Targeting Viral RNA Processing to Control HIV-1 Infection

Raymond Waiman Wong

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Graduate Department of Laboratory Medicine and Pathobiology University of Toronto

Raymond Waiman Wong Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2018

Abstract

Resistance to current drugs requires innovative strategies to control HIV-1 infection. We aimed at developing novel inhibitors of HIV-1 replication by targeting viral RNA processing—a stage dependent on conserved host proteins. We identified 12 members of the digoxin family

(cardiotonic steroids, CSs) that impede HIV growth in HIV-infected PBMCs from patients at concentrations (IC50s: 1.1-1.3 nM) that were 2-26 times below those used to treat people with heart conditions. I hypothesized that the response to CSs was due to activation of intracellular signaling pathways initiated upon binding to the Na+/K+-ATPase. CSs suppressed HIV-1 gene expression in part through MEK1/2-ERK1/2 activation, independent of the Ca2+-overloading mechanism responsible for their toxicity. Supporting this hypothesis, Na+/K+-ATPase depletion and MEK1/2-ERK1/2 activator addition also inhibited HIV-1 expression. All CSs tested induced oversplicing of HIV-1 RNAs, reducing unspliced (Gag) and singly spliced RNAs (Env/p14-Tat) encoding critical HIV-1 structural/regulatory proteins. Consequently, all CSs induced nuclear retention of genomic/unspliced viral RNAs, supporting viral RNA processing as the underlying mechanism disrupting HIV-1 replication. Concomitantly, CSs induced modification of SRp20 and Tra2β (whereas digitoxigenin caused de-modification of these splicing factors), which could ii account for responses observed. Consistent with this hypothesis, overexpression of SRp20 altered HIV-1 RNA processing in a similar manner as CS addition. In expanding this approach to other viruses dependent on RNA processing, we identified the splicing-modulator 5342191 as both an inhibitor of HIV-1 and Adenovirus replication (IC50: 750 and 900 nM, resp.). In contrast to CSs, 5342191 inhibition of HIV-1 expression also included proteasomal degradation of Tat, low perturbation of host gene expression (<0.5%), and G protein signaling through Ras-Raf-

MEK1/2-ERK1/2 from the cell membrane but not p38 MAPK or Ca2+ flux. Overexpression of

Ras small-G proteins phenocopied 5342191’s effects. These studies support modulating viral

RNA processing and targeting alternative cellular targets for controlling HIV-1/Adenovirus infection(s).

iii

Acknowledgments

I thank my supervisor, Dr. Alan Cochrane, for providing me the great opportunity to study these interesting projects, where I found my utmost passion for science. I am very grateful for his guidance and knowledge over the course of this dissertation. I would also like to express my greatest appreciation to my supervisory committee members: Scott Gray-Owen, Jeffrey Lee, and co-supervisor Clifford A. Lingwood, for their generous time in providing advice, encouragement, and reagents/equipment. I couldn’t have done this without your support. I thank the Canadian Institutes of Health Research (CIHR) for selecting me for their Doctoral Award – Frederick Banting and Charles Best Canada Graduate Scholarship, UofT/LMP for a couple of fellowship/awards, SGS for a couple of conference/travel grants, and conference committees that awarded me scholarships to attend the Canadian Association for HIV Research (CAHR) conferences for 2012 and 2015 and HIV DART™: Frontiers in Drug Development in Antiretroviral Therapies conference of 2014. Such gatherings have immensely grown my knowledge, helped me create amazing connections, and let me enjoy the fun of science! I thank all past and present members of the Cochrane lab, such as martial-arts Master Dr. Simon Duffy, Dr. Liang “The Panda or Cookie Monster” Ming, and Dr. Alex T.Y. Chen for their critical thoughts on my projects, hardworking undergraduate students such as Annie Y.Q. Mao, Chathura Wijewardena, Lewis Liu, Melissa Geng, etc., Dr. Rade Sajic for a good Northern blot protocol, and other labmates, especially ones who brought positivity and entertainment to the lab. I also wish to thank Shariq Mujib for training me on preparing HIV infected PBMCs for culture, Wendy Dobson-Belaire for teaching me how to perform HIV-1 infections of PBMCs, principal investigators who provided invaluable reagents for our studies (see manuscripts) such as Dr. Peter Stoilov for SMN2 compounds and Mario Ostrowski for PBMCs, many researchers who donated their time to proofread my written materials (i.e. Segen Kidane, see manuscripts), Natasha Christie and Shannon McGraw for their managerial advice, Ferzeen Sammy for assistance as our mommy on solving graduate student account issues, Dr. Harry Elsholtz, Donald R. Branch, and Dr. Tram N.Q. “Boss” Pham for their superb encouragement and advice, and Dr. Mark Wainberg for his motivating speeches and project support (who will be dearly missed!). I thank my parents, William S. and Susan Wong, for their support and raising us with everything we ever needed. I am also indebted to many friends, including Tiffany Pedron (who also contributed to many of my food porfolios entitled “Antidepressants”, “Nom Noms”, “Oinkings”, and “To Eat or Not to Eat, that is Not a Question”), Kaustabh “Bunty” Singh, Norman Ng, Khalid and Nicola Qureshi, Mark Ng, and many others, who have supported and encouraged me since the beginning. In further helping me maintain my sanity throughout all of these years, I thank members of my sports teams as follows: LMP volleyball team (Alex Falkenhagen, Stephen McCarthy, Olga Brashavitskaya, etc. which won a 2012-13 UofT Intramural championship and a free T-shirt), dodgeball team (Drs. Atta Goudarzi, Steven Hersch, Karen Founk, Fiona Coutinho, Shicong Betty Zou, Joe Bondy-Denomy, etc. which won over 7 championships and T-shirts) in the TSSC between 2009-2015 and in Nation Leagues (runner up in one tournament once so far) between 2016-2018, and LMP softball team, pick-up soccer/basketball, and events organized every year. Without the tremendous support from all of these people, organizations, sport teams, family, and friends, I could never have reached this milestone. Thank you everyone for being there!

Table of Contents

Acknowledgments ...... iv

Table of Contents ...... v

List of Tables ...... xi

List of Figures ...... xii

List of Abbreviations ...... xvii

List of Abbreviations (continued) ...... xviii

List of Abbreviations (continued) ...... xix

1 Introduction ...... 20

1.1 The HIV pandemic ...... 20

1.2 Vaccines, cures, and treatments to control the spread and infection of HIV-1 ...... 22

1.3 HIV-1 RNA processing ...... 25

1.3.1 Control of HIV-1 transcription by Tat ...... 27

1.3.2 RNA processing of host and HIV-1 transcripts ...... 28

1.3.3 Regulation of HIV-1 RNA splicing ...... 29

1.3.4 Regulation of HIV-1 gene expression by Rev ...... 33

1.4 Role of host splicing factors in the cell and in HIV-1 replication ...... 35

1.4.1 RNA processing in human diseases ...... 35

1.4.2 hnRNP functions ...... 35

1.4.3 SR protein functions ...... 36

1.4.4 Effect of modulating host splicing factors on HIV-1 replication ...... 36

1.5 Regulation of SR protein functions by phosphorylation and other post-translational modifications...... 37

1.5.1 Effect of different post-translational modifications on SR protein function ...... 37

1.5.2 Role of phosphorylation on SR proteins ...... 38

1.6 Regulation of host alternative RNA splicing by intracellular SR-protein/signaling kinases and their secondary messengers ...... 39

1.6.1 SR protein kinases...... 39

1.6.2 Intracellular signaling kinases and release of secondary messengers ...... 41

1.7 Controlling HIV-1 infection through small molecule modulators of viral RNA processing ...... 44

1.7.1 Inhibitors of SR protein kinases ...... 44

1.7.2 Modulators of SR protein function ...... 46

1.7.3 Inhibitors of HIV-1 Rev function ...... 47

1.7.4 Modulators of HIV-1 Rev and Tat accumulation ...... 48

1.7.5 Conclusion and future directions ...... 50

1.8 Cardiotonic steroids and the Na+/K+-ATPase ...... 51

1.8.1 Discovery and natural sources of CSs ...... 52

1.8.2 Traditional and current applications of CSs ...... 52

1.8.3 Current applications of CSs ...... 53

1.8.4 Discovery and general function of the Na+/K+-ATPase ...... 53

1.8.5 Vital subunits of the Na+/K+-ATPase ...... 55

1.8.6 Expression and regulation of the Na+/K+-ATPase ...... 55

1.8.7 Chemical structure of CSs ...... 56

1.8.8 Distinct properties of individual CSs ...... 57

1.8.9 Mechanism of the positive inotropic effects of CSs ...... 57

1.9 The Na+/K+-ATPase as a signal transducer ...... 58

1.9.1 Src kinase in the formation of the NKA signalosome ...... 58

2+ 1.9.2 NKA in IP3R or PLC-γ-IP3R regulation of intracellular Ca and PKC ...... 59

1.9.3 NKA and NCX amplification of Ca2+ responses via the plasmERosome ...... 60

1.9.4 NKA in EGFR transactivation and regulation of MAPK signaling ...... 60

1.9.5 NKA and PI3K activation ...... 62

1.10 Thesis rationale and outline ...... 63

2 Digoxin Suppresses HIV-1 Replication by Altering Viral RNA Processing ...... 65

2.1 Abstract ...... 66

2.2 Author Summary ...... 66

2.3 Introduction ...... 67

2.4 Results ...... 70

2.4.1 Digoxin is a potent inhibitor of HIV-1 gene expression ...... 70

2.4.2 Digoxin inhibits HIV-1 replication in PBMCs ...... 71

2.4.3 Digoxin alters HIV-1 RNA processing ...... 75

2.4.4 Digoxin alters the usage of specific HIV-1 pre-mRNA splice sites ...... 79

2.4.5 Digoxin induces loss of Rev expression and reduces cytoplasmic accumulation of US viral RNA ...... 82

2.4.6 Digoxin inhibits the activity of CLK SR protein kinases and induces modification of a subset of SR proteins ...... 84

2.4.7 SRp20 overexpression mimics the effects of digoxin on HIV-1 RNA processing ...... 88

2.5 Discussion ...... 90

2.6 Materials & Methods ...... 95

2.6.1 Screening of splice modulator drugs ...... 95

2.6.2 Ethics statement ...... 96

2.6.3 HIV-1 growth in PBMCs ...... 96

2.6.4 Quantitation of HIV-1 mRNA levels and localization ...... 96

2.6.5 Analysis of HIV-1 splice site usage ...... 97

2.6.6 Effect of digoxin on CLK function ...... 97

2.6.7 Analysis of HIV-1 and SR protein expression ...... 97

2.6.8 Effect of SR protein and Rev overexpression on HIV-1 gene expression ...... 98

2.6.9 Statistical analysis ...... 98

vii

3 Cardiac glycoside/aglycones inhibit HIV-1 gene expression by a mechanism requiring MEK1/2-ERK1/2 signaling ...... 99

3.1 Abstract ...... 100

3.2 Introduction ...... 100

3.3 Results ...... 103

3.3.1 Cardenolide and bufadienolide classes of CSs are potent inhibitors of HIV-1 gene expression ...... 103

3.3.2 CSs impede the growth of clinical strains of HIV from PBMCs of HIV- infected patients ...... 107

3.3.3 CSs block the expression of vital HIV-1 structural and regulatory proteins ...... 110

3.3.4 Inhibition of HIV-1 gene expression by CSs is associated with alterations in viral RNA processing ...... 113

3.3.5 CSs induce post-translational modification of specific host splicing factors ...... 117

3.3.6 The anti-HIV-1 activity of CSs requires interactions with the NKA ...... 118

2+ 3.3.7 CS inhibition of HIV-1 gene expression does not require changes in [Ca ]i or activation of PI3K-AKT signaling ...... 122

3.3.8 CS suppression of HIV-1 gene expression involves activation of the MEK1/2- ERK1/2 pathway ...... 125

3.3.9 Activation of the MEK1/2-ERK1/2 pathway by anisomycin suppresses HIV-1 gene expression ...... 131

3.4 Discussion ...... 134

3.5 Methods...... 141

3.5.1 Dose response of drugs on HIV-1 gene expression ...... 141

3.5.2 Ethics statement ...... 142

3.5.3 Assaying viral growth in HIV infected PBMCs ...... 142

3.5.4 Analysis of the expression of HIV-1 and host cellular proteins ...... 142

3.5.5 Determining the effect of drug/compounds on HIV-1 RNA processing and host gene expression ...... 144

3.5.6 Analysis of cell signaling pathways ...... 145

3.5.7 Determining the in vitro and ex vivo TIs of CSs ...... 146 viii

3.5.8 Statistical analyses ...... 146

3.5.9 Inter-chapter Transition ...... 147

4 Suppression of HIV-1 and adenovirus replication by small molecule alteration of RNA processing ...... 148

4.1 Abstract ...... 149

4.2 Introduction ...... 149

4.3 Results ...... 151

4.3.1 5342191 inhibits expression of HIV-1 structural and regulatory proteins ...... 151

4.3.2 5342191 suppresses the replication of wild-type and drug-resistant strains of HIV ...... 155

4.3.3 HIV-1 RNA processing is altered by 5342191 ...... 157

4.3.4 5342191 has limited effect on host RNA accumulation and processing ...... 164

4.3.5 Effect of 5342191 on the synthesis and degradation of HIV-1 and cellular proteins ...... 167

4.3.6 5342191 suppresses Adenovirus replication ...... 170

4.3.7 A subset of SR splicing factors are modulated by 5342191 ...... 172

4.3.8 Compound 5342191 modulation of HIV-1 gene expression involves activation of MAPK signaling ...... 174

4.3.9 Suppression of HIV-1 expression by 5342191 involves initiation of G protein signaling at the cell membrane ...... 180

4.4 Discussion ...... 184

4.5 Methods...... 191

4.5.1 Ethics statement ...... 191

4.5.2 Analysis of compounds for inhibition of HIV-1 gene expression ...... 191

4.5.3 Western blot analysis of viral and cellular proteins ...... 192

4.5.4 Analyses of HIV-1, Adenovirus, and host mRNAs ...... 193

4.5.5 Adenovirus yield ...... 193

4.5.6 Quantification of Adenovirus DNA ...... 194

4.5.7 Analysis of the changes in host alternative splicing and gene expression ...... 194

4.5.8 SUnSET analysis of total cellular protein synthesis229 ...... 195

4.5.9 Measuring the stability and degradation of HIV-1 proteins ...... 195

4.5.10 Deciphering the intracellular signaling pathways modulated by 5342191 ...... 195

4.5.11 Statistical analyses ...... 196

5 General Discussion and Future Studies ...... 197

5.1 Identifying digoxin as a novel inhibitor of HIV-1 RNA processing ...... 197

5.2 Discovering other cardiotonic steroids with improved anti-HIV-1 inhibitor profiles .....198

5.3 Impact of CSs on the expression of essential HIV-1 structural and regulatory proteins and replicative potential ...... 199

5.4 Identification of other novel inhibitors of HIV-1 RNA processing ...... 202

5.5 Effect of targeting viral RNA processing to control HIV replication ...... 205

5.6 Impact of HIV-1 RNA processing inhibitors on the potential evolution of drug resistant mutations in HIV ...... 207

5.7 CSs inhibit HIV-1 gene expression via signal transduction ...... 208

5.8 Compound 5342191 activates MEK1/2-ERK1/2 via G protein signaling ...... 210

5.9 Identification of MEK1/2-ERK1/2 downstream signaling effector(s) involved in controlling HIV-1 replication ...... 211

5.10 Repurposing HIV-1 RNA processing inhibitors in the treatment of cancer ...... 212

6 Conclusion ...... 213

7 References ...... 215

List of Tables

Table 1.1. Summary of some in vitro and/or in vivo targets reported for SR protein kinases...... 40

Table 3.1. Comparison of the in vitro (IVTI) and ex vivo therapeutic indices (EVTIs) of CSs and their impact the expression of essential HIV-1 proteins...... 135

Table 4.1. Acquired HIV-1 mutations associated with resistance to anti-HIV-1 drugs...... 156

Table 4.2. RNA-Seq dataset presenting the genes with significant changes in alternative splicing in cells treated with 5342191...... 160

Table 4.3. RNA-Seq dataset displaying the significant changes in gene expression in cells treated with 5342191...... 161

Table 4.4. RT-PCR dataset showing the genes with significant differences in alternative splicing in cells treated with 5342191...... 166

List of Figures

Figure 1.1. Phylogenetic tree comparing the genetic variability between HIV-1 (red) and global Influenza A (black) with size depicting the extent of variation...... 21

Figure 1.2. Diagram of the HIV-1 lifecycle depicting the various stages inhibited by current antiretroviral therapies, including viral RNA processing—an area not targeted by present drugs...... 23

Figure 1.3. Diagram of the HIV-1 proviral genome and its differentially spliced mRNAs...... 26

Figure 1.4. Coordinated step-wise assembly of the spliceosome...... 29

Figure 1.5. Map of the regulatory elements and splicing factors that modulate the splice site usage of HIV-1 pre-mRNAs...... 31

Figure 1.6. SR protein nomenclature and structural organization...... 32

Figure 1.7. Role of Rev during the early and late phases of HIV-1 gene expression...... 34

Figure 1.8. Regulation of alternative RNA splicing by various intracellular signaling kinases. .. 43

Figure 1.9. Illustration of Tet-ON HIV-1 proviruses used in cell-based assays for inhibitors of HIV-1 gene expression...... 45

Figure 1.10. 8-Azaguanine and 5350150 inhibit HIV-1 replication by altering viral RNA processing...... 49

Figure 1.11. Influence of CSs on the ion pumping and signalosome functions of the Na+/K+- ATPase...... 54

Figure 2.1. Pattern of HIV-1 mRNAs generated from splicing...... 68

Figure 2.2. Digoxin suppresses HIV-1 gene expression...... 72

Figure 2.3. Digoxin inhibits HIV-1 replication in PBMCs...... 73

Figure 2.4. Digoxin inhibits HIV-1 (BaL) gene expression in PBMCs at day 3...... 74 xii

Figure 2.5. Digoxin alters HIV-1 RNA processing...... 76

Figure 2.6. Digoxin alters HIV-1 RNA processing in a dose-dependent manner...... 77

Figure 2.7. Effect of digoxin on HIV-1 expression and RNA processing in a chronically-infected human T cell line...... 78

Figure 2.8. Digoxin alters HIV-1 pre-mRNA splice site usage to suppress Rev expression...... 80

Figure 2.9. Clotrimazole and flunarizine do not affect HIV-1 pre-mRNA splice site usage...... 81

Figure 2.10. Digoxin blocks cytoplasmic accumulation of HIV-1 US RNA and its effect is partially reversed by expression of Rev in trans...... 83

Figure 2.11. Digoxin alters the activity of SR protein kinases and induces modification of a subset of SR proteins...... 85

Figure 2.12. Digoxin alters the activity of CLK SR protein kinases...... 86

Figure 2.13. Overexpression of SRp20, Tra2β1, or Tra2β3 suppress HIV-1 expression...... 89

Figure 2.14. Digoxin inhibits HIV-1 replication at a new stage of the virus lifecycle...... 92

Figure 3.1. Chemical structure and inhibition data of cardiac glycoside/aglycones on HIV-1 gene expression...... 104

Figure 3.2. CSs inhibit HIV-1 gene expression in a dose-dependent manner...... 106

Figure 3.3. CD8+ T cell depletion of HIV-infected PBMCs from clinical patients...... 108

Figure 3.4. CSs inhibit the growth of clinical strains of HIV isolated from HIV infected patients...... 109

Figure 3.5. CSs reduce expression of essential HIV-1 structural and regulatory proteins...... 111

Figure 3.6. Immunoblot/gels used for representative data figures...... 112

Figure 3.7. CSs suppress HIV-1 gene expression by altering viral RNA processing...... 114

xiii

Figure 3.8. Effect of CSs on HIV-1 RNA processing in HIV-1-infected CD4+ T cells...... 116

Figure 3.9. Expression of different NKA α-subunit isoforms across various cell types...... 119

2+ Figure 3.10. Effect of modulating NKA expression, [Ca ]i, and PI3K-AKT on HIV-1 gene expression...... 120

2+ Figure 3.11. CSs inhibit HIV-1 gene expression in a mode independent of changes in [Ca ]i. 123

Figure 3.12. PI3K-AKT signaling plays little to no role in the suppression of HIV-1 gene expression by CSs...... 124

Figure 3.13. Activation of various MAPKs by CSs can be blocked by specific inhibitors...... 126

Figure 3.14. CSs control HIV-1 gene expression through intracellular signaling...... 127

Figure 3.15. CSs and anisomycin inhibit HIV-1 gene expression through MEK1/2-ERK1/2 signaling...... 129

Figure 3.16. Effect of CSs on ROS production and NKA levels in cells...... 130

Figure 3.17. Activation of the MEK1/2-ERK1/2 signaling pathway suppresses HIV-1 gene expression...... 132

Figure 3.18. Role of anisomycin signaling on the inhibition of HIV-1 gene expression and protein synthesis...... 133

Figure 3.19. Estimation of the approximate ex vivo TIs of four CSs...... 136

Figure 3.20. Model depicting the suggested signaling pathway modulated by CSs to suppress HIV-1 gene expression...... 138

Figure 3.21. CSs do not alter the subcellular localization or transport function of HIV-1 Rev. 140

Figure 4.1. Identification of 5342191 as a potent inhibitor of HIV-1 replication...... 153

Figure 4.2. 5342191 alters HIV-1 RNA processing in HIV-1-infected CD4+ T cells...... 154

Figure 4.3. 5342191 blocks infection of an entry drug-resistant HIV strain...... 156

xiv

Figure 4.4. 5342191 alters HIV-1 RNA processing with little perturbation of host alternative RNA splicing and gene expression...... 158

Figure 4.5. Effect of 5342191 on splice site usage of HIV-1 MS pre-mRNAs...... 162

Figure 4.6. Immunoblot/gels used for representative figures...... 163

Figure 4.7. Compound 5342191 alters a small subset of alternatively spliced cellular RNAs. .. 165

Figure 4.8. Changes in cell viability after exposure of HeLa cervical carcinoma cells to 5342191...... 167

Figure 4.9. Effect of 5342191 on cellular protein synthesis and degradation state of HIV-1 proteins...... 168

Figure 4.10. Decay rate of HIV-1 Tat in cells treated with 5342191...... 169

Figure 4.11. Suppression of Adenovirus replication by 5342191 results in blocked viral DNA replication and late gene expression...... 171

Figure 4.12. Effect of 5342191 on the modification of SR proteins...... 173

Figure 4.13. 5342191 inhibits HIV-1 gene expression via Raf-MEK1/2-ERK1/2 signaling. .... 175

Figure 4.14. 5342191 suppresses HIV-1 gene expression through MEK1/2-ERK1/2 activation...... 177

Figure 4.15. 5342191 suppression of HIV-1 gene expression involves MEK1/2-ERK1/2 signaling...... 178

Figure 4.16. 5342191 inhibition of HIV-1 gene expression requires only 4 h of treatment...... 179

Figure 4.17. 5342191 activates G protein signaling to inhibit HIV-1 gene expression via a Ras dependent mechanism...... 181

Figure 4.18. 5342191 inhibits HIV-1 gene expression through activation of G proteins...... 182

Figure 4.19. Model of 5342191 inhibition of HIV-1 gene expression through intracellular G protein signaling...... 183

Figure 4.20. Diagram of the impact of 5342191 on HIV-1 RNA processing and replication. ... 186

Figure 4.21. Treatment of cells with LB blocks expression of US and SS HIV-1 mRNAs...... 187

Figure 4.22. Effect of 5342191 on the levels of ROS, Na+/K+-ATPase, and p38 MAPK activation in cells...... 190

Figure 5.1. Chemical structure of HIV-1 RNA processing inhibitors...... 204

Figure 5.2. 5342191 inhibits the outgrowth of HIV from HIV infected patient PBMCs...... 205

xvi

List of Abbreviations

5342191 N-[4-chloro-3-(trifluoromethyl)phenyl]-7-nitro- CPSF30 Cleavage and polyadenylation 2,1,3-benzoxadiazol-4-amine specificity factor 30 2+ 2+ [Ca ]i intracellular Ca concentration CRM1 chromosomal maintenance 1 + + [Na ]i intracellular Na concentration CROP cisplatin resistance-associated overexpressed protein 3TC Lamivudine cRPKM corrected reads per kilobase of exon model per million mapped reads aa amino acid CS cardiotonic steroid ACE angiotensin converting enzyme CSF cerebral spinal fluid AIDS acquired immune deficiency syndrome CTL cytotoxic T lymphocytic AKT AK strain transforming CycT1 cyclin T1 ART antiretroviral therapy DAG 1,2-diacylglycerol ARV antiretroviral DAZAP1 DAZ-associated protein 1 AS alternatively spliced DDX DEAD-box helicase AS160 AKT kinase substrate of 160 kda DE differentially expressed AZT Azidothymidine DMSO dimethyl sulfoxide BMK Big MAP kinase Dox doxycycline BPT branchpoint DYRK Dual-specificity tyrosine phosphorylation-regulated kinase

CA capsid EC50 50% or half-maximal effective concentration CAG cardiac aglycone ELISA enzyme-linked immunosorbent assay CaM calmodulin EGF epidermal growth factor CaMK calmodulin kinase eNOS nitric oxide synthase cARTs combination antiretroviral therapies Env envelope

CC20 20% cytotoxicity concentration ERK extracellular signal-regulated kinase CCR5 CC-chemokine receptor 5 ESE exon splicing enhancer CDC2 cell division control 2 ESS exon splicing silencer CDK cyclin-dependent kinase EVTI ex vivo therapeutic index CG cardiac glycoside FAK focal adhesion kinase CHX cycloheximide FAST K Fas-activated serine/threonine kinase CIP calf intestinal alkaline phosphatase FCS fetal calf serum CLASP Clk4-associating SR-related protein FISH fluorescent in situ hybridization CLK CDC2-like kinases GAPDH glyceraldehyde 3-phosphate dehydrogenase CMV cytomegalovirus GEF guanine nucleotide exchange factor GDP guanosine diphosphate

xvii

List of Abbreviations (continued)

GFP green fluorescent protein MAP mitogen-activated protein gp41/120/160 HIV-1 Env glycoprotein 41/120/160 MAPK mitogen-activated protein kinase GPCR G protein coupled receptor MEK MAPK/ERK kinase GRB2 growth factor receptor-bound protein 2 MHC major histocompatibility complex GSK3 glycogen synthase kinase 3 MKK3/6 MAPK kinase 3/6 GTP guanosine triphosphate MOI multiplicity of infection HA hemagglutinin MS multiply spliced HAdV-C5 human Adenovirus C5 MVC Maraviroc HBMECs human brain microvessel endothelial cells MW molecular weight HCV hepatitis C virus Myr myristoylated HIV Human immunodeficiency virus NAP1 nucleosome assembly protein 1 hnRNP heterogeneous nuclear ribonucleoprotein NC nucleocapsid HPV human papillomavirus NCX Na+/Ca2+-exchanger hRip1 hypersensitive response inducing protein 1 NELF negative elongation factor HSCs hematopoietic stem cells NES nuclear export signals HSP70/90 heat shock protein 70 kDa or 90 kDa NKA Na+/K+-ATPase or sodium/Na+ pump HTS high-throughput screen NLS Nuclear localization signal

IC50 50% inhibitory concentration NMD non-sense mediated decay IgG immunoglobulin G NMDAR1 NMDA receptor I IL-2 interleukin-2 NO nitric oxide IL2rγ IL-2 receptor gamma chain NOD nonobese diabetic IN Integrase NRTI Nucleoside/nucleotide RT inhibitor null IP3 Inositol 1,4,5 trisphosphate NSG NOD-scid IL2rγ

IP3R IP3 receptor NXF1 Nuclear RNA export factor 1 ISS Intron splicing silencer ORF Open reading frame IVTI in vitro therapeutic index PBMCs peripheral blood mononuclear cells JNK c-Jun N-terminal kinase PEI polyethylene imine LB leptomycin B P-ERK phosphorylated ERK LTR long terminal repeat PHA-L phytohemagglutinin-leucoagglutinin (PHA-L) MA matrix PI3K Phosphatidylinositol-3-kinase

PKA/PAK protein kinase A

xviii

List of Abbreviations (continued)

PKC protein kinase C SIV simian immune deficiency syndrome PLC phospholipase C SIVcpz chimpanzee SIV PMA phorbol 12-myristate 13-acetate SIVsm sooty mangabey SIV PPT polypyrimidine tract SMA spinal muscular atrophy PR protease SMM small molecule microarray PRP4 pre-mRNA processing mutant 4 SMN2 Survival motor neuron 2 PSF Polypyrimidine-tract binding protein- snRNP small nuclear RNP associated splicing factor PSI percent spliced in SOS Son of Sevenless P-TEFb Positive transcription elongation factor b SR protein Serine-/arginine-rich protein qRT-PCR quantitative reverse-transcriptase polymerase SRPK SR-protein-specific kinase chain reaction Rev regulator of the expression of virions SRSF SR splicing factor RNAP RNA polymerase ss splice site RNP ribonucleoprotein SS) singly spliced ROS reactive oxygen species SUnSET Surface sensing of translation technique RRE Rev response element TAP Tip-associated protein RRM RNA recognition motif TAR transactivation-responsive region RRMH RRM homology Tat transactivator of transcription RS domains arginine/serine-rich domains TB trypan blue

RT reverse-transcriptase TD50 median toxic dose rtTA reverse-tetracycline transactivator TGF transforming growth factor S.e.m./SEM standard error of the mean THP-1 human acute monocytic cell line SA (or A) splice acceptor TI therapeutic index Sam68 SRC-associated in mitosis, 68 kDa TIA-1 T-cell intracellular antigen 1 scid severe combined immunodeficiency TIAR TIA-1-related SD (or D) splice donor Tra2 transformer-2 SEAP Secreted enzyme alkaline phosphatase TRAP150 thyroid hormone receptor-associated protein, 150 kDa subunit SERCA sarco-/endoplasmic reticulum Ca2+-ATPase tTA tetracycline transactivator SH2 Src homology 2 U2AF U2 snRNP auxiliary factor SHC Src homology 2 domain-containing US unspliced shRNA short hairpin RNA WT wild-type

xix

1 Introduction 1.1 The HIV pandemic Approximately 36.7 million people on the globe are infected and living with human immunodeficiency virus (HIV)/acquired immune deficiency syndrome (AIDS) in 20161. Since the beginning of this epidemic, over 35 million people have died from AIDS1. Although deaths from this disease has fallen by 45% since 2005, there are still ~1.8 million new people infected every year1. HIV infection can be spread by sexual, percutaneous, and perinatal routes. However, AIDS is primarily a sexually transmitted disease since 80% of adults acquire this virus from exposure at mucosal surfaces2. HIV-1 was first discovered in the US in 1981 as the causative agent of AIDS when an increasing number of homosexual men were found with unusual opportunistic infections and rare malignancies3,4. A morphologically similar but antigenically distinct virus named HIV-2 was found to cause AIDS in West Africa2. Hence, AIDS can be caused by two types of HIV: HIV-1 and HIV-2; through different evolutionary origins, these have close simian relatives (SIV) found in chimpanzees (SIVcpz) and sooty mangabeys (SIVsm), respectively2,5. Phylogenetic analyses support that HIV-1 and HIV-2 were the result of zoonotic transfers from these respective primate species infected with SIV in Africa2,5. HIV-1 is phylogenetically divided into four groups: M, N, O, and P2. Group N, O, and P have inactive/defective Vpu function and anti-tetherin response whereas HIV-1 group M retain these defenses2. Consequently, the group M lineage has resulted in a global epidemic and is further classified into nine subtypes: A-D, F-H, J, and K2. Subtypes A and D originated in central Africa and established epidemics in eastern Africa, C was introduced to and predominates in southern Africa but spread to India and other parts of Asia, and B was first spread to Haiti and then to the US and other Western countries where it accounts for the great majority of infections in the West (Americas and Europe)2. On the other hand, HIV-2 is less of a global concern. Not only is it restricted to West Africa, there is a near absence of transmission between people and mother to infants, and most people infected do not progress to AIDS. As a result, the overall prevalence rate of HIV-2 is declining and increasingly becoming replaced by HIV-12. HIV’s rate of evolution or its capacity to mutate and adapt is enormous: it can mathematically generate every possible mutation at each site in the genome per day (given approx. 109 new virions produced per day, 1 mutation per 105 bases, 104 bases per genome)6. This rate of evolution is primarily caused by a lack of proofreading function in HIV reverse-

20 transcriptase (RT), leading to 3.4 x 10-5 mutations per nucleotide per genome replication7. By relative comparisons, this mutation rate is 4-5 logs higher than those of pathogenic bacteria, fungi, and plasmodium falciparum which change between a range of 10-9 to 10-10 mutations per nucleotide per generation8. Consequently, and because each HIV subtype can recombine with one another, viruses within HIV-1 subtypes can diverge about 25% and, in locations such as Africa where there are many circulating subtypes, they can differ by up to 38%7,9. Although global Influenza is known to have very high genetic variation, the extent of genetic variability in HIV-1 is much greater by comparison (Fig. 1.1 and phylogenetic analyses in references)9,10. The extensive genetic variation and evolution rate of HIV allows it to adapt, subject to the barriers outlined below, creating difficult challenges for the development and sustainment of any vaccine, cure, or treatment strategy9,11.

Figure 1.1. Phylogenetic tree comparing the genetic variability between HIV-1 (red) and global Influenza A (black) with size depicting the extent of variation. Sequence data was from HIV-1 V2-C5 of the Democratic Republic of the Congo and global Influenza A from 1996. Image was reproduced with permission from McEnery (2010). IAVI Report 14(3): 4-9 via correspondence with Nicole Sender on Aug. 21, 201710.

1.2 Vaccines, cures, and treatments to control the spread and infection of HIV-1

Presently, there is no practical cure for HIV/AIDS; however, the “The Berlin Patient” known as Timothy Brown has challenged the assumption of this disease being incurable12,13. After three decades of research and over 85 trials, there is still no safe and effective vaccine to prevent HIV infection14. Many barriers have been described that prevent the development of an effective vaccine, which include: sequence diversity of HIV-1, infection of critical immune cells, immune avoidance (masking of neutralization epitopes, major histocompatibility complex (MHC) down- regulation, immune escape through viral mutation, counter-immunoregulatory mechanisms), and latency9,11. Some leaders in the field even question whether an AIDS vaccine is even feasible given our current knowledge of HIV9. Although there are many difficult hurdles to overcome in this endeavor, these efforts have had some success, broadening our understanding of HIV-1, and is the best hope to permanently prevent the spread and infection of HIV14. The medical management of HIV-1 infection and spread has relied on the development of antiretroviral (ARV) therapies (ARTs), which have evolved into combination antiretroviral therapies (cARTs) or known as highly active antiretroviral therapies (HAARTs), that have substantially decreased AIDS-related morbidity and mortality as well as HIV transmission15,16. Unfortunately, HIV cannot be effectively eradicated with current cARTs because of pools of latent infected cells which persist and are unaffected by these drugs17. Although there was some initial excitement surrounding the use of cARTs to eradicate HIV from patients, i.e. the “Mississippi Child,” unfortunately subsequent monitoring has verified late viral rebound18. ARV drugs target all three essential HIV-1 enzymes [RT, integrase (IN), and protease (PR)] and entry proteins (Fig. 1.2)15. Distinct from directly targeting viral enzymes, the only two existing HIV-1 entry drugs inhibit viral envelope (Env) interactions with the co-receptor, CC- chemokine receptor 5 (CCR5), and with the cell membrane (fusion)15. About the same number of drugs are in use for viral integration. In contrast, there are over 13 drugs for HIV-1 RT and 9 for PR. RT drugs are divided into two types: nucleoside/nucleotide RT inhibitors (NRTIs), which are the first class of drugs to be approved by the FDA, and non-nucleoside RT inhibitors (NNRTIs)15. Apart from these, there are inhibitors of viral transcription and ones targeting virus assembly and production but they are currently in preclinical testing15. HAARTs successfully perturb HIV-1 replication, reducing viral load in the plasma of patients to below limits of clinical 22

assays which result in significant reconstitution of the immune system15. Lower plasma HIV RNA is associated with lowered concentrations of virus in genital secretions, thus HIV infected people on cARTS have greatly reduced the risk of HIV transmission to other subjects17.

Figure 1.2. Diagram of the HIV-1 lifecycle depicting the various stages inhibited by current antiretroviral therapies, including viral RNA processing—an area not targeted by present drugs. See text for details. Image created by Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

However, the clinical application of current ARTs for HIV infection are limited by issues with toxicity, treatment adherence, high cost, and rise and transmission of drug-resistant viruses15,17,19. The morbidity and mortality in HIV-infected people on ARTs are increasingly driven by non-AIDS associated comorbidities, e.g. kidney, liver, and heart disease; age-related co-morbidities, e.g. diabetes and cardiovascular, renal, and bone disease; mitochondrial toxicity manifested as myopathy, neuropathy, hepatic failure, and lactic acidosis; and lipodystrophy, e.g. facial lipoatrophy, increase truncal fat, and hypertriglyceridemia19,20. Patients with transmitted HIV resistance to drugs, on the other hand, is also highly prevalent in North America and Europe, ranging between 7-24% (from 2002-2009 data) and stable at 15% for San Francisco and 11% for the UK by 200921–24. On the contrary, patients with pre-treatment HIV drug resistance in low and middle income countries, which are currently at ≥ 10% for most of these countries, are on the rise in Asia and, most alarmingly, are increasing exponentially in regions of Africa and Latin America (based on 1993-2016 data)23,25. The principal impetus for applying cARTs (multiple drug cocktails) was due to drug resistance developing from monotherapies such as in the use of the first ARV, AZT16. The development of drug resistance can be attributed to the activity of HIV’s RT and recombination ability, as mentioned above. The percentage of patients with drug resistant HIV increases steadily by their length of time on treatment, for instance, to 7% after 6-11 months, 11% after 12-23 months, and 21% after >36 months23. The lack of adherence and ineffective treatment regimens increase the chance of drug resistance23,24. Low and middle income countries, where there are frequent interruptions in treatments and/or only monotherapies available, are at higher risks for HIV drug resistance to occur23,25. Although reduced with HAARTs, HIV in patients on multiple drugs can still become resistant to a drug(s)16. HIV’s propensity to evolve and escape ARV control calls for new innovative treatment strategies and alternative approaches for combatting this pandemic15,26.

1.3 HIV-1 RNA processing

For the 9.2 kb HIV-1 genome to have the capacity to synthesize 9 protein/polyproteins (20 total), its transcript must undergo extensive viral RNA processing to generate over 47 different mRNAs that encode the full complement of essential viral structural/regulatory proteins and viral auxiliary factors (Figs. 1.2-1.3)27. This stage of the HIV-1 lifecycle has not been targeted by any ARV drug. Distinct form current ARV drugs, HIV-1 RNA processing is almost completely under the control of the host cell. It involves highly conserved cellular proteins/processes (e.g. transcription, splicing, and export of RNAs, transport of splicing factors, and translation) as well as conserved HIV-1 RNA regulatory elements (e.g. transcription, export, and splicing enhancer and silencer sequences) and essential viral factors (Tat and Rev) and their import, export, and RNA-binding elements. An inhibitor disrupting this stage may deliver long lasting control of HIV-1 infection and perhaps limit the evolution of viral resistance.

Figure 1.3. Diagram of the HIV-1 proviral genome and its differentially spliced mRNAs. The 5’ splice donor sites (D1-4) and 3’ splice acceptor (A1-3, A4 c, b, and a, A5, and A7) sites are indicated at the top and the regions of pre-mRNA that are potential spliced are indicated below (hatched lines). Open reading frames (ORFs) of coding exons for each HIV-1 mRNA product (shown on the right) are indicated by different colors while noncoding exons are displayed in gray. Note: this diagram is missing both SD5 (D5) and SA6 (A6) sites and mRNA labeled env is bicistronic, encoding env/vpu because of an additional vpu ORF upstream of the env ORF28,29. The 2, 4, and 9 kb RNAs in the right margin belong to the MS, SS, and US classes of HIV-1 RNAs (resp., see text). Image was reproduced with permission from Jamal Tazi [FEBS J. 277, 867–76 (2010)] and John Wiley and Sons, Inc. ©2010 (License No. 4183990648803)30. 26

1.3.1 Control of HIV-1 transcription by Tat After integration of HIV-1 into the host cell chromosome, the viral genome is transcribed into a single pre-mRNA from a complex promoter located within the 5’ long terminal repeat (LTR) region of the viral genome29,31. HIV transcription is mediated by RNA polymerase (RNAP) II and controlled by a powerful and highly efficient core promoter located in the LTR which contains multiple upstream DNA regulatory elements that serve as binding sites for cellular transcription initiation factors (depicted in Fig. 1A of reference)29. This promoter is capable of supporting levels of transcription that are higher than those of Adenovirus and CMV promoters29. The core promoter consists of three tandem SP1 binding sites, TATA element, and an initiator sequence that serves as binding sites for cellular transcription initiation factors29. Each of these elements are involved in cooperative binding with the initiation factor TFIID, and its associated TAF cofactors, to the TATA box29. Additionally, HIV-1 is controlled by an enhancer region which consists of two NF-B binding motifs which binds members of the NF- B family and NFAT (depicted in Fig. 1A of reference)29. Signaling via this enhancer is essential for the reactivation of latent proviruses and support of virus replication in primary T cells29. Furthermore, initiation of HIV-1 transcription requires transactivation by a viral factor known as the transactivator of transcription (Tat) which binds to the transactivation-responsive region (TAR) located +1 to +59 nucleotides downstream of the transcription initiation site (see Fig. 1A of reference)29. Tat stimulates transcription elongation and possibly initiation of the viral transcription complex29. Tat-TAR interaction leads to recruitment of the human positive transcription elongation factor b (P-TEFb), an essential cofactor of Tat consisting of cyclin T1 (CycT1) and cyclin-dependent kinase (CDK) 9. This recruitment leads to a complex series of phosphorylation events on the C-terminal domain of RNAPII to facilitate transcription elongation (depicted by Fig. 2A of reference)29. In the absence of Tat factor, HIV-1 transcription elongation is otherwise greatly restricted or paused by a negative elongation factor (NELF) binding to TAR until it is released via phosphorylation by P-TEFb29. Further information on the regulation of P-TEFb, epigenetic regulation of transcription, and transcriptional feedback, especially with regard to influencing Tat and HIV-1 active and latent states, have been thoroughly discussed in a recent review29.

1.3.2 RNA processing of host and HIV-1 transcripts After transcription, HIV-1 pre-mRNAs, like most cellular mRNAs, undergo 5’ capping, intron removal, and 3’ end processing [poly(A) tail addition] as detailed in recent reviews29,31. However, export of unspliced (US) and singly spliced (SS) viral RNAs to the cytoplasm (explained below) is tightly regulated29,31. The removal of intronic sequences in transcripts are performed by the host spliceosome, a multi-component ribonucleoprotein (RNP) complex consisting of five small nuclear RNP complexes (snRNPs, U1-2 and U4-6) which assemble onto a pre-mRNA when necessary splicing signals are present (Fig. 1.4)31,32. U1 snRNP recognizes and binds to 5’ splice sites (ss) while U2 snRNPs, along with cellular splicing factor U2AF, recognize and bind to 3’ss31,32. More specifically, U2 snRNP binds to the branchpoint (BPT) sequence and U2AF binds to the polypyrimidine tract (PPT) of the 3’ss31,32. Although the 5’ and 3’ss are required for splicing, recognition of these sequences requires additional regulatory elements in the transcript (described in the next section). These snRNPs are assembled in a very coordinated manner on pre-mRNA to form a macromolecular machine making up the spliceosome (Fig. 1.4)33,34. This involves sequential step-wise assembly of E, A, B, and C complexes to reach a catalytically active spliceosome (Fig. 1.4)33,34. The early E complex is formed by U1 snRNP binding to the 5’ss and heterodimeric U2 snRNP auxiliary factor (U2AF65 and U2AF35) binding to the PPT of 3’ss (Fig. 1.4)33,34. This step is regulated by phosphorylation-dependent interactions of serine-/arginine-rich (SR) proteins (involved in recruiting U1 snRNP and further reviewed below) and U1 snRNP 70 kDa (U1-70K or snRNP70) at the 5’ss and, additionally, the small subunit of U2AF (U2AF35) at the 3’ss. U2 snRNP binding at the BPT of the 3’ss, facilitated by SR protein neutralization of negative charged RNA, converts the E complex to an A complex (Fig. 1.4). Binding of U4/U6-U5 tri- snRNP via recruitment from bound SR proteins forms the B complex (Fig. 1.4). A number of rearrangements occur in RNA-protein and RNA-RNA interactions, coupled with dephosphorylation of SR proteins by phosphatases, result in assembly of the catalytic C complex (Fig. 1.4); this mature catalytically-active spliceosome arises from interactions between U6 and U2, displacement of U1 at the 5’ss by U6, releasing U1 and U4, and U5 coordinating exons prior to splicing and ligation. SR proteins also promote U6 binding during this step. The primary function and post-translational regulation of SR proteins are continued in Chapter 1.5.

Figure 1.4. Coordinated step-wise assembly of the spliceosome. U1-2 and U4-6 snRNPs and other splicing factors (different colors) are shown to sequentially bind to a pre-mRNA with two exons separated by an intron. Formation of E, A, B, and C complexes are required to achieve a catalytically active spliceosome as detailed in the text. Arrows highlight the influence of SR proteins on splicing factors involved in this process. Image was adapted with permission from Jeremy R. Sanford [Wiley Interdiscip Rev RNA. 6(1), 93-110 (2015)] and John Wiley and Sons, Inc. ©2014 (License No. 4183950721756)33.

1.3.3 Regulation of HIV-1 RNA splicing The increased coding capacity of the 9.2 kb HIV-1 genome has necessitated the evolution of a complex splicing regimen to generate the RNAs required to code for these vital proteins28. Studies have established that over 46 different spliced HIV-1 mRNAs are generated from its primary transcript (see Fig. 1.3 for only 25 major products or see Fig. 4 of reference) to encode 9 protein/polyproteins (20 total)27. Next generation sequencing has recently identified 62 different spliced HIV-1 mRNA species that are conserved among different isolates assayed and, in an extraordinary case, another study found 109 different spliced viral mRNAs from a cytotoxic 35,36 isolate (HIV-189.6) from a patient’s cerebral spinal fluid (CSF) . These RNA products are grouped into 3 main classes according to their size: US encoding Gag and Gagpol; SS encoding Vif, Vpr, p14 Tat, Env, and Vpu; and multiply spliced (MS) or completely spliced encoding Vpr, 29

p16 Tat, Rev, and Nef (Fig. 1.3)27,30. A new MS class of 1 kb was reported from the CSF-isolate 36 HIV-189.6 which encodes a Rev and Nef fusion called Ref . The synthesis of these different HIV-1 mRNAs requires balanced viral RNA processing (e.g. splicing, export, transactivation, etc.) of the US/genomic transcript to regulate the quantity of each RNA produced. Control is achieved by sequence motifs within the RNA recognized by the host spliceosomal machinery: four to five different 5’ss or splice donor (SD1-5) sites, eight to nine 3’ss or splice acceptor (SA1-3, SA4c, a, and b, and SA5-7) sites, and a BPT sequence (Fig. 1.3)28,29. The generation of 47 total different mRNAs are achieved through combinatorial use of highly active SD sites and suboptimal active SA sites28,29. SD sites were determined to have high activity while SA sites were found to be suboptimal (or less efficient in strength compared to cellular 3’ss) because of alterations in either their BPT and PPT sequences that decrease recognition by the host splicing machinery and, hence, cause incomplete splicing of HIV-1 RNAs28,29. The 3’ SA sites are, concomitantly, points of regulation, and depend on exon definition to influence the extent of their usage28,29. These cis-acting splicing regulatory sequences consist of exon splicing enhancers (ESEs) and exon splicing and intron splicing silencers (ESSs and ISSs, resp.) that can increase or suppress recognition and usage of adjacent 3’ss, respectively (Fig. 1.5)28,29. These cis-acting viral regulatory elements on the RNA transcript rely on an antagonistic interplay between two distinct families of trans-acting cellular splicing factors that regulate splice site usage near these sites (Fig. 1.5, Balachandran, A., Ming, L., and Cochrane, A., under review)31,37. There are four ESSs mapped that control the use of 3’ss for Vpr (ESSV), Tat (ESS2 and ESS2p), and the terminal 3’ss (ESS3)28,29,37. In general, members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family block spliceosome formation by binding to these ESS/ISS elements (Balachandran, A., Ming, L., and Cochrane, A., under review)31,37. Conversely, there are six ESEs: ESE-vif, ESE M1 and M2, GAR ESE, ESE2, and ESE3, whose positions are depicted in Figure 1.528–30. Members of the SR protein family (Fig. 1.6) generally promote splicing at adjacent SA sites upon binding to these ESEs by facilitating recruitment to and/or stabilization of factors that bind to adjacent 3’ss or counteract overlapping ESS/ISS which bind hnRNPs (Balachandran, A., Ming, L., and Cochrane, A., under review)31,37. For instance, the HIV-1 3'ss SA2 is repressed by hnRNP A/B proteins bound to ESSV (preventing U2AF65 recognition of the PPT, Fig. 1.5) but is reversed by competitive binding of SR splicing factor 1 (SRSF1), also known as (aka) SF2/ASF (Fig. 1.6), which strongly activates splicing at this splice site30. Data on the use and sequence of other ESE/ESS/ISSs, hnRNP/SR 30

proteins bound, and HIV-1 exon(s) regulated are extensively reviewed in references herein30,32. Consequently, alterations in this complex splicing pattern can have dramatic effects on the replication and infectivity of HIV-1 as observed after depletion or overexpression of an hnRNP or SR splicing factor in cells (Balachandran, A., Ming, L., and Cochrane, A., under review)38–41. These studies indicate that HIV-1 is highly dependent on balanced host RNA processing for survival.

Figure 1.5. Map of the regulatory elements and splicing factors that modulate the splice site usage of HIV-1 pre-mRNAs. The 5’ splice donor (D) and 3’ splice acceptor (A) sites are indicated on the HIV-1 proviral genome. Position of cis- acting regulatory elements (ESE, ESS, and ISSs) and their known interactions with various trans-acting regulatory factors (SR and hnRNP proteins) are displayed adjacent to splice acceptor sites regulated. Image was adapted with permission from Jamal Tazi [FEBS J. 277(4), 867–76 (2010)] and John Wiley and Sons, Inc. ©2010 (License No. 4183990648803)30. Updates to the original diagram include relabeling of ESSp and ESE to ESS2p and GAR ESE, respectively, while absent ESEs (ESE-vif, ESEM1, and ESEM2) were added adjacent to the A1 site.

Figure 1.6. SR protein nomenclature and structural organization. The new gene and protein names for SR protein family members, based on the proposed nomenclature for human SR proteins by Manley and Krainer (2010), are listed along with their previous popular protein name/aliases, domain organization, previous gene name(s), chromosome location, and amino acid (aa) lengths deduced primarily from multiple literature sources as well as from bioinformatic databases (e.g. HUGO Gene Nomenclature Committee, UniProt, and GeneCards®)33,42–45. Indicated in different colors are the RNA recognition motif (RRMs, blue), RRM homology (RRMH, purple), Zinc knuckle (Zn, red), and arginine/serine-rich (RS, yellow) domains. Regions in gray indicate open regions of aa sequence. Although not drawn to scale, RS domain sizes can be approximated from SRSF1 length of ~50 aa. Figure was created by Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

1.3.4 Regulation of HIV-1 gene expression by Rev The majority of cellular mRNAs are 5’ capped, spliced, and 3’ end processed prior to export to the cytoplasm37. HIV-1’s completely spliced (MS) mRNAs are fully processed and exported via the Tip-associated protein or nuclear RNA export factor 1 (TAP/NXF1)-p15 export pathway as are most cellular mRNAs (Fig. 1.7)37,46. However, the virus must overcome a restriction in the export of its incompletely spliced (US/SS) RNAs to the cytoplasm for translation of these RNAs29,47. Otherwise, US and SS HIV-1 RNAs retained in the nucleus are rapidly degraded in the cell during the early phase of viral gene expression (Fig. 1.7)29,47. To overcome this restriction, HIV-1 encodes a key viral factor called regulator of the expression of virions (Rev) expressed from MS mRNAs [which also code for Tat (p16), Nef, and Vpr] that can be imported into the nucleus via Importin-β-Ran-guanosine diphosphate (GDP) interactions (Fig. 1.7 or Fig. 5d of second reference)29,47. Once there is sufficient accumulation of Rev (late phase), this factor, which can shuttle between nucleus and cytoplasm [containing both nuclear localization (NLS) and nuclear export signals (NES)], binds to the Rev response element (RRE) within HIV-1 US and SS RNAs and facilitates the export of US and SS viral RNAs via the chromosomal maintenance 1 (CRM1 or exportin-1)-Ran-GTP pathway used by host small nuclear (snRNAs, Fig. 1.7 or Fig. 5d of second reference)29,46,47. These RNAs code for vital structural proteins: Gag and Env; key enzymes, Gagpol (upon a -1 frameshift as detailed in reference)29; essential regulatory factor, Tat (p14); and non-essential auxiliary factors: Vif, Vpr, and Vpu (Fig. 1.7). There are several cellular factors identified which can influence Rev function. Depletion of hypersensitive response inducing protein 1 (hRip1), SRC-associated in mitosis, 68 kDa (Sam68), or DEAD-box helicase (DDX) 1 and 3 result in the loss of Rev activity in HIV-1-infected cells whereas overexpression of nucleosome assembly protein 1 (NAP1) enhances Rev function48. The function of Rev in viral RNA processing represents another critical step within the HIV-1 lifecycle.

Figure 1.7. Role of Rev during the early and late phases of HIV-1 gene expression. After transcription, full-length HIV-1 unspliced (US, ~9 kb) RNAs are generated and become alternatively spliced into singly spliced (SS, ~4 kb) and multiply spliced (MS, ~1.8 kb) RNAs. In the absence or below thresholds necessary for Rev to function (early phase, left side), HIV-1 US and SS RNAs are retained in the nucleus where they are either spliced or degraded while completely spliced (MS) mRNAs are constitutively exported to the cytoplasm via the TAP-p15 export pathway and translated into Tat (p16), Rev, Nef, and Vpr. When the levels of Rev exceed thresholds required to function (late phase, right side), this factor facilitates the export of HIV-1 US and SS RNAs to the cytoplasm via the CRM1 export pathway for translation into essential/auxiliary viral proteins shown. This is achieved through interactions of Rev with the Rev-response element (RRE, +) located on both US and SS classes of RNAs. Figure was created by Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

1.4 Role of host splicing factors in the cell and in HIV-1 replication 1.4.1 RNA processing in human diseases It has been estimated by computational analysis that over 30% of known genetic mutations (in both exon and introns) are predicted to alter RNA splicing in human diseases49. Different therapeutic approaches have been described and applied to some diseases which include, but are not limited to, β-thalassemia, familial dysautonomia, spinal muscular atrophy (SMA), spinocerebellar ataxia type 1, Duchenne muscular dystrophy, and various cancers (e.g. breast, lung, colorectal, melanoma, and ones caused by human oncogenic viruses)49,50. Of human cancers worldwide, ~10.8% are cause by infection with human oncogenic viruses: human papillomavirus (HPV), Epstein-Barr virus, Merkel cell polyomavirus, human T-cell leukemia virus 1, Kaposi’s sarcoma-associated herpesvirus, hepatitis C virus (HCV), and hepatitis B virus51. Of these cases, RNA splicing is essential for nearly all of these tumor viruses, except HCV, to express their full coding capacity for successful infection and oncogenesis51. HIV-1 infection also depends on alternative splicing and other RNA processing events mediated by the host to replicate. Knowledge of the factors involved in these essential processes would help us understand how to target HIV-1 RNA processing and potentially control viral infection as well as other human diseases.

