For My Mother
Always in my thoughts Cv/lOtXCULAR. ABNORMALITIES OF y 3 E B % . COLLAGEN PROTEINS AND GENES IN OSTEOGENESIS IMPERFECTA
by
Sara Catherine Mary Daw
June 1991
Dermatology Research Group, MRC Clinical Research Centre, Harrow, Middlesex
Submitted for the degree of Doctor of Philosophy
Department of Biochemistry Charing Cross and Westminster Medical School, University of London CORRIGENDA
Page 37 Fig. 1.4 At residue 585, OI type IV is caused by an insertion, not a deletion.
Pages 37 & 40 Fig. 1.4 Substitution of cysteine for glycine at residue al(I) 175 and al(I) 178 produce moderate OI.
Page 98 Fig. 4.5 Tracks 4 and 5 indicating samples from patient IV-8 are incorrectly labelled. The patient was III-8.
Page 107 Probe E486 was used to screen the a2(I) M sp I dimorphism of 2.1 and 1.6 kb. The cDNA Hf32 was used for the Rsa I dimorphism of 2.9 and 2.1 kb. ABSTRACT
Type I collagen, the major protein constituent of adult bone, is a heteropolymer of three a-chains; two al(I) and one a2(I). Ninety-five percent of the molecule is included in a
characteristic triple helix requiring a glycine residue in every third position for stability. The a-chains are encoded by separate genes containing more than 50 exons.
Osteogenesis imperfecta (OI) is a clinically and genetically heterogeneous syndrome in
which brittle bone disease ranges from mild to lethal. Most OI patients have mutations,
which are unique to individual patients or families, in one of the two structural genes
encoding type I collagen so many must be studied if the disease is to be fully understood.
This thesis describes the investigation of four OI families.
In the first, normal, unrelated parents have produced six lethally affected babies; the two
available for study appear heterozygous for a collagen abnormality; probably the result of
a point mutation at the C-terminal end of the protein. Germinal mosaicism is suggested
as the mode of inheritance.
In two consanguineous families with severe, recessive OI protein data suggests that the affected children are homozygous for the production of an over-hydroxylated type I collagen. In both families the abnormality maps to the C-terminus of the protein. However, genetic linkage excluded both type I collagen structural genes as the disease
locus. It is proposed that the defect lies at a previously uncharacterised step in the
biosynthetic pathway. Furthermore, although almost certainly homozygous for the
defective allele, these OI patients show a heterogeneity in their protein normally
3 indicative of the heterozygous state. This observation is of considerable importance if such families are to be offered genetic counselling.
A baby with the broad boned lethal form of OI is also described. She is unusual in that she synthesises equal amounts of two distinct forms of al(I). This study further illustrates the heterogeneity of excessive post-translational modification in OI.
4 CONTENTS
Abstract 3 Acknowledgements 10 List of Abbreviations 11 List of Illustrations 13
Chapter 1 I ntroduction 1.1 Genes 17 1.2 Proteins 19 1.3 Group 1 Collagens 20 1.4 Group 2 Collagens 23 1.5 Group 3 Collagens 24 1.6 Biosynthesis of Type I collagen 26 1.6.1 Transcription 26 1.6.2 Translation 30 1.6.3 Post-translational Modifications 30 1.6.4 Helix Formation 31 1.6.5 Processing to Collagen 32 1.6.6 Fibril Formation 33 1.6.7 Crosslinking 33 1.7 Osteogenesis Imperfecta 34 1.8 Sillence Type I OI 39 1.8.1 Silent Allele Type 39 1.8.2 Structural Mutations 39 1.9 Sillence Type II OI 41 1.9.1 Gene Rearrangements 41 1.9.2 Point Mutations Causing Amino Acid Substitutions 42 1.9.2.1 Glycine to Cysteine 43 1.9.2.2 Glycine to Arginine 43 1.9.2.3 Glycine to Aspartate 44 1.9.2.4 Glycine to Alanine 44 1.9.2.5 Glycine to Valine 44
5 1.9.2.6 Glycine to Serine 45 1.9.3 Point Mutations Causing Exon Skipping 45 1.10 Sillence Type IH OI 46 1.11 Sillence Type IV OI 47 1.12 Other Disorders Caused by Type I Collagen Mutations 48 1.12.1 Atypical OI 48 1.12.2 Ehlers Danlos Syndrome 49 1.13 Causes of Type I Collagen Mutations 50 1.14 Methodology 51 1.14.1 Restriction Fragment Length Polymorphisms 51 1.14.2 Polymerase Chain Reaction 52 1.15 Reasons for the Study of OI 52 1.16 Project Introduction 54
Chapter 2 materials a n d M ethods 2.1 Materials 56 2.2 Human Skin Fibroblast Culture 57 2.2.1 Metabolic Protein Labelling 58 2.2.1.1 ..with ^ C or ^H-Proline 58 2.2.1.2 ..with ^C-Lysine 58 2.2.1.3 ..in the Presence of aa'dipyridyl 58 2.3 Isolation of Protein by Salt Precipitation 59 2.3.1 Cell Harvesting 59 2.3.2 Protein Isolation 59 2.4. Isolation of Protein by Ethanol Precipitation 60 2.4.1 Cell Harvesting 60 2.4.2 Protein Isolation 60 2.5 Polyacrylamide Gel Electrophoresis 61 2.5.1 Protein Separation 61
6 2.5.2 Visualisation on Protein Gels 62 2.6 Cyanogen Bromide Peptide Mapping 62 2.7 Determination of Thermal Stability of Collagen 63 2.8 Amino Acid Analysis 63 2.8.1 Estimation of Total Collagen Synthesis 63 2.8.2 Estimation of Lysine Hydroxylation 64 2.9 Extraction of DNA and RNA 64 2.9.1 Extraction of Genomic DNA from Fibroblasts 64 2.9.2 ..from Tissue 65 2.9.3 ..from Peripheral Blood 65 2.9.4 Extraction of Total Cytoplasmic RNA from Fibroblasts 65 2.10 Enzyme Reaction Conditions 66 2.10.1 Restriction Enzymes 66 2.10.2 T4 DNA Ligase 67 2.10.3 Calf Intestinal Phosphatase 67 2.10.4 First Strand cDNA Synthesis 67 2.10.5 Polymerase Chain Reaction 68 2.11 Microbiological Methods 68 2.11.1 Preparation of Competent Cells 68 2.11.1.1 Hanahan 1985 68 2.11.1.2 Sambrook et al 1990 69 2.11.2 Transformation of E .coli 69 2.11.3 Preparation of Plasmid DNA (STET) 69 2.11.4 Preparation of Plasmid DNA (CsCl) 70 2.12 Agarose Gel Electrophoresis 71 2.12.1 Separation of DNA Insert from Vector 71 2.12.2 Southern Blotting 72 2.13 ^P-dNTP Labelling of DNA Probes 72 2.14 Hybridisation Conditions 73
7 Chapter 3 An INVESTIGATION OF A FAMILY WITH OI TYPE III AND SIX CONSECUTIVE AFFECTED SIBS HETEROZYGOUS FOR A TYPE I COLLAGEN ABNORMALITY 3.1 Clinical Description 75 3.2 Protein Studies 78 3.2.1 a-chains 78 3.2.2 aa'dipyridyl Incubation 80 3.2.3 Hydroxylysine Analysis 81 3.2.4 One Dimensional CNBr Mapping 81 3.2.5 Two Dimensional CNBr Mapping 81 3.2.6 Estimation of Td 81 3.3 DNA Analysis 81 3.4 Discussion 84
Chapter 4 AN INVESTIGATION OF TWO CONSANGUINEOUS FAMILIES WITH AUTOSOMAL RECESSIVE OI TYPE III AND EXCESSIVE POST- TRANSLATIONAL MODIFICATION OF TYPE I COLLAGEN 4.1 Clinical Features 91 4.1.1 Family G 91 4.1.2 Family F 94 4.2 Protein Studies - Family G 94 4.2.1. a-chains 97 4.2.2 aa'dipyridyl Incubation 97 4.2.3 Hydroxylysine Analysis 99 4.2.4 One Dimensional CNBr Mapping 99 4.2.5 Two Dimensional CNBr Mapping 101 4.2.6 Estimation of Td 101 4.3 Protein Studies - Family F 101 4.4 DNA Analysis 106 4.4.1 Family G 106 4.4.2 Family F 107 4.5 Discussion 110
8 Chapter 5 AN INVESTIGATION OF A BABY WITH TYPE IIA, BROAD BONED LETHAL OI WHO SECRETES TWO DISCRETE FORMS OF a 1(1) 5.1 Preliminary Screening 118 5.1.1 Protein Analysis 118 5.1.2 Genomic DNA Analysis 118 5.2 Clinical Description 120 5.3 Protein Studies 121 5.3.1 a-chains 121 5.3.2 aa'dipyridyl Incubation 121 5.3.3 One Dimensional CNBr Mapping 121 5.3.4 Two Dimensional CNBr Mapping 121 5.3.5 Estimation of Td 121 5.4 DNA Analysis 125 5.4.1 Genomic DNA and RNAse A Mapping 125 5.4.2 cDNA Analysis 125 5.5 Discussion 127
Chapter 6 Concluding Remarks 130
Chapter 7 References 136
Appendix 1 Stock Buffers and Solutions 162 Appendix 2 Culture Media 170
9 ACKNOWLEDGEMENTS
I should like to thank Dr Mike Pope and all the other members of the Dermatology Research Group, both past and present; in particular, Mrs Olive Cutting for her care of the cell cultures and Mr David Renouf for running the amino acid analyser.
Thanks especially to Dr Alan Nicholls, a constant source of inspiration, for his excellent
supervision, cheerfulness and patience throughout.
I am also grateful to Professor Roger Mason, from the Department of Biochemistry at
Charing Cross, for his interest in the project, for his helpful advice and for organising my registration with the University of London.
Finally my special thanks to Jane McPheat, Marie Robson and Phil Ward for friendship
and encouragement and to Andrew for his moral and financial support and for the benefit of his considerable computing experience in the preparation of this thesis.
10 ABBREVIATIONS
ATP Adenosine triphosphate ota'DP aa'dipyridyl
BAPN 6-aminopropionitrile
Bis NN'Methylene bisacrylamide BME Basal medium (Eagles’)
BSA Bovine serum albumin
CIP Calf intestinal phosphatase CNBr/CB Cyanogen bromide
CTP Cytosine triphosphate DEAE- Diethylaminoethyl-
DEPC Diethylpyrocarbonate DMEM Dulbecco's modified Eagles' medium
DMSO Dimethylsulphoxide
DNA Deoxyribonucleic acid DTT Dithiothreitol EDS Ehlers Danlos Syndrome EDTA Ethylenediamine tetracetic acid EtBr Ethidium bromide
FCS Foetal calf serum
GTP Guanosine triphosphate
HEPES N-2-Hydroxyethylpiperazine-N'-2-ethane sulphonic acid IVS Intervening sequence PAGE Polyacrylamide gel electrophoresis
11 pHMB p-Hydroxymercuribenzoate IPTG Isopropyl-B-D-thiogalactoside LB Luria Bertani medium MOPS Morpholinopropane sulphonic acid NEM N-ethyl maleimide 01 Osteogenesis imperfecta
PBS Phosphate buffered saline PCR Polymerase chain reaction
PEG Polyethylene glycol
PMSF Phenylmethylsulphonyl fluoride
PPO 2-4-Diphenyl oxazole
PVP Polyvinyl pyrollidone RER Rough endoplasmic reticulum
RFLP Restriction fragment length polymorphism
RNA Ribonucleic acid
SDS Sodium dodecyl sulphate
SDW Sterile distilled water STET(L) See appendix 1
TCA Trichloroacetic acid TEMED NNN'N'-Tetramethylethylene diamine
Tris base Tris(hydroxymethyl)methylamine TTP Thymidine triphosphate X-Gal 5-bromo-4-chloro-3-indolyl-B-D-galactoside
12 ILLUSTRATIONS
Tables 1.1 Distribution of human collagen genes 18 1.2 The Interstitial collagens 21 3.1 Estimation of collagen synthesis and lysine hydroxylation in family T 80 4.1 Estimation of collagen synthesis in
families G and F 97
4.2 Estimation of lysine hydroxylation in
families G and F 99
4.3 Family G - Abbreviated haplotypes 107 5.1 Estimation of lysine hydroxylation in 01 type IIA cell lines 120
Figures Chapter 1
Introduction 1.1 Biosynthesis of type I collagen 27 1.2 C0L1A1 - Restriction map 28
1.3 COL1A2 - Restriction map 29 Key to Figures 1.4 and 1.5 36 1.4 Mutations in COL1A1 to Dec 1990 37
1.5 Mutations in COL1A2 to Dec 1990 38
Chapter 3
Family T 3.1 Pedigree and al(I) haplotypes 76
13 3.2 Clinical features 77 3.3 Type I collagen a-chains 79 3.4 Proa-chains in the presence of
aa'dipyridyl 79
3.5 ID CNBr peptides & peptide map 82 3.6 2D CNBr peptides 82 3.7 Estimation of thermal stability 83
Chapter 4
Families 4.1 Pedigree of family G 92 G and F 4.2 G, Clinical features-affected 93
4.3 G, Clinical features-unaffected 95 4.4 Pedigree of family F 96 4.5 G, Type I collagen a-chains 98 4.6 G, Type III collagen a-chains 98
4.7 G, Proa-chains in the presence of
aa'dipyridyl 100
4.8 G, ID CNBr peptides 100
4.9 G, 2D CNBr peptides 102 4.10 G, Estimation of thermal stability 103 4.11 F, Type I collagen a-chains 104
4.12 F, ID CNBr peptides 104
4.13 F, 2D CNBr peptides 105 4.14 RFLP analysis in family G 108
4.15 G, Summary of COL1A1 and COL1A2
haplotypes 109
14 Chapter 5
Family A 5.1 BA, Clinical features 119 5.2 BA, Type I collagen a-chains 122
5.3 BA, Proa-chains in the presence of aa'dipyridyl 122
5.4 BA, ID CNBr peptides 123
5.5 BA, 2D CNBr peptides 123 5.6 Estimation of thermal stability 124
5.7 BA, Genomic DNA - restriction fragments 124
5.8 BA, PCR generated cDNA from al(I)CB3 and al(I)CB7 126
15 C h a p t e r 1
16 INTRODUCTION
1.1 Genes
The collagens are a family of extracellular matrix proteins found in all multicellular organisms. In mammals collagen accounts for almost half of total adult body protein. Although the basic structure of the minor collagens has evolved to meet specialised needs the primary role of the collagens is in connective tissue support. Consequently, collagen is relatively inelastic, has a high tensile strength and a long half life (Laurent 1987).
Thirteen forms of collagen, containing more than twenty different polypeptide a-chains,
are now known. Each a-chain is encoded by a complex single copy of a structural gene
(Tolstoshev and Solomon 1982, Ramirez et al 1985, de Crombrugge and Schmidt 1987). Collagen genes are distributed throughout the genome (table 1.1). The major loci are
composed of 52 exons most of which are 54 bp long encoding 18 complete amino acid
residues, that is, six in phase triplets of a characteristic Gly-X-Y motif which is repeated throughout the triple helical region of the molecule. Other helical exons are 108, 99, or
45 bp in length. Typical fibrillar collagen genes have multiple polyadenylation signals
and produce mRNA of 5 to 6 kb (Myers et al 1983, Penttinen et al 1988). When the sequences of the human interstitial collagen genes are compared, the exons which encode the central triple helical region of the molecule show an almost identical size distribution.
There are only two exceptions; al(I) has a single 108 bp exon where other a-chains have
2 54 bp exons (Ramirez et al 1985) and in a2(XI) exon 48 has been replaced by 3 exons
of 54, 36 and 54 bp (Kimura et al 1989a). It has therefore been suggested that the fibrillar collagen genes arose from the tandem duplication of an ancestral 54 bp unit
(Yamada et al 1980, Chu et al 1984). This characteristic 54 bp exon has also been found
17 in more primitive organisms such as the sea urchin (D'Alessio et al 1989). As more complex connective tissues evolved, the functional requirement of collagen increased and the genetically and structurally distinct collagens arose by the duplication of a single
gene.
Distribution of Human Collagen Genes
Type a-chain Gene Locus Chromosomal Localisation
I al(I) COL1A1 17q21.3-q22 a2(I) COL1A2 7q21.3 - q22 II al(II) COL2A1 12ql3 - ql4 III al(III) COL3A1 2q24.3 - q31 IV al(IV) COL4A1 13q34 a2(IV) COL4A2 13q34
a3(IV) COL4A3 -
a4(IV) COL4A4 - oc5(IV) COL4A5 Xq22
V al(V) COL5A1 - a2(V) COL5A2 2q24.3 - q31
a3(V) COL5A3 - VI al(VI) COL6A1 21q22.3 a2(VI) COL6A2 21q22.3 a3(VI) COL6A3 2q37
VII al(VII) COL7A1 -
VIII al(VIII) COL8A1 - IX al(IX) COL9A1 6ql2 - ql4
a2(IX) COL9A2 -
oc3(IX) COL9A3 -
X al(X) COL10A1 - XI al(XI) COL11A1 Ip21 a2(XI) COL11A2 6p21.2 a3(XI) COL2A1 12ql3 - ql4
XII al(XII) COL12A1 - XIII a 1 (XIII) COL13A1 lOqll - qter
TABLE 1.1 1.2 Proteins
Each collagen molecule is composed of three a-chains wound into a characteristic left handed triple helix. Each a-chain has a helical structure, based on a poly-L-proline helix (Gly-Pro-Pro)n, and stabilised by the steric repulsion of the pyrrolidone rings on the proline residues. The collagen helix consists of repeating triplets of Gly-X-Y where the
X and Y positions are often filled with the imino acids proline and hydroxyproline. Lysine, hydroxylysine, arginine and glutamine are also relatively common.
Hydroxyproline and hydroxylysine are the products of post-translational modification and are seldom found in animal proteins other than collagen.
Three a-chains wind around each other to form a superhelical cable with 3.3 residues per turn held together by interchain hydrogen bonds between the NH peptide group of the glycine residues and the CO peptide groups of the other chains. The presence of the small glycine residue at every third position is crucial. The post-translational hydroxylation of proline residues confers stability on the final molecule through the formation of additional hydrogen bonds. In certain types of collagen, Eg type III, the triple helix is also bound by interchain disulphide bonds between cysteine residues. Regions of this characteristic polyproline triple helix are known as collagenous (COL) domains. These are sometimes interrupted by globular sections of non-collagenous (NC) protein.
The different collagens exhibit a diversity of structure and function and have been subdivided into three groups (Miller and Gay 1987). The size of the a-chains, the continuity of the Gly-X-Y triplet motif and the nature of the extracellular aggregates formed have been used as the criteria for the classification.
19 1.3 Group 1 Collagens
Group 1 is the largest group containing the interstitial or fibrillar collagens - table 1.2. These proteins contain more than 300 nm, that is some 1350 amino acids, of
uninterrupted triple helix flanked by N and C-terminal propeptides. The C-propeptides contain cysteine residues which align the a-chains prior to helix formation and the N-propeptide region of all the group 1 collagen a-chains, except a2(I), consists of a cysteine rich globular domain and a helical region. The whole procollagen molecule has
a molecular weight of around 450 kDal.
Type I collagen comprises 95 % of the total protein in adult bone. It is normally a
heterotrimer of two a 1(1) chains and one a2(I) chain although amniotic fluid cells
(Crouch and Bomstein 1978), certain mutant cells (Nicholls et al 1984a) and a number of
tumour cell lines (Rupard et al 1988) may also synthesise al(I) trimer. Type I collagen, the subject of this thesis, is the most abundant collagen and its biosynthesis is more fully described later (1.6).
Type II collagen, a homotrimer, is synthesised by chondrocytes and certain cells in the
eye (Sandberg and Vuorio 1987). Abnormalities in type II have been associated with
osteoarthrosis (Ala-Kokko et al 1990), achondrogenesis (Vissing et al 1989),
spondyloepiphyseal dysplasia (Hortone t al 1989) and the Stickler syndrome (Knowlton
et al 1989). The gene COL2A1 has a 5' promoter and first intron enhancer which are
both required for transcription and can direct expression of foreign genes in suitable constructs. COL2A1 can be alternatively spliced to give an mRNA lacking exon 2 which encodes the cysteine rich N-terminal region of the procollagen (Ryan and Sandell 1990).
