DOCSLIB.ORG

Supplementary Table 1: Histopathological Data for Samples Used in Study

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 1: Histopathological Data for Samples Used in Study Supplementary Table 1: Histopathological data for samples used in study Sample Type WHO Tumor Comments ID histology* stage** N1 Normal NA NA Biopsy Negative Control N2 Normal NA NA Biopsy Negative Control N3 Normal NA NA Biopsy Negative Control N4 Normal NA NA Biopsy Negative Control N5 Normal NA NA Adjacent pair of T18 N6 Normal NA NA Adjacent pair of T20 N7 Normal NA NA Adjacent pair of T7 N8 Normal NA NA Adjacent pair of T10 N9 Normal NA NA N10 Normal NA NA T1 Tumor IIB T1N1 T2 Tumor IIB T2N2 T3 Tumor IIA T3N2 T4 Tumor IIA T2N2 T5 Tumor IIB T2N1 T6 Tumor IIA T1N1 T7 Tumor IIA T1N1 T8 Tumor IIA T1N1 T9 Tumor IIB T1N0 T10 Tumor IIB T2N2 T11 Tumor IIB T1N1 T12 Tumor IIB T2N2 T13 Tumor IIA T2N1 T14 Tumor IIA T1N1 T15 Tumor IIA T1N0 T16 Tumor IIA T1N1 T17 Tumor IIA T1N1 T18 Tumor IIB T1N0 T19 Tumor IIB T1N1 T20 Tumor IIA T3N0 T21 Tumor IIB T2N1 T22 Tumor IIB T2N2 T23 Tumor IIA T2N2 T24 Tumor IIB T1N0 T25 Tumor IIA T2N1 T26 Tumor IIB T3N1 T27 Tumor IIA T1N1 T28 Tumor IIA T1N0 T29 Tumor IIB T1N0 T30 Tumor IIA T2N1 T31 Tumor IIB T3N2 * WHO Histology IIA: Non-Keratinizing Carcinoma and Moderately Differentiated Squamous cell carcinoma IIB: Undifferentiated Carcinoma, Poorly Differentiated Squamous cell carcinoma and Non-Keratinizing Carcinoma, Undifferentiated ** Tumor stage T1: Primary Tumor confined to nasopharynx T2: Tumor extends to nasal fossa, oropharynx, parapharynx, muscles/nerves below base of skull T3: Tumor extends to bone below base of skull, bone at base of skull, cranial nerve, orbit, infratemporal fossa, laryngopharynx N0: No regional lymph node metastasis N1: Metastasis to lymph nodes in upper neck N2: Metastasis to lymph nodes in mid neck NA: Not Applicable Supplementary Table 2: Primers and probes used for Quantitative Real Time PCR (5'→3') Gene Forward Reverse Probe β-actin TCACCCACACTGTGCCCATCTACGA TGAGGTAGTCAGTCAGGTCCCG ATGCCC TCCCCCATGCCATCCTGCGT BARTs GCC TGG CGG ACT TCA TTC T TCT CCT GTA ACC ACC TGG CG ACA GTC CCG AGA CCG GCT CCG BHRF1 GCA GGA CAT TGT GTT GTA ACC AG TAA TGT AGA CCA GCC GCC CT CTA CTC CTT ACT ATG TTG TGG ACC TGT CAG TTC GTG BZLF1 CCC AAG CCT GGA TGT TGA CT GAA GCA GGC GTG GTT TCA AT CAT TAT CCC CCG GAC ACC AGA TGT TTT ACA EBNA1 AGG ATG CGA TTA AGG ACC TTG TT CCA TCG TCA AAG CTG CAC AC TGA CAA AGC CCG CTC CTA CCT GCA ATA EBNA2 CGG CAA CCC CTA ACG TTT C GGG AAG AGA ATG GGA GCC TC CCA ATA CAT GAA CCG GAG TCC CAT AAT AGC C EBNA3A GTG GCA CTT GAG CGA CCA G TAA TGC CAG AAG TTT CCC CG TTA CCC CAA GCC AGT TCG TCC GG EBNA3B GGG CAC ATT CCA TAT CAG CC CTC TCG GTG GTG TCT GCA TG ACC AAC GGG TCC TGC TAC CAT GCT GT EBNA3C CAA GGT GCA TTT ACC CCA CTG GGG CAG GTC CGT GAG AAC T CAT TAA TGC CAC CAC GCC AAA AAG GC LMP1 TCC TCC TGT TTC TGG CGA TTT GGG AGT CAT