1.4.2 hnRNP functions The hnRNPs bound to ESS/ISSs influence alternative and constitutive splicing52. In HIV-1, members of the hnRNP A1 and H play a role in regulating several ESS/ISSs (Fig. 1.5) and are thoroughly discussed in reviews (Balachandran, A., Ming, L., and Cochrane, A., under review)30,32. Besides roles in regulating the function of cis-acting regulatory elements, some hnRNPs have been implicated in nucleo-cytoplasmic transport of mRNAs, translation, mRNA stability, transcription, 3’ end processing, and riboswitch function52. These factors are also controlled by post-translational modifications such as methylation, phosphorylation, sumoylation, and ubiquitination52. For example, hnRNPs of the A, B, and C group and hnRNP G, K, and U are all phoshorylated in vivo52. These type of modifications, which can influence the function of both SR proteins and hnRNPs, reveal a potentially important regulatory scheme in the modulation of RNA processing events in the cell53. 35

1.4.3 SR protein functions SR proteins (Fig. 1.6) are required for splice site selection in both alternative (described above) and constitutive RNA splicing33,34. For instance, the founding members, SRSF1 (SF2/ASF) and SRSF2 (SC35), also have essential functions in the latter, where they promote U1 snRNP binding to the 5' ss and U2 snRNP binding to the 3' ss, thereby connecting initial splice site recognition events with the mature active spliceosome33,34. In an example of alternative RNA splicing in HIV-1, the GAR ESE located immediately 3’ of SA5 can enhance recognition of both SA4c, 4a, and 4b, and SD4 whereby SRSF1 and SRSF5 (SRp40) can interact and enhance splicing via this element (Fig. 1.5)29. Other SR protein interactions with different ESEs on HIV-1 pre-mRNA are thoroughly covered in reviews (Balachandran, A., Ming, L., and Cochrane, A., under review)29,30. However, SR proteins also have other roles before and after RNA splicing, including interactions with chromatin, coupling with transcription machinery, mRNA export, regulating RNA stability in non-sense mediated decay (NMD), and translation control via cytoplasmic-restriction of the shuttling of SR proteins53.

1.4.4 Effect of modulating host splicing factors on HIV-1 replication In terms of HIV-1, viral expression can alter the subcellular distribution and activity of the total cellular SR proteins (Fig. 1.6) by decreasing modifications in their phosphorylation state and, furthermore, overexpression of SRSF4 (SRp75) and/or SR-protein-specific kinase (SRPK) 2 enhances HIV-1 gene expression54. HIV-1 can also cause up-regulation in the levels of SRSF2 and down-regulation of hnRNP A/B and H in 1-2 weeks after infection which are both inversed upon reaching the peak in virus production55. These initial studies indicated the potential importance of splicing factor activity during active HIV-1 replication. Many studies by us and others have followed up on the role and impact of hnRNPs and SR proteins on HIV-1 RNA processing and replication and described in detail in reviews (Balachandran, A., Ming, L., and Cochrane, A., under review)29,30,32. When overexpressed or depleted in cells, some hnRNPs (A1, E1/E2, and R/Q) enhance HIV-1 Gag expression or viral infectivity whereas a few hnRNPs such as A2, p37/40 isoforms of D (AUF1), E1, K, and R/Q reduce virus replication (Balachandran, A., Ming, L., and Cochrane, A., under review; Ming et al., submitted manuscript)56. Likewise, studies on SR proteins (Fig. 1.6) have uncovered that overexpression or depletion of some of these factors (SRSF1 or SRSF2) results in increased 36

HIV-1 Gag/Env expression while others such as SRSF1, SRSF3 (SRp20), SRSF5 (SRp40), SRSF6 (SRp55), and transformer-2 (Tra2) α/β reduce viral gene expression (Balachandran, A., Ming, L., and Cochrane, A., under review; Ming et al., submitted manuscript)38–41,57. The binding of each hnRNP and SR protein to their respective splicing regulatory elements (Fig. 1.5) and the splice site sequences that these influence on HIV-1 pre-mRNAs have been well summarized in a review30. Findings from these two family of splicing factors support that any imbalance in viral RNA processing could dramatically affect HIV-1 replication (Balachandran, A., Ming, L., and Cochrane, A., under review; Ming et al., submitted manuscript)38–41,56,57.

1.5 Regulation of SR protein functions by phosphorylation and other post-translational modifications 1.5.1 Effect of different post-translational modifications on SR protein function The importance of splicing factors in gene expression have prompted the exploration of how this family of proteins are regulated. At least three types of post-translational modifications are known to occur on SR proteins (Fig. 1.6)53. Arginine methylation has been reported on SR/SR- related proteins (e.g. Npl3p in budding yeast and three methylated arginine residues found in SRSF1)53,58. Methylation can affect the cellular localization and activity of SR proteins. For example, methylation of SRSF1 can impair nuclear import of this factor, enhancing translation in the cytoplasm but blocks its activity in the nucleus where it modulates alternative splicing and coupling of its target RNAs with NMD58. Large scale proteomics analysis has described lysine acetylation of both SR proteins and their kinases53. In one example, genotoxic stress has been described to induce acetylation of SRSF2 within its RRM domain, which correlates with altered regulation in the regulation of caspase 8 alternative RNA splicing, a factor playing a pivotal role in cellular apoptosis33. And, the most explored of these types of modifications, phosphorylation (and henceforth, dephosphorylation) have been described to regulate SR proteins by a number of different kinases (discussed next)53.

1.5.2 Role of phosphorylation on SR proteins As described, SR protein phosphorylation is required for assembly of spliceosomal components while dephosphorylation is critical for splicing catalysis, meaning reversible phosphorylation is necessary for spliceosome progression from assembly to catalysis (Fig. 1.4). In addition to roles described in HIV-1 RNA processing (Chapter 3), SRPKs assemble with the spliceosome: SRPK1 associates with U1 snRNP and SRPK2 connects with U4/6-U5 tri-snRNP complexes, suggesting a function of these kinases in phosphorylating SR proteins and other RS domain-containing splicing factors involved in splicing59. SR protein phosphorylation is required to facilitate spliceosome assembly by preventing non-specific interactions of positive charged RS domains with negatively charged RNA and promote interactions between SR proteins with U1-70K and possibly other RS domain-containing proteins59. In the case of SRSF1, this factor undergoes progressive phosphorylation; it binds to specific ESE when it is partially phosphorylated while further phosphorylation induces a switch from intra- to intermolecular interactions, promoting formation of the ternary complex with U1 snRNP and progressing spliceosome assembly (modeled in Fig. 2 of reference)53. Inversely, SRSF10 (SRp38) has no activity in its fully phosphorylated state but, after partial dephosphorylation, promotes splicing53. This mechanism is used to repress the RNA splicing process during mitosis and heat shock conditions, signifying distinctly different functions for SR proteins in various phosphorylation states53. Furthermore, SR protein phosphorylation can regulate SR protein recycling in the cell53. SRPK1-specific phosphorylation facilitates nuclear import of SR proteins, where they can be recruited to nascent pre-mRNA for co-transcriptional splicing53. After splicing, some SR proteins may become re-phosphorylated by an SR protein kinase within the nucleus, releasing them from post-splicing complexes (nuclear speckles) for activity in other rounds of splicing53. Besides this route, dephosphorylated SR proteins may remain bound to spliced mRNAs in the cytoplasm, which regulates mRNA export (by escorting mRNA to host exporting machinery) and NMD, and hence, require re-phosphorylation to disassociate them from these mRNAs and facilitate their re- import back into the nucleus53. SR proteins such as SRSF1 (SF2/ASF), SRSF3 (SRp20), and SRSF7 (9G8) not only shuttle between nucleus and cytoplasm but are involved in mediating transfer of mRNAs to the essential nuclear export factor, TAP44. In summary, SR proteins function in splicing activation as well as play other roles in splicing repression, mRNA export, and translation. These functions can be controlled by post- translational modification, especially phosphorylation of SR proteins. Additionally, SR proteins 38

and alternative RNA splicing can be controlled by specific SR/hnRNP protein kinases and by non-SR/hnRNP protein kinases such as intracellular signaling kinases which are further reviewed below.

1.6 Regulation of host alternative RNA splicing by intracellular SR-protein/signaling kinases and their secondary messengers 1.6.1 SR protein kinases Over a dozen protein kinases have been reported in the literature to phosphorylate, and thus potentially regulate, cellular SR and/or SR-like proteins and the alternative splicing events under their control (Table 1.1): SRPK1-3, CDK1 (encoded by cdc2 gene; formerly known as cell division control 2, CDC2, or p34CDC2), CDC2-like kinases (CLK1-4), AKT1-2 (from AK strain transforming), dual-specificity tyrosine phosphorylation-regulated kinases (DYRKs), pre-mRNA processing mutant 4 (PRP4), glycogen synthase kinase 3 (GSK3), cAMP-dependent protein kinase A (PKA/PAK), protein kinase C (PKC), DNA topoisomerase I, and cyclin-dependent kinase 11p110 (CDK11p110)53,60. Of these, only SRPKs and CLKs have been shown to be directly responsible for SR protein phosphorylation in vivo and reviewed in this thesis53. The first and best described of these kinases is SRPK1, which was later followed by discovery of other family members, SRPK 2 and 3 (discussed in detail in reviews)61,62. SRPK1 and SRPK2 phosphorylate the RS1 domain (~12-14 serine residues) of the prototype-SR protein SRSF1 in the cytoplasm, facilitating nuclear import and accumulation of this factor in nuclear speckles62–64. In the nucleus, the CLK family of SR protein kinases (Fig. 1.8), act on pre-phosphorylated SR proteins (Fig. 1.6), phosphorylating the RS2 domain of SR proteins (which is well documented for SRSF1, Table 1.1), causing broad dispersion of these factors from nuclear speckles to areas of splicing activity62,63. These two family of SR protein kinases have been described to act in a “relay” in phosphorylating SR proteins to synergistically regulate these splicing factors in the cell53. Besides their role in SR protein phosphorylation, these two families of SR protein kinases differ in substrate specificity, with CLKs having a broader number of targets64,65. These observations are supported by a larger number of substrates found for CLKs than SRPKs (Table 1.1). Unlike CLKs and other kinases which are highly regulated by diverse mechanisms, SRPK

members are constitutively active, requiring no post-translational modification or interactions with other proteins for optimal activity62.

Table 1.1. Summary of some in vitro and/or in vivo targets reported for SR protein kinases.

Notes: Data was assembled from a literature search completed on November 2009 and assorted by aa length. (x) = implicated. Acronyms: Clk4-associating SR-related protein (CLASP), cisplatin resistance-associated overexpressed protein (CROP), and splicing factor 3B subunit 1 or spliceosome-associated protein 155 (SF3b1/SAP155). Table was created by Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

1.6.2 Intracellular signaling kinases and release of secondary messengers A handful of other protein kinases (including a few already categorized as SR protein kinases above) have been reported to regulate alternative RNA splicing through other (non-SR/hnRNP) splicing factors, regulatory kinases, and/or intracellular signaling kinases (Fig. 1.8). For example, Sam68, a nuclear protein enhancing 3’ end processing (polyadenylation) in cells that influences alternative splicing of CD44 as well as increases HIV-1 US RNA and structural protein expression66,67, is phosphorylated by the mitogen-activated protein (MAP) kinase (MAPK) extracellular signal-regulated kinase (ERK)1/2 via Ras or MAPK/ERK kinase (MEK) signaling pathway (Fig. 1.8)68. Likewise, the MEK/ERK signaling cascade can regulate splicing of the FGF receptor upon stimulation of cells with transforming growth factor (TGF)-β69. MEK/ERK signals result in phosphorylation of DAZ-associated protein 1 (DAZAP1), a RNA- binding protein involved in mammalian development and spermatogenesis, which can act like an SR protein by neutralizing hnRNPs and promoting splicing when recruited to pre-mRNAs70. In addition, epidermal growth factor (EGF)-induces massive reprogramming of alternative splicing in mammalian cells through phosphatidylinositol-3-kinase (PI3K)/AKT signaling, which causes SRPK disassociation from heat shock protein 70 kDa (HSP70)-containing complexes to HSP90- containing complexes which facilitate its nuclear translocation, and phosphorylation of SR proteins (Fig. 1.8)71. Via this same signaling pathway, AKT2 can phosphorylate CLK1 and alter SR protein phosphorylation in response to insulin (Fig. 1.8, Table 1.1), which can be reversed pharmacologically by PI3K or CLK inhibitors (LY294002 and TG003, resp.)72. Insulin can also alter alternative splicing of the PKCβII gene via PI3K/AKT induced phosphorylation of SRSF5 (SRp40)73. Furthermore, in resting T cells, GSK3 directly phosphorylates polypyrimidine-tract binding protein-associated splicing factor (PSF), promoting its interaction with thyroid hormone receptor-associated protein, 150 kDa subunit (TRAP150) which prevents it from binding to RNA elements and leads to repressed exon inclusion in CD45 pre-mRNA (Fig. 1.8); conversely, this is reversed upon T cell activation, which reduces GSK3 activity and PSF phosphorylation74. Fas- activated serine/threonine kinase (FAST K) has been reported to enhance Fas receptor exon 6 inclusion (pro-apoptotic form) in cells by phosphorylating the T-cell intracellular antigen 1 (TIA-1) and TIA-1-related (TIAR) proteins, thereby promoting the use of suboptimal 5’ss and recruitment of U1 snRNP75. On the other hand, MAPK kinase 3/6 (MKK3/6)/p38-MAPK can signal responses from osmotic stress or DNA damage to induce phosphorylation of hnRNP A1,

which leads to sequestration of this factor in the cytoplasm and alteration of alternative splicing in Adenovirus E1A pre-mRNA (Fig. 1.8)76. Alternative splicing can also be regulated by factors that influence intracellular Ca2+ concentration or signaling pathways. The inclusion of alternative exons in mature mRNAs of at least 14 different genes have been reported so far to be promoted or repressed by Ca2+ modulation in various cell/tissues (summarized in Table 1 and 3 of reference)77. A well-studied example is Ca2+ signaling from the calmodulin (CaM) kinase (CaMK) IV77. CaMK IV Ca2+ signals can repress the STREX (stress axis) exon of the voltage-activated potassium (BK) channel, which is one of the 10+ alternative exons in the Slo gene that confers multiple different properties to the BK channel78,79. In addition, CaMK IV can regulate alternative splicing of NMDA receptor I (NMDAR1) by repressing inclusion of an exon through regulation of its E5 and E21 splice sites. CaMK IV also represses inclusion of exon III in the SR-like protein gene, Tra2β177. All of these changes described were reversible by addition of chemical agents77. Ca2+ signals can also directly regulate specific splicing factors, especially members of the hnRNP family (summarized in Table 3 of reference)77. In contrast to p38 MAPK signaling (which blocks hnRNP A1 translocation to the nucleus as described above)76, Ca2+ signaling from membrane depolarization in neurons promotes hnRNP A1 nuclear localization, resulting in repression of exon 21 inclusion in NMDAR177. Similar to hnRNP A1, blockage of Ca2+ signals by thapsigargin or ischemia causes cytoplasmic accumulation of Tra2β, resulting in increased inclusion of an exon in the ICH-1 gene80,81. As described for the Tra2β1 gene, Ca2+ signals can also regulate alternative splicing of splicing factors themselves (see Table 3 of reference)77. As an example, Ca2+ signals from membrane depolarization can repress exon inclusion of hnRNP H3 and RNPS182. Furthermore, CaM has been shown by affinity chromatography to directly interact with hnRNP A2 and C, spliceosome-associated protein 145 (SAP145), and cleavage and polyadenylation specificity factor 30 (CPSF30)77. These studies reveal that factors involved in regulating alternative splicing of pre-mRNA can be influenced by a number of extracellular and intracellular stimuli such as hormones (e.g. insulin), signaling (e.g. CaMKs, MAPKs, PI3K-AKT, and other kinases), molecular chaperones (HSP70 and HSP90), immune responses (e.g. inflammatory cytokines), cellular stress (e.g. pH change, osmotic shock, O2 deprivation, UV exposure), and neuronal membrane depolarization (ion changes, e.g. Ca2+). However, neither the role nor manipulation of many of these kinases or SR protein/hnRNP kinases have been explored in the context of HIV-1 replication. 42

Figure 1.8. Regulation of alternative RNA splicing by various intracellular signaling kinases. Many splicing factors such as hnRNP A, SR proteins and their kinases (SRPK and CLKs), and other splicing factors are regulated by intracellular signals relayed by various kinases shown and discussed in detail in the text. Image was reproduced with permission from Xiang-Dong Fu [Chromosoma 122(3), 191–207 (2013)] and ©2013 Springer (License No. 4187210403753)30.

1.7 Controlling HIV-1 infection through small molecule modulators of viral RNA processing

The reliance of HIV-1 on RNA processing to replicate is a weakness to be exploited. Balanced regulation of this process has been proven to be paramount for HIV-1 survival, suggesting that slight alterations (by ≤ 20% difference) in host alternative splicing could have a dramatic impact on virus replication (Balachandran, A., Ming, L., and Cochrane, A., under review; Ming et al., submitted manuscript)38–41,56,57. Applying such an approach to control HIV-1 infection could be achieved by modulating the activity or levels of important factors regulating RNA processing as demonstrated by overexpression or RNAi depletion studies of key host factors. In practical approaches undertaken to apply these findings in vivo, research in over the last two decades have identified a number of small molecules that can putatively alter the function of important splicing factors (Figs. 1.4 and 1.6), regulatory kinases of splicing factors (Table 1.1 and Fig. 1.8), or essential HIV-1 regulatory factors, Rev and Tat (Fig. 1.7), to ultimately perturb HIV-1 RNA processing and replication.

1.7.1 Inhibitors of SR protein kinases Initially, only a few studies addressed the impact of SR protein kinase activity (Table 1.1 and Fig. 1.8) on factors involved in RNA splicing and in controlling HIV-1 infection. Upon noticing a decrease in general levels of phospho-SR proteins (Fig. 1.6) in HIV-1 transfected Flp-In293 cells, Fukuhara et al. (2006) determined that SRp75 and its regulating kinase, SRPK2, can increase stability of SRp75 and enhance viral gene expression54. Specific inhibition of SRPKs 1 and 2 by the SR protein phosphorylation inhibitor 340 (SRPIN340, N-[2-(1-piperidinyl)-5- (trifluoromethyl)phenyl]isonicotinamide) was found to promote degradation of SRp75, which could lead to suppression in the propagation of Sindbis virus but had only variable inhibition of HIV-1 replication in T-cell lines54. On the other hand, expression of CLKs 1-4 demonstrated differential effects on HIV-1 gene expression: CLK1 enhanced, CLK2 inhibited, and CLKs 3 and 4 had limited effects on Gag expression83. These effects were reproduced by addition of the

CLK 2, 3, and 4 inhibitor, chlorhexidine (50% inhibitory concentration, IC50: ~3 and 1.2 μM on viral replication in HIV-1 infected peripheral blood mononuclear cells (PBMCs) cultured for 3 and 7d, resp., with no and limited effects on cell viability, resp.). Chlorhexidine is a FDA- approved antiseptic that was re-discovered via a high-throughput screen (HTS) to modulate 44

alternative RNA splicing and CLKs but not SRPK1/2 activity83,84. Chlorhexidine suppressed HIV-1 Gag, p14 Tat, and Rev (but not p16 Tat) expression and altered viral RNA accumulation (in HeLa rtTA-HIV-ΔMls cells, Fig. 1.9): decreasing US and SS RNAs while modestly increasing MS RNAs83, and also, causing nuclear retention of US RNAs (data not shown). HIV-

1 Gag expression was unaffected by the CLK 1 and 4 (and 2) inhibitor, TG003 (IC50 for CLKs: 20, 15, and 200 nM, resp.)85, suggesting that regulation of HIV-1 may be due to a selective effect of chlorhexidine on CLK3 function83. These studies reveal the possibility of inhibiting the replication of HIV-1 and other viruses through small molecule manipulation of SR protein kinases and/or kinases upstream of splicing factors.

Figure 1.9. Illustration of Tet-ON HIV-1 proviruses used in cell-based assays for inhibitors of HIV-1 gene expression. Drug/compounds were tested for effects on HIV-1 gene expression using inducible Tet-ON HIV-1 cell lines [HeLa rtTA-HIV-ΔMls or rtTA-HIV(Gag-GFP)] containing a HIV-1 (LAI) provirus activatable by doxycycline (Dox) or tetracycline transactivator (tTA). The rtTA-HIV-ΔMls provirus used in Wong et al. (2011) was modified from an HIV-reverse-tetracycline transactivator (rtTA) provirus published in Zhou et al. (2006) by deletion of the RT and IN genes by Mls1 digestion83,86. The rtTA-HIV(Gag-GFP) provirus was generated by deletion of the PR and RT coding regions within pol and insertion of GFP in frame with gag, creating a Gag-GFP fusion protein. Image was adapted with permission from Atze T. Das [Retrovirology 3:82 (2006)] and ©2006 Zhou et al. via BioMed Central Ltd under the distribution terms of the Creative Commons Attribution License (CC BY 2.0) for Open Access articles86.

1.7.2 Modulators of SR protein function In contrast to inducing splicing, a novel strategy to identify small molecules that inhibit splicing identified an indole derivative (IDC16) that interfered with ESE usage by the SR protein SRSF1, but not SRSF2 (Fig. 1.5)87,88. IDC16 (1 μM) strongly suppressed viral growth (p24 Gag production) from HIV-1 infected PBMCs and macrophages cultured for 14 days without affecting cell viability or reverse transcription and integration of the virus88. IDC16 treatment of cells caused a marked decrease in HIV-1 MS RNA accumulation (with no observed change in US RNA levels) which correlated with decreased SRSF1 binding88. However, due to the intercalating ability of these planar polycyclic structures into DNA and their cytotoxic effects exhibited by interfering with DNA processing enzymes, more flexible molecules with fewer fused rings were examined to avoid potential side effects of indole compounds. This resulted in the identification of the novel HIV-1 inhibitors, ABX464 and 1C889–91

ABX464 inhibited viral replication in HIV-1 infected PBMCs (IC50: 0.1-0.5 μM) and macrophages (IC50: 0.1-1 μM) without causing toxicity to these cells (CC50: 125 μM and data not shown, resp.)89. In contrast to IDC16, ABX464 caused a slight decrease in MS RNAs with no significant changes in the splice site usage of this class. Additionally, ABX464 caused a substantial decrease in US RNAs, consistent with inducing nuclear retention of RNAs as a consequence of reduced Rev function89. The most striking aspect of this compound, besides suppressing viral load when tested on HIV-1 infected humanized mice [nonobese diabetic (NOD)-severe combined immunodeficiency (scid) IL-2 receptor gamma chain (IL2rγ)null (NSG) mice engrafted with CD34+ human hematopoietic stem cells (HSCs)], is the limited extent of viral rebound after drug withdrawal from these mice and the lack of selection of any viral resistance mutations after 24 weeks of PBMC culture compared to treatments with other ARV drugs89. Moreover, ABX464 exhibited limited alteration in 264 host alternative splicing events measured in these cells89. Another structural mimic of IDC16, 4-pyridinonebenzisothiazole carboxamide (1C8), suppressed viral replication of HIV-1 infected PBMCs (IC50: 0.6-1.5 μM) near the same micromolar range as IDC16 and ABX46489. Similar to ABX464, 1C8 caused nuclear retention and reduced the accumulation of US RNAs but, on the contrary, decreased SS and MS RNAs90. These effects correlated with decreases in HIV-1 Gag, Env, and p14 and p16 Tat expression as well as likely decreases in Rev expression/function since US RNAs were undetectable in the cytoplasm of 1C8 treated HeLa-HIV-1 cells90. Further changes were found in the usage of 46

particular splice sites within SS and MS RNAs (resp.) which lead to increased usage of SD3-SA3 and reduced levels of a Tat1 splicing variant but not Nef2 (Fig. 1.3)90. These results corresponded with 1C8 inducing de-phosphorylation of SRSF10 (SRp38, Figs. 1.5-1.6), since depletion of this SR protein lead to similar changes in SS RNAs accumulation and the Tat1 splicing variant and, also, rescued SD3-SA3 spliced RNA products in cells co-treated with 1C8 compared to controls90. In comparison, 1C8 inhibited viral replication of HIV-1 infected PBMCs 90 (IC50: ~0.5 μM) with no observable effects on cell viability (CC50: >5 μM) . In CEM-GXR cells infected with a wild-type (WT) HIV-1 strain (IIIB or 97USSN54), 1C8 inhibited viral replication

(IC50: 0.6 and 0.9 μM, resp.) without significantly impacting cell viability in 3 days of culture

(CC50: >100 μM and >100 μM, resp.) with estimated in vitro therapeutic indices (TIs) of >166 and >111, respectively.

1.7.3 Inhibitors of HIV-1 Rev function Another approach to alter HIV-1 RNA processing is to inhibit Rev function, essential for late phase viral gene expression because of its role in facilitating export of incompletely spliced viral RNAs to the cytoplasm (Fig. 1.7). Previous work has demonstrated that one particular mutant, Rev M10, can act as a trans-dominant inhibitor of Rev function and, when expressed in cells, can inhibit HIV-1 replication92. Besides small molecules which indirectly impair Rev function/expression (chlorhexidine, ABX464, and likely 1C8), a HTS for bioavailable inhibitors (whereas previous attempts of such compounds lacked antiviral activity) that block Rev binding interactions with the RRE identified clomiphene and cyproheptadine as their best hits. These compounds inhibited HIV-1 replication in both infection (IC50: 4.3 and 4.3 μM, resp.) and post- integration assays (IC50: 17.5 and 25.6 μM, resp.) at similar concentrations in MT-2 cells with 93 limited to no effects on cell viability (CC50: 17.4 and >100 μM, resp.) . These compounds were found to impact transcriptional or post-transcriptional steps of the HIV-1 lifecycle93. Consistent with impairing Rev function, both compounds drastically reduced accumulation of US and SS HIV-1 RNAs and, also, MS viral RNAs, in MT-2 cells transfected with HIV-193. Other studies have also identified compounds that alter Rev function and/or accumulation. In screens for inhibitors of HIV-1 RNA processing that enhanced splicing of viral RNA, I identified the compounds 8-azaguanine and 2-(2-(5-nitro-2-thienyl)vinyl)quinoline (5350150) as potent inhibitors of HIV growth/replication from HIV-infected PBMCs from clinical patients without cytotoxicity at concentrations assayed (IC50: 500 and 180 nM, CC50: 47

>10 and >1uM, resp., Fig. 1.10)94. These compounds reduced accumulation of viral US RNAs as well as strongly perturbed expression of HIV-1 structural proteins (Gag and Env) but not Rev (Fig. 1.10)94. Intracellular localization studies revealed that 8-azaguanine and 5350150 induced nuclear retention of HIV-1 genomic/US RNAs and cytoplasmic accumulation of Rev, suggesting that these compounds impaired Rev nucleo-cytoplasmic transport (Fig. 1.10)94.

1.7.4 Modulators of HIV-1 Rev and Tat accumulation Further studies by A. Balachandran and me have identified a group of structurally different HIV- 1 RNA processing inhibitors (9147791, 5193892, and 5227833) that induced a dramatic loss of both essential HIV-1 regulatory factors, Rev and Tat (Fig. 1.7)95. The effects observed on Tat could be due to enhanced proteasomal degradation induced by these compounds since addition of MG132 partially rescued degradation of this factor95. Consistent with inhibiting Rev function, these compounds greatly reduced accumulation of both US and SS viral RNAs, decreased expression of Gag and Env/p14-Tat (resp.) encoded by these RNAs, and induced nuclear retention of HIV-1 genomic RNAs95. Distinct from the other compounds, 9147791 reduced the expression of the Rev cofactor, nucleosome assembly protein 1 (NAP1)95. Since this chaperone has been shown to prevent aggregates, stimulate Rev function, and increase levels of Tat, a reduction in the amount of NAP1 binding may not only have decreased Rev and Tat function but also increased accessibility of Rev and/or Tat for selective degradation by the host proteasome45,91. 9147791, 5193892, and 5227833 inhibited viral replication in HIV-1 infected 95 PBMCs at micromolar concentrations (IC50: 1.5, 1.6, and 2.0 μM, resp.) . However, most of these compounds displayed a significant impact on cell viability (CC50: >10, 3.0, 4.5 μM, resp.), 95 with the exception of 9147791 which reached an IC80 without cytoxicity .

Figure 1.10. 8-Azaguanine and 5350150 inhibit HIV-1 replication by altering viral RNA processing. These compounds inhibit the replication of HIV-1 by altering specific viral RNA processing events, which involve the following: (1) inducing oversplicing of HIV-1 pre-mRNA (depicted by an increasingly red arrow), which reduces both US and SS RNA levels (with the exception of 5350150), and (2) altering the localization of HIV-1 Rev, resulting in sequestration of incompletely-spliced (US/SS) RNAs in the cell nucleus. Both of these mechanisms lead to a marked reduction in viral US and SS (for 8-azaguanine) RNAs which encode a subset of HIV-1 structural, enzymatic, regulatory and accessory proteins that are necessary for new virion assembly and infection. Image was created by Raymond Waiman Wong [Nucleic Acids Res. 41(20), 9471–9483 (2013)] and reproduced with permission from © The Author(s) 2013 at Oxford University Press (License No. 501306888) and distribution terms of the Creative Commons Attribution License (CC BY 3.0) for Open Access articles94.

1.7.5 Conclusion and future directions These studies demonstrate that small molecules that disrupt various aspects of HIV-1 RNA processing can successfully perturb viral replication. Due to the dependence of HIV-1 on host splicing factors involved in promoting/suppressing splicing of its pre-mRNAs, the virus has proven to be much more sensitive to manipulation than the host cell. This is supported by an absence of any effects on the viability/proliferation/metabolism of transformed and primary cells treated at concentrations in which these splicing modulators cause drastic inhibition of HIV-1 replication. In fact, most of these compounds, i.e. ABX464, 8-azaguanine, 5350150, 9147791, 5193892, and 5227833, demonstrated little impact on alternative splicing events in cells (by RT- PCR analysis) compared to controls. Using RNA-seq, only 0.24% of host genes were significantly altered upon 1C8 addition and, also, only 0.75% of host genes were differentially expressed (and 0.02% had significant changes in host alternative RNA spicing) for cells treated with 9147791. Compounds 1C8 and 9147791 also inhibited the replication of HIV-1 strains containing one or more resistance mutations to each of the four classes of ARV drugs91,95. The ability of these compounds and possible other HIV-1 RNA processing inhibitors to control both WT and drug-resistant strains of HIV-1 suggests that these type of modulators could prove useful in salvage therapies and combinatory ARTs. Moreover, ABX464 has demonstrated the potential of HIV-1 RNA processing inhibitor in providing durable control of HIV-1 replication in vivo, which is supported by reduced magnitude of viral rebound after withdrawal of the compound and the lack of viral resistance towards the inhibitor in over 24 weeks of PBMC culture compared to other ARTs. Although most of these small molecules were found to putatively alter a host splicing factor/kinase or specific viral target, how these compounds signal their ARV responses and which kinases are vital for HIV-1 replication have only been explored in a limited fashion. Knowledge of how some of these HIV-1 RNA processing inhibitors control viral replication and the intracellular signals induced by these compounds could improve our search and design for more active inhibitors and provide new targets for therapeutic development. Continued approaches that show great promise include application of phenotypic assays to identify biologically active and RNA-binding small molecules, such as the screen for compounds that promoted exon 7 inclusion in the survival motor neuron 2 (SMN2) mRNA, could lead to splicing modulators with a potential impact on HIV-1 infection96. For instance, studies by Wong et al. have led to the identification of several splicing modulators with significant anti-HIV-1 activity: 8-azaguanine, 5350150, 9147791, 5193892, and 522783394,95. 50

Another phenotype-based screen for compounds that modulate the splicing of microtubule- associated protein tau exon 10 identified four hits belonging to the CS family of drugs97. An effective inhibitor isolated from this pool of FDA-approved drugs could be beneficial in finding a bioavailable molecule that could be repurposed to target viral RNA processing and control HIV-1 infection. Other exciting alternative approaches to target HIV-1 RNA processes in progress include a small molecule microarray (SMM) screen for TAR-binding molecules that interferes with Tat recognition of the TAR binding site96,98. The continued success of developing innovative strategies, especially those targeting HIV-1 RNA processing by small molecules, show great promise in producing a novel RNA-based ART for controlling this deadly infection.

1.8 Cardiotonic steroids and the Na+/K+-ATPase

Cardiotonic steroids (CSs) are a well-studied family of drugs known to bind to the Na+/K+- ATPase (NKA or sodium pump) and potentially activate over five different intracellular signals: 2+ phospholipase C (PLC)/inositol 1,4,5 trisphosphate (IP3) receptor (IP3R)-Ca , PLC-PKC, epidermal growth factor receptor (EGFR), EGFR-Ras-Raf-MEK1/2-ERK1/2, and PI3K-AKT and consequential release of the secondary messenger ROS and induction of stress-activated MAPKs: p38 and JNK1/2/3 (Fig. 1.11)99–103. As described above, each of these different signals can modulate a diverse set of alternative RNA splicing events in the cell. One approach, which could decipher the intracellular signal(s) activated by an anti-HIV-1 inhibitor (and ones for other viruses), is to co-apply kinase-specific inhibitors alongside an anti-HIV-1 inhibitor to deduce which signaling pathway is required for suppression of viral replication. CSs, such as digoxin, have been reported to perturb alternative splicing of HIV-1 RNAs104 (and other viruses)105–108 and known to activate many signaling pathways109,110, which can influence the alternative splicing of many different RNA events in the cell. Investigation into which signaling kinase(s) is responsible for suppressing HIV-1 replication in this class of drugs could reveal a major underlying mechanism involved and provide alternative cellular targets for controlling HIV-1 infection. Herein, over 232 years of Westernized scientific research on CSs and their NKA receptor are reviewed.

1.8.1 Discovery and natural sources of CSs Medicinal plants containing CSs have long been used by different cultures, dating as far back as the ancient Egyptians111. The most well known plant containing CSs is the foxglove from the Digitalis species, e.g. Digitalis purpurea and Digitalis lanata. This plant was first reported in the herbarium of Dr. Leonard Fuchs in 1542 and named digitulus, meaning “small finger,” because its flowers were similar to a thimble111. The word “digitalis” or “digitalis glycoside” is currently used as a generic term for all CSs, but common preparations of digitalis drugs used in modern medicine contain digoxin and digitoxin111. A significant number of plants containing these compounds are summarized in a detailed review111. Some common decorative plants rich in these compounds are the Christmas rose, lily of the valley, water lily, and oleander111. A scientific study and report of medical applications of CSs date back to a ten year study reported in 1785 on the effects of foxglove in herbal remedies (described below) by Sir William Withering112. On the other side of the globe, the bufadienolide class of CSs, found in dried skins of toads and among the active ingredients of the traditional-Chinese medicine Chan Su (or Senso in Japanese), has been in routine clinical practice for nearly a thousand years112. Moreover, CSs have been found in mammalian tissues and bodily fluids: in humans, ouabain is present in plasma, adrenal gland, and hypothalamus; digoxin is found in urine; marinobufagenin is observed in plasma (and increased after cardiac infarctions and other conditions) and urine; and several other bufadienolides are found in cataract lenses, placentas, plasma, and urine111,112. These endogenous CSs and their receptor (NKA) constitute the concept of the Third Factor involved in regulation of the cardiovascular system, fluid-electrolyte homeostasis, and pathogenesis of hypertension112.

1.8.2 Traditional and current applications of CSs Since Withering’s report in 1785, physicians have used digitalis preparations from the foxglove to treat edematous states, chronic heart failure, and irregular heart beats for the last 232 years112. Brews of CSs from tea leaves have been used to treat conditions such as Dropsy, which involves excessive swelling from over accumulation of water in cells, tissues, and body cavities112. CSs were observed to stimulate kidneys to release excess fluid111. Prior to Withering’s report, Ancient Greeks and Romans used the extracts of the foxglove for sprains and bruises111. Medieval witches have extracted digitalis for use as ingredients in potions and rapid action poisons111. The bufadienolide class of CSs, found in frogs and dried skins of toads as ingredients 52

of Chan Su/Senso, have long been used in the treatment of cardiac dysfunction in East Asia for probably over a thousand of years while, in Europe, even a 15th century physician has described the effects of toad’s blood in a book 5-600 years ago112,113. CSs extracted from toads, frogs, and certain plants (Acokanthera schimperi) have also long been used for poisoned arrows by African tribes and South American Indians111,113.

1.8.3 Current applications of CSs CSs are still used in cardiology today to treat congestive heart failure, atrial fibrillation, and atrial flutter111,114. These family of drugs are specific inhibitors of the NKA in plasma membranes and, 2+ 2+ through greater sodium-calcium exchange, increases intracellular Ca concentration ([Ca ]i) available for contractile proteins in the heart to improve the force of myocardial contractions111,115. The resulting positive inotropic (therapeutic) action of these drugs, slow the pulse and conduction of nerve impulses in the heart, thereby increasing the force of contraction and the amount of blood pumped per beat of the heart111,115. However, when cytoplasmic Ca2+ exceeds sarcoplasmic reticulum storage capacity, toxic (arrhythmogenic) effects can occur116. Due to questions about their toxicity and dosage issues in medicine114,115,117, drugs such as beta blockers, angiotensin converting enzyme (ACE) inhibitors, and spironolactone have replaced CSs as the primary medical treatment for various heart conditions that were traditionally treated by digitalis drugs118.

1.8.4 Discovery and general function of the Na+/K+-ATPase The sodium pump or NKA, found in the plasma membrane of all higher eukaryotes, functions in ion transport (Fig. 1.11): exporting three Na+ ions from the cell against their chemical gradients and electrical potential while importing two K+ ions into the cell via one ATP-driven transport cycle110. The existence of this enzyme was first described by Jens Christian Skou in 1957 using crab nerve extracts119. The main physiological function of this enzyme is the establishment and maintenance of an electrochemical gradient across the plasma membrane (Fig. 1.11) which is essential for physiological processes such as neuronal communication, osmotic regulation of cell volume, and ion homeostasis109. The NKA accounts for ~20-28% of the total energy expenditure in mammalian cells120,121 while, in the brain, this increases to ~50-60% of total ATP used in this organ122.

Figure 1.11. Influence of CSs on the ion pumping and signalosome functions of the Na+/K+-ATPase. CSs bind to the catalytic α subunit of the NKA, which inhibits the ion transport activity of this enzyme or, at

2+ concentrations with < 25% inhibition of this pump, activates over five different intracellular signals: PLC/IP3R-Ca , PLC-PKC, EGFR, EGFR-Ras-Raf-MEK1/2-ERK1/2, and PI3K-AKT. Subsequent release of secondary messengers, such as ROS, and stimulation of stress-activated MAPKs: p38 and JNK1/2/3, can result from activation of these signaling pathways. Arrows indicate activation signals: solid ones specify direct activation, dashed arrows indicate one or more steps may be required for activation, and dotted arrows highlight the reverse mode of the Na+/Ca2+- exchanger (NCX), direct activation by cross-talk (e.g. PKC and ERK1/2), or activation of a kinase by one or more components (e.g. PKC activation by DAG alone or with Ca2+). Acronyms: sarco-/endoplasmic reticulum (SR/ER) and as provided in the text. Image created by Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

1.8.5 Vital subunits of the Na+/K+-ATPase X-ray crystal structures of the NKA (resolved at 3.5, 2.8, and 4.3 Å resolution, resp.) have been recently reported123–125. The NKA is a multi-subunit P-type ATPase composed of an α and β subunit in equimolar ratios. The α subunit is the catalytic subunit, a transmembrane protein with binding sites for Na+, K+, ATP, and CSs, whereas the β subunit is a glycosylated single-span transmembrane protein with chaperone-like activity that is required for the biogenesis and activity of the αβ complex. The binding site for CSs is highly conserved and formed by three extracellular loops that are between the M1-M2, M3-M4, and M5-M6 transmembrane domains of the NKA α subunit (see Fig. 1a of reference125)109,124. CSs bind and stabilize the NKA in an E2 conformation which inhibits ion-transport activity of the enzyme124. In the absence of a β subunit, unassembled α subunits are withheld in the ER from trafficking to the plasma membrane by interactions with the regulator β-COP, eventually leading to its proteasomal degradation110. The α subunits are highly conserved and have similar primary structures and aa sequence homology across species: α1 and α2 share ~92%, α3 shares >96%, and α4 shares 90% aa similarity with other species111. Comparison of α isoforms within the same species displays a lower percentage of aa sequence homology: human α1, α2, and α3 share ~87% similarity while α4 has ~76-78% homology with the other three α isoforms in humans110,111,126. β subunits are also highly conserved across species, having a 94-96% aa homology for β1 and β2 and 75% similarity for β3111. However, within the same species, β subunits show more difference in aa sequence identity than α subunits: human β1, β2, and β3 share only 35-47% identity among themselves110.

1.8.6 Expression and regulation of the Na+/K+-ATPase There are four distinct α subunit isoforms and three different β subunits identified in human NKAs that are selectively expressed in a range of tissues and vary in kinetics (summarized in Fig. 3 of reference)111. Human NKA α1 isoforms are ubiquitously expressed in all tissues while expression of α2 and α3 subunits are restricted to the heart, brain, skeletal muscle, placenta, and a few other types of cell/tissues where these two isoforms differ110,127. In the brain, α2 is expressed in astrocytes while α3 is expressed in neurons. In contrast, α4 is only present in spermatazoa110,127. For β subunits, β1 is found in most tissues and believed to form a ubiquitously expresssed α1β1-complex of NKAs while β2 and β3 isoform expression is restricted to specific tissue/cells111,128. Fully assembled NKAs have the highest expression in tissues and 55

organs that require high ion-transporting function (e.g. kidney epithelia) and excitability (e.g. brain, skeletal muscle, and cardiac muscle)111. The activity of the NKA can be regulated at multiple different levels, with only a few described here, and thoroughly covered in recent reviews110,111. The NKA is usually associated with FXYD proteins (FXYD1-7), often referred to as γ subunits. The FXYD proteins are small regulatory single-span membrane proteins that influence NKA activity in a tissue- and isoform- specific manner but are not necessary for the functional expression of NKA αβ complexes110. NKA activity and expression can also be regulated by many factors110,111. Changes in intracellular Na+ and K+ concentrations, leading to higher Na+ and lower K+ levels, can increase NKA transcription. Various hormones can increase NKA transcription. PKA- and PKC-mediated phosphorylation can perturb enzyme activity by reducing ion transport and inducing clathrin- mediated internalization of the enzyme. Dopaminergic or adrenergic stimuli can activate G protein coupled receptors (GPCRs) in lung alveolar epithelial cells, which increase NKA activity by insertion of NKA proteins from intracellular compartments into the plasma membrane. Conversely, AKT kinase substrate of 160 kDa (AS160) can decrease NKA activity by phosphorylating the NKA α1 subunit, causing intracellular compartmentalization or endocytosis of NKAs into latent pools. Other modifications controlling the NKA by other protein-protein interactions, post-translational modifications, and interactions with other membrane components have been thoroughly summarized in reviews110,111.

1.8.7 Chemical structure of CSs CS compounds contain a steroid nucleus linked with a lactone moiety at position C17 and the presence or absence (aglycone) of glycoside side chain(s) at position C3129; hence, the naming of them as cardiac glycosides (CG) and cardiac aglycones (CAGs), respectively (depicted in Fig. 1 of reference)111. Two classes of CSs result from the presence of a different lactone moiety (depicted in Fig. 1 of reference)111: cardenolides consist of a five-membered unsaturated butyrolactone ring while bufadienolides contain a six-membered unsaturated α-pyrone group129. In general, the core steroid portions in CSs from plants, such as Digitalis and Strophanthus families, consists of the rings A/B and C/D that are cis fused while the rings B/C are trans fused, causing the nucleus of these CSs to have a characteristic ‘U’ shape from a cis-trans-cis conformation111. From these plant families, up to a total of four glycoside (sugar) molecules may be present on a CG and many of these are attached via the 3β-OH group of the steroid aglycone 56

(single link) in CSs or attached as a dioxanoid or double link in CSs from other plant families such as Asclepiadacea (depicted in Fig. 1 of first reference)111,129. From these classifications and structures, the cardenolide class includes the CGs digoxin, digitoxin and ouabain whereas CAGs consist of digitoxigenin and digoxigenin. The bufadienolide class, on the other hand, contains the CAGs bufalin and cinobufagenin.

1.8.8 Distinct properties of individual CSs Differences in the activity of ouabain have been noticed in tissues expressing different α isoforms. For an example, ouabain can influence ERK phosphorylation in cells expressing α3 and α4 subunit isoforms but not α2 isoforms, highlighting the importance of potential isoform- specific variations in NKA modulation across different CSs and tissue types112. One study addressed these differences and found that the binding affinity of most CGs such as digoxin and 130 digitoxin have significant selectivity (up 2.1-3.5 fold) for α2/α3 over α1 (KD α1 > α2 = α3) . In 130 contrast, ouabain has moderate selectivity (2.5 fold) for α1 over α2 (KD α1 ≤ α3 < α2) . CAGs such as digoxigenin, digitoxigenin, and even the bufadienolide bufalin demonstrated indistinguishable binding affinities for all three isoforms tested (KD α1 = α2 = α3), supporting the concept that glycoside groups determine the isoform selectivity of CSs130.

1.8.9 Mechanism of the positive inotropic effects of CSs The “Na+-pump lag” hypothesis was proposed to explain the positive inotropic response of digitalis and other CSs on the heart116,131. CSs bind specifically to the NKA α subunit and inhibit + + its transport function, leading to an increase in intracellular Na concentration ([Na ]i, Fig. 1.11). Accumulation of Na+ uncouples an electrical gradient, formed by normal 3:2 export of Na+ to + 2+ + 2+ import of K ions by the NKA, leading to a secondary rise in free [Ca ]i via the Na /Ca - exchanger (NCX) running in reverse mode (Fig. 1.11)132. This occurs as a direct result of the voltage relationship between the transmembrane potential and the NCX equilibrium potential. 2+ + + Initially, Ca efflux is diminished after Na pump inhibition and [Na ]i is increased. This same + 2+ increase in [Na ]i promotes Ca influx via its reverse mode at potentials positive to the NCX equilibrium potential (Fig. 1.11). These two effects increase Ca2+ uptake into the sarco- /endoplasmic reticulum via a Ca2+-ATPase (SERCA), which generates the greater Ca2+ oscillations responsible for the positive inotropic action of CSs on the heart (Fig. 1.11). However, when Ca2+ levels overload sarco-/endoplasmic reticulum storage capacity, due to 57

excessive Na+-pump inhibition and Na+ accumulation, excessive Ca2+ oscillations lead to the development of toxicity in patients such as triggering of cardiac arrhythmias. Consequently, doses inducing these toxic effects are low compared to other drugs, limiting the TI of CSs.

1.9 The Na+/K+-ATPase as a signal transducer 1.9.1 Src kinase in the formation of the NKA signalosome The binding of CSs (especially ouabain) to the NKA at low nanomolar concentrations that cause partial (< 25%) or no inhibition of this enzyme activates multiple signaling pathways in cardiac myocytes and renal epithelial cells (Fig. 1.11)99–103. This observation extends to other cell types, including vascular smooth muscle, endothelial, and skeletal muscle cells133. Distinct from the ionic mechanism described in the sodium pump lag theory (Fig. 1.11), the NKA relays a response to the cell interior through intracellular signaling triggered upon binding of a CS/ouabain. These initiate downstream phosphorylation events in a hormone-like manner, affecting various cellular processes such as gene expression, cell proliferation, apoptosis, and cell-cell contacts110,131. A central player in NKA-mediated signaling is interaction of the non- receptor tyrosine kinase, Src, with the α1 subunit of this enzyme (Fig. 1.11)99,103,134,135. With no intrinsic tyrosine kinase activity, it has been deduced that Src [via its Src homology 2 (SH2) and kinase domains] is in a complex with the NKA α1 subunit in an inactive state until ouabain binding induces a sufficient conformation change that releases the Src kinase domain, resulting in Src kinase activation110,133. A few studies challenge a direct structural interaction between the NKA and Src but suggest that Src activation by CSs (ouabain/digoxin) are due to changes in energetic status (ATP/ADP concentration) or, in other words, an ATP-sparing effect from a mixture of proteins competing for ATP136,137. By whichever mechanism, the binding of a CS leads to activation of Src as well as tyrosine phosphorylation of multiple other kinases in a Src- dependent manner. Other data supporting the role of Src in NKA-mediated signaling initiated upon CS binding (Fig. 1.11) was demonstrated by experiments that knocked down and knocked out the NKA α1 subunit or Src. Depletion of the NKA α1 subunit in LLC-PK1 (porcine kidney proximal tubule) cells stimulated the basal activity of Src and tyrosine phosphorylation of Src effector molecules, such as focal adhesion kinase (FAK) and ERK1/2138. More interestingly, the diminished ouabain-induced activation of Src and ERK1/2 in these same cells could both be

rescued by expression of a CS-insensitive rat α1 subunit138. Furthermore, similar observations of increased basal Src activity in cells could be reproduced in the liver of heterozygous NKA α1 knockout mice (α1+/-, which have a 30% decrease in α1 expression) and, also, in a pumping-null rat α1-NKA mutant139. These results highlight that NKA-Src interactions, but not ion transport, are vital for CS signaling of various intracellular pathways via the NKA receptor (Fig. 1.11). Moreover, formation of a functional NKA signalosome requires association with caveolae since depletion of either caveolin-1 or cholesterol redistributed the NKA and Src to other locations and blocked ouabain-induced activation of protein kinases (Fig. 1.11)110,133. In kidney proximal tubule cells, ouabain can stimulate clathrin-dependent endocytosis of NKA α1 subunits and accumulation of these subunits in early/recycling endosome fractions, and thus a reduction in NKA activity133. This could also terminate/propagate the signaling or target it to specific intracellular compartments133. Ouabain-induced endocytosis was found to require caveolin-1 and activation of c-Src and PI3K (described below). In addition, ouabain-activated NKA-Src-EGFR-Ras-Raf-MEK-ERK cascade (described below, Fig. 1.11) may also induce endocytosis and the formation of clathrin coats, since this complex can also be detected in both early and late endosomes131,133. Ouabain also enhances protein-protein interactions between the α1 subunit and clathrin heavy chains, adaptor protein AP-2, and PI3K131,133.

2+ 1.9.2 NKA in IP3R or PLC-γ-IP3R regulation of intracellular Ca and PKC

CS binding to the NKA promotes recruitment of IP3R of the sarco-/endoplasmic reticulum to form a Ca2+-regulatory microdomain with the NKA in the plasma membrane (Fig. 1.11)102,140. 2+ Although the IP3R Ca release channel usually responds to PLC-γ-stimulated production of IP3, 2+ data suggests that ouabain binding directly activates IP3R to release Ca in renal epithelial cells without requiring generation of this secondary messenger or even PLC-γ (Fig. 1.11)102,140. Partial truncation of the N-terminus of the NKA α1 subunit abolished these ouabain-induced low- 2+ 140 2+ frequency Ca oscillations . NKA-IP3R interactions and ouabain-induced Ca oscillations also require the intracellular scaffolding protein, ankyrin-B, which binds to the α1 subunit’s A domain, which likely stabilizes the plasma membrane pool of NKAs and recruits IP3R to lipid rafts133. These types of interactions, leading to ouabain-induced Ca2+ oscillations, have also been observed in other cell types, including hippocampal astrocytes133.

A later study found that ouabain binding to the NKA promotes PLC-γ and IP3R to form a Ca2+-regulatory microdomain with NKA, Src, and caveolin-1 in LLC-PK1 cells (Fig. 1.11)141. 59

Although involvement of PLC-γ may be controversial, these interactions were supported by co- immunoprecipitation of these components in a manner dependent on ouabain concentration, ouabain-induced phosphorylation of PLC-γ, activated Src, activation of PLC-γ by Src, and cholesterol141. In addition, the CD3 region of the NKA α subunit contains the interaction site for PLC-γ while a conserved LKK motif in the N-terminus of this subunit is an essential binding site 141,142 for IP3R . Through this NKA-PLC-γ-IP3R complex, PLC-γ activation also increases 141 production of 1,2-diacylglycerol (DAG) and IP3 in a classical manner (Fig. 1.11) . 2+ Subsequently, either IP3 secondary messengers or direct signaling from PLC-γ in the Ca - 2+ regulatory complex opens IP3R channels to release Ca stored in the sarco-/endoplasmic reticulum (Fig. 1.11). Ca2+ can subsequently deliver diverse responses to the nucleus of cells, including regulation of alternative RNA splicing (Fig. 1.11, described in Chapter 1.6)77,143. DAG and Ca2+ are also both secondary messengers that can activate classical PKCs (and novel PKCs by DAG alone) and their signaling (Fig. 1.11)141,144.

1.9.3 NKA and NCX amplification of Ca2+ responses via the plasmERosome Regional expression of specific NKA α isoforms in smooth muscle cells, astrocytes, and hippocampal neurons can amplify the effect of CSs whereas other isoforms do not131. In cells expressing the α2 or α3 subunits of the NKA, interactions between the NCX and the N-terminal regions of these subunits tether this complex to a plasma membrane microdomain where the sarco-/endoplasmic reticulum is present in a “junctional” subplasmalemmal space called the plasmERosome (Fig. 1.11 or see Fig. 2 of first reference for better depiction)131,145,146. Since Na+ + levels do not increase, it is proposed that a local transient increase of [Na ]i near or within this 2+ 2+ space stimulates a local increase of [Ca ] via the NCX, further elevating Ca uptake into the sarco-/endoplasmic reticulum by the SERCA and amplifies the amount of Ca2+ it releases in cells expressing α2/3 subunits of the NKA131. This allows for lower nanomolar concentrations of CS to initiate greater inotropy or other cellular responses, especially through Ca2+ signaling131,133.

1.9.4 NKA in EGFR transactivation and regulation of MAPK signaling Src activation upon ouabain binding to the NKA can transactivate the EGFR and provide the scaffolding necessary for recruitment of the adaptor protein SHC (Src homology 2 domain- containing) and concomitant binding of the growth factor receptor-bound protein 2 (GRB2)-Son of Sevenless (SOS) complex (Fig. 1.11)99,134,135. Upon activation of SOS, which is a guanine 60

nucleotide exchange factor (GEF) promoting GDP to guanosine triphosphate (GTP) exchange, Ras becomes activated (GTP bound) and initiates a classical MAPK signaling cascade involving Raf, MEK1/2, and the MAPK ERK1/2 (Fig. 1.11)99,103,134,135. Initiation of the Ras-Raf-MEK1/2 pathway can signal to the nucleus via ERK1/2 translocation or ROS release from mitochondria (Fig. 1.11)101,147,148. ERK1/2 activation and Src-mediated activation of ERK1/2 by ouabain was shown to occur in cardiac myocytes, A7r5, and vascular smooth muscle cells134,135. Ouabain was also observed to increase protein tyrosine phosphorylation in A7r5, HeLa, and L929 cells135. However, activation of ERK1/2 is not observed upon ouabain treatment when Src activity (and EGFR, Ras, and MEK in some studies) was blocked by a variety of specific inhibitors, supporting that CSs require activation of Src in order to signal ERK1/299,103,134,135. Studies with other CSs such as digoxin and digitoxin (and ouabain), revealed activation of not only ERK1/2 but also the MAPK c-Jun N-terminal kinase (JNK), but not p38 MAPK, in human breast cancer cells at therapeutic concentrations of these drugs (Fig. 1.11)103. In lung adenocarcinoma epithelial (A549) cells, on the other hand, ouabain was reported to activate both JNK and p38 MAPKs (Fig. 1.11)149. Moreover, ouabain induced activation of ERK1/2 has been described to require PKC activation, phosphoinositide turnover, and Ca2+ in cell media in neonatal cardiac myocytes, since inhibition of these processes impeded ERK1/2 activation by this CS (Fig. 1.11)150. This study suggests cooperativity or cross-talk between signal-transducing elements and ion pumping functions of the NKA in the activation of MAPKs, which are involved in regulating a variety of cellular processes150. Initiation of the Ras-Raf-MEK pathway can signal components in the nucleus via ERK translocation or ROS release from mitochondria (Fig. 1.11)101,147,148. ERK can influence over 160 molecular targets in the cell151. ROS, on the other hand, can influence a variety of responses in the cell [e.g. activation of stress-activated MAPKs: JNK and p38, and big MAP kinase (BMK)/ERK5; inhibit protein phosphatase activity, resulting in activation of ERK1/2; potentially damage DNA, contributing to genomic instability; affect cellular senescence and apoptosis; alter tumorigenesis; augment protein functions such as EGFR via sulfenylation; change subcellular localization of proteins, e.g nuclear factor erythroid 2-related factor 2; and release protein-protein interactions, e.g. nucleoredoxin and dishevelled]152,153.

