DOCSLIB.ORG

Puc18/19 DNA - Undigested Internet: Puc18/19 Vector (E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Puc18/19 DNA - Undigested Internet: Puc18/19 Vector (E Version 300314 G:\products\productflyer\pcr\ladders\descr_m3081_puc18_puc19_dna.docx X G ENAXXON bioscience ______________________ fon: +49 (0)73 1 – 3608 12 3 fax: +49 (0)73 1 – 3608 962 eMail: [email protected] pUC18/19 DNA - undigested internet: www.genaxxon.com pUC18/19 vector (E. coli plasmid of2686bp) Product Cat# Package size pUC18/19 DNA undigested M3081.0050 1 x 50µg pUC18/19 DNA undigested M3081.0250 1 x 250µg Description pUC18 / pUC19 from E.coli are commonly used small, high copy number, E. coli plasmids, 2686 bp in length. pUC19 is identical to pUC18 except that they contain multiple cloning sites (MCS) arranged in opposite orientations. pUC18/19 plasmids contain: 1. The pMB1 replicon rep responsible for the replication of plasmid (source – plasmid pBR322). The high copy number of pUC plasmids is a result of the lack of the rop gene and a single point mutation in the replicon rep of pMB1. 2. The bla gene, encoding beta-lactamase, confers resistance to ampicillin (source – plasmid pBR322). It differs from that of pBR322 by two point mutations 3. The region of E.coli lac operon containing a CAP protein binding site, promoter Plac, lac repressor binding site and the 5’- terminal part of the lacZ gene encoding the N-terminal fragment of beta-galactosidase (source – M13mp18/19). This fragment, whose synthesis can be induced by IPTG, is capable of intra-allelic (alpha) complementation with a defective form of beta-galactosidase encoded by the host (mutation delta(lacZ)M15). In the presence of IPTG, bacteria synthesize both fragments of the enzyme and form blue colonies on media with X-Gal. Insertion of DNA into the MCS located within the lacZ gene (codons 6-7 of lacZ are replaced by MCS) inactivates the N-terminal fragment of beta-galactosidase and abolishes alpha-complementation. Bacteria carrying recombinant plasmids therefore give rise to white colonies. The map shows enzymes that cut pUC18/19 DNA once. The coordinates refer to the position of the first nucleotide in each recognition sequence. The exact positions of the genetic elements are shown on the map (termination codons included). The bla gene nucleotides 2486- 2418 (complementary strand) code for a signal peptide. The LacZ polypeptide corresponding to wt beta-galactosidase and essential for blue/white screening ends at nt position 236 (compl. strand). Another 30 codons in the same reading frame are derived from pBR322. The indicated rep region is sufficient to promote replication. DNA replication initiates at position 866 (± 1) and proceeds in the direction indicated. Plasmids carrying the pMB1 and ColE1 replicons are incompatible, but they are fully compatible with those carrying the p15A replicon (pACYC177, pACYC184). pMB1-derived plasmids can be amplified using chloramphenicol. The pUC18/pUC19 sequence is stored as a pdf-file on the Genaxxon webpage www.genaxxon.com . It can be downloaded from the “Detaisl” view of the pUC18/pUC19 product description. Reference 1. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Gene 33, 103-119. 2. Accession L09137 X02514, Medline 85180545, Pubmed 2985470. Stability Very stable in the delivered form. The DNA is delivered frozen in storage buffer. Please prevent from repeated “freeze – thaw” cycles! Concentration: 0.2 – 0.5mg/mL Storage buffer: 10mM Tris/HCl (pH8.0), 1mM EDTA Storage and shipping: Please store product at -20°C after delivery. Shipment on “blue-ice”. Genaxxon bioscience GmbH fon: +49 731 3608 123 www.genaxxon.com fax: +49 731 3608 962 1 e-mail: [email protected] Version 300314 G:\products\productflyer\pcr\ladders\descr_m3081_puc18_puc19_dna.docx X G ENAXXON bioscience Restriction map of pUC18/pUC19 Vector ______________________ fon: +49 (0)73 1 – 3608 12 3 fax: +49 (0)73 1 – 3608 962 eMail: [email protected] internet: www.genaxxon.com Product Source: pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure. Polylinker DNA Sequence: GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT Related Products Product Cat# Phage Lambda DNA (dam, cdm) undigested M3074 Lambda-DNA – HindII DNA Marker M3075 Lambda-DNA – BstE II DNA Marker M3076 Phage T7 DNA M3077 pUC19 / MspI DNA Marker M3078 Lambda DNA / Sty Marker M3079 pBR322 – Hae III DNA Marker M3080 pUC19 (undigested vector) M3081 Genaxxon bioscience GmbH fon: +49 731 3608 123 www.genaxxon.com fax: +49 731 3608 962 2 e-mail: [email protected] .