CGT GGT GGT GT AAT CTG GAT GTA TTA CCA TGG ACA ACG ACA CA LMP2A CCG TCA CTC GGA CTA TCA AC TGA GAT GAG TCA TCC CGT GGA TCA TTC CCG TCG TGT TGC AAT CCC AAG TAC AG HLA -A,F CTG AGA TGG GAG CCG TCT TC AAC CAG GCC AGC AAT GAT G CAG CCC ACC ATC CCC ATC GTG Supplementary Table 3: Genes whose expression is upregulated in tumors Gene Symbol Fold Gene Title Chromosomal Affymetrix Change Location Probeset ID CXCL11 14.31 chemokine (C-X-C motif) ligand 11 4q21.2 211122_s_at CXCL11 13.31 chemokine (C-X-C motif) ligand 11 4q21.2 210163_at FN1 9.21 fibronectin 1 /// fibronectin 1 2q34 /// 2q34 211719_x_at PTGS2 8.69 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1q25.2-q25.3 204748_at FN1 7.61 fibronectin 1 2q34 212464_s_at CXCL10 7.56 chemokine (C-X-C motif) ligand 10 4q21 204533_at OSF-2 7.37 osteoblast specific factor 2 (fasciclin I-like) 13q13.3 210809_s_at --- 7.16 Homo sapiens mRNA; cDNA DKFZp686G12112 (from clone DKFZp686G12112) --- 227921_at LAMB1 6.53 laminin, beta 1 7q22 201505_at FN1 6.52 fibronectin 1 2q34 210495_x_at FLJ12505 6.34 hypothetical protein FLJ12505 1q32.3 235343_at FN1 6.25 fibronectin 1 2q34 216442_x_at --- 6.21 Homo sapiens clone 23688 mRNA sequence --- 213808_at --- 6.16 --- --- 1556499_s_at COL1A2 5.93 collagen, type I, alpha 2 7q22.1 202404_s_at --- 5.63 Homo sapiens cDNA FLJ11041 fis, clone PLACE1004405. --- 227140_at CHI3L1 5.55 chitinase 3-like 1 (cartilage glycoprotein-39) 1q32.1 209395_at CXCL9 5.48 chemokine (C-X-C motif) ligand 9 4q21 203915_at RAMP 5.37 RA-regulated nuclear matrix-associated protein --- 218585_s_at COL4A1 5.24 collagen, type IV, alpha 1 13q34 211980_at C6orf141 5.07 chromosome 6 open reading frame 141 6p12.3 1554314_at HOXC6 5.04 homeo box C6 12q13.3 206858_s_at PTGS2 4.95 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1q25.2-q25.3 1554997_a_at --- 4.93 Homo sapiens cDNA FLJ45482 fis, clone BRTHA2001953 --- 230312_at TNFAIP6 4.89 tumor necrosis factor, alpha-induced protein 6 2q24.1 206026_s_at --- 4.81 --- --- 211161_s_at GAD1 4.77 glutamate decarboxylase 1 (brain, 67kDa) 2q31 205278_at SULF1 4.73 sulfatase 1 8q13.2 212353_at DKFZp434C0631 4.70 hypothetical protein DKFZp434C0631 12p11.22 228245_s_at PIR51 4.69 RAD51-interacting protein 12p13.2-p13.1 204146_at NID 4.69 nidogen (enactin) 1q43 202007_at TOPK 4.66 T-LAK cell-originated protein kinase 8p21.2 219148_at TYMS 4.65 thymidylate synthetase 18p11.32 202589_at COL5A2 4.59 collagen, type V, alpha 2 2q14-q32 221729_at COL4A2 4.58 collagen, type IV, alpha 2 13q34 211964_at GZMB 4.53 granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) 14q11.2 210164_at CCNE2 4.52 cyclin E2 8q22.1 205034_at --- 4.51 Homo sapiens transcribed sequences --- 238852_at SYNPO2 4.45 synaptopodin 2 4q27 225895_at COL3A1 4.45 collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) 2q31 215076_s_at CCL2 4.39 chemokine (C-C motif) ligand 2 17q11.2-q21.1 216598_s_at PRO2000 4.22 