1.9.5 NKA and PI3K activation Ouabain binding to the NKA and activation of Src was demonstrated to activate PI3K, its substrate AKT, and downstream targets of AKT, which include mammalian target of rapamycin (mTOR) and GSK-3, in causing hypertrophy of neonatal cardiac myocytes (Fig. 1.11)154. Activation of PI3K-AKT signaling by ouabain was also noted in adult myocytes and isolated hearts (causing hypertrophy) as well as kidney proximal tubule cells (inducing cell proliferation) and other cells/animals131,154. Ouabain-induced activation of PI3K occurred in a dose-dependent manner, increased phosphatidylinositol 3,4,5-triphosphate (PIP3) production, and co- immunoprecipitated the NKA α subunit with PI3K154. A proline-rich region in the N-terminal region of the NKA α subunit was also found to bind PI3K155. In a non-conventional manner, ouabain induction of PI3K-AKT signaling required Src activity but not classical stimulation by EGFR (or MEK1, Fig. 1.11)154. Activation of the PI3K-AKT signaling pathway has been reported to influence the splicing pattern of over 200 genes, activate SR protein kinases, and, recently reported to promote balanced splicing of HIV-1 transcripts through regulation of SR proteins71,156. As described for the Ras-Raf-MEK1/2-ERK1/2 pathway, stimulation PI3K-AKT by CSs can activate endothelial nitric oxide synthase (eNOS) by phosphorylation, stimulating an increased production of nitric oxide (NO) from this enzyme (Fig. 1.11) which can mediate ROS- induced proliferative signals in endothelial cells101,148,153,157.

1.10 Thesis rationale and outline

As an innovative strategy to control HIV-1 infection, I aimed at developing novel inhibitors of viral RNA processing—a stage dependent on conserved host proteins. Among small molecules tested, I revealed that the FDA-approved drug digoxin is a potent inhibitor of this stage of virus replication. Digoxin was highly active against clinical strains of the virus from HIV-infected

PBMCs of patients (IC50: 1.1 nM), validating this novel approach and providing a basis for repurposing this drug for the potential treatment of HIV infection. I further identified at least 12 other CSs or CSs can inhibit HIV-1 gene expression at low nanomolar concentrations (IC50s: 5- 175 nM) and impede HIV growth in HIV-infected PBMCs from clinical patients at concentrations (IC50s: 1.1-1.3 nM) that were 2-26 times below those currently used in patients with heart conditions. These CSs were found to cause a dramatic decrease in essential HIV-1 structural and regulatory protein synthesis, due primarily to oversplicing of viral RNAs: reducing viral US (Gag) and SS (Env/p14-Tat) RNAs encoding these proteins. As a consequence, all CSs caused nuclear retention of genomic/US RNAs; supporting viral RNA processing as the underlying mechanism for their disruption of HIV-1 replication. In addition, CSs altered splice site usage of HIV-1 pre-mRNA; and, in the case of digoxin-like CSs, which contain a C-12 hydroxyl substituent, resulted in a loss of Rev whereas digitoxin-like CSs without this group had no effect on this key viral factor. Consistent with altering viral RNA processing, most CSs induced an increase in modification of the SR proteins, SRp20 and Tra2β, which could account for the effects observed. In contrast, the CAG digitoxigenin caused de-modification of these splicing factors. Consistent with this hypothesis, overexpression of SRp20 promoted changes in HIV-1 RNA processing similar to those observed with CSs. Since the NKA can form a signalosome (Fig. 1.11), I hypothesized that CSs utilize intracellular signaling to impact HIV-1 replication. I revealed that CSs inhibit viral gene expression in part through modulation of MEK1/2-ERK1/2 signaling in a manner independent of the Ca2+-overloading mechanism responsible for their toxicity. Supporting this hypothesis, depletion of the NKA (promoting Src activation) and addition of a MEK1/2-ERK1/2 activator, Anisomycin, also suppressed HIV-1 gene expression, phenocopying most of the effects of CSs. Because of the dependency of many mammalian viruses on RNA processing, we tested a splicing modulator identified from a screen of ~60 compounds as both an inhibitor of HIV-1 gene expression and, in collaboration with Dr. M. Brown, Adenovirus infection (IC50: 750 and

900 nM, resp.). This compound is effective in suppressing the replication of HIV-1 (BaL) in human primary PBMCs as well as drug-resistant strains of HIV-1 in a T cell line. In a similar manner as CSs, 5342191 dramatically reduced expression of HIV-1 structural and regulatory proteins and perturbed viral RNA accumulation, except that this compound also decreased Tat and Rev expression (and, consequently, export of genomic RNAs) with little perturbation of total protein synthesis in the cell. Inhibition of Adenovirus replication is associated with blockages in viral DNA replication and subsequent late gene expression (110K, fiber, hexon, and penton base). Consistent with altering RNA processing, 5342191 treatment of Adenovirus and HIV-1 infected cells (resp.) alters the accumulation of viral mRNA and the levels of various phospho- SR proteins compared to controls. In contrast to CSs, 5342191 causes little perturbation in host gene expression (<0.5% of 11,406 genes) and alternative RNA splicing (<0.3% of 9,806 events) in HIV-1 infected cells. Due to this compound having a similar phenotype as CSs on HIV-1 RNA processing, I hypothesized that 5342191 initiates similar signaling events to inhibit viral gene expression. 5342191 activates Ras-Raf and inhibits HIV-1 gene expression via MEK1/2- ERK1/2 signaling. In contrast to CSs and their toxic mechanisms, 5342191’s inhibition of HIV-1 gene expression required activation of G proteins at the cell membrane but not stimulation of p38 MAPK or Ca2+ flux. Supporting this hypothesis, overexpression of small G proteins (Ras) downstream of G protein signals inhibited HIV-1 gene expression, phenocopying the response of 5342191 as well as CSs. On the whole, the studies within this thesis support that CSs may have better TIs for treating HIV-1 infection than treating heart conditions and offers alternative cellular targets for controlling this infection. Moreover, I explore the possibility of applying small molecule inhibitors to suppress multiple viral infections by targeting a common cellular function: RNA processing; such a drug could potentially be used in salvage and/or combinatory therapies and have limited side effects to the host.

2 Digoxin Suppresses HIV-1 Replication by Altering Viral RNA Processing

The contents of this chapter [Wong et al. (2013). PLoS Pathog. 9(3), e1003241] were reproduced/reprinted with permission from © Wong et al. published by PLOS Pathogens under the distribution terms of the Creative Commons Attribution License (CC BY 4.0) for Open Access articles104.

Publication Wong, R. W., Balachandran, A., Ostrowski, M. A. & Cochrane, A. Digoxin Suppresses HIV-1 Replication by Altering Viral RNA Processing. PLoS Pathog. 9(3), e1003241 (2013).

Author contributions • Raymond W. Wong conceived and designed the experiments, performed the experiments, analyzed data for all Figures 2.2-2.9 and 2.11-2.14 (except for those done by AC), and wrote and edited the paper.

• Alan Cochrane conceived and designed the experiments, performed the experiments, analyzed data for Figure 2.13, prepped Figure 2.1, supervised study, and wrote and edited the paper.

• Ahalya Balachandran contributed to running of a few p24CA ELISAs on samples for Figure 2.1c and recorded RWW's counts onto a notepad for Figure 2.10c.

• Mario A. Ostrowski contributed HIV-infected PBMCs from patients.

Acknowledgements We thank Shariq Mujib, Wendy Dobson-Belaire, and Scott D. Gray-Owen for assistance in HIV-1 infections of PBMCs, people who provided blood (PBMCs) for medical research, and Peter Stoilov and Douglas Black for input during the preparation of this manuscript. We thank Bruce Chesebro for donating anti-gp120 hybridoma 902 to the NIH AIDS Research & Reference Reagent Program (Cat. No. 521); Michel Tremblay (Laval University, Quebec) for anti-p24 hybridoma 183; M. L. Hammarskjold (University of Virginia School of Medicine) for Znk1.4 serum; and John Bell (University of Ottawa) for CLK(1-4)-GFP vectors.

2.1 Abstract

To develop new approaches to control HIV-1 replication, we examined the capacity of recently described small molecular modulators of RNA splicing for their effects on viral RNA metabolism. Of the drugs tested, digoxin was found to induce a dramatic inhibition of HIV-1 structural protein synthesis, a response due, in part, to reduced accumulation of the corresponding viral mRNAs. In addition, digoxin altered viral RNA splice site use, resulting in loss of the essential viral factor Rev. Digoxin induced changes in activity of the CLK family of SR protein kinases and modification of several SR proteins, including SRp20 and Tra2β, which could account for the effects observed. Consistent with this hypothesis, overexpression of SRp20 elicited changes in HIV-1 RNA processing similar to those observed with digoxin. Importantly, digoxin was also highly active against clinical strains of HIV-1 in vitro, validating this novel approach to treatment of this infection.

2.2 Author Summary

Antiretroviral therapies (ART) for HIV/AIDS are successful in slowing disease progression by inhibiting viral proteins. However, the ability of HIV to adapt to ARTs has given rise to drug- resistant virus strains that now represent ≥ 16% of newly infected people. This development calls for the generation of new treatment strategies. Since HIV is dependent upon RNA processing under control of the host, we searched for compounds/drugs that inhibit HIV-1 replication at this step. We identified digoxin as a potent inhibitor of HIV-1 replication. The drug inhibited expression of HIV-1 structural proteins and a key factor involved in viral RNA export. This response was accomplished by altering the efficiency and splicing choices in HIV-1 RNA processing. Since this stage of the virus lifecycle is not targeted by current ARTs, the digoxin family of drugs represent a novel class of HIV-1 inhibitors. Since digoxin targets host factors and is already in clinical use, it and potentially the cardiac glycoside family of drugs has the possibility for swift development into a new ART for HIV-1 infection.

2.3 Introduction

Current highly active anti-retroviral therapies (HAARTs) have successfully delayed the progression of HIV-1-infected individuals to AIDS by targeting viral entry and all HIV-1 enzymes26,158. However, the clinical application of ARTs is being affected by the spread of drug resistant viral strains159–161; detection of drug resistant forms of HIV-1 in newly infected patients has increased ~3-fold from 2000 to 2007 to 16%162,163. To overcome these hurdles, more drugs with better profiles, and especially, novel mechanisms of action, are necessary for continued success in combating HIV-126,158,164. However, the majority of drugs currently undergoing clinical trials target the same enzymes/proteins for which drugs are already available26,158,165,166. In addition, the persistence of virus in reservoirs continues to be a challenge with standard HAART. There are at least 200 host factors required for HIV-1 infection and replication167–169. Efforts to understand the role of these factors in the lifecycle of HIV could aid development of future therapies. Among these are the factors regulating RNA processing. HIV-1 requires a balanced regulation of viral RNA processing to generate > 40 mRNAs for synthesis of 15 viral proteins, an effect achieved through alternative splicing of a single 9 kb pre-mRNA transcript (Fig. 2.1)32,37,170,171. HIV-1 RNA processing involves the combinatory use of four 5’ splice sites (splice donors, SD1-4) and eight suboptimal 3’ splice sites (splice acceptors, SA1-7; Fig. 2.1). Use of 3’ splice sites (ss) is regulated by host trans-acting factors that function in an antagonistic fashion by binding to cis-acting elements adjacent to the 3’ss, either impeding (hnRNPs) or promoting (SR proteins) their use30,37,38,40,171. Three classes of HIV-1 mRNAs result from HIV-1 RNA splicing (Fig. 2.1): unspliced RNAs (US) encoding Gag or Gagpol proteins, singly spliced RNAs (SS) producing Env, Tat (p14), Vif, Vpr, or Vpu, and multiply spliced RNAs (MS) for synthesis of Rev, Tat (p16), or Nef28,32,171. Among these, Tat and Rev factors play central roles in HIV-1 replication; Tat activates transcription of all viral RNAs, while Rev transports the incompletely-spliced RNAs (US, SS) to the cytoplasm for translation37,47,172–175. Imbalances in RNA processing can dramatically affect viral replication176–178; undersplicing results in the loss of key regulatory proteins such as Tat and Rev (from MS RNA), while oversplicing would reduce incompletely-spliced RNAs (US, SS) encoding viral structural proteins (Gag, Env) and accessory factors (Vif, Vpr, Vpu).

Figure 2.1. Pattern of HIV-1 mRNAs generated from splicing. Depicted is the organization of the HIV-1 proviral genome (top) indicating the position of multiple 5’ splice donor sites (SD1-4) and 3’ splice acceptor sites (SA1-7) used in the splicing of viral pre-mRNA. Below is an illustration of 68

the alternatively spliced RNAs generated by processing HIV-1 genomic RNA (unspliced, US, middle). Indicated are the common (open boxes) and alternative exons (closed boxes) used in generating the singly spliced (SS, 4 kb) and multiply spliced (MS, 1.8 kb) viral RNAs. At the bottom is a list of the nomenclature used to describe the exon composition of each RNA generated from these two classes of HIV-1 RNAs. Note: there are two isoforms of Tat generated from these exons: p14 Tat from SS RNAs and p16 Tat from MS RNAs. The SS RNA generates a truncated form of Tat (p14) due to the presence of a termination codon immediately 3' of SD4, thereby translating it into a shorter isoform than MS RNAs.

Knowledge of how to manipulate these processes to alter HIV-1 RNA splicing in cells could prove advantageous as a strategy for controlling HIV infection. This hypothesis is supported by studies where modulating SR protein abundance (by overexpression/depletion) caused imbalances in HIV-1 splicing, resulting in gross changes in viral protein synthesis38–41. This hypothesis is also supported by the observation that HIV-1 infection leads to a decrease in overall SR protein/activity which can be reversed by increasing SR protein kinase (SRPK) 2 function54. Consistent with these studies, we have successfully suppressed HIV-1 gene expression through modulation of another family of SR protein kinases, the Cdc2-like kinases (CLKs)83. While use of small molecular weight (MW) inhibitors of SRPK 1 and 2 have met with limited effect against HIV54, we recently demonstrated that chlorhexidine (an inhibitor of CLKs 2, 3, and 4) is able to alter HIV-1 RNA processing, leading to inhibition of HIV-1 replication83. However, the toxicity of chlorhexidine in peripheral blood mononuclear cell (PBMC) cultures precludes its systemic use. Further supporting the viability of this approach is recent work demonstrating the suppression of HIV-1 RNA splicing using indole derivatives that function by modulating SR protein function40,87,88. To explore this strategy further, we tested compounds shown to modulate host alternative RNA splicing to identify new inhibitors of HIV-1 replication84,97. We report here that digoxin, a drug widely used in treatment of congestive heart failure114,179, is a potent inhibitor of HIV-1 replication. Digoxin treatment drastically reduced HIV-1 gene expression in stably HIV-1 transduced HeLa and SupT1 cell lines and is effective in inhibiting replication of HIV-1 clinical strains in human CD4+ PBMCs. Digoxin accomplishes these effects through two mechanisms: inducing oversplicing of HIV-1 RNA, resulting in an alteration in splice site usage of HIV-1 pre- mRNA as well the loss of the key regulatory protein, Rev. Consequently, this response impairs expression of viral structural proteins. Reduced Rev expression leads to HIV-1 incompletely-

spliced RNAs (US, SS) being sequestered in the nucleus. Expression of Rev in trans led to a partial rescue of HIV-1 structural protein (Gag) synthesis. Coincident with the changes in viral RNA processing, digoxin treatment also induced changes in the modification of a subset of SR proteins (SRp20, Tra2β, SRp55, and SRp75) and the activity of the CLK family of SR protein kinases. Our findings support the hypothesis that HIV-1 RNA processing can be effectively targeted without severe toxicity to the host cell. Since this stage of the virus lifecycle is not targeted by current anti-retroviral therapies (ART)26,158, digoxin (and potentially the cardiac glycoside family of drugs) represent a novel class of HIV-1 inhibitors with the potential for rapid development into an ART.

2.4 Results 2.4.1 Digoxin is a potent inhibitor of HIV-1 gene expression In our search for novel HIV-1 inhibitors, drugs with the capacity to alter RNA splicing were screened for antiretroviral activity84,97. We used a human cell line stably transduced with a modified X4 HIV-1 (LAI) provirus regulated by a Tet-ON system that requires addition of doxycycline (Dox) for activation of viral gene expression83,86,180. The effects of drugs on HIV-1 gene expression were monitored by treating HeLa rtTA-HIV-ΔMls cells for 4 hours with drugs prior to induction of virus gene expression by Dox (Fig. 2.2). After 20 hours, media and cell lysates were harvested for analysis of HIV-1 Gag protein expression by p24CA ELISA (Fig. 2.2a) or Western blots for Gag and Env (gp120) (Fig. 2.2b, top and middle, respectively). We observed that digoxin (100 nM) caused a 94% inhibition of HIV-1 Gag protein expression relative to DMSO control (Fig. 2.2a). In contrast, other drugs shown to affect RNA splicing such as clotrimazole and flunarizine (10 μM) showed no significant effects84. Western blot analysis of Gag protein expression in cell lysates of digoxin-treated cells (Fig. 2.2b, top) confirms a complete loss of the Gag products, capsid (CA) and matrix (MA)-CA, and a marked reduction in Gag protein species relative to controls (untreated and TG009, +). Western blot analysis of Env (Fig. 2.2b, middle) demonstrated a loss in both gp120 and gp160 proteins to near undetectable levels compared to controls. Upon subsequent analysis of the dose response curve (Fig. 2.2c), digoxin demonstrated potent inhibition of HIV-1 Gag protein expression with an IC50 of ~45 nM

(IC90 = 100 nM). Parallel assessment of the cytotoxicity of digoxin treatment on this cell line (Fig. 2.2d) revealed no significant effects on cell viability at the dose ranges required to inhibit

HIV-1 gene expression (50-100 nM) as measured by XTT and Trypan blue (TB) exclusion assays (0-200 nM) (Fig. 2.2d).

2.4.2 Digoxin inhibits HIV-1 replication in PBMCs To validate our findings in a more relevant setting, the ability of digoxin to suppress HIV-1 replication in the context of human CD4+ PBMCs was examined. Isolated PBMCs were infected with a R5 BaL strain of HIV-1 in the presence of increasing doses of digoxin and the extent of virus replication was monitored by p24CA ELISA (Fig. 2.2a). Analysis of the data revealed a profound suppression of HIV-1 replication upon addition of digoxin (IC90 = ~25 nM). Parallel examination of the effect of these treatments on cell viability (Fig. 2.3b) determined that negative effects were only discernible at doses of ≥ 50 nM (by XTT assay), above the dose required to strongly suppress HIV-1 replication. In comparison to the stable cell line, analysis of media from PBMC infections at earlier time points (day 3; Fig. 2.4), representing less cycles of replication, demonstrated significant reduction in HIV-1 replication without significant effects on cell viability (data not shown). As a further test of the efficacy of digoxin in suppressing HIV- 1 replication, a similar trial was performed using CD8+-depleted PBMCs obtained from treatment-naïve HIV-infected patients. As shown in Figures 2.3c and 2.3e, while Gag accumulated over time in control samples (DMSO), digoxin inhibited HIV-1 replication over the 20 days of the assay to a level comparable to the nucleoside reverse transcriptase inhibitor (NRTI), 3TC (Figs. 2.3e and 2.3f). Furthermore, dose response curves (Fig. 2.3d) demonstrate inhibition of HIV-1 replication at an IC90 of 2 nM with no detectable effects on cell viability.

Figure 2.2. Digoxin suppresses HIV-1 gene expression. HeLa rtTA-HIV-ΔMls cells were treated with indicated drugs for 4 h prior to induction of viral gene expression with (+) and without (-) Dox for ~20 h. In (a, b), cells were either untreated or treated with 100 nM of digoxin, 10 μM of clotrimazole, 10 μM of flunarizine, or DMSO solvent. Equal concentrations of DMSO were present in each treatment (a-d). In (b), TG009 (an inactive analog of the CLK inhibitor, TG003) served as an additional control with untreated (+) control. (a, c, d) Cell culture supernatants were harvested after drug treatments for analysis of HIV-1 Gag protein expression by p24CA ELISA. Peak Gag expression averaged ~1200 pg/ml in media harvested from induced cells. Data was averaged from n ≥ 12, displayed as a fraction relative to DMSO (+) control, error bars are SEM, and statistical significance (drug treatments vs. DMSO (+) control) indicated by asterisks as described in “Materials & Methods”. (b) Cell lysates were analyzed by western blot of Gag (p55) as well as its processing intermediates (MA-CA, p41; CA, p24) (top) and Env (middle) while tubulin (bottom) served as an internal loading control. Data is representative of ≥ 4 independent experiments. (c, d) Dose-response curves characterizing digoxin inhibition of HIV-1 gene expression. Cells treated with digoxin (0-100 nM) were evaluated for (c) inhibition of Gag protein expression as described above or (d) effects on cell viability (0-200 nM) by Trypan blue (TB) (black diamonds) and XTT (gray circles). Inhibition data was averaged from n ≥ 7 and cell health data was n ≥ 6 and displayed as a fraction relative to DMSO (+) control, error bars are SEM, and statistical significance indicated by asterisks as mentioned above.

Figure 2.3. Digoxin inhibits HIV-1 replication in PBMCs. (a-b) Phytohemagglutinin-leucoagglutinin (PHA-L)/interleukin-2 (IL-2)-activated human PBMCs were infected with R5 BaL strain of HIV-1 at a multiplicity of infection (MOI) of 10-2. Following infection, cells were incubated in the presence of indicated doses of digoxin or DMSO (control). Equal concentrations of DMSO were present in each treatment. (a) After 8-10 days, media was harvested for analysis of HIV-1 Gag protein expression by p24CA ELISA. Peak levels of Gag expression averaged ~800 pg/ml at ~8 days post-infection. ELISA results were averaged 73

from ≥ 4 experiments and displayed as a fraction relative to DMSO (+) control, error bars are SEM, and statistically significant changes of treatments from DMSO control are indicated by asterisks as detailed in “Materials & Methods”. (b) Cells were assessed following digoxin treatment for cell viability by Trypan blue exclusion (TB, black diamonds) or XTT assay (grey circles) as indicated. Shown is data averaged from ≥ 5 and ≥ 3 experiments, respectively, and displayed as a fraction relative to DMSO (+) control, error bars are SEM, and statistical significance indicated by asterisks as mentioned above. (c-f) CD8+-depleted PBMCs from chronically HIV-1- infected patients were activated by treatment with anti-CD3 and anti-CD28 antibodies to induce virus growth in cell culture. Cells were treated with either (c, d) digoxin or (e, f) the NRTI, 3TC. Media was harvested at multiple times points to assess virus replication by p24CA ELISA of Gag. Shown (c, e) are the viral growth curves from 20 days of cell culture and (d, f) the dose response effects of the indicated drugs after only 14 days of culture. Effect of drugs on cell viability (Cell Viab., grey circles) was also tested in parallel by XTT assay. Note: cell viability data for (c, e) are shown on the y-axis adjacent to Gag levels while (d, f) is displayed in a similar manner but on the same y-axis as Gag expression. Inhibition and viability results shown (c-f) are derived from assays performed on three different patients, expressed relative to DMSO-treated cells, error bars are SEM, and statistical significance indicated by asterisks as described above.

Figure 2.4. Digoxin inhibits HIV-1 (BaL) gene expression in PBMCs at day 3. Isolated PBMCs were infected with R5 HIV-1 BaL at a MOI of 10-2 in the presence of indicated doses of digoxin as described in Fig. 2.3. Equal concentrations of DMSO were present in each treatment. After 3 days, media was harvested for analysis of HIV-1 Gag protein expression by p24CA ELISA. Plotted data was averaged from ≥ 3 experiments, error bars are SEM, and asterisks indicate significant differences in digoxin treatment from DMSO control as detailed in “Materials & Methods”.

2.4.3 Digoxin alters HIV-1 RNA processing To determine the mechanism underlying the response to digoxin, we analyzed its effect on the abundance of all three classes of HIV-1 mRNA by qRT-PCR (Fig. 2.5). Using the HeLa rtTA- HIV-ΔMls cell line, digoxin treatment induced an 84% reduction in US mRNA levels (encoding Gag and Gagpol) and a 68% decrease in SS mRNA (encoding Env, p14 Tat, Vpr, Vif, or Vpu). In contrast, digoxin increased MS mRNA (p16 Tat, Rev, Nef) by 300%. The effect of digoxin on HIV-1 RNA abundance was also dose dependent (Fig. 2.6), in agreement with its effects on the expression of viral structural proteins, Gag and Env (Fig. 2.2). These results are consistent with digoxin inhibition being due to the induction of viral RNA oversplicing, which is in contrast to the inhibition of splicing induced by indole derivatives30,88,181. The response to digoxin results in a specific loss of larger, incompletely-spliced mRNA species (encoded by US and SS) that, in turn, reduces the synthesis of proteins necessary for virus assembly. To validate that the response observed was not unique to the HeLa cell line, assays were repeated in 24ST1NLESG cells, a human T cell line (SupT1) chronically infected with a HIV-1 variant (NLE-S-G, a pNL4-3-based virus vector)182. Assays determined that digoxin also suppressed HIV-1 Gag expression in the SupT1 cell line (Fig. 2.7c), inducing a similar reduction in abundance of incompletely-spliced viral RNAs (US, SS) and increasing MS RNA accumulation (Fig. 2.7d) as seen for HeLa rtTA- HIV-ΔMls cells (Fig. 2.5).

Figure 2.5. Digoxin alters HIV-1 RNA processing. The effect of digoxin (100 nM) on HIV-1 mRNA levels was assessed by qRT-PCR of cells treated with drug or DMSO as described in Fig. 2.1. Equal concentrations of DMSO were present in each treatment. (a) Diagram indicating the position of the primers (arrow points) used in qRT-PCR (see Methods). (b) Abundance of HIV-1 unspliced (US, black), singly spliced (SS, white), and multiply spliced (MS, gray) mRNAs are shown relative to DMSO (+) controls. The housekeeping gene, β-actin, served as an internal loading control for the normalization of this data. Dox induced (+) compared to uninduced (-) shows successful activation of HIV-1 gene expression. Shown is data averaged from ≥ 6 experiments, error bars are SEM, and significant changes of treatments from DMSO (+) control are indicated by asterisk as described in “Materials & Methods”.

Figure 2.6. Digoxin alters HIV-1 RNA processing in a dose-dependent manner. The effect of increasing concentrations of digoxin on HIV-1 mRNA levels was assessed by qRT-PCR of cells treated with drug or DMSO as described in Fig. 2.1. Equal concentrations of DMSO were present in each treatment. Primers used in the amplification are described in Fig. 2.5 and “Materials & Methods”. The abundance of HIV-1 unspliced (US), singly spliced (SS), and multiply spliced (MS) mRNAs are shown relative to DMSO (+) control as indicated on the left. The housekeeping gene, β-actin, served as an internal loading control for the normalization of data. Data was averaged from ≥ 4 experiments, error bars are SEM, and asterisks indicate significant changes in treatments from DMSO (+) control as described in “Materials & Methods”.

Figure 2.7. Effect of digoxin on HIV-1 expression and RNA processing in a chronically-infected human T cell line. (a) Schematic diagram of the HIV-1 provirus vector (NLE-S-G) used to generate the stably transduced SupT1 human T cell line, 24ST1NLESG [43]. (b) Induction of HIV-1 gene expression in 24ST1NLESG cells by PMA. Cells were incubated in the presence (+) or absence (-) of PMA (1.8 μM) and Gag expression was assayed 24 h after PMA addition by p24CA ELISA. Data was averaged from ≥ 11 experiments, error bars are SEM, and asterisks indicate significant change from DMSO (-PMA) as detailed in “Materials & Methods”. (c) Analysis of the effect of digoxin on HIV-1 gene expression in 24ST1NLESG cells. Cells (seeded at 1x106 cells per mL in RPMI complete medium) were treated with indicated concentrations of digoxin for 4 h (prepared as described in "Materials and Methods" but in RPMI complete medium) and then HIV-1 gene expression was induced by addition of PMA. Equal concentrations of DMSO solvent were present in each treatment. After 24 h, cell media was harvested for quantitation of Gag expression by p24CA ELISA and cell viability was assessed in parallel by XTT assay (grey circles, secondary y-axis) as indicated. Shown is data averaged from ≥ 3-4 experiments, error bars are SEM, and asterisks indicate significant changes of treatment from DMSO (+) control as described in “Materials & Methods”. (d) Assessment of the effect of digoxin on HIV-1 mRNA accumulation. Cells were treated as outlined above, total RNA was extracted, and the abundance of US, SS, and MS forms of HIV-1 mRNA were quantitated by qRT-PCR as described in Fig. 2.5. Data was averaged from ≥ 5 experiments, error bars are SEM, and asterisks indicate significant changes in treatments from DMSO (+) controls as described in “Materials & Methods”.

2.4.4 Digoxin alters the usage of specific HIV-1 pre-mRNA splice sites To analyze the effects of digoxin on HIV-1 RNA processing in greater detail, we examined for changes in viral RNA splice site selection (Figs. 2.8a-c). Using RNA from HeLa rtTA-HIV- ΔMls cells incubated in the presence or absence of digoxin, effects on alternative RNA splicing were analyzed by RT-PCR of the HIV-1 MS (2 kb) mRNA class. Position of the primers is illustrated in Figure 2.4a. Upon comparison to control samples (Fig. 2.8b), we noted that digoxin significantly reduced the level of Rev 2/1 mRNA (generated by the use of SA4c, a, b), while having limited effect on other spliced 2 kb mRNAs. Subsequent densitometry analysis of each MS mRNA species (Fig. 2.8c) revealed that digoxin induced a 73% loss of Rev 2/1 mRNA levels compared to control samples as well as a slight increase in Tat 1 (generated by the use of SA3). In contrast, other splice modulator drugs such as clotrimazole and flunarizine had no significant effect on HIV-1 MS splice site selection (Fig. 2.9). These results reveal that digoxin causes selective alterations in the use of viral MS pre-mRNA splice sites, leading to the specific loss of the mRNA species encoding a key HIV-1 regulatory factor, Rev (Figs. 2.8b and c).

Figure 2.8. Digoxin alters HIV-1 pre-mRNA splice site usage to suppress Rev expression. Effects of digoxin on HIV-1 splice site use were assayed by RT-PCR of the 2 kb, MS class of HIV-1 mRNA. (a) Diagram of the HIV-1 provirus indicating the splice sites (SD1-4, SA1-7) and position of the primers (arrow points) used to amplify MS mRNA species (see Materials and Methods). Also shown below are the forms of viral RNA 80

used to express the two isoforms of Tat: p14 generated from SS RNA and p16 from MS RNA. Open boxes represent exons, closed boxes are alternative exons, and dashed lines are excised introns. The SS RNA generates a truncated form of Tat (p14) because of the presence of a termination codon immediately 3’ of SD4. (b) A representative RT- PCR gel of the levels of each MS mRNA species (arrows) from cells treated with digoxin (Dig) or control (C) using cDNAs described in Fig. 2.5. (c) Graph summarizing the effects of digoxin (white) and control treatments (gray) on the level of each MS mRNA species (x-axis) relative to the total HIV-1 MS mRNA (y-axis) and displayed as a fraction of the total MS HIV-1 RNA. Data was averaged from ≥ 6 experiments, error bars are SEM, and significant changes of treatments from DMSO (+) control are indicated by asterisks. (d) Western blot analysis of HIV-1 regulatory factors Rev (top) and Tat (bottom) from cells treated with digoxin or DMSO as described in Fig. 2.1. Anti-α-tubulin blots served as an internal loading control for the relative amount of protein lysate in each lane. In each experiment, Dox induced (+) compared to uninduced (-) shows successful activation of HIV-1 protein expression. Protein products (right), specific antibodies detecting them (left), and MW standards (top left) are as indicated. Each immunoblot is a representative of the effects observed from ≥ 7 independent experiments.

Figure 2.9. Clotrimazole and flunarizine do not affect HIV-1 pre-mRNA splice site usage. Effects of clotrimazole and flunarizine on HIV-1 splice site use were assayed by RT-PCR of the 2 kb, MS class of HIV-1 mRNA. Primers used to amplify HIV-1 MS mRNA species are described in Fig. 2.8 and “Materials & Methods”. This graph summarizes the effects of clotrimazole (white), flunarizine (gray), and control treatments (black) on the levels of each MS mRNA species (x-axis) relative to the total HIV-1 MS mRNA (y-axis), displayed as a fraction. Data was averaged from multiple experiments and error bars are SEM, and statistical significance calculated as described in “Materials & Methods”.

2.4.5 Digoxin induces loss of Rev expression and reduces cytoplasmic accumulation of US viral RNA To assess the impact of digoxin’s alteration of splice site usage at the protein level, we performed western blots of cell extracts to examine for changes in the viral regulatory factors Rev and Tat. Analysis of Rev (Fig. 2.8f, top) revealed a profound loss of Rev protein expression levels relative to DMSO control (+) consistent with the reduced level of the corresponding mRNA (Figs. 2.8n and 2.8c). This response was achieved without detectable changes in the level of p16 Tat, a Rev-independent isoform encoded by MS RNA, demonstrating selectivity in the responses observed. However, digoxin did reduce expression of p14 Tat (Fig. 2.8d, bottom), a Rev-dependent isoform produced from SS mRNA. Reduced p14 Tat levels is consistent with both a decrease in Rev expression (Fig. 2.8d, top) and of SS mRNA (Fig. 2.5). These observations confirm that digoxin selectively blocks Rev protein production, leading to impaired export of Rev-dependent mRNAs (US and SS) that produce viral structural proteins as well as a subset of regulatory/accessory factors (illustrated in Fig. 2.1). As further verification that digoxin results in reduced Rev activity, in situ hybridization was performed to look for changes in HIV-1 US RNA distribution associated with drug treatment. As shown in Figure 2.10a, in the presence of doxycycline alone (DMSO +Dox), signal for HIV-1 US RNA is observed throughout the cell with intense staining at the sites of proviral integration. In contrast, addition of both doxycycline and digoxin results in viral US RNA being predominately restricted to the nucleus (Fig. 2.10a, Digoxin +Dox,). Treatment of cells with the NRTI, 3TC, had no effect on the distribution of the viral US RNA (Fig. 2.10a, 3TC +Dox). To determine whether reduction of Rev alone was responsible for the loss of HIV-1 structural protein expression, cells were transfected with control (dsRed) or Rev (dsRed-Rev) expression vectors in the presence of digoxin and Gag protein synthesis monitored (Fig. 2.10b, c). These assays revealed that trans expression of Rev (ds Red Rev) yielded a partial recovery of HIV-1 Gag protein synthesis in comparison to the control vector (ds Red).

Figure 2.10. Digoxin blocks cytoplasmic accumulation of HIV-1 US RNA and its effect is partially reversed by expression of Rev in trans. (a) To assess the effect of digoxin treatment on viral RNA transport, in situ hybridization of US RNA was performed on HeLa rtTA-HIV-ΔMls cells treated with digoxin, 3TC, or DMSO solvent. After 4 h, viral expression was left uninduced (-) or induced by addition of Dox (+). After 24 h, cells were fixed and incubated with labeled 83

oligonucleotides specific to HIV-1 US RNA (US RNA). After washing to remove unbound probe, cells were stained with DAPI to allow detection of nuclei and images captured at 630x magnification. Shown is a representative sample of the results observed from ≥ 4 independent experiments. (b) To determine whether Rev expression in trans could alleviate the inhibition of Gag protein synthesis by digoxin, cells were transfected with vectors expressing dsRed or a dsRed-Rev fusion protein. At 24 h post-transfection, cells were treated with digoxin for 4 h then Dox was added to induce provirus expression. At 24 h post-doxycycline addition, cells were fixed, DAPI stained, and viewed for co-expression of dsRed (Cy3) and Gag signal (FITC). Shown is a representative sample of the results obtained. Note: intense foci in the nuclei seen in the FITC channel in cells transfected with dsRed-Rev is due to bleed through from the Cy3 channel. To assess the extent of reversing the effects of digoxin by expressing Rev in trans (c), > 100 dsRed+ cells were examined in each experiment and the frequency of dsRed+ cells also having Gag+ expression was determined for each condition and displayed as "% of cells rescued". Error bars of the data are SEM and significant changes from dsRed indicated by asterisk as detailed in “Materials & Methods”.

2.4.6 Digoxin inhibits the activity of CLK SR protein kinases and induces modification of a subset of SR proteins Digoxin inhibits the function of the sodium-potassium (Na+/K+) ATPase in the plasma membrane resulting in increased intracellular levels of calcium as well as the activation of a number of signaling cascades114,131,179. How events at the plasma membrane ultimately result in altered HIV-1 RNA processing in this system is not immediately apparent. However, many of the kinase cascades affected by cardiac glycosides have been described to influence alternative RNA splicing77,183,184. One hypothesis is that digoxin-induced alteration of cellular signaling cascades ultimately affect the activity of factors, such as SR proteins, known to regulate HIV-1 RNA splicing30,171. To test whether any alteration in SR protein function occurred in our experimental system, we first examined the effect of digoxin treatment on SR protein kinases belonging to the CLK family (1-4)185–187. As indicated in Figures 2.11a and 2.12, overexpression of any of these kinases results in a shift in the subnuclear distribution of SR proteins (such as SC35/SRSF2) from being localized to nuclear speckles to being dispersed throughout the nucleus (compare GFP- with GFP+ cells treated with DMSO). Treatment with digoxin reversed the effects of all CLK kinases tested (Figs. 2.11a and 2.12, Digoxin); SC35 remained in nuclear speckles in the presence of digoxin despite CLK overexpression, consistent with reduced activity of the transfected kinases.

Figure 2.11. Digoxin alters the activity of SR protein kinases and induces modification of a subset of SR proteins. (a) To assess the effect of digoxin on CLK kinase function, HeLa rtTA-HIV-ΔMls cells were transfected with vectors expressing GFP-tagged CLK1. Twenty-four hours post-transfection, cells were treated with DMSO or 100 nM digoxin. After 24 h of treatment, cells were fixed, stained for SC35/SRSF2 nuclear speckles (Texas Red), and nuclei stained with DAPI. Images are representative of the localization patterns observed from ≥ 5 independent experiments. Magnification 630X. (b, c, d) Western blot analysis of the effect of digoxin treatment on SR proteins. Lysates were harvested from HeLa rtTA-HIV-ΔMls cells treated with 100 nM digoxin or DMSO and were induced with Dox (+) or left uninduced (-) as described in Fig. 2.1. Immunoblots were probed by specific antibody for (b) phospho-SR proteins (1H4) or (c) SRp20, Tra2β1, 9G8, or SF2/ASF (SF2). (d) Cell lysates from above were dephosphorylated by treatment with (+) and without (-) calf intestinal alkaline phosphatase (CIP), then immunoblotted with a SRp20-specific antibody. Arrows on the right indicate the protein specie(s) detected and their modified/unmodified isoform(s). Anti-tubulin (Anti-Tub.) blots for each experiment served as an internal loading control for the relative amount of protein lysate per lane. Immunoblots are representative of ≥ 4 independent trials. 85

Figure 2.12. Digoxin alters the activity of CLK SR protein kinases. To assess the effect of digoxin on CLK kinase function, HeLa rtTA-HIV-ΔMls cells were transfected with vectors expressing GFP-tagged CLK1, CLK2, CLK3, or CLK4 as described in Fig. 2.11. Twenty-four hours post- transfection, cells were treated with (a) DMSO (control) or (b) 100 nM digoxin. After 24 h of treatment, cells were fixed, stained for SC35/SRSF2 nuclear speckles (Texas Red), and nuclei stained with DAPI. Images are representative of the localization patterns observed from ≥ 5 independent experiments. Magnification 630X.

Impaired activity of a family of SR protein kinases in response to digoxin addition suggests that an alteration in SR protein function underlies the inhibition of HIV-1 replication. To explore this hypothesis, SR proteins were analyzed by western blot of cell lysates (Fig. 2.11b) for changes in abundance or migration due to drug treatment. Initial analysis of phospho- SR proteins by 1H4 antibody determined that digoxin treatment increased the levels of at least two phospho-SR proteins (Fig. 2.11b): increasing SRp55 and moderately increasing SRp75 relative to DMSO controls (+/-). No consistent changes in the overall phospho-SR protein levels were observed in the presence or absence of HIV-1 expression by this antibody. To further explore specific members of SR proteins affected by digoxin, we performed western blot analysis on a panel of SR proteins with specific antibodies to SRp20, Tra2β, 9G8, and SF2/ASF (Fig. 2.11c). Recent work188 demonstrated that treatment with digitoxin (another cardiac glycoside) induced marked alterations in SRp20 and Tra2β abundance. Consistent with the selective effect of a cardiac glycoside on a subset of SR proteins, we observed that SRp20 (Fig. 2.11c) underwent a shift to a higher MW species upon digoxin treatment compared to DMSO- treated cells (+/-). Treatment of extracts with alkaline phosphatase confirmed that the shift observed in SRp20 was due to hyperphosphorylation of the protein (Fig. 2.11d). In the case of Tra2β (Fig. 2.6c), digoxin treatment increased the level of a high MW form of Tra2β that was reduced upon induction of HIV-1 (+ Dox) compared to control (-Dox). However, alkaline phosphatase had no effect on the higher MW forms of Tra2β blots induced by digoxin treatment (data not shown). Analysis of other SR proteins, 9G8 and SF2/ASF (Fig. 2.11c), showed little or no change in levels or MW upon digoxin treatment. These data are consistent with the recent work of Anderson et al.188 in that only a subset of SR proteins are affected by digoxin treatment, suggesting that at least one or a combination of these splice factors play a critical role in mediating the change in HIV-1 RNA processing or expression.

2.4.7 SRp20 overexpression mimics the effects of digoxin on HIV-1 RNA processing The increased SRp20 phosphorylation or changes in Tra2β modification in response to digoxin raised the possibility that the alterations in HIV-1 RNA splicing could be attributed to increased activity of either factor. To test this hypothesis directly, HeLa rtTA-HIV-ΔMls cells were transfected with vectors expressing these factors and their effects on viral structural protein and RNA accumulation were assessed (Fig. 2.13). To ensure that only cells taking up DNA expressed the HIV-1 provirus, cells were also co-transfected with plasmids expressing the TetO activator, tTA, to induce provirus expression, and secreted enzyme alkaline phosphatase (SEAP) as an indicator of global effects on gene expression. As shown in Fig. 2.13c, detection of HIV-1 Gag by p24CA ELISA was dependent upon transfection with tTA (see –tTA vs. +tTA). Transfection of SRp20 or either isoform of Tra2β (Tra2β1 and Tra2β3) resulted in a marked reduction in Gag protein expression with unchanged or increased expression of SEAP. Subsequent analysis of viral RNA accumulation indicated that each factor functioned in a different manner. qRT-PCR of each of the HIV-1 mRNAs (Fig. 2.13d) determined that SRp20 overexpression resulted in reduced accumulation of both US and SS viral RNAs with a trend towards increased MS RNA levels. In contrast, overexpression of either isoform of Tra2β resulted in reduced accumulation of all HIV-1 mRNAs. Subsequent analysis of splice site selection within the MS class of viral RNAs revealed distinct differences in how these factors affected HIV-1 MS RNA splicing (Figs. 2.13e, f). Similar to digoxin, SRp20 overexpression induced a shift in splice site usage that resulted in increased Tat1 accumulation while reducing Rev1/2 and Nef2 levels. In contrast, Tra2β1 overexpression elicited little change in splice site selection while Tra2β3 overexpression induced a marked accumulation of Nef1, generated by splicing the first 5’ss of HIV-1 to the last 3’ss of the virus. Taken together, the response to SRp20 overexpression is most similar to that observed upon digoxin treatment.

Figure 2.13. Overexpression of SRp20, Tra2β1, or Tra2β3 suppress HIV-1 expression. (a) Diagram of SRp20, Tra2β1, and Tra2β3 protein domain structure. (b) Cells were transfected with the vectors CMVmyc (mock), CMVmyc SRp20 (SRp20), CMVmyc Tra2β1 (Tra2β1), or CMVmyc Tra2β3 (Tra2β3). Forty- eight hours post-transfection, cells were harvested, lysed in RIPA buffer, and proteins analyzed by western blot with anti-myc antibody followed by anti-tubulin (Tubulin) antibody to indicate loading. (c) HeLa rtTA-HIV-ΔMls cells were transfected with (+) (or without, -) CMVtTApA (tTA) to activate the endogenous HIV-1 provirus along with 89

CMV PLAP and either CMVmyc, CMVmyc SRp20, CMVmyc Tra2β1, or CMVmyc Tra2β3. Forty-eight hours post transfection, cell media was harvested and assayed by p24CA ELISA for expression of HIV-1 Gag (black) and production of SEAP (white). Results are averaged from 6 independent assays, error bars are SEM, and asterisks indicate values deemed significant from CMVmyc (+tTA) as detailed in “Materials & Methods”. (d) In parallel, total RNA was extracted from transfected cells and the abundance of individual viral RNA (unspliced, US; singly spliced, SS; multiply spliced, MS) were determined by qRT-PCR. Shown are results averaged from 6 independent assays, error bars are SEM, and asterisks indicate significance as noted above. (e, f) MS HIV-1 RNAs from transfected cells were amplified by RT-PCR as described in Fig. 2.8. Amplicons were fractionated on urea-PAGE gels and a representative gel is shown (e). Relative abundance of individual MS viral RNA species were quantitated and graphed (f). Data was averaged from > 5 independent assays, errors bars are SEM, and asterisks indicate statistical significance as described above.

2.5 Discussion

Despite the success of ART/HAART, there are many caveats with current HIV-1 therapies, including the emergence of drug resistant forms of HIV-1, high cost, and toxicity26,158,166. New drugs with improvement in these profiles and novel mechanisms of action are necessary26,158,165. A number of strategies have targeted HIV regulatory and accessory proteins to date, but most remain under development165,189. It is unclear whether disrupting cellular processes essential for HIV-1 replication can yield alternative therapies without significant cellular toxicity. However, a number of existing therapies for other human diseases (e.g. heart disease, cancer, and dementia) do work by altering host protein function and are well tolerated190–193. In this report, we demonstrate a novel and alternative use of the FDA-approved cardiovascular drug, digoxin, as an anti-HIV-1 therapeutic (summarized in Fig. 2.14). More importantly, digoxin was found to inhibit virus replication by a novel mechanism, inducing oversplicing of HIV-1 RNA (Figs. 2.5, 2.6, 2.8, and 2.7d)—a stage of the virus lifecycle not targeted by current HIV-1 inhibitors and under host cell control. Digoxin achieves this effect by altering the splicing of HIV-1 RNA, reducing accumulation of two classes of viral mRNA (US and SS; Figs. 2.5, 2.6, 2.7d) that encode structural proteins essential for new virion assembly (Gag, Gagpol, and Env; Fig. 2.1). In addition, digoxin selectively inhibits expression of the HIV-1 regulatory factor Rev through specific alteration of viral RNA splice site use without affecting the expression of other viral proteins (p16 Tat; Fig. 2.4). While digoxin induced a 73% reduction in Rev2/1 RNA accumulation, it also increased MS viral RNA levels ~3 fold (Fig. 2.5). Combined, these alterations may not account for the complete loss of Rev protein observed, suggesting the 90

possibility that digoxin may have effects beyond the changes in viral RNA processing detected. The loss of Rev further impairs expression of incompletely-spliced viral mRNAs (US and SS) by preventing Rev-mediated export of RNAs to the cytoplasm (Fig. 2.10a) for translation into respective viral structural proteins (Gag, Gagpol, and Env) and regulatory/accessory factors (p14 Tat, Vif, Vpr, and Vpu) (Figs. 2.1, 2.3, 2.4, 2.8d). Furthermore, the effects were achieved at concentrations of digoxin that did not impact HeLa, SupT1, and PBMC cell viability relative to control treatments (Figs. 2.1, 2.3, and 2.7). Rev expression in trans (Fig. 2.10b-c) only partially reversed the effects of digoxin, indicating that loss of Rev alone is not sufficient to explain the full effect of digoxin. Rather, in light of the demonstration that Rev acts primarily on newly synthesized viral RNA194, the enhanced processing of the viral RNA induced by digoxin may result in the incompletely-spliced HIV-1 RNAs having too short a half-life to be engaged by Rev even when Rev is present. In summary (Fig. 2.14), digoxin selectively impairs HIV-1 replication at two levels: (1) through global alterations in the efficiency of HIV-1 RNA processing and (2) blocking export of incompletely-spliced viral RNAs to the cytoplasm.

Figure 2.14. Digoxin inhibits HIV-1 replication at a new stage of the virus lifecycle. The diagram outlines the current targets of HIV-1 ART/HAARTs which include inhibitors of viral entry (co- receptor and fusion) and all viral enzymes: reverse transcriptase, integrase, and protease. This study demonstrates that digoxin is a potent inhibitor of HIV-1 replication that perturbs RNA processing, a new and viable target of the virus lifecycle. Digoxin inhibits HIV-1 replication by altering specific pre-mRNA splicing events under the control of the host. This includes (1) inducing oversplicing of HIV-1 pre-mRNA (depicted by an increasingly red arrow), which reduces both unspliced (US) and singly spliced (SS) mRNA levels, and (2) altering the use of pre-mRNA splice sites within multiply spliced (MS) mRNA, leading to the reduction of mRNA (and protein) encoding a key HIV-1 regulatory factor, Rev. Loss of Rev further impacts the expression of viral proteins from incompletely-spliced mRNA (US and SS) by impeding nuclear export of these RNAs. The reduction of incompletely-spliced viral mRNAs by both of these mechanisms disrupts the synthesis of a subset of HIV-1 regulatory and accessory factors as well as structural proteins necessary for new virion assembly. This study demonstrates that digoxin, a member of the cardiac glycoside family of drugs, represents a novel class of HIV-1 inhibitors targeting viral RNA processing. 92

Digoxin and other cardiac glycosides are known to bind the Na+/K+-ATPase pump in the plasma membrane, initiating the activation of multiple signaling cascades that result in increased intracellular calcium concentrations as well as signaling of Src, AKT, and MAPK kinases131,195,196. How this response initiated at the cell membrane can alter RNA splicing was not immediately clear. In light of the observed changes in HIV-1 RNA processing, we initially focused on factors known to modulate these events: SR proteins197–200. Consistent with the findings of Anderson et al.188, our results reveal that a subset of SR proteins (SRp20, Tra2β, SRp55, and SRp75) are altered as well as the function of a number of SR protein kinases (CLKs 1-4) upon digoxin addition (Fig. 2.11). In the work of Anderson et al.188, only a subset of the exons examined were affected by treatment with digitoxin, suggesting that the response is not a general perturbation of host RNA splicing but is more selective. Since the modifications of SRp20 or Tra2β1 detected might increase their activity, we subsequently examined the impact of overexpression of both factors on HIV-1 RNA processing (Fig. 2.13). While the three factors tested (SRp20, Tra2β1, and Tra2β3) all elicited a marked reduction in HIV-1 Gag synthesis upon overexpression, analysis of the effects on viral RNA splicing determined that the basis for the response was markedly different. Of the three factors tested, overexpression of SRp20 most closely mimics the changes induced by digoxin; reducing accumulation of US and SS viral RNAs while trending towards increased MS RNA abundance. Furthermore, SRp20 induced increased accumulation of Tat1 and reduced Rev1/2 mRNA levels as observed with digoxin. The response documented here differs significantly from those induced by overexpression of SC35, SRp40, 9G8, and SF2/ASF previously reported38,40,41. In these studies, overexpression of SC35, SRp40, or 9G8 resulted in almost exclusive formation of MS RNA encoding Tat (Tat1), while SF2/ASF increased usage of the splice sites for Vpr. However, the effects of these factors on HIV-1 RNA accumulation and expression differ among published reports: one indicates that SF2/ASF, SC35, or SRp40 overexpression increases US viral RNA accumulation38 while another showed marked reduction of all viral RNAs with only SF2/ASF significantly decreasing Gag expression41. None of these reports demonstrated selective alterations in Rev1/2 RNA abundance comparable to digoxin or SRp20 overexpression reported here. Future efforts will be focused on understanding how SRp20 achieves this response on HIV-1, through either direct interaction with sites on the viral RNA and/or manipulation of abundance/activity of other host factors.

In contrast to the effects of SRp20, overexpression of Tra2β1 and Tra2β3 reduced levels of all viral RNAs (Fig. 2.13d) while only Tra2β3 altered splice usage to favor Nef1 (Figs. 2.13e, f). The difference in activity of Tra2β1 and Tra2β3 is of particular interest since both share a common RRM domain as well as a C-terminal RS domain (Fig. 2.13a) and interact with a common set of SR proteins201. However, previously analyses had indicated that Tra2β3 had limited or no ability to modulate splicing of a number of RNA substrates tested202. Our demonstration that the two Tra2β isoforms have quite distinct effects on splice usage in the context of HIV-1 RNA splicing suggests that variation in abundance of these two isoforms of Tra2β is likely to yield quite distinct effects on host cell RNA splicing. The response seen upon Tra2β3 overexpression is most similar to alterations induced upon mutation of the exon splicing enhancer (GAR) adjacent to SA5. Previous studies had determined that reduced function of GAR resulted in increased accumulation of spliced RNA corresponding to Nef1203,204, raising the possibility that Tra2β3 functions by interfering with GAR function. Our determination that digoxin can alter the equilibrium in viral RNA processing demonstrates that this step of the virus lifecycle can be manipulated to block HIV-1 replication. In principle, targeting host factors essential for HIV-1 replication offers the promise of broad spectrum activity against multiple viral strains and a reduced potential of resistance. Although digoxin has potent effects on HIV-1 in our assays, its use in the treatment of cardiovascular conditions has a narrow therapeutic dose range of 0.5-2.0 ng/mL (max. 5 nM) with higher doses yielding increased toxicity (including death)114,179. Our experiments using the stably transduced HeLa rtTA-HIV-ΔMls and 24ST1NLESG cell lines determined that complete suppression of

HIV-1 gene expression requires concentrations of digoxin (IC90 = 100 nM, Fig. 2.1c; IC90 = 370 nM, Fig. 2.7c, respectively) well above what is compatible for use in humans. However, our subsequent studies using PBMCs showed that reduced doses of digoxin are sufficient to achieve a significant response (IC90 = 25 nM, Figs. 2.3a, b). In experiments using HIV infected patient PBMCs, doses as low as 2 nM strongly suppressed HIV-1 replication (Fig. 2.3c, d). The differences in the dose of digoxin required to achieve a measurable response between the various assays might reflect differences in the ability to activate the signaling cascade initiated by the binding of digoxin to the Na+/K+ ATPase at the cell surface131. Given the transformed nature of both HeLa and SupT1 cells, it is not unexpected that portions of this cascade may be altered relative to PBMCs. Alternatively, differences in the response of the different cell types (HeLa/SupT1 vs. PBMCs) to digoxin may reflect the nature of the assay itself. In the 94

experiments using the stably transduced cell lines (HeLa/SupT1), > 90% of the cells are expressing viral proteins upon induction and, hence, inhibition would require significant alterations in HIV-1 RNA processing/protein synthesis. In contrast, for PBMCs, detection of Gag expression is dependent upon the exponential amplification of the virus in the culture. In this context, even small perturbations in HIV-1 replication will result in significant differences over multiple rounds of replication. The benefit is that doses of digoxin within the therapeutic range were able to suppress HIV infection. Better responses might be achieved using derivatives of digoxin with improved activity and a better TI131,195. The determination that digoxin, acting through the Na+/K+-ATPase (a plasma membrane receptor), can suppress HIV-1 gene expression suggests that its downstream effectors might also prove to be therapeutic targets. In addition, compounds which mimic digoxin’s effect on CLKs and/or SR protein function could prove equally capable of altering HIV-1 RNA processing. Several compounds affecting CLK function (TG003 and chlorohexidine) have already been described84,179, and we recently demonstrated that chlorhexidine (but not TG003) inhibits HIV-1 gene expression83. Recent studies109,193 have identified multiple kinases mediating the effect of cardiac glycosides in transformed cells. Determining which of these kinases is responsible for mediating digoxin’s effect on HIV-1 RNA processing would be useful in developing a more targeted approach to manipulating viral gene expression. However, the demonstration that digoxin can inhibit HIV-1 replication through a novel mechanism without significant toxicity to the host cell serves as proof that this strategy is viable and could be used in junction with existing treatments for better control of this infection.

