DOCSLIB.ORG

ARMET Is a Soluble ER Protein Induced by the Unfolded Protein Response Via ERSE-II Element

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ARMET Is a Soluble ER Protein Induced by the Unfolded Protein Response Via ERSE-II Element CELL STRUCTURE AND FUNCTION 32: 41–50 (2007) © 2007 by Japan Society for Cell Biology ARMET is a Soluble ER Protein Induced by the Unfolded Protein Response via ERSE-II Element Naomi Mizobuchi1,2,6, Jun Hoseki1,3,6, Hiroshi Kubota1,3, Shinya Toyokuni4, Jun-ichi Nozaki1,2,5, Motoko Naitoh1, Akio Koizumi2, and Kazuhiro Nagata1,3∗ 1Department of Molecular and Cellular Biology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8397, 2Department of Health and Environmental Sciences, Graduate School of Medicine and Faculty of Medicine, Kyoto University, Kyoto 606-8501, 3CREST, Japan Science Technology Agency, Kawaguchi, Saitama 332-0012, Japan, 4Department of Pathology and Biology of Diseases, Kyoto University Graduate School of Medicine, Kyoto 606-8501, Japan, 5Present address: Department of Public Health, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya 663-8501, Japan, 6These two authors equally contributed to this work. ABSTRACT. Arginine rich, mutated in early stage of tumors (ARMET) was first identified as a human gene highly mutated in a variety of cancers. However, little is known about the characteristics of the ARMET protein and its expression. We identified ARMET as a gene upregulated by endoplasmic reticulum (ER) stress. Here, we show that the mouse homologue of ARMET is an 18-kDa soluble ER protein that is mature after cleavage of a signal sequence and has four intramolecular disulfide bonds, including two in CXXC sequences. ER stress stim- ulated ARMET expression, and the expression patterns of ARMET mRNA and protein in mouse tissues were similar to those of Grp78, an Hsp70-family protein required for quality control of proteins in the ER. A reporter gene assay using a mouse ARMET promoter revealed that the unfolded protein response of the ARMET gene is regulated by an ERSE-II element whose sequence is identical to that of the HERP gene. ARMET is the second fully characterized ERSE-II-dependent gene and likely contributes to quality control of proteins in the ER. Key words: endoplasmic reticulum/unfolded protein response/transcriptional regulation/cis-acting element/disulfide bond Introduction 2001; Kaufman et al., 2002). Transcription factors XBP1 and ATF6 play key roles in the unfolded protein response Accumulation of unfolded or misfolded proteins in the by inducing ER chaperones and ERAD machineries. These endoplasmic reticulum (ER) stimulates pathways leading to transcription factors recognize the ER stress response ele- mediation of protein folding by molecular chaperones or ment (ERSE; consensus sequence CCAATN9CCACG) in degradation by ER-associated protein degradation (ERAD) the presence of NF-Y (Yoshida et al., 1998, 2000, 2001). system (Mori, 2000; Urano et al., 2000; Patil and Walter, ERSEs are frequently found in the promoters of ER chaper- one genes, including that of Grp78, an Hsp70 family protein *To whom correspondence should be addressed: Kazuhiro Nagata, Depart- required for protein quality control in the ER. ment of Molecular and Cellular Biology, Institute for Frontier Medical A second ER stress response element, ERSE-II (ATTG- Sciences, Kyoto University, 53 Shogoin Kawahara-cho, Sakyo-ku, Kyoto GNCCACGT), was discovered in a promoter assay of the 606-8397, Japan. Tel: +81–75–751–3848, Fax: +81–75–751–4645 human homocysteine-induced endoplasmic reticulum pro- E-mail: [email protected] tein (HERP) gene (Kokame et al., 2000, 2001; Yamamoto Abbreviations: AMS, 4-acetamide-4'-maleimidylstilbene-2,2'-disulfonic acid; et al., 2004). HERP is a ubiquitin-domain protein that local- ARMET, arginine rich, mutated in early stage of tumors; ATF6, activating izes in the ER membrane