Supplementary Table 1: Histopathological data for samples used in study

Sample Type WHO Tumor Comments ID histology* stage**

N1 Normal NA NA Biopsy Negative Control N2 Normal NA NA Biopsy Negative Control N3 Normal NA NA Biopsy Negative Control N4 Normal NA NA Biopsy Negative Control N5 Normal NA NA Adjacent pair of T18 N6 Normal NA NA Adjacent pair of T20 N7 Normal NA NA Adjacent pair of T7 N8 Normal NA NA Adjacent pair of T10 N9 Normal NA NA N10 Normal NA NA T1 Tumor IIB T1N1 T2 Tumor IIB T2N2 T3 Tumor IIA T3N2 T4 Tumor IIA T2N2 T5 Tumor IIB T2N1 T6 Tumor IIA T1N1 T7 Tumor IIA T1N1 T8 Tumor IIA T1N1 T9 Tumor IIB T1N0 T10 Tumor IIB T2N2 T11 Tumor IIB T1N1 T12 Tumor IIB T2N2 T13 Tumor IIA T2N1 T14 Tumor IIA T1N1 T15 Tumor IIA T1N0 T16 Tumor IIA T1N1 T17 Tumor IIA T1N1 T18 Tumor IIB T1N0 T19 Tumor IIB T1N1 T20 Tumor IIA T3N0 T21 Tumor IIB T2N1 T22 Tumor IIB T2N2 T23 Tumor IIA T2N2 T24 Tumor IIB T1N0 T25 Tumor IIA T2N1 T26 Tumor IIB T3N1 T27 Tumor IIA T1N1 T28 Tumor IIA T1N0 T29 Tumor IIB T1N0 T30 Tumor IIA T2N1 T31 Tumor IIB T3N2

* WHO Histology IIA: Non-Keratinizing Carcinoma and Moderately Differentiated Squamous carcinoma IIB: Undifferentiated Carcinoma, Poorly Differentiated Squamous cell carcinoma and Non-Keratinizing Carcinoma, Undifferentiated

** Tumor stage T1: Primary Tumor confined to nasopharynx T2: Tumor extends to nasal fossa, oropharynx, parapharynx, muscles/nerves below base of skull T3: Tumor extends to bone below base of skull, bone at base of skull, cranial nerve, orbit, infratemporal fossa, laryngopharynx N0: No regional lymph node metastasis N1: Metastasis to lymph nodes in upper neck N2: Metastasis to lymph nodes in mid neck

NA: Not Applicable Supplementary Table 2: Primers and probes used for Quantitative Real Time PCR (5'→3')

Gene Forward Reverse Probe

β- TCACCCACACTGTGCCCATCTACGA TGAGGTAGTCAGTCAGGTCCCG ATGCCC TCCCCCATGCCATCCTGCGT BARTs GCC TGG CGG ACT TCA TTC T TCT CCT GTA ACC ACC TGG CG ACA GTC CCG AGA CCG GCT CCG BHRF1 GCA GGA CAT TGT GTT GTA ACC AG TAA TGT AGA CCA GCC GCC CT CTA CTC CTT ACT ATG TTG TGG ACC TGT CAG TTC GTG BZLF1 CCC AAG CCT GGA TGT TGA CT GAA GCA GGC GTG GTT TCA AT CAT TAT CCC CCG GAC ACC AGA TGT TTT ACA EBNA1 AGG ATG CGA TTA AGG ACC TTG TT CCA TCG TCA AAG CTG CAC AC TGA CAA AGC CCG CTC CTA CCT GCA ATA EBNA2 CGG CAA CCC CTA ACG TTT C GGG AAG AGA ATG GGA GCC TC CCA ATA CAT GAA CCG GAG TCC CAT AAT AGC C EBNA3A GTG GCA CTT GAG CGA CCA G TAA TGC CAG AAG TTT CCC CG TTA CCC CAA GCC AGT TCG TCC GG EBNA3B GGG CAC ATT CCA TAT CAG CC CTC TCG GTG GTG TCT GCA TG ACC AAC GGG TCC TGC TAC CAT GCT GT EBNA3C CAA GGT GCA TTT ACC CCA CTG GGG CAG GTC CGT GAG AAC T CAT TAA TGC CAC CAC GCC AAA AAG GC LMP1 TCC TCC TGT TTC TGG CGA TTT GGG AGT CAT CGT GGT GGT GT AAT CTG GAT GTA TTA CCA TGG ACA ACG ACA CA LMP2A CCG TCA CTC GGA CTA TCA AC TGA GAT GAG TCA TCC CGT GGA TCA TTC CCG TCG TGT TGC AAT CCC AAG TAC AG HLA -A,F CTG AGA TGG GAG CCG TCT TC AAC CAG GCC AGC AAT GAT G CAG CCC ACC ATC CCC ATC GTG Supplementary Table 3: whose expression is upregulated in tumors

Gene Symbol Fold Gene Title Chromosomal Affymetrix Change Location Probeset ID

CXCL11 14.31 chemokine (C-X-C motif) ligand 11 4q21.2 211122_s_at CXCL11 13.31 chemokine (C-X-C motif) ligand 11 4q21.2 210163_at FN1 9.21 fibronectin 1 /// fibronectin 1 2q34 /// 2q34 211719_x_at PTGS2 8.69 -endoperoxide synthase 2 (prostaglandin G/H synthase and ) 1q25.2-q25.3 204748_at FN1 7.61 fibronectin 1 2q34 212464_s_at CXCL10 7.56 chemokine (C-X-C motif) ligand 10 4q21 204533_at OSF-2 7.37 osteoblast specific factor 2 (fasciclin I-like) 13q13.3 210809_s_at --- 7.16 Homo sapiens mRNA; cDNA DKFZp686G12112 (from clone DKFZp686G12112) --- 227921_at LAMB1 6.53 laminin, beta 1 7q22 201505_at FN1 6.52 fibronectin 1 2q34 210495_x_at FLJ12505 6.34 hypothetical FLJ12505 1q32.3 235343_at