight Tibellus of approximately uniform size and of mixed sexes and life stage, although mainly penultimate, were captured, housed, and reared as previously described (section 2.1.1). Tibellus were each provided five D. suzukii adults in the manner described in section 2.1.3. Five D. suzukii individuals were also added to each of five spider-less Petri dishes to determine the background mortality of D. suzukii. Flies were removed from Petri dishes after a consumption period of 24 h. Half of the Tibellus were frozen five days after feeding and the rest were frozen ten days after consumption. After 2 h freezing, Tibellus were transferred to tubes for DNA extraction. The molecular protocols described in section 2.1.4 were used. The volume of template DNA used in PCRs was 10 µL.

2.4.2b Effect of successive feeding bouts on the detection of D. suzukii DNA in Tibellus

Because the 543-bp PCR assay did not detect D. suzukii DNA in Tibellus samples from the previous experiment, the effect of multiple prey on detection was reassessed using digestion times shorter than 5 days. This experiment served a secondary function, which was to determine if successive feeding bouts of multiple flies would enhance detection. Twenty Tibellus were captured, housed, and reared as previously described (section 2.1.1). Tibellus were fed using the protocol described in section 2.1.3, except that spiders were not moved into new Petri dishes for successive feeding bouts and that ten D. suzukii were provided to each Tibellus. After a 24 h consumption period, flies were then counted and removed. Each feeding bout was accompanied by ten spider-less Petri dishes, each containing ten D. suzukii to determine background D. suzukii mortality. The first group of Tibellus was fed twice (F2). F2 Tibellus were starved eight days, fed once, starved for two further days, and then fed the second bout of D. suzukii. The second group of Tibellus was fed once (F1) and these were starved for the entire time up to the second feeding of F2 Tibellus (11 days), at which point the groups were fed in tandem. Two Tibellus from each group were frozen 24, 48, 72, 96, and 144 h after the tandem consumption period. The molecular protocols described in section 2.1.4 were used to extract spider DNA, assay samples using PCR, and visualize PCR products. The two groups were first analyzed separately using binomial logit analyses to determine if the independent variables, number of flies killed or digestion time significantly affected the detection of D. suzukii DNA from Tibellus samples. Data for the two groups were then merged and analyzed together using a binomial logit analysis to determine if either of a second feeding, the number of flies killed, or digestion time had a significant impact on PCR detection of D. suzukii DNA from Tibellus samples.

2.4.3 The detection of D. suzukii DNA in scavenging Tibellus

To determine if Tibellus scavenge or solely feed on live prey, a feeding experiment was designed to determine if Tibellus practiced this behaviour and if it would affect detection. Thirty

Tibellus were captured, housed, and maintained using the protocol in section 2.1.1. Tibellus were split into one group of ten and one group of twenty, both of which were fed using the feeding protocol previously described (section 2.1.3), except that Tibellus were each provided 10–15 D. suzukii. Group 1 had been last fed one Drosophila and were starved for seven days. The other two groups were last fed two Drosophila flies and starved for 14 days. Ten spider-less Petri dishes were also arranged with 10–15 flies each to determine the background mortality of D. suzukii. After a 24 h consumption period, two spiders from each group were frozen immediately

(t = 0) to serve as positive controls for detection. For the remaining spiders, immediately following the consumption period, half had all flies removed (control treatment) and the other half had only live flies removed (scavenging treatment). Two spiders per treatment per group were frozen 12 and 72 h after treatment. The molecular protocols described in section 2.1.4 were used to extract DNA from Tibellus, assay sample DNA, and visualize assay results. Number of flies killed, time of death, and scavenging were analyzed separately as independent variables using binomial logit analyses to determine their effects on the detection of D. suzukii DNA in

Tibellus samples. Results were first analyzed by starvation period and then altogether.

2.4.4 Screening field-collected Tibellus for prey DNA using the 543-bp PCR assay

To determine if target DNA could be detected from field-caught spiders, 26 Tibellus were collected using sweep nets from roadside field margins at five different sites in Wellington

County, Ontario on 10 October 2013 (Table 2.3). Tibellus were immediately placed in tubes, submerged in 95% EtOH, and stored on ice. Once brought back to the lab, spiders were stored at

-20 °C. Molecular protocols described in section 2.1.4 were used to extract Tibellus DNA, screen samples using the 543-bp PCR assay, and visualize PCR products. To maximize the possibility of detecting target DNA, 10 µL of template DNA was used in PCRs.

Table 2.3 – Field Tibellus collected using sweepnets in roadside field margins located in Wellington County, Ontario, Canada. Site Location # of Tibellus collected A N43°38‟15” W80°22‟53” 5 B N43°36‟08” W80°22‟58” 5 C N43°37‟10” W80°23‟44” 5 D N43°36‟45” W80°23‟38” 6 E N43°32‟42” W80°19‟17” 5

3. RESULTS AND DISCUSSION

3.1 Suitability of selected primers for detecting prey DNA

3.1.1 Validation of DNA detection using selected primers

3.1.1a Validation of universal primers for detecting arthropod DNA

To ensure that PCR could amplify DNA extracted from Tibellus and D. suzukii, two individuals of each arthropod were screened using universal primers in a PCR assay. The expected 211-bp region of COI DNA was amplified from all four samples. The results indicated that the assay could detect DNA when the amount added to a PCR was within the range of 5–243 ng. The results demonstrated that the integrity of arthropod DNA in samples had not been compromised by the methodology of DNA extraction. In contrast to samples, no amplification was detected from NPCs or NECs, indicating that the molecular protocols developed were satisfactory for the successful detection of DNA. The success of the universal primers in amplifying Tibellus and D. suzukii DNA motivated the investigation of Drosophila-specific primers to detect DNA from D. suzukii.

3.1.1b Validation of primers for detecting Drosophila DNA

Four combinations of primers selected to detect Drosophila DNA were assayed with PCR to identify a pair of primers that could reliably amplify D. suzukii DNA. The results from the first

71 assay showed detection of the expected 543-bp amplicon amplified from genomic D. suzukii

DNA using the 500F/R primers. In contrast, the 122F/R primers were unable to amplify the expected 167-bp amplicon in the parallel PCR run. For the 122F/R primers, the annealing temperature of 52 °C was estimated to be optimal for DNA amplification (see section 2.1.4b).

However, the 167-bp band of D. suzukii DNA was not detected, implying that 52 °C was not conducive to the amplification of D. suzukii DNA using this primer pair. A range of annealing temperatures was tested (50–59 °C) and a constant lack of PCR amplification of D. suzukii DNA from additional assays using the 122F/R primers suggested that DNA amplification was ineffective. In addition to retesting the estimated optimal annealing temperature (52 °C), the additional assays also tested the annealing temperature of 50 °C used in the original study by

Lewis et al. (2005).

Visualization of PCR products from the 122F/R assays revealed the detection of DNA bands that were significantly smaller than the 167-bp target. At <100 bp, these were likely primer- dimer artefacts, which are low weight molecules that result when primers bind together during

PCR and DNA polymerase amplifies a sequence from the 3‟ of one primer to the 5‟ of the second (Hoy 2013). The production of primer-dimers is detrimental to an assay as it depletes the number of primers available to amplify DNA and limits the potential number of copies amplified.

Primer-dimer formation is largely the result of reagent imbalance in the reaction (Hoy 2013), suggesting either the primer concentration was too high or the amount of template DNA supplied was insufficient. However, the detection of the 543-bp amplicon of D. suzukii DNA as well as similarly-sized smaller bands (<100 bp) using the 543-bp PCR assay indicated that the lack of amplification resulting from the 122F/R primers was likely unrelated to reagent imbalance.

Alternate theories to explain the lack of amplification using 122F/R could be that the primers

72 have a strong affinity for each other or that mutations at the primer binding sites preclude annealing and therefore amplification.

To confirm that 122F/R primers could bind to Drosophila DNA, each direction of primer was combined with the complementary direction of 500F/R primers. Strong bands were detected near the expected product sizes of 246 bp (500F/122R) and 464 bp (122F/500R), indicating that there were no or negligible mutations at the primer binding sites. This demonstrated that all of the primers used to detect Drosophila DNA can bind to the D. suzukii COI gene and facilitate DNA amplification, albeit not in every combination. In light of these results, because DNA could not be amplified from samples of D. suzukii using the 122F/R primers, further analysis using this primer pair was abandoned and the 500F/R primers were selected to be used exclusively to detect consumed prey DNA in all following PCR assays.

3.1.2 Specificity of the 543-bp PCR assay

3.1.2a Selectivity of 500F and 500R primers in silico

The in silico test of primer specificity revealed a total of 581 unique organisms with high sequence alignment to at least one of the primers. The top 100 matches to each primer are listed in Appendix VII. Some matches listed for 500F and 500R showed significance in terms of E- values (E < 1), which suggested a low likelihood that these matches in particular resulted by chance. However, the full range of E-values was 0.17–646 (500F) and 0.006–327 (500R), implying that some of the other matches may have resulted by chance. The ranges of E-values indicated variation in alignment for each primer as well as between the primers.

Of the organisms that significantly matched the 500F sequence, all showed a relatively moderate E-value of 0.17. Out of the top 1031 hits for the 500F primer, there were significant matches to at least 303 unique organisms, spanning 3 kingdoms and 9 phyla (Appendix VII).

Altogether, 500F matched COI sequences of organisms from diverse evolutionary nodes that ranged from cyanobacteria to mammals. Overall, arthropods totalled 828 hits and at least 269 unique organisms. The most diverse orders having COI sequences with high alignment to 500F were the insect orders, Lepidoptera (146 organisms; 432 hits), Coleoptera (53; 234), and Diptera

(49; 102). Interestingly, although modified to align to Drosophila sequences (Palumbi 1996), the

BLAST results for 500F did not reveal any significant matches to individuals from this genus.

Spiders also showed a high number of matches to 500F (153 hits), although these only included

17 species from 9 families (Ctenizidae, Gnaphosidae, Linyphiidae, Liphistiidae, Lycosidae,

Pisauridae, Salticidae, Theridiidae, and Thomisidae). Closely related to spiders, three spider mites (Arachnida: Acari) also showed significant alignment to 500F.

In contrast, the 500R primer was more specific than 500F. The most significant matches for

500R had an E-value of 0.006, which was lower than any of the matches to 500F. The other E- values for the top 500R results ranged from 0.022–0.34. Overall, this indicated a moderate-to- high probability of amplifying DNA from individuals that matched 500R. Out of 1132 BLAST results for 500R, the only taxa that showed significant alignment were three invertebrate phyla

(Appendix VII). All but two species were arthropods and all of the arthropod matches were insects. The main orders in terms of number of unique organisms were Lepidoptera (130 organisms; 489 hits) and Diptera (92; 535). Some other important orders were Coleoptera (17;

31), Hymenoptera (13; 47), and Hemiptera (12; 18). As well, eight other insect orders included at least one representative with a COI sequence significantly matching the 500R sequence. Neither

74 spider nor any other arachnid DNA was listed as a significant match to 500R. This suggested a low likelihood that arachnid DNA would be amplified through PCR if 500F and 500R were used in conjunction. Overall, 500R was selective for insect DNA and seemed exclusive to most other organisms.

In general, a wide variety of organisms aligned to the DNA sequence of least one of the primers. These findings showed that 500F is less selective than 500R in terms of the taxonomic breadth of in silico matches. Considered separately, the primers each matched a wide range of organisms, but used in combination, they should have significantly greater specificity.

Importantly, the use of the 500R primer should preclude amplification of the 543-bp target band from the DNA of spiders, i.e. Tibellus. The specificity was expected to be relatively narrow because there was no apparent overlap between the primers; no single organism was listed for matching both primers. The closest level of overlap was achieved in six insect genera that each contained more than one representative and both primer sequences were matched by at least one representative. These were identified as high-risk taxa in which an appropriately-sized amplicon was likely detected using the 543-bp PCR assay. The presence of high-risk taxa such as these suggests that caution may be necessary in interpreting PCR results from field-collected spiders, particularly because of the polyphagous nature of most spiders. In summary, although neither primer demonstrated selectivity to only Drosophila or Drosophilidae by in silico evaluation, these same analyses suggest the 500F/R primers should prevent Tibellus DNA from being amplified in laboratory experiments.

3.1.2b Selectivity of 500F/R primers in vitro

A total of 61 field-collected arthropods were assayed using the 543-bp PCR assay to determine the selectivity of the 500F/R primer set (Appendix VII). An amplicon near 543 bp was detected from Drosophila melanogaster and D. suzukii samples (all 3 positive) as well as 11 non- drosophilid samples. Among the 11 non-drosophilids, detection of target DNA was inconsistent within taxa. Testing positive were two of six coleopteran samples, four out of twelve non- drosophilid dipterans, three out of seven hemipterans, one of two lepidopterans, and the only orthopteran tested. Since the 543-bp amplicon was detected from the DNA of insects other than

Drosophila, it is clear the 500F/R primers are not selective to Drosophila spp.

For five samples – all the coleopterans and hemipterans which tested positive – the signal strength of the 543-bp amplicon detected was weak. Although usually indicative of low levels of template DNA, this was ruled out because the amount of template DNA used from these samples

(22–43 ng) was at least four times the amount of template used from a D. suzukii sample that previously tested positive using the 543-bp PCR assay (see section 3.1.1b). Instead, low levels of detection resulting from these samples could have arisen from low primer affinity at primer binding sites. Primer affinity is affected by differences in the DNA sequence along a binding site and enough mismatches result in mispriming, where primers do not bind to DNA (Hoy 2013). It is possible that the sequences of the five samples retained enough alignment for the primers to bind, but also enough mutations to prevent the primers from binding productively. This hindered the amplification of DNA, reducing the overall output of amplified DNA.

An alternative explanation is that these five samples with weak signals had been contaminated

76 during collection. All of the field arthropods had been collected together in a sweep net. It is possible during collection that the integuments of relatively soft-bodied insects may have ruptured from the actions of the sweep net and subsequently contaminated other arthropods as they were moved inside of the net. To detect false positives, two 95% EtOH controls were prepared immediately following collection. These controls (18.3 and 23 ng·µL-1) showed at least four times the concentration of DNA compared to all other ethanol samples (n = 8; range = 0–4.5 ng·µL-1) (see section 3.1.2c). Although both EtOH control samples from the field did not generate bands using the 543-bp PCR assay, the relatively high amount of DNA extracted still indicated the possibility that contamination was a source of false positives.

Non-target amplification occurred in relatively few samples and was inconsistent across taxa.

For example, the DNA from only one of two samples of pseudoscorpion (Arachnida:

Pseudoscorpiones) produced a pair amplicons. Neither corresponded to the 543 bp target– a strong 800-bp band was detected as well as a shorter, weaker band at about 450 bp. Non-target amplification occurred in six other samples. All bands were larger than the expected PCR product size ranging between 800–900 bp and were detected from samples of Harmonia axyridis

(Coleoptera: Coccinellidae), Pieris brassicae (Lepidoptera: Pieridae), Mecaphesa sp. (Araneae:

Thomisidae), and an unknown juvenile spider in addition to the pseudoscorpion. Non-target bands smaller than the target DNA were closer, at about 400–500 bp. Besides pseudoscorpion

DNA, small bands were also detected from samples of a damsel bug (Hemiptera: Nabidae) which tested positive for the 543-bp target as well and an unidentified species of weevil

(Coleoptera: Curculionidae).

The 543-bp PCR assay was unable to detect target DNA from any samples belonging to the

77 other assayed orders, including the only dermapteran, the only psocopteran, all seven hymenopterans, the only spider mite, and both pseudoscorpions. The distitarsi of 20 spiders belonging to 17 spider genera in 8 families were also negative for the 543-bp DNA band. Most of the samples that generated negative results with the 500F/R primers (n = 40) were rerun using the universal primers to determine whether amplifiable DNA was present. Ten spider samples were omitted from this second assay because a significant amount of DNA had been recovered from the extraction process (≥42 ng·µL-1), and therefore there was no doubt that DNA extraction was successful for these samples. Twenty-two of the rerun samples produced the expected 211- bp amplicon (Appendix VII), demonstrating that the DNA extractions had been successful. The inability of UnivF/R primers to amplify DNA from the remaining 18 samples may have been the consequence of incomplete taxonomic coverage by these primers (Clarke et al. 2014). An alternate explanation is that the lack of DNA amplification resulted from a failure to extract a sufficient quantity of amplifiable DNA. However, this alternate hypothesis was not supported because the sample recovering the lowest concentration of DNA (14.7 ng·µL-1) generated a positive result when assayed with the universal primers.

Overlap between in silico and in vitro tests was minimal at the species level. Only one sample generated positive results from both in vitro and in silico tests. The cabbage butterfly, Pieris brassicae (Lepidoptera: Pieridae), tested positive in the PCR assay and was listed as a match to the sequence of the 500F primer in a BLAST search (Appendix VII). In addition, some of the samples with positive results in the PCR assay belonged to families listed in the BLAST search, suggesting overlap at the family level.

The lack of amplification from spider samples demonstrated that the use of 500F/R primers to

78 detect D. suzukii DNA consumed by spiders is feasible. However, the PCR results and the results from in silico testing demonstrated that applying the 543-bp PCR assay to spiders collected in the field is not sufficiently specific to determine prey identity. Further modification to the method is required in determining the identity of prey consumed by field-collected spiders.

Despite this, there was ample evidence that the specificity of the 500F/R primers is sufficient enough to prevent the amplification of spider DNA. This finding suggested that the 543-bp PCR assay would be compatible with feeding assays using D. suzukii and Tibellus.

3.1.2c Selectivity of 500F/R primers against potential sources of contamination

To detect potential sources of contamination that could compromise the integrity of the assay,

DNA was extracted from a number of laboratory items that came into contact with Tibellus during a feeding assay. For 16 out of the 17 samples, the average concentration of DNA extracted was relatively low at 1.4 ± 1.0 ng·µL-1. The low concentrations of DNA extracted from these samples suggested minimal amounts of contamination. The remaining sample was the extraction of a piece of paper towel from a Petri dish used in a feeding assay. The DNA extracted from a paper towel had a relatively high concentration of about 10 ng·µL-1. Despite this high concentration of DNA, the only sample from which DNA was detected using the 543-bp PCR assay was an ethanol sample. This sample was a subsample of the ethanol used to store a Tibellus for one day. This Tibellus had consumed D. suzukii for 2 h and it is possible that the outside of the spider had contacted the fly. Once submerged in ethanol, fly DNA may have washed off into the ethanol. Retesting the same sample showed no detectable DNA. Generally, the results indicated that contamination within the laboratory was not a major concern.

In addition to the samples prepared in section 2.2.3c, NECs were also prepared for every batch of DNA extractions in order to detect potential carryover contamination. A total of 81

NECs were assayed using the 543-bp PCR assay. The low levels of DNA extracted from NECs

(1.4 ± 1 ng·µL-1) combined with the failure to amplify target DNA demonstrated that carryover contamination during the DNA extraction process was negligible.