and may be involved in quality transcription factor 6; DTNB, 5,5'-dithiobis(2-nitrobenzoic acid); ER, endoplasmic reticulum; ERAD, ER-associated protein degradation; ERSE, control of proteins in the ERAD pathway (Hori et al., 2004; ER stress response element; Grp78, 78-kDa glucose regulated protein; Schulze et al., 2005; Nogalska et al., 2006). ERSE and HERP, homocysteine-induced endoplasmic reticulum protein; Hsp70, 70- ERSE-II are known to be differentially recognized by ATF6 kDa heat shock protein; MALDI-TOF, matrix assisted laser desorption ion- ization-time of flight; NF-Y, nuclear factor Y; PBS, phosphate-buffered and XBP1 (Yamamoto et al., 2004). However, the general saline; PDI, protein disulfide isomerase; XBP1, X-box binding protein 1. role of the ERSE-II element in ER stress-responsive genes 41 N. Mizobuchi et al. is poorly understood due to the lack of other examples of mutagenesis. The effector construct containing mouse wild-type the gene containing ERSE-II elements. Ins2 and its C96Y mutant was described previously (Nozaki et al., Pancreatic β cells produce a high level of insulin and 2004). The reporter gene constructs driven by the human wild-type undergo a high level of ER stress (Iwawaki et al., 2004). and ERSE-disrupted GRP78 promoters were described previously The diabetes mellitus mouse strain, Insulin-Akita (Yoshioka (Yoshida et al., 1998). Nucleotide sequences of clones were con- et al., 1997), carries a C96Y mutation in the Ins2 gene firmed by sequencing. Supercoiled plasmid DNA was purified by (Wang et al., 1999). Since Cys96 is essential for a disulfide cesium chloride ultracentrifugation. bond in insulin, proinsulin carrying this mutation becomes structurally unstable and is prone to aggregation (Ron, Reporter gene assay 2002) due to an exposed hydrophobic surface (Yoshinaga et al., 2005). Previously, we established β cell lines from Cells were plated in 35-mm dishes, cultured for 24 h, and trans- Ins2+/Akita mice and reported that ER chaperones and the fected with a mixture of reporter, effector, and internal control ATF6 and XBP1 transcription factors are more strongly plasmid DNA (1.2–2.0 µg depending upon cell types) using 10 µl activated in Ins2+/Akita cells than in Ins2+/+ cells (Nozaki et of LipofectAMINE reagent (Invitrogen, Carlsbad, CA, USA) al., 2004). according to the manufacturer’s instructions. After a 5-h exposure The arginine rich, mutated in early stage of tumors to the DNA-LipofectAMINE complex, cells were cultured in (ARMET) gene was first reported as a human gene highly medium containing 10% serum for 19 h. The luciferase activities mutated in a variety of cancers (Shridhar et al., 1996). In a of transfected cells were determined using a dual luciferase assay DNA microarray study, ARMET was upregulated by tuni- system (Promega) according to the manufacturer’s instructions, camycin treatment in wild-type cells but not in XBP1 and the activity of firefly luciferase was normalized to that of the knockout cells in which ATF6 was knocked down with an sea pansy enzyme. RNAi vector (Lee et al., 2003). This suggests that ARMET is an ER stress-responsive gene. Here we report that Northern blot analysis ARMET is an ER-resident soluble protein containing intra- molecular disulfide bonds. ARMET expression is upregu- cDNA probes for mouse ARMET and Grp78 mRNA were gener- lated in pancreatic β cells expressing the C96Y mutant of ated by PCR. To induce ER stress, cells were incubated with a insulin and is induced by a variety of reagents that cause ER final concentration of 5 µg/ml tunicamycin, 0.3 µM thapsigargin, stress. Moreover, we found that the unfolded protein or 2 mM DTT. Total RNA was extracted using an RNeasy Mini response of the ARMET gene is mediated by an ERSE-II Kit (Qiagen, Valencia, CA, USA). RNA aliquots (10 µg) were element, like the HERP gene. These results suggest that denatured and