FN1 6.25 fibronectin 1 2q34 216442_x_at --- 6.21 Homo sapiens clone 23688 mRNA sequence --- 213808_at --- 6.16 ------1556499_s_at COL1A2 5.93 collagen, type I, alpha 2 7q22.1 202404_s_at --- 5.63 Homo sapiens cDNA FLJ11041 fis, clone PLACE1004405. --- 227140_at CHI3L1 5.55 3-like 1 (cartilage glycoprotein-39) 1q32.1 209395_at CXCL9 5.48 chemokine (C-X-C motif) ligand 9 4q21 203915_at RAMP 5.37 RA-regulated nuclear matrix-associated protein --- 218585_s_at COL4A1 5.24 collagen, type IV, alpha 1 13q34 211980_at C6orf141 5.07 6 open reading frame 141 6p12.3 1554314_at HOXC6 5.04 homeo box C6 12q13.3 206858_s_at PTGS2 4.95 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1q25.2-q25.3 1554997_a_at --- 4.93 Homo sapiens cDNA FLJ45482 fis, clone BRTHA2001953 --- 230312_at TNFAIP6 4.89 , alpha-induced protein 6 2q24.1 206026_s_at --- 4.81 ------211161_s_at GAD1 4.77 glutamate decarboxylase 1 (brain, 67kDa) 2q31 205278_at SULF1 4.73 1 8q13.2 212353_at DKFZp434C0631 4.70 hypothetical protein DKFZp434C0631 12p11.22 228245_s_at PIR51 4.69 RAD51-interacting protein 12p13.2-p13.1 204146_at NID 4.69 nidogen (enactin) 1q43 202007_at TOPK 4.66 T-LAK cell-originated protein kinase 8p21.2 219148_at TYMS 4.65 thymidylate synthetase 18p11.32 202589_at COL5A2 4.59 collagen, type V, alpha 2 2q14-q32 221729_at COL4A2 4.58 collagen, type IV, alpha 2 13q34 211964_at GZMB 4.53 granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine 1) 14q11.2 210164_at CCNE2 4.52 cyclin E2 8q22.1 205034_at --- 4.51 Homo sapiens transcribed sequences --- 238852_at SYNPO2 4.45 synaptopodin 2 4q27 225895_at COL3A1 4.45 collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) 2q31 215076_s_at CCL2 4.39 chemokine (C-C motif) ligand 2 17q11.2-q21.1 216598_s_at PRO2000 4.22 PRO2000 protein 8q24.13 222740_at ANAPC7 4.19 anaphase-promoting complex subunit 7 12q13.12 204709_s_at CDCA1 4.17 cell division cycle associated 1 1q23.2 223381_at --- 4.10 full-length cDNA 5-PRIME end of clone CS0DK007YB08 of HeLa cells of H. sapiens --- 242881_x_at PMCH 4.09 pro-melanin-concentrating hormone 12q23-q24 227928_at MAD2L1 4.06 MAD2 mitotic arrest deficient-like 1 (yeast) 4q27 203362_s_at --- 4.01 Homo sapiens cDNA FLJ11381 fis, clone HEMBA1000501. --- 227350_at PMAIP1 3.95 phorbol-12-myristate-13-acetate-induced protein 1 18q21.32 204286_s_at HEC 3.91 highly expressed in cancer, rich in leucine heptad repeats 18p11.31 204162_at NPL 3.88 N-acetylneuraminate pyruvate (dihydrodipicolinate synthase) 1q25 240440_at ZNF367 3.85 finger protein 367 9q22 229551_x_at COL3A1 3.83 collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) 2q31 201852_x_at CENPF 3.82 protein F, 350/400ka (mitosin) 1q32-q41 209172_s_at C20orf42 3.81 open reading frame 42 20p12.3 60474_at LAMB1 3.79 laminin, beta 1 /// laminin, beta 1 7q22 /// 7q22 211651_s_at KIAA0186 3.76 KIAA0186 gene product 20p11.21 206102_at BUB1B 3.76 BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) 15q15 203755_at COL8A1 3.75 collagen, type VIII, alpha 1 3q12.3 226237_at TOP2A 3.75 topoisomerase (DNA) II alpha 170kDa 17q21-q22 201292_at C6orf141 3.73 open reading frame 141 6p12.3 1552575_a_at C10orf3 3.73 open reading frame 3 10q23.33 218542_at ANLN 3.70 anillin, actin binding protein (scraps homolog, Drosophila) 7p15-p14 222608_s_at BRIP1 3.63 BRCA1 interacting protein C-terminal 1 17q22-q24 235609_at SPARC 3.61 secreted protein, acidic, -rich () 5q31.3-q32 200665_s_at ADAM23 3.59 a disintegrin and metalloproteinase domain 23 2q33 244463_at XTP1 3.56 HBxAg transactivated protein 1 5q12.1 226980_at ATP11C 3.55 ATPase, Class VI, type 11C Xq27.1 226785_at COL5A2 3.52 collagen, type V, alpha 2 2q14-q32 221730_at --- 3.50 Homo sapiens cDNA FLJ11397 fis, clone HEMBA1000622. --- 232797_at HCAP-G 3.50 chromosome condensation protein G 4p16-p15 218662_s_at --- 3.43 Homo sapiens transcribed sequences --- 236251_at KIAA0286 3.43 KIAA0286 protein 12q13.2 212621_at STAR 3.43 steroidogenic acute regulatory protein 8p11.2 204548_at KIAA0101 3.42 KIAA0101 gene product 15q22.1 202503_s_at CSPG2 3.41 chondroitin sulfate proteoglycan 2 (versican) 5q14.3 204619_s_at CALD1 3.40 caldesmon 1 7q33 212077_at PRO2000 3.39 PRO2000 protein 8q24.13 228401_at FLJ14813 3.38 hypothetical protein FLJ14813 10p12.1 228468_at KLIP1 3.38 KSHV latent nuclear antigen interacting protein 1 4q35.1 229305_at LOC147463 3.37 hypothetical protein LOC147463 18q11.2 238332_at KIF11 3.37 family member 11 10q24.1 204444_at NUSAP1 3.34 nucleolar and spindle associated protein 1 15q14 218039_at MCM8 3.32 MCM8 minichromosome maintenance deficient 8 (S. cerevisiae) 20p12.3 224320_s_at RRM2 3.31 ribonucleotide reductase M2 polypeptide 2p25-p24 201890_at HELLS 3.31 helicase, lymphoid-specific 10q24.2 242890_at CSPG2 3.29 chondroitin sulfate proteoglycan 2 (versican) 5q14.3 221731_x_at TRAG3 3.26 taxol resistance associated gene 3 Xq28 220445_s_at FZD7 3.25 frizzled homolog 7 (Drosophila) 2q33 203706_s_at NFE2L3 3.25 nuclear factor (erythroid-derived 2)-like 3 7p15-p14 204702_s_at FLJ11029 3.25 hypothetical protein FLJ11029 17q23.2 228273_at CALD1 3.24 caldesmon 1 7q33 201617_x_at CDC2 3.24 cell division cycle 2, G1 to S and G2 to M 10q21.1 203213_at KLIP1 3.24 KSHV latent nuclear antigen interacting protein 1 4q35.1 218883_s_at HELLS 3.21 helicase, lymphoid-specific 10q24.2 220085_at --- 3.20 Homo sapiens transcribed sequences --- 243299_at ADAM22 3.19 a disintegrin and metalloproteinase domain 22 7q21 213411_at PAPSS2 3.17 3'-phosphoadenosine 5'-phosphosulfate synthase 2 10q23-q24 203060_s_at HCAP-G 3.15 chromosome condensation protein G 4p16-p15 218663_at IQGAP3 3.14 IQ motif containing GTPase activating protein 3 1q23.1 229490_s_at C20orf42 3.13 chromosome 20 open reading frame 42 20p12.3 218796_at ANGPT2 3.12 angiopoietin 2 8p23.1 205572_at MOX2 3.11 antigen identified by monoclonal antibody MRC OX-2 3q12-q13 209583_s_at NEDD1 3.11 neural precursor cell expressed, developmentally down-regulated 1 12q23.1 234984_at LOC157570 3.10 hypothetical protein LOC157570 8p21.1 235178_x_at FMNL2 3.09 formin-like 2 2q24.1 226184_at PAPSS2 3.07 3'-phosphoadenosine 5'-phosphosulfate synthase 2 10q23-q24 203058_s_at RCN1 3.07 reticulocalbin 1, EF-hand calcium binding domain 11p13 201063_at GMNN 3.07 geminin, DNA replication inhibitor 6p22.1 218350_s_at NEDD1 3.06 neural precursor cell expressed, developmentally down-regulated 1 12q23.1 1552417_a_at COL27A1 3.06 collagen, type XXVII, alpha 1 9q33.1 225288_at ECT2 3.05 epithelial cell transforming sequence 2 oncogene 3q26.1-q26.2 219787_s_at TMPO 3.03 thymopoietin 12q22 203432_at SLC39A14 3.03 solute carrier family 39 (zinc transporter), member 14 8p21.2 212110_at --- 3.02 Homo sapiens cDNA clone IMAGE:5294683, partial cds --- 1558714_at SOCS1 3.02 suppressor of signaling 1 16p13.13 210001_s_at PRC1 3.01 protein regulator of cytokinesis 1 15q26.1 218009_s_at GALNT11 3.01 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 7q34-q36 219013_at (GalNAc-T11) PLA2G7 3.00 A2, group VII (platelet-activating factor acetylhydrolase, plasma) 6p21.2-p12 206214_at FIGNL1 2.98 fidgetin-like 1 7p12.2 222843_at FBN1 2.98 1 (Marfan syndrome) 15q21.1 202766_s_at MELK 2.97 maternal embryonic kinase 9p13.1 204825_at GJA1 2.97 gap junction protein, alpha 1, 43kDa (connexin 43) 6q21-q23.2 201667_at PLAU 2.97 plasminogen activator, urokinase 10q24 205479_s_at FANCL 2.96 Fanconi anemia, complementation group L 2p16.1 227854_at GLS 2.96 glutaminase 2q32-q34 221510_s_at --- 2.95 Homo sapiens transcribed sequences --- 229242_at NEDD1 2.94 neural precursor cell expressed, developmentally down-regulated 1 12q23.1 1560116_a_at DNA2L 