PRO2000 protein 8q24.13 222740_at ANAPC7 4.19 anaphase-promoting complex subunit 7 12q13.12 204709_s_at CDCA1 4.17 cell division cycle associated 1 1q23.2 223381_at --- 4.10 Human full-length cDNA 5-PRIME end of clone CS0DK007YB08 of HeLa cells of H. sapiens --- 242881_x_at PMCH 4.09 pro-melanin-concentrating hormone 12q23-q24 227928_at MAD2L1 4.06 MAD2 mitotic arrest deficient-like 1 (yeast) 4q27 203362_s_at --- 4.01 Homo sapiens cDNA FLJ11381 fis, clone HEMBA1000501. --- 227350_at PMAIP1 3.95 phorbol-12-myristate-13-acetate-induced protein 1 18q21.32 204286_s_at HEC 3.91 highly expressed in cancer, rich in leucine heptad repeats 18p11.31 204162_at NPL 3.88 N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) 1q25 240440_at ZNF367 3.85 zinc finger protein 367 9q22 229551_x_at COL3A1 3.83 collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) 2q31 201852_x_at CENPF 3.82 centromere protein F, 350/400ka (mitosin) 1q32-q41 209172_s_at C20orf42 3.81 chromosome 20 open reading frame 42 20p12.3 60474_at LAMB1 3.79 laminin, beta 1 /// laminin, beta 1 7q22 /// 7q22 211651_s_at KIAA0186 3.76 KIAA0186 gene product 20p11.21 206102_at BUB1B 3.76 BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) 15q15 203755_at COL8A1 3.75 collagen, type VIII, alpha 1 3q12.3 226237_at TOP2A 3.75 topoisomerase (DNA) II alpha 170kDa 17q21-q22 201292_at C6orf141 3.73 chromosome 6 open reading frame 141 6p12.3 1552575_a_at C10orf3 3.73 chromosome 10 open reading frame 3 10q23.33 218542_at ANLN 3.70 anillin, actin binding protein (scraps homolog, Drosophila) 7p15-p14 222608_s_at BRIP1 3.63 BRCA1 interacting protein C-terminal helicase 1 17q22-q24 235609_at SPARC 3.61 secreted protein, acidic, cysteine-rich (osteonectin) 5q31.3-q32 200665_s_at ADAM23 3.59 a disintegrin and metalloproteinase domain 23 2q33 244463_at XTP1 3.56 HBxAg transactivated protein 1 5q12.1 226980_at ATP11C 3.55 ATPase, Class VI, type 11C Xq27.1 226785_at COL5A2 3.52 collagen, type V, alpha 2 2q14-q32 221730_at --- 3.50 Homo sapiens cDNA FLJ11397 fis, clone HEMBA1000622. --- 232797_at HCAP-G 3.50 chromosome condensation protein G 4p16-p15 218662_s_at --- 3.43 Homo sapiens transcribed sequences --- 236251_at KIAA0286 3.43 KIAA0286 protein 12q13.2 212621_at STAR 3.43 steroidogenic acute regulatory protein 8p11.2 204548_at KIAA0101 3.42 KIAA0101 gene product 15q22.1 202503_s_at CSPG2 3.41 chondroitin sulfate proteoglycan 2 (versican) 5q14.3 204619_s_at CALD1 3.40 caldesmon 1 7q33 212077_at PRO2000 3.39 PRO2000 protein 8q24.13 228401_at FLJ14813 3.38 hypothetical protein FLJ14813 10p12.1 228468_at KLIP1 3.38 KSHV latent nuclear antigen interacting protein 1 4q35.1 229305_at LOC147463 3.37 hypothetical protein LOC147463 18q11.2 238332_at KIF11 3.37 kinesin family member 11 10q24.1 204444_at NUSAP1 3.34 nucleolar and spindle associated protein 1 15q14 218039_at MCM8 3.32 MCM8 minichromosome maintenance deficient 8 (S. cerevisiae) 