3.1.3 Sensitivity of the 543-bp PCR assay

After showing 5–18 ng D. suzukii DNA could be amplified and detected using the 500F/R primers (section 3.1.1b), the minimum amount of D. suzukii DNA detectable using the 543-bp

PCR assay was determined. Dilutions of a sample of genomic D. suzukii DNA (5 fg – 10 ng) were made in either water or competing Tibellus DNA (Table 3.1). The minimum amount of D. suzukii DNA detected using the 543-bp PCR assay was 50–100 fg, which was achieved in both dilution treatments. As expected, statistical results showed that dilution step had a significant effect on the detection of D. suzukii DNA (χ² = 49.9, df = 1, p < 0.0001). The assay reliably detected target DNA from all replicates diluted to 10-3 D. suzukii equivalents (5–10 pg) (Table

3.1). When diluted one order of magnitude further (0.5–1 pg), detection became inconsistent, indicating that the limit of detecting D. suzukii DNA had been reached for the 543-bp PCR assay.

Complete loss of detection occurred at 5–10 fg D. suzukii DNA (10-6 D. suzukii equivalents), based on the concentrations tested. Overall, the 543-bp PCR assay could reliably detect 5 pg D. suzukii DNA.

This limit of detection was on par with observations by other researchers that have used PCR to detect the presence of DNA from dilutions of DNA extracted from similarly-sized organisms.

For example, using the related Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae),

Monzó et al. (2010) showed the limit of detection of a 130-bp amplicon to be 1 pg of DNA (10-4

C. capitata equivalents). When different primers amplifying a slightly larger amplicon of 333 bp were used in the same study, DNA could not be detected from C. capitata DNA at dilutions beyond 100 pg (Monzó et al. 2010). Similarly, dilutions of samples of flea beetles, Phyllotreta spp. (Coleoptera: Chrysomelidae), were assayed using PCR and the limit of detection of a 188- bp amplicon of Phyllotreta DNA was determined to be 1.5 pg (10-4 Phyllotreta spp. equivalents)

(Ekbom et al. 2014). A study by Kuusk and colleagues (2008) showed that the limit of detection of a 331-bp amplicon from samples of bird cherry-oat aphids, Rhopalosiphum padi (Homoptera:

Aphididae), was 40 fg (10-5 R. padi equivalents). My results demonstrated a level of sensitivity matching the findings of the latter study by Kuusk et al. (2008). The minimum amount of D. suzukii DNA that the 543-bp PCR assay was able to detect was 50 fg (10-5 D. suzukii equivalents). These results corroborated the findings of other researchers and validated the high sensitivity of PCR.

Table 3.1 – Percentages of dilutions of Drosophila suzukii DNA (5–10 ng·μL-1) that tested positive using the 543- bp PCR assay. Range of template DNA addeda (pg) Treatment 5000–10 000 500–1000 50–100 5–10 0.5–1 0.05–0.1 0.005–0.01 (undiluted) Control 100 (6) Water 100 (5) 100 (6) 100 (5) 60 (5) 25 (4) 0 (4) Spider DNAb 100 (5) 100 (5) 100 (5) 0 (5) 20 (5) 0 (4) a number of replicates in parentheses b spider DNA never tested positive when tested without D. suzukii DNA; spider DNA to prey DNA ratio ranges from 1:73 at the least dilute to 5:73 100 000 at the most dilute

The presence of competing spider DNA (mean concentration = 73.1 ± 38.1 ng·μL-1) had no significant effect on detection compared to dilutions made in water (χ² = 0.11, df = 1, p = 0.7423).

There was a large discrepancy in detection rates of D. suzukii DNA at 10-4 D. suzukii equivalents

(0.5–1 pg). Despite three out of five water replicates generating positive results and no detection occurring from samples diluted in spider DNA extract, there was no significant difference between treatments at this dilution step (t = 2.45, df = 4, p = 0.07). For dilutions made in spider

DNA, Tibellus DNA was always in excess relative to that of D. suzukii, meaning the lack of detection of a target DNA band from the maximum dilution step corroborated the previous result that Tibellus DNA does not cross-amplify using the 543-bp PCR assay (section 3.1.2b).

Though dilutions of D. suzukii DNA were made in both water and spider DNA extract, there was no significant difference between the diluents in terms of detection. Two other studies have compared the detection of target DNA diluted in water and spider DNA (Kuusk et al. 2008;

Ekbom et al. 2014). In the first study, Phyllotreta DNA (15–50 ng·µL-1) was diluted in spider

DNA (8.8–38 ng·µL-1) and the amplicon targeted was 188 bp (Ekbom et al. 2014). In their study,

Ekbom et al. (2014) determined a difference of one order of magnitude in detection limit between diluents. Phyllotreta DNA was detected to a greater degree in the absence of competing spider DNA. The second study found similar results in which detection of target DNA diluted in water was more sensitive by one and a half orders of magnitude when compared to target DNA diluted in spider DNA (Kuusk et al. 2008). In their study, Kuusk and colleagues (2008) determined the sensitivity of a 331-bp amplicon of R. padi DNA was to 10-5 R. padi equivalents

(40 fg) in water. However, when diluted in spider DNA (~200 ng·µL-1), R. padi DNA was only detectable at 10-3.5 R. padi equivalents (900 fg). These studies contrasted my results because both showed a difference of at least one order of magnitude between diluents, but the 543-bp PCR assay revealed no difference in the detection limit of D. suzukii DNA, whether it was diluted in

Tibellus DNA or water. The success in detecting D. suzukii DNA in the presence of 1.46 x 106- fold more competing Tibellus DNA suggested that the 500F/R primers are indeed suitable for

82 detecting D. suzukii DNA consumed by Tibellus.

3.1.4 The detection of D. suzukii DNA in spiders

3.1.4a Post-consumption detection of D. suzukii DNA from whole-body extractions of Tibellus

Although D. suzukii DNA was amplified when diluted in spider DNA, it was not known if D. suzukii would be detectable after being consumed by Tibellus. In this experiment, the 543-bp

PCR assay was used to detect the COI DNA of D. suzukii from whole-body DNA extractions of

Tibellus and Tetragnatha spiders that had recently consumed D. suzukii. Samples of all fed spiders (6 Tibellus and 1 Tetragnatha) produced a band corresponding to the target size of 543 bp. No PCR products near the expected band size were amplified from samples of the three unfed spiders (2 Tibellus and 1 Tetragnatha). Non-target DNA amplification of smaller DNA fragments (~150 bp) did occur for some Tibellus.

Based on these results, the 543-bp PCR assay can be used to selectively detect D. suzukii

DNA from Tibellus samples since reaction inhibition and DNA cross-amplification due to presence of spider DNA do not occur. Considering D. suzukii DNA was detected from the samples of all spiders consuming D. suzukii within 26 h, this confirmed that PCR may be used as a method to characterize recent predation in Tibellus. This work corroborates the general finding that the DNA of prey consumed by spiders may be detected using PCR (e.g. Monzó et al. 2010;

Kobayashi et al. 2011), and is the first to demonstrate the detection of prey DNA in Tibellus.

3.1.4b Post consumption detection of D. suzukii DNA from extractions of Tibellus legs

In some spiders, midgut diverticula extend throughout the cephalothorax and into the leg cavities (Foelix 2011). This experiment determined if diverticula extended into Tibellus legs such that prey DNA could be detected from legs following consumption. Screening samples of

Tibellus legs using the 543-bp PCR assay revealed that D. suzukii DNA was not detected, even though samples of five of the bodies of the corresponding spiders tested positive. These results suggest that either the gut diverticula of Tibellus do not extend into their leg cavities or that insufficient prey was consumed to fill leg cavities. Although the former idea is unknown because

Tibellus anatomy has not been studied, the latter idea is possible considering the low frequency of feeding while maintained in the laboratory compared to in nature. It has been estimated that hunting spiders catch and consume approximately 1 prey per spider per day (Nyffeler et al.

1994a). While maintained in the lab, Tibellus were fed two flies every two weeks. Further supporting this theory is that Tibellus can take as long as 6 h to consume a single D. suzukii (pers. obs., 2013), and in this experiment, Tibellus were only allowed 2 h for feeding. This suggests that more D. suzukii material could be consumed by Tibellus, which could increase the amount of D. suzukii present throughout the body and possibly even the legs. In general, the removal of legs decreases the volume of material that is extracted from the spider and lacks prey DNA.

3.1.4c Post-contact detection of D. suzukii DNA from whole-body extractions of Tibellus

In this experiment, Tibellus were externally contacted by D. suzukii and assayed by the 543- bp PCR assay to determine if external contamination would generate false positives. Drosophila

84 suzukii was detected in half of the samples. One Tibellus that was positive had been frozen 12 h after contact and the other three positive Tibellus samples were Tibellus frozen 24 h after contact.

Spiders regularly groom their legs and it is known that they ingest foreign particles during this process (Foelix 2011). Omission of the grooming process may have left remnants of D. suzukii on the exterior of Tibellus, and these morsels could have washed off when the spider bodies were placed in ethanol for storage before DNA extraction. This may have accounted for samples in which there was no detection. For Tibellus maintained in the laboratory after contact with D. suzukii, the increase in detection rates over time since contact with D. suzukii may have resulted from an increased likelihood of grooming behaviour in which most remnants of D. suzukii were likely consumed. Mainly, these results demonstrated that Tibellus did not have to catch and kill

D. suzukii for there to be detection of D. suzukii DNA in Tibellus.

3.2 Optimizing the post-consumption detection of D. suzukii DNA in Tibellus using PCR

3.2.1 Effect of Tibellus sample storage on the detection of consumed D. suzukii DNA

The purpose of this experiment was to determine whether the preservation of Tibellus in ethanol or without prior to DNA extraction affected the detection of consumed D. suzukii DNA from Tibellus samples using PCR. The PCR assay detected the targeted 543-bp amplicon from all samples but one (Table 3.2). The only sample from which D. suzukii DNA was not detected had been stored for 180 days without preservative. Consequently, the presence or absence of ethanol showed no effect on the detection of D. suzukii DNA from Tibellus samples (χ² = 0.57, df = 1, p = 0.4515). The duration of storage also had no significant effect on detection (χ² = 3.0, df = 1, p = 0.0828). 85

Table 3.2 – Proportion of Tibellus samples testing positive for Drosophila suzukii DNA using the 543-bp PCR assay (sample size in parentheses). Tibellus had each consumed one adult D. suzukii for 5 h and were stored for up to 180 days at -20°C with or without preservative. Storage time (days) Preservative 0 1 7 14 30 180 95% EtOH 100 (3) 100 (3) 100 (3) 100 (3) 100 (2) None 100 (3) 100 (3) 100 (3) 100 (3) 100 (3) 66 (3)

The storage experiment revealed that after feeding, spiders could be stored for up to 180 days with minimal loss in detection of D. suzukii DNA. Many methods of storing predators exist, including storage at -20 or -80 °C as well as flash-freezing specimens in liquid nitrogen.

Generally, the use of highly-concentrated ethanol (70–90%) to store predators is recommended

(King et al. 2008), but it remained untested as to whether or not ethanol would enhance detection compared to samples frozen without a preservative. The 95% ethanol tested in this experiment had no significant effect on detection since only one sample in total was negative for D. suzukii

DNA.

Though some studies have compared preservation methods, so far no studies have examined the link between the duration of storing predators and the detection of consumed prey DNA. The closest study to this experiment had been storing spider specimens since the 1950‟s in 70%

EtOH at -20 °C and determined that DNA from a 650-bp region of the COI gene could be detected from extracted genomic spider DNA (Miller et al. 2013). Although detection rates were the highest for freshly caught individuals and only at about 50% for spiders stored during the

1960‟s, the results suggested that amplifiable DNA can be stored for decades in ethanol at -20 °C.

However, it does not suggest anything about the detection of consumed prey DNA from stored samples. For the experiments presented here, statistical analysis showed that storage up to 180 days had no significant effect on the detection of D. suzukii DNA in Tibellus (p = 0.08). This

86 result implied that periods of storage greater than 180 days may increase the number of false negative results. In summary, my results suggest that D. suzukii DNA may be detected for a storage period of 180 days with no significant differences in detection arising from the use or lack of preservative.

3.2.2 Effect of thawing Tibellus on the detection of consumed D. suzukii DNA

This experiment was conducted to determine if thawing spiders stored at -20 °C prior to DNA extraction affected the detection of consumed D. suzukii DNA. The DNA of D. suzukii was detected in all Tibellus samples from both thawed and frozen treatments (n = 4 and 5, respectively). A high level of consistency in detection was observed within treatments. Although

D. suzukii DNA was detected for all Tibellus samples, when samples were run on a single gel, subtle differences in detection could be observed (Appendix IX). The signals produced by frozen samples were consistently brighter than thawed samples. However, this PCR method does not quantify brightness as a measure of amplicons produced. Therefore, despite the high levels of consistency within treatments, no significant difference between treatments was observed.

Therefore, thawing Tibellus had no significant effect on the detection of D. suzukii DNA using

PCR.

Thawing of spiders prior to DNA extraction had not been investigated before. Although thawing of tissue was recommended by the manufacturer of the DNA extraction kit, this experiment showed that it was not a necessary step for successfully detecting consumed prey

DNA. The 543-bp PCR assay consistently detected D. suzukii DNA from both thawed and frozen

Tibellus samples. Therefore, thawing spiders was an unnecessary step in DNA extraction and to maximize detection, stored spiders should stay frozen until immediately prior to DNA extraction.

3.2.3 Efficiency of extracting Tibellus DNA

The purpose of this experiment was to determine the efficiency of the kit used to extract DNA from Tibellus. Quantification of DNA concentration indicated that negative extraction controls, which lacked any obvious organisms, yielded relatively low concentrations of DNA (<1 ng·μL-1) through three successive extractions, indicating no significant sources of contamination. For

Tibellus samples, the concentration of DNA recovered in each consecutive extraction decreased exponentially (Figure 3.1). Each successive extraction recovered significantly less DNA than the preceding round(s) (Round 1 vs. 2: t = 11.80, df = 19, p < 0.0001; Round 2 vs. 3: t = 9.16, df =

30, p < 0.0001; Round 1 vs. 3: t = 14.75, df = 18, p < 0.0001). Despite variation in the total DNA extracted from Tibellus individuals (77.7–116.7 ng·µL-1), the majority of DNA for each individual was consistently recovered from the first extraction round (61.2–83.8% of the total extracted DNA). In five out of six samples, >90% of the total extracted DNA was recovered after two extractions. The final extraction accounted for only 3.6–7.6% of the total extracted DNA for five out of six samples. It is clear from these results that the majority of Tibellus DNA is recovered from one extraction.

Samples screened by the 543-bp PCR assay revealed that successive extractions of a single individual increased the risk of error in detection. The PCR assay detected D. suzukii DNA from the first extraction of all four Tibellus that were fed D. suzukii. After two extractions, three out of

88 the four fed Tibellus tested positive for D. suzukii. The second extraction of DNA from a Tibellus that had been frozen 12 h after feeding on D. suzukii was negative for D. suzukii DNA, even though this extraction accounted for 30% of the total DNA extracted from this sample. This suggested that all of the D. suzukii DNA present in this sample was extracted in the first extraction. After the final extraction, the PCR assay revealed only two samples still testing positive for D. suzukii DNA, one from each time group (t = 0 & 12 h). Appropriately, D. suzukii

DNA was not detected from starved Tibellus samples that had undergone one or two extraction rounds. The final extraction of one unfed Tibellus tested positive for D. suzukii DNA.

75 100

)

1 - 75 50

50 25 25

DNA extracted DNA (ng · μL

Cumulative DNA extracted (%) 0 0 1 2 3 Extraction Round Figure 3.1 – Efficiency of QIAGEN DNA extraction kit in extracting DNA from Tibellus spiders (n = 6) using three consecutive extractions (x-axis). Square symbols connected by the solid line correspond with the primary y-axis. Diamonds connected by the broken line correspond with the secondary y-axis. Vertical error bars denote standard error of the mean.

Overall, the DNA concentrations of extracted Tibellus fell within the range of DNA extractions of spiders found in other studies (e.g. Kerzicnik et al. 2012). However, no studies using PCR to study consumption in spiders have conducted consecutive DNA extractions, particularly in the context of prey detection. The findings suggest that DNA extractions following the first were more prone to error. In one case, D. suzukii DNA was detected from one

89 of the unfed spider samples, but only after the third extraction. This may have occurred due to contamination. However, NECs from the successive extractions and the NPCs used in PCR all tested negative, indicating a low likelihood of contamination. In another case, the detection of D. suzukii DNA from fed Tibellus samples using PCR decreased from 100% in the first round of extractions to 50% in the third round. The increase in error over successive extractions in this case suggested that the ratio of D. suzukii DNA to Tibellus DNA was changing over successive extractions and eventually decreased beyond the limit of detection. Since the detection rates of D. suzukii DNA from all four fed Tibellus were highest after the first extraction, it was evident that further extractions introduced unnecessary noise. Alternative methods to maximize the amount of DNA recovered from a single extraction may be to increase the duration of the lysis step, although this variable was not tested here. In conclusion the results of this experiment suggested that, although not all of the DNA was initially extracted from a Tibellus, just one extraction was effective for the optimal detection of consumed D. suzukii DNA in Tibellus using PCR.

3.2.4 Replicability of the PCR result

To determine if the 543-bp PCR assay can consistently reproduce the same result, samples of

Tibellus each fed on one D. suzukii were assayed in replicated tests. The samples of Tibellus that were frozen until immediately prior to DNA extraction (group A) demonstrated consistent detection of D. suzukii DNA from all individuals and all four replicates of most individuals

(Figure 3.2a). This level of consistency suggested that there was ample D. suzukii DNA recovered from the extractions of group A Tibellus.

Group B Tibellus were thawed before DNA extraction and group B samples demonstrated

90 greater inconsistency in detection compared to group A samples. Overall, 19 out of 25 total replicates for group B tested positive. The DNA of one individual, sample B4, did not generate any positive results in this experiment (Figure 3.2b), although it had tested positive by the 543- bp PCR assay in a preliminary experiment (Appendix IX, Figure IX.1). In the preliminary assay, the signal produced by the DNA of sample B4 was weak, implying it was near the limit of detection of the 543-bp PCR assay and the lack of detection of D. suzukii DNA from sample B4 in this experiment corroborates this speculation. Likewise, assays of sample B3 detected a weak signal of D. suzukii DNA in the preliminary assay as well as in four out of five replicates from this experiment, while the fifth replicate tested negative for D. suzukii DNA. The remaining three samples from group B detected D. suzukii DNA from all replicates. In comparing the results of groups A and B, the term „signal consistency‟ was shown to have a significant effect on PCR replicability in this experiment (χ² = 6.53, df = 1, p = 0.0106). This suggested that samples containing low levels of target DNA would be less likely to replicate the same result in PCR as was observed with sample B4. Generally, replicability decreased as the amount of target DNA approached the limit of detection of the assay.