2.93 DNA2 DNA replication helicase 2-like (yeast) 10q21.3-q22.1 213647_at CSPG2 2.92 chondroitin sulfate proteoglycan 2 (versican) 5q14.3 204620_s_at COL15A1 2.92 collagen, type XV, alpha 1 9q21-q22 203477_at --- 2.91 Homo sapiens cDNA FLJ12909 fis, clone NT2RP2004400. --- 230650_at PRKDC 2.91 protein kinase, DNA-activated, catalytic polypeptide 8q11 208694_at HSXIAPAF1 2.91 XIAP associated factor-1 17p13.2 228617_at FLJ10493 2.90 hypothetical protein FLJ10493 9q31.3 218772_x_at --- 2.88 Homo sapiens cDNA clone IMAGE:6272440, partial cds --- 227099_s_at CRLF3 2.87 cytokine -like factor 3 17q11.2 235803_at KNSL7 2.87 kinesin-like 7 3p21.32 219306_at ZWINT 2.87 ZW10 interactor 10q21-q22 204026_s_at B4GALT6 2.86 UDP-Gal:betaGlcNAc beta 1,4- , polypeptide 6 18q11 235333_at GATA6 2.86 GATA binding protein 6 18q11.1-q11.2 210002_at SYNPO2 2.86 synaptopodin 2 4q27 225720_at CENPF 2.85 centromere protein F, 350/400ka (mitosin) 1q32-q41 207828_s_at RACGAP1 2.85 Rac GTPase activating protein 1 12q13.12 222077_s_at ARHGAP8 2.82 Rho GTPase activating protein 8 22q13.31 205980_s_at CHI3L1 2.81 chitinase 3-like 1 (cartilage glycoprotein-39) 1q32.1 209396_s_at MGC5528 2.81 defective in sister cohesion homolog 1 (S. cerevisiae) 8q24.12 219000_s_at CALD1 2.80 caldesmon 1 7q33 201616_s_at GNLY 2.80 granulysin 2p12-q11 37145_at FLJ12747 2.78 novel C3HC4 type (ring finger) 22q12.1 226360_at GLS 2.78 glutaminase 2q32-q34 223079_s_at FKSG14 2.78 leucine zipper protein FKSG14 5p15.2-q12.3 222848_at SOX4 2.77 SRY (sex determining region Y)-box 4 6p22.3 201417_at KCNMA1 2.77 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 10q22-q23 221584_s_at APOC1 2.76 C-I 19q13.2 204416_x_at GOLGA1 2.76 golgi autoantigen, golgin subfamily a, 1 9q34.11 228174_at TM7SF3 2.76 transmembrane 7 superfamily member 3 12q11-q12 226478_at EZH2 2.74 enhancer of zeste homolog 2 (Drosophila) 7q35-q36 203358_s_at FLJ12377 2.72 hypothetical protein FLJ12377 2q33.1 220576_at LOC339324 2.71 hypothetical protein LOC339324 19q13.13 1558700_s_at VRK2 2.70 vaccinia related kinase 2 2p16-p15 205126_at ACTA2 2.70 actin, alpha 2, smooth muscle, aorta 10q23.3 200974_at FCGR3A 2.70 Fc fragment of IgG, low affinity IIIa, receptor for (CD16) 1q23 204007_at NDE1 2.69 nudE nuclear distribution gene E homolog 1 (A. nidulans) 16p13.11 227249_at TTK 2.69 TTK protein kinase 6q13-q21 204822_at LOC146909 2.69 hypothetical protein LOC146909 17q21.31 222039_at PCNA 2.68 proliferating cell nuclear antigen 20pter-p12 201202_at MDA5 2.67 melanoma differentiation associated protein-5 2p24.3-q24.3 219209_at SDCCAG8 2.67 serologically defined colon cancer antigen 8 1q43-q44 212607_at PRO2000 2.65 PRO2000 protein 8q24.13 218782_s_at --- 2.65 Homo sapiens, clone IMAGE:5285034, mRNA 20q13.13 229899_s_at --- 2.64 Homo sapiens transcribed sequences --- 240558_at MGC33864 2.63 ADP-ribosylation-like factor 6-interacting protein 6 2q24.1 225707_at EIF5A2 2.63 eukaryotic translation initiation factor 5A2 3q26.2 235296_at DLG7 2.62 discs, large homolog 7 (Drosophila) 14q22.2 203764_at CDCA7 2.62 cell division cycle associated 7 /// cell division cycle associated 7 2q31 /// 2q31 224428_s_at TFRC 2.61 transferrin receptor (p90, CD71) 3q26.2-qter 207332_s_at KIAA1913 2.60 KIAA1913 6q23.1 234994_at CHN1 2.59 chimerin (chimaerin) 1 2q31-q32.1 212624_s_at FUSIP1 2.59 FUS interacting protein (serine-arginine rich) 1 1p36.11 225348_at ARHGAP8 2.59 Rho GTPase activating protein 8 22q13.31 37117_at LOC255743 2.58 hypothetical protein LOC255743 4q25 225911_at ASK 2.57 activator of S phase kinase 7q21.3 204244_s_at POLG 2.57 polymerase (DNA directed), gamma 15q25 213007_at SMC4L1 2.56 SMC4 structural maintenance of 4-like 1 (yeast) 3q26.1 201663_s_at CHEK1 2.56 CHK1 checkpoint homolog (S. pombe) 11q24-q24 205394_at --- 2.55 Homo sapiens cDNA