20p12.3 224320_s_at RRM2 3.31 ribonucleotide reductase M2 polypeptide 2p25-p24 201890_at HELLS 3.31 helicase, lymphoid-specific 10q24.2 242890_at CSPG2 3.29 chondroitin sulfate proteoglycan 2 (versican) 5q14.3 221731_x_at TRAG3 3.26 taxol resistance associated gene 3 Xq28 220445_s_at FZD7 3.25 frizzled homolog 7 (Drosophila) 2q33 203706_s_at NFE2L3 3.25 nuclear factor (erythroid-derived 2)-like 3 7p15-p14 204702_s_at FLJ11029 3.25 hypothetical protein FLJ11029 17q23.2 228273_at CALD1 3.24 caldesmon 1 7q33 201617_x_at CDC2 3.24 cell division cycle 2, G1 to S and G2 to M 10q21.1 203213_at KLIP1 3.24 KSHV latent nuclear antigen interacting protein 1 4q35.1 218883_s_at HELLS 3.21 helicase, lymphoid-specific 10q24.2 220085_at --- 3.20 Homo sapiens transcribed sequences --- 243299_at ADAM22 3.19 a disintegrin and metalloproteinase domain 22 7q21 213411_at PAPSS2 3.17 3'-phosphoadenosine
Load more

Recommended publications
  • ZNF354C Is a Transcriptional Repressor That Inhibits Endothelial Angiogenic Sprouting James A
    www.nature.com/scientificreports OPEN ZNF354C is a transcriptional repressor that inhibits endothelial angiogenic sprouting James A. Oo1,3, Barnabas Irmer1, Stefan Günther2, Timothy Warwick1, Katalin Pálf1, Judit Izquierdo Ponce1, Tom Teichmann1, Beatrice Pfüger‑Müller1,3, Ralf Gilsbach1,3, Ralf P. Brandes1,3 & Matthias S. Leisegang1,3* Zinc fnger proteins (ZNF) are a large group of transcription factors with diverse functions. We recently discovered that endothelial cells harbour a specifc mechanism to limit the action of ZNF354C, whose function in endothelial cells is unknown. Given that ZNF354C has so far only been studied in bone and tumour, its function was determined in endothelial cells. ZNF354C is expressed in vascular cells and localises to the nucleus and cytoplasm. Overexpression of ZNF354C in human endothelial cells results in a marked inhibition of endothelial sprouting. RNA‑sequencing of human microvascular endothelial cells with and without overexpression of ZNF354C revealed that the protein is a potent transcriptional repressor. ZNF354C contains an active KRAB domain which mediates this suppression as shown by mutagenesis analysis. ZNF354C interacts with dsDNA, TRIM28 and histones, as observed by proximity ligation and immunoprecipitation. Moreover, chromatin immunoprecipitation revealed that the ZNF binds to specifc endothelial‑relevant target‑gene promoters. ZNF354C suppresses these genes as shown by CRISPR/Cas knockout and RNAi. Inhibition of endothelial sprouting by ZNF354C is dependent on the amino acids DV and MLE of the KRAB domain. These results demonstrate that ZNF354C is a repressive transcription factor which acts through a KRAB domain to inhibit endothelial angiogenic sprouting. Te vascular system is controlled by numerous signaling pathways and growth factors which all contribute to the regulation of gene expression.