subjected to electrophoresis in a 1% agarose gel ARMET is involved in protein quality control in the ER. containing 2.2 M formaldehyde, 20 mM MOPS-NaOH (pH 7.0), 5 mM sodium acetate, and 1 mM EDTA. RNA was transferred onto a nylon membrane using standard capillary blotting techniques. A Materials and Methods mouse adult tissue blot and embryo-stage blot were purchased from Seegene (Seoul, Korea). These filters were hybridized with 32 Cell culture P-labelled probes in PerfectHyb Hybridization Solution (Toyobo, Tokyo, Japan) at 65°C for 1 h and washed in 0.1×SSC/0.1% SDS Mouse pancreatic β cell lines carrying the Ins2+/+ and Ins2+/Akita at 65°C. genes were cultured as described previously (Nozaki et al., 2004). HeLa, mouse L929, NIH 3T3, and BALB/c 3T3 cells were cul- Expression and purification of recombinant mouse tured in Dulbecco’s modified essential medium supplemented with ARMET 10% fetal bovine serum. Mouse ARMET cDNA was amplified by PCR using the prim- Construction of plasmids ers 5'-CATATGCTGCGGCCAGGAGACTGTGAAG-3' and 5'- GGATCCCTACAGATCAGTCCGTGCCGCTGG-3'. The ampli- ARMET cDNA was amplified from a mouse cDNA library (Clon- fied fragment containing the ORF of mature ARMET was sub- tech, Palo Alto, CA) by PCR and cloned into the pCAGGS vector cloned into the NdeI and BamHI sites of pET-21a (Novagen, (Niwa et al., 1991). A FLAG tag sequence was inserted in Madison, WI) modified with a N-terminal 6xHis tag. Escherichia ARMET immediately upstream the C-terminal RTDL sequence coli Origami B(DE3) cells (Novagen) carrying the ARMET using PCR, and the product was cloned pCAGGS. Based on the expression plasmid were grown at 37°C until the OD600 reached sequence of the mouse ARMET gene, a 600-bp fragment of the 0.6, at which time the expression of the recombinant protein was ARMET promoter was amplified by PCR from mouse genomic induced by addition of 0.4 mM isopropyl 1-thio-β-D-galactoside. DNA and cloned into the KpnI-XhoI sites of the pGL3-Basic After further culture overnight, the cells were collected and soni- firefly luciferase vector (Promega, Madison, WI). The ERSE-II cated in 20 mM Tris-HCl (pH 8.0) containing 50 mM NaCl. The sequence on the ARMET promoter was disrupted by site-directed lysate was centrifuged (16,000×g, 30 min, 4°C).
Load more

Recommended publications
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE Investigations Into The
    UNIVERSITY OF CALIFORNIA RIVERSIDE Investigations into the Role of TAF1-mediated Phosphorylation in Gene Regulation A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cell, Molecular and Developmental Biology by Brian James Gadd December 2012 Dissertation Committee: Dr. Xuan Liu, Chairperson Dr. Frank Sauer Dr. Frances M. Sladek Copyright by Brian James Gadd 2012 The Dissertation of Brian James Gadd is approved Committee Chairperson University of California, Riverside Acknowledgments I am thankful to Dr. Liu for her patience and support over the last eight years. I am deeply indebted to my committee members, Dr. Frank Sauer and Dr. Frances Sladek for the insightful comments on my research and this dissertation. Thanks goes out to CMDB, especially Dr. Bachant, Dr. Springer and Kathy Redd for their support. Thanks to all the members of the Liu lab both past and present. A very special thanks to the members of the Sauer lab, including Silvia, Stephane, David, Matt, Stephen, Ninuo, Toby, Josh, Alice, Alex and Flora. You have made all the years here fly by and made them so enjoyable. From the Sladek lab I want to thank Eugene, John, Linh and Karthi. Special thanks go out to all the friends I’ve made over the years here. Chris, Amber, Stephane and David, thank you so much for feeding me, encouraging me and keeping me sane. Thanks to the brothers for all your encouragement and prayers. To any I haven’t mentioned by name, I promise I haven’t forgotten all you’ve done for me during my graduate years.