FLJ39602 fis, clone SKNSH2005061. --- 1558105_a_at UHRF1 2.55 ubiquitin-like, containing PHD and RING finger domains, 1 19p13.3 225655_at GZMA 2.52 granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) 5q11-q12 205488_at HDGFRP3 2.52 hepatoma-derived growth factor, related protein 3 15q11.2 209524_at MGC22805 2.51 hypothetical protein MGC22805 10q23.31-q23.32 238439_at NFE2L3 2.50 nuclear factor (erythroid-derived 2)-like 3 7p15-p14 236471_at DOCK4 2.48 dedicator of cytokinesis 4 7q31.1 205003_at PMSCL1 2.48 polymyositis/scleroderma autoantigen 1, 75kDa 4q27 213226_at C12orf5 2.47 open reading frame 5 12p13.3 219099_at --- 2.47 Homo sapiens cDNA: FLJ21592 fis, clone COL07036 --- 226534_at --- 2.46 Homo sapiens, clone IMAGE:4798349, mRNA --- 231576_at HELLS 2.44 helicase, lymphoid-specific 10q24.2 223556_at 2.44 RAN, member RAS oncogene family 6p21 200749_at MDS010 2.44 x 010 protein 3q13.33 222681_at MCM4 2.43 MCM4 minichromosome maintenance deficient 4 (S. cerevisiae) 8q11.2 222036_s_at SMC4L1 2.42 SMC4 structural maintenance of chromosomes 4-like 1 (yeast) 3q26.1 201664_at --- 2.42 Homo sapiens cDNA FLJ40697 fis, clone THYMU2025406 --- 235203_at GNLY 2.40 granulysin 2p12-q11 205495_s_at TM7SF1 2.40 transmembrane 7 superfamily member 1 (upregulated in ) 1q42-q43 231944_at TFRC 2.40 transferrin receptor (p90, CD71) 3q26.2-qter 208691_at IDH1 2.40 1 (NADP+), soluble 2q33.3 1555037_a_at SYNPO2 2.39 synaptopodin 2 4q27 225721_at VEZATIN 2.38 vezatin 12q23.1 223089_at --- 2.38 Homo sapiens mRNA; cDNA DKFZp686H2244 (from clone DKFZp686H2244) --- 232174_at RBBP8 2.37 retinoblastoma binding protein 8 18q11.2 203344_s_at FLJ10493 2.37 hypothetical protein FLJ10493 9q31.3 222735_at FZD7 2.35 frizzled homolog 7 (Drosophila) 2q33 203705_s_at ZBED3 2.35 zinc finger, BED domain containing 3 5q14.1 235109_at TWSG1 2.35 twisted gastrulation homolog 1 (Drosophila) 18p11.3 225406_at --- 2.34 Homo sapiens transcribed sequences --- 241769_at --- 2.34 Homo sapiens transcribed sequences --- 236752_at PDCD1LG1 2.33 programmed cell death 1 ligand 1 9p24 227458_at FLJ11752 2.33 hypothetical protein FLJ11752 1q23.3 226337_at IL15 2.33 interleukin 15 4q31 205992_s_at FCGR1A 2.32 Fc fragment of IgG, high affinity Ia, receptor for (CD64) 1q21.2-q21.3 214511_x_at DKFZP434D193 2.32 DKFZP434D193 protein 2q24.1 226503_at --- 2.31 Homo sapiens cDNA FLJ33420 fis, clone BRACE2020028. --- 228191_at SDCCAG8 2.31 serologically defined colon cancer antigen 8 1q43-q44 212609_s_at TM7SF3 2.31 transmembrane 7 superfamily member 3 12q11-q12 217974_at MANEA 2.31 , endo-alpha 6q16.2 222805_at COL1A1 2.31 collagen, type I, alpha 1 17q21.3-q22.1 202310_s_at COL5A1 2.31 collagen, type V, alpha 1 9q34.2-q34.3 212489_at KPNB3 2.30 karyopherin (importin) beta 3 13q32.2 211953_s_at AF15Q14 2.30 AF15q14 protein 15q14 228323_at KIAA0635 2.30 KIAA0635 gene product 4q12 206003_at --- 2.29 Homo sapiens mRNA; cDNA DKFZp686F12218 (from clone DKFZp686F12218) --- 226311_at RFC3 2.28 replication factor C (activator 1) 3, 38kDa 13q12.3-q13 204127_at KLHL5 2.28 kelch-like 5 (Drosophila) 4p14 232297_at COL1A2 2.27 collagen, type I, alpha 2 7q22.1 202403_s_at ARNT2 2.27 aryl-hydrocarbon receptor nuclear translocator 2 15q24 202986_at --- 2.27 ------217371_s_at CENPE 2.27 , 312kDa 4q24-q25 205046_at GZMH 2.27 granzyme H (cathepsin G-like 2, protein h-CCPX) 14q11.2 210321_at TFEC 2.27 EC 7q31.2 206715_at SPARC 2.26 secreted protein, acidic, cysteine-rich (osteonectin) 5q31.3-q32 212667_at SULF1 2.26 sulfatase 1 8q13.2 212354_at CKAP4 2.25 -associated protein 4 12q24.11 200998_s_at CDC7 2.25 CDC7 cell division cycle 7 (S. cerevisiae) 1p22 204510_at DKFZP434D193 2.25 DKFZP434D193 protein 2q24.1 214700_x_at LOC339324 2.25 hypothetical protein LOC339324 19q13.13 228920_at FLJ21901 2.25 hypothetical protein FLJ21901 