2.6 Materials & Methods 2.6.1 Screening of splice modulator drugs Screening of drugs for effects on HIV-1 RNA processing was performed using the HeLa rtTA-HIV-ΔMls cell line containing an inducible Tet-On HIV-1 provirus86,180 as described in our previous study83. Activation of virus gene expression in these cells was achieved by addition of doxycycline (Dox) or transfection of plasmid expressing tTA. In drug screens, cells were seeded one day prior in IMDM containing 10% FBS, 1X Pen-Strep, and 1X Amphotericin B (Wisent Corporation) while drugs were solubilized to ~1000X of its final treatment concentration in DMSO. Next, cells were treated for 4 h with 100-200 μL of drugs pre-diluted to ~25X of its final concentration in Opti-MEM (Invitrogen, #31985070) and HIV gene expression was induced with Dox (2 μg/mL). After ~24 h of drug treatment, cells and media were harvested. To monitor effects of drug treatments, p24CA ELISA, western blotting, and RNA analyses were performed as described below. Cell viability was assessed using biochemical (XTT assay; Sigma-Aldrich, #TOX2) and/or physical (trypan blue exclusion; Invitrogen, #15250-061) assays. 95

2.6.2 Ethics statement Written informed consent was obtained from volunteer blood donors in accordance with the guidelines for conduct of biomedical research at the University of Toronto, and all experimental protocols were approved by the University of Toronto institutional review board.

2.6.3 HIV-1 growth in PBMCs Human primary cells were obtained for experiments either from healthy volunteer blood donors (uninfected with HIV) or drug-naïve HIV-infected individuals. For infection experiments, PBMCs were isolated, infected with HIV-1 (BaL), and cultured as described previously83. Cells were treated with drugs pre-diluted in RPMI in the same manner as described above. Every 3-4 days, 0.5 mL of media was harvested for p24CA ELISA and replaced with 0.5 mL of fresh R-10 medium containing fresh drug treating 1 mL (~1.5X final with fresh and decayed drug). The effect of drugs on cell health was assessed in parallel by XTT and/or trypan blue assays. For experiments using HIV-infected patient samples, PBMCs were first depleted of CD8+ T cells using Dynabeads CD8 (Invitrogen, #111.47D) as outline by manufacturer. Remaining cells were then activated by treatment with anti-CD3 anti-CD28 antibodies (Bio Legend #302914 and 317304, respectively; 1 µg/ml of each) as well as 50 U/ml of IL-2 (BD Pharmingen #554603) in the presence or absence of indicated drugs as mentioned above. Media (0.5 ml) was collected every 3-4 days and replaced with fresh media (0.5 ml) containing 20 U/ml of IL-2 and fresh drug. Effect of compounds on cell viability was monitored in parallel by XTT assay and expressed relative to control (DMSO) treated cells. HIV-1 growth in cultures was monitored by p24CA ELISA of cell supernatants.

2.6.4 Quantitation of HIV-1 mRNA levels and localization RNA was extracted from cells by Aurum Total RNA Mini Kits (Bio-Rad, Cat. #732-6820). Purified RNA was reverse transcribed using M-MLV (Invitrogen, Cat. No. 28025-013) and resulting cDNAs were used to quantitate HIV-1 mRNA levels by qRT-PCR as described83. To monitor for changes in HIV-1 US RNA subcellular distribution in response to digoxin, cells were treated with digoxin, 3TC, or DMSO solvent for 4 h and then viral gene expression was induced by addition of Dox. After 20 h, cells were fixed in 3.7% formaldehyde-1XPBS. Cells were permeabilized by treatment with 70% EtOH, then rehydrated in hybridization buffer (10% formamide, 2XSSPE). Hybridization was performed using a mixture of 48 Quasar 570-labelled oligonucleotides spanning the MA, CA, and nucleocapsid (NC) regions of HIV-1 as detailed by the supplier (Biosearch Technologies). Following washing to remove unbound probe, nuclei were stained with DAPI and images acquired using a Leica DMR microscope at 630x magnification.

2.6.5 Analysis of HIV-1 splice site usage The effect of drugs on HIV-1 splice site usage within the 2 kb, MS RNA class was analyzed by performing RT-PCR of cDNA obtained from RNA purified and reverse transcribed as previously described83.

2.6.6 Effect of digoxin on CLK function HeLa rtTA-HIV-ΔMls cells were transfected with vectors expressing GFP-tagged CLK1, CLK2, CLK3, or CLK4. Twenty-four hours post-transfection, cells were treated with either digoxin or DMSO for 24 h, fixed, processed, and analyzed by immunofluorescence microscopy83. Effects on SC35 localization was assessed using a mouse anti-SC35 antibody (BD Pharmingen, #556363) and a secondary Texas Red-conjugated donkey anti-mouse IgG antibody (Jackson Immunoresearch, #715-075-151), while nuclei were stained with DAPI.

2.6.7 Analysis of HIV-1 and SR protein expression To monitor HIV-1 gene expression or virus replication (Gag synthesis), cell culture supernatants were assayed by a HIV-1 p24CA antigen capture assay kit (AIDS & Cancer Virus Program, NCI-Frederick, Frederick, MD USA). Media harvested from PBMC cultures infected with HIV-1 (BaL) were diluted ~250-fold (or as needed) prior to performing this assay. For analysis of HIV-1 and SR protein expression by Western blot, cells were solubilized in RIPA buffer, quantitated by Bradford assay, and run on 8, 10, or 12% SDS-PAGE under reducing conditions, and then transferred to PVDF. Normally, 25-30 µg of protein was loaded, blots blocked in either 5% Milk-T (5% skim milk, 0.05% tween-20, 1XPBS) or 3% BSA-T for 1 h at room temperature (RT) according to the antibody diluent used, and blots incubated with antibody at RT for ~2.5 h, unless otherwise specified. Specific antibodies and conditions used for Tat, anti-tubulin, and isotype-specific HRP-conjugated antibodies were used as described83. Additional antibodies and conditions used in this study include a mouse anti-p24 supernatant from hybridoma 183 (provided by M. Tremblay, Laval University): 1/10th dilution in PBS-T incubated for 1 h at RT, blocked in 5% Milk- T overnight at 4oC. Mouse anti-gp120 purified supernatant from hybridoma 902 (obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: Hybridoma 902 (anti-gp120) from Dr. Bruce Chesebro): 1/10th dilution in PBS-T incubated normally or O/N at 4oC, blocked in 3% BSA-T at RT for 2.5 h. Mouse anti-Rev (Abcam, #ab85529): 1/1000th dilution in 3% BSA-T incubated O/N at 4oC, loaded with 30-40 µg of protein. Mouse anti-phospho-SR (1H4) (Invitrogen, #33-9400): 1/5000th dilution in 3% BSA-T, blocked for ~2.5 h at RT or overnight at 4oC. Rabbit anti-Tra2β (Abcam, #ab3135353): 1/10,000th dilution in 3% BSA-T incubated for 1.5 h at RT. Rabbit anti-9G8 serum (Znk1.4): 1/3000th dilution in 5% Milk-T. Mouse anti-SRp20 (Invitrogen, #334200), 1/1000th dilution in 3% BSA-T, loaded with 20 µg of protein. Generally, Western Lightning-ECL (Perkin-Elmer, #NEL101) but for anti-Rev, -Tat, and -gp120 blots, Western Lightning Plus-ECL (#NEL105) were used for development of signals onto autoradiography film. In addition, phosphatase inhibitors (e.g. 10 mM sodium fluoride, 2 mM sodium orthovanadate) were added to solutions for SR protein analyses. Lastly, SR protein phosphorylation was confirmed through treatment of ~20 μg of cell lysate with 20 U of calf intestinal alkaline phosphatase (NEB, #M0290S) for ~45 minutes at 37oC prior to western blot analysis.

2.6.8 Effect of SR protein and Rev overexpression on HIV-1 gene expression To assess effects of protein overexpression, cells were transfected in the presence or absence of the tTA expression vector, CMV PLAP (expressing SEAP/alkaline phosphatase), and either empty vector (CMVmyc pA), CMVmyc SRp20, CMVmyc Tra2β1, or CMVmyc Tra2β3 using polyethylene imine (PEI). At 48-72 h post-transfection, cells and media were harvested. To monitor effects of these manipulations, p24CA ELISA, western blotting, and RNA analyses were performed as described previously83. To assess the ability of expression of Rev in trans to rescue the synthesis of HIV-1 Gag in the presence of digoxin, cells were transfected as described above with plasmids expressing either dsRed or a dsRed-Rev fusion. At 24 h post-transfection, cells were treated with digoxin for 4 h then HIV-1 expression was induced for 20 h by addition of doxycycline. Cells were subsequently fixed and examined by immunofluorescence for co-expression of Gag and dsRed signal using a Leica DMR microscope.

2.6.9 Statistical analysis Data was analyzed using Microsoft Excel and expressed as means ± standard error of the mean (SEM). Differences between two groups of data (i.e. drug treatment vs. DMSO (+Dox) control, drug treatment vs. DMSO (+HIV), or transfected factor vs. mock vector (+tTA) were compared by Student’s t-test (two-tailed). Statistical significance of results are indicated on each graph as follows: p value < 0.05, *, p value < 0.01, **, and p value < 0.001, ***, unless otherwise indicated.

3 Cardiac glycoside/aglycones inhibit HIV-1 gene expression by a mechanism requiring MEK1/2- ERK1/2 signaling

The contents of this chapter [Wong et al. (Accepted Nov. 7, 2017). Sci Rep] were reproduced/reprinted with permission from © Wong et al. published by Scientific Reports under the distribution terms of the Creative Commons Attribution License (CC BY 4.0) for open access.

Publication Wong, R. W., Lingwood, C., Ostrowski, M. A., Cabral, T., and Cochrane, A. Cardiac glycoside/aglycones inhibit HIV-1 gene expression by a mechanism requiring MEK1/2-ERK1/2 signaling. Sci Rep (Accepted Nov. 7, 2017).

Author contributions 1. Raymond W. Wong wrote and edited the manuscript; conceived, designed, and performed the experiments and analyzed the data for Figs. 3.1-3.16, 3.17a-d, 3.19-3.20, Table 3.1, and analyzed and prepped Fig. 3.17e. 2. Clifford A. Lingwood contributed new reagents or analytic tools (convallatoxin derivatives). 3. Mario A. Ostrowski contributed new reagents or analytic tools (HIV-infected PBMCs from clinical patients). 4. Tyler Cabral performed the experiment for Fig. 3.17e. 5. Alan Cochrane supervised the study; edited the paper; conceived, designed, and performed the experiments and analyzed the data for Figs. 3.18d and 3.21.

Acknowledgements We thank M. Mylvaganam and J. La of C.A.L.’s lab for convallatoxin derivatives; S. Mujib for assistance prepping HIV-infected PBMCs for culture; A. Y.Q. Mao for AKT-1 transfections; T. Hoque and S.-K. Whyte of R. Bendayan’s lab for BMVEC cDNAs and L. Ming for THP-1 cDNAs and NKA shRNA supernatants; A. Balachandran for phytohemagglutinin-leucoagglutinin activated PBMC aliquot; M. Haaland for assisting A.C. in Rev immunofluorescence microscopy with digitoxin/ouabain; human blood donors for PBMCs; and J. Baxter, S. Kidane, W. X. Cao, A. Karatnikov, and A. T.Y. Chen for proofreading manuscript.

3.1 Abstract

The capacity of HIV-1 to develop resistance to current drugs calls for innovative strategies to control this infection. We aimed at developing novel inhibitors of HIV-1 replication by targeting viral RNA processing—a stage dependent on conserved host processes. We previously reported that digoxin is a potent inhibitor of this stage. Herein, we identify 12 other cardiac glycoside/aglycones or cardiotonic steroids (CSs) that impede HIV growth in HIV-infected T cells from clinical patients at IC50s (1.1-1.3 nM) that are 2-26 times below concentrations used in patients with heart conditions. We subsequently demonstrate that CSs inhibit HIV-1 gene expression in part through modulation of MEK1/2-ERK1/2 signaling via interaction with the Na+/K+-ATPase, independent of alterations in intracellular Ca2+. Supporting this hypothesis, depletion of the Na+/K+-ATPase or addition of a MEK1/2-ERK1/2 activator also impairs HIV-1 gene expression. Similar to digoxin, all CSs tested induce oversplicing of HIV-1 RNAs, reducing unspliced (Gag) and singly spliced RNAs (Env/p14-Tat) encoding essential HIV-1 structural/regulatory proteins. Furthermore, all CSs cause nuclear retention of genomic/unspliced RNAs, supporting viral RNA processing as the underlying mechanism for their disruption of HIV-1 replication. These findings call for further in vivo validation and supports the targeting of cellular processes to control HIV-1 infection.

3.2 Introduction

In the absence of an effective vaccine to prevent human immunodeficiency virus (HIV) infection, ~36.7 million people currently infected with HIV (2016) rely on the availability and efficacy of existing drug treatments1,26. Current antiretroviral therapies (ARTs) can prevent the onset of acquired immune deficiency syndrome (AIDS), but their efficacy is limited by toxicity, adherence to treatment, high cost, and transmission of drug-resistant viruses—representing over 7-24% of new infections in the United States and Europe21,23,24,26. Consequently, novel strategies reducing the chance of viral adaptation to drugs need to be explored26. In contrast to most existing ARTs which target rapidly evolving and mutation-prone viral enzymes and envelope (Env) interactions26,205, we explored the potential of altering HIV-1 RNA processing—a stage of the virus lifecycle not targeted by current ARTs and regulated by highly conserved cellular proteins and viral RNA elements (Fig. 2.1)32. Recent studies have indicated that disrupting this stage of the virus lifecycle prevents the development of drug-resistant virus89. 100

In our initial evaluation of known splice modulator drug/compounds, we identified two FDA-approved drugs (chlorhexidine and digoxin) as inhibitors of HIV-1 replication which altered viral RNA processing83,94,104. The use of digoxin in the clinic and its effectiveness against HIV replication at ex vivo concentrations ~2-6 fold below those present in the serum of patients treated for heart conditions made its antiviral properties worthy of further exploration104,111. However, it was unclear which responses elicited by CSs upon interaction with its receptor, the Na+/K+-ATPase (NKA)/Na+ pump, are required for suppression of HIV-1 gene expression. Various hypotheses have been suggested to explain the effect of CSs on cells. The “Na+- pump lag” hypothesis explains the positive inotropic action of CSs on the heart116,131 by proposing that CS binding and inhibition of NKA function results in increased intracellular Na+ + 2+ concentration ([Na ]i), ultimately leading to a rise in free intracellular Ca concentration 2+ 2+ ([Ca ]i). The increased Ca is subsequently stored in the sarco-/endoplasmic reticulum via a Ca2+-ATPase (SERCA), resulting in enhanced Ca2+ oscillations and stronger heart contractions that underly the therapeutic action of CSs. When Ca2+ levels exceed sarco-/endoplasmic reticulum storage capacity (due to excessive NKA inhibition), cardiac arrhythmias can occur in patients. Consequently, CSs have a limited TI116,206,207. However, binding of the CS ouabain at low nanomolar concentrations also activates multiple signaling cascades with little to no inhibition of the Na+ pump in cardiac myocytes, renal epithelial cells, and other cell types99–103,133. Unlike the Na+-pump lag hypothesis, the NKA signalosome hypothesis implicates multiple α-subunit isoforms of the NKA in the relay of responses to the cell interior upon ouabain binding110,131. CS binding to the NKA leads to activation of Src kinase and tyrosine phosphorylation of multiple kinases110,131. For instance, CS- NKA interaction and Src activation recruits phospholipase C (PLC)-γ and inositol 1,4,5 141,142 102,140 trisphosphate (IP3) receptor (IP3R) (or the IP3R alone) to the N-terminal domain of the 2+ NKA α subunit, resulting in Ca oscillations due to triggering of IP3R channels on the sarco- /endoplasmic reticulum to release Ca2+. Secondary messengers such as Ca2+ can consequently deliver diverse responses to the nucleus including regulation of host alternative RNA splicing77,143. In addition, CS binding to the NKA activates phosphatidylinositol-3-kinase (PI3K) which, in turn, increases activity of AKT and its downstream effectors, including nitric oxide synthase (eNOS) to produce reactive oxygen species (ROS) in cells101,148,157. Furthermore, Src activation by CSs can transactivate the epidermal growth factor receptor (EGFR), providing the necessary scaffold proteins to assemble and activate Ras, initiating classical mitogen-activated 101

protein (MAP) kinase (MAPK) extracellular signal-regulated kinase (ERK) 1/2 signaling through the Raf-MAPK/ERK (MEK) 1/2 cascade99,103,134,135. Initiation of the Ras-Raf-MEK1/2-ERK1/2 pathway can deliver signals to the nucleus via ERK1/2 translocation or ROS release from mitochondria101,147,148. Finally, ouabain has been reported to activate other MAPKs, such as c- Jun N-terminal kinase (JNK) and p38, upon binding to the NKA103,149. Since CSs can activate multiple signaling pathways, we hypothesized that CS inhibition of HIV-1 gene expression could be due to any one of these signaling cascades, potentially independent of the toxic/arrhythmogenic effects of Ca2+ flux. Defining the signaling mechanism involved could offer alternative strategies to control HIV-1 infection. We also examined other members of the CS family of FDA-approved drugs to identify modulators of viral RNA processing with improved inhibitor profiles104. In this report, we provide evidence that >3/4 of the CSs tested from the cardenolide/bufadienolide class have greater potency and in vitro and ex vivo TIs compared to digoxin. While all compounds tested have similar effects on HIV-1 Gag/Env and viral RNA accumulation, they differ in their effects on the expression of HIV-1 regulatory factors (Rev/Tat) and phosphorylation of host serine/arginine-rich (SR) splicing factors (SRp20/SRSF3 and Tra2β). Furthermore, we observed that the inhibition of HIV-1 gene expression by CSs is independent of changes in Ca2+, PI3K-AKT, and JNK/p38 MAPKs but could be partially alleviated by inhibitors of MEK1/2-ERK1/2 signaling. Moreover, depletion of the NKA α subunit, proposed to promote Src kinase activation, and addition of the MEK1/2- ERK1/2 activator, anisomycin, also inhibit HIV-1 gene expression110,208,209. These results highlight a link between signaling upon CS binding and the inhibition of HIV-1 and, possibly, other viruses105–108. This study highlights the potential of small molecules to modulate viral RNA processing by altering the activity of cellular factors and offers alternative strategies for controlling HIV/AIDS.

102

3.3 Results 3.3.1 Cardenolide and bufadienolide classes of CSs are potent inhibitors of HIV-1 gene expression Members of the cardenolide and bufadienolide classes of CSs were evaluated in a HeLa rtTA- HIV-ΔMls cell assay for their effect on HIV-1 (Gag) gene expression, summarized in Fig. 3.1

(from dose-response curves in Fig. 3.2), and their differences from digoxin described (IC90: 100 104 nM, IC50: 45 nM) . All of the CSs tested suppressed HIV-1 gene expression without discernible changes in cell viability unless otherwise noted. For the cardenolide class (with highest similarity to digoxin, Fig. 3.1), addition of an extra glycoside on digoxin’s structure, lanatoside C (IC90: 370 nM, Fig. 3.2a), and aglycones (lacking glycosides) of digoxin and digitoxin: digoxigenin

(IC90: N/A, IC70: 600 nM) and digitoxigenin (IC90: 500 nM), reduced anti-HIV-1 activity by ~4, 11, and 5 fold, respectively (Figs. 3.2a-c), compared to digoxin (Fig. 3.1)104. However, unlike digoxigenin which elicited some cytotoxic effects (≥20%) at a concentration of 600 nM (CC20,

Fig. 3.2b), digitoxigenin had no toxicity at 1000 nM or >5.7 times above its IC50 (Fig. 3.2c), suggesting that this compound, and perhaps other CSs (Fig. 3.1), may have better therapeutic profiles than digoxigenin/digoxin (described in Discussion). Digitoxin (IC90: 45 nM, Fig. 3.1, Fig. 3.2d), which differs from digoxin by the absence of a C-12 hydroxyl group on the steroid core, has a 2 fold reduction in IC50 for HIV-1 expression compared to digoxin (IC90: 100 nM). Additionally, ouabain, convallatoxin, and RIDK-34 also have improved anti-HIV-1 activity 111 (IC90: 40, 24, and 25 nM, resp., Fig. 3.1, Figs. 3.2e-g) relative to digoxin . In contrast, RIDK-

27, which resembles ouabain but contains a disrupted glycoside ring, had reduced activity (IC50: 111 >100 nM, Fig. 3.1) . Even minor differences in the steroid core from convallatoxin (IC90: 24 nM, Fig. 3.2f), such as peruvoside and RIDK-36 (IC90: 250 and ~1000 nM, switching –OH to –H and –CH=O to –CH=N-NH2, resp., Fig. 3.1, Figs. 3.2h-i), resulted in 10- and 42-fold reductions in potency. The bufadienolide class (bufalin and cinobufagin, IC90: 15 and 40 nM, resp., Fig. 3.1, Figs. 3.2j-k), which contains a 6-membered lactone moiety and have a higher average affinity for the NKA, are even more potent inhibitors of HIV-1 gene expression than cardenolides, with 131 IC50’s 9 and 2.3 fold lower than digoxin .

103

Figure 3.1. Chemical structure and inhibition data of cardiac glycoside/aglycones on HIV-1 gene expression. 104

Chemical structure and dose-response data of CSs on HIV-1 (Gag) gene expression (IC50s) are summarized from Fig. 3.2 from HeLa rtTA-HIV-ΔMls cells (except data was not shown from inactive compounds: RIDK-20, -21, -27, and -28) and Fig. 3.4 from HIV-infected PBMCs from clinical patients. The steroid core and the position of various chemical substituents of CSs (red) are depicted (top). The different modifications of each CS (A-J) are listed below by chemical group. The presence and absence of a glycoside (A) distinguish between CG and CAGs, respectively. Differences in the lactone moiety from butyrolactone and α-pyrone (G) demarcate cardenolide and bufadienolide classes of CSs, respectively. The presence and absence of a hydroxyl group (-OH) at position 12 (B) describes “digoxin-like” and “digitoxin-like” CSs, respectively. Modifications of the steroid in (D-F) except for ouabain are specific to convallatoxin derivatives while (H-J) are specific only to cinobufagin.

105

Figure 3.2. CSs inhibit HIV-1 gene expression in a dose-dependent manner. HeLa rtTA-HIV-ΔMls cells were treated with various cardenolides (a-i), convallatoxin and its derivatives (f-i), or bufadienolides (j-k) at concentrations indicated for 4 h prior to induction of viral gene expression with Dox for ~20 h. Dose response curves for each CS on HIV-1 gene expression were generated from p24CA ELISA of supernatants harvested from cells (black diamonds, y-axis, n ≥ 4, mean, s.e.m.) and, in parallel, their effects on cell viability assayed by XTT (gray circles, adjacent y-axis, n ≥ 4, mean, s.e.m.). Equal concentrations of DMSO solvent were present in each experiment. Peak Gag expression averaged ~1000 pg/mL in media harvested from induced cells. Data are displayed as a fraction relative to DMSO (+Dox) control (0 nM). Statistical analysis was performed per

Methods. Results were compared to digoxin’s published IC90 of 100 nM [Wong et al. (2013). PLoS Pathog. 9(3), e1003241] and were summarized in Fig. 3.1 and Table 3.1.

106

3.3.2 CSs impede the growth of clinical strains of HIV from PBMCs of HIV- infected patients The most promising cardenolides were subsequently tested on clinical strains of HIV using PBMCs of treatment-naïve HIV-infected patients. PBMCs were depleted of CD8+/cytotoxic T cells (Fig. 3.3), activated, and virus outgrowth monitored in the presence/absence of drug/compound (Figs. 3.4a-h). In contrast to DMSO-treated cells, addition of digitoxin or digitoxigenin exhibited strong suppression of viral growth (Figs. 3.4a-b) in a dose-dependent manner (IC90s: 7.5 and 2 nM, resp., Day14, Figs. 3.4f-g) with no observable changes in cell viability relative to controls. These results are comparable to the suppression of viral replication 104 by 3TC and digoxin (IC90: ~5 nM and 2 nM, resp., Figs. 3.4d-e) . In contrast, although RIDK- 34 effectively inhibited HIV replication, it also reduced cell viability by day 20 of culture (Figs. 3.4c and h), indicating some level of cytotoxicity.

107

Figure 3.3. CD8+ T cell depletion of HIV-infected PBMCs from clinical patients. PBMCs from 3 clinical patients were depleted of CD8+ T cells as detailed in Methods and analyzed by flow cytometry. (a) Representative data of T cells within the PBMC population before depletion (circled) viewed by forward and side scatter plot. (b) Representative data from patient 1 of the CD8+ T cell population (arrow) in the T cell total deduced from immunostaining with both anti-CD3+ (FITC) and anti-CD4+ (APC) antibodies prior to depletion. (c-e) Results of depleting CD8+ T cells from the PBMCs of 3 patients. The CD8+ T cell population remaining in each patient’s PBMCs after depletion are highlighted (arrows). This data was deduced from immunostaining cells with an anti-CD3+ (FITC) antibody for total T cells followed by probing with either (c) an anti-CD4+ (APC) or (d-e) anti-CD8+ (APC) antibody to detect the undesired or desired CD4+ and depleted CD8+ T cell fractions, respectively.

108

Figure 3.4. CSs inhibit the growth of clinical strains of HIV isolated from HIV infected patients. 109

PBMCs from HIV infected patients were depleted of CD8+ T cells (Fig. 3.3), activated by anti-CD3 and anti-CD28 antibodies, and treated 20 d with indicated concentrations of drug/compound. HIV particle formation was quantitated by p24CA ELISA of cell supernatants and viability of cells were assayed by XTT. Data are displayed relative to DMSO (0 nM). (a-e) CSs potently impair the outgrowth of HIV from HIV-infected PBMCs (n = 3, mean, s.e.m.). Graphs of viral growth (p24 protein levels) and cell viability (gray circles, adjacent y-axis) of cells treated with drug/compounds (red triangles) or DMSO (black circles) are shown. The drug 3TC and the CS digoxin (d-e) were provided for comparison. (f-h) CSs potently inhibit HIV replication in a dose-dependent manner (n = 3, mean, s.e.m.). Dose-response curves of CS effects on HIV replication (relative Gag expression, black circles) and cell viability (gray circles) were measured on day 14.

3.3.3 CSs block the expression of vital HIV-1 structural and regulatory proteins To determine whether there were differences in how these compounds inhibited HIV-1 replication, we examined the effect of CSs on the expression of essential HIV-1 proteins in HeLa rtTA-HIV-ΔMls cells (Fig. 3.5). All CSs tested markedly reduced the expression of Env polyprotein and its processed product (gp160 and gp120, resp., Fig. 3.5a). Consistent with dose- response curves (Fig. 3.2), these drug/compounds strongly decrease the levels of HIV-1 Gag polyprotein (p55) and its proteolytic processing intermediates, matrix-capsid (MA-CA, p41) and CA (p24) proteins, in cells relative to DMSO [+doxycycline (Dox)] control (Fig. 3.5a). In our previous study, digoxin was shown to reduce expression of key HIV-1 regulatory factors, Rev and p14 Tat, without altering the early-expressed p16 Tat isoform (see Fig. 2.1 on Tat isoforms)104. Rev functions by facilitating the export of incompletely-spliced [unspliced (US) or singly spliced (SS)] HIV-1 RNAs from the nucleus to the cytoplasm during late phase viral expression while Tat activates viral transcription during both early and late phases29,47. In evaluating the effect of other CSs, we noted that “digoxin-like CSs” (digoxin/lanatoside C/RIDK-34), containing a hydroxyl group at C-12 of the steroid (Fig. 3.1), reduce Rev accumulation relative to control (+, Fig. 3.5b). In contrast, CSs (Fig. 1) lacking the C-12 hydroxyl group (“digitoxin-like CSs”: digitoxin/ouabain) or those without anti-HIV-1 activity (RIDK-21/27) had no effect on Rev accumulation (Fig. 3.5b). Conversely, all CSs drastically decrease expression of p14 Tat while most of them have limited effects on p16 Tat levels (Figs. 3.5c-d). The exceptions were the digitoxigenin and RIDK-34 which reduced p16 Tat expression

110

to 57% and 32% of control, respectively. The differential effect of some CSs on both Rev and/or p16 Tat expression suggests potential mechanistic differences in the action of these drugs.

Figure 3.5. CSs reduce expression of essential HIV-1 structural and regulatory proteins.

HeLa rtTA-HIV-ΔMls cells were treated with ~IC80s of CSs (per Methods), 100 nM of RIDK-21 or -27, or DMSO for 4 h prior to Dox induction for 20 h. Cell extracts were analyzed by immunoblot of (a) HIV-1 structural proteins: Env (gp160/gp120) and Gag (p41/p24) and (b-d) viral regulatory factors: Rev (p19, b) and Tat (p16/p14, c-d). (d) Graph quantitating Tat expression. Results from (a-d) are from n ≥ 3, mean, s.e.m. GAPDH/tubulin serves as internal loading control and for normalization of these data. (a and d) Lanes were cropped and assembled from the same blot per box from Figs. 3.6a-b and c, respectively.

111

Figure 3.6. Immunoblot/gels used for representative data figures. Lanes from continuous unexcised blot/gels were cropped and rearranged for Figs. 3.5a (a-b), 3.5d (c), 3.7d (d), 3.13c (e), 3.15c (f), and 3.18c (g). Samples in gray were not displayed in figures. 112

3.3.4 Inhibition of HIV-1 gene expression by CSs is associated with alterations in viral RNA processing To understand how CSs reduce expression of HIV-1 structural/regulatory proteins, RNA was isolated from HeLa rtTA-HIV-ΔMls cells treated with CSs or DMSO and HIV-1 mRNA levels quantitated by RT-qPCR (Fig. 3.7a-b). All CSs tested decreased accumulation of incompletely- spliced HIV-1 RNAs: US RNA abundance was reduced to ~8 and 19% of control and SS RNA levels decreased to ~51 and 18% of control after treatment with digoxin- and digitoxin-like CSs, respectively, consistent with the reduced expression of Gag and Env/p14-Tat expression (Figs. 3.5a and c-d). Similar changes to HIV-1 RNA (and protein) accumulation were also observed upon addition of CSs (digoxin and digitoxin) to a CD4+ T-cell line (24ST1NLESG, Fig. 3.8)104. However, the similar increases in MS mRNA abundance induced by all CSs does not explain their differential effect on Rev and p16 Tat protein accumulation (Figs. 3.5b-d), suggesting that differences between the compounds with respect to Rev likely occur at the level of translation or protein stability. Additional experiments determined that all CSs tested induce a similar alteration in HIV- 1 genomic RNA localization as detected by fluorescent in situ hybridization (FISH) of US RNAs in HeLa rtTA-HIV(Gag-GFP) cells (Fig. 3.7c). Control-treated cells had nuclear signal (with intensely labeled foci at putative sites of transcription) and strong cytoplasmic staining for US RNAs. In contrast, treatment with any CS resulted in detection of US RNA signal almost exclusively within the nucleus, especially for digoxin-like CSs (digoxin/digoxigenin/RIDK-34), which reduce Rev accumulation (Fig. 3.5b), and bufalin. Some residual cytoplasmic staining for HIV-1 US RNAs was observed in cells treated with digitoxin-like CSs (digitoxin/digitoxigenin/ouabain, Fig. 3.7c) that do not affect Rev accumulation (Fig. 3.5b). These results indicate that, despite differences in their impact on Rev accumulation (and sometimes p16 Tat, Figs. 3.5b-d), CSs block HIV-1 US RNA export to the cytoplasm.

113

Figure 3.7. CSs suppress HIV-1 gene expression by altering viral RNA processing.

114

HeLa rtTA-HIV-ΔMls cells were treated with ~IC80s of CSs, RNAs extracted, quantitated by RT-qPCR or RT-PCR, and levels displayed relative to DMSO (+). (a-b) CSs induce oversplicing of HIV-1 RNAs (n ≥ 3, mean, s.e.m.). (a) Diagram of the primer positions (arrow heads) used for RT-qPCR. (b) Graph of the relative amount of US (black), SS (white), and MS (gray) HIV-1 RNAs in cells treated with various CSs. (c) Nuclear export of HIV-1 US RNAs in cells is altered by CSs (representative n ≥ 4). HIV-1 US RNAs were localized by FISH after treating HeLa rtTA-

HIV(Gag-GFP) cells as described above but with ~IC90s of CSs. Nuclei were stained by DAPI and images captured at 630x magnification. (d) CSs induce differential post-translational modification of SR proteins (representative n ≥ 3). SRp20, Tra2β, and tubulin were analyzed by immunoblot of HeLa rtTA-HIV-ΔMls cells treated as described above except cells of this representative blot were treated 3 d with ~IC50s of CSs. (g) Lanes were cropped and assembled from the same gel/blot per box (Fig. 3.6d).

115

Figure 3.8. Effect of CSs on HIV-1 RNA processing in HIV-1-infected CD4+ T cells. 24ST1NLESG cells were treated with 190 nM (or indicated concentrations) of digitoxin, 320 nM of digoxin, or DMSO for 4 h and viral gene expression was induced by addition of PMA. After 24 h, media or cells were harvested for analyses. (a) Schematic diagram of the 24ST1NLESG cell line containing a modified HIV-1 proviral genome,

- NLE S-G (a pNL4-3 strain), stably integrated into a human acute lymphoblastic lymphoma T-cell line, SUPT1. (b) Dose-dependent inhibition of HIV-1 gene expression after digitoxin treatment of 24ST1NLESG cells (n ≥ 4, mean, CA s.e.m.). HIV-1 Gag expression was assayed by p24 ELISA of cell supernatants (black circles) and viability of cells assayed by XTT (gray circles, adjacent y-axis) as previously described for digoxin. (c-d) HIV-1 Gag but not p16 Tat are altered by digitoxin treatment of T cells (representative of n ≥ 3). Cell lysates were analyzed by western blot with antibodies specific for (c) HIV-1 structural protein, Gag, and (d) viral regulatory factor, Tat. GAPDH served as internal loading control. Lanes were cropped and assembled from the same blot. (e) Digitoxin induces oversplicing of HIV-1 RNAs in T cells (n ≥ 5, mean, s.e.m.). Total mRNA was extracted from treated cells, reverse transcribed, analyzed by RT-qPCR, and the abundance of each HIV-1 RNA class displayed relative to DMSO (+) control as described in Figs. 3.7a-b.

116

3.3.5 CSs induce post-translational modification of specific host splicing factors The alterations in HIV-1 RNA accumulation by CSs (Figs. 3.7a-c) could be mediated by specific modification of cellular factors regulating RNA splicing, particularly serine/arginine-rich (SR) proteins which generally enhance splicing and are regulated by their extent of phosphorylation32,83. Previously, we demonstrated that digoxin induces hyperphosphorylation of SRp20/SRSF3 (and modification of Tra2β). Furthermore, the drug-induced changes in HIV-1 RNA accumulation are comparable to those observed upon overexpression of this SRp20104. Analysis of cell lysates determined that treatment with almost all CSs resulted in reduced mobility of SRp20 (Fig. 3.7d), comparable to digoxin-induced hyperphosphorylation104. Conversely, digitoxigenin treatment increased the mobility of SRp20/SRSF3 without affecting protein levels in a manner consistent with dephosphorylation104. In addition, CSs increased the abundance of a modified species of Tra2β while the digitoxigenin and lanatoside C had no effect (Fig. 3.7d)104. Observed differences in these SR protein modifications and Rev/Tat protein accumulation (Figs. 3.5b-d) support the hypothesis that CSs differ in their mechanism of altering HIV-1 RNA processing.

117

3.3.6 The anti-HIV-1 activity of CSs requires interactions with the NKA The effect of CSs on intracellular Ca2+ occurs via binding to the α subunit of the NKA99– 103,116,131,133. We confirmed that the α1 but not the α2 isoform of the human NKA is expressed in all cell types used in this study (HeLa, SUPT1, and PBMCs, Figs. 3.9a-b). Additionally, the α3 isoform is highly expressed in SUPT1s but detected only at background levels in PBMC and HeLa cells (relative to SUPT1s, Fig. 3.9c). In support of the hypothesis that the antiviral activity of CSs are mediated through interactions with the NKA, we note the trend in anti-HIV-1 activity of ouabain, digitoxin, digoxin, and digoxigenin (Fig. 3.1) coincides with their reported binding 104,130 affinities (1/Kd) for NKA α subunits . In addition, we found that alteration of the C-12 lactone group, which mediates CS binding to α subunits, results in reduced/no anti-HIV-1 activity of cardenolides (RIDK-20, -21, and -28, Fig. 3.1)210. These findings are further supported by a recent demonstration that overexpression of the mouse NKA α1 subunit, resistant to CS inhibition, blocks digoxin’s suppression of HIV-1 gene expression111,211. As a further test of whether inhibition of the NKA could affect HIV-1 gene expression, we examined if depletion of the NKA [using short hairpin RNAs (shRNAs) targeting the α1 subunit] could phenocopy the effect of CSs on HIV-1 protein and RNA accumulation. As detailed in Figs. 3.10a-c, shRNA depletion of the NKA α1 resulted in both a reduction in Gag expression and HIV-1 US/SS RNA abundance.

118

Figure 3.9. Expression of different NKA α-subunit isoforms across various cell types. Total mRNA was isolated from several human cell types, reverse transcribed, and analyzed by RT-qPCR, with data normalized to β-actin, as described in Methods. The expression of α1 and 2 subunits (a-b) are shown relative to human brain microvessel endothelial cells (HBMECs) while α3 (c) are displayed relative to a T lymphoblast cell line, SUPT1. cDNAs were assayed from the following: HBMECs using a sample run twice in triplicate/quadruplicate, HeLa [rtTA-HIV(Gag-GFP) or rtTA-HIV-ΔMls] cell lines using 1-2 different samples from 3-4 experiments, SUPT1 cell line (24ST1NLESG) using 2 different samples from 5-7 experiments, PHA-L activated PBMCs using a duplicated sample run in duplicate, and human acute monocytic cell line (THP-1, differentiated into macrophages by PMA) using a sample run in quadruplicate. Cells with a relative expression of <0.05 for a given α subunit were considered as background or confirmed negative.

119

2+ Figure 3.10. Effect of modulating NKA expression, [Ca ]i, and PI3K-AKT on HIV-1 gene expression.

120

Depletion of the NKA perturbs HIV-1 RNA processing (n ≥ 3, mean, s.e.m.). HeLa rtTA-HIV(Gag-GFP) cells were transduced with two shRNAs (E6/E10) to knockdown expression of the NKA α1 subunit and their effect on HIV-1 expression analyzed. After positive selection of cells with puromycin for 24-48 h, HIV-1 expression was Dox induced for 20 h, and cells harvested for analyses. Total mRNA (and protein) was isolated from cells, reverse transcribed, and analyzed by RT-qPCR and data normalized to β-actin (a, c). Results are shown relative to Stuffer (+). (a) Expression levels of NKA α1 mRNAs assayed by RT-qPCR. (b) HIV-1 Gag expression assayed by p24CA ELISA of cell lysates (40 μg). (c) Accumulation of HIV-1 US (black), SS (white), and MS (gray) mRNAs quantified

2+ by RT-qPCR. (d-g) CSs suppress HIV-1 gene expression independent of intracellular Ca flux/signaling and PI3K- 2+ AKT activation. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with either a chelator of [Ca ]i (5 µM BAPTA- AM, [Ca2+]ii), inhibitors of NCX Ca2+-entry (5 µM KB-R7943, NCXi) or PI3K (10 μM LY294002, PI3Ki), or untreated (DMSO, no pathway inhibitor) for ~2 h prior to treatment with ~IC80s of CSs or DMSO for 4 h, and Dox induced for ~20 h. The pathway used by a CS to inhibit HIV-1 expression was determined by monitoring for recovery of Gag-GFP expression by measuring GFP fluorescence in cell lysates (and initially by plate scans of

2+ live/fixed cells, Figs. 3.11a and 12c). (d) Levels of [Ca ]i measured by Fura Red AM™ (n ≥ 4, mean, s.e.m.). (e-f) Quantification of Gag-GFP expression by reducing SDS-PAGE in lysates (35 μg) of cells which were pre-treated with/without KB-R7943 (n ≥ 3-4 mean, s.e.m.). Graph (e) and representative gel (f) of these results. Tubulin immunoblots serve as internal loading control and for normalization of this data. (g) Graph quantitating Gag expression by p24CA ELISA in lysates of cells (35 μg) that were pre-treated with/without LY294002 (n ≥ 3, mean, s.e.m.). Statistical comparisons in (a-g) were performed as illustrated (black/gray dashed lines) or described in Methods.

121

3.3.7 CS inhibition of HIV-1 gene expression does not require changes in 2+ [Ca ]i or activation of PI3K-AKT signaling To identify which intracellular pathways induced by CSs mediate their anti-HIV activity, we independently blocked Ca2+, PI3K, or the 3 MAPK signals to determine if any pathway inhibitor(s) could restore HIV-1 gene expression (as measured by recovery of Gag-GFP expression) in the presence of CSs. HeLa rtTA-HIV(Gag-GFP) cells were treated as described above except pre-treated with/without a pathway inhibitor prior to addition of CS or DMSO and induction of HIV-1 expression by Dox. To examine the role of Ca2+ oscillations (ionic/signaling), we used an intracellular Ca2+ chelator (BAPTA-AM) or an inhibitor of Ca2+ influx via the Na+/Ca2+ exchanger (NCX, KB-R7943)149,206,212. Consistent with functional NCXs 213 2+ being expressed in HeLa cells as reported , all CSs triggered a significant rise in [Ca ]i, which was blocked by addition of KB-R7943 but not by BAPTA-AM at concentrations with little/no effect on cell density (Figs. 3.10d, 11a-b)102,116,131. However, neither of these Ca2+ blockers rescued HIV-1 Gag-GFP expression in the presence of CSs (Figs. 3.10e-f, 3.11a). This data indicates that CS inhibition of HIV-1 gene expression is independent of increased cytoplasmic Ca2+ levels responsible for the toxicity of these drugs in people. To test whether PI3K-AKT activation could affect HIV-1 gene expression within our system, we activated this pathway using either addition of EGF or overexpression assays. As shown in Fig. 3.12a, addition of EGF, which activates PI3K via binding to EGFR, marginally enhances HIV-1 gene expression in HeLa rtTA-HIV(Gag-GFP) cells. Similarly, overexpression of the PI3K substrate AKT [wild-type (WT)/constitutively-active/inactive] in HeLa rtTA-HIV- ΔMls cells resulted in a small increase in HIV-1 gene expression (Fig. 3.12b). To test whether CSs inhibition of HIV-1 gene expression required the PI3K pathway, the effect of a specific PI3K inhibitor, LY294002, on HIV-1 gene expression was assessed in the presence or absence of CSs (Figs. 3.10g, 3.12c-d). Although LY294002 reduced EGF-induced enhancement of HIV-1 Gag expression, it did not reverse the inhibition of HIV-1 Gag-GFP expression by CSs compared to controls (no pathway inhibitor and CS, Figs. 3.10g, 3.12c).

122

2+ Figure 3.11. CSs inhibit HIV-1 gene expression in a mode independent of changes in [Ca ]i. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated or untreated (no pathway inhibitor, black) with an intracellular Ca2+ chelator (5 µM BAPTA-AM, white) or NCX Ca2+-influx inhibitor (5 µM KB-R7943, gray) for ~2 h prior to treatment with ~IC80s of CSs or DMSO, and Dox induced (as described in Figs. 3.10d-f). To determine the signaling pathway used by a CS, cells were monitored for rescue of Gag-GFP expression by scanning for GFP fluorescence. (a) Changes in Ca2+ flux are not responsible for CS suppression of HIV-1 gene expression. Graph quantifying Gag- GFP expression in cells pre-treated/untreated with BAPTA-AM or KB-R7943 (n ≥ 3 and ≥ 9, resp., mean, s.e.m.). (b) Cells treated with BAPTA-AM or KB-R7943 and CS demonstrate limited effects on cell density (n ≥ 4 and ≥ 3, resp., mean, s.e.m.). Methylene blue staining was used to detect the density of cells in plates. Statistical comparisons were performed as illustrated (black or grayed dashed lines) and described in Methods. Inhibitor activity and results described in (a) were confirmed by Fura Red™ AM and SDS-PAGE analysis of Gag-GFP expression (Figs. 3.10d- f).

123

Figure 3.12. PI3K-AKT signaling plays little to no role in the suppression of HIV-1 gene expression by CSs. (a, c-d) Signaling pathways activated by CSs to inhibit HIV-1 gene expression were determined by monitoring for rescue of Gag-GFP expression via scanning for fluorescence in HeLa rtTA-HIV(Gag-GFP) cells after pre-treatment with/without (a) 0-60 ng/mL of EGF for ~1 h (n = 3, mean, s.e.m.) or (c-d) 10 μM of LY294002 for ~2 h (n ≥ 3-8, mean, s.e.m.), treatment with ~IC80s of CSs or DMSO, and Dox induction for 20 h. Results in (c) were confirmed by p24CA ELISA in Fig. 3.10g and the inhibitory activity of LY294002 on PI3K activity was confirmed by suppression of EGF induction of viral expression. (d) Density of cells treated in (c and Fig. 3.10g) were determined by methylene blue stain (n ≥ 3, mean, s.e.m.). (b) Expression of various forms of AKT-1 in cells demonstrate little effect on HIV-1 gene expression. HeLa rtTA-HIV-ΔMls cells were transfected with HA-tagged AKT-1 plasmid [kinase dead (K179M), wild-type (WT), or constitutively-active myristoylated (Myr)] or mock plasmid and HIV-1 gene expression activated by co-transfection with tTA (+). After 48 h, HIV-1 Gag expression in cell lysates (30 µg) were quantified by p24CA ELISA and displayed relative to mock (+) transfected cells (n ≥ 3, mean, s.e.m.). Statistical analyses were performed as illustrated (black or grayed dashed lines) or to DMSO (+, with 0 ng/mL of EGF) or Mock (+).

124

3.3.8 CS suppression of HIV-1 gene expression involves activation of the MEK1/2-ERK1/2 pathway Consistent with reported literature, treatment of HeLa rtTA-HIV(Gag-GFP) cells with CSs activated ERK1/2 (MEK1/2’s target), MAPKAPK-2 (MK-2, p38’s target substrate), p38 (Figs. 3.13a-b), and JNK1/2/3 relative to DMSO (+) controls (Figs. 3.14a-d)103,133,149. To determine whether any MAPK signaling pathway(s) is required for CS inhibition of HIV-1 gene expression, cells were pre-treated with inhibitors of MEK1/2 activity (U0126), p38α/β/β2 MAPK activity (SB203580), or JNK1/2/3 activation (SP600125) and monitored for Gag-GFP expression in the presence/absence of a CS. Each inhibitor was confirmed to block CS-induced activation of specific MAP/MAPK with little/no effect on cell viability (Figs. 3.13c-g). However, only pre- treatment of cells with a MEK1/2 inhibitor (U0126) partially restored HIV-1 gene expression for all CSs tested, with the exception of digitoxigenin (Dtg), relative to controls (no pathway inhibitor and CS, Figs. 3.14e-g). In contrast, inhibition of the other MAPKs (p38 and JNK) had no effect on HIV-1 Gag expression (Figs. 3.14e and g). To confirm this observation, the effect of Selumetinib/AZD6244, another specific inhibitor of MEK1/2 with distinct chemical structure, higher affinity (nM), and even lower selectivity entropy was examined214,215. Pre-treatment of cells with Selumetinib and subsequent addition of CSs (ouabain or digoxin) resulted in a response similar to that of U0126, blocking ERK activation and partially rescuing HIV-1 Gag expression (Figs. 3.15a-c). The possibility that Ras-Raf-MEK1/2 or PI3K-AKT response could be attributed to a secondary effect through ROS (or vice-versa) and subsequent endo/exocytosis of the NKA is unlikely given that we found no noticeable change in the levels of ROS or NKA upon treatment with CSs for 24 h (Figs. 3.16a-c)101,133,152. These data indicate that most CSs tested require, in part, signaling of the Raf-MEK1/2-ERK1/2 pathway to inhibit HIV-1 gene expression with little/no influence from activation of Ca2+ flux, PI3K-AKT, or p38/JNK MAPKs.

125

Figure 3.13. Activation of various MAPKs by CSs can be blocked by specific inhibitors. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a pathway inhibitor overnight (~15 h), treated with

~IC80s of CS, ouabain, or DMSO, Dox induced, and analyzed as described in Fig. 3.14. Activation levels (phospho/total protein) were determined by specific antibodies for phospho- and total-MAP/MAPK proteins, tubulin served as internal loading control and for normalization of these data, and results displayed relative to DMSO (+) control. A MEK1/2 (12 µM U0126), p38α/β/β2 (15 μM SB203580), or JNK1/2/3 (1.25 μM SP600125) inhibitor (black) or no inhibitor (white) were used as indicated. (a, d, f) Graphs quantifying the cellular activation levels of MAPKs (mean, s.e.m.): p38 (a, n ≥ 4), ERK1/2 (shown in Fig. 3.14a), MK-2 (d, downstream target of p38, n ≥ 3-4), and JNK1/2/3 (f, n ≥ 3-6), respectively. (b, c, e, g) Representative immunoblots for each MAP/MAPK above (resp.). Lanes were cropped and assembled from the same blot per box per column from Fig. 3.6e in (c) and from continuous parts assembled from the same blot in (g). (h) Combinations of pathway inhibitor and CSs applied demonstrate little/no change in total cell number as assayed methylene blue stain (n ≥ 3-6, mean, s.e.m.). 126

Figure 3.14. CSs control HIV-1 gene expression through intracellular signaling.

127

HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without pathway inhibitor overnight (~15 h) and treated with

~IC80s of CSs. All results were displayed relative to DMSO (+) with pre-treatment with no pathway inhibitor. (a-c) ERK1/2, MK-2, and JNK1/2/3 are activated upon treatment of cells with CSs (n ≥ 4-6, 3-4, and 3-6, resp., mean, s.e.m.). Graphs quantifying the activation level (phospho/total protein) of each MAP/MAPK by western blot. In (a), the results of pre-treating cells with a MEK1/2 inhibitor (12 μM U0126, MEKi) on ERK1/2 activation is also shown and a representative immunoblot is provided in Fig. 3.13c. (d) Representative immunoblots of MAP/MAPK activation levels from (a-c). (e-g) MEK1/2 activation may be involved in CS inhibition of HIV-1 gene expression. The signaling pathway(s) used by a CS to inhibit HIV-1 expression was determined by detecting Gag-GFP fluorescence in cell lysates (~35 μg) by reducing SDS-PAGE after pre-treatment of cells with a MEK1/2 (12 μM U0126, white), p38α/β/β2 (15 μM SB203580/p38i, gray), or JNK1/2/3 (1.25 μM SP600125/JNKi, hatched) inhibitor (n ≥ 5-7, 4-8, and 3-7, resp., mean, s.e.m.). Results were shown relative to DMSO (+). Tubulin immunoblots serve as internal loading control and for normalization of these data. (e) Graph and (f-g) representative gels of these results. Continuous lanes were cropped and assembled from 2 experiments for (f). Statistical comparisons were performed as illustrated (black/gray dashed lines) and described in Methods. Activity of each pathway inhibitor in cells was verified in (a) and Figs. 3.13c-g. Concentration of pathway inhibitor and CSs applied were predetermined to have little/no impact on total cell density (Fig. 3.13h).

128

Figure 3.15. CSs and anisomycin inhibit HIV-1 gene expression through MEK1/2-ERK1/2 signaling. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a second MEK1/2 inhibitor, Selumetinib (MEKi #2, 5.5 μM), for ~15 h, treated with 27 nM Ouabain, 70 nM Digoxin, 220 nM of Anisomycin, or DMSO, Dox induced, and analyzed as described in Fig. 3.14. Lysates of cells (~20 µg) were resolved on reducing SDS-PAGE to quantify rescue of HIV-1 Gag-GFP expression via detection of GFP fluorescence and gels were immunoblotted by specific antibodies for phospho-ERK1/2 and total-ERK1/2 to determine the levels of ERK activation. Stain-free™ gel staining was used to monitor total protein load and for normalization of these data. (a) Graph quantitating relative Gag-GFP expression in treated cells (n ≥ 3, mean, s.e.m.). (b) Graph showing relative ERK activation in treated cells (n ≥ 3, mean, s.e.m.). (c) Representative gels and immunoblots of (a-b). Results were shown relative to DMSO (+). Statistical comparisons were performed as illustrated (black or grayed dashed lines). Blots in (c) were cropped and assembled from Fig. 3.6f. 129

Figure 3.16. Effect of CSs on ROS production and NKA levels in cells.

HeLa rtTA-HIV(Gag-GFP) cells were treated with ~IC80s of CSs or DMSO for 4 h and viral gene expression induced (+) by Dox for 20 h. (a) Intracellular concentrations of ROS are unaltered upon exposure of cells to CSs (n ≥ 3, mean, s.e.m.). ROS levels in cells treated with CSs were monitored by CellROX® Deep Red labeling (as described in Methods) and results graphed. (b-c) CS treatment of cells cause little to no change in levels of NKA (n ≥ 3, mean, s.e.m.). The amount of NKA in cell lysates were monitored by western blot using specific antibodies to the NKA with α-tubulin served as internal loading control and for normalization of this data. (b) Graph quantitating the levels of NKA. (c) Representative immunoblot of (b). Results are displayed relative to DMSO (+) control. Statistical analyses (a-b) were performed as described in Methods.