Load more

Recommended publications
  • Ampicillin Versus Tetracycline in the Selection of Pbr322 Transformants
    Journal of Experimental Microbiology and Immunology (JEMI) Vol. 2:189-193 Copyright April 2002, M&I UBC The Effects of Ampicillin versus Tetracycline in the Selection of pBR322 Transformants JOYCE S. LAW, SHARON LEE, AMY TSENG, KO WING TSUI, AND NANCY YU Department of Microbiology and Immunology, UBC Escherichia coli DH5α cells were transformed with pBR322 plasmids, which encode both ampicillin and tetracycline resistance genes. After 45- and 60-minute recovery periods, the transformed cells were plated on three types of selective plates, containing 1) ampicillin only, 2) tetracycline only, and 3) ampicillin plus tetracycline. It was found that tetracycline selection from these recovery periods resulted in a lower level of transformant survival than ampicillin selection. However, after the transformants were allowed to recover for several generations, their survival rates were similar on ampicillin plates and on tetracycline plates. The pBR322 plasmid is a commonly used cloning vector that contains both the ampicillin and tetracycline resistance genes as selectable markers. Escherichia coli cells transformed with pBR322 plasmids have a selective advantage in antibiotic-treated environments. Results from a previous experiment indicate that different selective pressures affect the survival of transformed cells, as considerably more transformants survived ampicillin-only selection than ampicillin-tetracycline selection (1). Many possible reasons can explain this difference. Firstly, the mechanisms of ampicillin resistance and tetracycline resistance encoded on the pBR322 plasmid are very different. Ampicillin resistance on the pBR322 plasmid encodes the enzyme β-lactamase, which is secreted to the periplasm and acts by binding and inactivating the ampicillin molecule (http://wine1.sb.fsu.edu/bch5425/lec13/lect13.htm).
    [Show full text]
  • Transformation of Bacteria with Different Plasmids
    Molecular Biology of Life Laboratory BIOL 123 TRANSFORMATION OF BACTERIA WITH DIFFERENT PLASMIDS Objectives • To understand the concept of DNA as genetic material through the process of transformation. • To test the conditions that make cells competent for use in DNA-mediated transformation. • To study the characteristics of plasmid vectors. Introduction Transformation Modern molecular biology began with the experiments of Avery, MacLeod and McCarty (1944) on two strains of Pneumococcus bacteria. When grown on an agar plate, the wild type virulent strain had smooth glistening colonies designated as type S while an avirulent strain had colonies with irregular shape and rough surface, designated as type R. The change from type R to S could be mediated if a DNA extract from S was added to type R bacteria in a test tube. The term "transformation" was coined for such a change. Other contemporary scientists did not easily accept these experiments and what they implicated, mainly because the method of identifying DNA was not yet well established at the time. It took a decade before the validity of such experiments and their conclusions became fully appreciated as a result of rapidly increasing knowledge and understanding of the chemical and physical nature of DNA. Normally grown E. coli cells can not take up the exogenously supplied DNA. However, if the cells are soaked in an ice cold calcium chloride solution for a short time before the addition of DNA and a brief (90 seconds) heat shock (42°C) is given, DNA uptake by the cells is facilitated (Hanahan, 1983). When bacteria have been prepared in this special manner to easily accept the foreign DNA, they are said to be "competent".