    [Show full text]
  • B Inhibition in a Mouse Model of Chronic Colitis1
    The Journal of Immunology Differential Expression of Inflammatory and Fibrogenic Genes and Their Regulation by NF-␬B Inhibition in a Mouse Model of Chronic Colitis1 Feng Wu and Shukti Chakravarti2 Fibrosis is a major complication of chronic inflammation, as seen in Crohn’s disease and ulcerative colitis, two forms of inflam- matory bowel diseases. To elucidate inflammatory signals that regulate fibrosis, we investigated gene expression changes under- lying chronic inflammation and fibrosis in trinitrobenzene sulfonic acid-induced murine colitis. Six weekly 2,4,6-trinitrobenzene sulfonic acid enemas were given to establish colitis and temporal gene expression patterns were obtained at 6-, 8-, 10-, and 12-wk time points. The 6-wk point, TNBS-w6, was the active, chronic inflammatory stage of the model marked by macrophage, neu- trophil, and CD3؉ and CD4؉ T cell infiltrates in the colon, consistent with the idea that this model is T cell immune response driven. Proinflammatory genes Cxcl1, Ccl2, Il1b, Lcn2, Pla2g2a, Saa3, S100a9, Nos2, Reg2, and Reg3g, and profibrogenic extra- cellular matrix genes Col1a1, Col1a2, Col3a1, and Lum (lumican), encoding a collagen-associated proteoglycan, were up-regulated at the active/chronic inflammatory stages. Rectal administration of the NF-␬B p65 antisense oligonucleotide reduced but did not abrogate inflammation and fibrosis completely. The antisense oligonucleotide treatment reduced total NF-␬B by 60% and down- regulated most proinflammatory genes. However, Ccl2, a proinflammatory chemokine known to promote fibrosis, was not down- regulated. Among extracellular matrix gene expressions Lum was suppressed while Col1a1 and Col3a1 were not. Thus, effective treatment of fibrosis in inflammatory bowel disease may require early and complete blockade of NF-␬B with particular attention to specific proinflammatory and profibrogenic genes that remain active at low levels of NF-␬B.
    [Show full text]
  • Spectrum of Chromosomal Aberrations in Peripheral Blood Lymphocytes of Gastrointestinal Tract (GIT) and Breast Cancer Patients
    © Kamla-Raj 2010 Int J Hum Genet, 10(1-3): 147-158 (2010) Spectrum of Chromosomal Aberrations in Peripheral Blood Lymphocytes of Gastrointestinal Tract (GIT) and Breast Cancer Patients Kamlesh Guleria and Vasudha Sambyal Department of Human Genetics, Guru Nanak Dev University, Amritsar 143 005, Punjab, India KEYWORDS Peripheral Blood Lymphocytes. Gastrointestinal Cancer. Breast Cancer. Chromosomal Aberrations ABSTRACT The aim of present study was to assess the spectrum of chromosomal aberrations in peripheral blood lymphocytes of sporadic Gastrointestinal tract (GIT) and Breast cancer patients. Ninety eight patients (56 GIT cancer and 42 breast cancer) and seventy seven unrelated healthy set of control individuals were investigated in the present study. Lymphocytes were cultured using standard protocol. In each case, 100 metaphases were screened for numerical as well as structural aberrations. Higher frequency of aberrant metaphases with chromosomal aberrations including gaps, breaks, terminal deletions, acentric fragments, double minutes, acrocentric associations, premature chromatid separations, pulverisations, polyploidy, loss and gain of chromosomes, ring chromosome and marker chromosomes were observed in cancer patients as compared to controls. A non-random involvement in aberrations of chromosomes harbouring genes implicated in tumorigenesis was observed in GIT as well as in breast cancer patients. Aberrations in peripheral blood lymphocytes (PBLs) can indicate the constitutional anomalies and understanding of molecular basis of chromosomal instability (CIN) phenotype can help in earlier diagnosis or prognosis. INTRODUCTION typic changes that contribute to tumor cell evolution and pose therapeutic challenges (Gao Genomic instability is a prerequisite for the et al. 2007). Defects in both bipolar spindle onset of cancer. The majority of cancer cells are assembly and the spindle assembly checkpoint aneuploid, representing dynamic karyotypic have been identified in some CIN tumor cell lines changes, including gain or loss of whole chromo- (Cahill et al.