    [Show full text]
  • Trastuzumab Modulates the Protein Cargo of Extracellular Vesicles Released by ERBB2+ Breast Can‐ Cer Cells
    Supplementary Material: Trastuzumab Modulates the Protein Cargo of Extracellular Vesicles Released by ERBB2+ Breast Can‐ cer Cells Silvia Marconi, Sara Santamaria, Martina Bartolucci, Sara Stigliani, Cinzia Aiello, Maria Cristina Gagliani, Grazia Bellese, Andrea Petretto, Katia Cortese and Patrizio Castagnola Table S1. Antibodies used in the study. Antibody Catalog number Manufacturer Anti‐ALIX sc‐271975 Santa Cruz1 Anti‐CD9 PA5‐85955 Thermofisher Scientific2 Anti‐CD63 sc‐15363 Santa Cruz Anti‐ErbB2 (9G6) sc‐08 Santa Cruz Anti‐GAPDH 14C10 Cell signaling3 Anti‐HSP90 sc‐13119 Santa Cruz 1 Dallas, TX, USA; 2 Waltham, MA, USA; 3 Danvers, MA, USA. Table S2. Differentially regulated proteins by trastuzumab Tz treatment in extracellular vesicles EVs purified from SKBR‐ 3 cells with a statistically significant p‐value resulted from Studentʹs T‐test. The gene symbols coding for proteins downregulated by Tz (and hence upregulated in IgG treated cells) are highlighted in red while proteins upregulated by Tz are highlighted in blue. Official Gene Symbol 1 Gene product (Protein name) ACVR1B Activin A receptor type 1B ANO1 Anoctamin 1 ARFGEF2 ADP Ribosylation Factor Guanine Nucleotide Exchange Factor 2 BTN2A1 Butyrophilin subfamily 2 member A1 CIAPIN1 Cytokine Induced Apoptosis Inhibitor 1 CIT Citron Rho‐Interacting Serine/Threonine Kinase CPPED1 Calcineurin Like Phosphoesterase Domain Containing 1 DNAH7 Dynein Axonemal Heavy Chain 7 EIF3F Eukaryotic translation initiation factor 3 subunit F ESD Esterase D ESYT2 Extended Synaptotagmin 2 F2RL1 F2R Like Trypsin Receptor 1 RIPOR3 RIPOR Family Member 3 FZD6 Frizzled‐6 GAN Gigaxonin GTPBP2 GTP‐binding protein 2 GUCD1 Guanylyl Cyclase Domain Containing 1 HNRNPM Heterogeneous nuclear ribonucleoprotein M LMAN2 Lectin, Mannose Binding 2 LRRC8A Volume‐regulated anion channel subunit LRRC8A NOTCH4 Notch Receptor 4 NT5C2 5ʹ‐Nucleotidase, Cytosolic II PCID2 PCI domain‐containing 2 PDCD5 Programmed cell death 5 PHLDB3 Pleckstrin homology like domain family B member 3 PLAA Phospholipase A2 activating protein Membranes 2021, 11, 199.