    [Show full text]
  • The Effect of Increasing Plasmid Size on Transformation Efficiency in Escherichia Coli
    Journal of Experimental Microbiology and Immunology (JEMI) Vol. 2:207-223 Copyright April 2002, M&I UBC The Effect of Increasing Plasmid Size on Transformation Efficiency in Escherichia coli VICKY CHAN, LISA F. DREOLINI, KERRY A. FLINTOFF, SONJA J. LLOYD, AND ANDREA A. MATTENLEY Department of Microbiology and Immunology, UBC Based on the observation that the transformation of Escherchia coli was more efficient with pUC19 than with the larger plasmid pBR322, we hypothesized that transformation frequency is somehow affected by size. To test this hypothesis, we attempted to insert a 1.7kb lambda NdeI fragment into pUC19 to generate a plasmid (pHEL) of the same size as pBR322. The two plasmids of equal size were then to be used to transform E. coli in order to compare transformation efficiencies. After two rounds of cloning, we were unable to generate pHEL. In lieu of using pHEL and pBR322, E. coli were transformed with previously prepared plasmids of varying sizes: pUC8 (2.6 kb), pUC8 0-690 (4.3 kb), and pUC8 0-690::pKT210 (16.1 kb). The results of these transformations indicate that increasing plasmid size correlates with a decrease in transformation efficiency. Transformation is an important technique in molecular cloning for transferring genetic material to bacteria. It can be done by either heat shock or electroporation. The former involves the preparation of competent cells, incubation of the cells with DNA at 0oC and the completion of DNA uptake by heat pulse. Competent cells are capable of taking up DNA. They can be prepared by cold treatment with calcium chloride.
    [Show full text]
  • 10. E. Coli Cloning Vector Pbr322
    10. E. coli cloning vector pBR322 Important questions based on it: A. (a) Name the organism in which the vector shown is inserted to get the copies of the desired gene. (b) Mention the area labelled in the vector responsible for controlling the copy number of the inserted gene. (c) Name and explain the role of a selectable marker in the vector shown. (AI 2010) B. (a) Identify the selectable markers in the diagram of E. coli vector shown below. (b) How is the coding sequence of -galactosidase considered a better marker than the ones identified by you in the diagram? Explain. (Delhi 2009) A. Explain the importance of (a) ori, (b) ampR and (c) rop in the E. coli vector shown below. (AI 2008) B. Draw pBR322 cloning vector. Label ‘ori’, ‘rop’ and any one antibiotic resistance site on it and state their functions. (AI 2015C) C. Draw a schematic diagram of the E. coli cloning vector pBR322 and mark the following in it: (a) ori (b) rop (c) ampicillin resistance gene (d) tetracycline resistance gene (e) restriction site BamHI (f) restriction site EcoR I (AI 2014C) D. Draw a schematic sketch of pBR322 plasmid and label the following in it: (a) Any two restriction sites. (b) Ori and rop genes. (c) An antibiotic resistant gene. (Delhi 2012) E. Identify A, B, C and D in the given diagram. (a) A-ori, B-ampR, C-tetR, D-HindIII (b) A-HindIII, B-tetR, C-ampR, D-ori (c) A-ampR, B-tetR, C-HindIII, D-ori (d) A-tetR, B-HindIII, C-ori, D-ampR (COMEDK) F.
    [Show full text]
  • Effect of Plasmid Copy Number and Lac Operator Sequence on Antibiotic-Free Plasmid Selection by Operator-Repressor Titration in Escherichia Coli
    Research Article J Mol Microbiol Biotechnol 2004;7:197–203 DOI: 10.1159/000079828 Effect of Plasmid Copy Number and lac Operator Sequence on Antibiotic-Free Plasmid Selection by Operator-Repressor Titration in Escherichia coli Rocky M. Cranenburgh Kathryn S. Lewis Julian A.J. Hanak Cobra Biomanufacturing Plc, The Science Park, Keele , Staffs., UK Key Words Introduction Recombinant protein · Metabolic burden · DNA vaccine · lac repressor · DAP · DH1 lacdapD The use of antibiotics and antibiotic resistance genes in the production of recombinant biotherapeutics is unde- sirable for a number of reasons. These include the risk of Abstract antibiotic gene transfer to pathogenic organisms [David- The Escherichia coli strain DH1 lacdapD enables plasmid son, 1999], plasmid loss due to plasmid size and metabol- selection and maintenance that is free from antibiotics ic stress [Smith and Bidochka, 1998] or antibiotic break- and selectable marker genes. This is achieved by using down during culture and the risk of contamination of the only the lac operator sequence as a selectable element. product with antibiotics [Baneyx, 1999]. Strategies have This strain is currently used to generate high copy num- been developed to avoid the use of antibiotics, including ber plasmids with no antibiotic resistance genes for use plasmids enabling complementation of a host auxotrophy, as DNA vaccines and for expression of recombinant pro- or possessing post-segregational killing (PSK) mechanisms teins. Until now these have been limited to pUC-based [Hanak and Cranenburgh, 2001]. However, these share plasmids containing a high copy number pMB1-derived another major disadvantage with the antibiotic-selected origin of replication, and the principle lacO1 and auxil- plasmids: the metabolic burden associated with constitu- iary lacO3 operators.