    [Show full text]
  • Molecular Pathogenesis of Endometriosis-Associated Clear Cell Carcinoma of the Ovary (Review)
    233-240.qxd 22/6/2009 11:19 Ì ™ÂÏ›‰·233 ONCOLOGY REPORTS 22: 233-240, 2009 233 Molecular pathogenesis of endometriosis-associated clear cell carcinoma of the ovary (Review) HIROSHI KOBAYASHI, HIROTAKA KAJIWARA, SEIJI KANAYAMA, YOSHIHIKO YAMADA, NAOTO FURUKAWA, TAKETOSHI NOGUCHI, SHOJI HARUTA, SHOZO YOSHIDA, MARIKO SAKATA, TOSHIYUKI SADO and HIDEKAZU OI Department of Obstetrics and Gynecology, Nara Medical University, 840 Shijo-cho, Kashihara 634-8522, Japan Received February 10, 2009; Accepted April 29, 2009 DOI: 10.3892/or_00000429 Abstract. Epithelial ovarian cancer (EOC) is the leading Contents cause of death in women with gynecological malignancies. Among EOC, clear cell carcinoma (CCC) and endometrioid 1. Introduction adenocarcinoma (EAC) differ from the other histological 2. Identification of relevant studies types with respect to their clinical characteristics and 3. Characteristics of CCC carcinogenesis. Both tumor types are often associated with 4. LOH analysis endometriosis. EAC is recently reported to be characterized 5. LOH involved in endometrioid adenocarcinoma (EAC) of by K-RAS activation and PTEN dysfunction. However, the the ovary molecular changes in CCC remain largely unknown. The aim 6. LOH involved in clear cell carcinoma (CCC) of the ovary: of this review is to summarize the current knowledge on the the candidate tumor suppressor genes molecular mechanisms involved in CCC tumorigenesis. The 7. Microsatellite instability in CCC present article reviews the English language literature for 8. Genes specifically up-regulated in CCC biological, pathogenetic and pathophysiological studies on 9. Clear cell adenofibroma-CCC sequence endometriosis-associated CCC of the ovary. Several recent 10. Iron, oxidative stress and carcinogenesis studies of loss of heterozygosity (LOH), allelic loss, com- 11.
    [Show full text]
  • An Ancient Deletion in the ABO Gene Affects the Composition of the Porcine Microbiome by Altering Intestinal N-Acetyl-Galactosam
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.16.206219; this version posted July 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Effect of the ABO locus on the porcine gut microbiome Page 1 of 66 1 An ancient deletion in the ABO gene affects the composition of the porcine microbiome 2 by altering intestinal N-acetyl-galactosamine concentrations. 3 Hui Yang1*, Jinyuan Wu1*, Xiaochang Huang1, Yunyan Zhou1, Yifeng Zhang1, Min Liu1, Qin Liu1, 4 Shanlin Ke1, Maozhang He1, Hao Fu1, Shaoming Fang1, Xinwei Xiong1, Hui Jiang1, Zhe Chen1, 5 Zhongzi Wu1, Huanfa Gong1, Xinkai Tong1, Yizhong Huang1, Junwu Ma1, Jun Gao1, Carole 6 Charlier2,1, Wouter Coppieters2,1, Lev Shagam2, Zhiyan Zhang1, Huashui Ai1, Bin Yang1, Michel 7 Georges2,1,$ ,† , Congying Chen1, $,†, Lusheng Huang1, $,†,#. 8 1National Key Laboratory for Swine genetic improvement and production technology, 9 Ministry of Science and Technology of China, Jiangxi Agricultural University, NanChang, Jiangxi 10 Province, 330045, PR China. 2Unit of Animal Genomics, GIGA-Institute and Faculty of 11 Veterinary Medicine, University of Liege, 4000 Liege, Belgium. 12 *Contributed equally to this work. $Senior authors. †Corresponding authors. #Lead contact. 13 14 Summary 15 We have generated a large heterogenous stock population by intercrossing eight divergent 16 pig breeds for multiple generations. We have analyzed the composition of the intestinal 17 microbiota at different ages and anatomical locations in > 1,000 6th- and 7th- generation 18 animals. We show that, under conditions of exacerbated genetic yet controlled 19 environmental variability, microbiota composition and abundance of specific taxa (including 20 Christensenellaceae) are heritable in this monogastric omnivore.