130

3.3.9 Activation of the MEK1/2-ERK1/2 pathway by anisomycin suppresses HIV-1 gene expression Given the possible role of MEK1/2-ERK1/2 signal activation in CSs modulation of HIV-1 gene expression, we explored whether anisomycin, a known activator of this pathway, could elicit a similar effect208,209. Addition of anisomycin to HeLa rtTA-HIV(Gag-GFP) cells inhibited HIV-1 Gag expression (Figs. 3.17a-c, 3.15a and c), activated ERK1/2 (Figs. 3.15b-c, 3.17d, 3.18a), and altered viral RNA accumulation (Fig. 3.17e). Furthermore, as with CSs, inhibition of HIV-1 Gag expression by anisomycin was partially reversed upon pre-treatment with either U0126 (Figs. 3.17a-b, 3.18b) or Selumetinib (Figs. 3.15a and c), but not inhibitors of p38/JNK MAPKs or NCX (Figs. 3.17a and c, 3.18c). The concentration of anisomycin (220 nM) used had little to no effect on nascent protein synthesis or cell density used in these assays (Figs. 3.18b and d).

131

Figure 3.17. Activation of the MEK1/2-ERK1/2 signaling pathway suppresses HIV-1 gene expression. (a-e) HeLa rtTA-HIV(Gag-GFP) cells were pre-treated overnight (~15 h) with/without an inhibitor of MEK1/2 (12 μM U0126, MEKi, white), p38α/β/β2 (15 μM SB203580, p38i, light gray), JNK1/2/3 (1.25 μM SP600125, JNKi, hatched), or NCX (5 μM KB-R7943, NCXi, gray) and treated with a MEK1/2-ERK1/2 activator, anisomycin, to isolate the pathway signal as described (and run in parallel for verification of inhibitor activity) in Figs. 3.10d-f and 3.14. Cells were monitored for changes in HIV-1 gene expression by detecting Gag-GFP fluorescence in cell lysates (35 μg) resolved on reducing SDS-PAGE, levels of ERK activation by immunoblotting of phospho- and total-ERK from cell lysates, and extent of viral RNA expression by RT-qPCR of mRNAs extracted. Results were displayed relative to DMSO (+) with pre-treatment with no pathway inhibitor. Statistical comparisons were performed as illustrated (black/gray dashed lines) and described in Methods. (a) Graph and (b-c and Fig. 3.18c) representative gels of results on HIV-1 Gag-GFP expression (n ≥ 5, mean, s.e.m.). (d) Graph of ERK activation levels in the presence/absence of MEKi and anisomycin (n ≥ 5, mean, s.e.m.). Gels were run simultaneously and assembled from the same experiment. Representative immunoblot of these results is shown in Fig. 3.18a. Stain-free™ total protein staining serves as internal loading control and for normalization of data in (a-d). (e) Graph of the accumulation of US, SS, and MS HIV-1 RNAs (n ≥ 3, mean, s.e.m.). Concentrations of MEKi and anisomycin applied in these experiments were predetermined to have little/no impact on total cell density (Fig. 3.18b).

132

Figure 3.18. Role of anisomycin signaling on the inhibition of HIV-1 gene expression and protein synthesis. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without either a MEK1/2 (12 μM U0126), MEK1 (5.5 μM Selumetinib), or JNK1/2/3 (1.25 μM SP600125, JNKi) pathway inhibitor overnight (~15 h) or NCX inhibitor (5 μM KB-R7943, NCXi) for ~2 h, treated with anisomycin (220 nM), cycloheximide (100 µg/mL), or DMSO for ~4 h, Dox induced for 20 h, and analyzed per Figs. 3.17a-e. The cellular signal used by anisomycin to inhibit HIV-1 gene expression was determined by assaying for rescue of Gag-GFP expression/fluorescence in cell lysates (~35 μg) resolved on SDS-PAGE. Effects on ERK1/2 activation were quantified by immunoblots of phospho- and total- ERK1/2 and newly synthesized proteins were quantitated by SUnSET by immunoblots of puromycin-labeled proteins. The activity of each pathway inhibitor was confirmed and run in parallel with experiments in Fig. 3.13. Stain-free™ labeled total protein or tubulin were used as internal loading controls and for normalization of these data. Results are displayed relative to DMSO (+) control. (a) Representative immunoblot displaying ERK1/2 activation levels in treated cells (representative of n ≥ 4-5). Graph of results in (a) are found in Fig. 3.17d. (b) Graph of cell density after drug treatments assayed by methylene blue stain (n ≥ 4-5, mean, s.e.m.). (c) Representative gel of Gag-GFP expression in treated cells (representative of n ≥ 3). Lanes in (c) were cropped and assembled from same gel/blots from Fig. 3.6g. (d) Representative gel of Gag-GFP expression and blot of nascent synthesized

133

proteins in cells treated with anisomycin in duplicate (representative of n ≥ 3). The translation inhibitor cycloheximide was added as a control.

3.4 Discussion

The possibility of repurposing drugs already used in humans as novel therapeutics for the control of HIV-1 infection is highly attractive. Our findings agree with a recent study which identified multiple CSs as inhibitors of HIV-1 expression211,216. Our study confirms that ≥5 of the reported hits and 7 additional CSs suppress HIV-1 gene expression in transformed cells [HeLa and CD4+ SUPT1s, Figs. 3.1 (or 3.2) and 3.8] and HIV replication in primary CD4+ PBMCs from HIV- infected clinical patients (Fig. 3.4) at low to single-digit nanomolar concentrations without cytotoxicity (summarized in Table 3.1)104,109,131,196,217. The low concentration of CSs required to suppress viral replication in PBMCs (Table 3.1 or Fig. 3.4) suggests that these drugs could be 104 used to treat HIV-1 at doses below those recommended for heart conditions . Digitoxin (IC50: ~1.3 nM) requires 15-26 fold lower concentrations to inhibit viral replication in HIV-infected PBMCs than the recommended serum concentration in patients treated for heart conditions (20- 34 nM), a substantial improvement over digoxin (which required a 2-6 fold lower dose)104,111,218. Although RIDK-34 and digitoxigenin are not in clinical use, they displayed at least ~1.5 fold better approximate ex vivo TI than their FDA-approved counterparts (Table 3.1). In addition, ouabain (used in Europe), bufalin or cinobufagin (used in the traditional Chinese medicine Chansu), and convallatoxin, respectively, have 1.8, 9, 1.9, and 3.8 fold better anti-HIV-1 activity as well as 1.2, 9, 2.3, and 6.8 fold better in vitro TIs than digoxin in our cell based assays (Table 3.1). These results indicate that many CSs that are not in clinical use may have better TIs for controlling HIV infection than for treating heart conditions and may be worth further investigation as HIV inhibitors.

134

Table 3.1. Comparison of the in vitro (IVTI) and ex vivo therapeutic indices (EVTIs) of CSs and their impact on the expression of essential HIV-1 proteins.

Notes:

Data for CC20, CC50, and IC50s for each drug/compound were estimated from dose response curves in Figs. 2.3, 3.1- 3.2, 3.4, 3.8, and 3.19104. ">" means the estimate has not been accurately determined but is greater than the highest concentration tested. "( )" indicates preliminary data that was not shown. a CC20 instead of CC50 was estimated from dose response curves and used for calculation of IVTIs. b Cells were treated at ~IC90of a CS.

135

Figure 3.19. Estimation of the approximate ex vivo TIs of four CSs. ex vivo TIs were calculated from CC50/IC50 from day 14 of culture of HIV infected PBMCs (from clinical patients) treated with CSs. CC50s were estimated/extrapolated from data points by their trends (dashed arrows) from XTT CA assays of cell viability (gray circles) and their inferred near maximal IC50s estimated from results on HIV-1 p24 (Gag) production (black circles) from Figs. 3.4f-h and some data points published on digoxin [Wong et al. (2013). PLoS Pathog. 9(3), e1003241]. This data is summarized in Table 3.1.

Although very low doses of CSs were sufficient to inhibit HIV-1 replication in PBMCs, it should be noted that much higher concentrations were necessary in the assays using transformed cell lines (HeLa and SUPT1). While such differences might reflect the transformed nature of these cell lines (i.e. altered cell signaling), the enhanced activity of CSs in the context of primary cells could be attributed to the expansion of the infection. In addition to altering viral RNA processing (Fig. 3.7b-c, Fig. 3.8e) and inducing intracellular signaling (Figs. 3.10, 3.13-3.15), all CSs decreased p14 Tat (and digitoxigenin/RIDK-34 also affect p16 Tat, Figs. 5c-d) and, in the case of digoxin-like CSs, reduce Rev expression (Fig. 3.5b)104. While Tat is not required in the HIV-1 HeLa system used in this study, its essential role for viral transcription in the context of wild-type HIV would magnify the effect of CSs on viral growth (Fig. 3.4)26,32,104. The effect of

136

CSs on Tat and Rev (Figs. 3.5b-d) and incompletely-spliced viral RNAs (oversplicing, Fig. 3.7b) would also lead to reduced availability of genomic HIV-1 RNAs for packaging into viral particles (Fig. 3.7c). Although CSs have also been reported to block HIV entry at high doses (4.2 µM), there is no data on whether similar effects are observed at the low nanomolar concentrations used here219. On the other hand, a recent report revealed that digoxin, can also inhibit HIV-1 infection by affecting sites of provirus integration220. Consequently, in the context of PBMCs (Fig. 3.4) and in vivo, where multiple rounds of viral replication would occur, synergy between effects at multiple different stages of HIV replication would greatly enhance the antiviral effects of CSs. Consistent with data in previous reports, this study supports the hypothesis that CSs elicit their effect on HIV-1 gene expression (Figs. 3.1, 3.9-3.10, and 3.13-3.15) through binding to the 116,131 2+ NKA (modeled in Fig. 3.20) . Although CS addition increased intracellular [Ca ]i (Fig. 3.10d), treatment with the NCX inhibitor KB-R7943 did not reverse the CS suppression of HIV- 1 gene expression (Figs. 3.10e-f and 3.11). These results indicate that modulation of intracellular Ca2+ is not required for the antiviral effect of CSs but this does not fully rule out a role for Ca2+ signaling in vivo or in prolonged cultures of HIV-infected PBMCs (2-3 weeks, Fig. 3.4) during which time an amplification of a CS effect could potentially occur. MAPK activation may 2+ require a rise in [Ca ]i and vice-versa since both pathways are linked via a positive feed-back cycle (Fig. 3.20)221. It is unlikely that the antiviral effect of CSs is due to inotropy or Ca2+ signaling amplified via a “plasmERosome” mechanism (described by Blaustein that requires NKA α2/3 subunits)131,145,146 since HeLa and PBMCs express no/limited amounts of NKA α2 or α3 isoforms required for this response (Fig. 3.9)222,223. Supporting this hypothesis, the concentration of CS required to suppress HIV-1 gene expression in SUPT1s (Fig. 3.8b), which does express the α3 isoform (Fig. 3.9c), was higher, not lower than those used in the HeLa cell line that does not express this subunit (Fig. 3.1 or 3.2; summarized in Table 3.1)104. Our data is consistent with CS inhibition of HIV expression/replication being independent of drug-induced changes in intracellular Ca2+ (Figs. 3.10d-f and 3.11) that are responsible for the toxicity/arrhythmias of these drugs in patients116,206,212.

137

Figure 3.20. Model depicting the suggested signaling pathway modulated by CSs to suppress HIV-1 gene expression. Although all CSs tested induce intracellular Ca2+ flux/signaling as well as PI3K-AKT and JNK/p38 MAPK signaling via activation of the NKA signalosome (gray), this study supports the hypothesis that CSs inhibit HIV-1 gene expression in part through MEK1/2-ERK1/2 signaling (black) and accomplish this response independently of NCX-mediated Ca2+ influx responsible for potential Ca2+ overload (gray) and toxicity in patients.

Although previous work has determined that CSs can have multiple effects on cells depending on the concentrations used103,111,196,224,225, CSs or anisomycin reduction of HIV-1 gene expression can be partially reversed only by inhibition of MEK1/2-ERK1/2 signaling (by either of two highly specific and distinct inhibitors, Figs. 3.14e-f, 3.15) and is independent of PI3K- AKT (Figs. 3.10g, 3.12b-c) or p38/JNK MAPK activation (Figs. 3.14b-g, 3.13a-b and d- g)214,215. Likewise, depletion of the NKA α subunit (Figs. 3.10a-c), presumed to activate Src, inhibits HIV-1 gene expression. Each of these modulations (CSs, anisomycin, and shRNA

138

depletion of NKA) altered HIV-1 RNA accumulation, with NKA depletion being the most similar to the response induced by CSs (Figs. 3.7b, 3.10c, and 3.17e). This data indicates that activation of the Src-EFGR-Ras-Raf-MEK1/2-ERK1/2 pathway contributes to the suppression of HIV-1 replication by CSs. Stimulation of the Ras-Raf-MEK1/2 pathway could relay signals to the nucleus via activation of ERK1/2, which has ≥200 substrates151,226. The successful use of CSs (modeled in Fig. 3.20) for the treatment of cancers in which the EGFR-Ras-Raf pathway is activated suggests that the anti-cancer and antiviral activity of this class of compounds may be very similar (Figs. 3.14a and d-f, 3.13c, 3.15a-c)109,131,196,227. Our data support the hypothesis that, at low nM concentrations, CSs modulate viral RNA processing to inhibit expression of an integrated HIV-1 provirus (Figs. 3.1-3.2, 3.5, and 3.7-3.8). CSs reduce HIV-1 US and SS RNA accumulation (Figs. 3.7b and 3.8e), resulting in decreased synthesis of vital HIV-1 structural (Gag/Env, Fig. 3.5a and also Figs. 3.2, 3.4, and 3.8b) and regulatory proteins (p14 Tat, and sometimes, p16 Tat and/or Rev, Figs. 3.5b-d and 3.8c-d) necessary for new virion assembly, propagation, and infection. CSs also alter host alternative RNA splicing, affecting 1681 splicing events (~20.6% of 8,175 analyzed) in cells treated with digitoxin (q-value = 0, sepscore ≥ 1.0)188. However, while all CSs induced similar alterations in HIV-1 RNA accumulation, they differed dramatically in their effect on Rev expression. While digoxin-like CSs reduce Rev accumulation (necessary for facilitating US/SS RNA export), digitoxin-like compounds have little/no effect (Fig. 3.5b). Since the changes in Rev or p16 Tat accumulation (Figs. 3.5b-d) cannot be directly correlated with alterations in HIV-1 MS RNA abundance, the differences are likely due to effects at the level of translation or protein stability. Despite significant levels of Rev being expressed and retaining its ability to shuttle (see Fig. 3.21), we observed little or no accumulation of viral US RNAs in the cytoplasm upon addition of digitoxin-like CSs (Figs. 3.7c). This observation suggests that the reduced accumulation of HIV-1 US RNAs in the cytoplasm is the result of decreased accessibility of viral RNAs for Rev interaction as a consequence of enhanced viral RNA splicing (Fig. 3.7b, Fig. 3.8e). In support of this hypothesis, almost all CSs tested induce modification of SRp20/SRSF3 (similar to digoxin hyperphosphorylation, the exception being digitoxigenin, Fig. 3.7d) whose overexpression results in similar alterations in HIV-1 RNA accumulation as described for digoxin104.

139

Figure 3.21. CSs do not alter the subcellular localization or transport function of HIV-1 Rev. HeLa cells stably transfected with a constitutively active Rev were treated with CS (50 nM of digitoxin or ouabain) or with DMSO (control, not shown) overnight and observed in the presence (+) or absence of 4 mg/mL Act. D (reported to cause cytoplasmic localization of Rev) added 2 hours prior to harvest. Cells were fixed, permeabilized, and Rev was immunolocalized by rabbit anti-Rev antibody and FITC/Cy5-conjugated anti-rabbit IgG antibodies as previously described. Cells were stained with DAPI to detect nuclei. Images were acquired at 400x magnification. Results are representative of n ≥ 2. Experimental details were performed as previously described in Wong et al. (2013). Nucleic Acids Res. 41(20), 9471–9483.

140

Together, our findings support the concept of using CSs as novel ARTs for controlling HIV infection and suggest that they might have a similar or better TI for treating HIV infection than heart conditions (Table 3.1). The results also demonstrate that modulation of the NKA signalosome, particularly events involving MEK1/2-ERK1/2 activation, lead to suppression of HIV-1 gene expression (Fig. 3.20). Consequently, more refined modulation of the appropriate signaling pathways could serve as an alternative approach to control HIV-1 infection and bypass the cardiotoxic effects of CSs attributed to changes in intracellular Ca2+ (Fig. 3.20).

3.5 Methods 3.5.1 Dose response of drugs on HIV-1 gene expression Drug/compounds were tested for effects on HIV-1 gene expression using inducible Tet-ON HIV- 1 cell lines [HeLa rtTA-HIV-ΔMls or rtTA-HIV(Gag-GFP)] containing a HIV-1 (LAI) provirus activatable by Dox or tetracycline transactivator (tTA)86. The rtTA-HIV-ΔMls provirus was modified and used as previously reported56,83,94,104. The rtTA-HIV(Gag-GFP) provirus was generated by deletion of the PR and RT coding regions within pol and insertion of GFP to the 3’ of gag, creating GFP fused to the C-terminal of Gag. After 4 h of drug/compound treatment, HIV-1 gene expression was activated with Dox (2 μg/mL) or tTA (described below). Equal concentrations of DMSO were present in each experiment. After ~20 h, cells and media were harvested to monitor the effects of drug/compound treatments as described below. HIV-1 gene expression was quantified via p24CA ELISA or monitoring Gag-GFP fluorescence in cells as described below. In parallel, cell viability of treatments were assessed by XTT assay (Sigma- Aldrich, #TOX2). For confirmatory tests, the CD4+ HIV-1 T-cell line, 24ST1NLESG, from J. Dougherty, was treated with drug/compounds and HIV-1 gene expression activated by 1.8 µM of phorbol 12-myristate 13-acetate (PMA) as previously described94,104,228. The approximate concentrations of CSs used in experiments in HeLa rtTA-HIV-ΔMls or rtTA-HIV(Gag-GFP) cells were as follows: ~IC80s: 90 nM digoxin, 40 nM digitoxin, 500 nM digitoxigenin, 20 nM RIDK-34, 36 nM ouabain, 800 nM digoxigenin, 11 nM bufalin, 40 nM cinobufagin, and 400 nM lanatoside C; ~IC50s: 45 nM, digoxin, 20 nM digitoxin, 25 nM lanatoside C, 25 nM ouabain, 12 nM RIDK-34, and 165 nM digitoxigenin; and ~IC90s: 95 nM digoxin, 45 nM digitoxin, 500 nM digitoxigenin, 25 nM RIDK-34, 40 nM ouabain, 800 nM digoxigenin, 15 nM bufalin, and 40 nM cinobufagin. Drug/compounds were purchased from

141

Sigma (Digoxin, #D6003; Digitoxin, #D5878; Digoxigenin, #D9026; Digitoxigenin, #D9404; Ouabain, #O3125; Bufalin, #S961175; Cinobufagin, #C1272; and Anisomycin, #A9789) and derivatives of convallatoxin were synthesized from C. Lingwood's lab of the Hospital for Sick Children (convallatoxin, peruvoside, RIDK-34, -36, -20, -21, -27, and -28). Nucleoside analog reverse-transcriptase inhibitor, Lamivudine (3TC), was obtained from the NIH AIDS Reagent Program (#8146). Recombinant human EGF was from Invitrogen (#PHG0314). Chemical structures were drawn in ChemSketch (ACD/Labs).

3.5.2 Ethics statement Experimental procedures were performed on PBMCs, obtained with written informed consent from volunteer blood donors, in accordance with relevant guidelines and regulations which were reviewed and approved by the University of Toronto Research Ethics Board.

3.5.3 Assaying viral growth in HIV infected PBMCs Human PBMCs were obtained for experiments from drug-naïve HIV-infected patients, depleted of CD8+ T cells using Dynabeads CD8 (Invitrogen, #111.47D), activated with anti-CD3 and anti- CD28 antibodies, and treated as previously described and above94,104. PBMCs were then seeded to 24-well plates in the presence/absence of indicated drug/compounds (0.5 mL final) which were pre-diluted in RPMI+++ in the same manner as described above. Every 3-4 days, ~0.25 mL of media was harvested for assays and replenished with ~0.25 mL of fresh medium with drug/compound and 20 U/mL of IL-2. HIV growth in cultures was monitored by p24CA ELISA of cell supernatants harvested (detailed below) and the effect of compounds on cell viability were monitored by XTT assay.

3.5.4 Analysis of the expression of HIV-1 and host cellular proteins 3.5.4.1 Immunological quantification of viral and host proteins To monitor HIV-1 gene expression or replication, Gag release into cell culture supernatants were assayed by ELISA using a p24CA antigen capture assay kit (AIDS & Cancer Virus Program, NCI-Frederick, Frederick, MD USA). Media harvested from HIV clinical isolates were diluted ~10 fold (or as necessary) prior to performing this assay. For analysis of HIV-1 and SR protein expression (and phosphorylation states with calf intestinal alkaline phosphatase treatments), cells

142

were lysed and analyzed by western blot as previously outlined104. Phosphatase inhibitors (e.g. 10 mM sodium fluoride, 2 mM sodium orthovanadate) were added to solutions requiring phospho protein analyses. An anti-chicken NKA antibody (α6F, #a6F-c, Developmental Studies Hybridoma Bank, The University of Iowa, contributed by Douglas M. Fambrough, The Johns Hopkins University) was used as specified to detect NKA α1- and β1-subunits across species. Antibodies specific to respective phospho- and total-MAPK/MAP proteins for ERK1/2, JNK1/2/3, p38α/β/γ/δ, and MAPKAPK-2 were from Cell Signaling Technology (#9106, 9102, 9255, 9252, 9211, 9212, 3007, and 3042, resp.). Activation of MAPKs was determined by western blot quantitation and calculation of phospho/total protein levels. Clarity (Bio-Rad, #170- 5060) or Western Lightning ECL reagent (Perkin-Elmer, #NEL101) were used for detection of signals from blots bound with HRP-conjugated antibodies and captured by either X-ray film or Bio-Rad ChemiDoc™ MP System as previously described83. Unsaturated protein bands in immunoblots/SDS-PAGEs were quantitated by ImageLab, normalized to internal loading controls (α-tubulin, GAPDH, or Stain-Free™ labeled total protein), and displayed relative to DMSO (+Dox). Stain-Free™ gels were casted and proteins were detected as described in 10% TGX-Stain-Free FastCast Acrylamide Kit from Bio-Rad (#161-0183). Images were exported as TIF files for assembly, rotation, and equal brightness/contrast adjustments in ImageJ or Microsoft Powerpoint. Some lanes were cropped and rearranged from the same blot/gel as indicated. In representative gel/blot sets, samples were electrophoresed from the same experiment as controls, resolved simultaneously on identically cast gel(s), transferred to same PVDF (by either wet electrophoretic or by Bio-Rad Trans-Blot® Turbo Transfer System), and detected at same time. Marked locations of molecular weight (MW) standards are shown on the left as a reference. DMSO (+) vs. (-) demonstrate successful activation of viral gene expression by Dox in all assays.

3.5.4.2 SUnSET analysis of total cellular protein synthesis229 HeLa rtTA-HIV-ΔMls cells were cultured in the presence/absence of compound and pathway inhibitor (if any) and Dox induced for ~24 h as already described, then treated with puromycin (10 μg/mL, Sigma-Aldrich, #P8833) for 30 min to label nascent proteins prior to harvest. As control, 10 µM of cycloheximide (Sigma-Aldrich, #C4849) was added to some cells prior to puromycin treatment. Cells were subsequently washed, whole cell lysates prepared, and proteins

143

quantified by western blot using an anti-puromycin antibody (EMD Millipore, #anti-12D10) as described above.

3.5.4.3 Transfection of plasmid DNA into cells Transfection of pCMV6-HA-AKT-1 (WT, KM, or Myr) or CMV myc and with CMV tTA pA and CMV PLAP plasmids into HeLa rtTA-HIV-ΔMls cells were performed by polyethylene imine (PEI) transfection as previously described83,104. Transfections in each experiment contained equal amounts of DNA and performed in Opti-MEM (Invitrogen, #31985070). An anti-HA antibody from Abcam (16B12, #ab130275) was for detection of HA-tagged proteins. Depletion of NKA α subunits. shRNAs in pLKO-TRC005 targeting the NKA α1 subunit (ATP1A1) were prepared by transfection of plasmid DNA [with pLKO-TRC005 with ATP1A1 (E6 or E10), PAX-2, and VSV-G] into 293T cells as described above. Resulting cell supernatants containing shRNAs packaged into pseudotyped lentiviruses were harvested for gene silencing experiments. ATP1A1 E6 and E10 shRNAs were targeted towards the NKA α1 subunit coding sequence (5’-GCCTTTCAGAACGCCTATTTG-3’) and 3’-UTR (5’- GTGTACTTCAGTCTTGGAGTT-3’), respectively. For experiments, HeLa rtTA-HIV(Gag- GFP) cells were seeded 1 d prior, transduced overnight with a NKA α1 shRNA supernatant with 8 µg/mL polybrene, selected with 1 µg/mL of puromycin for ~3 d, viral gene expression induced by Dox for ~20 h, and cells harvested for analyses.

3.5.5 Determining the effect of drug/compounds on HIV-1 RNA processing and host gene expression 3.5.5.1 Quantitation of HIV-1 and cellular mRNA expression RNA was extracted from cells, reverse transcribed, and resulting cDNAs subject to qRT-PCR quantification of HIV-1 mRNAs as previously described except reactions used iTaq™ Universal SYBR® Green Supermix (Bio-Rad, #172-5120) run on a Bio-Rad CFX384 Touch™ Real-Time PCR Detection System and analyzed with CFX Manager™83. NKA α1, 2, and 3 subunits were detected by published primers, amplified by iTaq using the same cycling temperature and times previously described for HIV-1 US/MS cDNAs except α1, 2, and 3 annealing temperatures were 61oC83,230. All data was normalized to β-actin as internal loading control. Primers sequences for NKA α subunits were as follows: α1 forward (5’-AGTACACGGCAGTGATCTAAAGG -3’), α1 reverse (5’- CAGTCACAGCCACGATAGCAC -3’), α2 forward (5’- 144

GGAGATGCAAGATGCCTTTCA-3’), α2 reverse (5’-GCTCATCCGTGTCGAATTTGA-3’), α3 forward (5’-GACCTCATTTGACAAGAGTTCGC-3’), and α3 reverse (5’- GGGCAGACTCAGACGCATC-3’).

3.5.5.2 Monitoring the subcellular localization of HIV-1 genomic RNA HeLa rtTA-HIV(Gag-GFP) cells were seeded on cover slips, treated with drug/compound, and processed for FISH to detect HIV-1 US RNAs using Stellaris™ probes (Biosearch Technologies) as previously detailed94,104.

3.5.6 Analysis of cell signaling pathways Using the same methods and conditions described for HeLa rtTA-HIV-ΔMls cells, HeLa rtTA- HIV(Gag-GFP) cells were seeded in 48-/12-well plates and pretreated with/without pathway inhibitor prior to treatment with drug/compounds and Dox. Equal concentrations of DMSO were present in each experiment. HIV-1 gene expression was determined by detecting Gag-GFP fluorescence in cells by plate scans using a Typhoon Imager 9400 (Amersham Biosciences) or Typhoon FLA 9400 (GE) on ImageQuant, cell lysates by SDS-PAGE captured on ChemiDoc MP, or cell lysates by p24CA ELISA. Before quantification, cells were washed with warm PBS and either scanned live (and harvested for protein analyses) or fixed in 3.7% paraformaldehyde/formaldehyde-PBS for subsequent analyses. Data from cell scans and SDS- PAGEs were quantitated using ImageJ and Image Lab software, respectively. To determine which pathway signal was used by a CS to inhibit HIV-1 gene expression, cells treated with CS were pre-treated with a specific pathway inhibitor and monitored for recovery of Gag-GFP expression. Pathway inhibitors were purchased from Sigma (BAPTA-AM, #A1076-25MG; U0126, #U120-1MG; SP600125, #S5567-10MG; SB203580, #S8307-1MG), Abcam (KB- R7943, #ab120284), BioShop (U0126, #U0U237.5), Millipore/Calbiochem (LY294002, #440204), or Selleckchem (Selumetinib/AZD6244, #S1008). In parallel, the cell viability of each pathway inhibitor and CS treatment combination were monitored by cell density staining of fixed cells with 2% methylene blue (BioBasic, #MB0342) in 50% ethanol and read at OD664 on a TECAN Infinite® 200 PRO or Biotek Cytation5. Pathways activated by CSs were monitored by 2+ western blot as described above. Changes in [Ca ]i and ROS, respectively, were monitored by loading live cells with Fura Red™ AM (Life Technologies, #F-3020) or CellROX® Deep Red

145

Reagent (Life Technologies, #C10422) as outlined by the manufacturer and read as described for Gag-GFP above.

3.5.7 Determining the in vitro and ex vivo TIs of CSs

Without median toxic dose (TD50) and half-maximal effective concentration (EC50) data available to calculate TIs (in vivo) from HIV patients treated with CSs, we determined the following TIs for each cell type treated with a CS (summarized in Table 3.1): in vitro TIs from

HeLa rtTA-HIV-ΔMls cells using CC20/IC50 (instead of CC50/IC50), in vitro TIs from

24ST1NLESG cells using CC50/IC50, and ex vivo TIs from HIV-infected PBMCs using CC50/IC50

(at day 14 of culture approximated from available cell viability trends for CC50s of Fig. 3.19 and inferred near maximal IC50s).

3.5.8 Statistical analyses Data was analyzed in Microsoft Excel and expressed as means ± standard error of the mean (s.e.m.). Differences between two groups of data, i.e. drug/compound treatment vs. control (DMSO +Dox/HIV/PMA/tTA) or shRNA vs. control (stuffer +Dox), were compared by Student’s t-test (two-tailed). In cell signaling experiment graphs, cells pre-treated with no pathway inhibitor and CS were compared to those with no pathway inhibitor and DMSO (+) as illustrated (black dashed lines) whereas cells pre-treated with a pathway inhibitor and CS within a treatment set were compared to those with no pathway inhibitor and the CS within the same set (gray dashed lines). Statistical significance in results are indicated on graphs for each p value as follows: p < 0.05, *; p < 0.01, **; and p < 0.001, ***; unless otherwise noted.

146

3.5.9 Inter-chapter Transition Although some members of the CS family of drugs are federally approved for clinical usage, their low TIs in treating people with heart conditions imposes many challenges116,206,207, including impeding potential clinical trials with these drugs. The negative properties of these drug/compounds include accidental induction of toxicity to people, which can result in cardiac arrhythmias from excessive CS concentration in the serum of patients116,131. Increased Ca2+ oscillations from the sarco-/endoplasmic reticulum can relay diverse responses to the nucleus, particularly impacting alternative splicing of RNAs in the cell. This is supported by a recent demonstration that the CG digitoxin alters ~21% of AS events in cells treated with this drug (communicated from Anderson et al., 2012) and digoxin differentially regulates the expression of 557 genes188,220. Furthermore, CSs can activate over five different intracellular signals (Fig. 1.11), especially stress-activated MAPKs, p38 and JNK, and the release of ROS in various cell types99–103. P38 plays a special role in the activation, proliferation, and inflammation of cells but is also activated upon HIV-1 infection via Env (via interactions with CCR5/CXCR4 and CD4), Nef, and Tat which help promote viral replication231,232. However, HIV-1-induced hyper- activation of p38 can lead to cellular exhaustion and apoptosis232. Similarly, JNK is a critical intermediate in immune system signaling and, also, influences a handful of transcription factors (i.e. c-Jun which is involved in apoptosis and oncogenic transformation), regulators of protein turnover, mitochondrial anti-/pro-apoptotic proteins, scaffold and adaptor proteins, and protein kinases233. As noted for p38, JNK is activated after infection by various different microbes233. Some cellular consequences from JNK activation include altered gene expression, proliferation, apoptosis, and viral replication and progeny release233. Production of ROS, which may occur in some cell types (other than HeLa cells), can influence many responses, including activation of stress-activated MAPKs and BMK/ERK5, genomic instability, cellular senescence and apoptosis, and other cellular effects (see Chapter 1.9.4)152,153. Each response activated by CSs, especially prolonged signaling of stress-activated MAPKs, are likely to have a negative impact on the host cell. Identification of alternative compounds which can activate MEK1/2-ERK1/2 signaling, without inducing negative response signals, could lead to a HIV-1 RNA processing modulator(s) with improved inhibitor profile over CSs.

147

4 Suppression of HIV-1 and adenovirus replication

by small molecule alteration of RNA processing

Author contributions 1. Raymond W. Wong wrote and edited the paper; conceived, designed, and performed the experiments and analyzed the data for Figs. 4.1a-d, 4.2a-d, 4.4a-c, 4.5a-c, 4.6a and d-g, 4.12a-b, 4.13a-i, 4.14a-c, 4.15a-d, 4.16, 4.17a-c, 4.18a-b, 4.19-4.20, and 4.22a-e, Table 4.1, and contributed to figure/tables in collaboration with others as follows: Figs. 4.4b (co-contributed data with AB), 4.4d-g and Tables 4.1-4.2 (co-prepped for publication, analyzed data), 4.5b-c (co-contributed data with AB, prepped for publication), 4.7a (isolated and coordinated RNAs for PS’s RT-PCR analysis and prepped Table 4.4 for publication), 4.7b (isolated and coordinated RNAs for PS’s RT-PCR), and 4.11a and d-g [prepped each figure for publication as follows: 4.11a (replotted data, determined IC50, stat analysis), 4.11d (replotted data, stats analysis), 4.11e (created figure), 4.11f (regraphed data), and 4.11g (regraphed data, stats analysis)].

2. Ahalya Balachandran performed experiments and analyzed data for Figs. 4.1e-f, 4.8, 4.9 (uncropped blots in Figs. 4.6b-c), and 4.10, and contributed to figure/tables in collaboration with others as follows: 4.4d-g (isolated and coordinated RNA for QP’s RNA-Seq analysis, co-prepped for publication), 4.4b (co-contributed data with RWW), 4.5b-c (co-contributed data with RWW), 4.7a (labeled figure), and 4.7b (plotted data).

3. Filomena Grosso performed experiments and analyzed data for Figs. 4.11a-d and g.

4. Peter Stoilov contributed new reagents or analytic tools, performed experiments and analyzed data for Figs. Figs. 4.7a (RT-PCR and plotted data), 4.7b (RT-PCR), and 4.11 e-f (RT-PCR) and Table 4.4 (RT-PCR).

5. Qun Pan performed experiments and analyzed data for Figs. 4.4d (RNA-Seq) and 4.7a (RNA-Seq) and Tables 4.2 and 4.3.

6. Benjamin J. Blencowe contributed new reagents or analytic tools (RNA-Seq).

7. Peter Cheung performed experiments and analyzed data for Figs. 4.1g and 4.3.

8. P. Richard Harrigan contributed new reagents or analytic tools (Resistant HIV strains).

9. Martha Brown contributed new reagents or analytic tools (Adenovirus).

10. Mario A. Ostrowski contributed new reagents or analytic tools (HIV-infected PBMCs from a patient).

11. Alan Cochrane supervised the study; wrote and edited the paper; conceived and designed experiments and analyzed data for study; contributed Figs. 4.5b (gel electrophoresis of RT-PCR) and 4.21.

Acknowledgements We thank M. Ohh and Y. Kano for N-Ras plasmids, people providing blood for medical research, Scott Gray-Owen lab for PBMCs, and Dr. Alex T.Y. Chen for training A.B. in BaL infections of PBMCs. This work was supported by a Canadian Institutes of Health Research (CIHR) Operating Grant to A.C. (HOP-134065), CIHR Doctoral Award – Frederick Banting and Charles Best Canada Graduate Scholarship to R.W.W., and Ontario Graduate Scholarship Award to A.B.

148

4.1 Abstract

RNA processing plays a central role in the gene expression of eukaryotic cells and many mammalian viruses. By exploiting this dependency, we discovered a modulator of RNA processing, 5342191 (N-[4-chloro-3-(trifluoromethyl)phenyl]-7-nitro-2,1,3-benzoxadiazol-4- amine), as a potent inhibitor of both HIV-1 (including drug-resistant strains) and Adenovirus replication. 5342191 dramatically reduces expression of HIV-1 structural [IC50 (Gag): 750 nM] and regulatory protein/polyproteins, which are associated with alterations in viral RNA accumulation and transport, with little perturbation of host total protein synthesis, gene expression (<0.5% of 11,406 genes), and RNA splicing (<0.3% of 9,806 events). Inhibition of

Adenovirus replication (IC50: 900 nM) is associated with blockages in DNA replication and subsequent late gene expression. Consistent with altering RNA processing, the levels of phospho-serine/arginine-rich splicing factors are changed. Inhibition of HIV-1 expression by 5342191 requires activation of the Ras-Raf-MEK1/2-ERK1/2 pathway involving stimulation of G protein coupled receptors at the cell membrane. Supporting these hypotheses, overexpression of variants of the small G protein, Ras, lead to inhibition of HIV-1 gene expression. These findings reveal the potential for a future drug to suppress multiple viral infections by influencing a common cellular function (RNA processing), with limited side effects to the host, and suggests alternative cellular targets for therapeutic intervention.

4.2 Introduction

Alternative RNA splicing has allowed mammalian cells to significantly increase the coding potential of their genomes; in the case of humans, over 90% of genes are alternatively spliced (AS)234,235. Multiple mammalian viruses also exploit RNA splicing to increase the coding potential of their genomes, overcoming the physical restriction placed on their genome size by the virion capsid29,51,236–242. The dependency of these viruses on a common cellular process raises the possibility of developing novel strategies to inhibit multiple virus types with a single agent30,243. Indeed, recent work by several groups has demonstrated that viral dependency on RNA splicing can be exploited to develop novel small molecules that alter RNA processing pathways to significantly impair viral replication with limited effects on cell viability or host RNA splicing, particularly with regard to HIV-183,89,94,104,181.

149

Both Adenovirus and HIV-1 are critically dependent on alternative RNA splicing for their replication32,236,244. In HIV-1 infected cells, RNA polymerase II generates a single transcript from the integrated provirus that is subsequently processed into >40 mRNAs to allow expression of nine encoded viral protein/polyproteins (Fig. 2.1)32. Perturbation of this process through mutation of cis regulatory elements or altered expression of trans-acting splicing factors can dramatically alter the gene expression and replication of HIV-132. In Adenovirus, viral transcription is driven from five early promoters (E1A, E1B, E2, E3, and E4) and one major late promoter (MLP)236,244 with transcripts processed into multiple mRNAs through AS/polyadenylation in cells, to ultimately express all proteins essential for genome replication and formation of new virions245. In this report, we outline the ability of 5342191, identified from an assay for SMN2 splicing modulators, to suppress replication of both HIV-1 and Adenovirus associated with the modulation of RNA processing. In the context of HIV-1, suppression of viral replication by 5342191 is correlated with a dramatic decrease in expression of viral structural (Gag/Env) and regulatory (Tat/Rev) proteins. Although loss in Gag and Env expression could be attributed to decreases in unspliced (US) and single spliced (SS) viral RNAs and sequestration of viral US RNAs in the nucleus (due to absence of Rev-mediated export), levels of multiply spliced (MS) mRNAs encoding both Tat and Rev were unaffected. After determining that 5342191 treatment has no detectable effect on nascent protein synthesis in the cell, we observed that Tat expression could be restored by addition of a proteasome inhibitor. This suggests that 5342191 is selectively affecting production or degradation of at least the regulatory factor Tat, and not total protein synthesis of the cell. In parallel, treatment of Adenovirus infected cells with 5342191 led to a 1000 fold reduction in viral yield. However, 5342191 treatment did not impact the expression of the immediate early protein, E1A, indicating that genome delivery of the virus into the nucleus and initiation of viral transcription is not affected. Addition of 5342191 resulted in a 100 fold reduction in viral DNA amplification and a failure to induce expression of a late viral protein, hexon. Consistent with alterations in RNA processing, 5342191 changed the accumulation of AS isoforms of E1A mRNA and blocked expression of all late viral protein-encoding mRNAs tested (100K, fiber, hexon, and penton base). Despite the dramatic alterations in viral RNA accumulation and protein expression induced by 5342191, RNA-Seq analysis determined that this compound has limited effects on host gene expression, affecting the AS of only 0.7% of cellular genes (by ≥10% of 9,806 events) assayed 150

and the mRNA abundance of only 0.5% of cellular genes (by ≥2 fold from 11,406 genes) analyzed. In exploring the basis for the observed responses, 5342191 was found to activate multiple signaling cascades including mitogen-activated protein (MAP) kinases (MAPKs): extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 MAPK’s target substrate, MAPK-Activated Protein Kinase (MAPKAPK-2/MK-2). However, only modulation of the MEK1/2-ERK1/2 pathway by this compound contributes to inhibition of HIV- 1 gene expression. This hypothesis is supported by the fact that other activators of the MEK1/2- ERK1/2 pathway [i.e. anisomycin and cardiotonic steroids (CSs) in Wong, R. W., Lingwood, C., Ostrowski, M. A., Cabral, T., and Cochrane, A. Sci Rep (Accepted Nov. 7, 2017)] also lead to suppression of HIV-1 gene expression. Unlike CSs, but consistent with activating similar effectors, we determined that 5342191 achieves its anti-HIV-1 inhibitory response through G protein coupled receptor (GPCR) signaling at the cell membrane without inducing Ca2+ flux (responsible for the toxicity of CSs). Further supporting our hypothesis, overexpression of several variants of the small G protein, Ras, achieved a similar response as 5342191 on inhibiting HIV-1 expression. This study identifies 5342191 as a novel small molecule which can suppress the replication of HIV-1 and Adenovirus (and possibly other RNA splicing-dependent viruses) by disrupting viral RNA processing. These results highlight the cornerstone of a new strategy in controlling multiple viral infections through targeting a common cellular process, with possibly limited side effects to the host, and provide new cellular targets for potential therapeutic intervention.

4.3 Results 4.3.1 5342191 inhibits expression of HIV-1 structural and regulatory proteins To identify small molecule modulators of RNA splicing, a high throughput screen for compounds affecting SMN2 exon 7 inclusion was performed using the Chembridge library (P. Stoilov, unpublished data). Compounds identified were subsequently evaluated for their effect on HIV-1 gene expression using a HeLa cell line stably transduced with a Tet-ON HIV-1 LAI provirus (HeLa HIV-rtTA-ΔMls) whose expression is dependent on the addition of doxycycline (Dox)86. Compound 5342191 (Fig. 4.1a) strongly inhibits HIV-1 gene expression in a dose- dependent manner (IC50: 750 nM) reaching an IC90 of 1.75 µM (Fig. 4.1b) with no discernible effects on cell viability. Evaluation of 5342191 treatment of a CD4+ T cell line stably transduced

151

with a NL4-3-derived HIV-1 provirus (24ST1NLESG) demonstrated similar dose-dependent inhibition of HIV-1 gene expression (IC50: 750 nM, Figs. 4.2a-b). The capacity of 5342191 to inhibit HIV-1 expression in both HeLa and CD4+ T cell lines suggests a conserved inhibitory mechanism.

152

Figure 4.1. Identification of 5342191 as a potent inhibitor of HIV-1 replication. (a-d) 5342191 inhibits HIV-1 gene expression in a dose-dependent manner and blocks accumulation of vital HIV-1 structural and regulatory proteins (n ≥ 4-6, mean, s.e.m.). HeLa rtTA-HIV-ΔMls cells were treated with 2 μM or indicated concentrations of 5342191 (a, chemical structure) or DMSO (control) for 4 h prior to Dox (+) activation of viral expression. After 24 h, cell supernatants were harvested for (b) p24CA ELISA of HIV-1 (Gag) gene expression (black diamonds) and XTT assay of cell viability (gray circles, adjacent y-axis) while (c-d) cell lysates were analyzed by immunoblot for expression of HIV-1 structural proteins (c), Gag (polyprotein/p55, MA-CA/p41, CA/p24) and Env (gp160/gp120), and regulatory factors (d), Rev (p19) and Tat (p16/p14). GAPDH/α-tubulin served as internal loading controls. Lanes were cropped and assembled from the same blots in (c-d). (e-f) 5342191 suppresses HIV-1 replication in Bal-infected CD4+ PBMCs (n ≥ 3, mean, s.e.m.). Supernatants of PBMCs treated with indicated concentrations of 5342191 (191, green diamonds), DMSO (black circles), or AZT (3.7 μM, red boxes) were harvested for p24CA ELISA to determine (f) their dose-response on HIV-1 replication (red circles) and cell viability (gray boxes, adjacent y-axis) at day 8 and (e) HIV-1 growth from 0-8 d. (g) 5342191 blocks replication of drug-resistant HIV strains (Table 4.1, n ≥ 3, mean, s.e.m.). Viral replication (red, quantified from GFP by flow cytometry) and cell viability (gray, assayed by Guava ViaCount) were monitored after 3 days in CEM-GXR cells infected with WT or drug-resistant HIV and treated with 0.15, 0.3, 0.6, 1.25, 2.5, and 5 µM of 5342191 (gradient bar). Dashed lines (e-g) mark 100% cell viability (top) or IC50s (bottom). Statistical comparisons were performed per Methods.

153

Figure 4.2. 5342191 alters HIV-1 RNA processing in HIV-1-infected CD4+ T cells. 24ST1NLESG T cells were treated with ~4 μM or indicated concentrations of 5342191 or DMSO for 4 h and viral gene expression induced by addition of PMA. After 24 h, media or cells were harvested for analyses. (a) Schematic diagram of the 24ST1NLESG cell line containing a modified HIV-1 proviral genome, NLE-S-G (a pNL4-3 strain), stably integrated in the human acute lymphoblastic lymphoma T-cell line, SupT1. (b) Dose-dependent inhibition of HIV-1 gene expression by 5342191 in the natural context of infected T cells (n ≥ 4, mean, s.e.m.). HIV-1 Gag expression was assayed by p24CA ELISA of supernatants (black circles) and cell viability assayed by XTT (gray circles, adjacent y-axis). (c-d) 5342191 induces oversplicing of HIV-1 RNAs in T cells (n ≥ 3, mean, s.e.m.). Total mRNA was extracted from treated cells, reverse transcribed, analyzed by qRT-PCR. (c) Diagram of the HIV-1 genome and the position of primers used (solid arrow heads indicate start while dashed arrows demark the extended range of exons covered). (d) Graph of the abundance of each HIV-1 mRNA class displayed relative to DMSO (+) control.

154

To define the basis for the response to 5342191 treatment, expression of HIV-1 structural and regulatory proteins were evaluated in the context of HeLa rtTA-HIV-ΔMls cells. Western blot analysis (Fig. 1C) demonstrated that 5342191 dramatically suppresses expression of HIV-1 structural proteins, Gag polyprotein (p55), matrix (MA)-capsid (CA, p41), and CA (p24) and Env polyprotein (gp160) and processed product (gp120). In addition, 5342191 treatment causes depletion of both viral regulatory factors (Fig. 4.1d), Rev and Tat (p16/p14, described in Fig. 2.1), which are necessary for the nuclear export of incompletely-spliced (US/SS) HIV-1 RNAs47,175 and activation of viral transcription, respectively246. These results [and data on its impact on HIV-1 RNA and serine/arginine (SR)-rich proteins described below] are in marked contrast to other RNA processing inhibitors previously identified by our group, suggesting a novel mechanism of action83,94,95,104.

4.3.2 5342191 suppresses the replication of wild-type and drug-resistant strains of HIV To assess whether 5342191 is an effective inhibitor of replication competent HIV-1 in their natural context of primary CD4+ T cells, peripheral blood mononuclear cells (PBMCs) were activated, infected with HIV-1 Bal, and viral expansion monitored in the presence or absence of compound (Figs. 4.1e-f). Dose-response curves with 5342191 demonstrated dose-dependent inhibition of HIV-1 replication (IC50: 1.8 μM) reaching an IC90 of 4.8 μM with little impact on cell viability at doses up to 3 µM (Fig. 4.1e). Compared to control (DMSO) treated cells, addition of 3 μM of 5342191 resulted in a ~2.2 fold reduction in viral growth (Fig. 4.1f). The compound was not only effective in suppressing replication of wild-type (WT) HIV strains within clades A and B but also representative strains resistant to each of the four classes of anti- HIV-1 inhibitors (Table 4.1) that target viral enzymes [reverse transcriptase (RT), protease (PR), and integrase (IN), Fig. 4.1g] and entry [co-receptor (CCR5), Fig. 4.3]91. The ability of 5342191 to inhibit replication of both WT and drug-resistant strains of HIV suggests that it could prove useful in treatments after ART failure or in combination with existing drugs.

155

Table 4.1. Acquired HIV-1 mutations associated with resistance to anti-HIV-1 drugs.

*Abbreviations of drug names: Efavirenz (EFV), Nevirapine (NVP), Lamivudine (3TC), Abacavir (ABC), Azidothymidine (AZT), Atazanavir (ATV), Lopinavir (LPV), Raltegravir (RAL), Elvitegravir (EVG), Dolutegravir (DTG), and Maraviroc (MVC). Information was derived from Cheung et al. (2016)91.

Figure 4.3. 5342191 blocks infection of an entry drug-resistant HIV strain. Viral replication/infection (red, quantified from GFP by flow cytometry) and cell viability (gray, assayed by Guava ViaCount) were monitored after 3 days in CEM-GXR cells infected with Maraviroc (MVC)-resistant (res.) HIV strain (described in Table 4.1) and treated with 0.15, 0.3, 0.6, 1.25, 2.5, and 5 µM of 5342191 (n ≥ 2, mean, s.e.m.). Results were displayed relative to DMSO (0 μM). Experiments were done in parallel with WT and other drug- resistant HIV strains shown in Fig. 4.1g.

156

4.3.3 HIV-1 RNA processing is altered by 5342191 qRT-PCR analysis of HIV-1 RNA accumulation in HeLa rtTA-HIV-ΔMls cells (Figs. 4.4a-b) showed that 5342191 induces moderate oversplicing of viral RNAs, shifting the equilibrium from unspliced to spliced RNAs; reducing both US and SS mRNAs by ~60% but increasing MS mRNAs by 140% relative to controls. In CD4+ T cells (24ST1NLESG), 5342191 exhibits a similar and more pronounced effect on HIV-1 RNAs, reducing US and SS mRNAs by ~83% and increasing MS mRNA by 300% relative to controls (Figs. 4.2c-d). However, the changes in viral RNA levels only partially account for the effect of 5342191 on the expression of HIV-1 structural (Gag/Env) and regulatory (p14 Tat) proteins (Figs. 4.1b-g). Fluorescent in situ hybridization (FISH) analysis was performed in parallel to monitor HIV-1 genomic/US RNA subcellular distribution (Fig. 4.4c). In contrast to control cells with extensive signal for US RNAs in both the cytoplasm and nuclear foci, HeLa rtTA-HIV(Gag- GFP) cells treated with 5342191 had drastically reduced cytoplasmic accumulation of US RNAs but retained residual signal in the nucleus (similar results observed in HeLa rtTA-HIV-ΔMls cells, data not shown). These results indicate that 5342191 alters not only HIV-1 US RNA accumulation but also its movement to the cytoplasm, consistent with its impact on Rev expression. Whereas reduced Gag expression reflects changes in HIV-1 US RNA accumulation and subcellular distribution, reduced expression of both Tat and Rev upon 5342191 addition (Fig. 4.1d) contrasts with increased levels of HIV-1 MS RNAs (Fig. 4.4b). RT-PCR analysis of splice site usage within MS RNAs from HeLa rtTA-HIV-ΔMls cells (Figs. 4.5a-c) demonstrated no apparent changes in accumulation of the various MS RNAs that could account for the reduction in Tat and Rev levels in 5342191 treated cells.

157

Figure 4.4. 5342191 alters HIV-1 RNA processing with little perturbation of host alternative RNA splicing and gene expression.

158

HeLa rtTA-HIV-ΔMls cells were treated with 2 μM of 5342191 or DMSO and Dox induced per Fig. 4.1b-d). (a-b) HIV-1 RNAs were quantitated by qRT-PCR and expression was displayed relative to DMSO (+). (a) Diagram of the HIV-1 genome and the position of primers used (solid arrow heads indicate start while dashed arrows demark the extended range of exons covered). (b) Graph of the expression of US (gray), SS (white), and MS (black) HIV-1 RNAs (n ≥ 3, mean, s.e.m.). (c) 5342191 blocks nuclear export of HIV-1 US RNAs (representative of n ≥ 3). Distribution of US RNAs (Texas Red) in HeLa rtTA-HIV(Gag-GFP) cells treated with 5342191 or DMSO were detected by FISH. Nuclei were stained by DAPI, Gag expression visualized by GFP, and images captured at 630x magnification. (d-g) RNA-Seq quantitating the levels of AS in RNAs (mean percent spliced in, PSI) and DE genes of cells treated with 5342191 or DMSO from 9,806 exon inclusion/exclusion events (circles) and 11,406 genes expressed (mean fold change), respectively, from poly(A)+ RNA extracted, reverse transcribed, and sequenced. (d-e, g) Calculation of the level of PSIs between 5342191 and DMSO with significant changes in PSIs (PSIs, p < 0.05) indicated on plots (see Table 4.2) and tables as follows: <10% (black circles), ≥10% (yellow circles), and ≥20% (red circles). (d) Plot of PSIs between 5342191 (y-axis) and DMSO (x-axis) samples to display differences in AS of cellular RNAs. (e-g) Tabulation of (e) the total AS events changed, (f) total DE genes changed ≥2-10 fold (see Table 4.3), and (g) Venn diagram comparing the number of DE and AS genes (≥10% PSI) affected from (e) and (f), respectively.

159

Table 4.2. RNA-Seq dataset presenting the genes with significant changes in alternative splicing in cells treated with 5342191.

Notes: A total of 339 genes are listed demonstrating a significant change in alternative splicing from 9,806 exon inclusion/exclusion events (mean PSIs, p < 0.05) quantified by RNA-Seq of RNA from cells treated with 5342191 or DMSO, with those significantly altered ≥10% highlighted (light orange).

160

Table 4.3. RNA-Seq dataset displaying the significant changes in gene expression in cells treated with 5342191.

Notes: A total of 540 genes are listed having a significant change in gene expression (mean fold change, p < 0.05) from 11,406 genes quantitated by RNA-Seq of RNA from cells treated with 5342191 or DMSO, with those ≥2 or ≤0.5 fold change highlighted (light orange). 161

Figure 4.5. Effect of 5342191 on splice site usage of HIV-1 MS pre-mRNAs. (a-c) HeLa rtTA-HIV-ΔMls cells were treated with ~2 μM of 5342191 and cDNAs (from RNAs extracted and reverse-transcribed as described in Fig. 4.5b) were analyzed by RT-PCR of the MS RNA class (n ≥ 3-4, mean, s.e.m.). (a) Illustration indicating the position of primers used for PCR (arrow heads, see Fig. 2.1 for depiction of the products generated). (b) Representative gel and (c) graph of the MS mRNA species amplified from RT-PCR (x-axis) and displayed as a percentage (%) of the total HIV-1 MS mRNAs (y-axis). Lanes in (b) were cropped and assembled from the same blot (Fig. 4.6a).

162

Figure 4.6. Immunoblot/gels used for representative figures. Lanes from continuous and unexcised gel/blots were cropped and rearranged for Figs. 4.5a (a), 4.9a (b), 4.9c (c), 4.12a (d), 4.12b (e), 4.13a and 4.22d (f), and 4.13g (g).