20 The Interstitial (Fibrillar) Collagens
Type a-chain Gene Locus M r M r Molecular Composition Occurrence Procollagen Collagen
I a 1(1) COL1A1 140 95 [cxl(I)]3 & Bone, Skin, a2(I) COL1A2 125 95 [ II a l(II) COL2A1 140 95 [a 1(H)] Cartilage, Vertebral 3 disc & Vitreous humor III a l(III) COL3A1 140 95-110 [a l(III)]j Skin & Blood vessels V a l(V ) COL5A1 240 115 [«1(V)1 Skin, Comeal stroma, a2(V) COL5A2 160 125 [al(V)] a2(V), & Foetal membranes & 2 a3(V) COL5A3 - - ocl(V)a2(V)a3(V) periosteum XI a l(X I) COL11A1 - - a l (XI)a2(XI)a3(XI) Cartilage a2(XI) COL11A2 - - a3(XI) COL2A1 • • TABLE 1.2 Type III collagen is a homotrimer. The fully processed protein molecule is joined by an interchain disulphide bond between cysteine residues at position 1024, the last in the helix. In the procollagen molecule there is a second S-S bond within the N-terminal telopeptide. Like the other fibrillar collagen genes COL3A1 is genetically controlled by cis and trans-acting factors. Type HI fibrils are found in association with type I fibrils in distensible tissues such as skin and blood vessels; consequendy abnormalities in al(III) have been found in patients with vascular diseases such as Ehlers Danlos syndrome (EDS) type IV (Pope et al 1975, Superti-Furga et al 1989, Kuivaniemi et al 1991). Type V collagen has 3 different a-chains and a number of molecular forms. The protein shows only 20 % homology with types I and III but 71 % homology with type XI. Thus it might seem that types V and XI should be categorised as a different subgroup but analysis of genomic DNA (Weil et al 1987) indicated that type V does belong to the group 1 collagens. The Hyl-Gly-His-Arg sequence between positions 87 and 90 shows that type V may indeed form the quarter stagger fibril assembly seen in the more abundant interstitial collagens, (1.6.6). Furthermore, in al(I) the helical portion of the N-propeptide contains 14 triplet repeats. al(II) collagen contains 24 such repeats. a2(V) is similar to al(I) and al(III) in the cysteine rich globular domain but more like al(II) in the number of helical repeats (Woodbury et al 1989). There is also a putative N-propeptidase cleavage site, Ala-Gin, although processing of type V in tissue is limited. Type XI collagen (Bruckner et al 1989) is a heterotrimer of 3 distinct a-chains with homology to al(V) and a2(V). Genomic clones for this protein indicate that it also belongs in the fibrillar group (Bernard et al 1988, Law et al 1990). In addition, recent 22 evidence has suggested that a3(XI) is the highly glycosylated product of the al(II) gene COL2A1 on chromosome 12q (Eyre and Wu 1987). 1.4 Group 2 Collagens The second group of collagen molecules are large proteins composed of a-chains of more than 90 kDal molecular weight but which undergo less extensive lateral aggregation than the interstitial collagens. Group 2 includes types IV, VI, VII and VIII. Type IV collagen occurs with other protein components such as laminin and nidogen in basement membrane (Timpl 1989 Review). Type IV collagen molecules are heterotrimers formed from at least 5 different a-chains (Killen et al 1987,1988) with 390 nm of triple helix stabilised by disulphide bonds and lysine derived crosslinks. The structural genes COLA A1 and COLAA2 are arranged head to head on chromosome 13 encoded on opposite strands and separated by only 42 bp (Poeschl et al 1988, Soininen et al 1988). Like other collagen loci both genes contain an enhancer element in the first intron. COL4A5 is situated on the long arm of the X chromosome (Hostikka et al 1990, Myers et al 1990) and has recently been associated with Alport's syndrome in which patients suffer from abnormalities of the renal glomerular basement membrane (Barker et al 1990). Type VI collagen (Trueb et al 1987) has three different a-chain components; an acidic chain al(VI) of Mr 140 kDal and two basic chains of 140 kDal and 250 kDal (Chu et al 1987). a2(VI) has 3 variants arising from alternative splicing of COL6A2 (Weil et al 1988a). There are only about 335 residues (105 nm) of triple helix (Chu et al 1988) 23 flanked by large terminal globular domains. The COL/NC junctions contain cysteine residues through which dimers are formed. Molecules of type VI collagen aggregate by end to end association of tetramers to form microfibrillar arrays. In the COL domain there are 3 Arg-Gly-Asp (RGD) sequences thought to be involved in cell adhesion. The globular domains have 3 homologous repeats of approximately 180 amino acid residues, one at the amino terminus and two at the C-terminus. These have homology to the collagen binding region of Von Willebrand factor (Koller et al 1989, Chu et al 1990). Type VII collagen (Morris et al 1986) is a homotrimer, 450 nm in length, secreted by epithelial cells and found in the fibrils anchoring epithelium to the extracellular matrix. The COL domain is 425 nm long and has a Mr of 510 kDal. This is flanked by a 90 kDal NCI domain and a large C-terminus, NC2, of 450 kDal. Disulphide bonded dimers, overlapping by 60 nm, are formed between the NCI regions and the dimers aggregate laterally into fibrils. A reduction or absence of type VII collagen may lead to the recessive form of dystrophic epidermolysis bullosa but the gene has yet to be cloned. 1.5 Group 3 Collagens The group 3 collagens have a molecular weight of less than 95 kDal. Type IX collagen, a heterotrimer of 3 a-chains, is found in association with type II fibrils in cartilage 24 (Vaughan et al 1988). Type IX also occurs in neural tube, vitreous humour and corneal epithelium and may be co-ordinately expressed with type II (Kimura et al 1989b). In embryonic tissue COL9A1 uses a promoter 20 kb downstream of the adult promoter which results in the secretion of al(IX) lacking the N-terminal NC domain. However, in fully differentiated tissue, the large N-terminal globular domain extends into the matrix and may be involved in the binding of other extracellular matrix components. The sulphated glycosaminoglycans chondroitin sulphate and dermatan sulphate are found covalently bound to type IX fibrils. Type X collagen (Lu Valle et al 1989) is a homotrimer with similarities to type VIII. It is secreted by hypertrophic chondrocytes and is involved in endochondral bone formation. 150 nm of triple helix comprises 75 % of the type X molecule, this is encoded by one exon in COL10A1. The protein is secreted into a pericellular mat of fibrils of less than 5 nm diameter and is closely associated with type II collagen fibrils. Type XII collagen is a homotrimer with some terminal homology to type IX (Gordon et al 1987,1989). Type XII has 75 nm of triple helix incorporating a collagenase susceptible kink. It has been suggested that the involvement of type XII in type I collagen fibrils is similar to that of type IX with type II fibrils. mRNA from the most recently discovered collagen, type XIII, has been located by in situ hybridisation in bone, cartilage, gut, skin and muscle. The protein has not yet been isolated but the nucleotide sequence shows that it has 3 COL domains and 4 NC regions. The 3' end of the gene undergoes complex alternative splicing (Tikka et al 1988) and al(XIII) can therefore contain from 548 to 624 amino acid residues. Type Vffl collagen is the product of endothelial cells and is found in ocular sclerae, optic nerve and meninges (Kapoor et al 1988, Yamaguchi et al 1989). The type VIII molecule consists of 3 triple helical domains with 2 NC interruptions. There is a 60 % homology between al(VIII) and ocl(X) suggesting a common evolutionary origin. 25 1.6 Biosynthesis of Type I Collagen The biosynthesis of the fibrillar or interstitial collagens is a multistage process involving a number of enzymes (Kivirikko and Myllyla 1982, Prockop and Tuderman 1982, Koivu and Myllyla 1987). Typically the fibrillar collagens are synthesised as precursor molecules. These have a short N-terminal signal peptide, an N-terminal propeptide, a central collagen domain and a C-terminal propeptide, Fig 1.1. In type I collagen, the proal(I) chain is 1464 amino acids long. There is a 22 residue signal peptide encoded by the 5' region of COL1A1,161 residues of N-propeptide, a short 17 residue N-telopeptide, 1014 residues of triple helix, 26 residues of C-telopeptide and 246 of C-propeptide. Proa2(I) is very similar, consisting of a 22 residue signal peptide, a 79 amino acid N-propeptide, 11 residues of N-telopeptide, 1014 of triple helix, 15 of C-telopeptide and 247 residues of C-propeptide. 1.6.1 The two structural genes COL1A1 (Ramirez e t al 1985, Fig 1.2) and COL1A2 (de Wet et al 1987, Fig 1.3) consist of 51 and 52 exons covering 18 kb and 38 kb of genomic DNA respectively and are transcribed and spliced to give mRNA of about 5 kb (Olsen and h Prockop 1989, Vuorio and de Crombrugge 1990). There are regulatory regions both 5' and 3' of the transcription start site (Bomstein et al 1988). In experiments using transgenic mice, constructs comprising potential ris-acting and reporter gene sequences have shown that the 2000 bp upstream of the start site of transcription is sufficient to regulate tissue specific expression. As in other fibrillar collagen genes, there is an enhancer element in the first intron between nucleotides +700 and +1300 (Rossouw et al 1987). This region is both position and orientation specific (Sherwood and Bornstein 1990). 26 BIOSYNTHESIS OF TYPE I COLLAGEN COL1AI / COL1A2 Transcription ITranslation 3’ Signal Peptide N-Propeptide HELIX (Gly X Y) n C -Propeptide Preproachains of approx. 1350 amino acids 2 ff 1 (I) I1« 201 S /•s | Formation of triple helix Hydroxylation of lysine & proline residues Glycosylation (Glc, Gal) of hydroxylysine I Secretion s PROCOLLAGEN I Processing bv N & C propeptldases 300 nm « n m COLLAGEN I Fibrilloaenesls 40nm 66nm 300nm QUARTER STAGGERED ARRAY j Crosslinking Fig 1.1 27 Z - l idII—h Hind III — BcmHI Eco I R Xh oI C0L1A1 ---- 1 5-8 Restriction map of the COL1A1 locus encoding al(I) encoding locusCOL1A1 of the map Restriction -- N 23kb 10 12 ’ 2i 2 ‘ ° i , 2 ' °5- , 2 9-0 15 Hf 4-04 < c --- -- k 1 - ^ --- Hf 677 12-0 H , 2-2 , C Q ’6 f 62’ 6-0 * O - ^ ^ S V . 3* 30 6-6 5 kb 35 . 3' Rnm HI Rnm -FroRI . . III Hind — X'nol 1*9 I I J 9-5 3-4 4*2 ------l r ----- 1 ----- 1 1-7 ----- 2-Y i ------1 ------1 ------1 m ------f ------1 , 1------1 ------f ------6*7 6*7 5*9 *7 , 2 1-9 -. 5-5 5-5 . 3-0 1-7 ,1*3 3*1 4*1 1*3 26*3 26*3 , ------1 ------i ------3-5 5-3 —j------_____ 27*2 | Restriction map ofthe COL1A2 locus encoding a2(I) 1-5 0:6 1-3 1-2 V2 1-2 1-3 0:6 1-5 1C-5 i i i l | < J ______N N c< C 12-°, . 12-°, . 1-6 . . 4-0 1-6 . I I 1 1_ ------C0L1A2 Fig 1*3 Although fairly extensively dissected the role of these cis-acting elements in the regulation of type I collagen gene expression is not fully understood. A number of trans acting factors bind to promoter and enhancer segments in COL1A1 and COL1A2 (Vuorio and de Crombrugge 1990) but this area remains to be systematically analysed (Ramirez and Di Liberto 1990). 1.6.2 Translation begins in the cytosol on membrane bound ribosomes. As with other secreted proteins, the signal peptide is inserted into the membrane of the rough endoplasmic 7 reticulum (RER) and the elongating chain is then extruded into the cisternal space where it is subjected to a number of post-translational modifications (Kivirikko and Myllyla 1982) 1.6.3 Post-translational modifications include the hydroxylation of the C4 position of proline residues on the amino terminal side of a glycine residue, ie in the Y position of the Gly- X-Y triplet, by prolyl-4-hydroxylase [EC 1.14.11.2]. This enzyme is a dioxygenase composed of 2 a and 2 6 subunits with a ferrous ion at its active site. Molecular oxygen, a-ketoglutarate and ascorbate are required as cofactors. Exogenous hydroxyproline is not incorporated into collagen a-chains. The hydroxylation of proline is essential to the stability of the triple helix, increasing the amount of hydroxyimino acid produces a greater thermal stability. Poly-L-proline has a melting temperature of 24°C whereas ? [Pro-Hyp-Gly]n remains helical up to 58°C. The level of prolyl hydroxylation is dictated by the physiological temperature at which the animal lives. In general type I collagen will melt 3 to 4°C above the normal body temperature. In man about 100 proline residues in the Y position are hydroxylated and the normal T^ is 42°C. This is the rate limiting step in triple helix formation; once these 100 residues have been post- 30 translationally modified the triple helix forms preventing any further hydroxylation. Collagen which has been prepared in the presence of the iron chelator aa'-dipyridyl and is consequendy under hydroxylated will not form a stable triple helix at a physiological temperature. Similarly, in the absence of ascorbate, which keeps the ferrous ion in the reduced state, the collagen synthesised is under hydroxylated leading to the symptoms of scurvy. Certain proline residues in the X position of the Gly-X-Y triplet are modified by the action of prolyl-3-hydroxylase [EC 1.14.11.3] but the role of 3-hydroxyproline is not known. At the same time, whilst the molecule remains non-helical, about 20 lysine residues, on the amino terminal side of a glycine residue, are also hydroxylated at C5 under the action of another dioxygenase, lysyl hydroxylase [EC 1.14.11.4]. Hydroxylysine is then further modified, to a varying extent, by the addition of sugar moieties under the sequential action of galactosyl [EC 2.4.1.50] and glucosyl [EC 2.4.1.66] transferases (Harwood et al 1975). These enzymes require a bivalent cation as a cofactor and generally utilise Mn . It has been suggested that lysyl hydroxylase and these glycosyl transferases are a multienzyme complex on the RER. The C-propeptides are also N-glycosylated on specific asparagine residues. These sugar side chains probably serve to control the organisation of the fibrils. There is an inverse relationship between carbohydrate content and fibril diameter. The post-translational modifications are not fully complete by the end of chain elongation (Kirk et al 1987). A major proportion of fully translated but partially hydroxylated proa-chains remain in association with the polysome (Veiset al 1985) supporting the suggestion that chain association occurs at this stage. 1.6.4 It is essential that the 3 a-chains are in the correct register and that glycine is at every third position. The C-propeptides are involved in this alignment by the formation of 31 disulphide bonds between cysteine residues (Hillson et al 1984). It has been suggested that the number of S-S bonds dictates whether a heterotrimer or a homotrimer is formed (Weil et al 1987). a-chains capable of forming homotrimers have four cysteines in the C-propeptide and those forming heterotrimers have only three. The C-propeptides may also prevent intracellular fibril formation. It has been known for some time that the 6 subunit of prolyl-4-hydroxylase is present in the cell in considerable excess to the holoenzyme. Recent findings have shown that this subunit has a second enzyme activity which has been named as protein disulphide isomerase (Koivu and Myllyla 1987, Koivu et al 1987, Tasanen et al 1988). This enzyme catalyses the rearrangement of S-S bonds and may therefore play a role in the formation of such bonds between collagen C- propeptides. Once aligned at the C-terminus the triple helix forms, rapidly propagating from C to N (Uitto and Prockop 1974). Any interruption in helix formation, for example by a structural mutation, will allow excessive post-translational modification of the protein N-terminal of the mutation by the prolonged action of the enzymes described in 1.6.3. This phenomenon has been exploited by a number of workers to map mutations to a particular region of the protein molecule (Bonadio and Byers 1985). Once the helix has been fully formed the procollagen molecule is secreted into the extracellular matrix by a route which is still poorly understood. 1.6.5 The procollagen molecule is processed outside the cell (Prockop and Tuderman 1982, Bateman et al 1987a). The terminal propeptides, which prevent premature fibril formation within the cell and align the monomeric a-chains, are cleaved by specific endopeptidases. Procollagen-N-proteinase [EC 3.4.24] has the recognition sequence Ala- Gln and procollagen-C-proteinase, which has yet to be purified, cleaves at Glu-Asp. The 32 cleavage sites for these enzymes are in the telopeptides. The final type I collagen molecule is a long, semiflexible rod 300 nm by 1.5 nm. 1 .6.6 Fibrillogenesis appears to occur spontaneously directed only by intermolecular hydrophobic and electrostatic interactions and is thought to utilise the principle of nucleated growth (Prockop 1990a, Kuivaniemi et al 1991). Once processed from procollagen the aqueous solubility of collagen is dramatically reduced and polymerisation into fibrils, driven by entropy (Kadler et al 1987), occurs. Within the fibril, the rod shaped molecules align such that they overlap by 68 nm leaving a 40 nm gap between the ends of non-overlapping molecules (Fig 1.1). This quarter staggered array gives a characteristic banding pattern in electronmicrographs. Kadler et al (1988,1990) have shown that, in vitro, monomers are aligned at the N-terminus to form a tapering tip and more monomers are added at this end. It is therefore theoretically possible for more than one type of collagen molecule to be incorporated into a single fibril. Indeed this is sometimes the case. Fibrils containing type I and type V (Birk et al 1988) types I and III (Keene et al 1987) and types II and XI (Vaughan et al 1988) have all been found. 1.6.7 The intra and inter molecular crosslinks formed in collagen and elastin are unique and the nature and extent of crosslinking varies with tissue type and age. Connective tissues with particular mechanical strength are highly crosslinked. The e-amino terminus of specific lysine or hydroxylysine residues in the telopeptide regions are converted to aldehydes under the action of the copper dependent enzyme lysyl oxidase. Two such aldehydes from adjacent telopeptides can condense to form intramolecular aldol crosslinks. Alternatively an aldehyde can react with the e-amino group of a lysine or hydroxylysine residue from another molecule to form an intermolecular Schiff base. In certain tissues, 33 these can undergo further reaction to pyridinium compounds. The quarter staggered array formed by the interstitial collagens (Fig 1.1) dictates that the hydroxylysine residue in the sequence Hyl-Gly-His-Arg, which occurs twice in the helix, reacts with the telopeptide. If the hydroxylation of lysine residues is reduced, as in EDS VI (Pinnellet al 1972, Sussman et al 1974), there is also insufficient crosslinking. 1.7 Osteogenesis Imperfecta OI is a heterogeneous disease ranging from relatively mild to severe and lethal forms (Tsipouras and Ramirez 1987) with an overall incidence of one case per 10,000 births. The primary clinical manifestation is bone fragility. Other symptoms include blue ocular sclerae, pre-senile hearing loss, joint laxity and dentinogenesis imperfecta (DI) (Levinet al 1978). Although it is possible that abnormalities in other proteins are associated with OI (Pasquali-Ronchetti et al 1986) it is not surprising that in most OI patients studied a mutation in one of the genes encoding type I procollagen (Prockop et al 1990a) has been found (See Figs 1.4 and 1.5). Patients with OI may have a reduced type I procollagen synthesis or an increased degradation (Bateman et al 1984). Certain patients show poor processing to collagen (Minor et al 1986) and many have a demonstrably abnormal type I protein. A reduction in the type I collagen content of bone, a concomitant increase in types III and V collagen 34 (Bateman et al 1986) and ultrastructural changes in collagen fibrils (Stoss and Pesch 1985) have also been observed. Mutations in the type I structural genes are clearly the most common cause of the disease OI. Schnieke et al (1983) introduced retroviral provirus DNA from the Moloney murine leukaemia virus into the first intron of COL1A1. This blocked transcription producing a null allele. Transgenic mice homozygous for this mutation, known as Mov-13, died very early in foetal life at around 13 days from failure of the vascular system (Breindl et al 1984, Lohler et al 1984). Mov-13 heterozygotes have subsequently been shown to suffer from the symptoms of mild OI, deafness and bone fragility (Bonadio et al 1990a). Stacey et al (1988) have engineered mice (Schnieke et al 1987) with a glycine to cysteine or arginine change at residue 859 of the al(I) helix. These mice suffered from dominant lethal OI and it was concluded that as little as 10 % expression of a mutant allele might disrupt normal collagen function. A general clinical classification dividing OI patients into four major groups was proposed by Sillence et al (1978,1979). 35 1.8 Sillence Type I Ol Type IO I is the mild, autosomal dominant form of the disease in which patients suffer post-natal fractures. OI type I is clinically distinct from the slightly more severe type IV OI in which patients have white ocular sclerae (Sillence et al 1990). In the subgroup type IB OI the patients also have dentinogenesis imperfecta (DI). It is now generally accepted that all cases of autosomal dominant OI are the result of abnormalities in one of the two structural genes encoding type I collagen (Sykes et al 1990). A loss of hearing appears to be associated with patients in whom the disease is linked to the COL1 Al locus. 1 .8.1 OI type I patients appear to fall into two categories (Tsipouras et al 1984). In some patients, a 50 % reduction in the al(I) protein and a concomitant reduction in COL1 Al mRNA levels can be demonstrated (Barsh et al 1982, Rowe et al 1985, Genovese and Rowe 1987, Nicholls et al, unpublished). These individuals seem to be heterozygous for a silent COL1A1 allele and because there is no dosage compensation (Voss and Bomstein 1986) they synthesise half the normal amount of al(I). No regulatory mutation has yet been identified in a patient cell line but it is likely that mutations in the promoter region 5' of the gene or in the regulatory elements in the first intron or 3' of the gene might cause a null allele. 1.8.2 The second group of OI type I patients secrete normal amounts of type I collagen but have a mutation within the coding region. The change in the protein or the location of that change is clearly not sufficiently catastrophic to cause lethal disease but the secretion of the mutant protein and its incorporation into fibrils perturbs the tissue to some extent 39 giving a mild disease. Mutations identified to date include a 5 bp deletion in COL1A1 starting at glutamine 1275 ie residue 235 of the C-propeptide (Willing et al 1990). This frameshift mutation predicts an elongated al(I) chain which is detected in an in vitro translation system but is probably rapidly degraded in vivo. The product of the mutant allele is not present in any tissue and the protein phenotype is therefore very similar to that of patients with a silent allele. A number of point mutations have been identified. The majority of these individuals have a glycine to cysteine amino acid change at the extreme end of the protein molecule. As cysteine residues are not normally present in al(I) this change is readily identified by the presence of disulphide bonded dimers in patient collagen isolates. At the extreme C-terminal end of the molecule, in the third residue of the telopeptide at position 1017, a glycine to cysteine was described (Nicholls et al 1984b, Cohn et al 1988, Steinmann et al 1986, Labhard et al 1988). At the N-terminal end, there have been glycine to cysteine substitutions at positions 94 (Starman et al 1989), 175 (de Vries and de Wet 1986, Pretorius et al 1990) and 178 (Cetta et al 1990, Tenni et al 1990). In a2(I) this change has been found at position 646 (Wenstrup et al 1990a). It seems likely that mutations which result in the substitution of a residue from the X or Y position of the helix will also give a mild phenotype. Only one such mutation has been reported and this was associated with a variant of the Marfan syndrome (Phillips et al 1990). Bateman et al (1990) have reported a tryptophan to cysteine in al(I) at residue 94 of the C-propeptide that is residue 1134 of proal(I) in a patient with mild OI. N-terminal exon skipping mutations have also been observed in mild OI patients; al(I) exon 17 (Pruchno et al 1989) and a2(I) exon 26 (Wenstrup et al 1990a). A 19 bp deletion in a2(I) IVS 13 causing splicing out of exon 13 has also been described (Zhuang et al 1990b). 40 1.9 Sillence Type II Ol Type I I 01 is the perinatal lethal form of the disease and this has been further subdivided into categories A, B and C (Sillence et al 1984). Type DA is the broad boned lethal form with an overall frequency of 1 in 60,000 births. It is now generally accepted that the majority of these cases arise as new autosomal dominant mutations (Young et al 1987, Byerset al 1988a). Type IIB is a thin boned variant which may be a lethal form of type ID OI (1.10). Type IIC is extremely rare and associated with a very disorganised skeleton (Thompson e ta l 1987). Many cell lines established from patients with perinatally lethal OI have been characterised and the mutation identified (Figs 1.4 and 1.5). A number of gene rearrangements have been found but the majority of mutations are point mutations which cause a glycine to be substituted by another bulkier amino acid. Substitutions introducing a residue which significantly alters the molecular charge may also confer lethality. 