    [Show full text]
  • Chr21 Protein-Protein Interactions: Enrichment in Products Involved in Intellectual Disabilities, Autism and Late Onset Alzheimer Disease
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.11.872606; this version posted December 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Chr21 protein-protein interactions: enrichment in products involved in intellectual disabilities, autism and Late Onset Alzheimer Disease Julia Viard1,2*, Yann Loe-Mie1*, Rachel Daudin1, Malik Khelfaoui1, Christine Plancon2, Anne Boland2, Francisco Tejedor3, Richard L. Huganir4, Eunjoon Kim5, Makoto Kinoshita6, Guofa Liu7, Volker Haucke8, Thomas Moncion9, Eugene Yu10, Valérie Hindie9, Henri Bléhaut11, Clotilde Mircher12, Yann Herault13,14,15,16,17, Jean-François Deleuze2, Jean- Christophe Rain9, Michel Simonneau1, 18, 19, 20** and Aude-Marie Lepagnol- Bestel1** 1 Centre Psychiatrie & Neurosciences, INSERM U894, 75014 Paris, France 2 Laboratoire de génomique fonctionnelle, CNG, CEA, Evry 3 Instituto de Neurociencias CSIC-UMH, Universidad Miguel Hernandez-Campus de San Juan 03550 San Juan (Alicante), Spain 4 Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205 USA 5 Center for Synaptic Brain Dysfunctions, Institute for Basic Science, Daejeon 34141, Republic of Korea 6 Department of Molecular Biology, Division of Biological Science, Nagoya University Graduate School of Science, Furo, Chikusa, Nagoya, Japan 7 Department of Biological Sciences, University of Toledo, Toledo, OH, 43606, USA 8 Leibniz Forschungsinstitut für Molekulare Pharmakologie
    [Show full text]
  • Plakins, a Versatile Family of Cytolinkers: Roles in Skin Integrity and in Human Diseases Jamal-Eddine Bouameur1,2, Bertrand Favre1 and Luca Borradori1
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REVIEW Plakins, a Versatile Family of Cytolinkers: Roles in Skin Integrity and in Human Diseases Jamal-Eddine Bouameur1,2, Bertrand Favre1 and Luca Borradori1 The plakin family consists of giant proteins involved in in (Roper et al., 2002; Jefferson et al., 2004; Sonnenberg and the cross-linking and organization of the cytoskeleton Liem, 2007; Boyer et al., 2010; Suozzi et al., 2012). and adhesion complexes. They further modulate sev- Mammalian plakins share a similar structural organization eral fundamental biological processes, such as cell and comprise seven members: bullous pemphigoid antigen 1 adhesion, migration, and polarization or signaling (BPAG1), desmoplakin, envoplakin, epiplakin, microtubule- pathways. Inherited and acquired defects of plakins actin cross-linking factor 1 (MACF1), periplakin, and plectin in humans and in animal models potentially lead to (Figure 1) (Choi et al., 2002; Jefferson et al., 2007; Choi and dramatic manifestations in the skin, striated muscles, Weis, 2011; Ortega et al., 2011). The existence of develop- and/or nervous system. These observations unequivo- mentally regulated and tissue-specific splice variants of some cally demonstrate the key role of plakins in the plakins further increases the diversity and versatility of these proteins (Table 1; Figure 1; Leung et al., 2001; Rezniczek et al., maintenance of tissue integrity. Here we review the 2003; Lin et al., 2005; Jefferson et al., 2006; Cabral et al., 2010). characteristics of the mammalian plakin members BPAG1 (bullous pemphigoid antigen 1), desmoplakin, PLAKINS IN THE EPIDERMIS plectin, envoplakin, epiplakin, MACF1 (microtubule- Epithelial BPAG1 (BPAG1e, also called BP230) constitutes the actin cross-linking factor 1), and periplakin, highlight- epithelium-specific isoform of BPAG1 and is localized in basal ing their role in skin homeostasis and diseases.
    [Show full text]
  • Lysophosphatidic Acid and Its Receptors: Pharmacology and Therapeutic Potential in Atherosclerosis and Vascular Disease
    JPT-107404; No of Pages 13 Pharmacology & Therapeutics xxx (2019) xxx Contents lists available at ScienceDirect Pharmacology & Therapeutics journal homepage: www.elsevier.com/locate/pharmthera Lysophosphatidic acid and its receptors: pharmacology and therapeutic potential in atherosclerosis and vascular disease Ying Zhou a, Peter J. Little a,b, Hang T. Ta a,c, Suowen Xu d, Danielle Kamato a,b,⁎ a School of Pharmacy, University of Queensland, Pharmacy Australia Centre of Excellence, Woolloongabba, QLD 4102, Australia b Department of Pharmacy, Xinhua College of Sun Yat-sen University, Tianhe District, Guangzhou 510520, China c Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, St Lucia, QLD 4072, Australia d Aab Cardiovascular Research Institute, Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642, USA article info abstract Available online xxxx Lysophosphatidic acid (LPA) is a collective name for a set of bioactive lipid species. Via six widely distributed G protein-coupled receptors (GPCRs), LPA elicits a plethora of biological responses, contributing to inflammation, Keywords: thrombosis and atherosclerosis. There have recently been considerable advances in GPCR signaling especially Lysophosphatidic acid recognition of the extended role for GPCR transactivation of tyrosine and serine/threonine kinase growth factor G-protein coupled receptors receptors. This review covers LPA signaling pathways in the light of new information. The use of transgenic and Atherosclerosis gene knockout animals, gene manipulated cells, pharmacological LPA receptor agonists and antagonists have Gproteins fi β-arrestins provided many insights into the biological signi cance of LPA and individual LPA receptors in the progression Transactivation of atherosclerosis and vascular diseases.