The failure to detect D. suzukii DNA from all replicates of B3 and B4 samples prompted the second assay of group B samples. The second assay aimed to improve the replicability of PCR for these samples by increasing the volume of template DNA added to PCRs to 10 µL compared to 1 µL used in the first assay. This increased the detection rates for B3 and B4 samples by 17 and 33%, respectively (Table 3.3). However, despite this increase for these two samples, increasing the amount of template DNA used in PCR did not have a significant effect on overall

PCR replicability (χ² = 0.88, df = 1, p = 0.3491).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

a b c

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

Figure 3.2 – Results of PCR replicability tests (see sections 2.3.4 and 3.2.4). (a) Replicability assay of group A spiders, which were frozen until DNA extraction. Lanes 1 & 15: D. suzukii DNA (positive control). Lanes 2–5: replicates of sample A4. Lane 6: water (NPC). Lanes 7 & 8: DNA ladder – 1kb and 100 bp, respectively. Lanes 9– 10: replicates of sample A2. Lanes 11–15: replicates of sample A5. (b) Replicability assay of group B spiders using 1 µL template DNA. Group B spiders were thawed for 30 min before DNA extraction. Lanes 1–5: sample B1. Lanes 6 & 25: positive control. Lane 7: NPC. Lanes 8 & 23: 100 bp DNA ladder. Lanes 9–13: sample B2. Lanes 14–18: sample B3. Lanes 19–22 & 24: sample B4. Lanes 26–30: sample B5. (c) Replicability assay of group B spiders using 10 µL of template DNA. Lanes 1, 15, 16, & 30: positive control (1 µL). Lanes 2–5: sample B1. Lanes 6,7, 21, & 22: sample B2. Lanes 8 & 23: 100 bp DNA ladder. Lanes 10 & 25: NPC. Lanes 11–14: sample B3. Lanes 17–20: sample B4. Lane 24: blank. Lanes 26–29: sample B5. Arrows indicate 500 bp markers.

The results did not reveal a significant effect of template volume on PCR replicability likely due to a lack of samples for which changing template volume made any difference in outcome.

Most samples tested positive each time, biasing the data. Generally, PCR demonstrated high replicability in terms of detection as shown by the results from the replicated assays (Table 3.3).

However, D. suzukii DNA was not detected from some of the replicates of two group B samples.

Replicability of the PCR result is known to suffer as the amount of template DNA approaches the limit of detection of the assay (Sint et al. 2011). This suggested that these two group B samples contained an amount of D. suzukii DNA that was near the limit of detection (~50 fg).

Since samples at the limit of detection may generate false negatives, Sint et al. (2011) suggested replicating negative samples in at least one further PCR. However, no other research has assessed the replicability of detecting of prey DNA in spiders using PCR, so it was not known how changing the volume of template DNA used in PCRs would affect detection. No significant effects could be shown due to the limited number of samples for which increasing the volume of template DNA had any effect. The increase in the overall proportion of positive detections when template volume was increased suggests that only samples containing target DNA near the limit of detection may benefit from an increase in template DNA used for PCR. In conclusion, the use of 10 µL template DNA improved detection rates for some individuals and may be used to retest samples previously testing negative as a means to safeguard against false negatives.

Table 3.3 – Success detection of replicated PCR assays in detecting a 543-bp Drosophila amplicon in Tibellus spiders fed one adult D. suzukii for 5 h. Sample Time in -20 °C Treatment DNA extracted Detection success/Replicates freezer (days) ± SD (ng·µL-1) 1 μL template 10 μL template A1 31 frozen 110.4 ± 0.3 5/5 A2 31 frozen 61.2 ± 0.2 5/5 A3 31 frozen 84.5 ± 0.5 5/5 A4 31 frozen 50.6 ± 0.5 5/5 A5 31 frozen 67.7 ± 0.5 5/5 B1 0.13 thawed 36 ± 0.4 6/6 4/4 B2 0.13 thawed 64 ± 0.1 6/6 4/4 B3 0.13 thawed 56.7 ± 0.3 5/6 4/4 B4 0.13 thawed 36.8 ± 0.4 1/6 2/4 B5 0.13 thawed 38 ± 0.3 6/6 4/4

3.3 Application of the optimized PCR detection method to feeding and field experiments

3.3.1 The decay of a 543-bp region of D. suzukii DNA detected in Tibellus

3.3.1a The molecular decay of D. suzukii DNA detected in Tibellus using PCR

This experiment analyzed the molecular decay of a 543-bp region of D. suzukii DNA detected from samples of Tibellus after consuming a single D. suzukii. When Tibellus were given 2 h to consume D. suzukii, the maximum time point in which D. suzukii DNA could be detected from

Tibellus samples using PCR was 24 h (Table 3.4). Samples of all fed Tibellus from time groups prior to 24 h tested positive. Only 50% of Tibellus from the 24 h time group tested positive

(Figure 3.3). Tibellus digesting D. suzukii for 48 h and beyond all tested negative for D. suzukii

DNA. Because of this, the statistical analysis was based on only the Tibellus from time groups up to and including 72 h. Analysis using a binomial logit model confirmed that digestion time significantly affected the detection of D. suzukii DNA in Tibellus samples (χ² = 42.8, df = 1, p <

0.0001). Inverse prediction revealed that the molecular half-life of the 543-bp DNA fragment was 25 h (Figure 3.3). These results suggested that D. suzukii DNA could be detected from 50% of Tibellus samples within a day of ingesting D. suzukii.

Table 3.4 – Results of the 543-bp PCR assay in detecting a single adult Drosophila suzukii from starved Tibellus spiders frozen at time intervals (treatments) after a two or six hour feeding period. Treatments for fed spiders are the time periods (in hours) at which spiders were frozen following fly consumption. Boldface indicates treatment groups pertaining to both two- and six-hour feeding experiments. 2 h feeding perioda 6 h feeding periodb 6 h feeding periodb Combined 6 hb (14 days starved) (28 days starved) Treatment n # positivec n # positivec n # positivec n # positivec unfed control 5 1 (20) 5 0d 10 1 (10) fed 0 8 8 (100) 6 4 (67) 5 4 (80) 11 8 (73) 12 8 8 (100) 5 4 (80) 6 6 (100) 11 10 (91) 24 8 4 (50) 6 5 (83) 6 4 (67) 12 9 (75) 36 6 5 (83) 5 5 (100) 11 10 (91) 48 8 0 6 4 (66) 6 3 (50) 12 7 (58) 60 6 0 7 3 (43) 13 3 (23) 72 8 0 96 8 0 120 9 0 Total fed 57 16 (28) 35 22 (63) 35 25 (71) 70 47 (67) a Tibellus spiders caught in Fall, 2013, fed on one D. suzukii for 2 h b Tibellus spiders caught in Fall, 2014, fed on one D. suzukii for 6 h c percent of n testing positive in parentheses d one unfed spider tested positive, but only on a third consecutive extraction and thus was not counted here

For Tibellus, D. suzukii DNA was detected after 24 h of digestion, but there was no detection

from Tibellus given 48 h to feed. This result was similar to that of another study, which used

PCR to detect a relatively large region of DNA (>500 bp) from relatively small prey (<1 cm) in

wolf spiders. In their study, Li et al. (2011) measured the molecular decay of a 650-bp region of

DNA for 6 different species of prey from samples of Pirata subpiraticus (Araneae: Lycosidae)

that had been fed one of the prey species. Although the duration of feeding was not reported,

molecular decay experiments revealed that the 650-bp region of each prey was detected for up to

30 h following consumption. Only two prey species were tested as adults. These were Sitobion

avenae (Hemiptera: Aphididae) and Cyrtorhinus lividipennis (Hemiptera: Miridae), both of

which grow to about 3 mm. Although this was the same size as D. suzukii adults, only mirid

DNA was detected from P. subpiraticus for the same amount of time as D. suzukii DNA in

Tibellus. In comparison, aphid DNA was only detected from 50% of P. subpiraticus samples

95 tested 6 h after consumption and aphid DNA was not detected after more than 6 h of digestion.

The molecular half-lives of S. avenae and C. lividipennis DNA in P. subpiraticus were interpolated to be about 6 and 15 h, respectively. Both of the molecular half-lives fell short of that for the 543-bp amplicon of D. suzukii DNA detected in Tibellus. One cause for discrepancy among detection times could be that the prey fed to P. subpiraticus by Li et al. (2011) had been consumed for different durations compared to the D. suzukii fed to Tibellus. Alternately, the differences in DNA detection could have derived from the unique composition of DNA in each prey species, which may be digested at different rates by a single set of digestive enzymes. In summary, when Tibellus consumed D. suzukii for 2 h, the molecular decay of the 543-bp band of

D. suzukii DNA in Tibellus strongly resembled the decays of a 650-bp amplicon of DNA from small prey consumed by P. subpiraticus (Li et al. 2011).

The only other relatively large amplicon (>500 bp) investigated in spider predation studies was 555 bp used to detect the DNA of the field cricket, Acheta domesticus (Orthoptera:

Gryllidae). This DNA region showed a remarkably longer molecular half-life of 79 h in Pardosa wolf spiders (Sint et al. 2011). From the same study, two smaller amplicons (116 and 350 bp) showed similar half-lives (both 84 h) for the detection of cricket DNA in Pardosa. Although

Pardosa spiders were given the same amount of time to feed as Tibellus, the extended half-lives of cricket DNA in Pardosa may be due to prey size or spider habitat. The crickets used by Sint et al. (2011) were supposedly small, but even small crickets may be larger than Drosophila adults.

Although consumed for the same amount of time, the larger size of the cricket may mean that more prey was ingested by Pardosa compared to Tibellus, leading to longer overall detection times. Regarding habitat, Pardosa had been collected at an altitude of 2500 m from glacier foreland in Austria where the mean daily temperature during collection was 10 °C. In contrast,

Tibellus were collected at altitudes between 320–400 m where daily temperatures during collection fluctuated between 20-30 °C. Ambient temperature is known to affect the metabolic physiology of spiders in such a way that higher temperatures are associated with increased metabolic rates (Anderson 1970). Already discussed (see section 1.3.1), temperature can affect spider metabolism as revealed through the detection of prey DNA using PCR (Hosseini et al.

2008; Kobayashi et al. 2011). Spiders inhabiting colder environments are more likely to digest prey at a slower rate and this may explain why the molecular half-lives of A. domesticus DNA in

Pardosa was more than 3 times longer than the molecular half-life of D. suzukii DNA in Tibellus.

Regarding the unfed Tibellus used as negative controls in the 6 h molecular decay experiment, only one out of ten samples tested positive for D. suzukii DNA. Prior testing with the distitarsi of

Tibellus and other spiders revealed that the 500F/R primers did not amplify the 543-bp band when spider DNA was used as template (see section 3.1.2b). Since spiders had been fed

Drosophila spp. in the lab leading up to the experiment, the most probable cause of this false positive was the residual DNA of Drosophila spp. which had not been completely digested during the two week starvation period. Although the starvation period of seven days is common in PCR studies of spider predation (Ma et al. 2005; Hosseini et al. 2008; Monzó et al. 2010;

Quan et al. 2011; Sint et al. 2011; Virant-Doberlet et al. 2011), this result indicated that a longer starvation period may be generally needed for ridding spiders of residual ingested DNA. This result also has implications for studies that have starved spiders for less than seven days, suggesting that the DNA that was detected could have originated from prey consumed by spiders in the field. Overall, the results of this experiment mark the importance of a sufficient starvation period prior to feeding assays.

1.00

0.75

samples positive for positivesamples for

DNA (%) DNA 0.50

Tibellus D. suzukii D. 0.25

Proportion of Proportion 0.00 0 24 48 72 96 120 Time since feeding (h) Figure 3.3 – Molecular decay for a 543-bp amplicon of Drosophila suzukii DNA detected in the DNA extracted from Tibellus that had each consumed one fly for 2 h. Fitted line shows the prediction from a logit model. Each time point represents 8 Tibellus, except 120 h (n = 9).

1.00

0.75

samples positive for positivesamples for 0.50

DNA (%) DNA

Tibellus

0.25 D. suzukii D.

0.00 Proportion of Proportion 0 24 48 72

Time since feeding (h) Figure 3.4 – Molecular decay for a 543-bp amplicon of Drosophila suzukii DNA detected in the DNA extracted from Tibellus that had each consumed one fly for 6 h. Data for Tibellus from two feeding regimes combined here and each time point is represented by 11–13 Tibellus.

3.3.1b Effect of feeding regime on the molecular decay of D. suzukii DNA in Tibellus

This experiment tested Tibellus under a four-month feeding regime to determine the effect of feeding regime on the molecular decay of a 543-bp region of D. suzukii DNA amplified from extracts of Tibellus spiders. The DNA of D. suzukii was detected from Tibellus samples at all digestion times tested (Table 3.4). Immediately after feeding (t = 0), the proportion of positive individuals was below 100%, and detection rates varied from 73–91% of samples until 48 h after consumption. Only three samples tested positive from the 60 h time group (23%), all of which were spiders from the 4W feeding regime (Table 3.4). Logistic regression determined the molecular half-life of the 543-bp D. suzukii DNA fragment in Tibellus samples assayed with

PCR to be 52 h (Figure 3.3). Statistical analysis confirmed that digestion time had a significant effect on the detection of D. suzukii DNA from Tibellus using PCR (χ² = 18.32, df = 5, p =

0.0026). These results suggested that the DNA of D. suzukii could be detected from 50% of

Tibellus samples using PCR within two days of ingestion.

Compared to the 2 h decay experiment, the results of this decay experiment were skewed because the proportion of Tibellus samples testing positive never reached zero for a given time interval. Although the decay in the 2 h experiment was shaped like a normal decay, the decay from this experiment was shaped nearly horizontally (Figure 3.3). The shape for the 6 h decay was flattened due to the lack of detection of D. suzukii DNA from three out of 11 samples killed immediately after consumption. In the 2 h molecular decay experiment, all samples from the first time group (t = 0 h) were positive and the maximum period during which the target DNA of D. suzukii could be detected was 24 h. In this 6 h decay experiment, only 73% of samples tested positive immediately after feeding, but the detection period was extended to 60 h. This low level

99 of Tibellus samples testing positive from the t = 0 time group could have been a consequence of

Tibellus beginning to digest the D. suzukii ingested into the midgut. Spiders are known to void their secretory cells of digestive enzymes within several hours of ingestion, suggesting metabolic activity may have been near its maximum at the end of the 6 h feeding period (Collatz 1987;

Foelix 2011).

The duration of feeding was analyzed and this variable was normally distributed for all fed

Tibellus (N = 71, W = 0.966, p = 0.0545). The duration of feeding was variable, ranging from about half an hour to 6 h and had an overall mean of 3.7 ± 1.3 h. Neither the species nor stage of

Tibellus had significant effects on feeding duration (χ² = 0.17, df = 1, p = 0.6821; χ² = 2.23, df =

1, p = 0.1357, respectively). Unlike these variables, the feeding regime treatment (2W vs. 4W) had a significant effect on feeding duration (χ² = 4.18, df = 1, p = 0.0409). Tibellus fed more frequently (2W) consumed prey for 3.4 ± 0.2 h on average, which was significantly longer than

Tibellus fed less frequently (4W; mean = 4.0 ± 0.2 h) (t = 2.05, df = 68.8, p = 0.0444). This suggested that there may have been a difference in terms of the amount of D. suzukii ingested, and this difference between regime treatments could have influenced the detection of D. suzukii

DNA from Tibellus using PCR. However, a binomial logistic analysis showed no significant effect of feeding regime treatment on the overall detection of D. suzukii DNA using PCR (χ² =

0.34, df = 1, p = 0.5573). For the 60 h time group, feeding regime treatment almost significantly affected detection (p = 0.0571). This result in particular may have stemmed from the slower metabolic rates of 4W spiders.

Analyzed separately for 2W and 4W, a binomial logit analysis of the two variables digestion time and feeding duration showed that both had significant effects on the detection of D. suzukii

100

DNA from 2W samples when combined into a single model (χ² = 25.11, df = 5, p = 0.0001; χ² =

11.23, df = 1, p = 0.0008, respectively; full model: χ² = 25.15, df = 6, p = 0.0003). Neither this model nor any of its variables were shown to have a significant effect on detection in 4W samples (full model: χ² = 9.5888, df = 6, p = 0.1431). This was unexpected because digestion time was expected to consistently have a significant effect on detection of consumed prey DNA using PCR.

Overall, feeding regime had no statistical impact on the overall proportion of Tibellus samples that tested positive. When analyzing the two feeding regimes separately, digestion time and feeding duration had a significant effect on the detection of D. suzukii DNA only in Tibellus that were fed more frequently (2W). This suggests that when food is regularly available to Tibellus, metabolic breakdown of ingested material likely proceeds at a given rate and detection is more or less dependent on the amount ingested. In contrast, when Tibellus were fed less frequently (4W), digestion time and feeding duration did not significantly affect detection. This suggested that the metabolic breakdown of ingested material was proceeding at a different rate compared to 2W

Tibellus and implied that detection may not be dependent on the amount ingested. This result is consistent with the literature such that starved spiders have been shown to alter their physiological state by reducing metabolic rates by 30–40% (e.g. Anderson 1974). If Tibellus are reducing their metabolic rates when fed less frequently, then a change in detection rates of D. suzukii DNA would be expected between regime treatments. Since digestion time and duration of feeding variables had different levels of impact on detection between 2W and 4W samples, this indicates that the feeding regime or physiological state may indeed have an effect on detection.

Most of the unfed Tibellus tested negative for D. suzukii DNA using the 543-bp PCR assay.

101

Only the sample of one unfed 2W Tibellus weakly amplified D. suzukii DNA and it did so in two out of three PCRs. All of the 4W Tibellus tested negative for D. suzukii DNA. Because spiders can withstand starvation for significant periods of time, longer starvation periods should be used to encourage complete digestion of pre-existing gut contents. The increase in starvation period relative to the first molecular decay experiment resulted in significantly fewer unfed Tibellus testing positive in this experiment (χ² = 5.73, df = 1, p = 0.0166). Combining results from the two experiments showed that the starvation period had a significant effect on D. suzukii detection in Tibellus samples (χ² = 6.29, df = 2, p = 0.0431). Evidently, a greater starvation period has a greater chance of reducing false positives.

A handful of studies have used very short starvation periods before feeding experiments, such as 1–4 days (Greenstone & Shufran 2003; Kuusk et al. 2008; Lundgren et al. 2009; Li et al.

2011; Hagler & Blackmer 2013). According to my results, this may not have been enough time for Tibellus to metabolize previously-ingested meals before the feeding experiments, particularly if Tibellus fed for more than 2 h. Many studies use a starvation period of one week, but my results showed that the DNA of D. suzukii was still detected in samples of Tibellus that were starved for two weeks (10%). No detection of D. suzukii DNA was achieved after a four week starvation period. This amount of starvation may not be necessary, but it ensures a completely emptied gut. No comparisons to the literature may be made since no studies using PCR have compared the feeding histories of spiders prior to conducting molecular decay experiments.