1.9.1 Gene rearrangements al(I) A heterozygous deletion of 643 bp was the first defect causing lethal OI to be fully characterised. This cell line (American Type Culture Collection CRL 1262) had a deletion of exons 23 to 25 ie amino acid residues 328 to 411 of the al(I) chain (Penttinen et al 1975, Barsh and Byers 1981, Williams and Prockop 1983, Barsh et al 1985, Chu et 41 al 1983, 1985). The patient synthesised a shortened al(I) chain which was incorporated into 75 % of the type I collagen molecules produced. These molecules, containing one or two mutant al(I) chains, are destroyed intracellularly. This patient therefore secreted a reduced amount of type I collagen. Since a proportion of normal chains are also degraded in this way the phenomenon has been called protein suicide. Two cases of insertions in a 1(1) have been reported. In the first, Byers et al (1988b) described a 600 bp, in frame insertion. Sixty amino acids were added into the cyanogen bromide peptide, al(I)CB8. Bateman e t al (1989) observed the insertion of a single T in exon 49 of COL1A1. Cysteine 1146 in the al(I) C-propeptide became a valine and the ffameshift altered the remaining 50 amino acids. As this region of the protein is probably vital to the correct alignment of the helix the mutation produced a lethal phenotype. However, it might have been expected that such a mutation might prevent the product of the mutant allele from being incorporated at all and thus give rise to the mild OI phenotype seen in patients with a null allele (1.8.1). Willing et al (1988) described a large deletion of about 4.5 kb covering exons 34 to 40 of the helix, residues 586-765 in a2(I) were deleted. 1.9.2 Amino acid substitutions To date these have all been glycine substitutions. The codon for glycine, GGN, can be mutated by a point mutation to give that for cysteine, arginine, serine, tryptophan or the opal stop codon TGA by changing the first position and to the codon for valine, alanine, aspartic acid or glutamine by a change in the second position. 42 1.9.2.1 Glycine to Cysteine As outlined in 1.8.2 a glycine to cysteine change at either end of the molecule produces a mild phenotype. However, in the C-terminal part of the helix this alteration gives lethal OI. Nine have been described: a id ) 988 Steinmann et al 1984,1986 Cohn et al 1986 Rao et al 1989 Genovese et al 1989 904 Constantinou et al 1989,1990 748 Vogel e ta l 1987, 1988 718 Starman et al 1989 CB6 Hattori e ta l 1988 691 Prockop 1990b 244 Fertala et al 1990a 472 Cohn et al 1990c 1.9.2.2 Glycine to Arginine This change has been identified in 7 cases of lethal OI: al(I) 976 Lamande et al 1989 847 Wallis et al 1990a 667 Bateman et al 1987b, 1988 550 Wallis et al 1990b 391 Bateman et al 1987c a2(I) 694 Tsuneyoshi et al 1990 496 Bateman et al 1990 43 1.9.2.3 Glycine to Aspartate All eleven glycine to aspartate mutations found in type I collagen have produced perinatal lethal OI: ocl(I) 883 Cohn et al 1990a 673 Cohn et al 1990c 569 Cohn et al 1990c 559 Byers 1990 541 Zhuang e t a l1990a 97 Byers 1990 cx2(I) 976 Byers 1990 907 Baldwin et al 1989 805 Byers 1990 580 Byers 1990 547 Bonadio et al 1988 1.9.2.4 Glycine to Alanine This has been described at position 928 in al(I) (Lamande et al 1989). 1.9.2.5 Glycine to Valine al(I) 1009 Cohn et al 1990c 1006 Lamande et al 1989 973 Lamande et al 1989 637 Westerhausen et al 1990b 256 Patterson et al 1989 44 1.9.2.6 Glycine to serine Seven such mutations have been identified in type I collagen: 1003 Cohn et al 1990b 964 Wallis et al 1990c 913 Cohn et al 1990b 631 Westerhausen et al 1990a 598 Westerhausen et al 1990a 565 Bateman et al 1990 Lamande et al (1989) described a glycine to serine in a2(I) at residue 865. 1.9.3 Exon skipping Exon skipping might be expected as a mechanism causing defects in type I collagen. There are at least 50 introns to be removed during processing of the primary transcript to mature mRNA. A deletion in the cDNA is caused by a single base change at a splice junction in genomic sequence. The following have been described in lethal O I: a id ) Exon 14 Bonadio et al 1990b Exon 27 Byers 1990 Exon 44 Byers 1990 Exon 47 Wallis et al 1990c In COL1A2 exon 28 was skipped (de Wet et al 1983, Tromp and Prockop 1988) in a patient with a silent allele at this locus. Consequently the patient only produced mutant a2(I) chains. A patient with exon 33 skipping in COL1A2 has also been identified (Baldwin et al 1988). 45 1.10 Sillence Type III Ol Type III OI is a severe, progressively deforming condition. The mode of inheritance was originally defined as autosomal recessive but this may not always be the case. Clear autosomal recessive OI is exceptionally rare and may be confined to consanguineous pedigrees. Only one case of recessive OI has been fully characterised. Third cousin parents had a child affected with severe OI. The actual mutation was a 4 bp deletion in a2(I) starting at residue 214 in the C-propeptide. The resultant frameshift prevented the patient from synthesising any normal type I collagen. He only produced a 1(1) trimer (Nicholls et al 1984b). Both parents were heterozygous for the deletion but showed no overt disease (Deak et al 1983, Dickson et al 1984, Pihlajaniemi et al 1984, Pihlajaniemi and Myers 1987). Other pedigrees where an OI phenotype is apparently transmitted in an autosomal recessive fashion are not linked to COL1A1 or COL1A2 (Aitchison et al 1988) although there is clearly an abnormality in the type I collagen protein. Certain native South African families also have autosomal recessive OI (Viljoen and Beighton 1987, Byers 1990). In these cases the disease does not segregate with either of the type I collagen gene loci and in protein analysis there is no obvious abnormality. A defect in a bone specific protein which interacts with type I collagen is a good candidate for the OI in such patients. In al(I) glycine to arginine at 154, glycine to cysteine at 526 (Starman et al 1989), glycine to serine at 844 (Packet al 1989) and at 1009 (Cohn et al 1990b) all give the severe form of OI. OI III/IV has been shown by Nicholls et al (1990) to be due to glycine to cysteine at residue 415. Mutations in a2(I) include a deletion of the last 3 bp of exon 19, ie a deletion of a valine 46 (Molyneuxet al 1990) and a point mutation causing glycine to cysteine at 256 giving a variable severe phenotype (Wenstrup et al 1990a). 1.11 Sillence Type IV 0I The inheritance of this form of OI is autosomal dominant but it is more severe than type I OI and the patients have white sclerae (Wenstrup et al 1986a). At first it was thought that OI IV was only caused by a2(I) mutations. These include a glycine to arginine change at 1012 (Wenstrup et al 1988) a glycine to valine at 586 (Bateman et al 1990) and a glycine to cysteine at 259 (Wenstrup e t al 1990a). This hypothesis has now been discounted. The Sillence classification has no biochemical basis and the moderate and severe types are the most difficult to categorise in this way. There is clearly an overlap between OI type HI and OI IV. The moderately severe phenotype has been associated with single base changes which are presumably less catastrophic than those in OI II. The moderate OI phenotype has been associated with a number of exon skipping mutations. A 38 bp deletion in a2(I) in intervening sequence (IVS) 21 (Superti-Furga et al 1990) leads to the skipping of exon 21. Splicing out of exons 8 (Bateman et al 1990) and 12 (Byers 1990) from the COL1A1 locus and the addition of a hexapeptide between al(I) 585 and 586 as the result of an insertion in intron 33 (Wenstrup et al 1986b, 1990b) have also produced OI type IV. The following point mutations have been reported in patients with the moderately severe phenotype: 47 Glycine to serine at al(I) 832 (Mariniet al 1989) Glycine to cysteine at al(I) 382 (Byers 1990). Certain trends in severity have become apparent from the study of actual mutations in 01, see Figs 1.4 and 1.5. Large deletions or defects causing frameshifts are generally lethal. Mutations causing exon skipping and a consequently shortened cDNA are lethal if they occur within the helix and severe if more N-terminal. Defects which alter the propeptidase cleavage site are associated with poor processing and clinically with joint hypermobility. Point mutations within the helix often destabilise it and generally result in the more severe phenotypes if they occur at the C-terminal end possibly because the excessive post-translational hydroxylation affects more of the molecule. For instance, glycine to cysteine in al(I) is lethal in the C-terminal half of the helix and at residue 244, severe at residues 382, 415 and 526 and mild at the extreme ends of the molecule. 1.12 Other Disorders Caused by Type I Collagen Mutations Although most type I collagen mutations lead to OI certain other phenotypes are associated with type I abnormalities. 1.12.1 These abnormalities may be very mild with some of the features of OI. For example a point mutation causing a glycine to cysteine at residue 19 of al(I) has been characterised by Nicholls et al (1990). This patient has hypermobile joints and osteoporosis. In another family, also described by Nicholls et al (1990), affected patients have hypermobility, osteoporosis and some fractures. These patients have an 11 bp deletion in 48 IVS 9 which leads to skipping of exon 9 in the cDNA. A very similar family has been described (Sippola et al 1984, Kuivaniemi et al 1988); the deletion of 19 bp at the junction of intron 10 and exon 11 causes exon skipping and atypical 01. Spotilaet al (1990) have described a patient with osteoporosis in which a point mutation has changed a glycine at residue a2(I)-661 to a serine. Single base mutations at the extreme ends of the protein molecule might often produce a very mild disease and many such cases might go undiagnosed. 1. 12.2 Ehlers Danlos syndrome (EDS) is a highly heterogeneous group of inherited disorders characterised by hyperextensible skin, bruisability and hypermobile joints. Ten different forms are now recognised (Beighton et al 1988). The EDS VII variant is associated with type I collagen abnormalities (Cole et al 1986,1987, Steinmann et al 1980). EDS VII patients fall into two categories. In EDS VIIA there is a defect in al(I) and EDS VIIB sufferers have an abnormality in a2(I). This phenotype is relatively clearly defined. The protein phenotype for classical EDS VII is probably the least heterogeneous of the interstitial collagen disorders. However, a number of patients are clinically diagnosed as EDS VII but have a different biochemical profile. In patients with typical EDS VII there is a persistence of pN-collagen; that is a-chains to which the N-propeptide is still attached (Lichtenstein et al 1973). Poor processing is not only associated with the EDS VII phenotype; it may be the cause of joint hypermobility in other conditions. To date only classical cases of EDS VII have been described (Wirtz et al 1987). In all cases the region of the cDNA encoded by exon 6 is absent. This exon encodes the N-terminal telopeptide which contains the N-propeptidase cleavage site. The actual mutation in genomic DNA is a point mutation causing exon skipping. A G to A change in the last nucleotide of the exon in al(I) (Weil et al 1989a) or a2(I) (Weil et al 1989b) gives rise 49 to EDS VII. A T to C in the second nucleotide of intron 6 in COL1A2 produces this disease (Weil et al 1988b). 3 unrelated cases of a G to A change in the first nucleotide of intron 6 in a2(I) have now been reported (Weil et al 1990, Nicholls et al 1991 and Vasan et al 1990). These are the only published examples of coincidental mutations in type I collagen. 1.13 Causes of Type I Collagen Mutations The clinical effects of collagen gene defects are obvious and so they are perhaps more easily ascertained than mutations at other loci but collagen genes might be particularly predisposed to mutation. The structural genes COL1A1 and COL1A2 are not particularly large, covering 18 kb and 38 kb respectively, in comparison to other genes such as dystrophin. However, the loci are complicated. COL1A1 has 51 exons and COL1A2 has 52 so, in each case, more than 50 intervening sequences have to be spliced out from the primary transcript to generate mature mRNA. This extensive splicing may allow recombinations and deletions. The tripeptide Gly-Pro-Hyp is encoded by the sequence GGN-CCN-CCN so collagenous sequence is predisposed to unequal crossing over at meiosis. The most commonly observed point mutation in DNA is that of a C to T. 5-methyl cytosine can be deaminated to thymine. In this way a C in the antisense strand of a collagen coding sequence could lead to a GT mismatch. DNA repair enzymes might easily replace the guanine with adenine rather than correcting the mismatch by replacing the T in the antisense strand with a C. The result would be a G to A mutation in the sense strand. There are more than 300 glycine residues in each a-chain. As the codon for 50 glycine is GGN there are 600 antisense cytosines which might be mutated in this way causing an amino acid substitution and, in certain cases, the OI phenotype. 1.14 Methodology 1.14.1 In the general population there are many silent single base changes throughout the genome which may abolish or create restriction enzyme recognition sequences. This alters the pattern of restriction fragments obtained with a particular enzyme. These changes are known as restriction fragment length polymorphisms (RFLPs). RFLP segregation analysis for type I collagen genes has been possible for some time and has been used to generate markers for prenatal diagnosis (Sykes et al 1990, Lynch et al 1990). This methodology has the advantage of being general; it can be applied to families where the actual mutation is unknown. By analysing genomic DNA for a series of ordered polymorphisms linked to a candidate gene it is possible to assign haplotypes to patients and their unaffected relatives. Linkage phase can thus be established in families where the segregation of the disease phenotype with a particular haplotype can be traced through the pedigree. Linkage studies can also be used prior to sequence analysis when searching for a mutation. This is especially useful in OI where there are two candidate genes, COL1A1 and COL1A2. Exclusion of one locus by segregation analysis reduces the necessary DNA analysis by half. 51 Most suitable families, large kindreds or those with affected patients in several generations, have the autosomal dominant forms of OI. These generally produce the mild to moderate phenotypes and do not require prenatal diagnosis as urgently as those with the severe or lethal forms. 1.14.2 The polymerase chain reaction (PCR) (White et al 1989, Reiss and Cooper 1990, Reviews) is a technique which was greatly facilitated by the isolation of a DNA polymerase from Thermus aquaticus (Saiki et al 1987). This enzyme is stable up to 94°C, a temperature at which DNA is denatured into its single stranded form. Using this enzyme and specific oligonucleotide primers it is possible to amplify small amounts of DNA by a factor of at least 106 through a series of denaturation, primer annealing and elongation steps. The process is extremely rapid. The addition of nucleotides in the elongation stage can be as fast as 40 bp a second under optimum conditions. However, Taq DNA polymerase has no editing activity and therefore has a relatively high error rate. Consequently, when sequencing PCR generated DNA clones for mutations, a number must be analysed. Alternatively the whole PCR product can be directly sequenced to eliminate artefacts. 1.15 Reasons for the Study of OI OI is rare when compared with some other heritable disorders such as cystic fibrosis and it has the additional complication that the mutations so far described have been unique to a particular family. Nevertheless, there are a number of reasons why these patients should be investigated. The disease itself, in its severe and lethal forms is particularly 52 distressing. The severe non-lethal forms are progressively deforming leading to a wheelchair bound existence and many hospitalisations for surgical procedures. Often life expectancy is reduced. Even the mild forms are incapacitating to some extent. The best methods for prenatal diagnosis use PCR (1.14.2) DNA amplification and allele specific oligonucleotides (Boehm 1989) but it is a pre-requisite that the actual DNA defect be known; this is not the case in OI. All the evidence suggests that the milder forms of OI, types I and IV, are always linked to one of the type I collagen gene loci COL1A1 or COL1A2 and that the disease is transmitted in a Mendelian autosomal dominant fashion (Sykeset al 1990). In these families RFLPs (1.14.1) can be used to generate haplotypes which are traced through the pedigree. There are certain disadvantages to this technique. The most suitable families are usually those with the milder phenotypes, some subjects may be uninformative for the RFLPs associated with the type I collagen genes and although a first trimester termination of a suspect pregnancy is possible, there is no way of confirming that the diagnosis was indeed correct. At present the only effective, generally applicable method for prenatal diagnosis of the severe and lethal forms of OI is a series of ultrasound scans leading to very late terminations of affected pregnancies, at around 20 weeks gestation (Aylsworth et al 1984). The quality of counselling will be greatly improved if we have a further understanding of the mechanism and genetics of the disease. In the past decade the recurrence risk for lethal OI, which was originally considered recessively inherited, has been reduced by the demonstration that most cases are new dominant mutations in the foetus. This is however being further modified by the recognition of parental mosaicism in some families (Cohn et al 1990a, 1990c, Constantinou et al 1990, Wallis et al 1990b). Furthermore, as the number of fully characterised mutations increases the prospect of a truly biochemical classification improves. 53 The biosynthetic pathway described in 1.6 is complex and may not yet have been fully elucidated and, as a corollary, the study of the diseases of type I collagen will extend our knowledge of the biochemistry of this ubiquitous protein. 1.16 Project Introduction The majority of lethal 01 cases arise as new dominant mutations in the foetus (Young et al 1987, Byerset al 1988a). The recurrence risk in these families is thus very low. However, non-traditional mechanisms of inheritance, associated with an unknown but increased recurrence risk have been suggested (Hall and Byers 1987, Byers et al 1987, Hall 1988). Indeed it is possible that in as many as 10 % of OI families one parent is a germinal mosaic. The implications of this observation are very important when calculating recurrence risk. The statistical chance of a second affected child is perhaps 10 % (Edwards 1989) but the chance of a third might be as much as 50 % depending on the proportion of the defect in the germline. The initial aims of this study were, using a combination of peptide mapping and DNA analysis; to identify the molecular defect causing severe or lethal OI in certain families, especially those where there had been more than one affected child; to determine the mode of inheritance in these pedigrees and to provide insight into the mechanisms by which defects in type I collagen produce the disease. It was anticipated that this research would help establish a biochemical basis for the clinical classification and also generate possible determinants for prenatal diagnosis. 54 C h a p t e r 2 55 MATERIALS AND METHODS 2.1 Materials All media, foetal calf serum and cell culture materials were obtained from Flow laboratories. Bacto-agar, tryptone, yeast extract and other microbiological products were from Difco Laboratories, IPTG and antibiotics were purchased from Sigma Ltd. and X- Gal from NBL. Acrylamide, Bis, TEMED and ammonium persulphate were Electran grade, BDH Ltd. Agarose was purchased from Koch-Light Ltd.. All other chemicals, buffers etc were of analytical grade; AnalaR, BDH Ltd. or equivalent. Phenol was obtained from Rathbum Chemicals; acids and other solvents from either BDH or May and Baker. Pepsin was obtained from Worthington and proteinase K from BCL. Trypsin, chymotrypsin, trypsin inhibitor, NEM, PMSF, pHMB and RNase A were obtained from Sigma. Restriction enzymes were purchased from Gibco-BRL, Pharmacia or NBL, T4 DNA Ligase and CIP from BCL. The Klenow fragment of DNA polymerase I and AMV reverse transcriptase were obtained from NBL and in the ultrapure FPLC form from Pharmacia Ltd.. Taq DNA polymerase was obtained from Perkin-Elmer Cetus or BRL. 56 DEAE-cellulose NA45 was obtained from Schleicher and Schuell. Nitro-cellulose filters for the Southern analysis were obtained from Schleicher and Schuell or Gelman Ltd- Nylon membrane was obtained as Hybond-N from Amersham International. Sephadex G50-fine was from Pharmacia. Radio-isotopes were from either Du Pont-New England Nuclear or Amersham International. Kits for labelling DNA probes by nick translation or the random primer oligolabelling method were from Amersham International. X-ray films for autoradiography and fluorography were purchased from Fuji and Kodak respectively. 2.2 Human Skin Fibroblast Culture For culture media, see Appendix 2 Skin fibroblast cell lines were established from explants of 4 mm punch biopsies and propagated in DMEM supplemented with penicillin, streptomycin, FCS, glutamine and ascorbic acid (Appendix 2) at 37°C in a 5 % C02, 95 % air atmosphere. Cell medium was changed twice weekly. Cell lines were stored frozen under liquid nitrogen in 1.5 ml aliquots of complete DMEM containing 10 % DMSO. All manipulations were carried out on cells below passage 15. 57 Total cytoplasmic RNA and/or genomic DNA was extracted from confluent fibroblasts grown on 150 mm cell culture dishes. Half the medium was removed and replaced with fresh medium 24 hours before the cells were harvested. Cells in which collagens were to be labelled with radioactive tracer amino acids were grown to confluence on 35 or 50 mm dishes and fed with fresh medium 24 hours before labelling. 2.2.1 Metabolic Protein Labelling 2.2.1.1 ..with or ^H-Proline Confluent cell cultures were rinsed twice with BME supplemented as described in Appendix 2. 3 ml of BME containing ^C-proline at an activity of 1 pCi/ml was added to each 50 mm dish for routine 16 hour labelling. For short incubations of 4 hours or less 14 3 2 ml of BME containing 5 pCi/ml C-proline was added. When used H-proline was added at an activity of 50 pCi/ml in 2 ml BME. 2.2.1.2 ..with ^C-Lysine DMEM without either lysine or glutamine was specially prepared (Flow Laboratories). This was supplemented as described in 2.2. 1 pM lysine was also added. Confluent cultures were rinsed twice with this medium and allowed to equilibrate at 37°C for 30 mins. Cells were then incubated overnight in 3 ml of low lysine DMEM containing 5 pCi/ml ^C-lysine. 2.2.1.3 ..in the presence of cca’-dipyridyl Confluent cultures were equilibrated in BME, supplemented as before, with the addition of 0.3 mM aa'-dipyridyl and then incubated in the presence of both aa'-DP and the isotope overnight. 58 2.3 Isolation of Protein by Salt Precipitation Cell harvesting varied according to the method to be used for the extraction of the protein. 2.3.1 Cell harvesting (a) Procollagen. Medium was collected into a 0.5 oz McCartney bottle and the cell layer rinsed with PBS. Cell layers were scraped into PBS containing 0.5% Triton-TXIOO. Proteinase inhibitors were added to the following final concentrations: 50 pg/ml PMSF 50 pg/ml pHMB or NEM 10 mM EDTA (b) Collagen. Medium was collected into a chilled universal, the cell layer was washed with 1.5 ml 0.5 M acetic acid and this was added to the medium. After further washing the cells were scraped into 5 ml 0.5 M acetic acid containing 0.5% Triton-TXIOO. All samples were stored at -20°C. 2.3.2 Protein Isolation 50 to 100 pi of 3 mg/ml acid soluble calf skin collagen was normally added as carrier to samples which were to be purified by this method. Procollagen was isolated from the medium after removal of the cell debris by the addition of solid NaCl to a final concentration of 20% (w/v). The protein pellet was spun down and washed with 20% NaCl in 0.05 M Tris-Cl pH 7.5 and then desalted with 30% ethanol. The pellet was 59 resuspended in 0.3 ml 0.5 M acetic acid, the radioactivity determined by counting an aliquot in liquid scintillant and an estimate of labelling made from the number of TCA precipitable counts on filter paper discs. Cell layer procollagen was isolated by dialysis against 0.05 N ammonium formate pH 7.98 followed by 0.5 M acetic acid. Aliquots of medium or lysed cells were acidified with 0.5 M acetic acid. 300 pg/ml acid calf skin carrier and 35 pg/ml pepsin were added and the samples incubated at 16°C for 4 to 6 hours. After pepsin digestion, collagen was isolated from acidified medium or lysed cells. The cell debris was removed and the protein precipitated by incubating at 4°C overnight in 10 % NaCl (w/v). Protein pellets were washed with 10 % salt in 0.5 M acetic acid, 4 M NaCl in 0.05 M Tris-Cl pH 7.5, then rinsed with 30 % ethanol. Pellets were resuspended in 0.5 M acetic acid and their radioactivity estimated. 