2q31 219002_at ID2 2.25 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 2p25 201566_x_at GBP1 2.24 guanylate binding protein 1, interferon-inducible, 67kDa 1p22.2 202270_at IFNG 2.24 interferon, gamma /// interferon, gamma 12q14 /// 12q14 210354_at CCT6A 2.24 chaperonin containing TCP1, subunit 6A (zeta 1) 7p11.2 201326_at FLJ20060 2.23 hypothetical protein FLJ20060 9p22.1 218602_s_at ZNF84 2.23 zinc finger protein 84 (HPF2) 12q24.33 204453_at FLJ10539 2.23 hypothetical protein FLJ10539 3p14.2 213194_at ARL6IP2 2.23 ADP-ribosylation-like factor 6 interacting protein 2 2p22.3 235848_x_at TNFRSF6 2.23 tumor necrosis factor receptor superfamily, member 6 10q24.1 215719_x_at CTSC 2.22 cathepsin C 11q14.1-q14.3 225646_at SSX2IP 2.22 synovial sarcoma, X breakpoint 2 interacting protein --- 203017_s_at ID2 2.22 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 2p25 201565_s_at QDPR 2.22 quinoid dihydropteridine reductase 4p15.31 209123_at BST2 2.20 bone marrow stromal cell antigen 2 19p13.2 201641_at HDGFRP3 2.20 hepatoma-derived growth factor, related protein 3 15q11.2 216693_x_at NUPL1 2.20 nucleoporin like 1 13q12.13 225047_at CDH11 2.19 cadherin 11, type 2, OB-cadherin (osteoblast) 16q22.1 207173_x_at CTSC 2.18 cathepsin C 11q14.1-q14.3 225647_s_at ARL6IP2 2.18 ADP-ribosylation-like factor 6 interacting protein 2 2p22.3 222700_at ITGAV 2.18 integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) 2q31-q32 202351_at --- 2.18 Homo sapiens, Similar to diaphanous homolog 3 (Drosophila), clone IMAGE:5277415, mRNA 13q21.1 229097_at --- 2.17 Homo sapiens cDNA FLJ39602 fis, clone SKNSH2005061. --- 226550_at SR140 2.16 U2-associated SR140 protein 3q23 212060_at FGF2 2.16 2 (basic) 4q26-q27 204422_s_at FLJ20035 2.16 hypothetical protein FLJ20035 4q32.3 218986_s_at --- 2.15 Homo sapiens cDNA clone MGC:24034 IMAGE:4281701, complete cds --- 1553979_at --- 2.15 Homo sapiens transcribed sequence with weak similarity to protein sp:P39195 (H.sapiens) --- 244778_x_at ALU8_HUMAN Alu subfamily SX sequence contamination warning entry HDGFRP3 2.14 hepatoma-derived growth factor, related protein 3 15q11.2 209526_s_at FLJ10719 2.13 hypothetical protein FLJ10719 15q25-q26 213008_at --- 2.13 Homo sapiens cDNA FLJ43391 fis, clone OCBBF2007478 --- 241410_at MINPP1 2.12 multiple inositol polyphosphate , 1 10q23 209585_s_at ZNF131 2.12 zinc finger protein 131 (clone pHZ-10) 5p12-p11 214741_at HSPC049 2.11 HSPC049 protein 7q33 222799_at RCN2 2.11 reticulocalbin 2, EF-hand calcium binding domain 15q23 201486_at --- 2.11 Homo sapiens transcribed sequences --- 242273_at IDH1 2.11 isocitrate dehydrogenase 1 (NADP+), soluble 2q33.3 201193_at ADH5 2.11 alcohol dehydrogenase 5 (class III), chi polypeptide 4q21-q25 208848_at FLJ21924 2.10 hypothetical protein FLJ21924 11p13 226265_at FCGR2A 2.10 Fc fragment of IgG, low affinity IIa, receptor for (CD32) 1q23 203561_at SCML1 2.08 sex comb on midleg-like 1 (Drosophila) Xp22.2-p22.1 218793_s_at --- 2.08 Homo sapiens transcribed sequences --- 242759_at TTF2 2.08 transcription termination factor, RNA polymerase II 1p22 204407_at LAMC1 2.06 laminin, gamma 1 (formerly LAMB2) 1q31 200771_at CASK 2.06 calcium/-dependent serine protein kinase (MAGUK family) Xp11.4 211208_s_at TIA1 2.06 TIA1 cytotoxic granule-associated RNA binding protein 2p13 201448_at ZNF195 2.05 zinc finger protein 195 11p15.5 204234_s_at 2.05 transcription factor 3 6p22 203693_s_at FLJ10407 2.05 hypothetical protein FLJ10407 1p32.3 234672_s_at KIAA0974 2.04 KIAA0974 mRNA 10q22.2 213092_x_at UNG 2.03 uracil-DNA 12q23-q24.1 202330_s_at DOCK7 2.03 dedicator of cytokinesis 7 1p32.1 225384_at SMC1L1 2.02 SMC1 structural maintenance of chromosomes 1-like 1 (yeast) Xp11.22-p11.21 201589_at --- 2.02 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_055301.1 --- 