102

3.3.2 Effect of multiple prey on the detection of D. suzukii DNA in Tibellus

3.3.2a Effect of multiple prey on the detection of D. suzukii DNA in Tibellus

This experiment was designed to determine for how long of a period following ingestion D. suzukii DNA could be detected from extracts of Tibellus when up to five D. suzukii had been consumed. The cumulative results of multiple-prey feeding experiments are summed in

Appendix X. Significantly more flies died when contained with Tibellus compared to spider-less controls (t = 6.32, df = 9, p < 0.0001). This indicated significant levels of predation. Indeed, half of the spiders had killed 5 flies, suggesting that more flies could be used. The number of flies killed was not normally distributed (W = 0.69, p = 0.0007) and was skewed left, confirming the notion that more flies should be used. Spiders frozen five days after 24 h consumption had killed on average 3.75 ± 0.95 flies and spiders frozen ten days after consumption had killed an average of 4.25 ± 0.75 flies. There was no significant difference between spider groups with respect to the amount of flies killed (t = 0.41, df = 6, p = 0.35). However, D. suzukii DNA was not detected from any of the samples. This result indicated that shorter digestion times (<5 days) were necessary for the detection of D. suzukii DNA in Tibellus using PCR.

Tibellus had killed on average four out of the five provided flies during the 24 h feeding experiment. Despite this substantial increase in the amount of prey ingested relative to previous experiments, no samples were positive for D. suzukii DNA. Tibellus samples were tested no sooner than five days after consumption, which suggested that the targeted DNA region had been sufficiently degraded by this time. This prompted a second evaluation of the detection limits of multiple D. suzukii consumed by Tibellus using PCR.

103

3.3.2b Effect of successive feeding bouts on the detection of D. suzukii DNA in Tibellus

The purpose of this experiment was to determine how long DNA from multiple D. suzukii can be detected from Tibellus samples following the consumption of prey. For this experiment, two groups of Tibellus were each provided at least ten D. suzukii. One individual (fed once, frozen at

24 h) was omitted from the analysis because some of the prey had escaped during the feeding experiment. The number of flies killed were normally distributed in all cases; first feeding bout

(n = 19, W = 0.92, p = 0.1292), second feeding bout (n = 10, W = 0.95, p = 0.6549), and feeding bouts combined (n = 29, W = 0.96, p = 0.2877). Two-tailed t-tests assuming unequal variances determined significant differences in the number of flies killed between Tibellus fed once (F1) and either of the feeding bouts from Tibellus fed twice (F2) (first bout: t = 2.56, df = 15, p =

0.0219; second bout: t = 4.59, df = 17, p = 0.0003). There was also a significant difference in the number of flies killed between both feeding bouts for F2 Tibellus (t = 2.62, df = 17, p = 0.0178).

Despite discrepancies in the number of flies killed within and among groups, the number of flies killed did not significantly affect detection in either group (FO: χ² = 0.95, df = 1, p = 0.3291; FT:

χ² = 0.0055, df = 1, p = 0.9407).

Considering the Tibellus groups separately, digestion time following feeding did not significantly affect the detection of D. suzukii in F1 Tibellus (n = 9, χ2 = 1.3761, df = 1, p =

0.2408). The DNA of D. suzukii was not amplified from individuals frozen 48 h after consumption, although prey DNA was detected in Tibellus given 24, 72, and 96 h for digestion.

Only one sample tested positive for the 96 h group of Tibellus that had been fed once. For

Tibellus that were fed twice, D. suzukii DNA was detected for up to 72 h following consumption.

One sample from each of 48 h and 72 h time groups and both samples from the 24 h treatment

104 tested positive. Digestion time had a significant effect on detection for F2 Tibellus (n = 10, χ2 =

6.60, df = 1, p = 0.0102). These results were similar to previous results (section 3.3.1b) since the detection of D. suzukii DNA from Tibellus starved longer was less impacted by digestion time.

Considering the two groups of spiders together, D. suzukii DNA was detected in 8 of 15

Tibellus samples frozen between 24 and 96 h following consumption. No target DNA was detected from any of the samples frozen at 144 h. No significant effects on the detection of D. suzukii DNA were generated by number of feeding bouts (χ² = 0.038, df = 1, p = 0.8447) or the number of flies killed (χ2 = 0.31, df = 1, p = 0.5774). In contrast, digestion time had a significant effect on the detection of D. suzukii DNA in Tibellus samples (χ2 = 6.4325, df = 1, p = 0.0112).

In summary, consuming two bouts of flies had no effect on the detection of D. suzukii DNA from

Tibellus samples using the 543-bp PCR assay, and D. suzukii DNA could be detected from

Tibellus samples for up to 96 h when multiple flies were consumed.

This second multiple prey experiment evaluated more and shorter digestion times to study the detection of D. suzukii DNA in Tibellus. Two successive bouts of feeding in Tibellus had no effect on the detection of D. suzukii DNA compared to Tibellus that were fed once. However, when initially tested with PCR, only F1 Tibellus tested positive. Upon retesting negative samples with optimized parameters (e.g. increased template volume), it was mainly F2 Tibellus testing positive. Because of this discrepancy, it seemed that D. suzukii DNA was more prevalent in F1

Tibellus and perhaps more degraded in F2 Tibellus. It is possible that F1 Tibellus more readily retained DNA to compensate for the lack of nutrition leading up to the feeding experiment. On the other hand, F2 Tibellus may have been more likely to digest their prey, thinking they were in an environment of high prey availability having received two bouts of ten flies over the course of

105 three days. These conclusions again point to metabolic behaviours in Tibellus that affect the molecular detection of consumed prey DNA using PCR. In comparison to single-prey feeding experiments, D. suzukii DNA was detected in spiders for up to 96 h after consumption. This was four times the length of time in which D. suzukii was originally detected in the first molecular decay experiment (section 3.3.1a). No studies have so far investigated how the number of prey affects the molecular decay of detection of prey DNA in spiders using PCR. However, this experiment showed that the consumption of multiple prey extended the detection time of prey

DNA compared to when just one prey is consumed.

3.3.3 The detection of D. suzukii DNA in scavenging Tibellus

The purpose of this experiment was to determine if Tibellus feed on dead prey. One spider that had been provided 15 flies failed to kill any during the consumption period, making it an outlier. Because of this, it was killed immediately after feeding and used exclusively as a sensitivity or ectopic control. This individual was removed from the statistical analysis except to test if the number of flies killed significantly affected detection. PCR did not detect D. suzukii

DNA from this sample, indicating that this Tibellus did not consume any Drosophila DNA. With or without this sample, the number of flies killed had no significant effect on target detection

(with: n = 30, χ² = 2.30, df = 1, p = 0.1290; without: n = 29, χ² = 0.17, df = 1, p = 0.6801).

Overall, the number of flies killed by Tibellus was normally distributed whether analyzed altogether (n = 29, W = 0.97, p = 0.5196) or by starvation period (one week: n = 9, W = 0.96, p =

0.7506; two weeks: n = 20, W = 0.96, p = 0.5074). The five Tibellus in the 0 h time group had each killed between 4–11 flies and D. suzukii DNA was detected in samples from these spiders

106 using the 543-bp PCR assay. These positive controls were not included in the statistical tests for scavenging.

Analyzing starvation groups separately, the detection of D. suzukii DNA in samples of

Tibellus that were starved for one week was not affected by digestion time (n = 9, χ² = 0.97, df =

1, p = 0.3258), scavenging treatment (n = 8, χ² = 0.75, df = 1, p = 0.3880), or number of flies killed (n = 9, χ² = 2.45, df = 1, p = 0.1176). Detection of D. suzukii DNA in the samples of

Tibellus starved for two weeks was similarly not significantly affected by number of flies killed

(n = 20, χ² = 0.2290, df = 1, p = 0.6323), digestion time (n = 20, χ² = 3.09, df = 1, p = 0.0787), or scavenging treatment (n = 16, χ² = 2.18, df = 1, p = 0.1400).When both datasets were combined, a total of three spiders tested negative. These had been deprived of flies after consumption and frozen in the 72 h time group. One of the negative samples belonged to the group starved for one week and the other two had been Tibellus starved for two weeks. Despite this, no significant effects on target detection were caused by starvation time (n = 29, χ² = 0.0082, df = 1, p =

0.9280) or scavenging (n = 24, χ² = 3.67, df = 1, p = 0.0554). Digestion time was the only term that had a significant effect on the detection of D. suzukii DNA in Tibellus samples (χ² = 4.85, df

= 1, p = 0.0276). In conclusion, scavenging appeared to have no significant impact on the detection of D. suzukii DNA from Tibellus samples using PCR.

The scavenging experiment revealed no statistical difference between Tibellus retaining dead flies and those whose flies were removed after the consumption period. Despite lacking significance, all of the samples of scavenging Tibellus tested positive. Because some of the samples of Tibellus in the 72 h time group where flies were removed generated negative results, this discrepancy between treatments suggested that scavenging may have occurred. These results

107 demonstrate for the first time that Tibellus may acquire nutrition through scavenging. Using PCR, this foraging strategy has only been shown to occur in one other spider, the genus Tetragnatha which are a group of orb-weavers (von Berg et al. 2012). Interestingly, the hunting spider also studied by von Berg et al. (2012) selectively consumed live prey and avoided consuming dead prey. This hunting spider was a wolf spider (Araneae: Lycosidae) and the disinterest in carrion may have been a result of their hunting strategy, which generally requires prey movement

(Foelix 2011). Alternately, it may have resulted from an adequate nutritional state since scavenging is more likely to occur when an organism is nutritionally deprived. Tibellus generally hunts winged insects with bodies significantly smaller than their own (Nentwig & Wissel 1986;

Huseynov 2008). The way Tibellus naturally feeds involves waiting hidden on foliage and leaping after prey as they fly by (Dalton 2011). This method of prey capture implies that Tibellus rely on hunting live prey and shows little likelihood for the consumption of carrion in nature.

However, Tibellus habits are not well known and these spiders may move up and down the foliage strata throughout a day, which could cause Tibellus to come into contact with carrion.

Regardless, the exposure to dead flies after feeding increased the proportion of Tibellus testing positive when tested 72 h after consumption. Most likely due to small sample size, this slight increase in the proportion of detections of D. suzukii DNA compared to Tibellus where all flies were removed after consumption was not significant. Therefore, prolonged exposure to dead prey did not increase the overall detection time of D. suzukii DNA in Tibellus samples using

PCR.

108

3.3.4 Screening field-collected Tibellus for prey DNA using the 543-bp PCR assay

This experiment was intended to probe field-caught Tibellus using the 543-bp PCR assay.

Only samples from eight Tibellus out of the 26 total collected from field margins tested positive when assayed using the 543-bp PCR assay (Table 3.5). As discussed in section 3.1.3, the 500F/R primers are not specific to D. suzukii DNA and the detection of the target DNA sequence in these spiders probably does not indicate the recent consumption of D. suzukii DNA. Despite this, these results still suggest the consumption of insects by Tibellus in the field. Positive results varied among individuals from a site and signal strength varied among positive results (Figure 3.4). No target DNA was detected from all of the Tibellus at each of two of the sites. This may have resulted from a lack of certain prey at these sites, but this was not tested. Overall, the application of the 543-bp PCR assay to field-collected spiders proved successful. Although the identity of the prey is unclear, future assays could integrate the sequencing of amplicons to accurately determine prey identity. In conclusion, the 543-bp PCR assay selectively amplifies insect DNA without amplifying the DNA of spiders, making it useful to detect particular prey species consumed by spiders.

Results from the field test suggested that Tibellus spiders from some of the field sites had recently consumed at least one prey containing amplifiable DNA of the appropriate ~550 bp size.

Besides detecting DNA from a number of possible species of insect prey, it is also possible that detection resulted from secondary predation; i.e. spiders had consumed a predator that had recently ingested one of these species of insect prey. Secondary predation is likely to incur minimal false positives with respect to studying Tibellus from the field considering the preponderance of small, winged prey in Tibellus diet (Nentwig & Wissel 1986; Huseynov 2008).

109

In an Azerbaijani meadow, the related spider, T. macellus Simon 1875, consumed mainly prey

less than half of their body length (78% of prey) and the majority of prey (84%) consisted of

aphids, flies, and leafhoppers (Huseynov 2008). Although Tibellus are known to hunt other

predators, such as early instar spiderlings (Cutler 1991), preference for winged arthropods that

are significantly smaller than themselves inherently reduces the likelihood of Tibellus hunting

most other predators.

Table 3.5 – Results of the 543-bp PCR assay using Tibellus spiders collected from grassy field margins in north Wellington County, Ontario in 2013. Site Species Individuals assayed Mean DNA extracted ± SEa Individuals positiveb (ng·μL-1) A T. oblongus 5 96 ± 5 1 (20) B T. oblongus 5 155 ± 11 3 (60) C T. maritimus 5 108 ± 10 0 D T. maritimus 6 168 ± 30 4 (67) E T. oblongus 5 145 ± 15 0 a SE = standard error b percentages in parentheses

The relatively weak signals produced by spiders from the field reflect our understanding of

spider ecology. It is known that spiders demonstrate relatively low levels of predation in the field.

Generally, hunting spiders capture about 1 prey per day (Nyffeler 2000; Nyffeler & Sunderland

2003) and about 10% of observed hunting spiders are found feeding at any given time (Nyffeler

et al. 1994a; Nyffeler & Sunderland 2003). Although Huseynov (2008) observed more T.

macellus to be feeding at a given time (~16% of individuals), which may equate to higher overall

detection rates in Tibellus, detection rates may yet be low since small, individual prey are

preferentially targeted by Tibellus. Furthermore, there is little assurance that the captured prey is

consumed in its entirety because hunting spiders may drop their quarry in the presence of a

predator or another meal. Overall, the DNA detected using PCR suggested that spiders were

indeed consuming insect prey, but that either no large quantity of such prey was ingested or that

110 such prey was ingested infrequently.

Figure 3.5 – Results of field-collected Tibellus assayed using the 543-bp PCR assay. Lanes 1–5: Tibellus from site A. Lanes 6 & 11: NECs. Lane 7: water (NPC). Lane 8: 100 bp DNA ladder (500 bp and 1000 kb marked). Lanes 9, 10, & 13–15: samples from site B. Lane 12: D. suzukii DNA (10 ng).

111

4. CONCLUSIONS

This study set out to determine if PCR could be used to detect recent prey consumption in

Tibellus. A PCR assay was developed to detect a 543-bp fragment of the non-barcoding region of the COI gene of Drosophila suzukii mitochondrial DNA. The PCR assay can reliably detect 10-3

D. suzukii equivalents or approximately 10 ± 5 pg of target DNA. It was determined that the primers are not selective to D. suzukii, but despite the fact that the DNA of other insects may also be amplified using these primers, the PCR assay does not detect Tibellus DNA. Considering this, it was no surprise that the DNA of D. suzukii was detected from Tibellus extracts when Tibellus had consumed a single D. suzukii for at least 2 h.

The optimization experiments conducted in this study revealed three ways to simplify the process of detecting prey DNA from spiders and enhance detection. First, in fed Tibellus that were stored for up to 180 days, there was no significant difference in detection whether spiders had been stored in 95% ethanol or without preservative. This suggested that freezing was likely the most critical criteria for preserving consumed prey DNA. Second, PCR analysis revealed no difference in detection whether fed Tibellus were thawed or left frozen immediately before DNA extraction. Since freezing is directly linked to the preservation of consumed prey DNA, then spiders should remain frozen until DNA extraction to prolong the preservation of consumed

DNA as well as enhance detection. Finally, increasing the volume of sample DNA added to PCR from 1 to 10 µL enhanced detection for samples containing minute amounts of D. suzukii DNA.

112

Determination of the molecular decay rate of D. suzukii DNA in Tibellus

This is the first study to use Tibellus in conducting a molecular decay and the first study on the decay of D. suzukii DNA in spiders. The 543-bp region corresponding to the COI gene in the

D. suzukii genome can be detected for 2.5 days when Tibellus are allowed to feed on a single D. suzukii for a maximum of 6 h. The decay rate was not affected by previous feeding regime, which suggests that target DNA would be detected in the timeframe regardless of the feeding history of Tibellus. However, when fed for 2 h, D. suzukii DNA in Tibellus could be reliably detected for less than 24 h. Feeding on a single prey can take spiders several hours to complete

(Foelix 2011). Interrupting this process decreases the amount of prey ingested and in the field, for example, feeding may be interrupted by predators of spiders. This could lead to significantly reduced detection times and presents a challenge for using PCR to investigate trophic interactions in the field. When between 5 and 15 D. suzukii were consumed by Tibellus, the maximum period during which D. suzukii DNA could be detected after consumption increased to

96 h. In conclusion, PCR analysis of Tibellus showed that the duration of feeding and the number of prey consumed, which both reflect the amount of D. suzukii consumed, can change the molecular decay rate of D. suzukii DNA in Tibellus..

Interpretation of the field results

DNA not attributable to Tibellus was detected in 31% of the field samples. Because the primers used in this study were not specific, it is not possible to identify the species of prey consumed. The proportion of samples in which DNA is not attributable to Tibellus is probably an underestimate of the total proportion of Tibellus that had recently fed since not all prey DNA would have been amplified. In addition, secondary predation (Sheppard et al. 2005; Hosseini et

113 al. 2008) and scavenging (e.g. von Berg et al. 2012) may have introduced additional bias. A conservative estimate of the lower limit of predation rates in the field can be calculated assuming that spiders in which prey DNA was detected had fed within the last 48 h. This suggests that about 15% of field Tibellus had fed each day. The highest density of Tibellus observed during collection was approximately 5–10 per m², which equates to 5–10 x 104 Tibellus per hectare.

Thus, on a given day, spider predation rates in Tibellus may range between 7 500 and 15 000 prey per hectare per day. Considering Tibellus is just one member of a large and diverse guild of spiders living in field margins, these data suggest that it is reasonable to infer overall spider predation rates to total between 100 000 and 1 000 000 prey per hectare per day. Overall, the predation rates of spiders in field margins may be substantial and may contribute significantly to pest control in agroecosystems.

Future directions and applications

The PCR methodology developed in this thesis proved to be a useful tool for characterizing prey consumption in Tibellus in the laboratory, and it shows promise for the application to field spiders as well. The 543-bp PCR assay only detected the DNA of a fraction of insects examined as part of this research and did not amplify DNA from 17 different spider species. The overall lack of DNA amplification from the extracts of spiders is encouraging for the future application of this method. This result implies that, in addition to Tibellus, field spiders of these species could likely also be used in conjunction with the developed PCR assay without the concern of detecting spider DNA. If this is true, this method or a modification thereof could be directly applied to agriculture, for example for the surveillance of pests in crops.