    [Show full text]
  • Psoxs::Lacz Recombinant Pbr322 Plasmid As a Sensitive Reporter of Internal Reactive Oxygen Species in Escherichia Coli Dh5α
    Journal of Experimental Microbiology and Immunology (JEMI) Vol. 18: 121 – 128 Copyright © April 2014, M&I UBC Attempted construction of a soxR::PsoxS::lacZ recombinant pBR322 plasmid as a sensitive reporter of internal reactive oxygen species in Escherichia coli DH5α Dominique Haag, Tony Hui, Seo Young Kim, Jane Nguyen Department Microbiology & Immunology, University of British Columbia This study attempted to engineer an internal reactive oxygen species probe using lacZ expression driven by the soxS promoter in response to intracellular superoxide presence being sensed by SoxR. Using polymerase chain reaction amplification, soxR fused to the promoter of soxS (PsoxS) and lacZ amplicons were obtained. Double restriction digests and sticky-end ligations were then performed in an attempt to clone soxR::PsoxS::lacZ into the pBR322 plasmid vector. Following ligation, transformation of competent Escherichia coli DH5α by calcium chloride-heatshock transformation was performed, and resulting transformants were screened for the soxR::PsoxS::lacZ::pBR322 construct. Even though the amplicons were made, a successful ligation was not achieved. The lack of success in obtaining the desired construct prevented further examination of the potential of the proposed reactive oxygen species probe. - Reactive oxygen species (ROS), such as superoxide (O2 ) compared to the previously studied katG::luxCDABE and hydrogen peroxide (H2O2), are radicals that can be probe (9). generated by various mechanisms including exposure to A possible reason for the lack of sensitivity of the UV-A, paraquat, and side reactions involving quinones katG::luxCDABE probe used in a previous study may be a from the electron transport chain (1,2,3). Excessive levels consequence of luminescence activity inhibited by the of ROS are potentially harmful towards microorganisms growth media (9).
    [Show full text]
  • Download Author Version (PDF)
    Environmental Science: Water Research & Technology Elimination of transforming activity and gene degradation during UV and UV/H2O2 treatment of plasmid-encoded antibiotic resistance genes Journal: Environmental Science: Water Research & Technology Manuscript ID EW-ART-03-2018-000200.R2 Article Type: Paper Date Submitted by the Author: 27-May-2018 Complete List of Authors: Yoon, Younggun; Gwangju Institute of Science and Technology, School of Earth Sciences and Environmental Engineering Dodd, Michael; University of Washington, Civil and Environmental Engineering Lee, Yunho; Gwangju Institute of Science and Technology, Environmental Science and Engineering Page 1 of 40 Environmental Science: Water Research & Technology Water Impact Statement The efficiency and mode of actions for deactivating and degrading antibiotic resistance genes (ARGs) during water treatment with UV (254 nm) and UV/H2O2 have been poorly understood. Here, we show that efficiency of elimination of the transforming activity for a plasmid-encoded ARG during the UV-based treatments depends on the rate of formation of cyclobutane-pyrimidine dimers (CPDs) in the plasmid and the repair of such DNA damage during the transformation process in host cells. This work has important contributions to optimizing the monitoring and operation of UV-based water disinfection and oxidation processes for removing ARGs. Environmental Science: Water Research & Technology Page 2 of 40 1 Elimination of transforming activity and gene degradation during 2 UV and UV/H2O2 treatment of plasmid-encoded
    [Show full text]
  • Gene Cloning
    PLNT2530 2021 Unit 6a Gene Cloning Vectors Molecular Biotechnology (Ch 4) Principles of Gene Manipulation (Ch 3 & 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License 1 Attribution Share-Alike 2.5 Canada Plasmids Gene 1 Naturally occurring plasmids ori -occur widely in bacteria -are covalently closed circular dsDNA -are replicons, stably inherited as extra-chromosomal DNA -can be 1 kbp to 500 kbp in size (compared to 4000 kbp chromosome) -bacteria can contain several different types of plasmid simultaneously -many naturally occurring plasmids carry genes for restriction enzymes, antibiotic resistance, or other genes 2 Bacterial Vectors All vectors : 1. -must replicate autonomously in ori - origin of replication their specific host even when sequence at which DNA polymerase joined to foreign DNA initiates replication 2. - should