163

4.3.4 5342191 has limited effect on host RNA accumulation and processing Given 5342191-induced changes on HIV-1 RNA accumulation, we explored the effect of this compound on host RNA abundance and processing in HeLa rtTA-HIV-ΔMls cells by both RNA- Seq and RT-PCR. Out of a total of 9,806 exon inclusion/exclusion events quantitated by RNA- Seq (Figs. 4.4d-e and g, Table 4.2), 5342191 treatment of cells for 24 hours altered only 68 (0.69%) and 25 (0.26%) of these AS events by ≥10% and ≥20%, respectively. These findings are consistent with RT-PCR analysis of 70 AS events in cells treated with this compound, demonstrating a high correlation between RNA-Seq and RT-PCR data (r = 0.83, Figs. 4.7a-b, Table 4.4). The subset of alterations induced by 5342191 was well tolerated by the cell as indicated by a lack of cytotoxicity in over 4 different cell lines/types at concentrations tested, especially in prolonged cultures of T cells (Figs. 4.1b, e-f, and g, 4.2b, and 4.8). In addition to changes in RNA processing, 5342191 altered the abundance of only 54 mRNAs (0.46%) by ≥2 fold among 11,406 genes analyzed by RNA-Seq (Fig. 4.4f, Table 4.3). Comparison of 5342191-induced changes in alternative RNA splicing and differentially expressed (DE) genes showed that only one host gene, HYAL3 (Fig. 4.4g), was affected at both levels. Collectively, these results indicate that 5342191 does not act through general perturbation of alternative RNA splicing or gene expression of the host cell but rather through selective effects on a subset of cellular RNAs, sufficient to cause dramatic alterations in HIV-1 RNA processing.

164

Figure 4.7. Compound 5342191 alters a small subset of alternatively spliced cellular RNAs. (a) A total of 70 alternative splicing events were analyzed by RT-PCR of cDNAs from HeLa rtTA-HIV-ΔMls cells treated with 5342191 or DMSO (control) and quantitated by capillary electrophoresis to determine the levels of alternative exon inclusion (PSI; n = 3, mean). To display differences, mean PSIs (white and colored circles) from cells treated with 5342191 (y-axis) were plotted versus cells treated with DMSO (x-axis). Data (PSIs) that were significantly different between 5342191 and DMSO treated cells (p < 0.05) are indicated for events <10% (black circles), ≥10% (red circles), and ≥20% (yellow circles, and labeled by gene identity). All exon and genes used in this analysis are listed in Table 4.2. (b) RT-PCR results in (a) correlate with RNA-Seq data (Fig. 4.4d) for quantifying changes in alternative splicing (PSIs) of cells treated with 5342191. A graph of 17 overlapping alternative RNA splicing changes (PSIs between cells treated with 5342191 and DMSO) from RT-PCR analysis (x-axis, Table 4.4) and RNA-Seq (y-axis, Fig. 4.4d and Table 4.2) were compared (r = 0.83).

165

Table 4.4. RT-PCR dataset showing the genes with significant differences in alternative splicing in cells treated with 5342191.

Notes: A total of 70 alternative splicing events are shown from amplification by RT-PCR of RNA from cells treated with 5342191 or DMSO (control) to quantitate the level of alternative exon inclusions per gene (PSI, n = 3, mean, S.D.). PSIs were averaged (avg) from each treatment and differences between 5342191 and DMSO (Diff or PSI) were calculated as shown (or their PSIs plotted to view differences in Fig. 4.7a, white/colored circle data). PSIs significantly different between treatments (p < 0.05) were highlighted in red/pink (or as colored circles in Fig. 4.7a). Location of the exon and genes assayed are listed on the left. 166

Figure 4.8. Changes in cell viability after exposure of HeLa cervical carcinoma cells to 5342191. HeLa rtTA-HIV-ΔMls cells were treated with 2 μM of 5342191 (191, purple diamonds) or DMSO (control, black circles) over 4 days and cell viability monitored by XTT assay at days indicated (n ≥ 3, mean, s.e.m.).

4.3.5 Effect of 5342191 on the synthesis and degradation of HIV-1 and cellular proteins Having ruled out changes in HIV-1 MS RNA abundance or splicing that could account for the effect of 5342191 on Tat and Rev expression, we examined the impact of 5342191 on total protein synthesis and degradation of viral regulatory factors. Using the surface sensing of translation (SUnSET) technique229, immunoblot analysis of nascent protein synthesis determined that 5342191 treatment resulted in low to no changes in the rate of new protein production compared to control (Figs. 4.9a-b). Furthermore, 5342191 addition to cells resulted in no measurable change in Tat’s rate of degradation (Figs. 4.10a-c). Conversely, addition of the proteasome inhibitor MG132 resulted in partial rescue of both Tat isoforms compared to cells treated with control (DMSO with MG132, Figs. 4.9c-d). In contrast, MG132 addition did not restore Gag expression in the presence of 5342191. These results indicate that Tat synthesis does occur in the presence of 5342191 and its degradation is mediated by the host proteasome.

167

Figure 4.9. Effect of 5342191 on cellular protein synthesis and degradation state of HIV-1 proteins. HeLa rtTA-HIV-ΔMls cells were treated with 5342191 or DMSO. (a-b) Nascent protein synthesis in cells was monitored by SUnSET by labeling all newly synthesized proteins at the end of experiments using puromycin and then harvested for quantitation by western blot with an anti-puromycin antibody (n ≥ 3, mean, s.e.m.). (a) Representative immunoblot and (b) graph of these collective results displayed relative to DMSO (+) control. The translation inhibitor, cycloheximide (CHX), and absence of puromycin labeling were added as controls. (c-d) 5342191 effect on HIV-1 transactivator of transcription (Tat) factor (n ≥ 3, mean, s.e.m.). Cells were treated with 5342191 or DMSO, Dox induced (24 h), and a proteasome inhibitor (MG132) added 8 h prior to harvest. Lysates were analyzed by immunoblot of p16 (light blue) and p14 Tat (dark blue) or HIV-1 CA (p24 Gag, red). (c) Representative immunoblot and (d) graph of these results displayed relative to DMSO (+) control. Lanes (a, c) were cropped and assembled from the same blots (Figs. 4.6b and c, resp.). Statistical comparisons were performed as illustrated (black/gray dashed lines) and detailed in Methods. 168

Figure 4.10. Decay rate of HIV-1 Tat in cells treated with 5342191. HeLa rtTA-HIV-ΔMls cells were Dox induced for 24 h, then treated with 2 μM of 5342191 or DMSO (control) in the presence of 10 μM of cycloheximide, and the half-life of Tat in cell lysates monitored over a course of 8 h. MG132 (10 μM) was added to the last set (8 h) to assess Tat degradation upon inhibition of the proteasome. (a) Representative immunoblots and (b-c) graphs quantitating p16 (a-b) and p14 Tat levels (a, c) in 5342191 and DMSO treated cells relative to 0 h of treatment (n ≥ 3, mean, s.e.m.). GAPDH serves as internal loading control and for normalization of these data.

169

4.3.6 5342191 suppresses Adenovirus replication The ability of 5342191 to alter HIV-1 RNA accumulation raised the question as to whether it might inhibit other mammalian viruses dependent on RNA splicing for their replication. As shown (Fig. 4.11a), 5 µM of 5342191 reduced the yield of Adenovirus C5 (HAdV-C5, IC50: 900 nM) by 1000 fold when added at the end of the virus absorption period. While 5342191 had no effect on the levels of the immediate early protein, E1A (Fig. 4.11b), it suppressed the major capsid protein, hexon, to levels below detection by western blot (Fig. 4.11c). Therefore, this compound does not appear to affect delivery of the viral genome to the nucleus or initiation of viral gene expression. Reduced hexon expression (Fig. 4.11c), on the other hand, suggests a block in genome replication, an event essential for late gene expression247,248. In exploring this hypothesis, we determined that 5342191 reduces Adenovirus DNA levels ~100 fold (Fig. 4.11d), supporting interference of one or more steps prior to the onset of genome replication. Analysis of E1A transcripts revealed that 5342191 also induced a change in the relative accumulation of its different RNA isoforms compared to DMSO controls (Fig. 4.11e-f). At 8 h post infection (p.i.), there was an increased proportion of 13S RNAs at the expense of 12S whereas 9S variants were unaffected. By 24 h p.i., however, both 13S and 12S RNAs represented <3% of the total E1A mRNAs (nearly all were 9S) in DMSO-treated cells but, in 5342191-treated cells, they accounted for over 20% and 10% of these respective E1A RNAs (at the cost of 9S). Consistent with disruptions in viral DNA replication and hexon expression, relative levels of mRNAs encoding four late viral genes (110K, fiber, hexon, and penton base, Fig. 4.11g) were expressed at ≤5% of control levels at 24 h p.i.

170

Figure 4.11. Suppression of Adenovirus replication by 5342191 results in blocked viral DNA replication and late gene expression. 171

A549 cells were infected with HAdV-C5 for 1 h then inoculum was removed and replaced with culture media containing indicated concentrations of 5342191 (191) or DMSO. (a) Adenovirus titer (in millions on log-10 scale) was determined from cells and media collected 24 h p.i. for titration of progeny virus on HEK293 cells containing 5342191 (n ≥ 3, mean, s.e.m.). (b, c) Immunoblots of Adenovirus E1A (b) and hexon (c) proteins in cell lysates collected at 8 h (E1A) or 24 h (hexon) p.i. Tubulin/GAPDH served as internal loading controls. Lanes in (b-c) were cropped and assembled from the same blots. (d) Adenoviral DNA levels (in thousands on log-10 scale) were determined by qPCR analysis of cells harvested 20 h p.i. after incubation with 10 µM of 5342191 or DMSO (n ≥ 3, mean, s.e.m.). (e-f) Analysis of E1A RNA expression by RT-PCR of RNAs isolated 8 h and 24 h p.i. (e) Representative acrylamide gel electrophoresis and (f) graph of the relative abundance of different E1A mRNA isoforms amplified (13S, 12S, and 9S, green) and displayed as a fraction of their total (n ≥ 3, mean, s.e.m.). MW standards were run in each lane (red). (g) Effect of treatments on the late gene expression of 100K, fiber, hexon, and penton assayed by qRT-PCR of RNAs isolated from cells at 24 h p.i. Results in (a-g) are relative to DMSO treated cells. Statistical comparisons were performed by comparison of samples to cells with DMSO (0 μM) and virus (+) per isoform/protein indicated as described in Methods.

4.3.7 A subset of SR splicing factors are modulated by 5342191 Since 5342191 alters processing of both HIV-1 and Adenovirus RNAs, it may be inducing changes to host splicing factors which regulate RNA splicing. Analysis of cellular SR proteins using a pan phospho-SR protein antibody (1H4, Fig. 4.12a) demonstrated that 5342191 treatment of cells increased the level of two phospho-SR proteins within the molecular weight (MW) range of SRp30 (a, b, and c) and 9G8. Conversely, 5342191 decreased the level of four phospho-SR proteins: one migrating below SRp75, one below SRp55, and one within SRp30 to 9G8 range, and SRp20. However, 5342191 has the opposite effect as digoxin on SRp20, decreasing its modification (comparing ratio of phosphorylated/dephosphorylated species, Fig. 4.12b)104. Differences in the modification of SR proteins and expression/degradation of HIV-1 structural and regulatory proteins from other modulators of HIV-1 RNA processing confirms that 5342191 inhibits viral expression via a novel mechanism of action83,94,104.

172

Figure 4.12. Effect of 5342191 on the modification of SR proteins. HeLa rtTA-HIV-ΔMls cells were treated with ~2 μM 5342191 or DMSO and Dox induced (per Figs. 4.1b-d). Cell lysates were analyzed for changes in SR protein expression/modification by immunoblot with antibodies specific for pan phospho-SR proteins (1H4, a) or SRp20 (b) and representative of n ≥ 4 and 3, respectively. Tubulin serves as internal loading control for these data. Indicated are molecular weight (MW) markers (left), SR proteins detected (right), and different protein species detected (arrows). For protein lysates resolved in (a), increases and decreases in phospho-SR protein species are indicated by black and gray arrows, respectively. Lanes (a-b) were cropped and assembled from the same blot per box (Figs. 4.6d-e, resp.).

173

4.3.8 Compound 5342191 modulation of HIV-1 gene expression involves activation of MAPK signaling CSs, such as digoxin, interact with the Na+/K+-ATPase on the cell surface101,116,131,179,206, 2+ 2+ 179,206,249 resulting in increased free intracellular Ca concentration ([Ca ]i) and activation of phosphatidylinositol-3-kinase (PI3K)-AKT and ERK, JNK, and p38 MAPK signaling250,251. Given that some of the 5342191-induced alterations in viral RNA processing are similar to those observed following treatment with digoxin (see Chapter 3)104,106, it is possible that 5342191 acts through modulation of similar signaling pathways. Consistent with this hypothesis, we observed that 5342191 activates ERK1/2 (target of MEK1/2), MAPKAPK-2 (target of p38), and JNK1/2/3 (Figs. 4.13a-e) as well as suppress HIV-1 gene expression over a similar time course as digoxin (~4 h, Fig. 4.16)94,104. In contrast to the CS ouabain, 5342191 did not increase intracellular 2+ [Ca ]i relative to DMSO control (Fig. 4.13f). These results suggest that 5342191 may inhibit HIV-1 gene expression by a MAPK-based mechanism in a mode different from CSs. To assess which, if any, of the 5342191-induced changes in signaling mediate its effect on HIV-1 gene expression, HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with inhibitors of specific pathways, prior to addition of 5342191 and Dox, then monitored for recovery of Gag- GFP expression. Cells pre-treated with inhibitors of MEK1/2 (U0126), p38α/β/β2 (SB203580), or JNK1/2/3 (SP600125), a chelator of intracellular Ca2+ (BAPTA-AM), or inhibitor of Ca2+ influx via the Na+/Ca+-exchanger (NCX, KB-R7943) were confirmed to block ouabain- or 2+ 5342191-induced activation of each MAP/MAPK and [Ca ]i influx (Fig. 4.13b and 4.14a, Chapter 3) without altering relative cell density (Figs. 4.15b and d). Pre-treatment with U0126, but not other MAPK or Ca2+ influx inhibitors, partially rescued HIV-1 gene expression (47%) in cells treated with 5342191 compared to control (no pathway inhibitor and 5342191, Figs. 4.13g- h and 4.15a and c). Consistent with the response to U0126 (with at least one other target kinase reported)252, pre-treatment of cells with the most selective (higher affinity and lower selectivity entropy) inhibitor of MEK1/2 activity (Selumetinib/AZD6244) resulted in nearly complete rescue of HIV-1 gene expression (77% of DMSO-treated samples) (Figs. 4.13e and i and 4.14b- c)214. In support of this finding, other activators of MEK1/2-ERK1/2 signaling (anisomycin and CSs) also suppress HIV-1 gene expression (Chapter 3).

174

Figure 4.13. 5342191 inhibits HIV-1 gene expression via Raf-MEK1/2-ERK1/2 signaling.

175

HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a pathway inhibitor for times specified prior to addition of 5342191 and Dox as follows: (a-i) MEK1/2 (12 μM U0126, MEKi), p38α/β/β2 (15 μM SB203580, p38i), or JNK1/2/3 (1.25 μM SP600125, JNKi) inhibitor overnight (~15 h), (f-h) intracellular Ca2+ chelator (5 µM BAPTA-AM, [Ca2+]i) or NCX Ca2+ influx inhibitor (5 μM KB-R7943, NCXi) for ~3 h, or (e, i) a different MEK1/2 inhibitor (~5 μM Selumetinib, MEKi #2) overnight (~15 h). All results are displayed relative to DMSO (+) and pre- treatment with no pathway inhibitor. Tubulin immunoblots served as internal loading control and for normalization of these data. (a-e) MAP/MAPK are activated upon treatment of cells with 5342191. (a) Representative immunoblots and (b-e) graphs of collective results quantifying the activation level (phospho/total protein) of ERK1/2 (target of MEK1/2), MAPKAPK-2 (MK-2, target of p38 MAPK), or JNK1/2/3 by western blot (n ≥ 4-5, mean, s.e.m.). In (b and e), cells were also pre-treated with/without a MEK1/2 inhibitor (12 μM U0126/MEKi or ~5 μM Selumetinib/MEKi #2) and their representative immunoblots provided in Figs. 4.14a-b. (f-i) MEK1/2-ERK1/2

2+ activation but not [Ca ]i flux is necessary for 5342191 suppression of HIV-1 expression. The signaling pathway(s) used by a CS to inhibit HIV-1 gene expression was determined by detecting Gag-GFP fluorescence in cell lysates (~35 μg) by reducing SDS-PAGE (and initially in plates of live/fixed cells, Figs. 4.15a-d) after pre-treatment of

2+ cells with a pathway inhibitor and 5342191. (f) Levels of [Ca ]i measured by Fura Red AM™ (n ≥ 4, mean, s.e.m.). 2+ Ouabain was used as a positive activator of [Ca ]i flux. Representative SDS-PAGE gels (g and Fig. 4.15c) and graphs (h-i, resp.) quantitating relative Gag-GFP expression in cell lysates (n ≥ 3-4, mean, s.e.m.). Lanes in (a, g) were cropped and assembled from the same blots (Figs. 4.6fand g, resp.). Statistical comparisons (b-f, h-i) were performed as illustrated (black/gray dashed lines) and described in Methods. Treatment concentrations of each pathway inhibitor with/without 5342191 were verified for activity on MAP/MAPKs in cells in (b, e-f, and Figs. 4.14a-b) and for limited impact on total cell density (Figs. 4.15b and d) as well as run in parallel with CS experiments [Wong, R. W., Lingwood, C., Ostrowski, M. A., Cabral, T., and Cochrane, A. Sci Rep (Accepted Nov. 7, 2017)].

176

Figure 4.14. 5342191 suppresses HIV-1 gene expression through MEK1/2-ERK1/2 activation. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a pathway inhibitor [overnight ~15 h for U0126/Selumetinib (Sel.) and ~3 h for BIM-46187], prior to addition of 5342191 (1.9 μM) or DMSO (control) and Dox, as described and analyzed in Fig. 4.13. The signaling pathway(s) used by 5342191 to inhibit HIV-1 gene expression was determined by detecting Gag-GFP fluorescence in plates of live/fixed cells after pre-treatment of cells with an inhibitor of MEK1/2 [U0126 (a) or Sel. (b-c)] or pan Gα subunits [BIM-46187, (b)] and treatment with 5342191. (a-b) Representative immunoblot of the activation level of ERK1/2 in cells pre-treated with/without (a) U0126 (representative of n ≥ 3-4), (b, middle) Selumetinib (representative of n ≥ 3), or (b, right) BIM-46187 (representative of n ≥ 1) and 5342191 which were determined by specific antibodies for phospho- and total-ERK1/2. (c) Representative SDS-PAGE gel presenting the relative Gag-GFP expression in lysates of cells pre-treated with/without Selumetinib (representative of n ≥ 3). Anti-tubulin blots (a) or Stain-Free™ labeled total protein gels (b-c) serve as internal loading controls and for normalization of graphed data (found in Figs. 4.13b, e, and i). Cell lysates in (c) contain 1% BSA (66.5 kDa) added from p24CA ELISA sample diluent. Results are compared relative to DMSO (+). Note that protein load of the Selumetinib sample in (b) were underloaded and do not represent an impact

177

on protein synthesis. Continuous (b-c) and discontinuous lanes (a) were cropped and assembled from the same/simultaneously run gel/blot.

Figure 4.15. 5342191 suppression of HIV-1 gene expression involves MEK1/2-ERK1/2 signaling. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a pathway inhibitor overnight (~15 h), prior to addition of 1.9 μM of 5342191 or DMSO (control) and Dox, as described and analyzed in Fig. 4.13. Signaling pathways activated by 5342191 to inhibit HIV-1 gene expression were determined by assaying cells for (a, c) rescue of Gag-GFP expression [and their impact on cell density monitored by methylene blue stain, (b, d)] from pre- treatment with/without (a-b) an inhibitor of MEK1/2 (12 μM U0126), p38α/β/β2 (15 μM SB203580), or JNK1/2/3 (1.25 μM SP600125) for ~15 h or (c-d) intracellular Ca2+ chelator (5 µM BAPTA-AM) or NCX Ca2+ influx inhibitor (5 μM KB-R7943) for ~3 h (n ≥ 6-10, 6-10, 3-10, and 3, resp., mean, s.e.m.). Results were confirmed by SDS- PAGE analysis of Gag-GFP expression in gels (Figs. 4.13g-h) and the inhibitory activity of each pathway inhibitor 178

was confirmed (Figs. 4.13b and f and 4.14, and/or run in parallel with CS experiments [Wong, R. W., Lingwood, C., Ostrowski, M. A., Cabral, T., and Cochrane, A. Sci Rep (Accepted Nov. 7, 2017)]. Statistical comparisons were performed as illustrated (black or grayed dashed lines).

Figure 4.16. 5342191 inhibition of HIV-1 gene expression requires only 4 h of treatment. HeLa rtTA-HIV(Gag-GFP) cells were treated for 0.5, 1, 4, and 24 h of 5342191 (1.9 μM), or DMSO (control). After indicated time (except 24 h), wells were replaced with fresh media containing equal concentrations of DMSO and Dox. Cells were harvested after 24 h and HIV-1 Gag-GFP expression quantified by detecting GFP fluorescence in cells. Assay was performed in triplicate and results displayed as mean, s.e.m, and shown relative to DMSO (+).

179

4.3.9 Suppression of HIV-1 expression by 5342191 involves initiation of G protein signaling at the cell membrane Since 5342191 activates the MEK1/2-ERK1/2 pathway, we examined whether signaling is initiated upstream of this cascade and if any other pathway(s) known to activate these kinases, is essential for 5342191 inhibition of HIV-1 gene expression. By the same approach described above, cells were pre-treated with inhibitors selective for pan Gα proteins (Gαi), EGFR/ErbB/HER family (EGFRi) of receptor tyrosine kinases (RTKs), Src (Srci), or PI3K (PI3Ki) prior to addition of 5342191 and Dox and then analyzed. ELISA of cell lysates revealed that 5342191 treatment increases the GTPase activity (Raf binding) of Ras relative to control (Fig. 4.17a), suggesting that activation of MEK1/2-ERK1/2 may be dependent on activation of this small G protein. Addition of either Gαi, EGFRi, or Srci, which block signals upstream of small G proteins, were able to block Ras activation. Pre-treatment of cells with any of these signaling inhibitors (which have limited/no effects on cell density) demonstrated low to partial rescue of HIV-1 gene expression with the exception of Gαi, which rescued viral gene expression to levels near those of control (Figs. 4.18a-b). The requirement of 5342191 for each effector and its presumed upstream activator for inhibiting HIV-1 gene expression—activation of Gα subunit(s) via GPCRs, Src via βγ subunit(s), RTKs via transactivation by GPCRs, and PI3K via βγ subunit(s) or RTKs—supports the conclusion that 5342191 triggers GPCR signaling at the cell membrane (Fig. 4.19 and 4.18a-b). In support of this hypothesis, overexpression of WT and oncogenic (12D) N-Ras253 inhibited HIV-1 gene expression (Figs. 4.17b-c). In contrast, the dominant-negative (17N) N-Ras, with reduced GEF activation and Raf binding, demonstrated a 2.5 fold reduction in inhibition of HIV-1 expression compared to WT N-Ras (Figs. 4.17b-c). Moreover, inhibition of HIV-1 gene expression by each N-Ras occurred in a manner correlating with intracellular activation levels of ERK1/2 (Figs. 4.17b-c).

180

Figure 4.17. 5342191 activates G protein signaling to inhibit HIV-1 gene expression via a Ras dependent mechanism. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a pathway inhibitor for ~3 h, prior to addition of 5342191 (1.9 μM) or DMSO (control) and Dox, and equal amounts of cell lysate were analyzed. The signaling pathway(s) used by 5342191 to inhibit HIV-1 gene expression was determined by (a) detecting Ras activation by ELISA of Ras-GTP in cell lysates (~35 μg) after pre-treatment of cells with/without an inhibitor of pan Gα subunits (~10 μM BIM-46187, Gαi), ErbB/HER (120 nM PD158780, EGFRi), or Src (350 nM Herbimycin A, Srci). EGF (20 ng/mL) and thrombin (5 U/mL) were positive signaling controls for EGFR/PI3K/Src and GPCRs/Src, respectively, in Fig. 4.18a. Concentrations of inhibitor and 5342191 were also predetermined to have limited change on cell density (Fig. 4.18b). Results and statistical comparisons were relative/compared to DMSO (+) without pathway inhibitor as illustrated (black/grayed dashed lines) and described in Methods. (a) Graph of relative Ras activity (Rel. RLUs, n ≥ 3, mean, s.e.m.). (b-c) Cells were transfected with WT, oncogenic (12D), or dominant-negative (17N) N-

181

Ras, or empty plasmid (Mock) and HIV-1 expression activated by co-transfection with (+) tTA. After 48 h, cells lysates were analyzed by SDS-PAGE for Gag-GFP expression and immunoblotted by antibodies specific for ERK activation (P-ERK/ERK), N-Ras expression (HA), and tubulin/GAPDH. (b) Representative gel/blots of these results and (c) graph of HIV-1 Gag-GFP expression (n ≥ 3, mean, s.e.m.). Tubulin/GAPDH served as internal loading controls and for normalization of these data.

Figure 4.18. 5342191 inhibits HIV-1 gene expression through activation of G proteins. HeLa rtTA-HIV(Gag-GFP) cells were pre-treated with/without a pathway inhibitor for ~2 h prior to addition of 1.9 μM of 5342191 or DMSO and Dox induced, as described and analyzed in Figs. 4.13 and 4.17a-c. (a) Cell signaling pathways activated by 5342191 to inhibit HIV-1 gene expression were determined by detecting GFP fluorescence in plated cells for rescue of Gag-GFP expression after pre-treatment with DMSO or pan Gα subunit (~10 μM BIM- 46187, Gαi), ErbB/HER (120 nM PD158780, EGFRi), Src (350 nM Herbimycin A, Srci), or PI3K (10 μM LY294002, PI3Ki) inhibitor (n ≥ 4-8, mean, s.e.m.). EGF (50 ng/mL) was added as an activator of EGFR, PI3K, and Src signaling. (b) The impact of inhibitor combinations from (a) on cell density were assayed by methylene blue stain (n ≥ 5-6 and 5, resp., mean, s.e.m.). Inhibition of kinases by each path inhibitor was confirmed in Fig. 4.17a and by monitoring EGF effects in (a). Statistical comparisons were performed as illustrated (black/grayed dashed lines) or to DMSO (+).

182

Figure 4.19. Model of 5342191 inhibition of HIV-1 gene expression through intracellular G protein signaling. 5342191 inhibits HIV-1 gene expression through activation of G proteins near the cell surface and signaling of the Ras-Raf-MEK1/2-ERK1/2 pathway (green). Although JNK and MK-2 are activated by 5342191, these have

2+ limited/no effect on HIV-1 expression (blue), whereas p38, ROS, [Ca ]i flux, and PI3K-AKT signaling have limited/no effect on the virus and are not likely activated by this compound (brown).

183

4.4 Discussion

Development of many antiviral agents have focused on inhibitors that selectively target virus encoded enzymes/proteins (e.g. RT, IN, PR, and Env)26. While this approach has met with success, the rapid evolution of viruses have resulted in the selection of many variants resistant to these agents8,21,24. An alternative approach for an antiviral drug is to target host cell processes essential for virus replication. The potential benefit of this approach include reduced generation of resistant viruses and the possibility of impacting the replication of a number of different viruses whose replication depends on a common cellular factor or process254,255. Such agents could prove valuable for therapeutic use, similar to broad spectrum antibiotics. As a test of this approach, we explored the manipulation of RNA processing by small molecules to identify agents (5342191) that could inhibit replication of different mammalian viruses. RNA splicing requires the coordinated functioning of multiple host proteins and RNAs to allow efficient removal of introns256. Although targeting core components of the splicing process is likely to be lethal, modulation of regulatory factors might not have a severe effect. Multiple host proteins contribute to the regulation of exon inclusion, including the SR or hnRNP family of RNA binding proteins199,257–259, whose function is regulated in a developmental and tissue dependent manner through various signaling networks53. Identification of the splicing regulatory factors essential for replication of multiple viruses could allow for development of active agents against them. As validation of this approach, we identified compound 5342191 as an inhibitor of both HIV-1 (Fig. 4.20) and Adenovirus, two very different viruses that share a common requirement for host RNA processing to replicate. Previously, 5342191 was found to affect microsomal prostaglandin E synthase-1 (mPGES-1) but at concentrations (50 μM causing 71% reduction) well above those required to suppress HIV-1 or Adenovirus (~IC50: 750 and 900 nM, resp., Figs. 4.1b and 4.11a, resp.)260. Consequently, the capacity of 5342191 to modulate RNA processing (Figs. 4.4 and 4.11e-g) is a novel activity unlikely related to its effects on mPGES-1. In context of HIV-1 (Fig. 4.20), 5342191 induced the loss of viral structural (Gag/Env) and regulatory (Tat/Rev) proteins (Figs. 4.1 and 4.2b). Given that both Tat and Rev proteins are critical for HIV-1 replication29, as predicted, 5342191 inhibited the replication of several HIV-1 strains, including ones resistant to existing anti-HIV drugs (Figs. 4.1-4.3), indicating that this compound and/or analogs thereof might prove useful in salvage and/or combinatory therapies17. While reduced structural protein expression can be attributed to reduced abundance and nuclear

184

sequestration of HIV-1 US and SS RNAs, 5342191 had a limited effect on HIV-1 MS RNA levels (Figs. 4.4a-c and 4.2c-d). The partial restoration of Tat levels upon addition of MG132 confirms that Tat mRNA is being translated (Figs. 4.9c-d), suggesting that 5342191 either selectively reduces translation of the RNAs or promotes degradation of these proteins. Measurement of Tat protein degradation with/without 5342191 did not reveal any significant alteration in protein half-life (Fig. 4.10). However, the nature of the experiment does not exclude the possibility that 5342191 induces an activity over time that promotes Tat degradation. The failure of MG132 to elicit a similar restoration of Gag expression (Figs. 4.9c-d) is possibly due to the compound acting to either directly promote viral RNA processing from US to MS RNAs (Figs. 4.4b and 4.2d) or is an indirect effect on US/SS RNA transport (Fig. 4.4c) due to loss of Rev (Fig. 4.1d). Consistent with the latter interpretation, the effect of 5342191 on HIV-1 US, SS, and MS RNA levels is comparable to that of leptomycin B (LB, a Rev-CRM1 inhibitor, Fig. 4.21); LB significantly reduces US and SS RNA accumulation with limited effect on MS RNA abundance261.

185

Figure 4.20. Diagram of the impact of 5342191 on HIV-1 RNA processing and replication. 5342191 (191) decreases accumulation of HIV-1 incompletely-spliced (US/SS) RNAs (progressively-red arrow) and essential regulatory proteins (p16 Tat and Rev), which leads to a complete loss in the expression of vital HIV-1 structural proteins and regulatory factors (Gag, Env, and p14 Tat, gray dashed lines). In at least the case of Tat, 5342191 treatment of cells enhances proteasomal degradation of this factor (black arrows). This new viral RNA processing inhibitor suppresses both HIV-1 and Adenovirus replication and, in the case of HIV-1, blocks expression of four essential viral proteins with limited to no effects on cell viability, nascent protein synthesis, and expression/splicing of host RNAs.

186

Figure 4.21. Treatment of cells with LB blocks expression of US and SS HIV-1 mRNAs. HeLa rtTA-HIV-ΔMls cells were treated with 20 ng/mL of LB and HIV-1 RNAs harvested for quantitation by qRT- PCR of HIV-1 US (white), SS (gray), and MS (black) mRNAs as described in Figs. 4.4a-b and 4.2c-d (n ≥ 3, mean, s.e.m.). Results of each HIV-1 RNA class are shown relative to DMSO (+) control. Statistical comparisons were performed as described in Methods.

The ability of 5342191 to also inhibit Adenovirus replication (Fig. 4.11a) supports the hypothesis that targeting a common pathway within the cell can confer protection against multiple viruses. The lack of effect of 5342191 on E1A protein expression (Fig. 4.11b) indicates that viral genome delivery to the nucleus and initiation of viral gene expression is unaffected. However, 5342191 altered the accumulation of E1A mRNA splicing isoforms at both early (8 h) and late (24 h) time points p.i. (Figs. 4.11e-f). Although it is unclear whether the changes in E1A RNA processing contribute to reduced virus yield, it is possible that the splicing/expression of other early transcripts, including those encoding proteins involved in genome replication, are affected. As a first test of possible cellular factors affected, we looked for changes in SR protein abundance and modification given their roles in regulating RNA processing199,257–259. Using a pan phospho-SR protein antibody (1H4, Fig. 4.12a), significant decreases in the level of phospho-SRp20 (SRSF3) was observed (Fig. 4.12b). Given that modulation of SRp20 levels can impact HIV-1 gene expression, the changes in expression/modification of these two factors may partially account for the responses of 5342191 (manuscript in prep, Ming et al.)57,104. 187

The alterations in HIV-1 and Adenovirus gene expression/replication brought about by 5342191 occurred with only small perturbations in either host RNA accumulation or AS over the time course of treatment (24 h) of HeLa HIV-rtTA-ΔMls cells (Figs. 4.4d and 4.7). Consistent with these results, there were minimal effects of this compound on the metabolic activity or density of HeLa cells (Figs. 4.1b, 4.15b and d, and 4.18b) and CD4+ 24ST1NLESG T cells (Fig. 4.2b) over this time frame as well as only a small to no reduction in the cell proliferation/viability of HeLa (Fig. 4.8) and CD4+ CEM-GXR T cells (Figs. 4.1g and 4.3) over 3 days and CD4+ primary T cells (PBMCs, Fig. 4.1e) over 8 days. These findings confirm that selective alteration of viral RNA processing can be achieved without a dramatic impairment of host gene expression, which is consistent with recent work by our group and others using different compounds that modulate alternative RNA splicing (8-azaguanine, 5350150, digitoxin, and ABX464)89,94,188. In comparison, studies by Martinez et al.262 determined that T cell activation, a normal cellular signaling process, resulted in changes in AS of ~10% of the >10,000 events examined whereas 5342191 affected only 0.69 to 0.26% out of 9,806 events by ≥10 to 20% (Figs. 4.4d-e). In assessing the mechanism by which 5342191 mediates its antiviral effects (Fig. 4.19), we observed that, as in the case of CS addition, 5342191 induced three of the same signaling pathways (ERK1/2, JNK1/2/3, and MK-2, Figs. 4.13a-e and 4.14a-b) and caused no changes in the level of reactive oxygen species (ROS) or Na+/K+-ATPase in the cell (Figs. 4.22a and b-c, 2+ resp.). 5342191 does not induce alterations in [Ca ]i (Fig. 4.13f) or p38 MAPK activation as seen for CSs (Figs. 4.22d-e), indicating that this compound is not affecting HIV-1 through the Na+/K+-ATPase (the primary target of CSs) or its secondary messengers but mimics aspects of its signaling functions250,251. On a side note, blocking PI3K signals (also activated by CSs) in the presence of 5342191 lead to very low rescue of HIV-1 gene expression (Fig. 4.18a) whereas its addition with CSs had no effect [Wong, R. W., Lingwood, C., Ostrowski, M. A., Cabral, T., and Cochrane, A. Sci Rep (Accepted Nov. 7, 2017)]. Overexpression of various AKT-1 variants (WT/constitutively-active/inactive) had little effect on HIV-1 gene expression [Wong, R. W., Lingwood, C., Ostrowski, M. A., Cabral, T., and Cochrane, A. Sci Rep (Accepted Nov. 7, 2017)]. However, the low recovery of Gag expression by a PI3Ki suggests some level of accessory activation of MEK1/2-ERK1/2 (i.e. Rac-PAK to Raf, Fig. 4.19). Nonetheless, among the kinase pathways activated by 5342191 (Fig. 4.19), only inhibition of the MEK1/2-ERK1/2 pathway partially restored HIV-1 gene expression (Figs. 4.13g-i, 4.14c, and 4.15a), suggesting 188

that substrates of this pathway (~200 for ERK1/2) contribute to this response151,226. Supporting our hypothesis that the MEK1/2-ERK1/2 pathway confers suppression of HIV-1 gene expression, treatment of cells with the MEK1/2-ERK1/2 activators, anisomycin and CSs, lead to comparable inhibition of viral expression (Chapter 3)104. Additionally, 5342191 treatment of cells leads to increased Ras activity which could be blocked by a Gαi, EGFRi, or Srci. In the presence of 5342191, these signaling inhibitors partially reversed the anti-HIV-1 inhibitory activity of this compound whereas a PI3Ki yielded little rescue of viral expression. Furthermore, 5342191 inhibition of HIV-1 gene expression requires the activation of a Gα subunit(s) via a GPCR(s), (Fig. 4.18a), suggesting that this compound initiates signaling from this receptor(s) at the cell membrane (Fig. 4.19)263. Each of the signals activated by 5342191 converge on the Ras- Raf-MEK1/2-ERK1/2 signaling pathway to suppress HIV-1 gene expression whereas activation of JNK1/2/3 or blocking any potential signaling from p38, PI3K, or Ca2+ have limited effects on viral expression (Figs. 4.13 and 4.15). As further support for this hypothesis, overexpression of small G proteins (WT, 12D, and 17N N-Ras) suppressed HIV-1 gene expression in a manner correlating with levels of ERK1/2 activation (Figs. 4.17b-c). Although the Src-EGFR-Ras-Raf-MEK-ERK pathway regulate cell proliferation and anti-apoptosis in non-transformed/primary human cells, this same pathway activated by 5342191 to inhibit HIV-1 expression may be responsible in inducing the apoptosis (or inhibit proliferation) of cancer cells (e.g. pancreatic cancer with digitoxin) as described by the effects of CSs on at least 10 types of human cancer cells109,131,196. This is supported by 5342191 reducing the viability of HeLa cervical carcinoma cells after 3-4 days of treatment (Fig. 4.8) but only had limited effects on the survival of human primary PBMCs (even after 8 days, Fig. 4.1e). Interestingly, transformed CD4+ T cells (as well as primary PBMCs) appear more tolerant to 5342191 treatment than HeLa cells, which showed reduced cell viability after 3 days relative to DMSO controls (Fig. 4.1g). This study identifies a novel small molecule (5342191) that inhibits replication of two very different viruses by influencing a common host process: RNA processing (Fig. 4.20), with limited effects to the host. Additionally, the determination that other small molecules can inhibit HIV-1 gene expression by modulating MEK1/2-ERK1/2 signaling without affecting Ca2+ levels (which limit usage of the CS drug family), demonstrates the potential of manipulating segments of this signaling pathway (Fig. 4.19) for controlling viral infection111.

189

Figure 4.22. Effect of 5342191 on the levels of ROS, Na+/K+-ATPase, and p38 MAPK activation in cells. HeLa rtTA-HIV(Gag-GFP) cells were treated with 5342191 (1.9 μM) or DMSO (control) for 4 h and viral gene expression induced by Dox (+) for 20 h or left uninduced (-). (a-e) Treatment of cells with 5342191 demonstrates little impact on the levels of ROS, NKA, and p38 MAPK activation. (a) Graph of ROS levels monitored by CellROX® Deep Red labeling of treated cells as outlined by the manufacturer (n ≥ 3, mean, s.e.m.). (b) Representative blot and (c) graph quantifying the level of NKA in cell lysates from immunoblot analysis (n ≥ 3, mean, s.e.m.). (d) Representative blot and (e) graph quantitating the activation of p38 MAPK by immunoblot analysis of phospho- and total-p38 protein (n ≥ 3, mean, s.e.m.). Tubulin blots serve as internal/additional loading controls and for normalization of these data. Lanes in (d) were cropped and assembled from the same blot (Fig. 4.6f). In parallel, activation and inhibition of the p38 substrate, MAPKAPK-2, was analyzed in Figs. 4.13a and c. Statistical comparisons were performed as described in Methods.

190

4.5 Methods 4.5.1 Ethics statement Written informed consent was obtained from volunteer blood donors in accordance with the University of Toronto guidelines for conduct of biomedical research and experimental protocols approved by the institution’s review board.

4.5.2 Analysis of compounds for inhibition of HIV-1 gene expression 4.5.2.1 Inducible HIV-1 cell lines. Two inducible Tet-ON HIV-1 cell lines [HeLa rtTA-HIV-ΔMls or rtTA-HIV(Gag-GFP)] containing a HIV-1 (LAI) provirus activatable by Dox or tTA were used to assay drug/compounds for effects on HIV-1 gene expression22. The rtTA-HIV-ΔMls provirus was modified and used as previously described83,94,104. The rtTA-HIV(Gag-GFP) provirus was generated by deletion of the PR and RT coding regions within pol and insertion of GFP to the 3’ of gag, generating GFP fused to the C-terminal of Gag. Compound 5342191, 5193892, 9147791, 5227833, and 5350150 were purchased from the ChemBridge Online Chemical Store (www.hit2lead.com) while digoxin and 8-Azaguanine were from Sigma (#D6003 and A5284, resp.) and solubilized in DMSO. After 4 h of treatment of cells with pre- diluted compound, HIV-1 gene expression was induced with 2 μg/mL of Dox. Equal concentrations of DMSO were present in each experiment. After ~20 h, cells and media were harvested to monitor effects of treatments as described below. For confirmatory tests, a CD4+ T cell line (24ST1NLESG) was treated with compound as described above but induced by phorbol 12-myristate 13-acetate (PMA) as previously described182. Further evaluation of 5342191 on the replication of HIV-1 strains resistant to known antiretrovirals (Table 4.1) was evaluated in a human T-cell reporter assay based on CEM-GXR cells as previously reported91.

4.5.2.2 HIV-1 infected human primary cells. Human primary T cells (PBMCs) were isolated from healthy volunteer blood donors (not infected with HIV), leukophoresed, and stored at -80oC until use. PBMCs were activated by 2 μg/mL of PHA-L (Sigma, #L2769) and 20 U/mL of IL-2 (BD Pharmingen, #554603), isolated, infected with HIV-1 BaL (MOI: 10-2), and cultured as previously described83. Infected cells were seeded at 0.5 x 106 cells per well in 12 well plates and treated with compound/drugs pre-diluted in RPMI (2 mL final). Every 2 days, 0.5 mL of media was harvested for p24CA ELISA and, on day 4, media was also replaced with 1 mL of fresh RPMI (with 10% FBS, 1X Pen-Strep, and 1X Amphotericin B (Wisent Corp.) containing fresh compound and 20 U/mL of IL-2. The nucleoside reverse transcriptase inhibitor, 3’-azido-3’-deoxythymidine (AZT), was purchased from Sigma-Aldrich (#A2169).

4.5.2.3 Cell viability assays. The effect of compound/drugs on cell health were assessed in parallel by XTT assay (Sigma-Aldrich, #TOX2) and/or trypan blue exclusion (Invitrogen, #15250-061). For estimations of viable cell counts in CEM-GXR cells,

191

flow cytometry (Guava HT8) was performed and gated to cover 95% of the uninfected CEM-GXR cells and the same parameter was used to gate viable cells in inhibition assays.

4.5.2.4 Monitoring HIV-1 gene expression or replication. Supernatants (or lysates as specified) from treated cells were assayed by ELISA of Gag CA expression using HIV-1 p24CA antigen capture assay kits (AIDS & Cancer Virus Program, NCI-Frederick, Frederick, MD USA or Xpress Biokit, #XBR-1001) or by monitoring Gag-GFP fluorescence in HeLa rtTA-HIV(Gag-GFP) cells. Peak Gag expression in p24CA ELISAs reached ~1000 pg/mL, ~800 pg/mL, and ~6100 pg/mL for HeLa rtTA-HIV-ΔMls, 24ST1NLESG, and BaL-infected PBMC media, respectively.

4.5.3 Western blot analysis of viral and cellular proteins To quantify the levels of expression of HIV-1, Adenovirus, or host proteins (e.g. SR proteins and Na+/K+-ATPase), cell lysates were prepared for analysis by western blot using specific antibodies (and phosphatase inhibitors) as previously detailed94,104. To assess Adenovirus E1A and hexon expression, respectively, a mouse monoclonal Adenovirus-2/5 E1A antibody (M73, Santa Cruz, #sc-25) and mouse monoclonal anti-hexon antibody from hybridoma 2Hx2 [American Type Culture Collection (ATCC), #HB8117] were used. E1A blots were blocked with 5% Milk-TBS-T for 1 h and incubated overnight at 4oC with an anti-E1A antibody at 1/2000th dilution. Hexon blots were blocked with 5% Milk-PBS-T for 1 h and incubated overnight at 4oC with undiluted anti-hexon supernatant. An anti-chicken NKA antibody (α6F, #a6F-c, Developmental Studies Hybridoma Bank, The University of Iowa, contributed by Douglas M. Fambrough, The Johns Hopkins University) was used as specified to detect NKA α1- and β1-subunits across species. Antibodies specific to phospho- and total-MAPK/MAP proteins for ERK1/2, JNK1/2/3, p38α/β/γ/δ, and MAPKAPK-2 were from Cell Signaling Technology (#9106, 9102, 9255, 9252, 9211, 9212, 3007, and 3042, resp.). Activation of MAP/MAPKs were determined by western blot quantitation and calculation of their phospho ÷ total protein levels. Clarity (Bio-Rad, #170-5060) or Western Lightning ECL reagent (Perkin-Elmer, #NEL101) were used for detection of signals from blots bound with HRP-conjugated antibodies and captured by X-ray film or digitally by a Bio-Rad ChemiDoc™ MP System as previously described83. Unsaturated protein bands in immunoblots/SDS-PAGEs were quantitated by ImageLab, normalized to internal loading controls (α-tubulin, GAPDH, or Stain-Free™ labeled total protein), and displayed relative to DMSO (+Dox/virus). DMSO (+) vs. (-) demonstrate successful activation of viral gene expression by Dox for assays of HIV-1 or infection by Adenovirus. Stain-Free™ gels were casted and proteins were detected as described in 10% TGX-Stain-Free FastCast Acrylamide Kit (Bio-Rad #161-0183). Images acquired were exported as TIF files for assembly, rotation, and equal brightness/contrast adjustments in ImageJ or Microsoft Powerpoint. Some lanes were cropped and rearranged from the same blot/gel as indicated. In representative gel/blot sets, samples were electrophoresed from the same experiment as controls, resolved simultaneously on identically casted gel(s), transferred to the same PVDF (by either wet electrophoretic or by Bio-Rad Trans-Blot® Turbo Transfer System), and detected at same time. Marked locations of molecular weight (MW) standards are shown on the left as a reference.

192

4.5.4 Analyses of HIV-1, Adenovirus, and host mRNAs 4.5.4.1 Quantitation of virus and host mRNA expression RNAs were extracted from HeLa rtTA-HIV-ΔMls cells, reverse transcribed, and cDNAs analyzed by qRT-PCR to quantify HIV-1 mRNA levels as previously described83. All data was normalized to β-actin as internal loading control. Alternative RNA splicing of Adenovirus E1A was analyzed by RT-PCR as previously outlined264. Expression of late Adenovirus RNAs were analyzed by qRT-PCR as described above using one common forward primer for all late mRNAs (5’-CGAGAAAGGCGTCTAACCAG-3’) and a reverse primer for 100K (5’- GACGGGGAAGGTGGTAGG-3’), fiber (5’-GAAAAGGCACAGTTGGAGGA-3’), hexon (5’- CCCGAGATGTGCATGTAAGA-3’), and penton base (5’-GCTCACCACGCTCTCGTAG-3’). Results were normalized to GAPDH (forward 5’-CAATGACCCCTTCATTGACC-3’ and reverse 5’- GACAAGCTTCCCGTTCTCAG-3’). In 5342191 studies on HIV-1 in 24ST1NLESG cells and siRNA knockdown of G protein α subunits in HeLa rtTA-HIV(Gag-GFP) cells, however, qRT-PCR reactions used iTaq™ Universal SYBR® Green Supermix (Bio-Rad, #172-5120) and analyzed on a Bio-Rad CFX384 Touch™ Real-Time PCR Detection System with CFX Manager™ software. G protein α subunits were detected by published primers265,266 and amplified by iTaq™ using the same cycling temperature and times previously described for HIV-1 US/MS cDNAs except annealing temperatures were 53oC83. Primers sequences for Gα subunits were as follows: Gα i1 forward (5’- AAGTACAATTGTGAAGCAGATGAAA-3’), reverse (5’-TGGTGTTACTGTAGACCACTGCTT-3’); Gα i3 forward (5’-TGGGACGGCTAAAGATTGAC-3’), reverse (5’-ATAATTGCCGGGCATCATC-3’); Gα q forward (5’-GACTACTTCCCAGAATATGATGGAC-3’), reverse (5’-GGTTCAGGTCCACGAACATC-3’); Gα 13 forward (5’-TCGGGAAAAGACCTATGTGAA-3’), reverse (5’-CAACCAGCACCCTCATACCT-3’); and Gα s forward (5’-ACGTGATCAAGCAGGCTGACT-3’), reverse (5’-GGAACAGGATCACAGAGATGG-3’).

4.5.4.2 Analysis of HIV-1 splice site usage The effect of drug/compounds on splice site use within the HIV-1 MS mRNA class were analyzed by RT-PCR as previously outlined with cDNAs obtained from RNAs above94.

4.5.4.3 Subcellular localization of HIV-1 genomic RNA Changes in the distribution of HIV-1 US RNAs in cells was determined by FISH of HeLa rtTA-HIV(Gag-GFP) cells treated with compound. Cells were processed and analyzed using Stellaris™ probes comprising of a mixture of 48 Quasar 570-labelled 20-mer oligonucleotides spanning the HIV-1 Gag coding region (Biosearch Technologies) as previously detailed94,104.

4.5.5 Adenovirus yield Human lung carcinoma (A549) cells were obtained from the ATCC. HEK 293 cells were obtained from F. Graham, McMaster University, Hamilton, Ontario, Canada. Cells were maintained in minimal essential medium (MEM) supplemented with 10% fetal calf serum (FCS), penicillin (100 U/ml), and streptomycin (100 μg/ml). HAdV-C5 (ATCC) was infected (MOI <0.1) and propagated in 293 cells and harvested when cytopathic effects were complete. 193

Inhibition experiments were done in A549 cells seeded in 6-well plates at 50,000 cells per well and infected 1 d post seeding at an input MOI of 100-400 . After 1 h of adsorption at 37oC, inoculum was removed and replaced with fresh culture medium containing DMSO (control) or 5342191 (dissolved in DMSO). Progeny virus was harvested typically at 24 h p.i. by scraping the cells into the culture fluid, freeze-thawing the suspension five times, and vortexing. Clarified cell lysates were assayed for infectious viruses by endpoint dilution in 293 cells using 60-well Terasaki plates as previously described267.

4.5.6 Quantification of Adenovirus DNA A549 cells infected with HAdV-C5 were harvested at 20 h p.i. Cells were scraped into culture fluid, collected by centrifugation, washed with 1X PBS, and lysed with buffer (0.5% NP-40, 0.5% Tween 20, 0.1% SDS, 0.5 mg/ml proteinase K, 75 mM NaCl, 10mM Tris-HCl, pH 8.0) for 4-5 h at 56°C, then boiled for 15 min. Supernatants were used for qPCR analysis of intracellular Adenoviral DNA using primers specific to the Adenovirus E3 region and the housekeeping gene, TBP, as previously reported and follows: E3 forward (5’-CCGGTCATTTCCTGCTCAATA-3’) and reverse (5’-AGGTTGTAGCGCTGGAGCATA-3’)268 and TBP forward (5’-GATGCCTTATGGCACTGGAC- 3’) and reverse (5’-GCCTTTGTTGCTCTTCCAAA-3’). Cycle conditions used for E3 primers were 50.0°C for 2 min and 95°C for 10 min followed by 35 cycles of 95oC for 15s, 65oC for 1 min, and 72oC for 1 min while for TBP primers they were 50.0°C for 2 min and 95°C for 10 min followed by 35 cycles of 95oC for 15s, 60oC for 1 min, and 72oC for 30s.

4.5.7 Analysis of the changes in host alternative splicing and gene expression RNA was extracted from compound treated cells, reverse transcribed, and analyzed for effects on AS of cellular RNAs by medium throughput RT-PCR and RNA-Seq as previously described104,269. The inclusion levels of 157 AS exons and splice sites located in 96 AS regions of 85 genes were assayed by an automated RT-PCR using a Biomek 2000 workstation. Fluorescent products were generated using primer sets labeled with 5-FAM. Events assayed were previously suggested to be linked to cell transformation and available for lab use. Labeled PCR products were denatured in formamide and quantitated using an ABI Prism capillary sequencer (Life Technologies). The inclusion level of each exon was calculated as the amount of transcripts carrying the alternative exon relative to the total amount of all transcripts detected in the PCR reaction. Alternative exon inclusion data (PSI) were averaged for each treatment and differences between 5342191 and DMSO shown by plotting results on y- and x-axes, respectively, and significant differences between these treatments (ΔPSI) were tabulated for each event. For RNA-Seq, data was obtained from poly(A)+ RNA and sequenced on an Illumina HiSeq2500 as previously detailed269. RNA quality in samples was measured beforehand using an Agilent Bioanalyzer for a RNA Integrity Number (RIN) value ≥8. A total of 9,806 alternative RNA splicing events (exon inclusion or exclusion) and 11,406 expressed genes from cells were detected and analyzed as described in figure legends. PSI and PSIs were calculated from levels of exon inclusion/exclusions changed from 5342191 and DMSO treated cells while DE genes (corrected reads per kilobase of exon model per million mapped reads, cRPKM) were calculated from mean fold differences in the level of each gene expressed from 5342191 and DMSO treated cells.

194

4.5.8 SUnSET analysis of total cellular protein synthesis229 HeLa rtTA-HIV-ΔMls cells were cultured in the presence/absence of 5342191 and Dox for ~24 h to induce HIV-1 expression and then treated with puromycin (10 μg/mL, Sigma-Aldrich, #P8833) for 30 min to label nascent proteins. As control, 10 µM of cycloheximide (Sigma-Aldrich, #C4849) was added to some cells prior to puromycin treatment. In some experiments, 10 μM of MG132 (Sigma-Aldrich, #M7449) was added to cells 8 h prior to harvest. Cells were subsequently washed, whole cell lysates prepared, and proteins quantified by western blot using an anti- puromycin antibody (EMD Millipore, #anti-12D10) as described above.

4.5.9 Measuring the stability and degradation of HIV-1 proteins Analysis of the effects of compounds on HIV-1 Tat or Gag stability, HeLa rtTA-HIV-ΔMls cells were seeded 1 d prior, Dox induced for 24 h, treated with 10 μM of cycloheximide in combination with either compound or DMSO, and harvested at various time points shown. In experiments indicated, 10 µM of MG132 was added to cells 8 h prior to harvest. The effect of these treatments on the level of viral proteins were assessed by immunoblots as described above.