2.4 Isolation of Protein by Ethanol Precipitation 2.4.1 Cell harvesting The medium was collected into a chilled bijou. The cell layer was rinsed with 0.5 ml cold PBS and this was added to the medium. The cells were then washed thoroughly with PBS and the washings discarded. The monolayer of fibroblasts was scraped into 1.5 ml of PBS using a rubber policeman. The cells were spun down briefly in a microfuge, washed with PBS and stored at -20°C. 2.4.2 Protein Isolation Cell debris was removed from a 0.5 ml aliquot of tissue culture medium by centrifugation at 13 krpm for 3 to 5 mins in a microfuge. 2 volumes of cold ethanol were added to the 60 supernatant and the tube incubated at 4°C overnight. To certain samples, labelled in the absence of serum, 10 pi of carrier FCS was added. The ethanol precipitate was spun for 5 mins at 13 krpm in a microfuge at 4°C, washed with 70% ethanol and dried in vacuo. The pellet was resuspended in 0.3 ml 0.5 M acetic acid and the labelling estimated as already described (2.3.2). Cells were lysed in 0.5 ml PBS-0.5 % TX100 on ice for 1 hour, cell debris was removed and the procollagen isolated as described for the medium. Suitable amounts of procollagen were freeze dried for analysis by SDS-PAGE. Collagen was generated by digestion at 4°C overnight or at 16°C for 4 hours in the presence of 50 pg/ml pepsin prior to freeze drying. 2.5 Polyacrylamide Gel Electrophoresis 2.5.1 Protein Separation Procollagen and collagen a-chains were separated using SDS-PAGE. The Biorad Protean apparatus and the tris-glycine buffer system of Laemmli (1970) were used. Routinely, proteins were separated on a 1.5 mm thick, 5 % separating gel (pH 8.8) with a 3 % stacking gel (pH 6.8). For procollagen, samples were reduced with 1 % 2-mercaptoethanol and gels contained 2.0 M urea. Collagens were separated in the presence of 0.5 M urea. Cyanogen bromide peptides were separated on 10 % gels with 5 % stacking gels containing 0.5 M urea. Type III collagen a-chains were investigated using the reduced interrupted technique described by Sykes et al (1976a). Electrophoresis was carried out at a constant voltage of between 40 and 50 V overnight. 61 2.5.2 Visualisation of protein on gels Protein extracted from tissue was visualised by staining with Coomassie brilliant blue R250 and destaining as appropriate (see Appendix 1). Gels containing radiolabelled protein were soaked briefly in glacial acetic acid and then infused with 20 % (w/v) PPO in glacial acetic acid for 1 hour (Bonner and Laskey 1974) After precipitation of the fluor in distilled water, gels were dried onto Whatman 3MM paper in vacuo at 80°C. Fluorographs were produced by exposing gels to Kodak XOMAT-S film at -70°C. Certain fluorograms were exposed to prefogged film and the bands quantified using a Schimadzu CS-930 dual wavelength TLC scanner. 2.6 Cyanogen Bromide Peptide Mapping Peptide mapping made use of cyanogen bromide (CNBr) to cleave the protein at methionine residues. Procollagen or collagen labelled with ^C-proline or ^H-proline was freeze dried and then cleaved with 10 % (w/v) CNBr in 70 % formic acid at room temperature for 2 to 4 hours. Samples were diluted, the peptides redried and run out on a polyacrylamide gel (see 2.5.1). For two dimensional analysis, a-chains were separated on a 1 mm, 5 % gel. The bands were located by direct autoradiography then cleaved by CNBr in situ. After digestion, fragments from the first gel were washed twice with distilled water, equilibrated in sample buffer without SDS or urea and the CNBr peptides separated on a second gel. 62 2.7 Determination of Thermal Stability of Collagen. The method used was essentially that of Bonadio and Byers (1985) using trypsin to digest unfolded regions of triple helix (Bruckner and Prockop 1981). Sufficient radiolabelled collagen for about 10,000 cpm per temperature point was freeze dried. This was dissolved in 1 % acetic acid at 4°C overnight, neutralised with 2 M NaOH and diluted with 0.8 M NaCl, 0.1 M Tris-Cl pH 8.0 such that 30 pi of the final solution contained 10,000 cpm. 30 pi aliquots were then equilibrated at the starting temperature. The temperature was raised at 15°C per hour and at selected temperatures aliquots were removed and cooled rapidly to 20°C. 5 pi of 2 mg/ml (510 U/ml) trypsin in 0.4 M NaCl, 0.05 M Tris-Cl pH 8.0 was added. After two minutes, the digestion was stopped by the addition of 5 pi of 4 mg/ml trypsin inhibitor (from ovomucoid). The tube was placed on ice for 10 minutes. Samples were stored at -20°C then thawed, diluted with 4 x electrophoresis sample buffer, denatured and analysed on a 5 % polyacrylamide gel. The temperature at which the triple helix melted was determined from a fluorogram. 2.8 Amino Acid Analysis 2.8.1 Estimation of total collagen synthesis The level of collagen synthesis was estimated from the ratio of labelled proline: hydroxyproline in hydrolysed protein. Labelled medium and lysed cells together were dialysed as described in 2.4.1. The retentate was freeze dried and hydrolysedin vacuo in 6 M HC1. The hydrolysate was diluted and evaporated to dryness twice using a rotary evaporator, resuspended in up to 0.5 ml 0.1 N HC1 and then passed through a 0.45 pm filter before separating on the coarse cation exchange column of an amino acid analyser. 63 Hydroxyproline and proline peaks were separated by at least 7 minutes elution time. 14 0.5 ml aliquots of 2 ml fractions were counted for the C-activity and the results calculated as a ratio of hydroxyproline to proline. 2.8.2 Estimation of lysine hydroxylation As an estimation of post-translational hydroxylation, the level of hydroxylysine in the individual a-chains was determined. The appropriate protein band, located by autoradiography, was cut out, hydrolysed and prepared for the amino acid analyser as described in 2.8.1. Hydroxylysine was well resolved from the lysine peak. Results were calculated as relative percent hydroxylation. 2.9 Extraction of DNA and RNA 2.9.1 Extraction of genomic DNA from fibroblasts Skin fibroblasts were grown as described in 2.2.1. The culture medium was discarded. The cells were rinsed with PBS then detached using trypsin versene at 37°C for 10 minutes. The cells were collected into PBS and pelleted by low speed centrifugation (about 800g). The pellet was washed, frozen at -40°C for at least 2 hours and then resuspended in 10 ml of 100 mM NaCl, 20 mM EDTA. SDS and proteinase K were added to a final concentration of 0.5 % and 100 pg/ml respectively and the lysate incubated at 50°C for 1 hour or at 37°C overnight. The nucleic acid was extracted with an equal volume of phenol (equilibrated with 0.1 M Tris-Cl pH 8.0) for 1 hour followed by two extractions with phenolrchloroform (1:1 v:v) and one with chloroform for about 30 minutes each. DNA was precipitated with 2 volumes of cold absolute ethanol and resuspended in TE pH 8.0. RNA was removed by digestion with RNase A for 1 hour at 64 37°C. SDS and proteinase K were then added, incubated for 1 hour at 37°C, and the solvent extraction repeated. DNA was stored in TE at 4°C. DNA concentration was estimated from the absorbance of a 1:200 dilution at 260 nm (1 unit = 50 pg/ml). Protein contamination was checked by reading the absorbance at 280 nm. 2.9.2 Extraction of genomic DNA from tissue A small quantity of tissue was finely chopped with a scalpel and transferred to a Dounce homogeniser with a loose fitting plunger. An equal volume of 100 mM NaCl, 20 mM EDTA was added and the tissue homogenised. The homogenate was then transferred to a sterile Falcon tube incubated at 50°C overnight in the presence of SDS and proteinase K and purified as described for fibroblast DNA (see 2.9.1). 2.9.3 Extraction of genomic DNA from peripheral blood Blood was collected into acid citrated dextrose or EDTA and then stored at -20°C until required. After thawing at room temperature, 5 ml aliquots were placed in sterile 50 ml Falcons and 40 ml sucrose lysis buffer was added to each tube (see Appendix 1). Lymphocyte nuclei spun down at 800g, were lysed in 5 ml 100 mM NaCl, 20 mM EDTA by the addition of SDS to 0.5 %. Proteinase K was added and the DNA extracted as before (2.9.1). RNase A digestion was not necessary. 2.9.4 Extraction of total cytoplasmic RNA from fibroblasts Skin fibroblasts were cultured and freshly fed as described in 2.2.1. The cells were scraped into the medium using a sterile rubber policeman, washed with PBS and collected by low speed centrifugation into 15 ml baked, siliconised glass Corex tubes. The cell pellet was resuspended in 3 ml of RNA lysis buffer and underlaid with 2ml lysis buffer + sucrose; vanadyl ribonuclease complex was added to the lysis buffers at a final concentration of 50 pg/ml. The nuclear pellet was spun through the sucrose cushion at 65 10,000g for 20 minutes. The upper phase was aspirated into a Falcon tube, an equal volume of 2 x PK buffer and proteinase K to a final concentration of 200 pg/ml was added and the lysate incubated at 37°C for 30 minutes. After a brief extraction with RNase free phenolithe RNA was precipitated with ethanol (2.5 vols) at -20°C overnight in a 50 ml Corex tube. The RNA pellet was spun down at 10,000# for 30 minutes and resuspended in 0.2 ml DEPC treated water and stored at -70°C. The concentration was estimated from absorbance of a 1:200 dilution at 260 nm (1 unit = 40 pg/ml). 1 pi was diluted with sequencing gel buffer and run out on a 1.5 % agarose minigel to check for degradation. 2.10 Enzyme Reaction Conditions 2.10.1 Restriction enzymes 5 to 10 pg of genomic DNA for analysis by Southern blotting was digested overnight at 37°C in the presence of 4 mM spermidine and the appropriate enzyme buffer. Where incubation buffers were not supplied by the manufacturers, the core buffer system outlined in Appendix 2 was used. Restriction enzyme was added in excess. DNA was precipitated, after digestion, with ethanol and ammonium acetate at -20°C for at least an hour, dried and then resuspended in electrophoresis sample buffer. Purified cDNA probes and plasmid vector DNA were digested in small volumes, in the absence of spermidine, for 1 to 2 hours. 66 2.10.2 T4 DNA Ligase Ligation reactions were set up in < 20 pi final volume in 1 x ligation buffer. A series of molar ratios of insert to vector were used. T4 DNA ligase was added to a final concentration of 0.1 U/pl and the reaction incubated at 15°C overnight. 2.10.3 Calf Intestinal Phosphatase (CIP) The 5' phosphate group was removed from plasmid vectors, after digestion with the appropriate restriction enzyme, to prevent the plasmid DNA from recircularising. The restriction enzyme digest was diluted to about 50 pi with CIP buffer and CIP was added to a final concentration of 1.1 U/pl. The digest was incubated at 37°C for 1-2 hours. DNA was then purified by a series of brief extractions with phenolrchloroform followed by chloroform and then precipitated overnight with ethanol. 2.10.4 First Strand cDNA Synthesis from Total RNA. Specific oligonucleotide primers were made on a Milligen 7500 DNA synthesiser and separated from the solid support in fresh ammonia at 55°C overnight. The ammonia was removed in a speedvac and the oligonucleotide material was purified by phenol extraction and ethanol precipitation. The concentration of DNA was estimated (2.9.1) and 100 ng/pl stock solutions were prepared and stored at -70°C. 10 to 20 units human placental ribonuclease inhibitor (RNAsin) was added to 2 to 5 pg total cytoplasmic RNA (see 2.9.4) and 200 ng of antisense oligonucleotide primer (see results chapters). This was incubated at 55 to 60°C for 30 minutes to 1 hour and then chilled thoroughly on ice. 10 x RT buffer and 14 U of avian myeloblastosis virus (AMV) reverse transcriptase were then added to make a final volume of 25 pi and the reaction was incubated at 42°C for 1 to 4 hours. 67 2.10.5 Polymerase Chain Reaction (PCR) First strand cDNA, prepared as in 2.10.4, and control full length a 1(1) cDNA (10 ng) and genomic DNA (0.5 pg) were amplified using PCR. Each reaction contained 2-5 U Taq polymerase and the amplification was carried out at suitable temperatures on a Hybaid Thermal Reactor machine. The denaturation temperature of each oligonucleotide was estimated as 2(AT) + 4(GC)°C, which is suitable for sequences 11 to 30 nucleotides in length. The optimum reaction conditions were then determined experimentally. All reactions were carried out in a final volume of 100 pi covered by paraffin oil. 10 x PCR buffer was prepared at a number of different magnesium concentrations. Oligonucleotide primers were added at 1 ng/pl, about 10 pmol. dNTPs were added from a 10 mM mix to a final concentration of 400 pM. Products were run out on 1 % agarose and where appropriate extracted from the gel by electroelution or using Geneclean and precipitated with yeast tRNA or linearised polyacrylamide (Gaillard and Strauss 1990) as carrier. 2.11 Microbiological Methods E .coli strains were stored at -70°C as glycerol stocks. Agar streak plates were set up from the frozen stocks, incubated at 37°C overnight, stored at 4°C and restreaked from this plate about once a month. Overnight broth cultures were set up from single colonies. Culture media are described in Appendix 2. 2.11.1 Preparation of competent cells 2.11.1.1 Hanahan (1985). 100 ml of SOB broth was innoculated with 1/100 volume of an overnight culture of 7 E .coli HB101 and incubated until it had reached a viable cell count of 5 x 10 per ml 68 (0.3-0.6 absorbance units at 550 nm). Cells were collected by centrifugation at 1000# for 10 minutes at 4°C, resuspended in 33 ml RF1 and incubated on ice for 2 hours. The cells were collected as before, resuspended in 8 ml RF2 and incubated for a further 15 minutes. 200 pi aliquots were then flash frozen in Cardice and IMS and stored at -70°C for up to one month. 2.11.1.2 Sambrook et al (1990) 100 ml 2 x YT broth was innoculated with 1 ml of an overnight culture. When the cells 7 reached about 5 x 10 /ml they were collected by centrifugation as described above, incubated on ice in half the original volume of 50 mM CaC^ for 15 mins. These cells were then collected as before and resuspended in 1/15 the original culture volume and stored at 4°C overnight before transformation. Cells prepared in this way were used for transfection with recombinant bacteriophage M l3. 2.11.2 Transformation o iE .c o li Competent cells were thawed at room temperature, if appropriate. DNA was added in a volume of less than 20 pi and adsorbed to the cells on ice for 10-60 minutes. Cells were heat shocked at 42°C for 90 seconds and then returned to the ice. 0.8 ml of SOC broth was then added and the cells allowed to grow at 37°C for 1-2 hours before plating out onto selective agar. 2.11.3 Preparation of plasmid DNA (STET) 3 ml of an overnight broth culture was grown from each positive transformant. This was transferred to 1.5 ml eppendorf tubes and the cells spun down in a microfuge for 3 minutes. The cell pellet was resuspended in 100 pi STET and lysozyme added in a further 10 pi (as defined in Appendix 1). The cells were incubated at room temperature for 10 minutes and then placed in a boiling waterbath for 2 minutes. After centrifugation 69 at 4°C for 15 minutes the pellet was removed using a sterile pipette tip. The supernatant was then digested with RNase A (100 pg/ml final concentration) for 1 hour followed by proteinase K (100 pg/ml) for 30 minutes (see 2.9.1). An equal volume of isopropanol was added to each tube and the plasmid DNA was spun down immediately for 20 minutes. The pellet was resuspended in 100 pi TE pH 8.0. 1.5 ml broth yielded about 6 pg plasmid DNA. 2.11.4 Preparation of plasmid DNA (Alkali Lysis) 800 mis of pre-warmed LB broth containing the appropriate antibiotic, was innoculated with 8 ml of an overnight culture and incubated at 37°C to a cell density of 5 x 10^/ml (see 2.11.2). Chloramphenicol was then added to a final concentration of 0.17 mg/ml and the culture incubated overnight at 37°C. Cells were harvested by centrifugation at 1000# for 10 minutes, resuspended in 20 ml glucose lysis buffer containing lysozyme and incubated at room temperature for 10 minutes. 40 ml 0.2 M NaOH-1 % SDS was added and the mixture left on ice for 5 minutes, 40 ml 2.5 M potassium acetate pH 4.8 was then added and the mixture returned to the ice for 15 minutes. After centrifugation at lOOOg for 10 minutes, the supernatant was filtered through sterile, siliconised glass wool and 0.6 volumes of isopropanol added; the DNA was precipitated overnight at -20°C. The precipitate was collected and dessicated by freeze drying for about 30 minutes and then resuspended in 6 ml TE pH 8.0. The pH was then adjusted to pH 7-8 by the addition of 0.6 ml 0.5 M EDTA and 0.5 ml 1 M Tris-Cl pH 8.0. The volume was adjusted to 7.7 ml with TE pH 8.0 and 8.08 g caesium chloride added. Once this had dissolved, 0.5 ml 10 mg/ml ethidium bromide was added and the mixture transferred to ultracentrifuge tubes. Centrifugation was carried out at 22°C and 54 krpm for 16 to 22 hours. The intact plasmid was recovered and the EtBr removed by a series 70 of water saturated butanol extractions. The aqueous phase was then dialysed in sterile tubing against 4 changes of TE pH 8.0 and stored at -20°C until required. 2.12 Agarose Gel Electrophoresis Agarose gels were run in 1 x TBE or 1 x TAE at constant voltage. 25 to 40 ml minigels for checking restriction enzyme digestions, DNA concentrations and PCR products were run at approximately 50 V. 20 x 20 cm (250 ml) agarose gels for Southern blotting were run overnight at 30 V. DNA and RNA were visualised using 0.5-1 pg/ml ethidium bromide. Bacteriophage lambda DNA cut with Hind III or a 1 kb ladder (BRL) were used as molecular weight markers. % Agarose Linear DNA Separation (kb) 0.3 60-5 0.6 20-1 0.7 10 - 0.8 0.9 7-0.5 1.2 6-0.4 1.5 4-0.2 2.0 3-0.1 2.12.1 Separation of DNA insert from vector A suitable amount of plasmid containing the relevant insert was precipitated with ethanol and the insert cut out with the appropriate restriction enzyme. Insert DNA was separated from vector DNA on an agarose gel containing 0.5 pg/ml EtBr. The DNA was then recovered from the gel by running it onto DEAE-NA45 paper and eluting it with 1 M 71 NaCl at 70°C for an hour. Alternatively, the insert band was electroeluted into 0.1 x electrode buffer in a piece of dialysis tubing, and then precipitated in ethanol. Insert required for random primer oligolabelling was separated on agarose with a low melting point, gel fragments were diluted with 1.5 ml SDW per gram of gel and boiled before use. 2.12.2 Southern blotting (Southern 1975, 1987) This method was used for transferring restriction fragments of DNA to nitro-cellulose or nylon filters prior to hybridisation with a DNA probe. The solutions used for the denaturing of DNA in the gel, its neutralisation and blotting are given in Appendix 2. 2.13 Labelling of DNA Probes with ^ P-dNTP In general, circular DNA (vector+insert) was labelled using the nick translation procedure (Sambrook et al 1990). Where insert had been separated from vector (2.12.1), the random primer oligolabelling method was used (Feinberg and Vogelstein 1984). Kits for both techniques were supplied by Amersham International. Nick translation reactions were incubated at 15°C for 2 hours and random primed reactions at room temperature overnight. The labelled DNA was separated from the unincorporated counts using a 2 ml column of sephadex G50-fine equilibrated in G50 buffer. An estimate of percentage 7 9 incorporation was made and probes had a specific activity between 10 and 10 cpm/pg DNA. 72 2.14 Hybridisation Conditions DNA was fixed to nitro-cellulose by baking at 80°C in vacuo for 2 hours or covalently bound to nylon by u.v. transillumination and baking. The filters were prehybridised at 65°C for 1-2 hours and hybridised overnight, (see Appendix 2). Denatured salmon sperm DNA and, where required, human competitor DNA were added to a final concentration of 50 pg/ml and 200 pg/ml respectively. Filters were washed at 65°C in 3 x SSC, 0.1 % SDS for 1 hour and then in 0.3 x SSC, 0.1 % SDS for a further hour before autoradiography with an intensifying screen at -70°C for about one week. 73 C h a p t e r 3 74 An Investigation of a family with 01 type III and six consecutive affected sibs heterozygous for a type I collagen abnormality. 3.1 Clinical Description In family T, (Fig 3.1) clinically normal, unrelated parents have produced six babies affected with Sillence type III OI (Fig 3.2). The mother's first pregnancy was a social termination at about 8 weeks gestation. The foetus was not examined. The first known affected baby, II-2, was bom after an uncomplicated pregnancy at 39 weeks with multiple fractures of both legs and forearms and the right humerus. He died after 10 hours from respiratory complications. Subsequently II-3 and II-4 were diagnosed as affected in utero by ultrasonography and terminated at 26 and 29 weeks respectively. The diagnosis of OI was confirmed bypost mortem X-ray. II-5 was a spontaneous miscarriage at 17 weeks. This foetus was examined and a diagnosis of OI was made. The index case, IE-6, was terminated following an abnormal ultrasound scan at 24 weeks. Samples of skin and bone were taken for confirmation of the diagnosis by electronmicroscopy and for fibroblast cell culture. The brain was also taken and stored at -40°C as a source of genomic DNA. The next pregnancy was also monitored by ultrasound. In addition a chorionic villus biopsy was taken at 15 weeks. Cells were grown out and examined for the production of abnormal collagen to establish whether prenatal diagnosis at the protein level, using the information gained from the study of II-6, was possible 75 HAPLOTYPE ANALYSIS C(1(I) p2Fc6 Nsf 70 1 + + Family T 2 — 3 + 4 — — I OC1 Haplotype Gestational Age 1%2 B9/52 26/s? 2% % V B % t Index Case Whole body post mortem X-rays of affected children from family T II6 - j (Gibbs et a l, submitted). Both biochemical and ultrasound techniques indicated a sixth affected foetus and the pregnancy was terminated at 23 weeks. A diagnosis of 01 was confirmed by histology, X-ray and protein analysis. The radiological observations were the same for II-6 and II-7 (Fig 3.2) and, as far as could be seen, the same as the other 01 foetuses from whom no viable tissue was obtained. 3.2 Protein Studies Skin biopsies were taken from both parents. No viable tissue was available from any of the first four affected foetuses. Skin and bone samples were obtained from II-6 and both skin and periosteal fibroblast cell lines were established. The seventh pregnancy was similarly investigated in collaboration with Dr D.A. Gibbs, who performed the prenatal diagnosis. After termination the material from II-7 was investigated in the same way as the index case. All the data obtained from analysis of tissue from foetus II-7 indicated that the two siblings were the same. 3.2.1 Collagens were labelled and separated by gel electrophoresis as described in chapter 2. a-chains (Fig 3.3) from II-6 revealed that although synthesis was normal (table 3.1) and the relative ratios of al(I) to a2(I) were 2 to 1 as expected, both a 1(1) and a2(I) bands were broader than those in samples from either controls or the normal parents. This was evidence of more than one form of a-chain some of which were normal and some slow migrating. 78 Fig. 3.3 a-chains (pepsin treated) from cultured control and patient fibroblasts (Family T) Fig. 3.4 Proa-chains from a control, the index case (Family T) and his father. The fibroblasts were cultured in the presence (+) and absence (-) of the iron chelator aa'dipyridyl 6 6 2 12 C o n tro l bone 1 skin • • ' ' I I ■ C o n tro l ♦ ♦ I ♦ I I i Q_ 6 2 1 6 I I I Control II I C o n tro l ! 1 1 • 1 » i 9 2 r M HH LU 1 II IMI UM Ml r u r v L 6 1 1 • | : : l 1 i l i i 1 1 1 r o ►— 5 — * a * l I I I | Fig 3-3 Fig 3-4 Table 3.1 Above - Summary of hydroxylysine figures, obtained from duplicate cultures, treated as described in 2.8.2, page 64 Below - Column 1: Direct ratio of hydroxyproline to proline in duplicate cultures treated as described in 2.8.1, page 63 - Column 2: Approximation of collagen synthesis derived from: 2 x Hydroxyproline (Proline - Hydroxyproline) 14 to allow for the presence of unhydroxylated C-proline counts in collagenous protein. [Approximately 50 % of proline residues in the triple helix are hydroxylated] 3.2.2 Incubation of cells with aa'-dipyridyl eliminated the heterogeneity (Fig 3.4) indicating that the slow migrating material was excessively modified post-translationally rather than of greater size as the result of an insertion. 14 Analysis of C-Lysine labelled a-chains for lysine hydroxylation. Hydroxylysine / Total Lysine + Hydroxylysine (% ) al(I) a 2(I) al(III) Adult control (MP) 18.7, 11.4 32.6, 21.7 42.4 Foetal control 1(T188) 18.7, 14.6 37.8, 18.4 ND 2(FeSin) 18.1, 16.6 34.2, 24.6 36.1 3(FM) 25.6 44.0 44.9 Mean + SEM 17.9 ±4.1 32.5 ± 8.6 41.1 ±3.7 Family T Mother 1-1 22.4, 21.6 41.2, 24.5 31.3 Father 1-2 20.6, 25.0 26.8, 38.9 ND Affected II-6 26.7, 36.9 46.3, 48.2 58.0 14 Analysis of C-proline labelled a-chains for estimation of collagen synthesis. HyprorPro 2Hypro:Pro-Hypro Adult control (MP) 0.24 0.63 Foetal control 1(T188) 0.35 1.10 2(FeSin) 0.12 0.27 Mean ± SEM 0.24 ±0.1 0.67 ± 0.3 Family T Father 1-2 0.17 0.41 Affected II-6 0.18 0.44 TABLE 3.1 80 3.2.3 Direct analysis of lysine labelled material which had been separated on a gel and then hydrolysed demonstrated overhydroxylation (table 3.1) in material isolated from -6IE when compared with the parents and with foetal controls. 3.2.4 Peptide Mapping One dimensional CNBr peptide mapping showed that all the major peptides from both al(I) and a2(I) had slow migrating components (Fig 3.5). However, a proportion of normally migrating material was also evident. 