be easily separated from host chromosomal DNA E. coli chromosomal DNA: ~ 4 million bp typical plasmid vector: ~ 3 to 10 kb Most modern cloning vectors in E. coli are derived from naturally-ocurring plasmid col E1. Most of col E1 was deleted except for an origin of replication and an antibiotic resistance gene. 3 Vectors Types cloning small plasmids- can occur naturally in as circular dsDNA in fragments bacteria (up to 15 kb) eg. single genes bacteriophage -viruses of bacteria (~10-50 kb) used in the cDNA cloning, high-efficiency construction of cDNA and genomic libraries cloning BAC-bacterial artificial chromosome (130-150 kb genomic libraries YAC-Yeast artificial chromosome (1000-2000 kb) with large inserts Each type of vector has specific applications but primary function is to carry foreign DNA (foreign to bacteria) and have it replicated by the bacteria 4 Introduction of foreign DNA into E.
    [Show full text]
  • Cloning Vector Puc119
    Cloning Vector pUC119 Product Information Sheet # V33402 SUMMARY shipped at RT; store at 4 °C For research use only Product pUC119 high copy phagemid vector for cloning and replication in E. coli and production of single-stranded DNA with helper phage M13KO7; suitable for “blue-white screening” technique. Description pUC119 is a high copy phagemid cloning vector for cloning and replication in E. coli and production of single-stranded DNA. It has been constructed by inserting the intergenic region (IG region) of the M13 phage DNA into the NdeI site of the pUC19 plasmid. This IG region contains the M13 origin of replication. Infection by the helper phage M13KO7 induces the production of single stranded pUC119 DNA, which is predominantly packaged into phage particles and then is released from bacterial cells. In addition, there is almost no contamination by the single stranded DNA of the helper phage. Using this system, single stranded DNA from large DNA fragments (up to 7 kb) can be stably obtained without deletion. pUC119 (as pUC19) bears the ampicillin resistance gene and the pMB1 origin of replication from pBR322. However, the pMB1 of pUC119 differs from the pBR322 origin by a single point mutation and the lack of the rop gene, leading to a high copy number. Additionally, pUC119 contains the lac operon of E. coli with CAP binding site, lac promoter (Plac), Lac repressor (LacR) binding site, and the 5’-terminal part of the lacZ gene encoding the N-terminal part of β-galactosidase (source – M13mp19 phage vector). This 5’-terminal part of the lacZ gene contains the multiple cloning site (MCS), and its expression is IPTG inducible.
    [Show full text]
  • The Effects of Sub-Inhibitory Levels of Chloramphenicol on Pbr322
    Journal of Experimental Microbiology and Immunology (JEMI) Vol. 7:82-88 Copyright © April 2005, M&I UBC The Effects of Sub-Inhibitory Levels of Chloramphenicol on pBR322 Plasmid Copy Number in Escherichia coli DH5α Cells SARAH BEGBIE, GIULIO DOMINELLI, KIA DUTHIE, JOANNA HOLLAND, MARISSA JITRATKOSOL Department of Microbiology and Immunology, UBC While humans use antibiotics at inhibitory levels to prevent microbial growth, antibiotics are normally found at sub-inhibitory concentrations in nature. The role and effects of sub-inhibitory levels of antibiotics is one of the key areas of research in microbial science today. In this experiment, the effects of sub-inhibitory levels of chloramphenicol on pBR322 plasmid copy number in Escherichia coli DH5α cells were examined. E. coli DH5α cells with pBR322 plasmid were grown in different concentrations of chloramphenicol ranging from 1 to 5 µg/ml. The cells were enzymatically lysed and the DNA extracted through a phenol:chloroform:isoamyl alcohol extraction. The total bacterial DNA was run on a 0.8% agarose gel; using the ratio of genomic DNA to pBR322 DNA, the plasmid copy numbers per genome were calculated. It was found that 1 µg/ml chloramphenicol quantities had no significant affect when compared to the control; however, 3-5 µg/ml of chloramphenicol caused pBR322 concentrations to double. Due to assay insensitivity, there was no significant difference between the 3 µg/ml and 5 µg/ml samples. ___________________________________________________________ Chloramphenicol is a commonly used bacterial cultures prior to overnight incubation. bacteriostatic antibiotic that reversibly binds to the 50S Following growth in the presence of the antibiotic, subunit (L10 protein) and inhibits peptidyl transferase yield of plasmid DNA was analyzed and compared.