    [Show full text]
  • Neural Stem Cell-Derived Exosomes Revert HFD-Dependent Memory Impairment Via CREB-BDNF Signalling
    International Journal of Molecular Sciences Article Neural Stem Cell-Derived Exosomes Revert HFD-Dependent Memory Impairment via CREB-BDNF Signalling Matteo Spinelli 1, Francesca Natale 1,2, Marco Rinaudo 1, Lucia Leone 1,2, Daniele Mezzogori 1, Salvatore Fusco 1,2,* and Claudio Grassi 1,2 1 Department of Neuroscience, Università Cattolica del Sacro Cuore, 00168 Rome, Italy; [email protected] (M.S.); [email protected] (F.N.); [email protected] (M.R.); [email protected] (L.L.); [email protected] (D.M.); [email protected] (C.G.) 2 Fondazione Policlinico Universitario Agostino Gemelli IRCCS, 00168 Rome, Italy * Correspondence: [email protected] Received: 6 October 2020; Accepted: 25 November 2020; Published: 26 November 2020 Abstract: Overnutrition and metabolic disorders impair cognitive functions through molecular mechanisms still poorly understood. In mice fed with a high fat diet (HFD) we analysed the expression of synaptic plasticity-related genes and the activation of cAMP response element-binding protein (CREB)-brain-derived neurotrophic factor (BDNF)-tropomyosin receptor kinase B (TrkB) signalling. We found that a HFD inhibited both CREB phosphorylation and the expression of a set of CREB target genes in the hippocampus. The intranasal administration of neural stem cell (NSC)-derived exosomes (exo-NSC) epigenetically restored the transcription of Bdnf, nNOS, Sirt1, Egr3, and RelA genes by inducing the recruitment of CREB on their regulatory sequences. Finally, exo-NSC administration rescued both BDNF signalling and memory in HFD mice. Collectively, our findings highlight novel mechanisms underlying HFD-related memory impairment and provide evidence of the potential therapeutic effect of exo-NSC against metabolic disease-related cognitive decline.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Promiscuity and Specificity of Eukaryotic Glycosyltransferases
    Biochemical Society Transactions (2020) 48 891–900 https://doi.org/10.1042/BST20190651 Review Article Promiscuity and specificity of eukaryotic glycosyltransferases Ansuman Biswas and Mukund Thattai Simons Centre for the Study of Living Machines, National Centre for Biological Sciences, TIFR, Bangalore, India Correspondence: Mukund Thattai ([email protected]) Glycosyltransferases are a large family of enzymes responsible for covalently linking sugar monosaccharides to a variety of organic substrates. These enzymes drive the synthesis of complex oligosaccharides known as glycans, which play key roles in inter-cellular interac- tions across all the kingdoms of life; they also catalyze sugar attachment during the syn- thesis of small-molecule metabolites such as plant flavonoids. A given glycosyltransferase enzyme is typically responsible for attaching a specific donor monosaccharide, via a spe- cific glycosidic linkage, to a specific moiety on the acceptor substrate. However these enzymes are often promiscuous, able catalyze linkages between a variety of donors and acceptors. In this review we discuss distinct classes of glycosyltransferase promiscuity, each illustrated by enzymatic examples from small-molecule or glycan synthesis. We high- light the physical causes of promiscuity, and its biochemical consequences. Structural studies of glycosyltransferases involved in glycan synthesis show that they make specific contacts with ‘recognition motifs’ that are much smaller than the full oligosaccharide sub- strate. There is a wide range in the sizes of glycosyltransferase recognition motifs: highly promiscuous enzymes recognize monosaccharide or disaccharide motifs across multiple oligosaccharides, while highly specific enzymes recognize large, complex motifs found on few oligosaccharides. In eukaryotes, the localization of glycosyltransferases within compartments of the Golgi apparatus may play a role in mitigating the glycan variability caused by enzyme promiscuity.