243252_at (H.sapiens) neuronal thread protein [Homo sapiens] --- 2.01 Homo sapiens transcribed sequences --- 242673_at FKBP5 2.01 FK506 binding protein 5 6p21.3-21.2 224840_at CD14 2.00 CD14 antigen 5q22-q32 201743_at CBX3 2.00 chromobox homolog 3 (HP1 gamma homolog, Drosophila) 7p15.2 230998_at RBMX 2.00 RNA binding motif protein, X-linked Xq26 225310_at FLJ31051 1.99 hypothetical protein FLJ31051 12q23.1 236249_at IGSF6 1.99 immunoglobulin superfamily, member 6 16p12-p13 206420_at VEZATIN 1.99 transmembrane protein vezatin 12q23.1 223675_s_at VANGL2 1.98 vang-like 2 (van gogh, Drosophila) 1q22-q23 226029_at NAP1L1 1.98 assembly protein 1-like 1 12q21.1 208753_s_at FLJ11259 1.97 hypothetical protein FLJ11259 12q23.3 218627_at INPP4A 1.96 inositol polyphosphate-4-phosphatase, type I, 107kDa 2q11.2 204552_at TNFRSF10B 1.96 tumor necrosis factor receptor superfamily, member 10b 8p22-p21 209295_at HIVEP1 1.95 human immunodeficiency virus type I enhancer binding protein 1 6p24-p22.3 204512_at LOC157697 1.95 hypothetical protein LOC157697 8p23.3 227017_at --- 1.94 Homo sapiens cDNA FLJ31089 fis, clone IMR321000092. --- 227077_at --- 1.94 Homo sapiens, clone IMAGE:5736845, mRNA --- 238807_at INPP4A 1.94 inositol polyphosphate-4-phosphatase, type I, 107kDa 2q11.2 227087_at LOC92906 1.93 hypothetical protein BC008217 2p22.3 225385_s_at SR140 1.93 U2-associated SR140 protein 3q23 212058_at CTL1 1.92 choline transporter-like protein 1 9q31.2 224595_at MPHOSPH9 1.92 M-phase phosphoprotein 9 12q24.31 206205_at POLE2 1.91 polymerase (DNA directed), epsilon 2 (p59 subunit) 14q21-q22 205909_at MCFP 1.91 mitochondrial carrier family protein 7q21.13 227012_at EFNB2 1.91 ephrin-B2 13q33 202668_at WDHD1 1.90 WD repeat and HMG-box DNA binding protein 1 14q22.2 216228_s_at CLASP1 1.90 cytoplasmic linker associated protein 1 2q14.2-q14.3 212752_at DLEU2 1.89 deleted in lymphocytic leukemia, 2 13q14.3 1556821_x_at CGI-77 1.89 CGI-77 protein 8q21.3 222825_at SOCS2 1.88 suppressor of cytokine signaling 2 12q 203373_at --- 1.87 Homo sapiens full length insert cDNA clone YQ50C11 --- 1560869_a_at ZNF92 1.86 zinc finger protein 92 (HTF12) 7q11.21 235170_at SFXN1 1.85 sideroflexin 1 --- 230069_at NFYB 1.85 nuclear transcription factor Y, beta 12q22-q23 218128_at MTR 1.84 5-methyltetrahydrofolate-homocysteine methyltransferase 1q43 203774_at MN7 1.84 D15F37 () 15q11-q13 217317_s_at CENPJ 1.84 centromere protein J 13q12.13 223513_at --- 1.84 Homo sapiens mRNA; cDNA DKFZp686E16168 (from clone DKFZp686E16168) --- 1558250_s_at VEZATIN 1.84 transmembrane protein vezatin 12q23.1 223090_x_at TRIPIN 1.83 tripin 2q33.2 230165_at --- 1.83 Homo sapiens mRNA; cDNA DKFZp547N074 (from clone DKFZp547N074) --- 215062_at ZNF267 1.83 zinc finger protein 267 16p11.2 219540_at CCNF 1.83 cyclin F 16p13.3 204826_at --- 1.83 Homo sapiens mRNA; cDNA DKFZp434G0972 (from clone DKFZp434G0972) --- 226797_at PMS1 1.82 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2q31-q33 213677_s_at M11S1 1.82 membrane component, , surface marker 1 11p13 225340_s_at DPYSL2 1.82 dihydropyrimidinase-like 2 8p22-p21 200762_at ARTS-1 1.81 type 1 tumor necrosis factor receptor shedding aminopeptidase regulator 5q15 209788_s_at ACY1L2 1.81 aminoacylase 1-like 2 6q16.1 225421_at RASSF4 1.80 Ras association (RalGDS/AF-6) domain family 4 10q11.21 226436_at TDG 1.80 thymine-DNA glycosylase 12q24.1 203743_s_at --- 1.80 Homo sapiens cDNA FLJ33237 fis, clone ASTRO2002632, weakly similar to NAM7 PROTEIN. --- 228859_at 3'HEXO 1.79 3' 8p23.1 226416_at M96 1.79 likely ortholog of mouse metal response element binding transcription factor 2 1p22.1 203347_s_at TNFRSF6 1.79 tumor necrosis factor receptor superfamily, member 6 10q24.1 204780_s_at NFKBIA 1.79 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 14q13 201502_s_at XPO1 