3.2.5 Two dimensional CNBr analysis (Fig 3.6) confirmed the observation made in 3.2.4. The tilting of all the bands in the affected foetuses suggested each CB peptide was heterogeneous with both normal and overmodified components (see 1.6.4). Material from the parents showed no such heterogeneity. 3.2.6 Thermal stability measurement The melting temperature of the type I collagen, at 42°C (Fig 3.7) was normal. 3.3 DNA Analysis RFLPs at each of the two type I collagen gene loci were used to assign haplotypes to both parents, II-6 and II-7 thus: 81 Fig. 3.5 Above - Type I collagen a-chains from family T cleaved by cyanogen bromide Below - Diagrammatic representation of a 1(1) and a2(I) cyanogen bromide (CB) peptides Fig. 3.6 Type I collagen a-chains, from a control and two affected children from family T, separated by SDS-PAGE, cleaved with cyanogen bromide and the resultant peptides separated on a second gel Control II 6 II 7 C 11 12 116 117 o<2CB3,5 of 2 C B 4— mm — mm ^ oo cB7^ S M M W W 4 * o(1 C B 3— " • *• N>0 0 r i T (X1 (I) H2Nt / \ ^ C01 CB2 CB4 CBS CBS CBB CB7 CB6 CX2(I) HjNH------H ------ CB1 CBi. CB2 C33 CBS a 1 # 2 a1 a 2 Fig 3*5 Fig 3*6 Estimation of Tj of type I collagen (pepsin treated) secieted fiom skin fibroblasts from the index case in family T. The of normal human type I collagen is 42 °C ° C 35 37 39 41 42 II 6 Fig 3-7 83 COL1A1: Rsa I/p2Fc6 and Rsa I/Nst 70. COL1A2: E c o R l/N tt (see Fig 4.14, page 108). The results for COL1A1 are summarised on the pedigree diagram in Fig 3.1. All the subjects were heterozygous for the Eco Rl site in COL1A2. 3.4 Discussion This family is particularly remarkable for the number of consecutive pregnancies affected by severe to lethal 01. The protein data from the index case II -6 show slow migrating a-chains. Peptide mapping confirms the presence of both a normally migrating and an overmodified component for each of the major CB peptides. This heterogeneity is abolished by incubation of the cells with aa'-dipyridyl which is normally taken as good evidence for excessive post-translational modification of a-chains. Direct evidence for excessive hydroxylation was obtained by analysing labelled a-chains for lysine and hydroxylysine. No slow migrating material is evident in either parent. In a conventional autosomal recessive inheritance pattern, both parents would be heterozygous and the affected children homozygous for the mutant allele and its protein product. Neither parent has any bone abnormality nor any abnormally migrating protein. If either were heterozygous for a mutation causing excessive post-translational modification some abnormal material would be expected from their cultured fibroblasts. The slow migration of al(I) and a2(I) in II -6 provided a potential biochemical marker for prenatal diagnosis in the subsequent pregnancy. Analysis of chorionic villus cells indicated another affected foetus. The pregnancy was terminated after this was 84 confirmed by ultrasonography. More detailed analysis of type I collagen in skin fibroblasts from this affected foetus, II-7, gave results which were identical to those obtained with II- 6. This strongly suggests that both II -6 and II-7 and presumably all the previous affected individuals, from whom no data were vailable, suffer from the same genetic defect. Overhydroxylation of lysine residues is a secondary phenomenon occurring when a mutation in one or more of the a-chains of the trimeric molecule delays helix formation (1.6.4). Since triple helix formation propagates from the carboxyl terminus towards the amino terminus the onset of overmodification can be used as a marker for the point of mutation (Bonadio and Byers 1985). The one dimensional cyanogen bromide peptide maps suggested that the mutation was at the extreme C-terminal end of the molecule. The melting temperature of the type I collagen was not noticeably depressed. Although certain mutations within the helix do not appreciably alter thermal stability (Pack et al 1990), this might be indicative of a defect in the C-propeptide rather than in the helical region as the molecule once formed is not appreciably destabilised. In any event the onset of overmodification shows that the defect lies at the 3' end of the coding region of either COL1 Al or COL1A2. Mapping experiments using in situ CNBr digestion in two dimensional gels showed that the pool of a-chains in cells from the affected foetuses were heterogeneous. Both babies analysed showed characteristically tilted bands indicating that they were heterozygous for a defect. All the large cyanogen bromide peptides were affected which further confirms the presence of a defect at the C-terminal end of the molecule. The 2D maps from both parents were normal giving flat bands for each of the major type I collagen peptides. These observations seem to exclude an autosomal recessive inheritance pattern. 85 Haplotype analysis (Fig 3.1) although of little use to assign linkage in such a small pedigree did show that both affected foetuses had inherited different alleles from their parents. The mother has haplotype 2/4 and the father 2/1 for al(I). Although they share the common allele 2 neither of the two foetuses studied are homozygous 2/2. This mitigates against autosomal recessive inheritance. It is possible that the affected children are compound heterozygotes at COL1A1 as they have both inherited the 2 allele from mother and the 1 allele from the father. At the COL1A2 locus all were heterozygous for the Eco Rl RFLP, again suggesting non-recessive inheritance but leaving the possibility of compound heterozygosity. Compound heterozygosity, each parent carrying a different mutation at the same locus but on a different allele cannot be excluded until cDNA from the affected patients has been analysed in the future. However, this mode of inheritance is extremely unlikely. Firstly, the incidence of OI known to be caused by de novo mutations suggests that the frequency of mutation is very low in the population and therefore the probability of 2 unrelated, asymptomatic individuals having a mutation at the same locus is remote, 2 (1/60,000) . Furthermore, the risk of an affected child would still be 1 in 4 at each pregnancy and 1 in 4096 for six consecutively. Secondly, in the simplest case, if the mutant locus were COL1A2 there would be two forms of collagen in the affected subjects' cells; one from each of the parental alleles. If one of the parental COL1A2 alleles caused overmodification the baby should show the same protein profile as the donor parent. On the other hand, if the mutation were in COL1A1 three populations of type I collagen molecules would be synthesised by the foetal cells. Half the type I collagen protein would contain an a l chain from each parental allele and the other half would contain 2 identical, but different, mutant a-chains. 1 molecule in 4 would contain two maternally derived chains and another 1 in 4 two from the father. No normal al(I) would be encoded in these cells. A proportion of the foetal type I collagen has a normal 86 electrophoretic migration. It seems unlikely that a collagen molecule with 2 mutant a 1(1) chains would have normal migration. This would have to be the case as a quarter of the type I synthesised by each of the parents would contain two identical mutant chains. This protein phenotype would only be possible if homozygous mutant molecules gave normal migration but heterozygous molecules were overmodified. Alternative mechanisms of inheritance are worthy of consideration. From the evidence presented here the most likely explanation for the recurrence of 01 in this family is a dominant type I collagen abnormality passed through the germline of one of the phenotypically normal parents. Cases of gonadal mosaicism have already been reported in inherited connective tissue disease. In one family with pseudoachondroplasia an affected individual with an assumed autosomal recessive condition later had an affected child (Hall et al 1987). Cohn et al (1990a) described a case of germinal mosaicism where a clinically normal man had fathered two babies with type IIA, broad boned lethal 01 through different mothers. The mutation, a glycine to aspartate change at residue 883 in al(I), was detected in DNA from sperm and lymphocytes but not in skin fibroblasts. In a second family (Constantinou et al 1990) the mother has been shown to carry a mutation causing a glycine to cysteine substitution at residue 904 in a 1(1). This patient had some 01 symptoms; blue sclerae, short stature and characteristic facies. She had produced one baby with lethal OI and two normal children. She was estimated to have a similar level of somatic mosaicism to the case described by Cohn et al (1990a) but expression of the mutant allele was also detected in her skin fibroblasts. However, the proportion of this allele decreased with increasing passage. Constantinou and colleagues suggested that this 87 might account for the fact that this woman had shown more obvious clinical abnormalities in childhood. A third pedigree has also been investigated (Wallis et al 1990b) in which a glycine to arginine substitution at residue 550 in a 1(1) was detected in a man with a mild form of 01 and his lethally affected son. He also has one normal child. The mutation accounted for about 50 % of the COL1A1 alleles in the father's fibroblasts, 27 % of those in blood and 37 % in sperm. Pure germinal mosaicism would only be manifest in the next generation (Edwards 1989) but some level of somatic mosaicism in the carrier parent is often observed (Hall 1988). Although, in family T, there was no convincing evidence for low level expression of a collagen mutation in either parent, the protein methods are relatively insensitive and the possibility cannot be excluded until the mutation has been identified at the nucleic acid level and the parents screened directly. It is not clear from our data which of the parents in this family might be the mosaic but it is generally considered more common for men to be the carrier of a mutant allele in germ cells only (Prof J. Hall, Personal communication). Germinal mosaicism for a lethal mutation would increase the risk in this family to as much as 50 % in each pregnancy. Although much lower than the odds for six consecutive recessive mutations, at 1 in 64, it is still remarkable that none of the pregnancies have produced a normal foetus. If the mutation event had occurred very early in the development of the carrier parent many mutant germ cells would be expected along with a detectable level of somatic mosaicism. However, in the case of a mutation after the separation of the germ cell lineage, somatic mosaicism would be less easily 88 detected and a larger proportion of normal gametes would be expected. The reverse is seen in family T. It seems likely that there is some other biological mechanism operative here to account for the large number of affected children but we do not have enough relevant data to speculate. 89 C h a p t e r 4 90 An Investigation of two consanguineous families with autosomal recessive Osteogenesis Imperfecta type III and excessive post-translational modification of type I collagen. 4.1 Clinical Features In both these families there have been several consanguineous marriages. 4.1.1 Family G Clinically described by Williams et al in Clin Genet 35(3) 181-190,1989. This is an Irish traveller family in which the pedigree (Fig 4.1) was extremely difficult to elucidate. The index case, III-7, was the second child of first cousin parents. He had severe OI and at birth showed anterior bowing of the tibiae and fibulae, thin ribs, blue sclerae and joint hypermobility consistent with OI type ID. He suffered recurrent chest infections and died six weeks after birth. The next pregnancy also resulted in a baby with OI, III -8 (Fig 4.2). This was revealed by ultrasonography at 20 weeks gestation but the family elected to continue with the pregnancy. The baby survived the perinatal period. She suffered from progressively deforming OI and died following a chest infection at 7 years of age. An ultrasound scan in the fourth pregnancy resulted in a diagnosis of OI and a termination at 28 weeks. The abortus was examined and the disease confirmed by both radiology and histology. Three further pregnancies have produced normal children. In the most recent case a chorionic villus sample was taken at 12 weeks gestation and analysed. No type I collagen abnormality was apparent (Gibbs et al, submitted). 91 Q Case _ Family Fig 4-1 Family G III 8-Sillence hype III 01 Aged 3 years nr8-At birth 1118-Aged 5 years Fig 4-2 93 The father, 11-17, was clinically normal but spinal X-rays of the mother, 11-31, indicated premature osteoporosis (Fig 4.3). Six children in the mothers' sibship are said to have died from OI. Documentary evidence for this in one case, the death certificate from the youngest of these children (11-32), states that he had severe OI at birth and died at three months of age. 4.1.2 Family F This family (Fig 4.4) is of Asian extraction. The index case, IV-4, was the only affected individual available for study. He was delivered at 38 weeks because of intrauterine growth retardation and was diagnosed as having severe OI. He survived the perinatal period and was discharged at 7 weeks of age. Both parents were clinically normal. The mother, HI-5, had 2 siblings who had died in childhood from severe OI. 4.2 Protein Analysis - Family G Skin fibroblast cell lines were established from the parents, 11-17 and 11-31, the grandparents, 1-3 and 1-6, a paternal aunt, II-3 and from the affected children III-7 and IH-8. Collagen was labelled in culture with ^C-proline. When compared with controls SDS-PAGE of radiolabelled collagens from both the affected children showed a marked retardation of both al(I) and a2(I) chains (Fig 4.5). There was no evidence of any normal a-chains. The al(I) and a2(I) chains from both parents and other unaffected relatives migrated normally. 94 Family G 1117 1131 II 17 II 31 Fig 4-3 95 Fig 4*4 Table 4.1 Column 1: Direct ratio of hydroxyproline to proline in duplicate cultures treated as described in 2.8.1, page 63 Column 2: Approximation of collagen synthesis derived from: 2 x Hydroxvproline (Proline - Hydroxyproline) to allow for the presence of unhydroxylated 14 C-proline counts in collagenous protein. [Approximately 50 % of proline residues in the triple helix are hydroxylated] 4.2.1 The ratio of al(I) to a2(I) was estimated by densitometry and found, as expected, to be 2 to 1 (Data not shown). Total collagen synthesis was normal (table 4.1) and the relative amounts of types I and III collagen were in the normal range. The electrophoretic mobility of type III collagen was examined using interrupted reduced PAGE (Fig 4.6) and migration of al(V) and a2(V) showed no difference between normal and affected individuals. 14 Analysis of C-proline labelled a-chains for estimation of collagen synthesis Hypro:Pro 2Hypro:Pro-Hypro Adult control 1(MP) 0.24 0.63 2(F28) 0.21 0.26 Foetal control 1(FM) 0.14 0.15 2(FeSin) 0.12 0.27 Mean ± SEM 0.18 ±0.05 0.33 ±0.18 Familv G Affected III-7 0.08 0.18 Affected III-8 0.11 0.12 Familv F Mother III-5 0.35 1.10 Father III-4 0.25 0.65 Affected IV-4 0.30 0.85 TABLE 4.1 4.2.2 Incubation of cell cultures with aa'-dipyridyl to inhibit post-translational modification showed no difference between proa-chains from the affected children and the normal cell lines (Fig 4.7) suggesting the slow migration of type I a-chains in affected individuals was due to excessive post-translational modification. 97 Fig 4.5 Collagen a-chains (pepsin treated) secreted by a control (C), unaffected (II-3,11-31,11-17) and affected (III-8) members of family G to demonstrate overmodification Fig 4.6 Collagen a-chains from control cell lines and those from family G separated by the reduced interrupted technique described in 2.5, page 61 / [a1(m)]3 13 Ctr II3 IE8 Ctr a 1(1) a 2 (I) Fig 4-6 4.2.3 al(I), a2(I) and al(III) were labelled with ^C-lysine and directly analysed for lysine and hydroxylysine. The results are shown in table 4.2. The type I collagen a-chains obtained from the children were clearly overhydroxylated when compared with controls. There was no significant overhydroxylation of the type III material in any case. 14 Analysis of C-Lysine labelled a-chains for lysine hydroxylation Hydroxylysine / Total Lysine + Hydroxylysine (% ) al(I) a 2(I) al(III) Adult control (MP) 18.7, 11.4 32.6, 21.7 42.4 Foetal control 1(T188) 18.7, 14.6 37.8, 18.4 ND 2(FeSin) 18.1, 14.6 34.2, 24.6 36.1 3(FM) 25.6, 26.1 44.0, 44.4 44.9, 44.8 Mean ± SEM 18.5+4.9 32.2 ±9.2 42.1 ±3.6 Familv G Mother 11-31 18.8, 18.8 29.1, 31.6 27.7, 34.1 Father 11-17 21.3, 21.1 36.6, 37.4 46.0, 46.9 Affected III-7 34.6, 35.3 46.8,51.1 43.3, 32.1 Affected III-8 38.5, 39.2 48.8, 50.7 28.1,29.3 Family F Father III-4 18.6 30.6 ND Affected IV-4 31.4 41.2 ND TABLE 4.2 Table 4.2 Summary of hydroxylysine figures, obtained from ^ 2 4 duplicate cultures, treated as described in 2.8.2, page 64 Collagens from both III-7 and III -8 were analysed by CNBr cleavage of whole collagen in one dimensional gels (Fig 4.8). All the large peptides from type I collagen including the most C-terminal (see page 82), al(I)CB 6, ran more slowly than those from normal cell lines. 99 Fig. 4.7 Proa-chains from a control (C) and affected member of family G (III-8). The fibroblasts were cultured in the presence (+) and absence (-) of the iron chelator aa'dipyridyl Fig. 4.8 Type I collagen a-chains from family G cleaved by cyanogen bromide C III 7 III 8 1131 H17 13 II3 cm'dipyridyl ^ - —proaKIII) ' proaKI) — - a 2(I)CB 4 ""^proa^d) m m -a'l (I) C B 7 (I) C B 8 mm-a'l (I) CB 6 _a 1 (I)CB 3 Fig 4-8 4.2.5 Two dimensional CNBr peptide mapping was first performed by running a-chains on a 1 mm thick gel in the first dimension, cleaving with cyanogen bromide in situ, and running the resultant peptides in a second dimension on 2 mm gels. These second dimension gels were difficult to dry down for fluorography but all the peptide bands from III-8 seemed to be homogeneous. No obvious tilting was observed. The 2D mapping method was then improved (2.6, Nicholls unpublished) and further work on the affected members of family G has revealed that all type ICB peptides were tilted to some extent (Fig 4.9), suggesting heterogeneity. The abbreviation CB is also used for Cyanogen Bromide (as well 4 2 6 as the given abbreviation of CNBr). Collagen from III-8 was tested for abnormal melting. Type I collagen from both the OI baby and her normal grandfather melted normally at 42°C (Fig 4.10). 4.3 Protein Analysis - Family F Cell lines were established from the index case IV-4 and his parents III-4 and III-5. ^ C labelled protein was analysed in a series of experiments parallel to those described for family G in 4.2. The affected child produced a normal amount of type I collagen all of which appeared overmodified on ID gels. The parents produced only normally hydroxylated type I collagen. Types IH and V collagen appeared normal. The results are shown in Figs 4.11 and 4.12 and in tables 4.1 and 4.2. However, 2D mapping again showed a heterogeneity of type I CB peptides (Fig 4.13). 101 1117 III 7 III 8 1131 Family Q a-chains from affected members (III-7 and III-8) of family G and their parents cleaved with cyanogen bromide and separated in a second dimension oto a1(l) CB 7 ar1(I) CB 8 ■ a1(I) CB 6 <*1 (I) CB 3 Fig 4-9 a ] a 2 [ . O O c m •J' 'O oo O cnj cvi r n m m m m nn m "4 •'4* -4- III 8 Estimation of of type I collagen (pepsin treated) secreted from skin fibroblasts from m\affected (III-8) and nornial (1-3) member of family G. The of normal human type I collagen is 42°C Fig 4-10 103 Fig 4.11 a-chains (pepsin treated) from a control (C), the index case in family F (IV-4) and his parents to demonstrate overmodification Fig 4.12 Type I collagen a-chains from family F cleaved with cyanogen bromide in 5 iv4 m4 iv4 m5 c c m 5 IV4 ID 4 c [annuL 3 —o^tDCB 3,5 ^ —a2(I)CB4 ■ —a1(I)CB 7 Is S — a1(I)CB8 — a1(ffl)CB5 — a-KDCB 6 m m — a'KI) CB 3 Fig 4-11 Fig 4-12 ■ III 4 Family F a-chains from the index case (IV-4) and his parents cleaved with cyanogen bromide and separated in a second dimension X t • add) C B 7 ------a1(I)CB8 • a1 (I)C B 6 ------a1(I)CB3 a 1 a i Fig 3 4.4 DNA Analysis 4.4.1 Family G In order to establish which of the two structural genes encoding type I collagen might contain the mutation, RFLPs were used in linkage analysis. Genomic DNA from all available family members; those characterised at the protein level in 4.2,1-2 and III-5, was digested to completion with Eco RI, Msp I or Rsa I. Southern blots of restriction fragments were hybridised to 32 P internally labelled probes. In the first instance three RFLPs (Tsipouras 1987) associated with each locus were investigated. Locus Enzyme Probe Source COL1A1 Rsa I p2Fc6 Dr B. Sykes it Rsa I Nst70 ii M sp I 1006 COL1A2 Eco R l NJ3 Dr J. Myers li Rsa I Hf32 M sp I E 486 Dr R Dalgleish p2Fc6 is a 2.76 kb genomic probe which detects an intragenic dimorphism showing a band at 3.6 kb and one at 2.6 kb (Sykes et al 1986). Nst 70 is a 1.4 kb genomic subclone of CG103 which hybridises to a region about 10 kb 3' of COL1 Al showing a constant 3.0 kb band and a dimorphism between bands at 2.4 and 2.1 kb (Ogilvie et al, 1987). 1006 is a repeat reduced 1.6 kb genomic clone showing up the M sp IRFLP, which lies some 20 kb 5' of COL1A1. All three COL1A2 polymorphisms are intragenic. The Eco Rl site is at the 5' end of the gene. NJ3 consists of two contiguous genomic sequences (NJ3.55 and NJ3.2) with a total 106 length of 6.75 kb (Tsipouras et al 1983). In this investigation only NJ3.55 was used to show alleles of 14 kb and 3.5 kb. The R sa I site is in the centre of the gene and was probed using Hf32 a 2.2 kb cDNA. This showed alleles of 1.6 and 2.1 kb (Grobler-Rabie et al 1985a). The M sp IRFLP was probed using E486 a 4 kb genomic probe (Grobler- Rabie e t al 1985b). A fourth M nl I RFLP in COL1A1 (Cohn et al 1990d) was also examined using PCR to generate the relevant DNA fragment but this proved uninformative. Examples of the data obtained are shown in Fig 4.14 and the haplotypes generated (table 4.3) are summarised on the abbreviated pedigree in Fig 4.15. Summary of Family G Haplotypes COL1A1 M sp VI006 R sa Vp2Fc6 R sa VNst70 COL1A2 E c o R W n M sp VE486 R sa VHf32 Haplotype 1 + + + 2 + + - 3 + - + 4 + - - 5 - + + 6 - + - 7 - - + 8 - - - TABLE 4.3 4.4.2 Family F Linkage analysis on this family was performed and reported by Aitchison et al (1988). Both COL1A1 and COL1A2 were excluded as the disease locus on the grounds of non homozygosity at either. 107 Fig 4.14 Examples of the analysis of genomic DNA from family G for RFLPs by Southern blotting as described in 2.12.2, page 72. - Above a 1(1) Below a2(I) Diagrammatic representation of the COL1A1 and COL1A2 loci showing the location of the RFLPs used in the haplotype analysis m vo m fn vo on ^ ^ N — — • W W !=! — i ------3-6 kb (-) 2*6 k b (+) RsaI//p2Fc6 — 3kb (constant) — 2-4 Kb ( - ) Rsal /Nst70 5' 3' Msp I Rsal Rsal ! T ------// C0 L1A1 ■------m b lofo p2FC6 Nst 70 Msp I EcpRI Rsalf C0L1A2 — ------N j' 3 Hf 32 ' E486' i-----5 kb » Fig 4-1A- ------3-5 kb (+) EcoRI/NJ 3-55 2-1 kb (-) . - s - * 1-6 kb (+) MspI/E486 108 II 0(1 (I) 6/8 nn 0(2(1) 5/6 LQ ■!