    [Show full text]
  • 20P Deletions FTNW
    20p deletions rarechromo.org Deletions from chromosome 20p A chromosome 20p deletion is a rare genetic condition caused by the loss of material from one of the body’s 46 chromosomes. The material has been lost from the short arm (the top part in the diagram on the next page) of chromosome 20. Chromosomes are the structures in the nucleus of the body’s cells that carry the genetic information that controls development and function. In total every human individual normally has 46 chromosomes. Of these, two are a pair of sex chromosomes, XX (a pair of X chromosomes) in females and XY (one X chromosome and one Y chromosome) in males. The remaining 44 chromosomes are grouped in pairs. One chromosome from each pair is inherited from the mother while the other one is inherited from the father. Each chromosome has a short arm (called p) and a long arm (called q). Chromosome 20 is one of the smallest chromosomes in man. At present it is known to contain 737 genes out of the total of 20,000 to 25,000 genes in the human genome. You can’t see chromosomes with the naked eye, but if you stain them and magnify their image enough - about 850 times - you can see that each one has a distinctive pattern of light and dark bands. The diagram on the next page shows the bands of chromosome 20. These bands are numbered outwards starting from the point where the short and long arms meet (the centromere ). A low number, as in p11 in the short arm, is close to the centromere.
    [Show full text]
  • In Vitro Analysis of Mutations Causing Myoclonus Epilepsy with Ragged-Red Fibers in the Mitochondrial Trnalys Gene: Two Genotypes Produce Similar Phenotypes JUDY P
    MOLECULAR AND CELLULAR BIOLOGY, May 1995, p. 2872–2881 Vol. 15, No. 5 0270-7306/95/$04.0010 Copyright q 1995, American Society for Microbiology In Vitro Analysis of Mutations Causing Myoclonus Epilepsy with Ragged-Red Fibers in the Mitochondrial tRNALys Gene: Two Genotypes Produce Similar Phenotypes JUDY P. MASUCCI,1 MERCY DAVIDSON,2 YASUTOSHI KOGA,2† 1,2 2 ERIC A. SCHON, AND MICHAEL P. KING * Departments of Genetics and Development1 and Neurology,2 Columbia University, New York, New York 10032 Received 6 December 1994/Returned for modification 20 January 1995/Accepted 20 February 1995 Cytoplasts from patients with myoclonus epilepsy with ragged-red fibers harboring a pathogenic point mutation at either nucleotide 8344 or 8356 in the human mitochondrial tRNALys gene were fused with human cells lacking endogenous mitochondrial DNA (mtDNA). For each mutation, cytoplasmic hybrid (cybrid) cell lines containing 0 or 100% mutated mtDNAs were isolated and their genetic, biochemical, and morphological characteristics were examined. Both mutations resulted in the same biochemical and molecular genetic phenotypes. Specifically, cybrids containing 100% mutated mtDNAs, but not those containing the correspond- ing wild-type mtDNAs, exhibited severe defects in respiratory chain activity, in the rates of protein synthesis, and in the steady-state levels of mitochondrial translation products. In addition, aberrant mitochondrial translation products were detected with both mutations. No significant alterations were observed in the processing of polycistronic RNA precursor transcripts derived from the region containing the tRNALys gene. These results demonstrate that two different mtDNA mutations in tRNALys, both associated with the same mitochondrial disorder, result in fundamentally identical defects at the cellular level and strongly suggest that specific protein synthesis abnormalities contribute to the pathogenesis of myoclonus epilepsy with ragged-red fibers.
    [Show full text]