Version 300314 G:\products\productflyer\pcr\ladders\descr_m3081_puc18_puc19_dna.docx X G ENAXXON bioscience ______________________ fon: +49 (0)73 1 – 3608 12 3 fax: +49 (0)73 1 – 3608 962 eMail: [email protected] pUC18/19 DNA - undigested internet: www.genaxxon.com pUC18/19 vector (E. coli plasmid of2686bp) Product Cat# Package size pUC18/19 DNA undigested M3081.0050 1 x 50µg pUC18/19 DNA undigested M3081.0250 1 x 250µg Description pUC18 / pUC19 from E.coli are commonly used small, high copy number, E. coli plasmids, 2686 bp in length. pUC19 is identical to pUC18 except that they contain multiple cloning sites (MCS) arranged in opposite orientations. pUC18/19 plasmids contain: 1. The pMB1 replicon rep responsible for the replication of plasmid (source – plasmid pBR322). The high copy number of pUC plasmids is a result of the lack of the rop gene and a single point mutation in the replicon rep of pMB1. 2. The bla gene, encoding beta-lactamase, confers resistance to ampicillin (source – plasmid pBR322). It differs from that of pBR322 by two point mutations 3. The region of E.coli lac operon containing a CAP protein binding site, promoter Plac, lac repressor binding site and the 5’- terminal part of the lacZ gene encoding the N-terminal fragment of beta-galactosidase (source – M13mp18/19). This fragment, whose synthesis can be induced by IPTG, is capable of intra-allelic (alpha) complementation with a defective form of beta-galactosidase encoded by the host (mutation delta(lacZ)M15). In the presence of IPTG, bacteria synthesize both fragments of the enzyme and form blue colonies on media with X-Gal. Insertion of DNA into the MCS located within the lacZ gene (codons 6-7 of lacZ are replaced by MCS) inactivates the N-terminal fragment of beta-galactosidase and abolishes alpha-complementation. Bacteria carrying recombinant plasmids therefore give rise to white colonies. The map shows enzymes that cut pUC18/19 DNA once. The coordinates refer to the position of the first nucleotide in each recognition sequence. The exact positions of the genetic elements are shown on the map (termination codons included). The bla gene nucleotides 2486- 2418 (complementary strand) code for a signal peptide. The LacZ polypeptide corresponding to wt beta-galactosidase and essential for blue/white screening ends at nt position 236 (compl. strand). Another 30 codons in the same reading frame are derived from pBR322. The indicated rep region is sufficient to promote replication. DNA replication initiates at position 866 (± 1) and proceeds in the direction indicated. Plasmids carrying the pMB1 and ColE1 replicons are incompatible, but they are fully compatible with those carrying the p15A replicon (pACYC177, pACYC184). pMB1-derived plasmids can be amplified using chloramphenicol. The pUC18/pUC19 sequence is stored as a pdf-file on the Genaxxon webpage www.genaxxon.com . It can be downloaded from the “Detaisl” view of the pUC18/pUC19 product description. Reference 1. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Gene 33, 103-119. 2. Accession L09137 X02514, Medline 85180545, Pubmed 2985470. Stability Very stable in the delivered form. The DNA is delivered frozen in storage buffer. Please prevent from repeated “freeze – thaw” cycles! Concentration: 0.2 – 0.5mg/mL Storage buffer: 10mM Tris/HCl (pH8.0), 1mM EDTA Storage and shipping: Please store product at -20°C after delivery. Shipment on “blue-ice”. Genaxxon bioscience GmbH fon: +49 731 3608 123 www.genaxxon.com fax: +49 731 3608 962 1 e-mail: [email protected] Version 300314 G:\products\productflyer\pcr\ladders\descr_m3081_puc18_puc19_dna.docx X G ENAXXON bioscience Restriction map of pUC18/pUC19 Vector ______________________ fon: +49 (0)73 1 – 3608 12 3 fax: +49 (0)73 1 – 3608 962 eMail: [email protected] internet: www.genaxxon.com Product Source: pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure. Polylinker DNA Sequence: GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT Related Products Product Cat# Phage Lambda DNA (dam, cdm) undigested M3074 Lambda-DNA – HindII DNA Marker M3075 Lambda-DNA – BstE II DNA Marker M3076 Phage T7 DNA M3077 pUC19 / MspI DNA Marker M3078 Lambda DNA / Sty Marker M3079 pBR322 – Hae III DNA Marker M3080 pUC19 (undigested vector) M3081 Genaxxon bioscience GmbH fon: +49 731 3608 123 www.genaxxon.com fax: +49 731 3608 962 2 e-mail: [email protected] .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages2 Page
-
File Size-