> U 1 A k u 10 11 0(1(1) 6/8 6/S 6/6 <*2(D 5/6 5/6 5/6 o r l/fo. Family G Haplofype Analysis 4.5 Discussion The pedigree structure in both these families strongly suggests that the disease is inherited in an autosomal recessive fashion. In both, normal consanguineous parents have produced more than one affected child. There have been other consanguineous marriages and the disease has occurred in more than one generation. Furthermore, the cx- chain and one dimensional peptide mapping gels from the affected children show only slow migrating proteins. The abnormal migration is abolished by the presence of aa'dipyridyl. This suggests that the patients are homozygous for a defect which results in excessive post-translational modification of type I collagen. The disease itself must be due to a reduced ability of these overhydroxylated and presumably overglycosylated protein molecules to form collagen fibrils. The histology of the bone in the affected children showed a paucity of collagen and a poorly organised matrix. The abnormality appears specific to type I collagen, neither type III nor type V collagens are retarded in SDS-PAGE and al(III) shows no significant overhydroxylation of lysine residues when measured directly. As already described, the peptide mapping experiments (1.6.4 and 3.4) use the onset of overmodification to define where in the protein molecule the mutation lies. In these families, since all the major type I collagen peptides were overmodified a structural mutation causing this protein profile would be expected at the C-terminal end of the helix or in the C-propeptide of either al(I) or a2(I). There is no significant reduction in the melting temperature suggesting that despite being overhydroxylated, the stability of the type I collagen triple helix is not significantly altered. Although the mother, 11-31, in family G is considered prematurely osteoporotic the heterozygous state seems to produce no overt disease. If the parents were heterozygous 110 for a structural abnormality of type I collagen, a considerable proportion of their protein ought to contain at least one mutant a-chain and be overhydroxylated. If the defect were in al(I) 1/4 of the type I collagen molecules would be the same as those from the affected children, if the mutant were a2(I) half the protein would be the same as the affected. This is not the case. The RFLP segregation analysis was carried out to determine which of the two gene loci might contain the mutation. The results of these experiments were quite unexpected. If the disease in these consanguineous pedigrees is being inherited in an autosomal recessive manner the most likely mechanism is that the affected individuals have inherited two copies of a common ancestral mutant allele, one from each parent and should be homozygous for its haplotype. In neither of these pedigrees are the affected individuals homozygous at either the al(I) or a2(I) locus (Figs 4.14, 4.15 and Aitchison e t al 1988). In family F the pedigree was reliable, the parents of the index case are double first cousins. The data obtained from RFLP analysis clearly excluded al(I). However, compound heterozygosity at the a2(I) locus, both parents carrying different mutations, was still a remote possibility (Aitchison et al 1988). In family G COL1A2 is clearly excluded as the mutant locus (Fig 4.15). The affected children III-7 and III-8 have inherited different alleles from each parent. III-7 has allele 5 from the mother and 6 from the father but so has the first child III-5 and she is unaffected. III-8 has inherited 5 from father and 2 from mother. Thus even though the parents 11-17 and 11-31 have the common allele 5 at this locus the segregation with the disease is discordant. At the COL1A1 locus both parents are homozygous for all the 111 RFLPs examined but they do not share a common allele and all the children are heterozygous for the haplotype 6/8. The fact that the parents do not share a common allele excludes COL1A1 as the mutant locus by the common ancestral gene hypothesis. The RFLPs used in the linkage study are all either intragenic or physically very close to the gene loci and the chance of a recombination event between the marker and a mutation is extremely unlikely. In a large linkage study of dominant pedigrees there have been no recombinations (Sykes et al 1990). Compound heterozygosity is most unlikely as there is a high level of consanguinity in the family. The only way to exclude this possibility however would be to distinguish between the maternal alleles, denoted as 6, by extending the haplotype analysis along chromosome 17 when other markers linked to COL1 Al become available. If the transmission of the disease in family G is truly autosomal recessive the maternal grandmother, 1-6, must be heterozygous for the same mutation. The probability of consanguinity in this first generation marriage must also be considered. There is anecdotal evidence that 1-6 was related to her husband 1-5. DNA fingerprinting using 'minisatellite' hypervariable probes (Jeffreys et al 1985) was considered as a possible method for establishing whether or not this were true. If it could be proved that 1-6 was related to her husband's family, ie 1-3, the evidence for recessive inheritance would be greatly increased. However, 25 % of bands seen in these experiments are shared between unrelated individuals by chance. First degree relatives share about 62 % of their bands and second degree relatives about 44 % (Dr G. Rysiecki, ICI Cellmark, personal communication). These analyses are very useful in an investigation of close relationships, such as paternity testing, but it did not seem likely that such experiments would clarify the situation in this case. 112 The two dimensional peptide mapping shows tilted bands for CB peptides. This was quite unexpected. In a homozygous normal individual these bands are straight. It was anticipated that a homozygous mutant individual would give straight, albeit overmodified bands. Tilted bands are believed to show a heterogeneity in the protein and should only be seen in a heterozygote. This method has been used world-wide to map mutations to a particular region of the protein, defined by a cyanogen bromide peptide (Fig 3.5, page 82) and also to indicate whether a patient is heterozygous for a defect. If normal parents produce a baby with lethal OI in whom there are tilted bands, a new dominant mutation is assumed and the empirical recurrence risk of 5 % would be quoted. However, in a case of autosomal recessive OI the chance of an affected pregnancy would actually be 1 in 4. The implications of this observation for genetic counselling are considerable. The question remains whether the tilted bands observed in this family are due only to a heterogeneity in the mutant population of a-chains. Alternative mechanisms of inheritance such as germinal mosaicism, as discussed in 3.4, are becoming more well documented. In these cases the affected children are obligate heterozygotes. The pedigree structure in families F and G excludes gonadal mosaicism. There have been affected children in two generations. Clearly the defective gene in these families produces a situation where the formation of the triple helix is delayed allowing post-translational modification to become excessive. The biosynthetic pathway as outlined in 1.6 may not be fully understood but involves a number of enzymes responsible for the post-translational modification. Although these enzymes are normally present in excess, an increase in their activity is theoretically possible (Wilkinson et al 1984). However, these enzymes are thought to act on all fibrillar collagens and the fact that neither type III nor type V collagen are overmodified would seem to suggest that this is not the case. 113 An enzyme activity in the biosynthetic pathway at the stage of chain alignment has been attributed to the B subunit of prolyl-4-hydroxylase (Koivu et al 1987). This has been called protein disulphide isomerase. This enzyme is not specific to type I collagen either and could not account for the abnormalities seen in families F or G. Collagen molecules are assembled from a pool of proa-chains in the cistemae of the rough endoplasmic reticulum (RER). It is generally assumed that the alignment of a- chains in the correct stoichiometry is governed by the thermodynamics and by the formation of disulphide bonds between cysteine residues in the C-propeptide. Three a 1(1) chains come together to form type I trimer in certain tumour cells and amniotic fluid cells. Type I trimer is also the sole product synthesised by a patient with a 4 bp deletion in the C-propeptide of the a2(I) chain. The frameshift prevents any of the a2(I) from being incorporated (Deak et al 1983). It is possible that there is some biosynthetic component, hitherto undescribed, which prevents the formation of type I trimer in all but exceptional circumstances. If such a physical determinant, for example a docking protein serving to bring the a-chains together in the correct way, were missing or inefficient it might account for an OI phenotype. However, in families F and G, there would have to be sufficient present in the heterozygous state to prevent any detectable overhydroxylation of protein in these individuals. Many more experiments would be required to establish the actual cause of the disease in these families. This investigation shows that there are families with autosomal recessive OI. However these may be very rare and all might include some level of consanguinity. The infrequent occurrence of recessive OI was considered by Thompson and colleagues (1987) when estimating their empirical recurrence risk for a second child with lethal OI as 5 %. 114 Linkage analysis has indicated that the milder, dominantly inherited forms of OI always result from abnormalities in one of the two type I structural genes (Sykes et al 1990) but the investigations described here and by Aitchison et al (1988) clearly indicate that although the majority of severe OI patients have an abnormality in COL1A1 or COL1A2 certain cases may not be due to collagen gene defects. To be certain that family G has no mutation at either of these loci it would be necessary to examine the 3' end of the gene encoding the C-propeptide and the most C-terminal cyanogen bromide peptide, al(I)CB6, using a combination of cDNA amplification, cloning and sequencing. In family F it would be necessary to examine the corresponding cDNA sequence in the a2(I) chain. These regions each consist of some 465 residues or 1.4 kb of cDNA. The problem with such a research strategy is that where no abnormality is expected an indefinite number of clones would have to be analysed before the absence of a defect were considered proven. A number of methods for the detection of DNA mismatches have now been described (Rossiter and Caskey 1990, Review) and these should facilitate such a study. This work has important implications for the prenatal diagnosis of severe OI. Sykes and colleagues offer antenatal testing for the milder, autosomal dominant forms of OI, Sillence types I and IV using allele identification in early chorionic villus samples. Clearly prenatal diagnosis using RFLP analysis would be inappropriate in these variants of OI where the disease cannot be linked with a single allele from either of the two type I collagen loci. Families with severe OI rely on ultrasonography for antenatal screening and counselling. However, in families where a previously affected baby has been made available for study, as in family G, prenatal diagnosis using protein analysis of chorionic villus collagen or 115 preferably allele specific oligonucleotide hybridisation to chorionic villus DNA is possible. 116 C h a p t e r 5 An Investigation of a baby with type IIA broad boned lethal 01 who secretes two discrete forms of a1 (I). 5.1. Preliminary Screening Ten OI type HA cell lines were selected from the collection at the MRC Clinical Research Centre and subjected to preliminary screening at both protein and DNA levels. 5.1.1 Protein Radiolabelled a-chains from each patient were separated by SDS-PAGE. In all cases there was some evidence of slow migrating material but this differed between patients. The level of hydroxylysine in each patient was estimated. The results are shown in table 5.1. Patient BA (Fig 5.1) was unusual in that she secreted protein with two discrete forms of al(I). 5.1.2 Genomic DNA Genomic DNA from all ten OI IIA patients was digested to completion with Rsa I and a Southern blot of the restriction fragments probed with p2Fc6 to ascertain whether the C0L1A1 alleles could be distinguished using this RFLP. COL1A2 was not investigated. BA was homozygous for the 3.6 kb allele (Sykes et al 1986). However, this cell line was selected for further investigation because of the unusual protein observation. 118 BA-Sillence type IIA 01-Fig 5-1 119 Analysis of Lysine hydroxylation in 01 type DA cell lines. Hydroxylysine / Total Lysine + Hydroxylysine (% ) al(I) a2(I) Adult control (MP) 11.4 21.7 Foetal control 1(T188) 14.6 18.4 2(FeSin) 14.6 24.6 Mean ± SEM 13.5 ±1.5 21.6 ±2.5 OI Patients BA 27.1 25.9 BAhk 15.0 25.5 BBr 29.1 30.5 BC 17.4 26.3 BJ 28.6 26.0 BKi 19.3 47.7 BKo 32.7 30.1 BO 17.2 ND BS 21.3 31.6 BBe 26.9 37.7 TABLE 5.1 Summary of hydroxylysine figures, obtained from 01 type HA cell lines treated as described in 2.8.2, page 64 5.2 Clinical Description BA, a girl, was delivered suddenly and prematurely at 34 weeks gestation to an 18 year old mother. The baby weighed 1100 g and died after only a few minutes from early, severe, neonatal asphyxia. Post mortem examination showed that she had no vault to her skull and short limbs. Radiological examination (Fig 5.1) showed poorly calcified bones and multiple rib fractures, all indicative of Sillence type IIA OI, which was confirmed histologically. 120 5.3 Protein Studies 5.3.1 BA synthesised normal levels of type I collagen but its secretion was reduced. In the medium the two forms of ocl(I) were present in a 1 to 1 to 1 ratio with a2(I) as seen in Fig 5.2. The slow migrating form, a 1(1) , was clearly retained in the cell layer. 5.3.2 When proa-chains from cells labelled in the presence of aa'dipyridyl were separated on * PAGE gels it was not clear whether the slow migration was eliminated. Proa 1(1) was poorly resolved from proal(I) and the picture further complicated by proal(III), Fig 5.3. The protein was unstable in the underhydroxylated state. Even at 4°C for 2 hours pepsin treatment was too severe to allow analysis of unhydroxylated collagen. 5.3.3 The ID CNBr peptide mapping gel (Fig 5.4) showed a doublet in the region of al(I)CB3. 5.3.4 2D CNBr peptides were obviously tilted (Fig 5.5) but it was not clear whether the onset of the overhydroxylation was in al(I)CB3 or the more C-terminal al(I)CB7. 5.3.5 Unlike the protein from the three families previously described, the type I collagen from BA melted at 39°C (Fig 5.6) as opposed to 42°C in a normal individual. 121 Fig. 5.2 Collagen material (pepsin treated) from a control (C) and the 01 type IIA cell line BA (01) secreted (tracks 1-3) and retained within the cell layer (tracks4-6). The abnormal protein band is indicated as a 1(1) Fig. 5.3 Proa-chains from a control (C) and the cell line from BA (01). The fibroblasts were cultured in the presence (+) and absence (-) of the iron chelator aa'dipyridyl — Med.— | |— Cells— LJ O LJ L_J O ------la1(III)]3 C 01 01 c c + + ar^'dipyridyl __—procil (III) /pro 1(1)* — proa1(I) — prw2(I) Fig 5-B £Zl Control Affected m r n * » Control T l i LO L n 4 ^ f t * ^ f t f t f t . f t — k — * IN ) h O 1— 1 • t— 1 m m m m m m C D C D C D C D C D CD U J o Q d 4 ^ UJ LTI • • * » • o CD > n n n CD CD CD O N c o - J Fig. 5.6 Estimation of of type I collagen (pepsin treated) secreted from skin fibroblasts from the patient BA. The of normal human type I collagen is 42° * n The abnormal protein band is indicated as al(I) Fig. 5.7 Southern blots of genomic DNA extracted from control (C) and patient (BA) cells digested with either Hind III or Bam HI and probed with the cDNA Hf404. (M indicates the marker track). No large gene rearrangements were apparent. -fc>. K> • 35° C O LJ m vO o LJ m - r * " m m m m m O LJ m oo Fig5-6 o LJ N 1 CN ■ m i LJ O — x O LJ m l) ( 2 a - [crKnni al(I)* 3 B C M C BA C Hin k * 6 kb * III I I d , « 9kb i 5-7Fig BamHI B C BA C m * kb 4*8 2 Kb 12 5.4 DNA Analysis 5.4.1 Genomic DNA was prepared from skin fibroblasts. Samples were digested with Bam HI or Hind III and the restriction fragments separated, blotted and probed with the cDNA Hf404 (see Fig 1.2, page 28). There were no gross abnormalities, Fig 5.7. Hf404 was cut with Ava I to generate four small fragments. The ends of these were filled in using the Klenow fragment of DNA polymerase I. These were then to be subcloned into pBluescript so that riboprobes could be used to screen the patient material for mismatches using the RNAse A method (Marini et al 1989). However, the blunt ended ligation was inefficient and the transformation produced too few recombinants. 5.4.2 Oligonucleotide primers, with a GC content of about 50 %, were chosen (Dr A.C. Nicholls) for regions of the al(I) cDNA covering CB3 and CB7. All primers were screened to ensure that they were unique to COL1A1 and that there was no 3' sequence homology. The denaturation temperature of each primer was calculated using the formula: 2(AT) + 4(GC)°C Pairs of primers were chosen with the same theoretical denaturation temperature, about 65°C. The actual sequences are shown in Fig 5.8. Using the appropriate antisense primer it was possible to generate enough first strand cDNA from a preparation of total RNA to amplify as described in 2.10.4 and 2.10.5. A single band of amplified patient cDNA was obtained in each case. However, sufficient material 125 PCR PRIMERS A— CCTGGTCCTGATGGCAAAACT B— ATCACCTCTGTCACCCTTAGG C — TTTGGTACCGGGTGATGCTGGTGCCCCTGGAG D — TTTTCTAGAGCAGGAGCCCCCTCACGTCCAG PCR amplification of first strand cDNA from the patient BA covering a 1(1) cyanogen bromide peptides 3 and 7 M BA SDW 1018 bp 1018 b p 516 bp — 602 bp 516 bp CB 3 Fig 5-8 126 for a blunt ended ligation into bacteriophage M l3 was not obtained. Limitations of time precluded repetition and the actual mutation remains obscure. 5.5 Discussion It is now generally accepted that although non-traditional modes of inheritance operate in some OI families, the majority of OI type IIA cases arise as new dominant mutations in the foetus and the consequent recurrence risk is low (Thompson et al 1987). Most mutations are point mutations resulting in the substitution of a glycine for another, larger amino acid residue as described in 1.9.2 and illustrated in Figs 1.4 and 1.5. This particular patient was investigated because the presence of two discrete bands might have indicated the presence of an in frame insertion of material into COL1A1. This type of defect has only been described once in the literature by Byers and colleagues (1988b). The actual sequencing of this insertion has not yet been reported. The intracellular retention of molecules containing the mutant a 1(1) chain and the lowering of the melting temperature to 39°C were all expected observations. The results obtained using aa'dipyridyl in the culture medium were inconclusive. The separation of proal(I) from proal(III) in the SDS-PAGE system does not allow accurate interpretation of data in this patient where the mutant proal(I) chain co-migrated with proal(III). The lack of hydroxylation in collagen which results from the use of the iron chelator renders the triple helix unstable and the treatment of procollagen with pepsin to generate collagen is severe. The yield was too low to see clearly whether there were still two forms of ccl(I). 127 To produce such a clear difference in the protein it was surmised that an insertion would have to be about two exons, ie 36 amino acid residues. The actual size of the insertion in the genomic DNA would depend upon the length of intervening sequence between two such exons, but would probably be at least 200 bp. The ID CNBr peptide mapping experiment suggested an insertion in al(I)CB3. The 2D peptide mapping showed that there were overmodified forms of both al(I)CB3 and the more N-terminal al(I)CB8. ocl(I)CB6 appeared normal but it was not clear whether the band corresponding to al(I)CB7 was tilted or not and therefore the mutation might be at the N-terminal end of CB7 or in al(I)CB3. The cDNA Hf404 covers both these CB peptides. There were no obvious abnormalities in the restriction maps of genomic DNA. B am HI gave bands of 2 kb, 4.8 kb and 12 kb and Hind III 9 kb and 6 kb as expected. This suggested that the retardation of the protein was due to extreme overmodification rather than an insertion of peptide material. A combination of first strand cDNA synthesis and PCR were used in an attempt to clone and sequence the suspect regions of the COL1A1 gene. Both PCR products obtained were single bands of 524 bp and 941 bp for al(I)CB3 and al(I)CB7 respectively, see Fig 5.8. This seems to confirm that the mutation is simply a point mutation giving rise to a very severely overhydroxylated protein from one allele. Further studies would be needed to estimate the exact levels of overhydroxylation and, in the event of generating enough PCR product to clone, it should be possible to define the actual base change in the cDNA and hence the amino acid substitution. 128 C h apter 6 129 CONCLUDING REMARKS The type I collagen structural genes were good candidates for the site of mutation in patients with 01 and certain forms of EDS. It has now been shown that almost all 01 can be attributed to defects in one of these genes. Those patients in whom the actual DNA defect has been detected have demonstrated that, as might have been expected from the diversity of clinical phenotype, OI is the result of many different genetic defects. Patients with the mildest abnormalities may not even be clinically classified as OI and many such subjects presumably go undetected in the general population. The most severe cases which are either progressively deforming or lethal in the perinatal period are the subject of the investigations described here. It was anticipated that these studies would contribute towards a biochemical classification of the disease. However, it is now clear that mutations occur throughout the type I collagen molecule and there is no reliable correlation between a DNA defect and the clinical appearance of the patient. Only in classical EDS VII, a disease associated with an abnormality affecting the N-propeptidase cleavage site, have unrelated patients shown identical DNA defects. The characterisation of the first mutations revealed certain trends in phenotype (1.11). It is still true that point mutations at the C-terminal end of the protein molecule are generally more severe than those at the N-terminus and that frameshift mutations are more severe than those, such as exon skipping, which do not alter the critical collagen Gly-X-Y reading frame. However the generalisations made from the original observation of glycine to cysteine substitutions in C0L1A1 (Starman et al 1989) have not been true for all point mutations causing substitution of a glycine residue. In the a2(I) chain, glycine to cysteine is lethal at residues 472 and 787 but inbetween the two, at residue 130 646, produces the mild phenotype. It appears that glycine to aspartate substitutions cannot be tolerated anywhere in the molecule; all point mutations producing this change have been lethal. Glycine to valine is lethal in al(I) but severe at a2(I)-586. For glycine to serine changes in COL1A1 the discrepancies are the most obvious. The triple helix is not as significantly destabilised as it is when a bulkier amino acid has been substituted. At residues 1009,844 and 832 the disease is severe, at residues 1003,964,913, 598 and 565 this change is lethal. Glycine to serine at al(I)-589, inbetween and close to two lethal defects, produces severe Sillence type HI OI (Briggs et al 1991 Personal communication). Furthermore, the disease caused by glycine to serine at residue 661 in a2(I) is not even classified as OI. These observations suggest that certain regions of the protein molecule are more critical than others, that an unstable triple helix may not be the only cause of the disease and the position of a mutation is possibly as important as the actual defect. In chapters 3 and 4 families with recurrent severe OI are described. Affected subjects have shown tilted bands on 2D gels of CNBr cleaved a-chains. This is generally considered to be an indicator of heterozygosity. In family T the observation would be explained if one of the parents were a germinal mosaic. This mode of inheritance might account for the disease in as many as 10 % of all families with types II and III OI (Byers, unpublished). In fact all recurrent OI, with the exception of that in consanguineous pedigrees, may be the result of germinal mosaicism in one of the parents. In families F and G the pedigree structure suggests autosomal recessive inheritance. The affected children should be homozygous for the abnormality and there is no evidence for any normal protein in cells from the affected children but there are tilted bands on 2D maps. This may be due to a heterogeneous population of overmodified material. There is an indication of heterogeneity in ID gels; although there is no normally migrating 131 material, bands from the affected children are slightly broadened. This hypothesis is reinforced by the data obtained from the lethal OI patients. All ten subjects screened (chapter 5) showed some level of overmodification as demonstrated by SDS-PAGE and direct estimation of lysine hydroxylation but only BA synthesised two resolvable forms of al(I). More detailed analysis indicated that the doublet al(I) in BA is a consequence of excessive post-translational modification. Other OI patients with a defect mapping to the same region of the protein molecule show only broadened bands. This shows that different levels of hydroxylation can be detected using these separation methods. However, the interpretation of 2D peptide maps used world-wide might be only partially correct. Tilting certainly indicates heterogeneity but a heterozygous normal/mutant individual may be indistinguishable from one with a heterogeneity of protein all of which is overmodified to some extent. The implications of this for genetic counselling are considerable. The investigation of families F and G has revealed a second important point which further complicates genetic counselling. Affected patients from these families suffer from a severe, progressively deforming OI, classified as Sillence type ID, which is clinically very similar to family T. Clearly the disease in both these pedigrees is the result of an abnormal type I collagen. However, in families F and G, the disease is apparently caused by a defect in a gene other than COL1A1 or COL1A2. The defective locus must encode a component involved in the biosynthesis of type I collagen. The enzymes known to be involved in this pathway would be good candidates but can be excluded as they are not thought specific to type I collagen. In both families F and G the disease is transmitted in an autosomal recessive manner and heterozygosity for a mutation at this locus does not produce overt disease. If the mutation rate is as low for this unknown gene as for COL1A1 and COL1A2 the chance of two unrelated individuals carrying a mutation at the same locus is remote. The absence of linkage to the type I 132 collagen structural genes in OI may be confined to consanguineous families and so the presence of a third OI gene may not influence genetic counselling to any great extent. However, there are certain geographical areas where consanguinity and consequently severe OI are relatively common and in such populations the possibility of a third locus must be considered in the genetic counselling. Prenatal counselling and diagnosis is of most value to families with severe, recurrent OI and these types are the subject of this thesis. The method of choice for prenatal testing uses allele specific oligonucleotide hybridisation to DNA from the suspect pregnancy. However, this is clearly specific and only appropriate in families where a previously affected child has been studied and the actual defect in their genomic DNA identified. This technique has yet to be applied to OI because most of the defects defined have been new dominant mutations. RFLP segregation analysis is appropriate only in large kindreds with autosomal dominant transmission of mild to moderate OI (Lynch et al 1990, Sykes et al 1990) but no estimate of false positives can be made. Severe OI pedigrees are too small for phase to be determined. In these, sequential ultrasound scans revealing an affected foetus late in gestation at around 24 weeks are the only option in most cases. However, where a previously affected child has been investigated a protein marker might allow a prenatal diagnosis based on the analysis of collagen from cultured chorionic villus cells. This study succeeded in its aim to identify markers for prenatal diagnosis. Two of the four families have been given a prenatal test using a protein marker, one was abnormal and both were confirmed as correct. A biochemical classification of OI is probably not realistic because of the diversity of the disease. However, it would seem appropriate to continue screening families with 133 recurrent OI to identify markers for prenatal diagnosis and to estimate the actual incidence of a non-traditional inheritance pattern. Whilst it is appropriate to continue to search for mutations to establish a mutation map we must also address the question of their effect on the protein and on how they alter the clinical phenotype. 