    [Show full text]
  • Stem Cell-Based Reporter Assays for the Identification of Carcinogenic Properties of (Non)-Genotoxic Chemicals
    UNIVERSIDADE DE LISBOA Faculdade de Ciências Departamento de Biologia Animal Stem cell-based reporter assays for the identification of carcinogenic properties of (non)-genotoxic chemicals Cátia Sofia Alão Gonçalves DISSERTAÇÃO MESTRADO EM BIOLOGIA HUMANA E AMBIENTE 2013 UNIVERSIDADE DE LISBOA Faculdade de Ciências Departamento de Biologia Animal Stem cell-based reporter assays for the identification of carcinogenic properties of (non)-genotoxic chemicals Cátia Sofia Alão Gonçalves Dissertação orientada por: Dr. Harry Vrieling (Toxicogenetic/LUMC) Professora Dra. Deodália Dias (DBA/FCUL) DISSERTAÇÃO MESTRADO EM BIOLOGIA HUMANA E AMBIENTE 2013 Acknowledgements First of all I would like to express my deep and sincere gratitude to Harry Vrieling, for having welcomed me in your workgroup and give me the opportunity to develop my dissertation. I also have to thank Giel Hendriks for the useful discussions and uplifting spirits that allowed me to develop my dissertation and allowed me to develop, not only the professional level, but also the personal one. A special thanks to the entire lab, in particular to Brunno for helping me with the BAC recombennering and the great talks, to Fabienne for the tips on how to culture the mES cell lines and for her constant assistance in the Lab and to Binni for helping me understand a little better the Dutch culture. I wish to thank all of my colleagues at the Department of Toxicogenetics, at the Leiden University Medical Centre, for all the support. I thank Professor Deodália Dias for all the support provided under this thesis and also in my training. I want to thank to all the friends that I made during my time in Leiden, without them, probably this dissertation would not be completed.
    [Show full text]
  • Dissection of Prostate Tumour, Stroma and Immune Transcription Reveals a Key Contribution by the Microenvironment to Disease Progression
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.16.993162; this version posted March 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dissection of prostate tumour, stroma and immune transcription reveals a key contribution by the microenvironment to disease progression Stefano Mangiola1,2,3, Patrick McCoy2,3, Martin Modrak4, Fernando Souza-Fonseca-Guimaraes5, Daniel Blashki7, Ryan Stuchbery3, Michael Kerger8, Ken Chow2,3, Chayanica Nasa9, Melanie Le Page9, Natalie Lister10, Simon Monard9, Justin Peters8, Phil Dundee8, Anthony J. Costello2,3,8, Bhupinder Pal11, Nicholas D. Huntington5, Niall M. Corcoran2,3,8,12,*, Anthony T. Papenfuss1,13,14,15,16,*, Christopher M. Hovens2,3,8,* 1Bioinformatics Division, The Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia 2Department of Surgery, The University of Melbourne, Parkville, Victoria, Australia 3Department of Urology, Royal Melbourne Hospital, Parkville, Victoria, Australia 4Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic. 5Molecular Immunology Division, The Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia 6University of Queensland Diamantina Institute, Translational Research Institute, University of Queensland, Brisbane, QLD, Australia 7The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia 8Australian Prostate Cancer Research Centre
    [Show full text]
  • Functions for the Cardiomyokine, MANF, in Cardioprotection, Hypertrophy and Heart Failure
    Journal of Molecular and Cellular Cardiology 51 (2011) 512–517 Contents lists available at ScienceDirect Journal of Molecular and Cellular Cardiology journal homepage: www.elsevier.com/locate/yjmcc Review Article Functions for the cardiomyokine, MANF, in cardioprotection, hypertrophy and heart failure Christopher C. Glembotski ⁎ The SDSU Heart Institute and the Department of Biology, San Diego State University, San Diego, CA 92182, USA article info abstract Article history: We define cardiomyokines as heart-derived secreted proteins that affect cardiovascular function via Received 5 August 2010 autocrine, paracrine and/or endocrine mechanisms. The subject of this review is the cardiomyokine, Received in revised form 1 October 2010 mesencephalic astrocyte-derived neurotrophic factor (MANF). The expression of MANF is increased in the Accepted 4 October 2010 ischemic heart, in part, through activation of ER stress, a condition that drastically impairs the expression and Available online 21 October 2010 secretion of most cardiomyokines. This novel function of MANF suggests that it may have important roles in the ER stressed, ischemic heart. Consistent with this are recent findings showing that MANF protects against Keywords: Cardiomyokine ischemic damage, and that it is anti-hypertrophic. Accordingly, in light of its function as a potentially secreted MANF cardiomyokine, MANF has translational potential as a novel therapy for ischemic heart disease. This article is ER stress part of a special issue entitled “Key Signaling Molecules in Hypertrophy and Heart Failure.” Cardioprotection © 2010 Elsevier Ltd. All rights reserved. Hypertrophy Contents 1. Introduction .............................................................. 512 1.1. Cardiomyokines and ER stress .................................................. 512 1.2. MANF, an ATF6-regulated gene in the heart ...........................................