    [Show full text]
  • EFFECT of the KANAMYCIN RESISTANCE MARKER on STABILITY of 2M-BASED EXPRESSION PLASMIDS
    Arch. Biol. Sci., Belgrade, 59 (1), 1-12, 2007. DOI:10.2298/ABS0701001S EFFECT OF THE KANAMYCIN RESISTANCE MARKER ON STABILITY OF 2m-BASED EXPRESSION PLASMIDS STANKOVIĆ NADA., VASILJEVIĆ BRANKA., and†G. LJUBIJANKIĆ Institute of Molecular Genetics and Genetic Engineering, 11010 Belgrade, Serbia Abstract – In this paper we describe the effect of the kanamycin resistance gene (Kmr) on 2μm-based plasmid mainte- nance in Saccharomyces cerevisiae. The influence of this marker gene on the loss of the stable model-vectors proved to be constant, as well as independent of carbon source and culture growth rates. In strains for GALUAS – driven heterolo- gous protein production introduction of Kmr resulted in curing of the yeast episomal plasmid (YEp) from the population in a small number of generations. Application of selective pressure on the strain producing recombinant penicillin G ami- dase (rPGA) did not provide the expected increase of protein yield. The influence of genetic elements for heterologous protein production on vector stability was examined, and the most destabilizing factors prove to be the presence and expression of the foreign gene. Key words: 2μm plasmid, kanamycin resistance, penicillin G amidase, plasmid stability, Saccharomyces cerevisiae, selective markers. UDC577.182.76 : 577.21 579.25 INTRODUCTION based expression vectors were successfully applied in our laboratory for expression of the recombinant penicillin G Expression vectors based on the naturally occurring 2μm amidase (penicillin acylase, PGA, pac) gene from the plasmid are the sole vectors in baker’s yeast which satis- bacterium Providencia rettgeri (Ljubijankićet al., fy two major biotechnological requirements: mitotic sta- 1999; Ljubijankićet al., 2002) and gene for human bility and high copy number.
    [Show full text]
  • Stability of Plasmid Pbr322 Within Escherichia Coli Cells
    MOJ Biology and Medicine Research Article Open Access Stability of plasmid pBR322 within Escherichia coli cells Abstract Volume 6 Issue 1 - 2021 Insertion of plasmids into the bacterial cells is of great significance especially in course Tahsin Tabassum, Tasmin Tabassum, Nafisa of the transfer of drug resistance, virulence and other traits. Retention of plasmids within Tabassum, Syeda Muntaka Maniha, Rashed the host bacteria is therefore an important factor for bacterial homeostasis. Current study inferred the pBR322 plasmid stability within the Escherichia coli competent cells. The Noor Department of Life Sciences (DLS), School of Environment and calcium chloride heat shock method was used for the transformation purpose. The plasmid Life Sciences (SELS), Independent University, Bangladesh retention phenomenon was assessed through the replica plating. The results positively showed the plasmid retention within E. coli. Correspondence: Rashed Noor, Associate Professor, Department of Life Sciences (DLS), School of Environment and Keywords: pBR322, plasmid stability, Escherichia coli, replica plating Life Sciences (SELS), Independent University, Bangladesh (IUB), Plot 16, Block B, Bashundhara, Dhaka 1229, Bangladesh, Tel +8801749401451, Email Received: December 11, 2020 | Published: January 27, 2021 Introduction Such segregation and selection model (SS) further suggested the inclusive study of the growth dynamics of two bacterial populations: Plasmids, the self-replicating genetic elements, separated from the one, consisting of plasmid containing
    [Show full text]