134 Chapter 7 135 REFERENCES Aitchison K., Ogilvie D., Honeyman M., Thompson E., Sykes B. (1988) Homozygous 01 unlinked to collagen I genesHum. Genet. 78:233-236. Ala-Kokko L., Baldwin C.T., Moskowitz R.W., Prockop D.J. (1990) Single base mutation in the type II procollagen gene (COL2A1) as a cause of primary osteoarthritis associated with a mild chondrodysplasiaProc. Natl. Acad. Sci. (USA) 87:6565-6568. Aylsworth A.S., Seeds J.W., Guilford B., Bums C.B., Washburn D.B. (1984) Prenatal diagnosis of a severe deforming type ofAm. OI J. Med. Genet. 19:707-714. Baldwin C.T., Ganguly A., Rooney J., Hosomi S., Conway D.M., Prockop D.J. (1988) Exon 33 of proa2(I) collagen is deleted in mRNAs from a patient with OI: Localisation of the mutation with carbodiimideColl. Rel. Res. 8:508A Abstr. Baldwin C.T., Constantinou C.D., Dumars K.W., Prockop D.J. (1989) A single base mutation that converts glycine 907 of the a2(I) chain of type I procollagen to aspartate in a lethal variant of OIJ. Biol. Chem. 264:3002-3006. Barker D.F., Hostikka S.L., Zhou J., Chow L.T., Oliphant A.R., Gerken S.C., Gregory M.C., Skolnick M.H., Atkin C.L., Tryggvason K. (1990) Identification of mutations in the COL4A5 collagen gene in Alport SyndromeScience 248:1224-1227. Barsh G.S., Byers P.H. (1981) Reduced secretion of structurally abnormal type I procollagen in a form ofProc. OI Natl. Acad. Sci. (USA) 78:5142-5146. Barsh G.S., David K.E., Byers P.H. (1982) Type I OI: A non-functional allele for proal(I) chains of type I procollagenProc. Natl. Acad. Sci. (USA) 79:3838-3842. Barsh G.S., Roush C.L., Bonadio J., Byers P.H., Gelinas R.E. (1985) Intron mediated recombination may cause a deletion in an a l type collagen chain in a lethal form of OI Proc. Natl. Acad. Sci. (USA) 82:2870-2874. Bateman J.F., Mascara T., Chan D., Cole W.G. (1984) Abnormal type I collagen metabolism by cultured fibroblasts in lethal perinatal OIBiochem. J. 217:103-115. 136 Bateman J.F., Chan D., Mascara T., Rogers J.G., Cole W.G. (1986) Collagen defects in lethal perinatal OI Biochem J. 240:699-708. Bateman J.F., Pillow J., Mascara T., Medvedec S., Ramshaw J.A.M., Cole W.G. (1987a) Cell layer associated proteolytic cleavage of the telopeptides of type I collagen in fibroblast cultureBiochem. J. 245:677-682. Bateman J.F., Mascara T., Chan D., Cole W.G. (1987b) A structural mutation of the collagen al(I)CB7 peptide in lethal perinatal OIJ. Biol. Chem. 262:4445-4451. Bateman J.F., Chan D., Walker I.D., Rogers J.G., Cole W.G. (1987c) Lethal perinatal OI due to the substitution of arginine for glycine at residue 391 of the a l(I) chain of type I collagen /.Biol. Chem. 262:7021-7027. Bateman J.F., Lamande S.R., Dahl H-H., Chan D., Cole W.G. (1988) Substitution of arginine for glycine 664* in the collagen a l(I) chain in lethal OIJ. Biol. Chem. 263:11627-11630. Bateman J.F., Lamande S.R., Dahl H-H., Chan D., Mascara T., Cole W.G. (1989) A frameshift mutation results in a truncated non-functional carboxyl-terminal proal(I) propeptide of type I collagen inJ. OI Biol. Chem. 264:10960-10964. Bateman J.F., Hannagan M., Lamande S.R., Moeller I., Chan D., Cole W.G. (1990) Collagen I mutations in perinatal lethal OIAnn. NY Acad. Sci. Abstr (In Press). Beighton P., de Paepe A., Danks D., Finidori G., Gedde-Dahl T., Goodman R., Hall J.G., Hollister D.W., Horton W., McKusick V.A., Opitz J.M., Pope F.M., Pyeritz R.E., Rimoin D.L., Sillence D., Spranger J.W., Thompson E., Tsipouras P., Viljoen D., Winship I., Young I. (1988) International nosology of heritable disorders of connective tissue, Berlin, 1986 Am. J. Med. Genet. 29:581-594. * More recently quoted as 667 137 Bernard M., Yoshioka H., Rodriguez E., van der Rest M., Kimura T., Ninomiya Y., Olsen B.R., Ramirez F. (1988) Cloning and sequencing of pro-al(XI)-collagen cDNA demonstrates that type XI belongs to the fibrillar class of collagens and reveals that the expression of the gene is not restricted to cartilagenous J.tissue Biol. Chem. 263:17159- 17166. Birk D.E., Fitch J.M., Babiarz J.P., Linsenmayer T.F. (1988) Collagen types I and V are present in the same fibril in avian comeal stroma/.C ell Biol. 106:999-1008. Boehm C.D. (1989) Use of polymerase chain reaction for diagnosis of inherited disorders Clin. Chem. 35:1843-1848. Bonadio J., Byers P.H. (1985) Subtle alterations in the chains of type I procollagen produce 01 type IINature (Lond) 316:363-366. Bonadio J., Patterson E., Smiley E. (1988) RNA sequence analysis of perinatal lethal 01 mutationsColl. Rel. Res. 8:506A Abstr. Bonadio J., Saunders T.L., Tsai E., Goldstein S.A., Morris-Wiman J., Brinkley L., Dolan D.F., Altschuler R.A., Hawkins J.E., Bateman J.F., Mascara T., Jaenisch R. (1990a) Transgenic mouse model of the mild, dominant form ofProc. 01 Natl. Acad. Sci. (USA) 87:7145-7149. Bonadio J., Ramirez F., Barr M. (1990b) An intron mutation in the human al(I) collagen gene alters the efficiency of pre-mRNA splicing and is associated with 01 typeJ. II Biol. Chem. 265:2262-2268. Bonner W.M., Laskey R.A. (1974) A film detection method for tritium labelled proteins and nucleic acids in polyacrylamide gelsEur. J. Biochem. 46:83-88. Bomstein P., McKay J., Liska D.J., Apone S., Devarayalu S. (1988) Interactions between the promoter and the first intron are involved in transcriptional control of a 1(1) collagen gene expressionMol. Cell. Biol. 8:4851-4857. Breindl M., Harbers K., Jaenisch R. (1984) Retrovirus induced lethal mutation in collagen I gene of mice is associated with an altered chromatin structureCell 38:9-16. 138 Bruckner P., Mendler M., Steinmann B., Huber S., Winterhalter K.H. (1989) The structure of human collagen type XI and its organisation in foetal and infant cartilage fibrils J. Biol. Chem. 263:16911-16917. Bruckner P., Prockop D J. (1981) Proteolytic enzymes as probes for the triple helical conformation of procollagenAnal. Biochem. 110:360-368. Byers P.H., Wenstrup R.J., Bonadio J.F., Starman B., Cohn D.H. (1987) Molecular basis of inherited disorders of collagen biosynthesis. Implications for prenatal diagnosisCurr. Probl. Dermatol. 16:158-174. Byers P.H., Tsipouras P., Bonadio J.F., Starman B.J., Schwartz R.C. (1988a) Perinatal lethal OI (type II): A biochemically heterogenous disorder usually due to new mutations in the genes for type I collagenAm. J. Med. Genet. 42:237-248. Byers P.H., Starman B J., Cohn D.H., Horwitz A.L. (1988b) A novel mutation causes a perinatal lethal form of OI. An insertion in one a l(I) collagen allele (COL1A1)J. Biol. Chem. 263:7855-7861. Byers P.H. (1990) Brittle bones - fragile molecules: Disorders of collagen gene structure and expression (Review)TIG 6:293-300. Cetta G., Tenni R., Rossi A., Antoniazzi F., Vitellaro-Zuccarello L., Valli M. (1990) The substitution of glycine for cysteine 178 in a l(I) triple helical domain: Mutual influence of the mutation with neighboring amino acidsAnn. NY Acad. Sci. Abstr (In press). Chu M-L., Williams C.J., Pepe G., Hirsch J.L., Prockop D.J., Ramirez F. (1983) Internal deletion in a collagen gene in perinatal lethal OINature (Lond) 304:78-80. Chu M-L., de Wet W., Bernard M., Ding J-F., Morabito M., Myers J., Williams C., Ramirez F. (1984) Human proal(I) collagen gene structure reveals evolutionary conservation of a pattern of introns and exonsNature (Lond) 310:337-340. Chu M-L., Gargiulo V., Williams C.J., Ramirez F. (1985) Multiexon deletion in an OI variant with increased type III collagen mRNAJ. Biol. Chem. 260:691-694. 139 Chu M-L., Mann K., Deutzmann R., Pribula-Conway D., Hsu-Chen C-G., Bernard M.P., Timpl R. (1987) Characterisation of three constituent chains of collagen type VI by peptide sequences and cDNA clonesEur. J. Biochem. 168:309-317. Chu M-L., Conway D., Pan T., Baldwin C., Mann K., Deutzmann R., Timpl R. (1988) Amino acid sequence of the triple helical domain of human collagen typeJ. Biol. VI Chem. 263:18601-18606. Chu M-L., Zhan R-Z., Pan T., Stokes D., Conway D., Kuo H-J., Glanville R., Mayer U., Mann K., Deutzmann R., Timpl R. (1990) Mosaic structure of globular domains in the human type VI collagen a3 chain: Similarity to Von Willebrand factor, fibronectin, actin, salivary proteins and aprotinin type protease inhibitorsEMBO J. 9:385-393. Cohn D.H., Byers P.H., Steinmann B., Gelinas R.E. (1986) Lethal 01 resulting from a single nucleotide change in one human proal(I) collagen alleleProc. Natl. Acad. Sci. (USA) 83:6045-6047. Cohn D.H., Apone S., Eyre D.R., Starman B.J., Andreassen P., Charbonneau H., Nicholls A.C., Pope F.M., Byers P.H. (1988) Substitution of cysteine for glycine within the carboxyl terminal telopeptide of the a l chain of type I collagen produced J.mild Biol. OI Chem. 263:14605-14607. Cohn D.H., Starman B.J., Blumberg B., Byers P.H. (1990a) Recurrence of lethal OI due to parental mosaicism for a dominant mutation in a human type I collagen gene (COL1A1) Am. J. Hum. Genet. 46:591-601. Cohn D.H., Wallis G.A., Zhang X., Byers P.H. (1990b) Serine for glycine substitutions in the al(I) chain of type I collagen: Biological plasticity in the gly-pro-hyp clamp at the C-terminal end of the triple helical domainM atrix 10:236 Abstr. Cohn D.H., Wallis G.A., Edwards M.J., Starman B.J., Byers P.H. (1990c) Germline and somatic mosaicism in OIAnn. NY Acad. Sci. Abstr (In press). Cohn D.H., Zhang X. (1990d) PCR based linkage strategies for type I collagen genes M atrix 10:236 Abstr. 140 Cole W.G., Chan D., Chambers G.W., Walker I.D., Bateman J.F. (1986) Deletion of 24 amino acids from the proa 1(1) chain of type I procollagen in a patient with the EDS VII / . Biol. Chem. 261:5496-5503. Cole W.G., Evans R., Sillence D.O. (1987) The clinical features of EDS VII due to a deletion of 24 amino acids from the proal(I) chain of type I procollagenCase Reports. Constantinou C.D., Nielsen K.B., Prockop D.J. (1989) A lethal variant of OI has a single base mutation that substitutes cysteine for glycine 904 of the a 1(1) chain of type I procollagenJ. Clin. Invest. 83:574-584. Constantinou C.D., Pack M., Young S.B., Prockop D.J. (1990) Phenotypic heterogeneity in OI: The mildly affected mother of a proband with a lethal variant has the same mutation substituting cysteine for a 1-glycine 904 in a type I procollagen gene (COL1 Al) Am. J. Hum. Genet. 47:670-679. Crouch E., Bomstein P. (1978) Collagen synthesis by human amniotic fluid cells in culture: Characterisation of a procollagen with three identical proa 1(1) chains Biochemistry 17:5499-5509. D'Alessio M., Ramirez F., Suzuki H., Solursh M., Gambino R. (1989) Structure and developmental expression of a sea urchin fibrillar collagenProc. gene Natl. Acad. Sci. (USA) 86:9303-9307. Deak S.B., Nicholls A.C., Pope F.M., Prockop D.J. (1983) The molecular defect in a non-lethal variant of OI. Synthesis of proa2(I) chains which are not incorporated into trimers of type I procollagenJ. Biol. Chem. 258:15192-15197. de Crombrugghe B., Schmidt A. (1987) Structure and expression of collagen Meth.genes Enzymol. 144:61-74. de Vries W.N., de Wet W.J. (1986) The molecular defect in an autosomal dominant form of OI. Synthesis of type I procollagen containing cysteine in the triple helical domain of proal(I) chainsJ. Biol. Chem. 261:9056-9064. 141 de Wet W., Pihlajaniemi T., Myers J., Kelly T.E., Prockop D.J. (1983) Synthesis of a shortened proa2(I) chain and reduced synthesis of proa2(I) chains in a proband with 01 J. Biol. Chem. 258:7721-7728. de Wet W., Bernard M., Benson-Chanda V., Chu M-L., Dickson L., Weil D., Ramirez F. (1987) Organisation of the human proa2(I) collagen J.gene Biol. Chem. 262:16032- 16036. Dickson L.A., Pihlajaniemi T., Deak S., Pope F.M., Nicholls A.C., Prockop D J., Myers J.C. (1984) Nuclease SI mapping of a homozygous mutation in the carboxyl propeptide coding region of the proa2(I) collagen gene in a patient withProc. OI Natl. Acad. Sci. (USA) 81:4524-4528. Edwards J.H. (1989) Familiarity, recessivity and germline mosaicismAnn. Hum. Genet. 53:33-47. Eyre D., Wu J.J. (1987) in Structure and function of collagen types p 261-281 Ed. Mayne R. and Burgeson R.E. Pub. NY Acad. Feinberg A.P., Vogelstein B. (1984) A technique for radiolabelling restriction enzyme fragments to a high specific activityAnal. Biochem. 137:266-267. Fertala A., Westerhausen A., Morris G.M., Rooney J.E., Prockop D.J. (1990a) Two cysteine substitutions in the type I procollagen genes (COL1A1 and COL1A2) that cause lethal OI. The location of glycine substitution does not in any simple way predict their effects on protein function or phenotypeAm. J. Hum. Genet. 47:A216. Fertala A., Rooney J., Westerhausen A., Prockop D.J. (1990b) Single base mutation that converts the codon for glycine a2-787 to cysteine in the type I procollagen gene (COL1 Al) causes a lethal variant of OIM atrix 10:238 Abstr. Gaillard C., Strauss F. (1990) Ethanol precipitation of DNA with linear polyacrylamide as carrier Nuc. Acids Res. 18:378. Genovese C., Rowe D. (1987) Analysis of cytoplasmic and nuclear mRNA in fibroblasts from patients with type I OIMeth. Enzymol. 145:223-235. 142 Genovese C., Brufsky A., Shapiro J., Rowe D. (1989) Detection of mutations in human type I collagen mRNA in OI by indirect RNase protectionJ. Biol. Chem. 264:9632-9367. Gibbs D.A., Daw S.C.M., Campbell S., Hall E.M., Nicholls A.C., Pope F.M., Siggers D., Williams E.M. (1991) Successful prenatal diagnosis in two unusual families with recurrent OI Prenat. Diagn. (Submitted). Gordon M.K., Gerecke D.R., Olsen B.R., (1987) Type XII collagen: Distinct extracellular matrix component discovered by cDNA cloningProc. Natl. Acad. Sci. (USA) 84:6040-6044. Gordon M.K., Gerecke D.R., Dublet B., van der Rest M., Olsen B.R. (1989) Type XII collagen. A large multidomain molecule with partial homology to type IX collagen /. Biol. Chem. 264:19772-19778. Grobler-Rabie A.F., Wallis G., Brebner D.K., Beighton P., Mathew C.G. (1985a) Detection of a high frequencyRsa I polymorphism in the human proa2(I) collagen gene which is linked to an autosomal dominant form ofEMBO OI J. 4:1745-1748. Grobler-Rabie A.F., Brebner D.K., Vandenplas S., Wallis G., Dalgleish R., Kaufman R.E., Bester A.J., Mathew C.G.P., Boyd C.D. (1985b) Polymorphism of DNA sequence in the proa2(I) geneJ. Med. Genet. 22:182-186. Hall J.G., Byers P.H. (1987) Germline MosaicismLancet i:751. Hall J.G., Dorst J.P., Rotta J., McKusick V.A. (1987) Gonadal mosaicism in pseudoachondroplasia Am.J. Med. Genet. 28:143-151. Hall J.G. (1988) Somatic mosaicism: Observations related to clinical geneticsAm. J. Hum. Genet. 43:355-363. Hanahan D. (1985) Techniques for transformationE of .coli in DNA cloning Vol 1-A practical Approach Ed. D.M. Glover Pub. IRL Press. 143 Harwood R., Grant M.E., Jackson D.S. (1975) Studies on the glycosylation of hydroxylysine residues during collagen biosynthesis and the subcellular localisation of collagen galactosyltransferase and collagen glucosyltransferase in tendon and cartilage cells Biochem. J. 152:291-302. Hattori S., Hasegawa T., Shimura K., Akimoto H., Taniguchi K., Hamazaki M., Nagai Y. (1988) 01 type D: A variant characterised by the presence of cysteine in the CB6 region of type I procollagenColl. Rel. Res. 8:506 Abstr. Hillson D.A., Lambert L., Freedman R.B. (1984) Formation and isomerisation of disulphide bonds in proteins: protein disulphide isomeraseMeth. Enzymol. 107:281-294. Horton W.A., Campbell D., Machado M.A., Chou J. (1989) Type II collagen screening in the human chondrodysplasiasAm. J. Med. Genet. 34:579-583. Hostikka S.L., Eddy R.L., Byers M.G., Hoyhtya M., Shows T.B., Tryggvason K. (1990) Identification of a distinct type IV collagen a-chain with restricted kidney distribution and assignment of its gene to the locus o f X chromosome linked Alport syndromeProc. Natl. Acad. Sci. (USA) 87:1606-1610. Jeffreys A.J., Wilson V., Thein S.L. (1985) Hypervariable "minisatellite" regions in human DNA Nature (Lond) 314:67-73. Kadler K.E., Hojima Y., Prockop D.J. (1987) Assembly of collagende fibrils novo by cleavage of the type I pC-collagen with procollagen C-proteinase. Assay of critical concentration demonstrates that collagen self-assembly is a classical example of an entropy driven processJ. Biol. Chem. 262:15696-15701. Kadler K.E., Hojima Y., Prockop D.J. (1988) Assembly of type I collagende fibrils novo. Between 37 and 41°C the process is limited by microunfolding of monomersJ. Biol. Chem. 263:10517-10523. Kadler K.E., Hojima Y., Prockop D.J. (1990) Collagen fibrilsin vitro grow from pointed tips in the C to N-terminal directionBiochem. J. 268:339-343. 144 Kapoor R., Sakai L.Y., Funk S., Roux E., Bomstein P., Sage E.H. (1988) Type VIII collagen has a restricted distribution in specialised extracellular matricesJ. Cell Biol. 107:721-730. Keene D.R., Sakai L.Y., Bachinger H-P., Burgeson R.E. (1987) Type III collagen can be present on banded collagen fibrils regardless of fibril diameterJ. Cell Biol. 105:2393- 2402. Killen P.D., Francomano C.A., Yamada Y., Modi W.S., O'Brien S.J. (1987) Partial structure of the human a2(IV) collagen chain and chromosomal localisation of the gene COL4A2 Hum. G enet. 77:318-324. Killen P.D., Burbelo P.D., Martin G.R., Yamada Y. (1988) Characterisation of the promoter for the al(IV ) collagen geneJ. Biol. Chem. 263:12310-12314. Kimura T., Cheah K.S.E., Chan S.D.H., Lui V.C.H., Mattei M-G., van der Rest M., Ono K., Solomon E., Ninomiya Y., Olsen B.R. (1989a) The human a2(XI) collagen (COL11A2) chain. Molecular cloning of cDNA and genomic DNA reveals characteristics of a fibrillar collagen with differences in genomic organisationJ. Biol. Chem. 264:13910-13916. Kimura T., Mattei M-G., Stevens J., Goldring M., Ninomiya Y., Olsen B. (1989b) Molecular cloning of rat and human type IX collagen cDNA and localisation of the al(IX ) gene on the human chromosomeEur. 6 J. Biochem. 179:71-78. KirkT.Z., Evans J.S., Veis A. (1987) Biosynthesis of type I procollagen. Characterisation of the distribution of chain sizes and extent of hydroxylation of polysome associated proa-chainsJ. Biol. Chem. 262:5540-5545. Kivirikko K., Myllyla R. (1982) Post-translational enzymes in the biosynthesis of collagen: Intracellular enzymesMeth. Enzymol. 82:245-304. Koivu J., Myllyla R. (1987) Interchain disulphide bond formation in types I and II procollagen. Evidence for a protein disulphide isomersase catalysing bond formationJ. Biol. Chem. 262:6159-6164. 145 Koivu J., Myllyla R., Helaakoski T., Pihlajaniemi T., Tasanen K., Kivirikko K.I. (1987) A single polypeptide acts both as the 6 subunit of prolyl-4-hydroxylase and as a protein disulphide isomeraseJ. Biol. Chem. 262:6447-6449. Koller E., Winterhalter K.H., Trueb B. (1989) The globular domains of type VI collagen are related to the collagen binding domains of cartilage matrix protein and Von Willebrand factorEMBO J. 8:1073-1077. Knowlton R.G., Weaver E.J., Struyk A.F., Knobloch W.H., King R.A., Norris S.K., Shambana A., Uitto J., Jimenez S.A., Prockop D.J. (1989) Genetic linkage analysis of hereditary arthro-ophthalmology (Stickler Syndrome) and the type II procollagen gene Am.J. Med. Genet. 45:681-688. Kuivaniemi H., Sabol C., Tromp G., Sippola-Thiele M., Prockop D.J. (1988) A 19 bp deletion in the proa2(I) gene of type I procollagen that causes in frame RNA splicing from exon 10 to exon 12 in a proband with atypical OI and his asymptomaticJ. mother Biol. Chem. 263:11407-11413. Kuivaniemi H., Tromp G., Prockop D.J. (1991) Mutations in collagen genes. Causes of rare and some common diseases in manFASEB J. 5:2052-2060. Labhard M.E., Wirtz M.K., Pope F.M., Nicholls A.C., Hollister D.W. (1988) A cysteine ' for glycine substitution at position 1017 in an al(I) chain of type I collagen in a patient with mild dominantly inherited OIMol. Biol. Med. 5:197-207. Laemmli U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4Nature (bond) 227:680-685. Lamande S.R., Dahl H-H., Cole W.G., Bateman J.F. (1989) Characterisation of point mutations in the collagen COL1A1 and COL1A2 genes causing lethal perinatal OIJ. Biol. Chem. 264:15809-15812. Laurent G.J. (1987) Dynamic state of collagen: Pathways of collagen degradationin vivo and their possible role in regulation of collagen Am.mass J. Physiol. 252:C1-C9. 146 Law M.L., Chan S.D.H., Berger R., Jones C., Kao F.T., Solomon E., Cheah K.S.E. (1990) The gene for the a2 chain of the human fibrillar collagen type XI (COL11A2) assigned to the short arm of chromosomeAnn. 6Hum. Genet. 54:23-29. Levin L.S., Salinas C.F., Jorgenson R.J. (1978) Classification of 01 by dental characteristics Lancet i:332-333. Lichtenstein J.R., Martin G.R., Kohn L., Byers P.H., McKusick V.A. (1973) Defect in conversion of procollagen to collagen in a formScience of EDS 182:298-300. Lohler J., Timpl R., Jaenisch R. (1984) Embryonic lethal mutation in mouse collagen I gene causes rupture of blood vessels and is associated with erythopoietic and mesenchymal cell death Cell 38:597-607. Lu Valle P., Ninomiaya Y., Rosenblum N.D., Olsen B.R., (1989) The type X collagen gene. Intron sequences split the 5' untranslated region and separate the coding regions for the non-collagenous amino terminal and triple helical domainsJ. Biol. Chem. 263:18378- 18385. Lynch J.R., Ogilvie D.J., Priestley L.M., Baigrie C.M., Sykes B.C. (1990) Prenatal diagnosis of OIJ. Med. Genet. 27:655 Abstr. Marini J., Grange D.K., Gottesman G.S., Lewis M.B., Koeplin D.A. (1989) OI type IV: Detection of a point mutation in one a 1(1) collagen allele (COL1A1) by RNA/RNA hybrid analysis /.Biol. Chem. 264:11893-11900. Miller E.J., Gay S. (1987) The Collagens: An overview and updateMeth. Enzymol. 144:3-41. Minor R.R., Sippola-Thiele M., McKeon J., Berger J., Prockop D J. (1986) Defects in the processing of procollagen to collagen are demonstrable in cultured fibroblasts from patients with EDS and OI syndromesJ. Biol. Chem. 261:10006-10014. Molyneux K., Byers P.H., Dalgleish R. (1990) A new mutation in the a2(I) gene of a patient with non-lethal OIAnn. NY Acad. Sci. Abstr (In press). 147 Morris N.P., Keene D.R., Glanville R.W., Bentz H., Burgeson R.E. (1986) The tissue form of type VII collagen is an antiparallel dim er/.Biol. Chem. 261:5638-5644. Myers J.C., Dickson L.A., de Wet W.J., Bernard M.P., Chu M-L., Di Liberto M., Pepe G., Sangiorgi F.O., Ramirez F. (1983) Analysis of the 3' end of the human proa2(I) collagen gene. Utilisation of multiple polyadenylation sites in cultured fibroblasts /. Biol. Chem. 258:10128-10135. Myers J.C., Jones T.A., Pohjolainen E-R., Kadri A.S., Goddard A.D., Sheer D., Solomon E., Pihlajaniemi T. (1990) Molecular cloning of a5(IV) collagen and assignment of the gene to the region of the X chromosome containing the Alport syndromeAm. J. locus Hum. Genet. 46:1024-1033. Nicholls A.C., Osse G., Schloon H.G., Lenard G., Deak S., Myers J.C., Prockop D.J., Weigel W.R.F., Fryer P., Pope F.M. (1984a) The clinical features of homozygous a2(I) collagen deficient OI /.Med. Genet. 21:257-262. Nicholls A.C., Pope F.M., Craig D. (1984b) An abnormal collagen a-chain containing cysteine in autosomal dominantBrit. OI Med. J. 24:112-113. Nicholls A.C., Oliver J., Renouf D.V., Pope F.M. (1990) Type I collagen mutations in OI and inherited osteoporosisAnn. NY Acad. Sci. Abstr (In press). Nicholls A.C., Oliver J., Renouf D.V., McPheat J., Palan A., Pope F.M. (1991) EDS VII: A single base change that causes exon skipping in the type I collagen a2(I) chainHum. Genet. (In Press). Ogilvie D.J., Aitchison K., Sykes B.C. (1987) An RFLP close to the human collagen gene COL1A1 Nuc. Acids Res. 15:4699. Olsen A.S., Prockop D.J. (1989) Transcription of human type I collagen genes. Variation in the relative rates of transcription of the proal and proa2 Mgenes atrix 9:73-81. Pack M., Constantinou C.D., Kalia K., Nielsen K.B., Prockop D.J. (1989) Substitution of serine for a 1(1) glycine 844 in a severe variant of OI minimally destabilises the triple helix of type I procollagenJ. Biol. Chem. 264:19694-19699. 