Although the methodology presented in this thesis may be directly applied to controlled

114 experiments conducted in the laboratory, the methodology as developed may not be directly applicable to field experiments. The overall lack of primer specificity causes ambiguity in results from field spiders, but with slight modification to the 543-bp PCR assay, the methodology may be able to differentiate between prey species. Because the region of prey DNA that is amplified is relatively long, there is a high probability of enough mutations in the sequence to identify the species of insect whose DNA is detected by the PCR assay. By expanding specificity testing and sequencing all PCR products around 550 bp, a library of sequences could be created for the 543- bp PCR assay that could be used to identify prey species that test positive. Therefore, the sequencing of PCR products is an important addition to the methodology that could both enhance the information obtained and broaden the circumstances in which the methodology could be used.

Two alternatives to sequencing would be to use a nested PCR approach or to use sequence- specific probes using a quantitative PCR (qPCR) approach. For a nested PCR, the 500F/R primers would be used in a primary PCR to obtain the 550-bp product, which would then be used as the template in a secondary PCR that uses another set of primers to detect the DNA of a particular prey species (Kobayashi et al. 2011; Hoy 2013). Nested PCR could allow a number of prey species to be detected from the products of the first PCR, which would make this a useful and versatile technique to apply to field spiders. The second alternative to sequencing is to use specific probes that bind to a particular sequence. Probes are generally employed in qPCR and these allow the number of target copies amplified by PCR to be quantified. This technique may be the most useful for studying the prey of field spiders because more than one probe may be used at once, theoretically being able to detect multiple consumed prey species, and the amount of DNA is quantified, which might give an idea of how much DNA is being consumed by field spiders.

115

In summary, the results presented support the conclusion that PCR may be used to characterize recent feeding history in Tibellus. This was the first laboratory study to use PCR to assess the molecular decay of prey DNA in a member of the running crab spider family,

Philodromidae. This was also the first study to determine the molecular decay of D. suzukii DNA in a spider. The main conclusions drawn from my experiments corroborate previous findings regarding PCR research on spider predation (e.g. Agustí et al. 2003; Greenstone & Shufran

2003; Ma et al. 2005; Monzó et al. 2010). The methodology developed and presented here reliably reproduced the detection of target DNA from a given sample. The results also supported the conclusion from other studies that reproducibility in detection suffers for samples possessing minute quantities of target DNA (Piggott 2004; McMillan et al. 2007; Seeber et al. 2010; Sint et al. 2011). The 500F/R primers used to detect prey DNA in this thesis were selective to the DNA of certain insects and never amplified spider DNA at the targeted band size. This selectivity makes the 543-bp PCR assay useful for analyzing Tibellus predation in the laboratory and suggests the possibility of application to other spider species. Although sufficient for laboratory experiments, the specificity of the assay is limited for application to field spiders. Modifying the methodology to determine prey identity would reduce these limitations and provide greater insight into spider trophic ecology. In conclusion, the developed PCR method is robust and effective for characterizing the recent consumption of prey by spiders in the laboratory, but requires modification to investigate the consumption of prey in spiders collected from the field.

116

REFERENCES

Ackermann, G. 2012. Lepidodactylus lugubris (Squamata: Gekkonidae) als Beute von Pholcus phalangioides (Araneae: Pholcidae). Arachnologische Mitteilungen, 44: 14–16. Agnew, C.W., Dean, D.A., & J.W. Smith. 1985. Southwestern association of naturalists spiders collected from peanuts and non-agricultural habitats in the Texas West Cross-Timbers. The Southwestern Naturalist, 30: 1–12. Agustí, N., Shayler, S.P., Harwood, J.D., Vaughan, P., Sunderland, K.D., & W.O.C. Symondson. 2003. Collembola as alternative prey sustaining spiders in arable ecosystems: Prey detection within predators using molecular markers. Molecular Ecology, 12: 3467–3475. Agustí, N., de Vicente, M.C., & R. Gabarra. 1999. Development of sequence amplified characterized region (SCAR) markers of Helicoverpa armigera: A new polymerase chain reaction-based technique for predator gut analysis. Molecular Ecology, 8: 1467–1474. Agustí, N., de Vicente, M.C., & R. Gabarra. 2000. Developing SCAR markers to study predation on Trialeurodes vaporariorum. Insect Molecular Biology, 9: 263–268. Aitchison, C.W. 1984. The phenology of winter-active spiders. Journal of Arachnology, 12: 249–271. van Alebeek, F., Kamstra, J.-H., van Kruistum, G., & A. Visser. 2006. Improving natural pest suppression in arable farming: field margins and the importance of ground dwelling predators. IOBC-WPRS Bulletin, 29: 137–140. Almquist, S. 1969. Seasonal growth of some dune-living spiders. Oikos, 20: 392–408. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., & D.J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215: 403–410. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., & D.J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25: 3389–3402. Anderson, J.F. 1966. The excreta of spiders. Comparative Biochemistry and Physiology, 17: 973–982. Anderson, J.F. 1970. Metabolic rates of spiders. Comparative Biochemistry and Physiology, 33: 51–72. Anderson JF (1974) Responses to starvation in the spiders Lycosa lenta Hentz and Filistata hibernalis (Hentz). Ecological Society of America, 55: 576–585. Anderson, J.F. 1996. Metabolic rates of resting salticid and thomisid spiders. Journal of Arachnology, 24: 129–134. Bajwa, W.I. & M.T. Aliniazee. 2001. Spider fauna in apple ecosystem of western Oregon and its field susceptibility to chemical and microbial insecticides. Journal of Economic Entomology, 94: 68–75. Barbosa, P. 1998. Agroecosystems and Conservation Biological Control. In: Conservation Biological Control (Ed Barbosa, P.), pp. 39–54. Academic Press, San Diego, California, USA. Bell, J.R., Bohan, D.A., Shaw, E.M., & G.S. Weyman. 2005. Ballooning dispersal using silk: world fauna, phylogenies, genetics and models. Bulletin of Entomological Research, 95: 69–114. von Berg, K., Traugott, M., Scheu, S. 2012. Scavenging and active predation in generalist predators: A mesocosm study employing DNA-based gut content analysis. Pedobiologia, 55: 1–5. Bianchi, F.J.J.A., Booij, C.J.H., & T. Tscharntke. 2006. Sustainable pest regulation in agricultural landscapes: a review on landscape composition, biodiversity and natural pest control. Proceedings of the Royal Society B: Biological Sciences, 273: 1715–1727. Birkhofer, K., Gavish-Regev, E., Endlweber, K., Lubin, Y.D., von Berg, K., Wise, D.H., & S. Scheu. 2008. Cursorial spiders retard initial aphid population growth at low densities in winter wheat. Bulletin of Entomological Research, 98: 249–255. Blackledge, T.A., Scharff, N., Coddington, J.A., Szüts, T., Wenzel, J.W., Hayashi, C.Y., & I. Agnarsson. 2009. Reconstructing web evolution and spider diversification in the molecular era. Proceedings of the National Academy of Sciences of the United States of America, 106: 5229–5234. Bohan, D.A., Raybould, A., Mulder, C., Woodward, G., Tamaddoni-Nezhad, A., Bluthgen, N., Pocock, M.J.O., Muggleton, S., Evans, D.M., Astegiano, J., Massol, F., Loeuille, N., Petit, S., & S. MacFadyen. 2013. Networking agroecology: Integrating the diversity of agroecosystem interactions. In: Ecological Networks in an Agricultural World (Eds. Woodward, G. & D.A. Bohan), pp. 1–67. Elsevier Academic Press Incorporated, San Diego, California, USA. Boiteau, G. 1986. Native predators and the control of potato aphids. The Canadian Entomologist, 118: 1177–1183. Boiteau, G. 2010. Insect pest control on potato: Harmonization of alternative and conventional control methods. American Journal of Potato Research, 87: 412–419. Bonte, D. & L. Lens. 2007. Heritability of spider ballooning motivation under different wind velocities. Evolutionary Ecology Research, 9: 817–827.

117

Boreau de Roincé, C., Lavigne, C., Mandrin, J.-F., Rollard, C., & W.O.C. Symondson. 2013. Early-season predation on aphids by winter-active spiders in apple orchards revealed by diagnostic PCR. Bulletin of Entomological Research, 103: 1–7. Boreau de Roincé, C., Lavigne, C., Ricard, J.-M., Franck, P., Bouvier, J.-C., Garcin, A., & W.O.C. Symondson. 2012. Predation by generalist predators on the codling moth versus a closely-related emerging pest the oriental fruit moth: A molecular analysis. Agricultural and Forest Entomology, 14: 260–269. Bristowe, W.S. 1958. The World of Spiders. HarperCollins, London, UK. Cárcamo, H., Pinzón, J., Leech, R., Spence, J. 2014. Spiders (Arachnida: Araneae) of the Canadian Prairies. In: Arthropods of Canadian Grasslands (Volume 3): Biodiversity and Systematics Part 1 (Eds. Cárcamo, H.A. & D.J. Giberson), pp. 75–137. Biological Survey of Canada. Carter, P.E. & A.L. Rypstra. 1995. Top-down effects in soybean agroecosystems - spider density affects herbivore damage. Oikos, 72: 433–439. Casewell, N.R., Wüster, W., Vonk, F.J., Harrison, R.A., & B.G. Fry. 2013. Complex cocktails: The evolutionary novelty of venoms. Trends in Ecology and Evolution, 28: 219–229. Cassel-Lundhagen, A., Öberg, S., Högfeldt, C., & B. Ekbom. 2009. Species-specific primers for predation studies of the pollen beetle, Meligethes aeneus (Coleoptera, Nitidulidae). Molecular Ecology Resources, 9: 1132–1134. Chapman, E.G., Romero, S.A., & J.D. Harwood. 2010. Maximizing collection and minimizing risk: Does vacuum suction sampling increase the likelihood for misinterpretation of food web connections? Molecular Ecology Resources, 10: 1023–1033. Chapman, E.G., Schmidt, J.M., Welch, K.D., & J.D. Harwood. 2013. Molecular evidence for dietary selectivity and pest suppression potential in an epigeal spider community in winter wheat. Biological Control, 65: 72–86. Chen, Y., Giles, K.L., Payton, M.E., & M.H. Greenstone. 2000. Identifying key cereal aphid predators by molecular gut analysis. Molecular Ecology, 9:1887–1898. Chiu, J.C., Jiang, X.T., Zhao, L., Hamm, C.A., Cridland, J.M., Saelao, P., Hamby, K.A., Lee, E.K., Kwok, R.S., Zhang, G., Zalom, F.G., Walton, V.M., & D.J. Begun. 2013. Genome of Drosophila suzukii, the spotted wing drosophila. G3-Genes Genomes Genetics, 3: 2257–2271. Cini, A., Anfora, G., Escudero-Colomar, L.A., Grassi, A., Santosuosso, U., Seljak, G., & A. Papini. 2014. Tracking the invasion of the alien fruit pest Drosophila suzukii in Europe. Journal of Pest Science, 87: 559–566. Clare, E.L. 2014. Molecular detection of trophic interactions: emerging trends, distinct advantages, significant considerations and conservation applications. Evolutionary Applications, 7: 1144–1157. Clarke, L.J., Soubrier, J., Weyrich, L.S., Cooper, A. 2014. Environmental metabarcodes for insects: In silico PCR reveals potential for taxonomic bias. Molecular Ecology Resources, 14: 1160–1170. Cohen, A.C. 1995. Extra-oral digestion in predaceous terrestrial arthropoda. Annual Review of Entomology, 40: 85– 103. Collatz, K.-G. 1987. I Structure and Function of the Digestive Tract. In: Ecophysiology of Spiders (Ed. Nentwig, W.), pp. 229–238. Springer-Verlag, Berlin, Germany. Comstock, J.H. 1980. The Spider Book (Ed. Gertsch, W.J.). Cornell University Press, London, UK. Copley, C.R. & N.N. Winchester. 2010. Effect of disturbance and distance from a riparian corridor on spiders in a temperate rainforest. Canadian Journal of Forest Research, 40: 904–916. Cutler, B. 1991. Reduced predation on the antlike jumping spider Synageles occidentalis (Araneae: Salticidae). Journal of Insect Behavior, 4: 401–407. Dalton, S. 2011. Spiders: The ultimate predators. Firefly Books Limited, Richmond Hill, Ontario, Canada. Dempster, J.P. 1960. A quantitative study of the predators on the eggs and larvae of the broom beetle, Phytodecta olivacea Forster, using the precipitin test. Journal of Animal Ecology, 29: 149–167. Dennis, P. & G.L.A. Fry. 1992. Field margins: can they enhance natural enemy population densities and general arthropod diversity on farmland? Agriculture, Ecosystems & Environment, 40: 95–115. Doane, J.F. & C.D. Dondale. 1979. Seasonal captures of spiders (Araneae) in a wheat field and its grassy borders in central Saskatchewan. The Canadian Entomologist, 111: 439–445. Dondale, C.D. 1956. Annotated list of spiders (Araneae) from apple trees in Nova Scotia. The Canadian Entomologist, 88: 697–700. Dondale, C.D. 1970. Spiders of Heasman‟s field, a mown meadow near Belleville, Ontario. Proceedings of the Entomological Society of Ontario, 101: 62–69. Dondale, C.D., Parent, B., & D. Pitre. 1979. A 6-year study of spiders (Araneae) in a Quebec apple orchard. The Canadian Entomologist, 111: 377–380. Dondale, C.D. & J.H. Redner. 1978. Part 5: The Crab Spiders of Canada and Alaska (Araneae: Philodromidae and Thomisidae). Supply and Services Canada.

118

Ekbom, B., Kuusk, A.-K., Malsher, G., Åström, S., & A. Cassel-Lundhagen. 2014. Consumption of flea beetles (Phyllotreta, Coleoptera: Chrysomelidae) by spiders in field habitats detected by molecular analysis. The Canadian Entomologist, 146: 639–651. Everly, R.T. 1938. Spiders and insects found associated with sweet corn with notes on the food and habits of some species. I, Arachnida and Coleoptera. The Ohio Journal of Science, 38: 136–148. Foelix, R.F. 2011. Biology of Spiders. Oxford University Press; Oxford & New York. Folmer, O., Black, M., Hoeh, W., Lutz, R., & R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3: 294–299. Fournier, V., Hagler, J., Daane, K., De León, J., & R. Groves. 2008. Identifying the predator complex of Homalodisca vitripennis (Hemiptera: Cicadellidae): A comparative study of the efficacy of an ELISA and PCR gut content assay. Oecologia, 157: 629–640. Fox, C.J.S. & C.D. Dondale. 1972. Annotated list of spiders (Araneae) from hayfields and their margins in Nova Scotia. The Canadian Entomologist, 104: 1911–1915. Furlong, M.J., Rowley, D.L., Murtiningsih, R., & M.H. Greenstone. 2014. Combining ecological methods and molecular gut-content analysis to investigate predation of a lepidopteran pest complex of Brassica crops. Entomologia Experimentalis et Applicata, 153: 128–141. Gibson, J.F., Kelso, S., Jackson, M.D., Kits, J.H., Miranda, G.F.G., & J.H. Skevington. 2011. Diptera-specific polymerase chain reaction amplification primers of use in molecular phylogenetic research. Annals of the Entomological Society of America, 104: 976–997. Gleason, J.M., Caccone, A., Moriyama, E.N., White, K.P., & J.R. Powell. 1997. Mitochondrial DNA phylogenies for the Drosophila obscura group. Evolution, 51: 433–440. Gómez-Polo, P., Alomar, O., Castañé, C., Lundgren, J.G., Piñol, J., & N. Agustí. 2013. Analyzing predation of hoverflies (Diptera: Syrphidae) in Mediterranean lettuce crops using molecular techniques. In: 2nd International Symposium on the Molecular Detection of Trophic Interactions Greenstone, M.H. 1999. Spider predation: How and why we study it. Journal of Arachnology, 27: 333–342. Greenstone, M.H. & A.F. Bennett. 1980. Foraging strategy and metabolic rate in spiders. Ecology, 61: 1255–1259. Greenstone, M.H., Payton, M.E., Weber, D.C., & A.M. Simmons 2014. The detectability half-life in arthropod predator-prey research: what it is, why we need it, how to measure it, and how to use it. Molecular Ecology, 23: 3799–3813. Greenstone, M.H. & K.A. Shufran. 2003. Spider predation: species-specific identification of gut contents by polymerase chain reaction. Journal of Arachnology, 31: 131–134. Greenstone, M.H. & K.D. Sunderland. 1999. Why a symposium on spiders in agroecosystems now? Journal of Arachnology, 27: 267–269. Hagler, J.R. & F. Blackmer. 2013. Identifying inter- and intra-guild feeding activity of an arthropod predator assemblage. Ecological Entomology, 38: 258–271. Hagler, J.R., Blackmer, F., Krugner, R., Groves, R.L., Morse, J.G., & M.W. Johnson. 2013. Gut content examination of the citrus predator assemblage for the presence of Homalodisca vitripennis remains. BioControl, 58: 341–349. Hagley, E.A.C. 1974. The arthropod fauna in unsprayed apple orchards in Ontario II. Some predacious species. Proceedings of the Entomological Society of Ontario, 105: 28–40. Harwood, J.D., Sunderland, K.D., & W.O.C. Symondson. 2004. Prey selection by linyphiid spiders: Molecular tracking of the effects of alternative prey on rates of aphid consumption in the field. Molecular Ecology, 13: 3549– 3560. Harwood, J.D., Sunderland, K.D., & W.O.C. Symondson. 2005. Monoclonal antibodies reveal the potential of the tetragnathid spider Pachygnatha degeeri (Araneae: Tetragnathidae) as an aphid predator. Bulletin of Entomological Research, 95: 161–167. Hauser, M. 2011. A historic account of the invasion of Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) in the continental United States, with remarks on their identification. Pest Management Science, 67: 1352–1357. Holland, J.M., Oaten, H., Moreby, S., Birkett, T., Simper, J., Southway, S., & B.M. Smith. 2012. Agri-environment scheme enhancing ecosystem services: A demonstration of improved biological control in cereal crops. Agriculture, Ecosystems & Environment, 155: 147–152. Holopainen, J. & J. Helenius. 1992. Gut contents of ground beetles (Col, Carabidae), and activity of these and other epigeal predators during an outbreak of Rhopalosiphum padi (Hom, Aphididae). Acta Agriculturae Scandinavica Section B-Soil and Plant Science, 42: 57–61. Hormiga, G. & C.E. Griswold. 2014. Systematics, phylogeny, and evolution of orb-weaving spiders. Annual Review