4.5.10 Deciphering the intracellular signaling pathways modulated by 5342191 Using the same methods and conditions described for HeLa rtTA-HIV-ΔMls cells, HeLa rtTA-HIV(Gag-GFP) cells were seeded in 48-/12-well plates prior to addition of inhibitor and Dox. Equal concentrations of DMSO were present in each experiment. To determine which pathway signal inhibits HIV-1 gene expression, cells were pre- treated with a specific pathway inhibitor (or a Gα subunit protein was knockdown), prior to addition of 5342191 or DMSO and Dox, and monitored for recovery of Gag-GFP expression via detection of GFP fluorescence as follows. GFP fluorescence was initially detected in plated cells by a Typhoon Imager 9400 (Amersham Biosciences) or Typhoon FLA 9400 (GE) on ImageQuant and then in cell lysates by SDS-PAGE captured on ChemiDoc MP or by p24CA ELISA. Before quantification, cells were washed with warm PBS and either scanned live (and harvested for protein analyses) or fixed in 3.7% paraformaldehyde/formaldehyde-PBS for subsequent analyses. Data from cell scans and SDS-PAGEs were quantitated using ImageJ and Image Lab software, respectively. Pathway inhibitors were purchased from Sigma (BAPTA-AM, #A1076-25MG; U0126, #U120-1MG; SP600125, #S5567-10MG; SB203580, #S8307-1MG), Abcam (KB-R7943, #ab120284), BioShop (U0126, #U0U237.5), Millipore/Calbiochem (LY294002, #440204), or Selleckchem (Selumetinib/AZD6244, #S1008). Recombinant human EGF was from Invitrogen (#PHG0314). Concentrations of SP600125 were 8 fold lower than those reported to limit off-target effects described215. In parallel, the cell viability of each pathway inhibitor and compound treatment combination were monitored by cell density staining of fixed cells with 2% methylene blue (BioBasic, #MB0342) in 50% ethanol and read at OD664 on a TECAN Infinite® 200 PRO or Biotek Cytation5. Ras activation in cell lysates was assayed by a Ras GTPase activation Kit (EMD Millipore #17-497) as specified. Pathways activated by a compound were

195

2+ monitored by western blot as described above. Changes in [Ca ]i and ROS, respectively, were monitored by loading live cells with Fura Red™ AM (Life Technologies, #F-3020) or CellROX® Deep Red Reagent (Life Technologies, #C10422) as outlined by the manufacturer. To determine which G protein family(s) are involved in 5342191 signaling, G protein α subunits were knocked down in cells by addition of 75 nM of standard custom siRNA (GE Healthcare Dharmacon) for 48 h as previously described56 prior to addition of 5342191 or DMSO, and the published sense sequences are as follows: Gαi1 (5’-AGCGGAGUAAGAUGAUCGAUU-3’), Gαq (5’-

GCUGGUGUAUCAGAACAUCUU-3’), Gα13 (5’-GAAGAUCGACUGACCAAUCUU-3’), and Gαs (5’- CGAUGUGACUGCCAUCAUCUU-3’)270.

4.5.11 Statistical analyses Data was analyzed in Microsoft Excel or GraphPad Prism and expressed as means ± standard error of the mean (s.e.m.). Differences between two groups of data, i.e. drug/compound treatment vs. control (DMSO +Dox/PMA/HIV/Adenovirus and, if present, per RNA/protein isoform), were compared by two-tailed Student’s t- test. In cell signaling graphs, cells pre-treated with no pathway inhibitor and compound were compared to those with no pathway inhibitor and DMSO (+) as illustrated (black dashed lines) whereas cells pre-treated with a pathway inhibitor and compound within a treatment set were compared to those with no pathway inhibitor and the compound within the same set (gray dashed lines). MG132 in Fig. 4.9d substitutes as the “pathway inhibitor” described above. Statistical significance in results are indicated on graphs for each p value as follows: p <0.05, *; p <0.01, **; and p <0.001, ***; unless otherwise noted.

196

5 General Discussion and Future Studies 5.1 Identifying digoxin as a novel inhibitor of HIV-1 RNA processing

Previous studies have established that modulation of splicing factors such as hnRNPs, SR proteins, and SR protein kinases, which can induce imbalances in RNA processing, can have a dramatic impact on HIV-1 gene expression30,38,39,41,56. Supporting an approach which exploits this weakness, addition of a small molecule inhibitor of the CLK family of SR protein kinases (chlorhexidine) in Wong et al. (2011) and inhibitors of SR proteins (indole derivatives) altered viral RNA processing and lead to suppression of HIV-1 replication83,87,88. Although chlorhexidine is a FDA-approved antiseptic, its toxicity in prolonged cultures of human PBMCs likely preclude its systemic use83. To further explore this strategy, I tested other drugs discovered in a HTS for modulators of host alternative RNA splicing in cells. I identified digoxin as a novel inhibitor of HIV-1 replication which induces oversplicing of viral RNAs (Fig. 2.14)104. Digoxin was found to inhibit HIV replication of HIV infected PBMCs from clinical patients at concentrations (IC50: ~1.1 nM, (Fig. 2.3c-d) that were 2-6 fold below those used to treat people with heart conditions (~2.3-5 nM); these results are an improvement when compared to the life- threatening toxicity (i.e. cardiac arrythmias) which can occur when digoxin concentrations exceed 5-9 nM104,111. In light of these limitations, further studies in the context of in vivo models of HIV-1 infection (e.g. HIV-1-infected humanized NSG mice or SIV-infected rhesus macaques) could validate whether this drug is effective in controlling (and preventing) viral infection under in vivo conditions271,272. Since this drug is also internationally and FDA approved and still in use, it could be practical to begin a clinical trial with this drug to validate whether digoxin and perhaps other CSs (described below) are capable of modulating HIV expansion in the plasma of HIV infected people as it can in primary PBMC culture104,111. A dual center, single arm, non- blinded phase I/II pilot study design using oral digoxin could be performed as described by our collaborator, Dr. Sharon Walmsley (clinical research scientist, Toronto General Hospital Research Institute). The study would address the hypothesis: does digoxin (or other CSs) suppress HIV-1 replication by altering viral RNA processing and lower viral load (RNA copies) in plasma of ART naïve participants with no underlying cardiac disease. Primary objective will be to determine the proportion of HIV infected participants who respond with a decrease in HIV-

197

1 replication (>0.7 log copies/mL) from treatment with therapeutic doses of digoxin for 4 weeks. Secondary objectives will establish the viral load change, adverse effects, and change in CD4+ T cell counts. Consistent with the hypothesis that the observed response involves alterations in RNA processing, my study revealed that digoxin induces noticeable changes in the modification of SR proteins (SRp20, Tra2β, and phospho-SRp75 and -SRp55, Fig. 2.11b-c)104. Furthermore, overexpression of SRp20, but not other SR proteins, mimicked digoxin’s effects which include alteration of HIV-1 RNA processing (increasing oversplicing and altering splice site usage) and inducing hyperphosphorylation of SRp20 (Fig. 2.11d)104. Modification of SRp20 was confirmed via digestion by phosphatase whereas the modification of Tra2β was not affected under conditions applied (data not shown)104. Further analysis will be necessary to identify the modification on Tra2β. Isolation of this protein species and analysis by LC-MS could determine this post-translational modification.

5.2 Discovering other cardiotonic steroids with improved anti-HIV-1 inhibitor profiles

Previous work has shown that micromolar concentrations of CSs can induce deleterious effects such as NKA inhibition (≥50% at 0.5 μM) and cytoxicity103,111,225 and, at particular nanomolar

IC50s (i.e. ≥90 nM of digitoxin and ≥84 nM of digoxin), inhibit cell proliferation and protein synthesis of many cancer cell lines111,196,224. A recent study identified 13 CSs as inhibitors of HIV-1 expression at high concentrations (10 μM) in a HTS of these compounds in 293T cells and a previous work reported that digitoxin inhibited a recombinant HIV strain in a MT-2 VSV- G-pseudotyped recombinant virus assay211,216. My study substantiated that >5 of these reported hits as well as 7 additional CSs (Fig. 3.1) suppress HIV-1 gene expression at nanomolar concentrations below those which induced deleterious effects in the context of transformed cell lines (HeLa and CD4+ SupT1 T cells) and inhibit HIV replication in CD4+ primary human PBMCs from HIV infected patients at single-digit nanomolar concentrations without any observed toxicity in all cell types assayed (on metabolism/proliferation, density, and viability)104. In addition, PBMCs from HIV-infected patients were also depleted of CD8+ T lymphocytes prior to activation and drug treatment (Fig. 3.3-3.4), suggesting that the inhibitory responses observed with CSs are not likely the result of a cytotoxic T lymphocytic (CTL) response towards viral 198

infection104. Furthermore, I compared the chemical structure and inhibition characteristics of CSs and revealed that certain changes in the substituents on a CS (Fig. 3.1), i.e. the glycoside or lactone, could substantially influence the anti-HIV-1 activity of these drugs and these results correlated with their reported binding affinities to their receptor104,130. Through this analysis, I provide evidence that the majority (>3/4) of CSs tested have improved inhibitor profiles: greater potency and increased in vitro and ex vivo TIs compared to digoxin (Table 3.1)104. For example, while digoxin improved ~2-6 fold in concentrations required to treat HIV infection ex vivo compared to those used to treat heart conditions in patients, digitoxin (approved in Canada and Europe) improved over ~15-26 fold in this regard (Fig. 3.4). RIDK 34 and digitoxigenin, not in clinical use, have similar IC50s as digoxin (1.1 and 1.3 nM, resp.) yet still demonstrate at least a ~1.5 fold improvement in ex vivo TIs compared to digoxin (Table 3.1)104,111,218. Moreover, the bufadienolide bufalin, not tested ex vivo, improved 9 fold in in vitro TI compared to digoxin (Table 3.1)104. My study supports further investigation into potentially repurposing this class of drugs for treating HIV-1 infection (as described above for digoxin).

5.3 Impact of CSs on the expression of essential HIV-1 structural and regulatory proteins and replicative potential

In contrast to other studies, I demonstrate the mechanism by which CSs impact the expression of HIV-1 RNA and proteins104. These drug/compounds were found to markedly reduce the expression of essential viral structural proteins (Gag and Env) and the regulatory factor, p14 Tat, in cells (Figs. 3.5a and c-d, 2.8d)104. The changes in viral protein expression correlated with decreases in US and SS RNAs in cells treated with a CS (Figs. 3.7b, 2.8c)104. Dose response experiments for each CS suggest that they function by binding to the NKA to elicit an inotropic response (in especially cardiac myocytes) and activate the NKA signalosome (Fig. 3.1)116,131. In contrast, we demonstrate that these compounds differ in their effects on the expression of HIV-1 regulatory factors, Rev and p16 Tat (Figs. 3.5b-d, 2.8d)104. However, the accumulation of these factors did not correlate with their respective RNAs in our assays (Figs. 3.7b, 2.8d), suggesting that these differences occur at the level of translation or stability of these proteins. Digoxin-like CSs were found to deplete Rev while digitoxin-like compounds had little to no effect on the accumulation of this factor (Figs. 3.7b, 2.8d)104. This difference is correlated to the presence of a single hydroxyl substituent at C-12 of digoxin-like CSs (Fig. 3.1). Although there is no 199

information in the literature to explain this difference, we note that cells treated with digitoxin- like compounds (ouabain and digitoxin) do not appear to alter Rev transport (Fig. 3.21) or its export of viral incompletely-spliced RNAs (Figs. 3.7c, 2.10a). It is probable that digitoxin-like CSs could increase ubiquitination of Rev which, instead of promoting its degradation, enhances its stability as reported by Vitte et al. (2006)273. If this is the case, it is unclear which E3 ligase is responsible for this modification. CS activation of JNK (Fig. 3.14c) could potentially influence viral protein accumulation by either enhancing degradation (via phosphorylation of the E3 ligase Itch) or increasing stability of a protein (via phosphorylation), given its effects reported on several transcription factors233. Although this may be possible, there are no known JNK phosphorylation sites mapped on Rev and all CSs elicited a similar activation of JNK (Fig. 3.14c). Identification of the molecules interacting with Rev (i.e. by co-immunoprecipitation or affinity purification) could address what modifies and/or influences the stability of this factor. A repeat of RNA quantitation on samples from PBMCs infected with HIV-1 (BaL) and treated with CSs, however, could at least confirm our observations on viral RNAs (Figs. 3.7c, 3.8b, 2.10a, 2.7d) in the natural context of infection instead of transformed cell lines containing a mutated virus. Regardless of observed differences in Rev accumulation in cells treated with CSs (Figs. 3.5b, 2.8d), I revealed that there are low levels of genomic RNA in the nucleus and cytoplasm of cells treated with each CS (Figs. 3.7c, 2.10a), suggesting that oversplicing of HIV-1 RNAs (Fig. 3.7b, 2.8d) is the primary mechanism reducing the expression of viral structural and regulatory proteins104. Digitoxigenin and RIDK 34, on the other hand, substantially reduce the expression of p16 Tat whereas other CSs demonstrate little to no change in this factor (Figs. 3.5c-d, 2.8d) 104. Reduced levels of Tat could substantially decrease viral transcription and negatively impact HIV-1 replication29, which is supported by the drastically lower concentrations of CS used to control HIV replication in HIV infected PBMCs from patients (Figs. 3.4, 2.3c-d)104. However, this would not affect the levels of viral expression in our HIV-1 HeLa cell lines since Tat and its binding site (TAR) have been mutated (Fig. 1.9)83. It is possible that these CSs may be promoting the degradation (or reduce the stability) of Tat (Figs. 3.5c-d, 2.8d) as noticed in cells treated with 5342191 (Fig. 4.9d). Similar experiments described for 5342191 could measure the degradation and stability of Tat and Rev in cells treated with digitoxigenin and RIDK 34 (Figs. 3.5b-d, 2.8d) to address the effects observed on these key viral factors.

200

Collectively, the effect of CSs on multiple facets of HIV-1 RNA and protein expression could explain the drastic difference between the IC50s required to suppress viral expression in transformed cells lines and those necessary in HIV-infected human primary PBMCs (Table 3.1):

CSs tested required an IC50 between 10-175 nM in HIV-1 HeLa cells but needed only IC50s of 1.1-1.3 nM in HIV infected PBMCs104. This may be because the recombinant Tet-On HIV-1 system in HeLa cells contains mutations in Tat and TAR and deletions of RT and IN (or PR and RT in the Gag-GFP version, Fig. 1.9) from the pol reading frame, which essentially knocks out at least 3 essential viral proteins required for unabridged viral replication in cells83. Additionally, a report of CSs being involved in blocking HIV entry (fusion) into cells (4.2 μM) could influence the suppressive capability of CSs219. Impairment of multiple components of the HIV lifecycle in the natural context of HIV infected PBMCs would be synergistic and, through multiple rounds of viral replication (20 d compared to 1 d, Figs. 3.4 and 2.3c-d vs. Figs. 3.1, 3.2, and 2.2c)104, could greatly amplify the response of an inhibitor. This hypothesis is supported in the case of digoxin, digitoxin, digitoxigenin, and RIDK 34 (Table 3.1) as well as 8-Azaguanine and 535015094,95,104. Moreover, a recent publication by Zhyvoloup et al. (2017) added that digoxin, via interaction with RORγ/γt (RORC) expressed in a subset of CD4+ T-cells and innate lymphoid cells, inhibits HIV-1 infection by blocking viral integration around T cell activation and metabolism genes repressed by this drug220. Although this finding may apply to digoxin and digitoxin, it does not apply to CSs that lack two or more sugar/glycoside moieties such as digitoxigenin and RIDK 34, which demonstrated similar IC50s on HIV replication within the context of HIV infected PBMCs (Figs. 3.4, 2.3c)104,220. To likely explain this, these two compounds are the only CSs affecting the early-expressed p16 Tat (Figs. 3.5c-d and 2.8d, along with similar viral components/functions affected by all CSs) which may explain their similar levels of suppression of the virus as observed with digoxin/digitoxin in HIV infected PBMCs (Figs. 3.4, 2.3c).

201

5.4 Identification of other novel inhibitors of HIV-1 RNA processing

In my attempt to identify other novel inhibitors of HIV-1 RNA processing, I tested other small molecules identified from an HTS for modulators of SMN2 splicing by our collaborator Peter

Stoilov (unpublished, University of West Virginia, WV, USA) and identified 5342191 (IC50: 750 nM) as well as several other compounds that are now published (8-Azaguanine, 5350150, 9147791, 5227833, and 5183892, Fig. 5.1)94,95. By comparison with other HIV-1 RNA processing inhibitors, 5342191 has a substituent in its chemical structure with similarity to the CLK inhibitor, chlorhexidine (Fig. 5.1)83,84. Further study will be necessary to identify the role of this substituent within these two compounds. Although 5342191 inhibited HIV-1 gene expression in the high nanomolar range with an IC50 of 750 nM (Fig. 4.1b) compared to the low nanomolar range of CSs in HIV-1 HeLa cells (~10-175 nM, Fig. 3.1 or 3.2) 104, we demonstrated that it is effective in suppressing representative HIV strains containing one or multiple drug resistance mutations, supporting the potential of this compound and/or its derivatives in salvage and/or combinatory therapies (Figs. 4.1g, 4.3). In regards to the effect of this compound on the expression of essential HIV-1 proteins, similar observations and explanations described for CSs could be extended for the case of 5342191 (Fig. 4.1-4.2b). In contrast to CSs, 5342191 markedly suppresses expression of all four essential viral proteins assayed (Gag, Env, p14 and p16 Tat, and Rev, Figs. 4.1-4.2b)104. Expression levels of the first three proteins partially correlated with their respective US and SS RNAs (~40% of controls) whereas the latter two factors did not correlate with MS RNA levels (Figs. 4.4b, 4.2d). Upon demonstrating that the changes observed were not due to general effects on cellular protein synthesis, we revealed that 5342191 enhances proteasomal degradation of both Tats (Fig. 4.9d). Although Rev was not assessed in these experiments, it is possible that this factor is affected in a similar manner as Tat and could be addressed in follow up studies. For the remaining 40% of US and SS RNAs encoding Gag and Env/p14-Tat (resp., Fig. 4.4b), it is plausible that depletion of Rev in cells treated with 5342191 (Fig. 4.2d) blocks expression of these RNAs since Rev facilitates nuclear export of these RNAs for cytoplasmic translation. This hypothesis is supported by the detection of reduced levels and nuclear retention of genomic RNAs in cells treated with 5342191 (Fig. 4.4c). Because 5342191 affects four essential viral proteins and HIV undergoes multiple rounds of replication over time, these effects could synergistically and exponentially decrease viral 202

particles in prolonged cell culture as observed in PBMCs treated with CSs (Figs. 3.1 and 3.4 or 94,104 Table 3.1), 8-Azaguanine, and 5350150 . However, we found an increase in IC50s (1.8 µM) required to control the replication of HIV-1 (BaL) infected into PBMCs cultured for 8 days with 5342191 (Fig. 4.1e) compared to the concentrations of this compound on viral gene expression in HIV-1 HeLa and 24ST1NLESG cell lines cultured for 1 day (IC50s: 750 and 750 nM, resp.,

Figs. 4.1b and 4.2b). There was also a low difference between these IC50s and those of CEM- GXR cells infected with WT or drug-resistant HIV-1 strains cultured for 3 days with 5342191

(IC50s: 0.6-2.5 μM, Figs. 4.1g and 4.3). Although these results are not exactly comparable to experiments where HIV outgrowth is monitored from HIV infected PBMCs of patients cultured for 20 days, a preliminary experiment of 5342191 (run in parallel with 8-Azaguanine/5350150) demonstrated that 5342191 suppresses HIV replication with an IC50 of 750 nM at day 14 (Fig. 94 5.2) . These results demonstrate that IC50s do not change much between 1-3 days in HIV-1 cell lines (Figs. 4.1b and g, 4.3, 4.2b) and required a similar concentration to perturb HIV outgrowth from HIV infected PBMCs (Fig. 5.2). However, the increased difference in IC50s observed in HIV-1 (BaL) infected PBMCs cultured for 8 days with 5342191 (Fig. 4.1e-f) have intrinsic differences in the experimental conditions and materials used. This includes artificial infection of PBMCs with high titers of virus and variability of PBMC donors with different degrees of sensitivity to drug treatment and/or virus infection. At very least, uninfected PBMCs used in these experiments had a low percentage of CD8+ T cells (data not shown, A. Balachandran and S. Mujib) and the HIV infected PBMCs used from one patient was depleted of CD8+ T cells (Fig. 5.2) supports that 5342191 inhibition of HIV replication is specific and not due to an active CTL driven response towards viral infection. In summary, 5342191 is effective in controlling HIV replication at nanomolar concentrations for the majority of contexts, however, mining for higher affinity derivatives of this compound may be necessary for future therapeutic applications.

203

Figure 5.1. Chemical structure of HIV-1 RNA processing inhibitors. All drug/compounds that I identified as anti-HIV-1 inhibitors have little to no similarity with one another, except 5342191 has some similarity with chlorhexidine83,94,95,104. Note: TG003 and TG009 are provided as a reference only and are not active ARV inhibitors. Image was created by Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

204

Figure 5.2. 5342191 inhibits the outgrowth of HIV from HIV infected patient PBMCs. PBMCs from HIV infected patients were depleted of CD8+ T cells (data not shown), activated by anti-CD3 and anti- CD28 antibodies, and treated 20 d with indicated concentrations of 5342191. HIV particle formation was quantitated by p24CA ELISA of cell supernatants and viability of cells were assayed by XTT. Data are displayed relative to DMSO (0 nM). (a) Graph of viral growth (p24 protein levels) and cell viability (gray circles, adjacent y-axis) of cells treated with compound (red triangles) or DMSO (black circles; n = 1). The drug 3TC and HIV-1 RNA processing inhibitors, 8-Azaguanine and 5350150, were run in parallel with this experiment94. (b) Dose-response curves of 5342191 on HIV replication (relative Gag expression, black circles) and cell viability (gray circles) measured on day 14 (n = 1). Figure was from Raymond Waiman Wong [Wong, R. W. (2017). Targeting Viral RNA Processing to Control HIV-1 Infection (Doctoral Dissertation, University of Toronto). Retrieved from https://tspace.library.utoronto.ca].

5.5 Effect of targeting viral RNA processing to control HIV replication

I determined that the impact of CSs on the expression of vital HIV-1 structural and regulatory proteins (Figs. 3.5, 2.2b, 2.8d) correlates with decreases in the corresponding US and SS RNAs encoding them (Figs. 3.7b, 2.5). In the context of clinical isolates of HIV (Figs. 3.4 and 2.4c-d) and, especially in vivo, such alterations could also do the following: reduce the expression of essential HIV-1 enzymes encoded by US RNAs via a frameshift and decrease levels of viral auxiliary proteins such as Vif (which functions in concert with a cullin-5-based E3 ubiquitin ligase complex to mediate polyubiquitination and rapid degradation of APOBEC3G by the proteasome) and Vpr (which redirects host ubiquitination pathways for HIV specific outcomes, such as degradation of antiviral factors, and other functions)274–276. In other words, these

205

unaccounted for effects could contribute additively to the overall suppression of viral replication by these compounds in, especially, natural settings of HIV-1 infection. Consistent with CSs (and 5342191) altering HIV-1 RNA processing, my analysis of cellular splicing factors from the SR protein family indicated distinct differences between CSs (Figs. 3.7d, 2.11c, and 4.12b). All CSs reduced the mobility of SRp20, consistent with hyperphosphorylation observed in digoxin treated cells, except digitoxigenin caused de- modification of this factor (Figs. 3.7d and 2.11c)104. 5342191, on the other hand, caused de- modification of SRp20 (Fig. 4.12a-b). Since overexpression of SRp20 can induce similar alterations in HIV-1 RNA accumulation (Fig. 2.13), the changes in modification of this factor could likely underlie the responses of most CSs (Figs. 3.7-3.8)104. However, in the case of digitoxigenin and 5342191 (Figs. 3.7d and 4.12b, resp.), it is unclear what role that dephosphorylation of SRp20 plays and whether depletion of this factor has a similar outcome on HIV-1 RNA processing as these compounds or if it is equivalent to de-modification of this factor. Further studies applying RNAi (siRNA or shRNA) on SRp20 could address the impact of digitoxigenin/5342191 on this splicing factor. In contrast to the belief that targeting a host process would have detrimental outcomes, splicing modulators such as ABX464, 5342191 (Figs. 4.4d-g, 4.7a), 8-azaguanine, 5350150, 9147791, 5227833, and 5183892 have demonstrated that they can selectively alter HIV-1 RNA processing without severely impairing the gene expression or alternative RNA splicing of the host cell89,94,95,220. In fact, 5342191 only alters 0.5% of genes expressed and 0.7% of AS events in cells (Figs. 4.4f and d-e, resp.). In contrast, the CS digitoxin affects around 20.6% of AS events as communicated from Anderson et al. (2012)188. Additionally, a recent report by Zhyvoloup et al. (2017) describes digoxin differentially regulating 557 genes (by ≥ 4 fold, p<0.05), however, the total number of genes (and alternative splicing events) captured was not reported220. Additional analysis of their RNA-Seq data, which I have recently obtained, could estimate the extent of these types of cellular changes by digoxin (compared to other HIV-1 RNA processing inhibitors set at similar variables). By comparison, normal cellular processes such as T cell activation can result in up to ~10% change in the total AS events in a cell262 whereas the majority of our HIV-1 RNA processing inhibitors apart from CSs affected much less: 0.02-0.26% with ≥20% change from ~10,000 events quantitated by RNA-seq (from 5342191 in Figs. 4.4d-e and 9147791) and 0-2.6% with ≥20% change from 70 events quantified by RT-PCR (from 5342191 in Fig. 4.7a, 9147791, 8-azaguanine, 5350150, 5227833, and 5183892)94,95. Further evaluation of 206

other CSs, especially ones with higher ex vivo or in vitro TIs such as digitoxigenin and bufalin (Table 3.1) could potentially reveal more unique differences between members of this family of drugs. There are many viruses that are dependent on host RNA processing to replicate, i.e. Adenovirus, Influenza, and many human oncogenic viruses (e.g. HPV)51,236,237. Since HIV-1 RNA processing inhibitors modulate host RNA processing, I hypothesized that other mammalian viruses that are critically dependent on this process could be controlled by these agents. CSs and 5342191 were found to potently suppress Adenovirus replication (Fig. 4.11)106. Consistent with affecting viral RNA processing, 5342191 induced changes in the accumulation of alternatively spliced isoforms of E1A mRNAs and blocked expression of all late viral protein-encoding RNAs assayed (Fig. 4.11g). The studies of this thesis highlight a new strategy of controlling multiple viral infections by targeting a common cellular process (RNA processing) with potentially limited side effects to the host. Future studies will test our repertoire of HIV-1 RNA processing inhibitors on other viruses dependent on cellular RNA processing.

5.6 Impact of HIV-1 RNA processing inhibitors on the potential evolution of drug resistant mutations in HIV

In theory, targeting HIV-1 RNA processing should reduce the chance of a virus evolving drug resistance mutations since this process is under the control of conserved host processes (e.g. splicing and splicing-regulatory factors and RNA transport factors) and viral components (e.g. cis- and trans-acting RNA elements, nuclear-cytoplasmic export/import signals on RNA/proteins, and regulatory factors). In support of this idea, the splicing modulator ABX464 inhibits HIV-1 replication in PBMCs (IC50: 100-500 nM) but the virus did not develop resistance in 24 weeks of selection whereas the non-nucleoside RT inhibitor, Nevirapine, induced viral resistance in only 3 weeks89. Monitoring of virus outgrowth in HIV infected PBMCs from patients treated with four different CSs, 8-Azaguanine, 5350150, or a preliminary test of 5342191 (n = 1) did not demonstrate any viral rebound in 3 weeks of treatment (Figs. 2.3c-d, 3.4, and 5.2)94,104. Further evaluation will be necessary to assess if these drugs will induce an HIV-resistance mutation(s), and to what exact process, in ≥24 weeks of selection. One potential caveat in performing such a long term selection is the possibility that the ex vivo TI of some of these drug/compounds may not be high enough, introducing cytotoxicity as a negative factor. 207

Moreover, assaying whether these inhibitors are effective against representative drug-resistant HIV strains (as tested in the 5342191 study) could address the potential of each of these drug/compounds in salvage and/or combinatory therapies, especially if a HIV-1 RNA processing inhibitor can prevent/reduce selection of a drug-resistance mutation with benefit to viral fitness.

5.7 CSs inhibit HIV-1 gene expression via signal transduction

Consistent with the literature, I observed that CSs activate multiple signaling pathways upon binding to the NKA (summarized in Fig. 3.20 from Figs. 3.1, 3.9-3.10, and 3.13-3.15)99–102. However, CSs alter a significant percentage of cellular genes expressed which may be attributed 2+ 116,131 2+ to their ability to induce changes in [Ca ]i . Their ability to alter Ca flux underlies their inotropic action on the heart but this is also their source of toxicity to humans (i.e. cardiac arrhythmias) when Ca2+ concentrations exceed the storage capacity of the sarco-/endoplasmic 116,206,207 2+ reticulum (Fig. 1.11) . Although each CS increases [Ca ]i upon addition to HIV-1 HeLa cells (Fig. 3.10d), I demonstrate that they can inhibit HIV-1 gene expression by a mechanism independent of changes in intracellular Ca2+ levels (Figs. 3.10e-f, Fig. 3.11) linked to potential arrhythmogenic effects of these drugs by use of a NCX inhibitor that blocks Ca2+ influx and arrhythmogenic Ca2+ overload of the sarco-/endoplasmic reticulum206. In addressing my hypothesis that CSs suppress HIV-1 gene expression through one of the induced signaling pathways, I was able to identify that nearly all CSs tested require, in part, MEK1/2-ERK1/2 signaling (by 2 highly specific inhibitors) but not the activation of other MAPKs (p38/JNK), PI3K-AKT, or Ca2+ influx (Figs. 3.10-3.15)277,278. Furthermore, we were able to mimic these inhibitory responses by depleting the CS receptor (NKA α subunit), which is known to activate Src and its signaling (Fig. 3.10a-c)110. Moreover, I was able to sufficiently reproduce a similar inhibitory response on HIV-1 gene expression by treatment of cells with a small molecule activator of MEK1/2-ERK1/2: anisomycin (and also later with 5342191, Figs. 3.14a-d and 3.15). This data supports the hypothesis that activation of the NKA-Src-EGFR-Ras-Raf-MEK1/2- ERK1/2 pathway contributes to inhibition of HIV-1 gene expression (Fig. 3.20). Our ability to achieve these responses via signaling provides an alternative approach for controlling HIV-1 infection.

208

However, partial rescue by MEK1/2 inhibitors, but not by other pathway inhibitors tested, suggest that we have identified only part of the inhibitory signals induced by CSs (Fig. 3.20). This is complicated by the presence of multiple signaling entry and feedback points within 2+ the pathway (Fig. 3.20). For instance, MAPK activation may require a rise in [Ca ]i and vice- versa since both pathways are linked via a positive feed-back cycle. Since other pathway inhibitors demonstrated no significant rescue of HIV-1 expression, these finding may suggest that these pathway inhibitors either lack the strength or specificity to decipher the 5 signals activated by CSs (Figs. 3.20) or an unknown signal may be initiated by CSs215,278,279. For instance, there is a general lack of specific inhibitors for PLC-IP3-IP3R interactions involved in 2+ Ca signaling. Widely used specific inhibitors for the IP3R, such as Xestospongin and 2-APB, are actually inhibitors of the SERCA and store-operated channels (SOCs), respectively280,281. In addition, an inhibitor available for PLC has been reported to have pleiotropic effects on cellular processes while progress for a specific inhibitor of this molecule is still at the HTS stage282. Also, some NCX inhibitors used for biomolecular studies, such as KB-R7943, have other reported nonspecific effects associated with them279. The widely used JNK1/2/3 inhibitor, SP600125, has multiple alternative targets, making it a rather weak (or nonspecific) inhibitor of JNK signaling215. In contrast, the MEK1/2-inhibitor U0126 had no off target kinases identified from these assays278, but one report found it reducing ERK5 (MEK5) activation252. In light of this, I confirmed the results in my study through another inhibitor of MEK1/2 signaling (selumetinib) which had extremely low selectivity entropy and described as the most selective kinase inhibitor by Uitdehaag et al. (2011)214. Further investigation using a kinome HTS (as described in Prassas et al., 2011) could be useful in identifying all signals involved in CS inhibition of HIV-1 gene expression196. This could potentially discover the exact signaling network(s) involved as well as any other unreported kinase(s) involved in the mechanism of action of CSs. And, in the absence of drug, this could be employed to reveal all signaling cascades that are critical for HIV-1 replication. Such a study has the potential to lead to many alternative signaling approaches for controlling HIV-1 infection. Moreover, since CSs have been reported to inhibit the propagation of other recently reported viruses, which may not require host RNA processing to survive, there may be a link between the inhibitory signals described here for HIV-1 and the antiviral effect of CSs on other viruses105–108. Future studies using a similar approach on other viruses could determine whether NKA/Src/EGFR/Ras/Raf/MEK1/2/ERK1/2 signaling (Figs. 3.20) is involved in any of 209

the inhibitory responses described. Since CSs can cause Ca2+ influx and overload of the sarco- /endoplasmic reticulum leading to cardiotoxicity in patients, but still inhibits HIV-1 gene expression independent of these properties (in the presence of the NCX influx inhibitor, KB- R7943), it would be reasonable to co-administer a suitable antiarrhythmic agent to any clinical trial with CSs as described above283. There are at least a dozen anti-arrhythmic drugs currently available which could serve this purpose283. Co-administration of an anti-arrhythmic agent and a CS could prevent the toxicities associated with this class of drugs, increasing their TIs, and improve the in vivo targeting efficacy of CSs toward HIV infection.

5.8 Compound 5342191 activates MEK1/2-ERK1/2 via G protein signaling

Since the effects of 5342191 on HIV-1 RNA processing resembled those of CSs, I hypothesized that this new inhibitor could be modulating similar signaling pathways. Consistent with this thought, 5342191 was found to activate MAP/MAPKs (ERK1/2, JNK1/2/3, and MAPKAPK-2, Fig. 4.13a-e). Similarly, highly specific inhibitors of MEK1/2 activity (U0126 and selumetinib) could rescue the majority of the effect of this compound on HIV-1 gene expression (Fig. 4.13g-i and 4.14c)214,278, supporting that the MEK1/2-ERK1/2 pathway is an important component in eliciting the inhibitory responses of several types of our HIV-1 RNA processing inhibitors identified to date (CSs, 5342191, and anisomycin). Whether or not other HIV-1 RNA processing inhibitors, such as 8-azaguanine, 5350150, 9147791, 5227833, 5183892, and other ones not described, utilize this pathway will require further investigation. 2+ 2+ In contrast, 5342191 neither altered [Ca ]i nor required Ca influx in its inhibitory response on HIV-1 gene expression (Figs. 4.13f-h). Although this compound activated MAPKAPK-2 (Figs. 4.22d-e), which is downstream target of p38 MAPK, it did not activate p38 MAPKs as observed for CSs or require its activity for suppressing HIV-1 gene expression (Figs. 4.13g-h). A plausible explanation for this discrepancy is that MAPKAPK-2 may be also a downstream substrate of ERK1/2 signaling (Fig. 4.19)284. These two differences highlight a major difference between 5342191 and CSs as novel inhibitors of HIV-1 RNA processing. In other words, application of 5342191 avoids the Ca2+-associated cardiotoxicity and altered cellular gene expression in humans as well as p38-induced inflammation, exhaustion, and apoptosis of T cells caused by CSs111,116,232. 210

Collectively, these results indicated 5342191 does not likely bind to the same receptor as CSs (NKA, Fig. 1.11)103,110,149. In testing an alternative hypothesis of activating MEK1/2- ERK1/2, I revealed that 5342191 inhibition of HIV-1 gene expression requires activation of G proteins (Fig. 4.18a), pinpointing that this compound likely initiates its inhibitory signal from a GPCR(s) at the cell membrane (Fig. 4.19)263. Moreover, these signals activate Ras and may partially require signals from transactivation of EGFR and activation of Src, which are both downstream effectors of GPCR signaling (Fig. 4.17a)263,285,286. Confirmation assays by SDS- PAGE detection of Gag-GFP fluorescence in cell lysates will confirm whether these signaling events are required by 5342191. To further support the hypothesis that G proteins and MEK1/2- ERK1/2 signaling are central to 5342191’s responses, I demonstrate that overexpression of small G proteins (Ras), immediately downstream of GPCRs ,were sufficient to inhibit HIV-1 gene expression (Fig. 4.17b-c)263. Future studies will attempt to identify the bonafide receptor for 5342191. Surprisingly, there are over 900 GPCRs (Fig. 4.19) with ~400-500 of them recognizing nonsensory ligands yet only ~200 GPCRs have known physiological ligands263,287. To potentially determine which receptor(s) is bound by 5342191, a representative member of each of the four families of G protein α subunits (i.e. Gαi1, Gαq, Gα13, and Gαs, Fig. 4.19) will be depleted by siRNAs (as previously described) in HeLa rtTA-HIV(Gag-GFP) cells prior to addition of 5342191 and analysis of viral Gag expression270,287.

5.9 Identification of MEK1/2-ERK1/2 downstream signaling effector(s) involved in controlling HIV-1 replication

In understanding the anti-HIV-1 inhibitory pathway identified, ERK1 and ERK2 are the only known substrates of MEK226 and, likewise, MEK1 and MEK2 are the only validated physiologically relevant substrates of Raf kinase (Fig. 1.11 or 4.19)227. However, other targets for MEK1/2 are unknown226. Further investigation into this pathway for modulating HIV-1 infection could turn towards ERK1/2 which, unlike MEK or Raf kinases, have at least 200 known substrates151,226. Along this pathway, I have addressed that CSs and 5342191 do not elicit a significant change in the levels of ROS in HIV-1 HeLa cells, suggesting that these drugs are not likely suppressing viral expression via release of this secondary messenger (Figs. 3.16a, 4.22a). Further studies to identify the downstream effector(s) necessary for causing this ARV response could be achieved by targeted knockdown or knockout of each of these 200 genes by 211

RNAi (shRNA) or CRISPR/Cas9 tools. One interesting candidate modulated by this pathway is the splicing factor, DAZAP1 (mentioned in Chapter 1.6.2), which is known to interact with/neutralize hnRNPs, and enhance splicing when recruited to a pre-mRNA70. Overexpression or knockdown of DAZAP1 may reveal whether this factor plays a role in HIV-1 replication.

5.10 Repurposing HIV-1 RNA processing inhibitors in the treatment of cancer

The EGFR-Ras-Raf pathway (Figs. 3.20 or 4.19) is aberrantly activated in approximately one- third of human cancers and found in 17 different types of cancers227,288. However, CSs have antiproliferative or apoptotic effects on many types of cancer cells and they are undergoing clinical trials to treat at least 8 types of cancers with over half of these (5) with this same signaling pathway activated109,131,196,227. Although there are multiple theories on how CSs kill cancer cells, one reports that inhibition of multiple kinases within this pathway (c- Src/EGFR/MEK/Rho-kinases) prevents digitoxin-induced apoptosis of pancreatic cancer cells109,196. This suggests CSs may kill cancer cells and suppress HIV-1 replication through a similar signaling mechanism. In addition to CSs (with possible exception of digitoxigenin), exploration of similar activators of the Src-EGFR-Ras-Raf-MEK1/2-ERK1/2 pathway for anti- cancer properties could be of value; among these candidates is 5342191 which could be evaluated as an anti-cancer drug in the similar manner as CSs109,131,196,227.

212

6 Conclusion

In the scope of this thesis, I identified that digoxin (Chapter 2) can inhibit HIV-1 replication through a novel mechanism without observed toxicity to cells, proving that targeting HIV-1 RNA processing is a viable strategy for controlling HIV-1 infection (Fig. 2.14)104. I extended these observations to over a dozen other CSs (Chapter 3), many of which have better inhibitor profiles than digoxin such as increased in vitro and ex vivo TIs and, possibly, improved in vivo TIs for controlling HIV infection than treating heart conditions. The findings of these studies support the notion of repurposing CSs as novel ARTs for controlling HIV infection104. Through interrogation of the signals initiated by CSs on the NKA signalosome (Chapter 3), I identified that CSs necessitate, in part, MEK1/2-ERK1/2 signaling to inhibit HIV-1 gene 2+ expression but does not require changes in [Ca ]i which are responsible for inducing toxicity in patients (Fig. 3.20). Supporting this hypothesis, depletion of the CS receptor and addition of a MEK1/2-ERK1/2 activator, anisomycin, inhibits HIV-1 gene expression (Figs. 3.17a-b, 3.15)208,209. While expanding our repertoire to over a half a dozen unique HIV-1 RNA processing inhibitors (Fig. 5.1)83,94,95,104, I determined that the compound 5342191 (Chapter 4) also inhibited HIV-1 gene expression through modulation of MEK1/2-ERK1/2 signaling (Fig. 4.19). I found that 5342191 utilizes a completely different pathway, requiring initiation of GPCR signaling to activate MEK1/2-ERK1/2 but not intracellular Ca2+ influx. Supporting this finding, overexpression of small G proteins (Ras) immediately downstream of GPCR signals were sufficient to inhibit HIV-1 gene expression. These results demonstrate that induction of either the NKA signalosome (Fig. 3.20) or GPCR signaling (Fig. 4.19)—leading to activation of MEK1/2- ERK1/2—can promote suppression of HIV-1 gene expression. The studies within this thesis provide the basis of an alternative approach for controlling HIV-1 infection. Furthermore, this thesis describes a whole family of FDA-approved drugs (Fig. 2.14, Chapter 2-3) and the compound 5342191 (Fig. 4.20, Chapter 4,) as novel inhibitors of two very different viruses (HIV-1 and Adenovirus) by targeting a common host process: RNA processing104,106. CSs (Fig. 2.14) and 5342191 (Fig. 4.20) were found to induce oversplicing of HIV-1 RNAs in cells leading to similar losses in the expression of vital viral structural and regulatory proteins104. However, I discovered that distinct differences exist between CS family members on the expression of HIV-1 regulatory proteins, especially Rev. Consistent with altering RNA processing, most CSs increase modification of SRp20 whereas digitoxigenin and

213

5342191 decrease modification of this splicing factor104. Since SRp20 overexpression can induce similar alterations in HIV-1 RNA accumulation as described for digoxin, changes in modification of this factor could underlie the response of most CSs104. Further experimentation will be necessary to determine the role of SRp20 dephosphorylation on HIV-1 RNA processing. Future studies will evaluate the efficacy of these drug/compounds on the replication of HIV-1 and Adenovirus using in vivo models of infection. Because of the dependency of many other mammalian viruses on host RNA processing, further studies should explore whether these compounds can inhibit the replication of viruses such as Influenza and human oncogenic viruses (e.g. HPV, etc.)51,236,237. On the other hand, since 5342191 induces similar signaling as CSs (Fig. 4.19 vs. 3.20), and do so with low perturbations in host gene expression, it could be tested for activity against various cancers responsive to CSs, especially pancreatic cancer cells which have been reported to be sensitive to Src/EGFR/MEK1/2-induced apoptosis by digitoxin227,288. The ability of these compounds to induce a specific intracellular signal (MEK1/2-ERK1/2) may potentially explain recent reports of how CSs can inhibit the replication of a broader range of viruses105–108. CSs and 5342191 could, therefore, be tested against other mammalian viruses regardless of their dependence on host RNA processing because of their ability to influence intracellular signaling. In summary, this thesis identifies many new inhibitors of HIV-1 RNA processing, suggests modulation of this stage to achieve broad spectrum impact on viruses dependent on this process, and supports targeting of a specific intracellular signaling pathway for controlling HIV-1 infection.

214

7 References

1. Fact sheet - Latest statistics on the status of the AIDS epidemic. UNAIDS (2017). Available at: http://www.unaids.org/en/resources/fact-sheet. 2. Sharp, P. M. & Hahn, B. H. Origins of HIV and the AIDS pandemic. Cold Spring Harb. Perspect. Med. 1, a006841 (2011). 3. Barré-Sinoussi, F., Chermann, J. C., Rey, F., Nugeyre, M. T., Chamaret, S., Gruest, J., Dauguet, C., Axler- Blin, C., Vézinet-Brun, F., Rouzioux, C., Rozenbaum, W. & Montagnier, L. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science (80-. ). 220, 868–71 (1983). 4. Greene, W. C. A history of AIDS: Looking back to see ahead. Eur. J. Immunol. 37, S94–S102 (2007). 5. Rambaut, A., Posada, D., Crandall, K. a & Holmes, E. C. The causes and consequences of HIV evolution. Nat. Rev. Genet. 5, 52–61 (2004). 6. Goulder, P. J. R. & Watkins, D. I. HIV and SIV CTL escape: implications for vaccine design. Nat. Rev. Immunol. 4, 630–40 (2004). 7. Sharp, P. M., Bailes, E., Robertson, D. L., Gao, F. & Hahn, B. H. Origins and Evolution of AIDS Viruses. Biol. Bull. 196, 338–342 (1999). 8. Hughes, D. & Andersson, D. I. Evolutionary consequences of drug resistance: shared principles across diverse targets and organisms. Nat Rev Genet 16, 459–471 (2015). 9. Walker, B. D. & Burton, D. R. Toward an AIDS vaccine. Science 320, 760–4 (2008). 10. McEnery, R. TRACKING HIV EVOLUTION. IAVI Report: The Publication on AIDS Vaccine Research 14, 4–9 (2010). 11. Thomas, C. Roadblocks in HIV research: five questions. Nat. Med. 15, 855–9 (2009). 12. Allers, K., Hutter, G., Hofmann, J., Loddenkemper, C., Rieger, K., Thiel, E. & Schneider, T. Evidence for the cure of HIV infection by CCR5 32/ 32 stem cell transplantation. Blood 117, 2791–2799 (2011). 13. Dubé, K., Ramirez, C., Handibode, J., Taylor, J., Skinner, A., Greene, S. & Tucker, J. D. Participation in HIV cure-related research: a scoping review of the proxy literature and implications for future research. J. virus Erad. 1, 250–256 (2015). 14. M Barry, S., Lora, A. J. M. & Novak, R. M. Trial, Error, and Breakthrough: A Review of HIV Vaccine Development. J. AIDS Clin. Res. 5, (2014). 15. Arts, E. J. & Hazuda, D. J. HIV-1 Antiretroviral Drug Therapy. Cold Spring Harb. Perspect. Med. 2, 1–24 (2012). 16. Pirrone, V., Thakkar, N., Jacobson, J. M., Wigdahl, B. & Krebs, F. C. Combinatorial approaches to the prevention and treatment of HIV-1 infection. Antimicrob. Agents Chemother. 55, 1831–42 (2011). 17. Cihlar, T. & Fordyce, M. Current status and prospects of HIV treatment. Curr. Opin. Virol. 18, 50–56 (2016). 18. Luzuriaga, K., Gay, H., Ziemniak, C., Sanborn, K. B., Somasundaran, M., Rainwater-Lovett, K., Mellors, J. W., Rosenbloom, D. & Persaud, D. Viremic relapse after HIV-1 remission in a perinatally infected child. N.

215

Engl. J. Med. 372, 786–8 (2015). 19. Margolis, A. M., Heverling, H., Pham, P. A. & Stolbach, A. A Review of the Toxicity of HIV Medications. J. Med. Toxicol. 10, 26–39 (2014). 20. Guidelines for the Use of Antiretroviral Agents in Adults and Adolescents Living with HIV. AIDSinfo (2017). Available at: https://aidsinfo.nih.gov/guidelines/html/1/adult-and-adolescent-arv/31/adverse-effects- of-arv. (Accessed: 27th November 2017) 21. Jain, V., Liegler, T., Vittinghoff, E., Hartogensis, W., Bacchetti, P., Poole, L., Loeb, L., Pilcher, C. D., Grant, R. M., Deeks, S. G. & Hecht, F. M. Transmitted drug resistance in persons with acute/early HIV-1 in San Francisco, 2002-2009. PLoS One 5, 1–4 (2010). 22. Resistance, U. C. G. on H. D. Time trends in drug resistant HIV-1 infections in the United Kingdom up to 2009: multicentre observational study. BMJ 345, 1–7 (2012). 23. Pennings, P. S. HIV drug resistance: Problems and perspectives. Infect. Dis. Rep. 5, 21–25 (2013). 24. Shen, M., Xiao, Y., Rong, L., Meyers, L. A. & Bellan, S. E. Early antiretroviral therapy and potent second- line drugs could decrease HIV incidence of drug resistance. Proc. R. Soc. B Biol. Sci. 284, (2017). 25. HIV DRUG RESISTANCE REPORT 2017. (2017). 26. Mehellou, Y. & De Clercq, E. Twenty-six years of anti-HIV drug discovery: where do we stand and where do we go? J. Med. Chem. 53, 521–38 (2010). 27. Purcell, D. F. J. & Martin, M. A. Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity. J. Virol. 67, 6365–78 (1993). 28. Cochrane, A. W., McNally, M. T. & Mouland, A. J. The retrovirus RNA trafficking granule: from birth to maturity. Retrovirology 3, 18 (2006). 29. Karn, J. & Stoltzfus, C. M. Transcriptional and posttranscriptional regulation of HIV-1 gene expression. Cold Spring Harb. Perspect. Med. 2, a006916 (2012). 30. Tazi, J., Bakkour, N., Marchand, V., Ayadi, L., Aboufirassi, A. & Branlant, C. Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action. FEBS J. 277, 867–76 (2010). 31. Caputi, M. Chapter 4. RNA Processing. The Regulation of HIV-1 mRNA Biogenesis. in Biochemistry, Genetics and Molecular Biology 79–100 (2011). doi:10.5772/20899 32. Stoltzfus, M. C. Chapter 1. Regulation of HIV-1 alternative RNA splicing and its role in virus replication. Advances in virus research 74, (Elsevier Inc., 2009). 33. Howard, J. M. & Sanford, J. R. THE RNAissance Family: SR proteins as multifaceted regulators of gene expression. Wiley Interdiscip Rev RNA 6, 93–110 (2015). 34. Stojdl, D. F. & Bell, J. C. REVIEW / SYNTHÈSE SR protein kinases : the splice of life. Cell 298, 293–298 (1999). 35. Emery, A., Zhou, S., Pollom, E. & Swanstrom, R. Characterizing HIV-1 Splicing by Using Next-Generation Sequencing. J. Virol. 91, e02515-16 (2017). 36. Ocwieja, K. E., Sherrill-Mix, S., Mukherjee, R., Custers-Allen, R., David, P., Brown, M., Wang, S., Link, D. R., Olson, J., Travers, K., Schadt, E. & Bushman, F. D. Dynamic regulation of HIV-1 mRNA populations analyzed by single-molecule enrichment and long-read sequencing. Nucleic Acids Res. 40, 10345–55 (2012).

216

37. McLaren, M., Marsh, K. & Cochrane, A. Modulating HIV-1 RNA processing and utilization. Front. Biosci. 13, 5693–707 (2008). 38. Jablonski, J. A. & Caputi, M. Role of cellular RNA processing factors in human immunodeficiency virus type 1 mRNA metabolism, replication, and infectivity. J. Virol. 83, 981–92 (2009). 39. Powell, D. M., Amaral, M. C., Wu, J. Y., Maniatis, T. & Greene, W. C. HIV Rev-dependent binding of SF2/ASF to the Rev response element: possible role in Rev-mediated inhibition of HIV RNA splicing. Proc. Natl. Acad. Sci. U. S. A. 94, 973–8 (1997). 40. Ropers, D., Ayadi, L., Gattoni, R., Jacquenet, S., Damier, L., Branlant, C. & Stévenin, J. Differential effects of the SR proteins 9G8, SC35, ASF/SF2, and SRp40 on the utilization of the A1 to A5 splicing sites of HIV- 1 RNA. J. Biol. Chem. 279, 29963–73 (2004). 41. Jacquenet, S., Decimo, D., Muriaux, D. & Darlix, J.-L. Dual effect of the SR proteins ASF/SF2, SC35 and 9G8 on HIV-1 RNA splicing and virion production. Retrovirology 2, 33 (2005). 42. Manley, J. L. & Krainer, A. R. A rational nomenclature for serine/arginine-rich protein splicing factors (SR proteins). Genes Dev. 24, 1073–4 (2010). 43. Corbo, C., Orrù, S. & Salvatore, F. SRp20: an overview of its role in human diseases. Biochem. Biophys. Res. Commun. 436, 1–5 (2013). 44. Shepard, P. J. & Hertel, K. J. Protein family review: The SR protein family. Genome Biol. 10, 1–9 (2009). 45. Haynes, C. & Iakoucheva, L. M. Serine/arginine-rich splicing factors belong to a class of intrinsically disordered proteins. Nucleic Acids Res. 34, 305–312 (2006). 46. Köhler, A. & Hurt, E. Exporting RNA from the nucleus to the cytoplasm. Nat. Rev. Mol. Cell Biol. 8, 761– 773 (2007). 47. Pollard, V. W. & Malim, M. H. The HIV-1 Rev Protein. Annu. Rev. Microbiol. 52, 491–532 (1998). 48. Cochrane, A., Murley, L. L., Gao, M., Wong, R., Clayton, K., Brufatto, N., Canadien, V., Mamelak, D., Chen, T., Richards, D., Zeghouf, M., Greenblatt, J., Burks, C. & Frappier, L. Stable complex formation between HIV Rev and the nucleosome assembly protein, NAP1, affects Rev function. Virology 388, 103–11 (2009). 49. Havens, M. A. & Hastings, M. L. Targeting RNA Splicing for Disease Therapy. Wiley Interdiscip Rev RNA 4, 247–266 (2013). 50. Da Silva, M. R., Moreira, G. A., Gonçalves Da Silva, R. A., De Almeida Alves Barbosa, É., Pais Siqueira, R., Teixera, R. R., Almeida, M. R., Silva Júnior, A., Fietto, J. L. R. & Bressan, G. C. Splicing regulators and their roles in cancer biology and therapy. Biomed Res. Int. 2015, (2015). 51. Ajiro, M. & Zheng, Z.-M. Oncogenes and RNA splicing of human tumor viruses. Emerg. Microbes Infect. 3, e63 (2014). 52. Chaudhury, A., Chander, P. & Howe, P. H. Heterogeneous nuclear ribonucleoproteins (hnRNPs) in cellular processes: Focus on hnRNP E1’s multifunctional regulatory roles. RNA 16, 1449–1462 (2010). 53. Zhou, Z. & Fu, X.-D. Regulation of Splicing by SR proteins and SR Protein-Specific Kinases. Chromosoma 122, 191–207 (2013). 54. Fukuhara, T., Hosoya, T., Shimizu, S., Sumi, K., Oshiro, T., Yoshinaka, Y., Suzuki, M., Yamamoto, N.,

217

Herzenberg, L. A., Herzenberg, L. A. & Hagiwara, M. Utilization of host SR protein kinases and RNA- splicing machinery during viral replication. Proc. Natl. Acad. Sci. U. S. A. 103, 11329–33 (2006). 55. Dowling, D., Nasr-Esfahani, S., Tan, C. H., O’Brien, K., Howard, J. L., Jans, D. A., Purcell, D. F., Stoltzfus, C. M. & Sonza, S. HIV-1 infection induces changes in expression of cellular splicing factors that regulate alternative viral splicing and virus production in macrophages. Retrovirology 5, 18 (2008). 56. Lund, N., Milev, M. P., Wong, R., Sanmuganantham, T., Woolaway, K., Chabot, B., Abou Elela, S., Mouland, A. J. & Cochrane, A. Differential effects of hnRNP D/AUF1 isoforms on HIV-1 gene expression. Nucleic Acids Res. 40, 3663–75 (2012). 57. Platt, C., Calimano, M., Nemet, J., Bubenik, J. & Cochrane, A. Differential effects of Tra2β isoforms on HIV-1 RNA processing and expression. PLoS One 10, 1–21 (2015). 58. Sinha, R., Allemand, E., Zhang, Z., Karni, R., Myers, M. P. & Krainer, A. R. Arginine Methylation Controls the Subcellular Localization and Functions of the Oncoprotein Splicing Factor SF2/ASF. Mol. Cell. Biol. 30, 2762–2774 (2010). 59. Mathew, R., Hartmuth, K., Möhlmann, S., Urlaub, H., Ficner, R. & Lührmann, R. Phosphorylation of human PRP28 by SRPK2 is required for integration of the U4/U6-U5 tri-snRNP into the spliceosome. Nat. Struct. Mol. Biol. 15, 435–43 (2008). 60. Stamm, S. Regulation of alternative splicing by reversible protein phosphorylation. J. Biol. Chem. 283, 1223–7 (2008). 61. Giannakouros, T., Nikolakaki, E., Mylonis, I. & Georgatsou, E. Serine-arginine protein kinases: A small protein kinase family with a large cellular presence. FEBS J. 278, 570–586 (2011). 62. Ghosh, G. & Adams, J. A. Phosphorylation mechanism and structure of serine-arginine protein kinases. FEBS J. 278, 587–597 (2011). 63. Ngo, J. C. K., Chakrabarti, S., Ding, J.-H., Velazquez-Dones, A., Nolen, B., Aubol, B. E., Adams, J. A., Fu, X.-D. & Ghosh, G. Interplay between SRPK and Clk/Sty Kinases in Phosphorylation of the Splicing Factor ASF/SF2 Is Regulated by a Docking Motif in ASF/SF2. Mol. Cell 20, 77–89 (2005). 64. Bullock, A. N., Das, S., Debreczeni, J. É., Rellos, P., Fedorov, O., Niesen, H., Guo, K., Papagrigoriou, E., Amos, A. L., Cho, S., Turk, B. E., Ghosh, G. & Knapp, S. Structure. Structure 17, 352–362 (2009). 65. Colwill, K., Feng, L. L., Yeakley, J. M., Gish, G. D., Cáceres, J. F., Pawson, T. & Fu, X. D. SRPK1 and Clk/Sty protein kinases show distinct substrate specificities for serine/arginine-rich splicing factors. J. Biol. Chem. 271, 24569–75 (1996). 66. Mclaren, M., Asai, K. & Cochrane, A. A novel function for Sam68: enhancement of HIV-1 RNA 3’ end processing. RNA 10, 1119–29 (2004). 67. Marsh, K., Soros, V. & Cochrane, A. Selective translational repression of HIV-1 RNA by Sam68DeltaC occurs by altering PABP1 binding to unspliced viral RNA. Retrovirology 5, 97 (2008). 68. Matter, N., Herrlich, P. & König, H. Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature 420, 691–695 (2002). 69. Shirakihara, T., Horiguchi, K., Miyazawa, K., Ehata, S., Shibata, T., Morita, I., Miyazono, K. & Saitoh, M. TGF-β regulates isoform switching of FGF receptors and epithelial-mesenchymal transition. EMBO J. 30,

218

783–795 (2011). 70. Choudhury, R., Roy, S. G., Tsai, Y. S., Tripathy, A., Graves, L. M. & Wang, Z. The splicing activator DAZAP1 integrates splicing control into MEK/Erk-regulated cell proliferation and migration. Nat. Commun. 5, 3078 (2014). 71. Zhou, Z., Qiu, J., Liu, W., Zhou, Y., Plocinik, R. M., Li, H., Hu, Q., Ghosh, G., Adams, J. A., Rosenfeld, M. G. & Fu, X.-D. The Akt-SRPK-SR Axis Constitutes a Major Pathway in Transducing EGF Signaling to Regulate Alternative Splicing in the Nucleus. Mol. Cell 47, 422–433 (2012). 72. Jiang, K., Patel, N. a, Watson, J. E., Apostolatos, H., Kleiman, E., Hanson, O., Hagiwara, M. & Cooper, D. R. Akt2 regulation of Cdc2-like kinases (Clk/Sty), serine/arginine-rich (SR) protein phosphorylation, and insulin-induced alternative splicing of PKCbetaII messenger ribonucleic acid. Endocrinology 150, 2087–97 (2009). 73. Patel, N. a, Kaneko, S., Apostolatos, H. S., Bae, S. S., Watson, J. E., Davidowitz, K., Chappell, D. S., Birnbaum, M. J., Cheng, J. Q. & Cooper, D. R. Molecular and genetic studies imply Akt-mediated signaling promotes protein kinase CbetaII alternative splicing via phosphorylation of serine/arginine-rich splicing factor SRp40. J. Biol. Chem. 280, 14302–9 (2005). 74. Heyd, F. & Lynch, K. W. Phosphorylation-Dependent Regulation of PSF by GSK3 Controls CD45 Alternative Splicing. Mol. Cell 40, 126–137 (2010). 75. Izquierdo, J. M. & Valcárcel, J. Fas-activated Serine/Threonine Kinase (FAST K) Synergizes with TIA- 1/TIAR Proteins to Regulate Fas Alternative Splicing. J. Biol. Chem. 282, 1539–1543 (2007). 76. van der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J., Krainer, A. R., Moscat, J. & Cáceres, J. F. The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. J. Cell Biol. 149, 307–16 (2000). 77. Xie, J. Control of alternative pre-mRNA splicing by Ca++ signals. Biochim. Biophys. Acta 1779, 438–52 (2008). 78. Xie, J. & Black, D. L. A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels. Nature 410, 936–939 (2001). 79. Xie, J., Jan, C., Stoilov, P., Park, J. & Black, D. L. A consensus CaMK IV-responsive RNA sequence mediates regulation of alternative exons in neurons. RNA 11, 1825–1834 (2005). 80. Daoud, R., Da Penha Berzaghi, M., Siedler, F., Hübener, M. & Stamm, S. Activity-dependent regulation of alternative splicing patterns in the rat brain. Eur. J. Neurosci. 11, 788–802 (1999). 81. Daoud, R., Mies, G., Smialowska, A., Oláh, L., Hossmann, K.-A. & Stamm, S. Ischemia induces a translocation of the splicing factor tra2-beta 1 and changes alternative splicing patterns in the brain. J. Neurosci. 22, 5889–99 (2002). 82. An, P. & Grabowski, P. J. Exon silencing by UAGG motifs in response to neuronal excitation. PLoS Biol. 5, e36 (2007). 83. Wong, R., Balachandran, A., Mao, A. Y. Q., Dobson, W., Gray-owen, S. & Cochrane, A. Differential effect of CLK SR Kinases on HIV-1 gene expression : potential novel targets for therapy. Retrovirology 8, 47 (2011).