148 Pasquali-Ronchetti I., Quaglino D., Baccarani-Contri M., Tenconi R., Bressan G.M., Volpin D. (1986) Aortic elastin abnormalities in OI typeColl. II Rel. Res. 6:409-421. Patterson E., Smiley E., Bonadio J. (1989) RNA sequence analysis of a perinatal OI mutation/.Biol. Chem. 264:10083-10087. Penttinen R.P., Lichtenstein J.R., Martin G.R., McKusick V.A. (1975) Abnormal collagen metabolism in cultured cells in OIProc. Natl. Acad. Sci. (USA) 72:586-589. Penttinen R.P., Kobayashi S., Bomstein P. (1988) Transforming growth factor B increases mRNA for matrix proteins both in the presence and in the absence of changes in mRNA stabilityProc. Natl. Acad. Sci. (USA) 85:1105-1108. Phillips C.L., Shrago-Howe A.W., Pinnell S.R., Wenstrup R.J. (1990) A substitution at a non-glycine position in the triple helical domain of proa2(I) collagen chains present in an individual with a variant of the Marfan syndromeClin. /. Invest. 86:1723-1728. Pihlajaniemi T., Dickson L.A., Pope F.M., Korhonen V.R., Nicholls A.C., Prockop D.J., Myers J.C. (1984) OI: Cloning of a proa2(I) collagen gene with a ffameshift mutation /. Biol. Chem. 259:12941-12944. Pihlajaniemi T., Myers J.C. (1987) Characterisation of a proa2(I) collagen gene mutation by nuclease SI mappingMeth. Enzymol. 145:213-222. Pinnell S.R., Krane S.M., Kenzora J.E., Glimcher M.H. (1972) A heritable disorder of connective tissue. Hydroxylysine deficient collagen diseaseNew Eng. J. Med. 286:1013- 1020. Poeschl E., Pollner R., Kuhn K. (1988) The genes for the al(IV ) and a2(IV) chains of human basement membrane collagen type IV are arranged head to head and separated by a bidirectional promoter of unique structureEM BO J. 7:2687-2695. Pope F.M., Martin G.R., Lichtenstein J.R., Penttinen R., Gerson B., Rowe D.W., McKusick V.A. (1975) Patients with EDS type IV lack type III collagenProc. Natl. Acad. Sci. (USA) 72:1314-1316. 149 Pretorius P.J., Wirtz M.K., Rao V.H., Hollister D.W., Gericke G., de Vries W.N., de Wet W.J. (1990) Glycine to cysteine substitution at position 175 in an a l chain of type I collagen produces a clinically heterogeneous form Mof atrix OI 10:245 Abstr. Prockop D J. (1990a) Mutations that alter the primary structure of type I collagen. The perils of a system for generating large structures by the principle of nucleated growthJ. B io l Chem. 265:15349-15352. Prockop D.J. (1990b) Mutations in collagen genes. The lessons of rare diseases applied to common diseasesAnn. NY Acad. Sci. Abstr (In press). Prockop D.J., Tuderman L. (1982) Post-translational modifications in the biosynthesis of collagen: Extracellular enzymesMeth. Enzymol. 82:305-319. Pruchno C.J., Willing M.C., Starman B.J., Aylesworth A., Byers P.H. (1989) Inefficient splicing and production of both a normal and shortened mRNA from the same COL1 Al allele of type I collagen in a father and son withAm. OI J. Hum. Genet. 45:A213. Ramirez F., Di Liberto M. (1990) Complex and diversified regulatory programs control the expression of vertebrate collagen genesFASEB J. 4:1616-1623. Ramirez F., Bernard M., Chu M-L., Dickson L., Sangiorgi F., Weil D., de Wet W., Junien C., Sobel M. (1985) Isolation and characterisation of the human fibrillar collagen genes Ann. NY Acad. Sci. 460:117-129. Rao V.H., Steinmann B., de Wet W., Hollister D.W. (1989) Decreased thermal denaturation temperature of OI mutant collagen is independent of post-translational modification of lysine and hydroxylysineJ. Biol. Chem. 264:1793-1798. Reiss J., Cooper D.N. (1990) Application of the polymerase chain reaction to the diagnosis of human disease (Review)Hum. Genet. 85:1-8. Rossiter B.J.F., Caskey C.T. (1990) Molecular scanning methods of mutation detection (Review)J. Biol. Chem. 265:12753-12756. 150 Rossouw C.M.S., Vergeer W.P., Plooy S J., Bernard M.P., Ramirez F., de Wet WJ. (1987) DNA sequences in the first intron of the human proa 1(1) collagen gene enhance transcription /.Biol. Chem. 262:15151-15157. Rowe D., Shapiro J., Poirier M., Schlesinger S. (1985) Diminished type I collagen synthesis and reduced al(I) collagen mRNA in cultured fibroblasts from patients with dominantly inherited (type I) OIJ. Clin. Invest. 76:604-611. Rupard J.H., Dimari S.J., Damjanov I., Haralson M.A. (1988) Synthesis of type I homotrimer collagen molecules by cultured human lung adenocarcinomaAm. cells J. Pathol. 133:316-326. Ryan M.C., Sandell L.J. (1990) Differential expression of a cysteine-rich domain in the amino terminal propeptide of type II (cartilage) procollagen by alternative splicing of mRNA J. Biol. Chem. 265:10334-10339. Saiki R.D., Gelfand D.H., Stoffel S., Scharf S.J., Higuchi R., Horn G.T., Mullis K.B., Erlich H.A. (1987) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymeraseScience 239:487-491. Sambrook J., Fritsch E.F., Maniatis T. (1989) Molecular Cloning - A Laboratory Manual (2Nd Edition) Pub. Cold Spring Harbor Lab. Press. Sandberg M., Vuorio E. (1987) Localisation of types I, II and HI collagen mRNAs in developing human skeletal tissues byin situ hybridisationJ. Cell Biol. 104:1077-1084. Schnieke A., Harbers K., Jaenisch R. (1983) Embryonic lethal mutation in mice induced by retrovirus insertion into the al(I) collagen Naturegene (Lond) 304:315-320. Schnieke A., Dziadek M., Bateman J.F., Mascara T., Harbers K., Gelinas R., Jaenisch R. (1987) Introduction of the human proal(I) collagen gene into proal(I)-deficient Mov-13 mouse cells leads to formation of functional mouse-human hybrid type I Proc.collagen Natl. Acad. Sci. (USA) 84:764-768. Sherwood A.L., Bomstein P. (1990) Transcriptional control of the al(I) collagen gene involves orientation and position specific intronic sequencesBiochem. J. 265:895-897. 151 Sillence D.O., Rimoin D. (1978) Classification of Osteogenesis ImperfectaLancet ii: 1041-1042. Sillence D.O., Senn A., Danks D.M. (1979) Genetic heterogeneity in 01 Med./. Genet. 16:101-116. Sillence D.O., Barlow K.K., Garber A.P., Hall J.G., Rimoin D.L. (1984) OI type n. Delineation of the phenotype with reference to genetic heterogeneityAm. J. Med. Genet. 17:407-423. Sillence D.O., Butler B., Latham M. (1990) The natural history of blue sclerae in Ann.OI NY Acad. Sci. Abstr (In press). Sippola M., Kaffe S., Prockop D.J. (1984) A heterozygous defect for structurally altered proa2 chain of type I procollagen in a mild variant of OI. The altered structure decreases the thermal stability of procollagen and makes it resistant to procollagen N-proteinaseJ. Biol. Chem. 259:14094-14100. Soininen R., Huotari M., Hostikka S.L., Prockop D.J., Tryggvason K. (1988) The structural genes for a l and a2 chains of human type IV collagen are divergently encoded on opposite DNA strands and have an overlapping promoterJ. region Biol. Chem. 263:17217-17220. Southern E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresisJ. Mol. Biol. 98:503-517. Southern E.M. (1987) Gel electrophoresis of restriction fragmentsMeth. Enzymol. 152:152-176. Spotila L.D., Constantinou C.D., Sereda L., Riggs B.L., Prockop D J. (1990) Substitution of serine for glycine (X2-661 in the gene for type I procollagen (COL1A2) as a cause of post-menopausal osteoporosisAm. J. Hum. Genet. 47:A237. Stacey A., Bateman J.F., Choi T., Mascara T., Cole W., Jaenisch R. (1988) Perinatal lethal OI in transgenic mice bearing an engineered mutant proal(I) collagen geneNature (bond) 332:131-136. 152 Starman B.J., Eyre D., Charbonneau H., Harrylock M., Weis M.A., Weiss L., Graham J.M., Byers P.H. (1989) OI: The position of substitution for glycine by cysteine in the triple helical domain of the proal(I) chains of type I collagen determines the clinical phenotype/.Clin. Invest. 84:1206-1214. Steinmann B., Tuderman L., Peltonen L., Martin G.R., McKusick V.A., Prockop D J. (1980) Evidence for a structural mutation of procollagen type I in a patient with the EDS type VIIJ. Biol. Chem. 255:8887-8893. Steinmann B., Rao V.H., Vogel A., Bruckner P., Gitzelmann R., Byers P.H. (1984) Cysteine in the triple helical domain of one allelic product of the a 1(1) gene of type I collagen produces a lethal form of OIBiol. /. Chem. 259:11129-11138. Steinmann B., Nicholls A.C., Pope F.M. (1986) Clinical variability of OI reflecting molecular heterogeneity: Cysteine substitutions in the a 1(1) collagen chain producing mild and lethal forms /.Biol. Chem. 261:8958-8964. Stoss H., Pesch H-J. (1985) Structural changes of collagen fibrils in skeletal dysplasias. Ultrastructural findings in the iliac crest Virchow's Arch. [Pathol. Anat.] 405:341-364. Superti-Furga A., Steinmann B., Ramirez F., Byers P.H. (1989) Molecular defects of type III procollagen in EDS IVHum. Genet. 82:104-108. Superti-Furga A., Raghunath M., Pistone F.M., Romano C., Steinmann B. (1990) Deletion of nucleotides +2 to +40 in intron 21 of COL1A2 leading to skipping of exon 21 observed in a boy with short stature, osteoporosis, dentinogenesis imperfecta but no fractures (OI type IV)Ann. NY Acad. Sci. Abstr (In press). Sussman M., Lichtenstein J.R., Nigra T.P., Martin G.R., McKusick V.A. (1974) Hydroxylysine deficient skin collagen in a patient with a form of theJ. EDSBone Jt. Surg. 56A:1228-1234. Sykes B., Puddle B., Francis M., Smith R. (1976a) Estimation of two types of collagen using interrupted gel electrophoresisBiochim. Biophys. Res. Commun. 72:1472-1480. Sykes B.C., Ogilvie D.J., Wordsworth B.P., Anderson D.J., Jones N. (1986) Osteogenesis imperfecta is linked to both type I collagen structural genesLancet ii:69-72. 153 Sykes B., Ogilvie D., Wordsworth P., Wallis G., Mathew C., Beighton P., Nicholls A., Pope F.M., Thompson E., Tsipouras P., Schwartz R., Jensson O., Amason A., Borresen A-L., Heiberg A., Frey D., Steinmann B. (1990) Consistent linkage of dominantly inherited OI to the type I collagen loci: COL1A1 and COL1A2Am. J. Hum. Genet. 46:293-307. Tasanen K., Parkkonen T., Chow L.T., Kivirikko K., Pihlajaniemi T. (1988) Characterisation of the human gene for a polypeptide that acts both as the 6 subunit of prolyl-4-hydroxylase and as protein disulphide isomeraseJ. Biol. Chem. 263:16218- 16224. Tenni R., Rossi A., Valli M., Mottes M., Pignatti P.F., Cetta G. (1990) Anomalous cysteine in type I collagen. Localisation by chemical cleavage of the protein using 2- nitro-5-thiocyanobenzoic acid and by mismatch analysis of cDNA heteroduplexesM atrix 10:20-26. Thompson E.M., Young I.D., Hall C.M., Pembrey M.E. (1987) Recurrence risks and prognosis in severe sporadicJ. OI Med. Genet. 24:390-405. Tikka L., Pihlajaniemi T., Henttu P., Prockop D.J., Tryggvason K. (1988) Gene structure for the a l chain of a human short chain collagen (type XIII) with alternatively spliced transcripts and translation termination codon at the 5' end of the last exonProc. Natl. Acad. Sci. (USA) 85:7491-7495. Timpl R. (1989) Structure and biological activity of basement membrane proteins (Review)Eur. J. Biochem. 80:487-502. Tolstoshev P., Solomon E. (1982) CollagenNature genes (Lond) 300:581-582. Tromp G., Prockop D.J. (1988) Single base mutation in the proa2(I) collagen gene that causes efficient splicing of RNA from exon 27 to exon 29 and synthesis of a shortened but in frame proa2(I) chainProc. Natl. Acad. Sci. (USA) 85:5254-5258. Trueb B., Schreier T., Bruckner P., Winterhalter K.H. (1987) Type VI collagen represents a major fraction of connective tissue collagensEur. J. Biochem. 166:699-703. 154 Tsipouras P. (1987) Restriction fragment length polymorphisms (Review)Meth. Enzymol. 145:205-213. Tsipouras P., Ramirez F. (1987) Genetic disorders of collagen (Review)J. Med. Genet. 24:2-8. Tsipouras P., Myers J.C., Ramirez F., Prockop DJ. (1983) RFLP associated with the proa2(I) gene of human type I procollagenJ. Clin. Invest. 72:1262-1267. Tsipouras P., Borresen A.L., Dickson L.A., Berg K., Prockop D.J. (1984) Molecular heterogeneity in the mild autosomal dominant forms ofAm. OI J. Hum. Genet. 36:1172- 1179. Tsuneyoshi T., Constantinou C.D., Mikkelson M., Prockop D.J. (1990) A substitution of arginine for glycine oc2-694 in a gene for type I procollagen (COL1A2) that causes lethal OI. Further definition of a co-operative block for micro-unfolding of the triple helix between about residues 637 and 775Am. J. Hum. Genet. 47:A240 Abstr. Uitto J., Prockop D.J. (1974) Biosynthesis of cartilage procollagen. Influence of chain association and hydroxylation of prolyl residues on the folding of the polypeptide into the triple-helical conformationBiochemistry 13:4586-4591. Vasan N.S., Kuivaniemi H., Vogel B.E., Minor R.R., Wootton J.A.M., Weksberg R., Prockop D.J. (1990) A single base mutation in the proa2(I) gene of type I procollagen that causes in frame RNA splicing from exon 5 to exon 7 in a proband with EDS VIIB M atrix 10:250 Abstr. Vaughan L., Mendler M., Huber S., Bruckner P., Winterhalter K.H., Irwin M.I., Mayne R. (1988) D-periodic distribution of collagen type IX along cartilageJ. fibrils C ell Biol. 106:991-997. Veis A., Leibovich S.J., Evans J., Kirk T.Z. (1985) Supramolecular assemblies of mRNA direct the coordinated synthesis of type I procollagen Proc.chains Natl. Acad. Sci. (USA) 82:3693-3697. Viljoen D., Beighton P. (1987) OI type III: An ancient mutation in AfricaAm. ? J. Med. Genet. 27:907-912. 155 Vissing H., D'Alessio M., Lee B., Ramirez F., Godfrey M., Hollister D.W. (1989) Glycine to serine substitution in the triple helical domain of proa 1(1) collagen results in a lethal perinatal form of shortlimbed dwarfismJ. Biol. Chem. 264:18265-18267. Vogel B.E., Minor R.R., Freund M., Prockop D.J. (1987) A point mutation in a type I procollagen gene converts glycine 748 of the a l chain to cysteine and destabilises the triple helix in a lethal variant of OIJ. Biol. Chem. 262:14737-14744. Vogel B.E., Doeltz R., Kadler K., Hojima Y., Engel J., Prockop D.J. (1988) A substitution of cysteine for glycine 748 of the a 1 chain produces a kink at this site in the procollagen I molecule and an altered N-proteinase cleavage site over 225 nmJ. away Biol. Chem. 263:19249-19255. Voss T., Bomstein P. (1986) Regulation of type I collagen mRNA levels in fibroblasts Eur. J. Biochem. 157:433-439. Vuorio E., de Crombrugghe B. (1990) The family of collagenAnn. genes Rev. Biochem. 59:837-906. Wallis G.A., Starman B.J., Schwartz M.F., Byers P.H. (1990a) Substitution of arginine for glycine at position 847 in the triple helical domain of the a l(I) chain of type I collagen produces lethal OI. Molecules that contain one or two abnormal chains differ in stability and secretionJ. Biol. Chem. 265:18628-18633. Wallis G.A., Starman B.J., Zinn A.B., Byers P.H. (1990b) Variable expression of OI in a nuclear family is explained by somatic mosaicism for a lethal point mutation in the a 1(1) gene (COL1A1) of type I collagen in a parentAm. J. Hum. Genet. 46:1034-1040. Wallis G.A., Starman B.J., Chessler S.D., Willing M.C., Byers P.H. (1990c) Mutations in the CB6 and carboxyl terminal regions of COL1 Al causing lethal OI have different effects on the stability and secretion of the type I collagen moleculeAnn. NY Acad. Sci. Abstr (In press). Weil D., Bernard M., Gargano S., Ramirez F. (1987) The proa2(V) collagen gene is evolutionarily related to the major fibrillar forming collagensNuc. Acids Res. 15:181- 198. 156 Weil D., Mattei M-G., Passage E., Van Cong N., Pribula-Conway D., Mann K., Deutzmann R., Timpl R., Chu M-L. (1988a) Cloning and chromosomal localisation of human genes encoding the three chains of type VI collagenAm. J. Hum. Genet. 42:435- 445. Weil D., Bernard M., Combates N., Wirtz M., Hollister D., Steinmann B., Ramirez F. (1988b) Identification of a mutation that causes exon skipping during collagen pre- mRNA splicing in an EDS variantJ. Biol. Chem. 263:8561-8564. Weil D., D'Alessio M., Ramirez F., de Wet W., Cole W., Chan D., Bateman J.F. (1989a) A base substitution in the exon of a collagen gene causes alternative splicing and generates a structurally abnormal polypeptide in a patient with EDS VEMBO II J. 8:1705-1710. Weil D., D'Alessio M., Ramirez F., Steinmann B., Wirtz M.K., Glanville W., Hollister D.W. (1989b) Temperature dependent expression of a collagen splicing defect in the fibroblasts of a patient with EDS VIIBJ. Biol. Chem. 264:16804-16809. Weil D., D'Alessio M., Ramirez F., Eyre D.R. (1990) Structural and functional characterisation of a splicing mutation in the proa2(I) collagen gene of an EDS VII patien t/.Biol. Chem. 265:16007-16011. Wenstrup R.J., Hunter A.G.W., Byers P.H. (1986a) OI type IV: Evidence of abnormal triple helical structure of type I collagenHum. Genet. 74:47-53. Wenstrup R.J., Tsipouras P., Byers P.H. (1986b) OI type IV: Biochemical confirmation of genetic linkage to the proa2(I) gene in type I collagenJ. Clin. Invest. 78:1449-1455. Wenstrup R.J., Cohn D.H., Cohen T., Byers P.H. (1988) Arginine for glycine substitution in the triple helical domain of the products of one a2(I) collagen allele (COL1A2) produces the OI type IV phenotypeJ. Biol. Chem. 263:7734-7740. Wenstrup R., Schrago-Howe A., Lever L., Phillips C. (1990a) Mutations in COL1A2 that result in non-lethal OI phenotypesAnn. NY Acad. Sci. Abstr (In press). 157 Wenstrup R.J., Shrago A.W., Phillips C.L., Byers P.H., Cohn D.H. (1990b) OI type IV: Analysis of mutations in a2(I) chains of type I collagen by oc2(I)-specific cDNA synthesis and polymerase chain reaction (PCR)Ann. NY. Acad. Sci. 580:546 Abstr. Westerhausen A., Kishi J., Prockop D.J. (1990a) Mutations that substitute serine for glycine al-598 and glycine al-631 in type I procollagenJ. Biol. Chem. 265:13995- 14000. Westerhausen A., Constantinou C.D., Prockop D.J. (1990b) A mutation that substitutes valine for glycine al-637 in a type I procollagen gene (COL1 Al) and causes lethal OI. Evidence for a co-operative block of microunfolding between amino acid positions 637 and 775 Am. J. Hum. Genet. 47:A242 Abstr. White T.J., Amheim N., Erlich H.A. (1989) The polymerase chain reaction (Review)TIG 5:185-189. Wilkinson A.J., Fersht A.R., Blow D.M., Carter P., Winter G. (1984) A large increase in enzyme-substrate affinity by protein engineeringNature (Lond) 307:187-188. Williams C.J., Prockop D.J. (1983) Synthesis and processing of a type I procollagen containing shortened proal(I) chains by fibroblasts from a patient withJ. Biol. OI Chem. 258:5915-5921. Williams E.M., Nicholls A.C., Daw S.C.M., Mitchell N., Levin L.S., Green B., Mackenzie J., Chudleigh P.A., Pope F.M. (1989) Phenotypical features of an Irish family with severe autosomal recessive Clin.OI Genet. 35:181-190. Willing M.C., Cohn D.H., Starman B.J., Holbrook K.A., Greenberg C.R., Byers P.H. (1988) Heterozygosity for a large deletion in the a2(I) collagen gene (COL1A2) has a dramatic effect on type I collagen secretion and produces perinatal lethalJ. OIBiol. Chem. 263:8398-8404. Willing M.C., Cohn D.H., Byers P.H. (1990) Frameshift mutation near the 3' end of the COL1 Al gene of type I collagen predicts an elongated proa 1(1) chain and results in OI type IJ. Clin. Invest. 85:282-290. 158 Wirtz M.K., Glanville R.W., Steinmann B., Rao V.H., Hollister D.W. (1987) EDS type VIIB. Deletion of 18 amino acids comprising the N-telopeptide region of a proa2(I) chain /. Biol. Chem. 262:16376-16385. Woodbury D., Benson-Chanda V., Ramirez F. (1989) Amino-terminal propeptide of human proa2(V) collagen conforms to the structural criteria of a fibrillar procollagen moleculeJ. Biol. Chem. 264:2735-2738. Yamada Y.V., Avvedimento E., Mudryj M., Ohkubo H., Vogeli G., Irani M., Pastan I., de Crombrugghe B. (1980) The collagen gene: Evidence for its evolutionary assembly by amplification of a DNA segment containing an exon of C54 ell bp 22:887-892. Yamaguchi N., Benya P.D., Van der Rest M., Ninomiya Y. (1989) The cloning and sequencing of al(VIII) collagen cDNAs demonstrate that type VIII collagen is a short chain collagen and contains triple helical and carboxyl terminal non-triple helical domains similar to those of type X collagenJ. Biol. Chem. 264:16022-16029. Young I.D., Thompson E.M., Hall C.M., Pembrey M.E. (1987) OI type IIA: Evidence for dominant inheritanceJ. Med. Genet. 24:386-389. Zhuang J., Constantinou C.D., Ganguly A., Prockop D.J. (1990a) A single base mutation in type I procollagen that converts glycine a 1-541 to aspartate in a lethal variant of OI. Detection of the mutation with carbodiimide reactionM atrix 10:252 Abstr. Zhuang J., Constantinou C.D., Prockop D.J. (1990b) Heterozygous defect that deletes the codons of exon 13 from the mRNA of the a2 chain of type I procollagen in a patient with mild OI M atrix 10:252 Abstr. 159 PUBLICATIONS Daw S.C.M., Nicholls A.C., Williams M., Sykes B., Pope F.M. (1988) Autosomal recessive OI. Excess post-translational modification of collagen not linked to either COL1A1 or COL1A2J. Med. Genet. 25:275 Abstr. Williams E.M., Nicholls A.C., Daw S.C.M., Mitchell N., Levin L.S., Green B., Mackenzie J., Chudleigh P.A., Pope F.M. (1989) Phenotypical features of an Irish family with severe autosomal recessive Clin.OI Genet. 35:181-190. Pope F.M., Daw S.C.M., Narcisi P., Richards A.J., Nicholls A.C. (1989) Prenatal diagnosis and prevention of inherited abnormalities of collagenJ. Inker. Metab. Dis. 12 Suppl. 1:135-173. Daw S.C.M., Gibbs D.A., Nicholls A.C., Hall E.C., Siggers D.C., Pope F.M. (1990) Lethal OI: A family with six affected sibs heterozygous for a type I collagen mutationJ. Med. Genet. 27:205-210 Abstr. 160 Appendices 161 APPENDIX 1 STOCK BUFFERS AND SOLUTIONS Protein Analysis 1.875 M Tris-Cl pH 8.8 1.5 Tris-Cl pH 6.8 Acrylamide 30 % Acrylamide (w/v) 0.8 % Bis (w/v) SDS 10 % SDS Urea 5 M Urea (prepared fresh) PAGE Sample buffer 0.15 M Tris-Cl 2 % SDS 0.5 M Urea 10 % Glycerol 0.1 % Bromophenol blue pH 6.8 162 DNA & RNA Analysis TE8 10 mM Tris-Cl ImMEDTA pH 8.0 TNE 10 mM Tris-Cl lOOmMNaCl 1 mMEDTA pH 8.0 10 x TBE 0.89 M Tris 0.89 M Boric acid 20 mM EDTA pH 8.0 50 x TAE 0.2 M Tris-acetate 10 mM EDTA pH 8.0 Denaturing 1.5 M NaCl 0.5 M NaOH Neutralising 3.0 M NaCl 0.5 M Tris-Cl pH 7.0 20 x SSC 3.0 M NaCl 0.3 M Sodium citrate pH 7.0 163 PBS 'A1 0.14 M NaCl 0.015 M KH2P04 0.03 M KC1 0.08 M Na2HPQ4 pH 7.4 100 x Denhardt's 2 % Ficoll (w/v) 2 % PVP (w/v) 2 % BSA (w/v) Filter sterilised and stored at -20°C G50 Buffer 50 mM Tris-Cl 150 mM NaCl 10 mM EDTA 0.1 % SDS (w/v) pH 7.5 DNA Prehyb. 10 x Denhardt's 3 x SSC 0.1 % SDS (w/v) Stored at -20°C DNA Hyb. DNA Prehyb. solution with 6 % PEG 8000 (w/v) 164 RNA Lysis buffer 0.14 M NaCl 1.5 mM MgCl2 10 mM Tris-Cl 0.5 % Nonidet-NP40 (v/v) pH 8.6 RNA Lysis buffer As above with 1% NP40 +Sucrose 24 % Sucrose (w/v) pH 8.6 2 xPK Buffer 0.2 M Tris-Cl 25 mM EDTA 0.3 M NaCl 2 % SDS (w/v) pH 7.5 Sucrose Lysis 0.32 M Sucrose (w/v) buffer 10 mM Tris-Cl 5 mM MgCl2 1 % Triton-TXlOO (v/v) pH 7.5 Glucose Lysis 50 mM Glucose buffer 10 mM EDTA 25 mM Tris-Cl pH 8.0 (5 mg/ml Lysozyme) 165 STET(L) 8 % Sucrose (w/v) 5 % Triton-TXlOO (v/v) 50 mM EDTA 50 mM Tris-Cl (0.5 mg/ml Lysozyme) pH 8.0 10 x Restriction Enzyme Buffers 0 100 mM Tris-Cl, pH 7.5 K1 100 mM Tris-Cl, pH 7.5 100 mM MgCl2 100 mM MgCl2 1 mg/ml Gelatin 1 mg/ml Gelatin 60 mMKCl N1 100 mM Tris-Cl, pH 7.5 K2 100 mM Tris-Cl, pH 7.5 100 mM MgCl2 100 mM MgCl2 1 mg/ml Gelatin 1 mg/ml Gelatin 60 mM NaCl 200 mM KC1 N2 100 mM Tris-Cl, pH 7.5 K3 100 mM Tris-Cl, pH 7.5 100 mM MgCl2 100 mM MgCl2 1 mg/ml Gelatin 1 mg/ml Gelatin 600 mM NaCl 660 mM KC1 N3 100 mM Tris-Cl, pH 7.5 100 mM MgCl2 1 mg/ml Gelatin 1.5 M NaCl 166 N4 1 MTris-Cl,pH7.5 50 mM MgCl2 1 mg/ml Gelatin 500 mM NaCl 2-mercaptoethanol to a final concentration of 6 mM was added as required, thus: A va IN2+, Bam HI N3+, Eco Rl N4-, H ind III N2-, H in t IN2+, M sp IK1+, Rsa IN2+, Sm a IK2+, Taq IN1+. 10 x CIP Buffer 0.5 M Tris-Cl 1 mM ZnCl2 10 mM MgCl2 10 mM Spermidine pH 9.0 10 x Ligation 0.5 M Tris-Cl buffer 0.1 M MgCl2 0.1MDTT 10 mM Spermidine 10 mM ATP 1 mg/ml BSA pH 7.4 Stored at -20°C 167 RF1 100 mM RbCl2 50 mM MnCl2 30 mM Potassium acetate 10 mM CaCl2 15 % Glycerol (w/v) Filter sterilised RF2 10 mM MOPS 10 mM RbCl2 75 mM CaCl2 15 % Glycerol (w/v) 10 x PCR Buffer 0.1 M Tris-Cl 0.5 M KC1 10-50 mM MgCl2 pH 8.4 dNTPs were added to 1 x PCR buffer at a final concentration of 400 pM from a 10 mM stock mix. 10 x RT Buffer 0.5 M Tris-Cl 0.5 M KC1 0.1 M MgCl2 10 mM EDTA 100 pg/ml BSA lOOmMDTT* 40 mM NaPi 10 mM dNTPs* pH 8.3 at 42°C * Added from separate stock solutions. 168 6 x Sequencing Gel Buffer (RNase free) 80 % Deionised formamide 50 mM TB ImM EDTA 0.1 % Xylene cyanol (w/v) 0.1% Bromophenol blue (w/v) Stored at -20°C Solutions for DNA work were autoclaved or filter sterilised before use, as appropriate. Solutions for RNA manipulations were treated with DEPC for at least 20 minutes and then autoclaved. Volatile solutions and buffers containing Tris were prepared with DEPC treated sterile distilled water. 169 APPENDIX 2 CULTURE MEDIA Human Skin Fibroblasts DMEM Flow medium was supplemented with 100 IU/ml Penicillin 100 Jig/ml Streptomycin 25 |ig/ml Ascorbate 2 mM Glutamine 8 % FCS Trypsin:versene 0.25 % Trypsin 0.2 % Versene BME and DMEM Flow medium was supplemented with (For Labelling) 100 IU/ml Penicillin 100 pg/ml Streptomycin 25 Jig/ml Ascorbate 0.01 M HEPES (made up in Hank's solution) 0.18 % Sodium bicarbonate 5% dialysed FCS 50 p.g/ml BAPN 170 E.coli LB 1 % Bacto-tryptone (w/v) 0.5 % Bacto-yeast extract (w/v) 0.5 % NaCl (w/v) pH 7.5 SOB 2 % Bacto-tryptone (w/v) 0.5 % Bacto-yeast extract (w/v) 10 mM NaCl 2.5 mM KC1 10 mM MgCl2 10mMMgSO4 pH 7.6 SOC SOB with 20 mM Glucose 2x YT 1.6 % Bacto-tryptone (w/v) 1 % Bacto-yeast extract (w/v) 0.5 % NaCl (w/v) pH 7.0 Agar media were prepared by the addition of 1.5 % (w/v) Bacto-agar to the appropriate broth and sterilised by autoclaving. 171