119

of Entomology, 59: 487–512. Horton, D.R., Miliczky, E.R., Broers, D.A., Lewis, R.R., & C.O. Calkins. 2001. Numbers, diversity, and phenology of spiders (Araneae) overwintering in cardboard bands placed in pear and apple orchards of central Washington. Annals of the Entomological Society of America, 94: 405–414. Horton, D.R., Miliczky, E.R., Jones, V.P., Baker, C.C., & T.R. Unruh. 2012. Diversity and phenology of the generalist predator community in apple orchards of Central Washington State (Insecta, Araneae). The Canadian Entomologist, 144: 691–710. Hosseini, R., Schmidt, O., & M.A. Keller. 2008. Factors affecting detectability of prey DNA in the gut contents of invertebrate predators: A polymerase chain reaction-based method. Entomologia Experimentalis et Applicata, 126: 194–202. Hoy, M.A. 2013. Insect Molecular Genetics - An Introduction to Principles and Applications. Academic Press, London, UK. Huseynov, E.F.O. 2008. Natural prey of the spider Tibellus macellus (Araneae, Philodromidae). Bulletin of the British Arachnological Society, 14: 206–208. Kean, J., Wratten, S., Tylianakis, J., & N. Barlow. 2003. The population consequences of natural enemy enhancement, and implications for conservation biological control. Ecology Letters, 6: 604–612. Kerzicnik, L.M., Chapman, E.G., Harwood, J.D., Peairs, F.B., & P.E. Cushing. 2012. Molecular characterization of Russian wheat aphid consumption by spiders in winter wheat. Journal of Arachnology, 40: 71–77. King, R.A., Davey, J., Bell, J.R., Read, D.S., Bohan, D.A., & W.O.C. Symondson. 2012. Suction sampling as a significant source of error in molecular analysis of predator diets. Bulletin of Entomological Research, 102: 261– 266. King ,R.A., Moreno-Ripoll, R., Agustí, N., Shayler, S.P., Bell, J.R., Bohan, D.A., & W.O.C. Symondson. 2011. Multiplex reactions for the molecular detection of predation on pest and nonpest invertebrates in agroecosystems. Molecular Ecology Resources, 11: 370–373. King, R.A., Read, D.S., Traugott, M., & W.O.C. Symondson. 2008. Molecular analysis of predation: A review of best practice for DNA-based approaches. Molecular Ecology, 17: 947–963. Kobayashi, T., Takada, M., Takagi, S., Yoshioka, A., & I. Washitani. 2011. Spider predation on a mirid pest in Japanese rice fields. Basic and Applied Ecology, 12: 532–539. Kowal, V.A. & R.V. Cartar. 2012. Edge effects of three anthropogenic disturbances on spider communities in Alberta‟s boreal forest. Journal of Insect Conservation, 16: 613–627. Kromp, B. & K.-H. Steinberger. 1992. Grassy field margins and arthropod diversity: a case study on ground beetles and spiders in eastern Austria (Coleoptera: Carabidae; Arachnida: Aranei, Opiliones). Agriculture, Ecosystems & Environment, 40: 71–93. Kuusk, A.-K., Cassel-Lundhagen, A., Kvarnheden, A., & B. Ekbom. 2008. Tracking aphid predation by lycosid spiders in spring-sown cereals using PCR-based gut-content analysis. Basic and Applied Ecology, 9: 718–725. Kuusk, A.-K., & B. Ekbom. 2010. Lycosid spiders and alternative food: Feeding behavior and implications for biological control. Biological Control, 55: 20–26. Kuusk, A.-K. & B. Ekbom. 2012. Feeding habits of lycosid spiders in field habitats. Journal of Pest Science, 85: 253–260. Larrivée, M. & C.M. Buddle. 2009. Diversity of canopy and understorey spiders in north-temperate hardwood forests. Agricultural and Forest Entomology, 11: 225–237. Lee, J.C., Bruck, D.J., Dreves, A.J., Ioratti, C., Vogt, H., & P. Baufeld. 2011. In Focus: Spotted wing drosophila, Drosophila suzukii, across perspectives. Pest Management Science, 67: 1349–1351. Lewis, R.L., Beckenbach, A.T., & A.Ø. Mooers. 2005. The phylogeny of the subgroups within the melanogaster species group: Likelihood tests on COI and COII sequences and a Bayesian estimate of phylogeny. Molecular Phylogenetics and Evolution, 37: 15–24. Li, K., Tian, J., Wang, Q., Chen, Q., Chen, M., Wang, H., Zhou, Y., Peng, Y., Xiao, J., & G.-Y. Ye. 2011. Application of a novel method PCR-ligase detection reaction for tracking predator-prey trophic links in insect- resistant GM rice ecosystem. Ecotoxicology, 20: 2090–2100. Lundgren, J.G., Ellsbury, M.E., & D.A. Prischmann. 2009. Analysis of the predator community of a subterranean herbivorous insect based on polymerase chain reaction. Ecological Applications, 19: 2157–2166. Ma, J., Li, D., Keller, M., Schmidt, O., & X. Feng. 2005. A DNA marker to identify predation of Plutella xylostella (Lep., Plutellidae) by Nabis kinbergii (Hem., Nabidae) and Lycosa sp. (Aranaea, Lycosidae). Journal of Applied Entomology, 129: 330–335. Maretić, Z. 1987. III Spider Venoms and Their Effect. In: Ecophysiology of Spiders (Ed. Nentwig, W.), pp. 142–159. Springer-Verlag, Berlin, Germany.

120

McMillan, S., Kuusk, A.-K., Cassel-Lundhagen, A., & B. Ekbom. 2007. The influence of time and temperature on molecular gut content analysis: Adalia bipunctata fed with Rhopalosiphum padi. Insect Science, 14: 353–358. Mikulska, I. 1970. Some observations on the biology of Tibellus oblongus (Walckenaer) (Araneae). Bulletin - British Arachnological Society, 1: 113–116. Miliczky, E.R., Horton, D.R., & C.O. Calkins. 2008. Observations on phenology and overwintering of spiders associated with apple and pear orchards in south-central Washington. Journal of Arachnology, 36: 565–573. Miller, J.A., Beentjes, K.K., Van Helsdingen, P., & S. Ijland. 2013. Which specimens from a museum collection will yield DNA barcodes? A time series study of spiders in alcohol. ZooKeys, 365: 245–261. Mitsui, H., Takahashi, K.H., & M.T. Kimura. 2006. Spatial distributions and clutch sizes of Drosophila species ovipositing on cherry fruits of different stages. Population Ecology, 48: 233–237. Mommsen, T.P. 1978. Digestive enzymes of a spider (Tegenaria atrica Koch) - III. Esterases, phosphatases, nucleases. Comparative Biochemistry and Physiology Part A: Physiology, 60A: 377–382. Monzó, C., Sabater-Muñoz, B., Urbaneja, A., & P. Castañera. 2010. Tracking medfly predation by the wolf spider, Pardosa cribata Simon, in citrus orchards using PCR-based gut-content analysis. Bulletin of Entomological Research, 100: 145–152. Mullis, K.B. & F.A. Faloona. 1987. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods in Enzymology, 155: 335–350. Nentwig, W. 1980. The selective prey of linyphiid-like spiders and of their space webs. Oecologia, 45: 236–243. Nentwig, W. 1986. Non-webbuilding spiders: prey specialists or generalists? Oecologia, 69: 571–576. Nentwig, W. & C. Wissel. 1986. A comparison of prey lengths among spiders. Oecologia, 68: 595–600. Nørgaard, E. 1956. Environment and behaviour of Theridion saxatile. Oikos, 7: 159–192. Northam, W.T., Allison, L.A., & D.A. Cristol. 2011. Using group-specific PCR to detect predation of mayflies (Ephemeroptera) by wolf spiders (Lycosidae) at a mercury-contaminated site. Science of the Total Environment, 416: 225–231. Nyffeler, M. 1999. Prey selection of spiders in the field. Journal of Arachnology, 27: 317–324. Nyffeler, M. 2000. Ecological impact of spider predation: a critical assessment of Bristowe‟s and Turnbull's estimates. Bulletin of the British Arachnological Society, 11: 367–373. Nyffeler, M. & G. Benz. 1987. Spiders in natural pest control: A review. Journal of Applied Entomology, 103: 321– 339. Nyffeler, M. & G. Benz. 1988. Prey analysis of the spider Achaearanea riparia (Blackw.) (Araneae, Theridiidae), a generalist predator in winter wheat fields. Journal of Applied Entomology, 106: 425–431. Nyffeler, M., Sterling, W., & D. Dean. 1994a. Insectivorous activities of spiders in United-States field crops. Journal of Applied Entomology, 118: 113–128. Nyffeler, M., Sterling, W., & D. Dean. 1994b. How spiders make a living. Environmental Entomology, 23: 1357– 1367. Nyffeler, M. & K.D. Sunderland. 2003. Composition, abundance and pest control potential of spider communities in agroecosystems: A comparison of European and US studies. Agriculture, Ecosystems and Environment, 95: 579– 612. Öberg, S., Cassel-Lundhagen, A., & B. Ekbom. 2011. Pollen beetles are consumed by ground- and foliage-dwelling spiders in winter oilseed rape. Entomologia Experimentalis et Applicata, 138: 256–262. Ometto, L., Cestaro, A., Ramasamy, S., Grassi, A., Revadi, S., Siozios, S., Moretto, M., Fontana, P., Varotto, C., Pisani, D., Dekker, T., Wrobel, N., Viola, R., Cavalieri, D., Blaxter, M., Anfora, G., & O. Rota-Stabelli. 2013. Linking genomics and ecology to investigate the complex evolution of an invasive Drosophila pest. Genome Biology and Evolution, 5: 745–757. Opatovsky, I., Chapman, E.G., Weintraub, P.G., Lubin, Y., & J.D. Harwood. 2012. Molecular characterization of the differential role of immigrant and agrobiont generalist predators in pest suppression. Biological Control, 63: 25–30. Palumbi, S.R. 1996. Nucleic Acids II: The Polymerase Chain Reaction. In: Molecular Systematics (Eds. Hillis, D.M., Moritz, C., & B.K. Mable), pp. 205–247. Sinauer Associates, Inc., Sunderland, Massachusetts, USA. Paradis, S. & T.T. Work. 2011. Partial cutting does not maintain spider assemblages within the observed range of natural variability in Eastern Canadian black spruce forests. Forest Ecology and Management, 262: 2079–2093. Parks J, Stoecker WV, Kristensen C (2006) Observations on Loxosceles reclusa (Araneae, Sicariidae) feeding on short-horned grasshoppers. Journal of Arachnology, 34, 221–226. Pekár S, Coddington JA, Blackledge TA (2011) Evolution of stenophagy in spiders (Araneae): Evidence based on the comparative analysis of spider diets. Evolution, 66, 776–806. Pekár, S. & F. Kocourek. 2004. Spiders (Araneae) in the biological and integrated pest management of apple in the

121

Czech Republic. Journal of Applied Entomology, 128: 561–566. Piggott, M.P. 2004. Effect of sample age and season of collection on reliability of microsatellite genotyping of faecal DNA. Wildlife Research, 31: 485–493. Pinzon, J., Spence, J.R., & D.W. Langor. 2011. Spider assemblages in the overstory, understory, and ground layers of managed stands in the western boreal mixedwood forest of Canada. Environmental Entomology, 40: 797–808. Pinzon, J., Spence, J.R., & D.W. Langor. 2013. Effects of prescribed burning and harvesting on ground-dwelling spiders in the Canadian boreal mixedwood forest. Biodiversity and Conservation, 22: 1513–1536. Platnick, N.I. 2014. The World Spider Catalog. American Museum of Natural History. Pollard, S.D. 1989. Constraints affecting partial prey consumption by a crab spider, Diea sp. indet. (Araneae: Thomisidae). Oecologia, 81: 392–396. Pompanon, F., Deagle, B.E., Symondson, W.O.C., Brown, D.S., Jarman, S.N., & P. Taberlet. 2012. Who is eating what: Diet assessment using next generation sequencing. Molecular Ecology, 21: 1931–1950. Provencher, L., Coderre, D., & C.D. Dondale. 1988. Spiders (Araneae) in corn fields in Quebec. The Canadian Entomologist, 120: 97–100. Pruitt, J.N. & J.J. Krauel. 2010. The adaptive value of gluttony: Predators mediate the life history trade-offs of satiation threshold. Journal of Evolutionary Biology, 23: 2104–2111. Putman, W.L. 1967. Prevalence of spiders and their importance as predators in Ontario peach orchards. The Canadian Entomologist, 99: 160–170. Quan, X., Wu, L., Zhou, Q., Yun, Y., Peng, Y.-F., & J. Chen. 2011. Identification of predation by spiders on the diamondback moth Plutella xylostella. Bulletin of Insectology, 64: 223–227. Ratnasingham, S. & P. Hebert. 2007. bold: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes, 3: 355–364. doi: 10.1111/j.1471-8286.2007.01678.x Riechert, S.E. & L. Bishop. 1990. Prey control by an assemblage of generalist predators: Spiders in garden test systems. Ecology, 71: 1441–1450. Riechert, S. & T. Lockley. 1984. Spiders as biological control agents. Annual Review of Entomology, 29: 299–320. Rydzak, S.P. & D.W. Killebrew. 1982. Seasonal diversity and relative abundance of herbaceous dwelling crab spiders in Smith County, Texas. BIOS, 53: 4–11. Sackett, T.E., Buddle, C.M., & C. Vincent. 2008. Comparisons of the composition of foliage-dwelling spider assemblages in apple orchards and adjacent deciduous forest. The Canadian Entomologist, 140: 338–347. Samu, F., Beleznai, O., & G. Tholt. 2013. A potential spider natural enemy against virus vector leafhoppers in agricultural mosaic landscapes - Corroborating ecological and behavioral evidence. Biological Control, 67: 390– 396. Samu, F. & Z. Bíró. 1993. Functional response, multiple feeding and wasteful killing in a wolf spider (Araneae: Lycosidae). European Journal of Entomology, 90: 471–476. Samu, F. & C. Szinetár. 2002. On the nature of agrobiont spiders. Journal of Arachnology, 30: 389–402. Seeber, J., Rief, A., Seeber, G.U.H., Meyer, E., & M. Traugott. 2010. Molecular identification of detritivorous soil invertebrates from their faecal pellets. Soil Biology and Biochemistry, 42: 1263–1267. Sheppard, S.K., Bell, J., Sunderland, K.D., Skervin, F.D., & W.O.C. Symondson. 2005. Detection of secondary predation by PCR analyses of the gut contents of invertebrate generalist predators. Molecular Ecology, 14: 4461– 4468. Sint, D., Niederklapfer, B., Kaufmann, R., & M. Traugott. 2014. Group-specific multiplex PCR detection systems for the identification of flying insect prey. PLoS ONE, 9: e115501. Sint, D., Raso, L., Kaufmann, R., & M. Traugott. 2011. Optimizing methods for PCR-based analysis of predation. Molecular Ecology Resources, 11: 795–801. Sint, D., Raso, L., & M. Traugott. 2012. Advances in multiplex PCR: Balancing primer efficiencies and improving detection success. Methods in Ecology and Evolution, 3: 898–905. Sint, D., Thurner, I., Kaufmann, R., & M. Traugott. 2015. Sparing spiders: faeces as a non-invasive source of DNA. Frontiers in Zoology, 12: 3. doi: 10.1186/s12983-015-0096-y Sittertz-Bhatkar, H. 1980. Oral cleansing in spiders is gland mediated. Zeitschrift für Naturforschung C, 35: 669– 673. Štokmane, M. & V. Spuņģis. 2014. Diversity of grass-dwelling spiders (Arachnida: Araneae) in calcareous fens of the Coastal Lowland, Latvia. Journal of Insect Conservation, 18: 757–769. Sunderland, K., Crook, N., Stacey, D., & B. Fuller. 1987. A study of feeding by polyphagous predators on cereal aphids using ELISA and gut dissection. Journal of Applied Ecology, 24: 907–933. Symondson, W.O.C. 2002. Molecular identification of prey in predator diets. Molecular Ecology, 11: 627–641. Symondson, W.O.C. 2012. The Molecular Revolution: Using Polymerase Chain Reaction based Methods to Explore

122

the Role of Predators in Terrestrial Food Webs. In: Biodiversity and Insect Pests: Key Issues for Sustainable Management, pp. 166–184. Symondson, W.O.C. & J.D. Harwood. 2014. Special issue on molecular detection of trophic interactions: Unpicking the tangled bank. Molecular Ecology, 23: 3601–3604. Szendrei, Z., Bryant, A., Rowley, D., Furlong, M.J., Schmidt, J.M., & M.H. Greenstone. 2014. Linking habitat complexity with predation of pests through molecular gut-content analyses. Biocontrol Science and Technology, 24: 1425–1438. Tian, J.-C., Chen, Y., Li, Z.-L., Li, K., Chen, M., Peng, Y.-F., Hu, C., Shelton, A.M. & G.-Y. Ye. 2012. Transgenic Cry1Ab rice does not impact ecological fitness and predation of a generalist spider. PLoS ONE, 7: e35164. Traugott, M., Bell, J.R., Raso, L., Sint, D., & W.O.C. Symondson. 2012. Generalist predators disrupt parasitoid aphid control by direct and coincidental intraguild predation. Bulletin of Entomological Research, 102: 239–247. Traugott, M., Kamenova, S., Ruess, L., Seeber, J. & M. Plantegenest. 2013. Empirically characterising trophic networks: What emerging DNA-based methods, stable isotope and fatty acid analyses can offer. In: Ecological Networks in an Agricultural World (Eds. Woodward, G. & D.A. Bohan), pp. 177–224. Elsevier Academic Press Incorporated, San Diego, California, USA. Traugott, M. & W.O.C. Symondson. 2008. Molecular analysis of predation on parasitized hosts. Bulletin of Entomological Research, 98: 223–231. Trubl, P., Blackmore, V., & J.C. Johnson. 2011. Wasteful killing in urban black widows: Gluttony in response to food abundance. Ethology, 117: 236–245. Turnbull, A.L. 1966. A population of spiders and their potential prey in an overgrazed pasture in eastern Ontario. Canadian Journal of Zoology, 44: 557–583. Vandereycken, A., Durieux, D., Joie, E., Sloggett, J.J., Haubruge, E., & F.J. Verheggen. 2013. Is the multicolored Asian ladybeetle, Harmonia axyridis, the most abundant natural enemy to aphids in agroecosystems? Journal of Insect Science (Online), 13: 158. Available online: http://www.insectscience.org/13.158 Vink, C. & J. Kean. 2013. PCR gut analysis reveals that Tenuiphantes tenuis (Araneae: Linyphiidae) is a potentially significant predator of Argentine stem weevil, Listronotus bonariensis (Coleoptera: Curculionidae), in New Zealand pastures. New Zealand Journal of Zoology, 40: 304–313. Virant-Doberlet, M., King, R.A., Polajnar, J., & W.O.C. Symondson. 2011. Molecular diagnostics reveal spiders that exploit prey vibrational signals used in sexual communication. Molecular Ecology, 20: 2204–2216. Wade, D. & R. Roughley. 2010. Responses of a Tallgrass Prairie Spider (Araneae) Community to Various Burn Seasons and Its Importance to Tallgrass Prairie Management. In: Arthropods of Canadian Grasslands (Volume 1): Ecology and Interactions in Grassland Habitats (Eds. Shorthouse, J.D. & K.D. Floate), pp. 237–249. Biological Survey of Canada. Walsh, D.B., Bolda, M.P., Goodhue, R.E., Dreves, A.J., Lee, J., Bruck, D.J., Walton, V.M., O'Neal, S.D., & F.G. Zalom . 2011. Drosophila suzukii (Diptera: Drosophilidae): Invasive pest of ripening soft fruit expanding its geographic range and damage potential. Journal of Integrated Pest Management, 2: 1–7. Wegener, C. 1998. Predation on the grassbug species Notostira elongata (Heteroptera: Miridae) by Nabidae (Heteroptera) and selected non-webbuilding spiders (Araneae). Entomologia Generalis, 22: 295–304. Weyman, G.S. 1993. A review of the possible causative factors and significance of ballooning in spiders. Ethology Ecology & Evolution, 5: 279–291. Wheeler, Jr., A.G. 1973. Studies on the arthropod fauna of alfalfa V. Spiders (Araneida). The Canadian Entomologist, 105: 425–432. Wise, D.H. 1993. Spiders in Ecological Webs. University Press, Cambridge, UK. Woods, M.W. & R.C. Harrel. 1976. Spider populations of a southeast Texas rice field. The Southwestern Naturalist, 21: 37–47. Young, O.P. & G.B. Edwards. 1990. Spiders in United States field crops and their potential effect on crop pests. Journal of Arachnology, 18: 1–27. Zaidi, R.H., Jaal, Z., Hawkes, N.J., Hemingway, J., & W.O.C. Symondson. 1999. Can multiple-copy sequences of prey DNA be detected amongst the gut contents of invertebrate predators? Molecular Ecology, 8: 2081–2087. Zeale, M.R.K., Butlin, R.K., Barker, G.L., Lees, D.C., & G. Jones. 2011. Taxon-specific PCR for DNA barcoding arthropod prey in bat faeces. Molecular Ecology Resources, 11: 236–244. Zhang, G.F., Lü, Z.C., & F.H. Wan. 2007a. Detection of Bemisia tabaci remains in predator guts using a sequence- characterized amplified region marker. Entomologia Experimentalis et Applicata, 123: 81–90. Zhang, G.F., Lü, Z.C., Wan, F.H., & G.L. Lövei. 2007b. Real-time PCR quantification of Bemisia tabaci (Homoptera: Aleyrodidae) B-biotype remains in predator guts. Molecular Ecology Notes, 7: 947–954.