219

84. Younis, I., Berg, M., Kaida, D., Dittmar, K., Wang, C. & Dreyfuss, G. Rapid-response splicing reporter screens identify differential regulators of constitutive and alternative splicing. Mol. Cell. Biol. 30, 1718–28 (2010). 85. Muraki, M., Ohkawara, B., Hosoya, T., Onogi, H., Koizumi, J., Koizumi, T., Sumi, K., Yomoda, J., Murray, M. V, Kimura, H., Furuichi, K., Shibuya, H., Krainer, A. R., Suzuki, M. & Hagiwara, M. Manipulation of alternative splicing by a newly developed inhibitor of Clks. J. Biol. Chem. 279, 24246–54 (2004). 86. Zhou, X., Vink, M., Berkhout, B. & Das, A. T. Modification of the Tet-On regulatory system prevents the conditional-live HIV-1 variant from losing doxycycline-control. Retrovirology 3, 82 (2006). 87. Soret, J., Bakkour, N., Maire, S., Durand, S., Zekri, L., Gabut, M., Fic, W., Divita, G., Rivalle, C., Dauzonne, D., Nguyen, C. H., Jeanteur, P. & Tazi, J. Selective modification of alternative splicing by indole derivatives that target serine-arginine-rich protein splicing factors. Proc. Natl. Acad. Sci. U. S. A. 102, 8764– 9 (2005). 88. Bakkour, N., Lin, Y.-L., Maire, S., Ayadi, L., Mahuteau-Betzer, F., Nguyen, C. H., Mettling, C., Portales, P., Grierson, D., Chabot, B., Jeanteur, P., Branlant, C., Corbeau, P. & Tazi, J. Small-molecule inhibition of HIV pre-mRNA splicing as a novel antiretroviral therapy to overcome drug resistance. PLoS Pathog. 3, 1530–9 (2007). 89. Campos, N., Myburgh, R., Garcel, A., Vautrin, A., Lapasset, L., Nadal, E. S., Mahuteau-Betzer, F., Najman, R., Fornarelli, P., Tantale, K., Basyuk, E., Séveno, M., Venables, J. P., Pau, B., Bertrand, E., Wainberg, M. a, Speck, R. F., Scherrer, D. & Tazi, J. Long lasting control of viral rebound with a new drug ABX464 targeting Rev – mediated viral RNA biogenesis. Retrovirology 12, 30 (2015). 90. Shkreta, L., Blanchette, M., Toutant, J., Wilhelm, E., Bell, B., Story, B. A., Balachandran, A., Cochrane, A., Cheung, P. K., Harrigan, P. R., Grierson, D. S. & Chabot, B. Modulation of the splicing regulatory function of SRSF10 by a novel compound that impairs HIV-1 replication. Nucleic Acids Res. 45, 4051–4067 (2017). 91. Cheung, P. K., Horhant, D., Bandy, L. E., Zamiri, M., Rabea, S. M., Karagiosov, S. K., Matloobi, M., McArthur, S., Harrigan, P. R., Chabot, B. & Grierson, D. S. A Parallel Synthesis Approach to the Identification of Novel Diheteroarylamide-Based Compounds Blocking HIV Replication: Potential Inhibitors of HIV-1 Pre-mRNA Alternative Splicing. J. Med. Chem. 59, 1869–1879 (2016). 92. Malim, M, Böhnlein, S, Hauber, J, Cullen, B. Functional dissection of the HIV-1 Rev trans-activator— Derivation of a trans-dominant repressor of Rev function. Cell 58, 205–214 (1989). 93. Prado, S., Beltrán, M., Coiras, M., Bedoya, L. M., Alcamí, J. & Gallego, J. Bioavailable inhibitors of HIV-1 RNA biogenesis identified through a Rev-based screen. Biochem. Pharmacol. 107, 14–28 (2016). 94. Wong, R. W., Balachandran, A., Haaland, M., Stoilov, P. & Cochrane, A. Characterization of novel inhibitors of HIV-1 replication that function via alteration of viral RNA processing and rev function. Nucleic Acids Res. 41, 9471–9483 (2013). 95. Balachandran, A., Wong, R., Stoilov, P., Pan, S., Blencowe, B., Cheung, P., Harrigan, P. R. & Cochrane, A. Identification of small molecule modulators of HIV-1 Tat and Rev protein accumulation. Retrovirology 14, 7 (2017). 96. Connelly, C. M., Moon, M. H. & Schneekloth, J. S. The Emerging Role of RNA as a Therapeutic Target for

220

Small Molecules. Cell Chem. Biol. 23, 1077–1090 (2016). 97. Stoilov, P., Lin, C.-H., Damoiseaux, R., Nikolic, J. & Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proc. Natl. Acad. Sci. U. S. A. 105, 11218– 23 (2008). 98. Hermann, T. Small molecules targeting viral RNA. Wiley Interdiscip. Rev. RNA 7, 726–743 (2016). 99. Kometiani, P., Li, J., Gnudi, L., Kahn, B., Askari, A., Xie, Z. & Kahn, B. B. Multiple Signal Transduction Pathways Link Na+/K+-ATPase to Growth-related Genes in Cardiac Myocytes : The Roles of Ras and Mitogen-activated Protein Kinases. J. Biol. Chem. 273, 15249–15256 (1998). 100. Haas, M., Wang, H., Tian, J. & Xie, Z. Src-mediated inter-receptor cross-talk between the Na+/K+-ATPase and the epidermal growth factor receptor relays the signal from ouabain to mitogen-activated protein kinases. J. Biol. Chem. 277, 18694–702 (2002). 101. Liu, J., Tian, J., Haas, M., Shapiro, J. I., Askari, A. & Xie, Z. Ouabain interaction with cardiac Na+/K+- ATPase initiates signal cascades independent of changes in intracellular Na+ and Ca2+ concentrations. J. Biol. Chem. 275, 27838–44 (2000). 102. Aizman, O., Uhlén, P., Lal, M., Brismar, H. & Aperia, A. Ouabain, a steroid hormone that signals with slow calcium oscillations. Proc. Natl. Acad. Sci. U. S. A. 98, 13420–4 (2001). 103. Kometiani, P., Liu, L. & Askari, A. Digitalis-Induced Signaling by Na+/K+-ATPase in Human Breast Cancer Cells. Mol. Pharmacol. 67, 929–936 (2005). 104. Wong, R. W., Balachandran, A., Ostrowski, M. A. & Cochrane, A. Digoxin Suppresses HIV-1 Replication by Altering Viral RNA Processing. PLoS Pathog. 9, e1003241 (2013). 105. Ashbrook, A. W., Lentscher, A. J., Zamora, P. F., Silva, L. A., May, N. A., Bauer, J. A., Morrison, T. E. & Dermody, T. S. Antagonism of the sodium-potassium ATPase impairs chikungunya virus infection. MBio 7, 1–14 (2016). 106. Grosso, F., Stoilov, P., Lingwood, C., Brown, M. & Cochrane, A. Suppression of Adenovirus Replication by Cardiotonic Steroids. J. Virol. 91, e01623-16 (2017). 107. Dodson, Allen W., Taylor, Travis J, Knipe, David M., and Coena, D. M. Inhibitors of the Sodium Potassium ATPase that Impair Herpes Simplex Virus Replication Identified via a Chemical Screening Approach. Virology 366, 340–348 (2007). 108. Kapoor, A., Cai, H., Forman, M., He, R., Shamay, M. & Arav-Boger, R. Human cytomegalovirus inhibition by cardiac glycosides: Evidence for involvement of the hERG gene. Antimicrob. Agents Chemother. 56, 4891–4899 (2012). 109. Prassas, I. & Diamandis, E. P. Novel therapeutic applications of cardiac glycosides. Nat. Rev. Drug Discov. 7, 926–35 (2008). 110. Reinhard, L., Tidow, H., Clausen, M. J. & Nissen, P. Na+,K+-ATPase as a docking station: Protein-protein complexes of the Na+,K+-ATPase. Cell. Mol. Life Sci. 70, 205–222 (2013). 111. Mijatovic, T., Van Quaquebeke, E., Delest, B., Debeir, O., Darro, F. & Kiss, R. Cardiotonic steroids on the road to anti-cancer therapy. Biochim. Biophys. Acta 1776, 32–57 (2007). 112. Bagrov, A. Y., Shapiro, J. I. & Fedorova, O. V. Endogenous Cardiotonic Steroids : Physiology ,

221

Pharmacology , and Novel Therapeutic Targets. 61, 9–38 (2009). 113. Chen, K. K. & Kovarikova, A. Pharmacology and toxicology of toad venom. J. Pharm. Sci. 56, 1535–1541 (1967). 114. Campbell, T. J. & Macdonald, P. S. New drugs, old drugs: Digoxin in heart failure and cardiac arrhythmias. Med. J. Aust. 179, 99–102 (2003). 115. Ehle, M., Patel, C. & Giugliano, R. P. Digoxin: clinical highlights: a review of digoxin and its use in contemporary medicine. Crit. Pathw. Cardiol. 10, 93–8 (2011). 116. Wasserstrom, J. A. & Aistrup, G. L. Digitalis: new actions for an old drug. Am. J. Physiol. Heart Circ. Physiol. 289, H1781-93 (2005). 117. Cowie, M. R., Savage, H. O. Digoxin - time for its rehabilitation? Int. J. Clin. Pract. 65, 1207–8 (2011). 118. Showkat A. & Movahed, A. Update on Digoxin Therapy in Congestive Heart Failure. Am. Fam. Physician 62, 409–416 (2000). 119. SKOU, J. C. The influence of some cations on an adenosine triphosphatase from peripheral nerves. Biochim. Biophys. Acta 23, 394–401 (1957). 120. Milligan LP, M. B. Energy costs of ion pumping by animal tissues. J Nutr. 115, 1374–82 (1985). 121. Ramsey, J. J. & Hagopian, K. Energy expenditure and restriction of energy intake: could energy restriction alter energy expenditure in companion animals? J. Nutr. 136, 1958S–1966S (2006). 122. Erecińska, M. & Silver, I. A. Ions and energy in mammalian brain. Prog. Neurobiol. 43, 37–71 (1994). 123. Morth, J. P., Pedersen, B. P., Toustrup-Jensen, M. S., Sørensen, T. L.-M., Petersen, J., Andersen, J. P., Vilsen, B. & Nissen, P. Crystal structure of the sodium–potassium pump. Nature 450, 1043–1049 (2007). 124. Ogawa, H., Shinoda, T., Cornelius, F. & Toyoshima, C. Crystal structure of the sodium-potassium pump (Na+,K+-ATPase) with bound potassium and ouabain. Proc. Natl. Acad. Sci. U. S. A. 106, 13742–7 (2009). 125. Nyblom, M., Poulsen, H., Gourdon, P., Reinhard, L., Andersson, M., Lindahl, E., Fedosova, N. & Nissen, P. Crystal structure of Na+, K(+)-ATPase in the Na(+)-bound state. Science 342, 123–7 (2013). 126. Shull, G. E., Greeb, J. & Lingrel, J. B. Molecular cloning of three distinct forms of the Na+,K+-ATPase alpha- subunit from rat brain. Biochemistry 25, 8125–8132 (1986). 127. Mijatovic, T. & Kiss, R. Cardiotonic STEROIDS-MEDIATED Na+/K+-ATPase targeting could circumvent various chemoresistance pathways. Planta Med. 79, 189–198 (2013). 128. Morth, J. P., Pedersen, B. P., Buch-Pedersen, M. J., Andersen, J. P., Vilsen, B., Palmgren, M. G. & Nissen, P. A structural overview of the plasma membrane Na+,K+-ATPase and H+-ATPase ion pumps. Nat. Rev. Mol. Cell Biol. 12, 60–70 (2011). 129. Pongrakhananon, V. Chapter 3: Anticancer Properties of Cardiac Glycosides. in Cancer Treatment - Conventional and Innovative Approaches 65–83 (2013). doi:10.5772/55381 130. Katz, A., Lifshitz, Y., Bab-Dinitz, E., Kapri-Pardes, E., Goldshleger, R., Tal, D. M. & Karlish, S. J. D. Selectivity of digitalis glycosides for isoforms of human Na,K-ATPase. J. Biol. Chem. 285, 19582–92 (2010). 131. Schoner, W. & Scheiner-Bobis, G. Endogenous and exogenous cardiac glycosides: their roles in hypertension, salt metabolism, and cell growth. Am. J. Physiol. Cell Physiol. 293, C509-36 (2007).

222

132. Reuter, H., Henderson, S. A., Han, T., Ross, R. S., Goldhaber, J. I. & Philipson, K. D. The Na+-Ca2+ exchanger is essential for the action of cardiac glycosides. Circ. Res. 90, 305–8 (2002). 133. Liu, J. & Xie, Z.-J. The sodium pump and cardiotonic steroids-induced signal transduction protein kinases and calcium-signaling microdomain in regulation of transporter trafficking. Biochim. Biophys. Acta 1802, 1237–45 (2010). 134. Aydemir-Koksoy, A., Abramowitz, J. & Allen, J. C. Ouabain-induced Signaling and Vascular Smooth Muscle Cell Proliferation. J. Biol. Chem. 276, 46605–46611 (2001). 135. Haas, M., Askari, a & Xie, Z. Involvement of Src and epidermal growth factor receptor in the signal- transducing function of Na+/K+-ATPase. J. Biol. Chem. 275, 27832–7 (2000). 136. Weigand, K. M., Swarts, H. G. P., Fedosova, N. U., Russel, F. G. M. & Koenderink, J. B. Na,K-ATPase activity modulates Src activation: a role for ATP/ADP ratio. Biochim. Biophys. Acta 1818, 1269–73 (2012). 137. Gable, M. E., Abdallah, S. L., Najjar, S. M., Liu, L. & Askari, A. Digitalis-induced cell signaling by the sodium pump: On the relation of Src to Na+/K+-ATPase. Biochem. Biophys. Res. Commun. 446, 1151–1154 (2014). 138. Liang, M., Cai, T., Tian, J., Qu, W. & Xie, Z.-J. J. Functional characterization of Src-interacting Na/K- ATPase using RNA interference assay. J. Biol. Chem. 281, 19709–19 (2006). 139. Chen, Y., Cai, T., Wang, H., Li, Z., Loreaux, E., Lingrel, J. B. & Xie, Z. Regulation of Intracellular Cholesterol Distribution by Na/K-ATPase. J. Biol. Chem. 284, 14881–14890 (2009). 140. Miyakawa-Naito, A., Uhlén, P., Lal, M., Aizman, O., Mikoshiba, K., Brismar, H., Zelenin, S. & Aperia, A. Cell signaling microdomain with Na,K-ATPase and inositol 1,4,5-trisphosphate receptor generates calcium oscillations. J. Biol. Chem. 278, 50355–61 (2003). 141. Yuan, Z., Cai, T., Tian, J., Ivanov, A. V, Giovannucci, D. R. & Xie, Z. Na/K-ATPase Tethers Phospholipase C and IP3 Receptor into a Calcium-regulatory Complex. 16, 4034–4045 (2005). 142. Zhang, S., Malmersjö, S., Li, J., Ando, H., Aizman, O., Uhlén, P., Mikoshiba, K. & Aperia, A. Distinct role of the N-terminal tail of the Na,K-ATPase catalytic subunit as a signal transducer. J. Biol. Chem. 281, 21954–62 (2006). 143. Berridge, M. J., Lipp, P. & Bootman, M. D. The Versatility and Universality of Calcium Signalling. Nat. Rev. Mol. Cell Biol. 1, 1–11 (2000). 144. Way, K. J., Chou, E. & King, G. L. Identification of PKC-isoform-specific biological actions using pharmacological approaches. Trends Pharmacol. Sci. 21, 181–7 (2000). 145. Blaustein MP, Juhaszova M, G. V., Blaustein, M. P., Juhaszova, M. & Golovina, V. A. The cellular mechanism of action of cardiotonic steroids: a new hypothesis. Clin Exp Hypertens 20, 691–703 (1998). 146. Song, H., Lee, M. Y., Kinsey, S. P., Weber, D. J. & Blaustein, M. P. An N-terminal sequence targets and tethers Na+ pump a2 subunits to specialized plasma membrane microdomains. J. Biol. Chem. 281, 12929– 12940 (2006). 147. Tian, J., Gong, X. & Xie, Z. Signal-transducing function of Na+-K+-ATPase is essential for ouabain’s effect on [Ca2+]i in rat cardiac myocytes. 5804, 1899–1907 (2001). 148. Xie, Z., Kometiani, P., Liu, J., Li, J., Shapiro, J. I. & Askari, a. Intracellular reactive oxygen species

223

mediate the linkage of Na+/K+-ATPase to hypertrophy and its marker genes in cardiac myocytes. J. Biol. Chem. 274, 19323–8 (1999). 149. Feng, S., Chen, W., Cao, D., Bian, J., Gong, F.-Y., Cheng, W., Cheng, S., Xu, Q., Hua, Z.-C. & Yin, W. Involvement of Na+, K+-ATPase and its inhibitors in HuR-mediated cytokine mRNA stabilization in lung epithelial cells. Cell. Mol. life Sci. 68, 109–24 (2011). 150. Mohammadi, K., Kometiani, P., Xie, Z. & Askari, a. Role of protein kinase C in the signal pathways that link Na+/K+-ATPase to ERK1/2. J. Biol. Chem. 276, 42050–6 (2001). 151. Yoon, S. & Seger, R. The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors 24, 21–44 (2006). 152. McCubrey, J. A., Steelman, L. S., Chappell, W. H., Abrams, S. L., Wong, E. W. T., Chang, F., Lehmann, B., Terrian, D. M., Milella, M., Tafuri, A., Stivala, F., Libra, M., Basecke, J., Evangelisti, C., Martelli, A. M. & Franklin, R. a. Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Biochim. Biophys. Acta 1773, 1263–84 (2007). 153. Holmström, K. M. & Finkel, T. Cellular mechanisms and physiological consequences of redox-dependent signalling. Nat. Rev. Mol. Cell Biol. 15, 411–421 (2014). 154. Liu, L., Zhao, X., Pierre, S. V. & Askari, A. Association of PI3K-Akt signaling pathway with digitalis- induced hypertrophy of cardiac myocytes. AJP Cell Physiol. 293, C1489–C1497 (2007). 155. Yudowski, G. A., Efendiev, R., Pedemonte, C. H., Katz, A. I., Berggren, P. O. & Bertorello, A. M. Phosphoinositide-3 kinase binds to a proline-rich motif in the Na+, K+-ATPase alpha subunit and regulates its trafficking. Proc. Natl. Acad. Sci. U. S. A. 97, 6556–61 (2000). 156. Hillebrand, F., Erkelenz, S., Diehl, N., Widera, M., Noffke, J., Avota, E., Schneider-Schaulies, S., Dabauvalle, M. C. & Schaal, H. The PI3K pathway acting on alternative HIV-1 pre-mRNA splicing. J. Gen. Virol. 95, 1809–1815 (2014). 157. Eva, A., Kirch, U. & Scheiner-Bobis, G. Signaling pathways involving the sodium pump stimulate NO production in endothelial cells. Biochim. Biophys. Acta 1758, 1809–14 (2006). 158. Flexner, C. HIV drug development: the next 25 years. Nat. Rev. Drug Discov. 6, 959–66 (2007). 159. Little, S. J., Holte, S., Routy, J.-P., Daar, E. S., Markowitz, M., Collier, A. C., Koup, R. A., Mellors, J. W., Connick, E., Conway, B., Kilby, M., Wang, L., Whitcomb, J. M., Hellmann, N. S. & Richman, D. D. Antiretroviral-drug resistance among patients recently infected with HIV. N. Engl. J. Med. 347, 385–94 (2002). 160. Martinez-Picado, J., DePasquale, M. P., Kartsonis, N., Hanna, G. J., Wong, J., Finzi, D., Rosenberg, E., Gunthard, H. F., Sutton, L., Savara, a, Petropoulos, C. J., Hellmann, N., Walker, B. D., Richman, D. D., Siliciano, R. & D’Aquila, R. T. Antiretroviral resistance during successful therapy of HIV type 1 infection. Proc. Natl. Acad. Sci. U. S. A. 97, 10948–53 (2000). 161. Struble, K., Murray, J., Cheng, B., Gegeny, T., Miller, V. & Gulick, R. Antiretroviral therapies for treatment-experienced patients: current status and research challenges. AIDS 19, 747–56 (2005). 162. Horn, T. One in six new HIV cases involves drug-resistant virus. AIDSmeds.com (2010). Available at: http://www.aidsmeds.com/articles/hiv_drug_resistance_transmission_1667_18071.shtml. (Accessed: 14th

224

April 2011) 163. Horn, T. ICAAC: More Drug-Resistant HIV? POZ - Treatment News (September 29) (2006). Available at: http://www.poz.com/articles/761_10641.shtml. (Accessed: 14th April 2011) 164. Tian, R., Liao, Q. & Chen, X. Current status of targets and assays for anti-HIV drug screening. Virol. Sin. 22, 476–485 (2008). 165. Scherer, L., Rossi, J. J. & Weinberg, M. S. Progress and prospects: RNA-based therapies for treatment of HIV infection. Gene Ther. 14, 1057–64 (2007). 166. Tsygankov, A. Y. Current developments in anti-HIV/AIDS gene therapy. Curr. Opin. Investig. Drugs 10, 137–49 (2009). 167. Zhou, H., Xu, M., Huang, Q., Gates, A. T., Zhang, X. D., Castle, J. C., Stec, E., Ferrer, M., Strulovici, B., Hazuda, D. J. & Espeseth, A. S. Genome-scale RNAi screen for host factors required for HIV replication. Cell Host Microbe 4, 495–504 (2008). 168. König, R., Zhou, Y., Elleder, D., Diamond, T. L., Bonamy, G. M. C., Irelan, J. T., Chiang, C.-Y., Tu, B. P., De Jesus, P. D., Lilley, C. E., Seidel, S., Opaluch, A. M., Caldwell, J. S., Weitzman, M. D., Kuhen, K. L., Bandyopadhyay, S., Ideker, T., Orth, A. P., Miraglia, L. J., et al. Global analysis of host-pathogen interactions that regulate early-stage HIV-1 replication. Cell 135, 49–60 (2008). 169. Brass, A. L., Dykxhoorn, D. M., Benita, Y., Yan, N., Engelman, A., Xavier, R. J., Lieberman, J. & Elledge, S. J. Identification of host proteins required for HIV infection through a functional genomic screen. Science (80-. ). 319, 921–6 (2008). 170. Schwartz, S., Felber, B. K., Benko, D. M., Fenyö, E. M. & Pavlakis, G. N. Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency virus type 1. J. Virol. 64, 2519–29 (1990). 171. Stoltzfus, C. M. & Madsen, J. M. Role of viral splicing elements and cellular RNA binding proteins in regulation of HIV-1 alternative RNA splicing. Curr. HIV Res. 4, 43–55 (2006). 172. Cullen, B. R. Nuclear mRNA export: insights from virology. Trends Biochem. Sci. 28, 419–424 (2003). 173. Cullen, B. R. Using retroviruses to study the nuclear export of mRNA. Results Probl. Cell Differ. 35, 151– 68 (2002). 174. Jeang, K. T., Xiao, H. & Rich, E. a. Multifaceted activities of the HIV-1 transactivator of transcription, Tat. J. Biol. Chem. 274, 28837–40 (1999). 175. Hope, T. J. The ins and outs of HIV Rev. Arch. Biochem. Biophys. 365, 186–191 (1999). 176. Mandal, D., Feng, Z. & Stoltzfus, C. M. Gag-processing defect of human immunodeficiency virus type 1 integrase E246 and G247 mutants is caused by activation of an overlapping 5’ splice site. J. Virol. 82, 1600– 4 (2008). 177. Madsen, J. M. & Stoltzfus, C. M. An Exonic Splicing Silencer Downstream of the 3Ј Splice Site A2 Is Required for Efficient Human Immunodeficiency Virus Type 1 Replication. J. Virol. 79, 10478–10486 (2005). 178. Zheng, Y.-H., Yu, H.-F. & Peterlin, B. M. Human p32 protein relieves a post-transcriptional block to HIV replication in murine cells. Nat. Cell Biol. 5, 611–8 (2003). 179. Hauptman, P. J. & Kelly, R. A. Digitalis Mechanism of Action. Circulation 99, 1265–1270 (1999).

225

180. Zhou, X., Vink, M., Klaver, B., Verhoef, K., Marzio, G., Das, A. T. & Berkhout, B. The genetic stability of a conditional live HIV-1 variant can be improved by mutations in the Tet-On regulatory system that restrain evolution. J. Biol. Chem. 281, 17084–91 (2006). 181. Keriel, A., Mahuteau-Betzer, F., Jacquet, C., Plays, M., Grierson, D., Sitbon, M. & Tazi, J. Protection against retrovirus pathogenesis by SR protein inhibitors. PLoS One 4, (2009). 182. Micheva-viteva, S., Pacchia, A. L., Ron, Y., Peltz, S. W. & Dougherty, J. P. Human Immunodeficiency Virus Type 1 Latency Model for High-Throughput Screening. Antimicrob. Agents Chemother. 49, 5185– 5188 (2005). 183. Zacharias, D. A. & Strehler, E. E. Change in plasma membrane Ca2(+)-ATPase splice-variant expression in response to a rise in intracellular Ca2+. Curr. Biol. 6, 1642–52 (1996). 184. Stamm, S. Signals and their transduction pathways regulating alternative splicing: a new dimension of the human genome. Hum. Mol. Genet. 11, 2409–16 (2002). 185. Nayler, O., Stamm, S. & Ullrich, A. Characterization and comparison of four serine- and arginine-rich (SR) protein kinases. Biochem J 326, 693–700 (1997). 186. Duncan, P. I., Stojdl, D. F., Marius, R. M., Scheit, K. H. & Bell, J. C. The Clk2 and Clk3 dual-specificity protein kinases regulate the intranuclear distribution of SR proteins and influence pre-mRNA splicing. Exp. Cell Res. 241, 300–8 (1998). 187. Hartmann, a M., Rujescu, D., Giannakouros, T., Nikolakaki, E., Goedert, M., Mandelkow, E. M., Gao, Q. S., Andreadis, a & Stamm, S. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Mol. Cell. Neurosci. 18, 80–90 (2001). 188. Anderson, E. S., Lin, C.-H., Xiao, X., Stoilov, P., Burge, C. B. & Black, D. L. The cardiotonic steroid digitoxin regulates alternative splicing through depletion of the splicing factors SRSF3 and TRA2B. RNA 18, 1041–9 (2012). 189. Rossi, J. J., June, C. H. & Kohn, D. B. Genetic therapies against HIV. Nat. Biotechnol. 25, 1444–54 (2007). 190. Miller, W. R., Anderson, T. J., Evans, D. B., Krause, A., Hampton, G. & Dixon, J. M. An integrated view of aromatase and its inhibition. J. Steroid Biochem. Mol. Biol. 86, 413–21 (2003). 191. Menard, J. & Patchett, A. A. Angiotensin-converting enzyme inhibitors. Adv. Protein Chem. 56, 13–75 (2001). 192. Hook, V. Y. H. & Reisine, T. D. Cysteine Proteases Are the Major Beta-Secretase in the Regulated Secretory Pathway That Provides Most of the Beta-Amyloid in Alzheimer ’ s Disease : Role of BACE 1 in the Constitutive Secretory Pathway. J. Neurosci. Res. 74, 393–405 (2003). 193. Folkman, J. Antiangiogenesis in cancer therapy--endostatin and its mechanisms of action. Exp. Cell Res. 312, 594–607 (2006). 194. Iacampo, S. & Cochrane, A. Human immunodeficiency virus type 1 Rev function requires continued synthesis of its target mRNA. J. Virol. 70, 8332–9 (1996). 195. Dvela, M., Rosen, H., Feldmann, T., Nesher, M. & Lichtstein, D. Diverse biological responses to different cardiotonic steroids. Pathophysiology 14, 159–66 (2007). 196. Prassas, I., Karagiannis, G. S., Batruch, I., Dimitromanolakis, A., Datti, A. & Diamandis, E. P. Digitoxin-

226

induced cytotoxicity in cancer cells is mediated through distinct kinase and interferon signaling networks. Mol. Cancer Ther. 10, 2083–93 (2011). 197. Graveley, B. R. Sorting out the complexity of SR protein functions. RNA 6, 1197–211 (2000). 198. Manley, J. L. & Tacke, R. SR proteins and splicing control. Genes Dev. 24, 1 (2010). 199. Sanford, J. R., Ellis, J. & Cáceres, J. Multiple roles of arginine / serine-rich splicing factors in RNA processing. Biochem Soc Trans 33, 443–446 (2005). 200. Zahler, A. M., Neugebauer, K. M., Lane, W. S. & Roth, M. B. Distinct functions of SR proteins in alternative pre-mRNA splicing. Science 260, 219–22 (1993). 201. Nayler, O., Cap, C. & Stamm, S. Human transformer-2-beta gene (SFRS10): complete nucleotide sequence, chromosomal localization, and generation of a tissue-specific isoform. Genomics 53, 191–202 (1998). 202. Stoilov, P., Daoud, R., Nayler, O. & Stamm, S. Human tra2-beta1 autoregulates its protein concentration by influencing alternative splicing of its pre-mRNA. Hum. Mol. Genet. 13, 509–24 (2004). 203. Caputi, M., Freund, M., Kammler, S., Asang, C. & Schaal, H. A bidirectional SF2/ASF- and SRp40- dependent splicing enhancer regulates human immunodeficiency virus type 1 rev, env, vpu, and nef gene expression. J. Virol. 78, 6517–26 (2004). 204. Asang, C., Hauber, I. & Schaal, H. Insights into the selective activation of alternatively used splice acceptors by the human immunodeficiency virus type-1 bidirectional splicing enhancer. Nucleic Acids Res. 36, 1450– 63 (2008). 205. Kim D., Ziebell R. & Saduvala N. Trend in transmitted HIV-1 ARV drug resistance-associated mutations: 10 HIV surveillance areas, US, 2007-2010. in 20th Conference on Retroviruses and Opportunistic Infections (CROI 2013) (ed. Mark Mascolini) (2013). 206. Satoh, H., Ginsburg, K. S., Qing, K., Terada, H., Hayashi, H. & Bers, D. M. KB-R7943 Block of Ca2+ Influx Via Na+/Ca2+ Exchange Does Not Alter Twitches or Glycoside Inotropy but Prevents Ca2+ Overload in Rat Ventricular Myocytes. Circulation 101, 1441–1446 (2000). 207. Becker, D. E. Drug therapy in dental practice: general principles. Part 2 - pharmacodynamic considerations. Anesth. Prog. 54, 19-23–5 (2007). 208. Dhawan, P., Bell, A., Kumar, A., Golden, C. & Mehta, K. D. Critical role of p42/44(MAPK) activation in anisomycin and hepatocyte growth factor-induced LDL receptor expression: activation of Raf-1/Mek- 1/p42/44(MAPK) cascade alone is sufficient to induce LDL receptor expression. J. Lipid Res. 40, 1911– 1919 (1999). 209. Bébien, M., Salinas, S., Becamel, C., Richard, V., Linares, L. & Hipskind, R. a. Immediate-early gene induction by the stresses anisomycin and arsenite in human osteosarcoma cells involves MAPK cascade signaling to Elk-1, CREB and SRF. Oncogene 22, 1836–1847 (2003). 210. Keenan, S. M., DeLisle, R. K., Welsh, W. J., Paula, S. & Ball, W. J. Elucidation of the Na+, K+-ATPase digitalis binding site. J. Mol. Graph. Model. 23, 465–75 (2005). 211. Laird, G. M., Eisele, E. E., Rabi, S. A., Nikolaeva, D. & Siliciano, R. F. A novel cell-based high-throughput screen for inhibitors of HIV-1 gene expression and budding identifies the cardiac glycosides. J. Antimicrob. Chemother. 69, 988–994 (2014).

227

212. Bourgonje, V. J. A., Vos, M. A., Ozdemir, S., Doisne, N., Acsai, K., Varro, A., Sztojkov-Ivanov, A., Zupko, I., Rauch, E., Kattner, L., Bito, V., Houtman, M., Van Der Nagel, R., Beekman, J. D., Van Veen, T. A. B., Sipido, K. R. & Antoons, G. Combined Na+/Ca2+ Exchanger and L-Type Calcium Channel Block as a Potential Strategy to Suppress Arrhythmias and Maintain Ventricular Function. Circ. Arrhythmia Electrophysiol. 6, 371–379 (2013). 213. Markova, J., Hudecova, S., Soltysova, A., Sirova, M., Csaderova, L., Lencesova, L., Ondrias, K. & Krizanova, O. Sodium/calcium exchanger is upregulated by sulfide signaling, forms complex with the β1 and β3 but not β2 adrenergic receptors, and induces apoptosis. Pflugers Arch. - Eur. J. Physiol. (2013). doi:10.1007/s00424-013-1366-1 214. Uitdehaag, J. C. M., Verkaar, F., Alwan, H., De Man, J., Buijsman, R. C. & Zaman, G. J. R. A guide to picking the most selective kinase inhibitor tool compounds for pharmacological validation of drug targets. Br. J. Pharmacol. 166, 858–876 (2012). 215. Bain, J., McLauchlan, H., Elliott, M. & Cohen, P. The specificities of protein kinase inhibitors: an update. Biochem. J. 371, 199–204 (2003). 216. Prinsloo, G., Meyer, J. J. M., Hussein, A. A., Munoz, E. & Sanchez, R. A cardiac glucoside with in vitro anti-HIV activity isolated from Elaeodendron croceum. Nat. Prod. Res. 24, 1743–6 (2010). 217. Takai, N., Kira, N., Ishii, T., Yoshida, T., Nishida, M., Nishida, Y., Nasu, K. & Narahara, H. Bufalin, a traditional oriental medicine, induces apoptosis in human cancer cells. Asian Pac. J. Cancer Prev. 13, 399– 402 (2012). 218. Hess, T., Riesen, W., Scholtysik, G. & Stucki, P. Digitoxin intoxication with severe thrombocytopenia: reversal by digoxin-specific antibodies. Eur. J. Clin. Invest. 13, 159–63 (1983). 219. Esposito, A. M., Cheung, P., Swartz, T. H., Li, H., Tsibane, T., Durham, N. D., Basler, C. F., Felsenfeld, D. P. & Chen, B. K. A high throughput Cre–lox activated viral membrane fusion assay identifies pharmacological inhibitors of HIV entry. Virology 490, 6–16 (2016). 220. Zhyvoloup, A., Melamed, A., Anderson, I., Planas, D., Lee, H., Kriston-vizi, J., Ketteler, R., Merritt, A., Routy, J., Ancuta, P., Bangham, C. R. M. & Fassati, A. Digoxin reveals a functional connection between HIV-1 integration preference and T- cell activation. PLoS Pathog. 13, e1006460 (2017). 221. Xie, Z. & Askari, A. Na+/K+-ATPase as a signal transducer. Eur. J. Biochem. 269, 2434–2439 (2002). 222. Zahler, R., Zhang, Z. T., Manor, M. & Boron, W. F. Sodium kinetics of Na,K-ATPase alpha isoforms in intact transfected HeLa cells. J. Gen. Physiol. 110, 201–213 (1997). 223. Trenti, A. Analysis of the molecular mechanisms of the antineoplastic effect of ouabain. Università degli Studi di Padova (2012). 224. Perne, A., Muellner, M. K., Steinrueck, M., Craig-Mueller, N., Mayerhofer, J., Schwarzinger, I., Sloane, M., Uras, I. Z., Hoermann, G., Nijman, S. M. B. & Mayerhofer, M. Cardiac glycosides induce cell death in human cells by inhibiting general protein synthesis. PLoS One 4, e8292 (2009). 225. Kulikov, A., Eva, A., Kirch, U., Boldyrev, A. & Scheiner-Bobis, G. Ouabain activates signaling pathways associated with cell death in human neuroblastoma. Biochim Biophys Acta 1768, 1691–1702 (2007). 226. Wortzel, I. & Seger, R. The ERK Cascade: Distinct Functions within Various Subcellular Organelles. Genes

228

Cancer 2, 195–209 (2011). 227. Roberts, P. J. & Der, C. J. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene 26, 3291–310 (2007). 228. Micheva-Viteva, S., Kobayashi, Y., Edelstein, L. C., Pacchia, A. L., Lee, H. R., Ron, Y., Peltz, S. W. & Dougherty, J. P. High-throughput Screening Uncovers a Compound That Activates Latent HIV-1 and Acts Cooperatively with a Histone Deacetylase (HDAC) Inhibitor*. J. Biol. Chem. 286, 21083–21091 (2011). 229. Schmidt, E. K., Clavarino, G., Ceppi, M. & Pierre, P. SUnSET , a nonradioactive method to monitor protein synthesis. 6, 275–277 (2009). 230. Li, H., Wang, P., Gao, Y., Zhu, X., Liu, L., Cohen, L., Meng, Z. & Yang, P. Na+/K+-ATPase alpha3 mediates sensitivity of hepatocellular carcinoma cells to bufalin. Oncol Rep 25, 825–830 (2011). 231. Cohen, P. S., Schmidtmayerova, H., Dennis, J., Dubrovsky, L., Sherry, B., Wang, H., Bukrinsky, M. & Tracey, K. J. The critical role of p38 MAP kinase in T cell HIV-1 replication. Mol. Med. 3, 339–46 (1997). 232. Furler, R. L. & Uittenbogaart, C. H. Signaling through the P38 and ERK pathways: a common link between HIV replication and the immune response. Immunol. Res. 48, 99–109 (2010). 233. Bogoyevitch, M. a & Kobe, B. Uses for JNK: the many and varied substrates of the c-Jun N-terminal kinases. Microbiol. Mol. Biol. Rev. 70, 1061–95 (2006). 234. Pan, Q., Shai, O., Lee, L. J., Frey, B. J. & Blencowe, B. J. Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing. Nature Genetics 40, 1413–1415 (2008). 235. Wang, E. T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S. F., Schroth, G. P. & Burge, C. B. Alternative isoform regulation in human tissue transcriptomes. Nature 456, 470–6 (2008). 236. Biasiotto, R. & Akusjarvi, G. Regulation of human adenovirus alternative RNA splicing by the adenoviral L4-33K and L4-22K proteins. International Journal of Molecular Sciences 16, 2893–2912 (2015). 237. Dubois, J., Terrier, O. & Rosa-Calatrava, M. Influenza viruses and mRNA splicing: Doing more with less. mBio 5, (2014). 238. Huang, Y. & Carmichael, G. G. RNA processing in the polyoma virus life cycle. Frontiers in bioscience 14, 4968–77 (2009). 239. Journo, C., Douceron, E. & Mahieux, R. HTLV gene regulation: because size matters, transcription is not enough. Future microbiology 4, 425–40 (2009). 240. Klymenko, T. & Graham, S. V. Human papillomavirus gene expression is controlled by host cell splicing factors. Biochemical Society transactions 40, 773–7 (2012). 241. Krug, L. T. Complexities of gammaherpesvirus transcription revealed by microarrays and RNAseq. Current Opinion in Virology 3, 276–284 (2013). 242. Schwartz, S. Papillomavirus transcripts and posttranscriptional regulation. Virology 445, 187–196 (2013). 243. Hernandez-Lopez, H. & Graham, S. Alternative splicing in tumour viruses: a therapeutic target? Biochem J 445, 145–156 (2012). 244. Shenk, T. E. Adenoviridae: The Viruses and Their Replication. 245. Zhao, H., Chen, M. & Pettersson, U. A new look at adenovirus splicing. Virology 456–457, 329–341 (2014). 246. Nekhai, S. & Jeang, K.-T. Transcriptional and post-transcriptional regulation of HIV-1 gene expression: role

229

of cellular factors for Tat and Rev. Future microbiology 1, 417–26 (2006). 247. Larsson, S., Kreivi, J. P. & Akusjärvi, G. Control of adenovirus alternative RNA splicing: effect of viral DNA replication on RNA splice site choice. Gene 107, 219–227 (1991). 248. Thomas, G. P. & Mathews, M. B. DNA replication and the early to late transition in adenovirus infection. Cell 22, 523–33 (1980). 249. Iwamoto, T., Watanabe, Y., Kita, S. & Blaustein, M. P. Na+/Ca2+ exchange inhibitors: a new class of calcium regulators. Cardiovasc. Hematol. Disord. Drug Targets 7, 188–98 (2007). 250. Matchkov, V. V. & Krivoi, I. I. Specialized functional diversity and interactions of the Na,K-ATPase. Front. Physiol. 7, (2016). 251. Xie, Z. & Cai, T. Na+-K+--ATPase-mediated signal transduction: from protein interaction to cellular function. Mol. Interv. 3, 157–68 (2003). 252. Kamakura, S., Moriguchi, T. & Nishida, E. Activation of the Protein Kinase ERK5 / BMK1 by Receptor. Biochemistry 274, 26563–26571 (1999). 253. Bunda, S., Heir, P., Srikumar, T., Cook, J. D., Burrell, K., Kano, Y., Lee, J. E., Zadeh, G., Raught, B. & Ohh, M. Src promotes GTPase activity of Ras via tyrosine 32 phosphorylation. Proc. Natl. Acad. Sci. U. S. A. 111, E3785-94 (2014). 254. Zhu, J. Da, Meng, W., Wang, X. J. & Wang, H. C. R. Broad-spectrum antiviral agents. Front. Microbiol. 6, 1–15 (2015). 255. Martinez, J. P., Sasse, F., Brönstrup, M., Diez, J. & Meyerhans, A. Antiviral drug discovery: broad-spectrum drugs from nature. Nat. Prod. Rep. 32, 29–48 (2015). 256. Chen, M. & Manley, J. Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nature reviews. Molecular cell biology 10, 741–54 (2009). 257. Long, J. C., Caceres, J. F., Berget, S. M., Moore, C., Sharp, P. A., Chow, L. T., Gelinas, R. E., Broker, T. R., Roberts, R. J., Kramer, A., Will, C. L., Luhrmann, R., Matlin, A. J., Moore, M. J., Rappsilber, J., Ryder, U., Lamond, A. I., Mann, M., Zhou, Z., et al. The SR protein family of splicing factors: master regulators of gene expression. The Biochemical journal 417, 15–27 (2009). 258. Shen, M. & Mattox, W. Activation and repression functions of an SR splicing regulator depend on exonic versus intronic-binding position. Nucleic Acids Res. 40, 428–437 (2012). 259. Venables, J. P., Koh, C.-S., Froehlich, U., Lapointe, E., Couture, S., Inkel, L., Bramard, A., Paquet, E. R., Watier, V., Durand, M., Lucier, J.-F., Gervais-Bird, J., Tremblay, K., Prinos, P., Klinck, R., Elela, S. A. & Chabot, B. Multiple and Specific mRNA Processing Targets for the Major Human hnRNP Proteins. Molecular and Cellular Biology 28, 6033–6043 (2008). 260. Corso, G., Coletta, I. & Ombrato, R. Murine mPGES-1 3D structure elucidation and inhibitors binding mode predictions by homology modeling and site-directed mutagenesis. Journal of Chemical Information and Modeling 53, 1804–1817 (2013). 261. Wolff, B., Sanglier, J.-J. & Wang, Y. Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo- cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev- dependent mRNA. Chemistry & Biology 4, 139–147 (1997).

230

262. Martinez, N. M., Pan, Q., Cole, B. S., Yarosh, C. a., Babcock, G. a., Heyd, F., Zhu, W., Ajith, S., Blencowe, B. J. & Lynch, K. W. Alternative splicing networks regulated by signaling in human T cells. Rna 18, 1029– 1040 (2012). 263. Lappano, R. & Maggiolini, M. G protein-coupled receptors: novel targets for drug discovery in cancer. Nat Rev Drug Discov 10, 47–60 (2011). 264. Yomoda, J. I., Muraki, M., Kataoka, N., Hosoya, T., Suzuki, M., Hagiwara, M. & Kimura, H. Combination of Clk family kinase and SRp75 modulates alternative splicing of Adenovirus E1A. Genes Cells 13, 233–44 (2008). 265. Sivaraj, K. K., Li, R., Albarran-Juarez, J., Wang, S., Tischner, D., Grimm, M., Swiercz, J. M., Offermanns, S. & Wettschureck, N. Endothelial Gaq/11 is required for VEGF-induced vascular permeability and angiogenesis. Cardiovasc. Res. 108, 171–180 (2015). 266. Dwivedi, Y., Risavi, H. S., Conley, R. R., Roberts, R. C., Tamminga, C. A. & Pandey, G. N. Erratum: mRNA and protein expression of selective alpha subunits of G proteins are abnormal in prefrontal cortex of suicide victims (Neuropsychopharmacology (October 2002) 27:4 (499-517) PII:S0893133X02003354). Neuropsychopharmacology 27, 1092 (2002). 267. Brown, M. Selection of nonfastidious adenovirus species in 293 cells inoculated with stool specimens containing adenovirus 40. Journal of Clinical Microbiology 22, 205–209 (1985). 268. Ying, B., Toth, K., Spencer, J. F., Meyer, J., Tollefson, A. E., Patra, D., Dhar, D., Shashkova, E. V, Kuppuswamy, M., Doronin, K., Thomas, M. A., Zumstein, L. A., Wold, W. S. M. & Lichtenstein, D. L. INGN 007, an oncolytic adenovirus vector, replicates in Syrian hamsters but not mice: comparison of biodistribution studies. Cancer Gene Ther. 16, 625–37 (2009). 269. Irimia, M., Weatheritt, R. J., Ellis, J. D., Parikshak, N. N., Gonatopoulos-Pournatzis, T., Babor, M., Quesnel-Vallières, M., Tapial, J., Raj, B., O’Hanlon, D., Barrios-Rodiles, M., Sternberg, M. J. E., Cordes, S. P., Roth, F. P., Wrana, J. L., Geschwind, D. H. & Blencowe, B. J. A highly conserved program of neuronal microexons is misregulated in autistic brains. Cell 159, 1511–23 (2014). 270. Krumins, A. M. & Gilman, A. G. Targeted knockdown of G protein subunits selectively prevents receptor- mediated modulation of effectors and reveals complex changes in non-targeted signaling proteins. J. Biol. Chem. 281, 10250–10262 (2006). 271. Van Duyne, R., Pedati, C., Guendel, I., Carpio, L., Kehn-Hall, K., Saifuddin, M. & Kashanchi, F. The utilization of humanized mouse models for the study of human retroviral infections. Retrovirology 6, 76 (2009). 272. Zhang, L., Kovalev, G. I. & Su, L. HIV-1 infection and pathogenesis in a novel humanized mouse model. Blood 109, 2978–81 (2007). 273. Vitte, A.-L., Buchsbaum, S. & Jalinot, P. Modulation of HIV-1 Rev protein abundance and activity by polyubiquitination with unconventional Lys-33 branching. FEBS Lett. 580, 6155–60 (2006). 274. Arora, S., Verma, S. & Banerjea, A. C. HIV-1 Vpr redirects host ubiquitination pathway. J. Virol. 88, 9141– 52 (2014). 275. Nielsen, M. H., Pedersen, F. S. & Kjems, J. Molecular strategies to inhibit HIV-1 replication. Retrovirology

231

2, 10 (2005). 276. Fun, A., Wensing, A. M. J., Verheyen, J. & Nijhuis, M. Human Immunodeficiency Virus Gag and protease: partners in resistance. Retrovirology 9, 63 (2012). 277. Davis, M. I., Hunt, J. P., Herrgard, S., Ciceri, P., Wodicka, L. M., Pallares, G., Hocker, M., Treiber, D. K. & Zarrinkar, P. P. Comprehensive analysis of kinase inhibitor selectivity. Nat. Biotechnol. 29, 1046–51 (2011). 278. Davies, S. P., Reddy, H., Caivano, M. & Cohen, P. protein kinase inhibitors. 105, 95–105 (2000). 279. Pogwizd, S. M. Clinical potential of sodium-calcium exchanger inhibitors as antiarrhythmic agents. Drugs 63, 439–452 (2003). 280. Solovyova, N., Fernyhough, P., Glazner, G. & Verkhratsky, a. Xestospongin C empties the ER calcium store but does not inhibit InsP3-induced Ca2+ release in cultured dorsal root ganglia neurones. Cell Calcium 32, 49–52 (2002). 281. Bootman, M. D., Collins, T. J., Mackenzie, L., Roderick, H. L., Berridge, M. J. & Peppiatt, C. M. 2- Aminoethoxydiphenyl borate (2-APB) is a reliable blocker of store-operated Ca2+ entry but an inconsistent inhibitor of InsP 3-induced Ca2+ release. 1145–1150 (1997). 282. Huang, W., Barrett, M., Hajicek, N., Hicks, S., Harden, T. K., Sondek, J. & Zhang, Q. Small molecule inhibitors of phospholipase C from a novel high-throughput screen. J. Biol. Chem. 288, 5840–8 (2013). 283. Singla, S., Karam, P., Deshmukh, A. J., Mehta, J. & Paydak, H. Review of contemporary antiarrhythmic drug therapy for maintenance of sinus rhythm in atrial fibrillation. J. Cardiovasc. Pharmacol. Ther. 17, 12– 20 (2012). 284. Miguel, S. M. S., Namdar-Attar, M., Noh, T., Frenkel, B. & Bab, I. ERK1/2-activated de Novo Mapkapk2 Synthesis Is Essential for Osteogenic Growth Peptide Mitogenic Signaling in Osteoblastic Cells. J. Biol. Chem. 280, 37495–37502 (2005). 285. Wang, Z. Transactivation of epidermal growth factor receptor by g protein-coupled receptors: Recent progress, challenges and future research. Int. J. Mol. Sci. 17, (2016). 286. Paolillo, M. & Schinelli, S. Therapeutic targeting of g-protein coupled receptor-mediated epidermal growth factor receptor transactivation in human glioma brain tumors. Mini Rev. Med. Chem. 8, 1418–28 (2008). 287. Wettschureck, N. & Offermanns, S. Mammalian G Proteins and Their Cell Type Specific Functions. Physilological Rev. 85, 1159–1204 (2005). 288. Dhillon, Hagan, Rath & Kolch. MAP kinase signalling pathways in cancer. Oncogene 26, 3279–90 (2007).

232