    [Show full text]
  • ARMET (MANF) (NM 006010) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC122734 ARMET (MANF) (NM_006010) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: ARMET (MANF) (NM_006010) Human Untagged Clone Tag: Tag Free Symbol: MANF Synonyms: ARMET; ARP Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene sequence for NM_006010 edited GGATGAGGAGGATGTGGGCCACGCAGGGGCTGGCGGTGGCGCTGGCTCTGAGCGTGCTGC CGGGCAGCCGGGCGCTGCGGCCGGGCGACTGCGAAGTTTGTATTTCTTATCTGGGAAGAT TTTACCAGGACCTCAAAGACAGAGATGTCACATTCTCACCAGCCACTATTGAAAACGAAC TTATAAAGTTCTGCCGGGAAGCAAGAGGCAAAGAGAATCGGTTGTGCTACTATATCGGGG CCACAGATGATGCAGCCACCAAAATCATCAATGAGGTATCAAAGCCTCTGGCCCACCACA TCCCTGTGGAGAAGATCTGTGAGAAGCTTAAGAAGAAGGACAGCCAGATATGTGAGCTTA AGTATGACAAGCAGATCGACCTGAGCACAGTGGACCTGAAGAAGCTCCGAGTTAAAGAGC TGAAGAAGATTCTGGATGACTGGGGGGAGACATGCAAAGGCTGTGCAGAAAAGTCTGACT ACATCCGGAAGATAAATGAACTGATGCCTAAATATGCCCCCAAGGCAGCCAGTGCACGGA CCGATTTGTAGTCTGCTCAATCTCTGTTGCACCTGAGGGGGAAAAAACAGTTCAACTGCT TACTCCCAAAACAGCCTTTTTGTAATTTATTTTTTAAGTGGGCTCCTGACAATACTGTAT CAGATGTGAAGCCTGGAGCTTTCCTGATGATGCTGGCCCTACAGTACCCCCATGAGGGGA TTCCCTTCCTTCTGTTGCTGGTGTACTCTAGGACTTCAAAGTGTGTCTGGGATTTTTTTA TTAAAGAAAAAAAATTTCTAGCTGTCCTTGCAGAATTATAGTGAATACCAAAATGGGGTT TTGCCCCAGGAGGCTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online
    [Show full text]
  • Integrative Analysis of the Cancer Transcriptome
    PERSPECTIVE Integrative analysis of the cancer transcriptome Daniel R Rhodes & Arul M Chinnaiyan DNA microarrays have been widely applied to the study of making a list of differences in the parts and then focusing on a single human cancer, delineating myriad molecular subtypes of part. Opposite to this single-part approach, a new line of attack seeks cancer, many of which are associated with distinct biological to examine the cancer profile as a whole, often in the context of other underpinnings, disease progression and treatment response. cancer signatures or other types of genomic data. Such integrative These primary analyses have begun to decipher the molecular approaches are capable of simplifying complex cancer signatures heterogeneity of cancer, but integrative analyses that evaluate into coordinately regulated modules, transforming one-dimensional http://www.nature.com/naturegenetics cancer transcriptome data in the context of other data sources cancer signatures into multidimensional interaction networks and are often capable of extracting deeper biological insight from extracting regulatory mechanisms encoded in cancer gene expres- the data. Here we discuss several such integrative computational sion. Here, we review approaches that glean biological insight from and analytical approaches, including meta-analysis, functional cancer microarray data by applying integrative computational and enrichment analysis, interactome analysis, transcriptional analytical methodologies. network analysis and integrative model system analysis. Before exploring the integrative analyses carried out on cancer tran- scriptome data, it is useful to provide a brief overview of the cancer The widespread application of DNA microarrays to cancer research is profiling field. In the past few years, we have witnessed an explosion nothing less than astounding.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]