123

APPENDIX I

LITERATURE SOURCES FOR PREY DETECTION METHODS

Table I.1 – Sources for methods of detecting prey consumption in spiders. Method Sources Observation Visual Nyffeler et al. (1994a); Symondson (2002); Nyffeler & Sunderland (2003); Hagler & Blackmer (2013)

Protein Monoclonal antibodies Chen et al. (2000); Symondson (2002); Fournier et al. (2008); Traugott et al. (2013); Greenstone et al. (2014)

DNA Standard PCR Chen et al. (2000); Traugott & Symondson (2008); Kobayashi et al. (2011); Symondson (2012); Traugott et al. (2013); Greenstone et al. (2014); Sint et al. (2014) Multiplex PCR Traugott & Symondson (2008); Pompanon et al. (2012); Symondson (2012); Traugott et al. (2013); Sint et al. (2014) Next generation sequencing Pompanon et al. (2012); Symondson (2012); Traugott et al. (2013)

124

APPENDIX II

SPIDERS STUDIED USING POLYMERASE CHAIN REACTION

Table II.1 – Studies using PCR to detect the DNA of prey consumed by spiders. Spider taxa investigated Prey taxaa Assayb Settingc Study Oxyopes salticus Rhopalosiphum maidis S L Greenstone & Shufran (2003) Misumenops sp. Erigone atra Isotoma anglicana M L/F Agustí et al. (2003) Lycosa sp. Plutella xylostella S L/F Ma et al. (2005) Tenuiphantes tenuis Sitobion avenae S L Sheppard et al. (2005) Erigonnidium graminicolum Bemesia tabaci S L/Fd Zhang et al. (2007a) Neoscona doenitzi E. graminicolum B. tabaci Se L(/F)d Zhang et al. (2007b) N. doenitzi Mangora acalypha S. avenae S F Birkhofer et al. (2008) Pardosa palustris Xysticus cristatus Spider assemblage Homalodisca vitripennis S F Fournier et al. (2008) Venator spenceri P. xylostella S L Hosseini et al. (2008) Pardosa spp. (89% P. Rhopalosiphum padi S L/F Kuusk et al. (2008) agrestis) Erigone sp. Lysiphlebus testaceipes S, M L Traugott & Symondson (2008) Aphis fabae Pardosa sp. Meligethes aeneus S L Cassel-Lundhagen et al. (2009) Lycosidae, other spiders Diabrotica virgifera Se L/F Lundgren et al. (2009) Glenognatha foxi Aphididae S F Chapman et al. (2010) Collembola Pardosa spp. (89% P. agrestis) Collembola S L/F Kuusk & Ekbom (2010) Pardosa cribata Ceratitis capitata S L/F Monzó et al. (2010) Pardosa agrarian Stenotus rubrovittatus Sf L/F Kobayashi et al. (2011) Tetragnatha spp. Pirata subpiraticus Chilo suppressalis Sg L/F Li et al. (2011) Nilaparvata lugens Laodelphax striatellus Nephotettix bipunctatus S. avenae Cyrtorhinus lividipennis Lycosidae spp. Ephemeroptera S L/F Northam et al. (2011) Pardosa, Theridion M. aeneus S F Öberg et al. (2011) Ebrechtella tricuspidata P. xylostella S L/F Quan et al. (2011) Pardosa spp. Pardosa spp. Acheta domesticus S L Sint et al. (2011) Pardosa amentata Aphrodes makarovi S L/F Virant-Doberlet et al. (2011) Enoplognatha ovata Trochosa ruricola live S. avenae S L von Berg et al. (2012) Pachygnatha degeeri dead R. padi Spider assemblage Cydia pomonella M F Boreau de Roincé et al. (2012) Grapholita molesta Tetragnatha laboriosa Diuraphis noxia S L/F Kerzicnik et al. (2012) Pardosa sternalis Bathyphantes gracilis Collembola S F King et al. (2012) T. tenuis Erigone spp.

125

P. degeeri Pardosa sp. R. padi S F Kuusk & Ekbom (2012) Collembola Linyphiidae (>5 spp.) Mayetiola destructor S F Opatovsky et al. (2012) Enoplognatha spp. Aphididae Collembola Pardosa pseudoannulata N. lugens S L/F Tian et al. (2012) Spider assemblage S. avenae S F Traugott et al. (2012) (95% Linyphiidae) Ephedrus plagiator Aphidius spp. Dendrocerus carpenteri Spider assemblage Aphididae S F Boreau de Roincé et al. (2013) Tennesseellum formicum Sinella curviseta S L/F Chapman et al. (2013) G. foxi (Trimorus) (Aphididae) (Brachycera) Phidippus audax B. tabaci S L/F Hagler & Blackmer (2013) Misumenops celer Lygus hesperus (spp.) [pooled] Geocoris punctipes (spp.) (Collops vittatus) Spider assemblage H. vitripennis S F Hagler et al. (2013) T. tenuis Listronotus bonariensis S F Vink & Kean (2013) Pardosa Phyllotreta spp. S L/F Ekbom et al. (2014) Spider assemblage Crocidolomia pavonana S, M F Furlong et al. (2014) P. xylostella P. rapae Spider assemblage P. xylostella S F Szendrei et al. (2014) Pieris rapae a if laboratory and field studies targeted different organisms, prey DNA detected from only field spiders and not lab spiders are in parentheses. In some cases, a prey species was used in lab feeding experiments, but primers amplified prey congeners; this was represented by adding “(spp.)” after the species used in the feeding experiment b S = standard PCR; M = multiplex PCR c L = laboratory; F = field d predators collected in cotton that tested positive in a previous experiment were retested using qPCR e qPCR f nested PCR g ligase detection reaction

126

Table II.2 – List of spiders in studies using PCR to determine the molecular half-life (T50) for a region of prey DNA. Results from this thesis are bolded. Predator(s) Prey Taxona Prey Time starved Feeding Amplicon DNA gene T50c Reference details (days) timeb (h) size (bp) region (h) Linyphiidae Erigone atra Collembola (A) 1 14 1.5 276 COI >24 Agustí et al. (2003) Tennesseellum formicum Collembola (A) 1 5 2 180 18S 32 Chapman et al. (2013) Tenuiphantes tenuis Hemiptera (P) ad libitum 14 1 110 COI 59.8 Sheppard et al. (2005) Lycosidae Lycosidae spp. Coleoptera (P) 1 early 3rd instar 2 0.08 119 COI >6 Lundgren et al. (2009) Lycosa sp. Lepidoptera (P) 4th instar 7 2 275 ITS-1 96 (1) Ma et al. (2005) same fragment >120 (2) Pardosa agrarian Hemiptera (P) 1 adult 14 NR 246, 239 COI 193.7 [16] Kobayashi et al. (2011)d same fragment 82.3 [25] P. amentata Hemiptera (A) ½ adult 14 3 289 COI >120 Virant-Doberlet et al. (2011) (lengthwise) 348 COI >120 P. cribata Diptera (P) 1 adult 7 3 130 ITS-1 78.1 Monzó et al. (2010) 333 ITS-1 78.3 P. pseudoannulata Hemiptera (P) 1 female 15 NR 351 COI 49.8 Tian et al. (2012) P. sternalis Hemiptera (P) 2 7 NR 227 COI 2 Kerzicnik et al. (2012) Pardosa Coleoptera (P) 1 2nd instar 7 NR 163 COI ~40 Cassel-Lundhagen et al. (2009) 266 COI ~36 290 COI ~40 Pardosa Coleoptera (P) 1 adult 7 0.25-0.33 188 COI 10.7 Ekbom et al. (2014) Pardosa spp.e Hemiptera (P) 1 4th instar or 4 0.25-0.33 331 COII 3.7 Kuusk et al. (2008) adult Pardosa spp.f Collembola (A) 1 adult 7 0.08-0.33 272 18S <24 Kuusk & Ekbom (2010) Pardosa spp. Lepidoptera (P) 1 4th instar 7 NR 275 ITS-1 72 Quan et al. (2011) Pardosa spp.g Orthoptera (A) 1 small 7 2 116 COI >84 Sint et al. (2011) 350 COI >84 555 COI 79.2 Pirata subpiraticus Lepidoptera (P) 1 1 NR 650 COI ~20 Li et al. (2011)h Hemiptera (P) 1 same fragment ~14 Hemiptera (P) 1 same fragment ~9 Hemiptera (P) 1 same fragment ~20 Hemiptera (P) 1 same fragment ~6 Hemiptera (B) 1 same fragment ~14 Venator spenceri Lepidoptera (P) 1 4th instar 7 0.5-0.75 293 COI 49.6 Hosseini et al. (2008) Philodromidae Tibellusi Diptera (P) 1 adult 14 2 543 COI 25 28 6 52

127

Oxyopidae Oxyopes salticus Hemiptera (P) 1, then 5 chase 3 4-12 198 COII >12 Greenstone & Shufran (2003) Salticidae Phidippus audaxj Hemiptera (P) 1 adult 2 NR 139 COI 0 Hagler & Blackmer (2013) Hemiptera (P) 1 adult 323 COI ~6 Hemiptera (B) 1 2nd instar 131 COI ~30 Tetragnathidae Glenognatha foxi Collembola (A) 1 5 2 180 18S 9.5 Chapman et al. (2013) Tetragnatha laboriosa Hemiptera (P) 1 7 NR 227 COI 4.2 Kerzicnik et al. (2012) Tetragnatha spp.k Hemiptera (P) 1 adult 14 NR 246, 239 COI 94.1 [16] Kobayashi et al. (2011) same fragment 36.5 [25] Theridiidae Enoplognatha ovata Hemiptera (A) 1 nymph 7 3 289 COI 65.8 Virant-Doberlet et al. (2011) 348 COI 72.8 Thomisidae Ebrechtella tricuspidata Lepidoptera (P) 1 4th instar 7 NR 275 ITS-1 36 Quan et al. (2011) Misumenops celerj Hagler & Blackmer (2013) a in parentheses: A = alternate prey, B = beneficial arthropods, P = agricultural pests b NR = not reported c parentheses used when T50 differed due to specific conditions; round brackets show prey number and square brackets show temperature (°C); values preceded by „~‟ indicate interpolation from source data d nested PCR e 94% P. agrestis; 6% P. palustris & P. prativaga f 89% P. agrestis, 7% P. palustris, 4% P. prativaga g P. nigra and P. saturatior h ligase detection reaction i T. maritimus and T. oblongus j results pooled for both spiders k Tetragnatha praedonia, T. extensa, T. caudicula, T. maxillosa

128

APPENDIX III

SPIDERS COLLECTED IN CANADIAN AGROECOSYSTEMS

Table III.1 – Summary of number of named spider species collected from agroecosystems across Canada. Province of interest bolded; spider family of interest italicized. Family

Total Total

Agroecosystem Prov. Agelenidae Amaurobiidae Anyphaenidae Araneidae Clubionidae Corrinidae Dictynidae Eutichuridae Gnaphosidae Hahniidae Linyphiidae Liocranidae Lycosidae Mimetidae Philodromidae Pholcidae Phrurolithidae Pisauridae Salticidae Tetragnathidae Theridiidae Theridiosomatidae Thomisidae Trachelidae Uloboridae fam. sp. Authors Meadowa ON 1 2 1 7 2 3 7 11 2 38 18 6 2 1 15 3 11 16 1 19 147 Dondale (1970) Hardwood QC 2 14 4 2 16 3 1 3 1 5 3 13 1 4 1 15 73 Larrivée & Buddle (2009) Orchards (apple) NS 4 1 2 7 2 4 1 13 1 6 10 2 13 7 14 73 Dondale (1956) Mixedwood/Meadow MB 1 1 1 2 5 3 22 2 5 2 2 2 1 2 1 4 15 56 Aitchison (1984) Wheat/Field margin SK 2 1 1 3 6 1 5 1 15 5 2 2 2 9 14 55 Doane & Dondale (1979) Hayfields NS 2 2 1 1 6 3 12 1 6 2 1 1 1 8 14 47 Fox & Dondale (1972) Orchard (apple)/ QC 5 5 2 1 5 4 6 1 8 6 10 43 Sackett et al. (2008) Forest margin Orchard (apple) ON 1 3 2 1 2 1 3 5 1 10 2 5 4 1 14 41 Hagley (1974) Orchard (apple) QC 6 1 14 5 3 1 7 4 8 41 Dondale et al. (1979) Grazed pasturea ON 1 1 2 2 1 1 1 12 4 2 1 1 3 1 4 15 37 Turnbull (1966) Tallgrass prairieb MB 1 2 4 2 9 1 2 4 8 25 Wade & Roughley (2010) Orchard (peach)b ON 2 1 3 3 2 5 2 2 1 9 21 Putman (1967) Grain corn QC 1 2 2 1 4 1 1 4 1 9 17 Provencher et al. (1988) a studies conducted at same site b most common spiders reported; unknown total identified by Putman (1967), but 126 species total from 17 families identified by Wade & Roughley (2010)

129

APPENDIX IV

OCCURRENCES OF TIBELLUS SPECIES

Table IV.1 – Occurrences of Tibellus species (Araneae: Philodromidae) from ecosystems in Canada and northern USA. Tibellus Ecosystem Province/ % of spider Sampling Notes Authors species State/Region fauna methoda asiaticus Apple/pear canopy/understory WA n/a BC, SW, H Miliczky et al. (2008) asiaticus Unknown Prairies n/a n/a Cárcamo et al. (2014) duttoni Aspen parkland MB 0.004 PF, SW Cárcamo et al. (2014) maritimus Mixedwood coniferous forest AB 0.086 PFb Kowal & Cartar (2012) maritimus Wheat field margin SK 0.08 PF Doane & Dondale (1979) maritimus Moist mixed grassland, tallgrass OH 0.01–0.3 SW, PF 4 localities Cárcamo et al. (2014) prairie grassland, aspen parkland maritimus Boreal mixedwood forest AB n/a BC, PF only in harvested conifer-dominated stand Pinzon et al. (2011) maritimus Boreal mixedwood forest Prairies n/a PF Pinzon et al. (2013) maritimus Oak grove/long grass meadow MB n/a PF juveniles winter-active Aitchison (1984) oblongus Mixed grassland, moist mixed Prairies 0.004–0.95 BC, PF, SW 6 localities Cárcamo et al. (2014) grassland, aspen parkland, tallgrass aspen, boreal transition oblongus Regenerating coniferous forest BC 0.69 M equal demography (11F, 9M, 20 juveniles) Copley & Winchester (2010) oblongus Apple OR 0.09 BC Bajwa & Aliniazee (2001) oblongus Mixedwood coniferous forest AB 0.07 PFb Kowal & Cartar (2012) oblongus Black spruce forest QC 0.017 PF found in both clear cut and partial cut Paradis & Work (2011) oblongus Meadow ON rare V Dondale (1970) oblongus Alfalfa NY n/a P, SW, PF immatures overwinter/ground-active, Wheeler, Jr. (1973) adults only on plants; sometimes captured at nocturnal hours; late May to mid-Oct oblongus Apple/pear canopy/understory WA n/a BC, SW, H, C 83% in understory, occasionally on trees; Miliczky et al. (2008) overwinter as immatures oblongus Apple ON n/a BC, H, F 9 localities Dondale (1956) oblongus Boreal mixedwood forest AB n/a PF only found in areas after prescribed burn Pinzon et al. (2013) oblongus Oak grove/long grass meadow MB n/a PF juveniles winter active Aitchison (1984) oblongus Sweet corn NS n/a H Everly (1938) unidentified Apple/pear lower strata WA 0.1 C Horton et al. (2001) unidentified Apple ON n/a S, PF, BC Hagley (1974) unidentified Apple WA n/a BC Horton et al. (2012) a BC = beating stick & cloth, C = cardboard, F = fumigation, H = hand, M = Malaise, P = plant, PF = pitfall, SW = sweepnetting, V = vacuum b pitfalls complemented by yellow pan traps

130

Table IV.2 – Occurrences of Tibellus in habitats when their frequency among spiders was > 0.1%. Habitat Country % of spider Sampling Tibellus Notes Source fauna methoda species Phytocoenosis of Elymus repens Germany “dominant” SW oblongus (% not reported) Wegener (1998) Roadside fields USA 43.6*, b SW oblongus highest relative abundance winter* Rydzak & Killebrew (1982) Calcareous fens Latvia 31 SW maritimus overall 2nd most abundant species Štokmane & Spuņģis (2014) 10 years of sampling grassy Hungary 13 PF, V oblongus 99.3% caught using vacuum Samu et al. (2013) field margins Sand dunes Sweden 5.57 H, S oblongus Almquist (1969) Peanut USA ~5 H, PF, SW duttoni caught regularly and one of the two Agnew et al. (1985) most abundant philodromids Rice field USA 1.86 PF, SW, A twoc June to September, November Woods & Harrel (1976) Mixed grassland Canada 0.95 PF oblongus Cárcamo et al. (2014) Canola/moist mixed grassland Canada 0.91 SW twoc Cárcamo et al. (2014) Ancient/regenerating forest Canada 0.69 M oblongus Copley & Winchester (2010) Aspen parkland Canada ≥0.5 and <5d SW oblongus Cárcamo et al. (2014) Canola/moist mixed grassland Canada 0.3 SW twoc Cárcamo et al. (2014) Control (no chemical) and Czech Republic 0.26 BC oblongus Pekár & Kocourek (2004) BPMe apple orchard a A = aspirator, BC = beating stick & cloth, H = hand, PF = pitfall, M = Malaise, S = sieving, SW = sweepnet, V = vacuum (mechanical suction device) b only crab spiders (Thomisidae, Philodromidae) examined c both T. oblongus and T. maritimus reported d represented is the “frequent” proportion range, sensu international ACFOR standard e BPM = biological pest management (exclusively using biological methods of pest control)

131

APPENDIX V

SITES FOR THE COLLECTION OF SPIDERS

Table V.1 – Collection sites of spiders used in PCR assays. N = number of spiders assayed using the 543-bp PCR assay. Experiment code Na Coordinates Site description Dominant florab Collection date (sensu Chapter 2) 2.2.1a, 2*, N43°31‟36‟‟, W80°13‟55‟‟ unmown meadow adjacent to Elymus repens; Solidago spp.; late Oct. 2012 2.2.4a (Tibellus) 8** woodland; urban thistle; Aster spp. Total 8 2.2.4a (Tetragnatha) 2 N43°40‟28‟‟, W80°25‟24‟‟ backyard sampling; rural/urban in specific area: tall grass; in Oct. 2012 general: no dominant flora and Total 2 >100 plant spp. 2.2.4b, 3‡ & 5x, N43°39‟27‟‟, W80°24‟43‟‟ wide roadside field margin (3–4 m) E. repens Aug. – Oct. 2013 2.2.4c, 12 adjacent to leys; rural 2.3.1, 32‡‡, 2.4.1a, 63xx, 2.4.2a, 8, 2.4.2b, 19, 2.4.3 30 Total 164 2.3.2, 9 ††, N43°27‟39‟‟, W80°16‟30‟‟ wide roadside field margin (3–4 m) E. repens Aug. 2014 2.3.4 4† & 5 adjacent to corn; rural Total 14 2.2.2b (17 spp.)c, 20, same site as above Mid Sept. – early Oct. 2014 2.2.4b, 1°, 2.2.4c, 3, 2.3.3, 6°, 2.4.1b 80°° Total 103 a one superscript symbol denotes a group of spiders that was used for multiple experiments, the other experiment group of spiders is labelled by two superscript symbols of the same kind b most abundant species underlined c Hypselistes sp. and 1 other Araneidae sp. (Araneae: Araneidae); 1 Clubionidae or Miturgidae sp.; 1 Dictynidae sp.; 1 Liocranidae sp.; 1–2 Philodromus spp., 1 Thanatus sp., 1–2 Tibellus spp. (Araneae: Philodromidae); 1 Phidippus sp. and 4 other Salticidae spp. (Araneae: Salticidae); 1 Tetragnatha sp. (Araneae: Tetragnathidae); 1 Mecaphesa sp. (Araneae: Thomisidae); and 1 unidentifiable juvenile (not counted). Total species (17) is the most conservative estimate.

132

APPENDIX VI

PRELIMINARY EXPERIMENT TO DETERMINE OPTIMAL PRIMER CONCENTRATIONS

FOR THE 543-BP PCR ASSAY

Since ingested prey DNA is expected to be degraded and targeted regions may be present in low quantities, the sensitivity of a PCR assay needs to be optimized. To develop an optimized assay that could reliably detect low quantities of D. suzukii DNA, I investigated the optimum concentrations of 500F and 500R primers for amplifying the 543-bp region of COI DNA from genomic D. suzukii DNA during PCR. Following the protocol described in section 2.1.4a, the

DNA of an adult D. suzukii was extracted and had a concentration of 15 ng·µL-1. Using micropipettes, the D. suzukii extract was diluted one hundred- and one thousand-fold in nuclease-free water to concentrations of 150 pg·µL-1 and 15 pg·µL-1, respectively. Primers were also diluted in water so that the final concentrations would be 40, 100, 200, 300, 400, and 500 nM. These values were selected for testing based on the primer concentrations recommended by the manufacturer of GoTaq® Master Mix (100–500 nM). It was assumed that the primers would work optimally if the concentrations of the forward and reverse primers matched. Each primer concentration was used to amplify DNA from each dilution of D. suzukii extract once. PCR and visualization of PCR products followed the prescribed protocols in sections 2.1.4b and 2.1.4c.

All of the results were compared directly on a single gel.

This experiment evaluated the ability of various concentrations of the 500 F/R primer set to detect low amounts of D. suzukii DNA (between 0.015–15 ng DNA). The assay showed that all primer concentrations (40–500 nM) amplified detectable target DNA from undiluted template

DNA (Figure VI.1). Target DNA was also successfully detected from diluted target DNA in

133 most cases. However, the 40 nM primer concentration showed inconsistent detection of target

DNA, suggesting it was inadequate for detecting consumed and partially digested prey DNA.

Primers concentrations in the range of 200–500 nM consistently amplified target DNA (Figure

VI.1), suggesting this range of primer concentrations is indeed productive in detecting small amounts of DNA. Overall, primers at higher concentrations (≥300 nM) were more successful at detecting diluted target DNA compared to primers at lower concentrations. Thus, considering there was no apparent disadvantage from using the highest concentration of primers (500 nM), these were selected and incorporated into the 543-bp PCR assay.

Figure VI.1 – PCR amplification of genomic D. suzukii DNA (15 ng·µL-1) using a range of 500F/R primer concentrations (40, 100, 200, 300, 400, & 500 nM.). Lanes 8 & 16: 100 bp DNA ladder (500 bp marked by arrow). Lanes 4, 19, 22, & 24: NPCs. Lanes 1-3 & 5-7: 15 ng D. suzukii DNA (undiluted). Lanes 10-15: 0.15 ng D. suzukii DNA. Lanes 17, 18, 20, 21, 23, & 25: 0.015 ng D. suzukii DNA. Primer concentrations increase from left to right for each dilution level.

134

APPENDIX VII

RESULTS FOR IN SILICO AND IN VITRO SPECIFICITY TESTS

Table VII.1 – Possible sources of non-specific amplification for 500F/R primers. Primers considered individually for the in silico BLAST search of matching DNA sequences. Primers were used together to screen DNA from field-collected arthropods to determine in vitro specificity. Organism taxonomy In silico specificitya In vitro specificityb Class Order Family Genus Species F n R n Result n Actinopterygii Cypriniformes Cyprinidae Desmopuntius pentazona x 1 Perciformes Pomacentridae Abudefduf vaigiensis x 1 Arachnida Araneae sp. (unknown juvenile) 00 1 Araneidae sp. 00 1 Hypselistes sp. ' /0 1/1 Dictynidae sp. 00 1 Eutichuridae sp. 0 1 Liocranidae sp. 0 1 Philodromidae Philodromus sp. ' /0 1/1 Thanatus sp. ' 1 Tibellus sp. ' /0 1/2 Salticidae sp. 0/00 3/1 Phidippus sp. 0 1 Tetragnathidae sp. 00 1 Thomisidae Mecaphesa sp. 0 1 Pseudoscorpiones sp. ' 1 Trombidiformes sp. 00 1 Lebertiidae Lebertia sp. x 1 Clitellata Arhynchobdellida Orobdellidae Orobdella masaakikuroiwai x 3 Entognatha Collembola Isotomidae Parisotoma notabilis x 1 Insecta Coleoptera sp. ' 1 Buprestidae Actenodes calcarata x 1 Coomaniella purpurascens x 1 Carabidae Badister sp. 00 1 bullatus x 1 Calathus micropterus x 1 Oodes helopioides x 2 Pogonistes convexicollis x 1 Sarticus esmeraldipennis x 1 Chrysomelidae sp. 00 1 Altica carinthiaca x 3

135

Galerucella sagittariae x 1 Labidostomis tridentata x 1 Coccinellidae Coleomegilla maculata 00 1 Harmonia axyridis * 1 Curculionidae sp. * 1 Elatyridae Pectocera maruyamai x 1 fortunei x 10 amamiinsulana x 2 Sphindidae sp. x 1 Staphylinidae Acrolocha sulcula x 1 Atheta nigripes x 2 Devia prospera x 1 Gyrophaena fasciata x 2 Meotica pallens x 1 Phloeopora concolor x 1 Dermaptera Forficulidae sp. ' 1 Diptera sp. */ ' 3/6 Ceratopogonidae Culicoides sp. x 1 Chironomidae Procladius sp. x 1 Chloropidae sp. x 2 Culicidae sp. ' 1 Anopheles albitarsis x 9 deaneorum x 1 Dolichopodidae sp. x 1 Drosophilidae Drosophila diamphidiopoda x 1 funebris x 2 yakuba x 27 santomea x 5 teissieri x 1 melanogaster * 1 suzukii ^ 2 Scaptomyza varia x 1 scoloplichas x 1 exigua x 1 Ephydridae Polytrichophora sp. x 1 Sciomyzidae sp. * 1 Syrphidae Merodon pruni x 1 clavipes x 1 Tachinidae sp. x 1 Tephritidae Bactrocera cucurbitae x 39

136

Organism taxonomy In silico specificitya In vitro specificityb Class Order Family Genus Species F n R n Result n Tephritidae Bactrocera carambolae x 1 Tipulidae sp. ' 1 Hemiptera Aphididae sp. ^/ ' 1/1 Cicadellidae Draeculacephela zeae * 1 Gerridae Gerris argentatus x 1 Issidae Acanalonia bivittata 00 1 Miridae Lygus lineolaris ' 1 Nabidae sp. */ ' 1/1 Nabis brevis x 1 Hymenoptera sp. ' /00 2/3 Braconidae Apanteles sp. x 2 Formicidae sp. 00 2 Halictidae Pseudagapostemon brasiliensis x 1 Lepidoptera Crambidae Scoparia annulata x 6 Spoladea recurvalis x 1 Lasiocampidae Dendrolimus spectabilis x 1 pini x 6 Lycaenidae Durbania amakosa x 1 Erikssonia acraeina x 1 Evenus coronata x 2 Japonica lutea x 1 Lipaphnaeus loxura x 1 Polyommatus icarus x 16 Pseudaletis agrippina x 1 Noctuidae Acronicta tritona x 1 Spodoptera sp. ' 1 Nymphalidae Euthalia phemius x 1 Mycalesis mineus x 1 Pieridae Pieris brassicae x 3 ^ 1 canidia x 1 Talbotia nagana x 1 Thaumetopoeidae Thaumetopoea pityocampa x 1 Tortricidae Crocidosema plebejana x 1 Mecoptera Panorpidae Panorpa longihypovalva x 1 Psocoptera sp. 00 1 Orthoptera Gryllidae Acheta domesticus * 1 Raphidioptera Raphidiidae Dichrostigma flavipes x 1 Trichoptera Limnephilidae Drusus croaticus x 4

137

Polychaeta sp. x 1 a F = forward primer, R = reverse primer; n = number of matches; x = match to primer according to BLAST b n = number of organisms tested and matching adjacent result; the n on one side of a solidus matches the result on the respective side of the solidus; result symbols are ^ = positive using both 500F/R and UnivF/R primer sets; * = positive using 500F/R primers and untested using UnivF/R primers; ' = negative using 500F/R primers, but positive using UnivF/R primers; 0 = negative using 500F/R primers and untested using UnivF/R primers; 00 = negative using both primer sets

138

APPENDIX VIII

PRELIMINARY EXPERIMENT TO PROBE SENSITIVITY OF THE 543-BP PCR ASSAY

Ingested prey DNA is degraded and there may be few copies of the targeted region present in a spider‟s gut, thus it is important to determine the sensitivity of the PCR assay. To evaluate the sensitivity of the 543-bp PCR assay, the DNA extracted from an adult D. suzukii (5 ng·µL-1) was diluted in either water or DNA extracted from a starved Tibellus (16.7 ng·µL-1), and then amplified using PCR. Serial dilutions were made 1:9 for each diluent until D. suzukii DNA had been diluted five orders of magnitude (i.e. 50 fg·µL-1). A sub-sample of each dilution step was assayed in duplicate for both diluents. DNA extraction, PCR, and visualization followed the protocols previously described (section 2.1.4).

The results demonstrated that D. suzukii DNA could be detected when only 50 fg of target

DNA was present in a PCR (Table VIII.1). All duplicates tested positive for D. suzukii DNA to a limit of 5 pg. When diluted further, replicability of the result became inconsistent for both diluents. There was a discrepancy between the diluents in the limit of detection of D. suzukii

DNA (Table VIII.1). However, this was not considered significant because of the small number of samples tested. Overall, this experiment demonstrated that the limit of detection of D. suzukii

DNA for the 543-bp PCR assay was 50 fg.

Table VIII.1 – Proportions of D. suzukii DNA (5 ng·μL-1), diluted in either water or the DNA of a starved Tibellus (16.7 ng·µL-1), in which a 543-bp region of D. suzukii DNA was detected using PCR. Target DNA present (pg) Diluent 500 50 5 0.5 0.05 Water 100 100 100 50 NTa Tibellus DNA 100 100 100 0 50 a NT = not tested

139

APPENDIX IX

PRELIMINARY EXPERIMENT TO EFFECT VARIATION IN BRIGHTNESS OF PCR

RESULTS AMONG FED SPIDERS

This experiment was designed to develop samples to be used to test the reproducibility of the

PCR result when target DNA is minimal. Reproducibility of PCR outcome is known to suffer near its limit of detection and so 14 Tibellus were arranged into three treatment groups designed to change the amount of D. suzukii DNA available for detection. Considering brightness diminishes as the amount of target DNA decreases, the goal was to generate variation in the brightness of D. suzukii DNA bands detected from Tibellus. 14 Tibellus were each fed one D. suzukii for 5 h using the feeding method outlined in section 2.1.3. For the first treatment, five

Tibellus were frozen at -20 °C for 3 h in their Petri dishes following consumption and then thawed for 30 minutes before being subject to DNA extraction. For the second and third treatments, Tibellus were initially frozen for 2 h in their Petri dishes following consumption, but then stored in tubes, submerged in 95% EtOH, and frozen for a further 32 days. After storage, the second treatment (n = 4) was thawed as the first treatment was, but the third treatment (n = 5) was not thawed prior to DNA extraction. The conditions for DNA extraction, PCR, and visualization followed the protocols detailed in section 2.1.4. All PCR products were run on a single gel to allow direct comparison between treatment groups.

Results of the PCR assay showed that variation in band brightness produced by PCR was achieved in one of the three treatments (Figure IX.1). Detection should have been consistent within each group; however, two of the Tibellus samples in the first treatment showed DNA bands that were faint, indicating relatively little amplicon had been detected. Although DNA was

140 still detected in these two samples and the absolute value remains the same, i.e. positive, the lack of brightness produced by these two samples suggested that these two samples contained fewer copies of target DNA compared to all other Tibellus samples as well as the positive control.

Overall, this experiment indicated that the Tibellus from the first treatment showed variation and were deemed suitable for investigating the reproducibility of the PCR result.

Figure IX.1 – PCR amplification of D. suzukii DNA from Tibellus fed one adult D. suzukii for 5 h. Spiders were subject to various handling methods prior to DNA extraction. All samples run on a single gel. Lanes 8 & 23: 100 bp DNA ladder (500 bp marked by arrow). Lanes 1-5: Spiders frozen for 3 h and thawed for 0.5 h before DNA extraction. Lanes 16-19: Spiders frozen in 95% EtOH for 1 month and thawed for 0.5 h before DNA extraction. Lanes 24-28: Spiders frozen in 95% EtOH for 1 month and extracted without thawing. Lane 9: DNA from the body of a D. suzukii that had been partially consumed during the experiment (positive control). Lanes 6, 7, 20, 21, 29, & 30: Blank negative extraction controls. Lanes 10 & 22: Negative PCR control (water).

141

APPENDIX X

RESULTS OF MULTIPLE-PREY FEEDING EXPERIMENTS

Table X.1 – Results of 24 h multiple-prey feeding experiments. Drosophila suzukii were offered as prey to starved Tibellus spiders in individual Petri dishes (100 mm diameter x 20 mm depth). Some of the Tibellus, i.e. the samples, were then assayed for the detection of a 543-bp region of D. suzukii DNA using PCR. Results presented once if all spiders from an experiment were assayed. Experimental controls were without spiders. Experimenta n Starvation Mean prey Mean prey t-testb Proportion time (d) added mortality positive by PCR (%) 2.4.2a, 3.3.2a 10 7 5.10 ± 0.10 4.10 ± 0.46 Samples 8 7 5.13 ± 0.13 4.00 ± 0.57 ** 0 Control 5 - 5.20 ± 0.20 0.20 ± 0.20 2.4.2b, 3.3.2b – F1 10 11 10.50 ± 0.27 8.90 ± 1.12 Samples 9 11 10.56 ± 0.29 9.78 ± 0.78 ** 44 Control 10 - 11.20 ± 0.44 0.80 ± 0.42 2.4.2b, 3.3.2b – F2 10 8, 2 Samples – 1st bout 10 8 10.40 ± 0.22 7.30 ± 0.58 ** n/a Samples – 2nd boutc 10 2 10.30 ± 0.21 4.80 ± 0.76 ** 40 Control – 1st bout 10 - 10.10 ± 0.23 1.40 ± 0.40 2.4.3, 3.3.3 – Group 1 10 7 Samples 10 7 15 7.50 ± 1.10 ** 80 Control 5 - 15 0 2.4.3, 3.3.3 – Group 2 10 14 Samplesd 10 14 15 6.10 ± 0.38 ** 80 2.4.3, 3.3.3 – Group 3 10 14 Samples 10 14 10 5.30 ± 0.75 ** 100 Control 5 - 10 0 a experiments named by section codes corresponding to Chapters 2 & 3 b two-sample t-test assuming unequal variance, i.e. „samples‟ vs. „control‟ for each experiment; ** = p < 0.001 c control for 2nd bout same as control for F1 d control same as for “Group 1”

142