1.78 exportin 1 (CRM1 homolog, yeast) 2p16 235927_at GART 1.78 phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, 21q22.1 230097_at phosphoribosylaminoimidazole synthetase TMPO 1.78 thymopoietin 12q22 224944_at DUT 1.77 dUTP 15q15-q21.1 208956_x_at --- 1.77 ------AFFX-HUMISGF3A/ M97935_3_at TNFRSF6 1.77 tumor necrosis factor receptor superfamily, member 6 10q24.1 204781_s_at RRM1 1.76 ribonucleotide reductase M1 polypeptide 11p15.5 201477_s_at NBS1 1.76 Nijmegen breakage syndrome 1 () 8q21 202906_s_at RBBP9 1.76 retinoblastoma binding protein 9 20p11.2 226696_at --- 1.76 Homo sapiens transcribed sequences --- 237246_at RBM9 1.74 RNA binding motif protein 9 22q13.1 212104_s_at SLC39A6 1.74 solute carrier family 39 (zinc transporter), member 6 18q12.2 202088_at KIAA0877 1.73 KIAA0877 protein 7p14.3-p14.2 212792_at ZNF131 1.72 zinc finger protein 131 (clone pHZ-10) 5p12-p11 221842_s_at DDEF1 1.72 development and differentiation enhancing factor 1 8q24.1-q24.2 224791_at FCGR1A 1.72 Fc fragment of IgG, high affinity Ia, receptor for (CD64) 1q21.2-q21.3 216950_s_at RAP2B 1.72 RAP2B, member of RAS oncogene family 3q25.2 227897_at HELIC1 1.71 helicase, ATP binding 1 6q16 212815_at HAVCR2 1.70 hepatitis A virus cellular receptor 2 5q33.3 235458_at FLJ31051 1.69 hypothetical protein FLJ31051 12q23.1 227295_at PHCA 1.69 phytoceramidase, alkaline 11q13.3 222688_at SOCS5 1.69 suppressor of cytokine signaling 5 2p21 209648_x_at HMGB2 1.68 high-mobility group box 2 4q31 208808_s_at FLJ13081 1.68 hypothetical protein FLJ13081 10q26.13 222464_s_at FLJ36874 1.68 hypothetical protein FLJ36874 11q12.2 225466_at --- 1.67 Homo sapiens, clone IMAGE:5263020, mRNA --- 229635_at --- 1.67 Homo sapiens transcribed sequence with weak similarity to protein pir:S23650 (H.sapiens) --- 241815_at S23650 retrovirus-related hypothetical protein II - human retrotransposon LINE-1 G3BP 1.66 Ras-GTPase-activating protein SH3-domain-binding protein 5q33.1 201503_at --- 1.66 Homo sapiens transcribed sequences --- 239227_at WDHD1 1.65 WD repeat and HMG-box DNA binding protein 1 14q22.2 204728_s_at STAT1 1.65 signal transducer and activator of transcription 1, 91kDa 2q32.2 200887_s_at HIWI2 1.65 piwi-like 2 (Drosophila) 11q21 230480_at NBS1 1.65 Nijmegen breakage syndrome 1 (nibrin) 8q21 202907_s_at SFRS3 1.65 splicing factor, arginine/serine-rich 3 6p21 208673_s_at CGI-72 1.64 CGI-72 protein 8q24.22 230098_at M96 1.64 likely ortholog of mouse metal response element binding transcription factor 2 1p22.1 209704_at EIF2C2 1.64 eukaryotic translation initiation factor 2C, 2 8q24 225569_at HNRPA2B1 1.63 heterogeneous nuclear ribonucleoprotein A2/B1 7p15 225932_s_at OSBPL1A 1.62 oxysterol binding protein-like 1A /// oxysterol binding protein-like 1A 18q11.1 /// 18q11.1 208158_s_at TNFRSF9 1.62 tumor necrosis factor receptor superfamily, member 9 1p36 207536_s_at THY1 1.60 Thy-1 cell surface antigen 11q22.3-q23 213869_x_at EMILIN2 1.57 elastin microfibril interfacer 2 /// elastin microfibril interfacer 2 18p11.3 /// 18p11.3 224374_s_at --- 1.57 Homo sapiens transcribed sequences --- 231449_at PRNP 1.55 prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, 20pter-p12 201300_s_at fatal familial insomnia) KLIP1 1.54 KSHV latent nuclear antigen interacting protein 1 4q35.1 229304_s_at ZNF180 1.54 zinc finger protein 180 (HHZ168) 19q13.2 219495_s_at ______

Genes whose expression is downregulated in tumors ______

Gene Symbol Fold Gene Title Chromosomal Affymetrix Change Location Probeset ID ______

MUC4 0.04 mucin 4, tracheobronchial 3q29 217109_at MUC4 0.04 mucin 4, tracheobronchial 3q29 217110_s_at --- 0.04 Homo sapiens cDNA FLJ44379 fis, clone TRACH3035235 3p21.1 239150_at C20orf85 0.05 chromosome 20 open reading frame 85 20q13.32 229542_at UPK1B 0.05 uroplakin 1B 3q13.3-q21 210065_s_at FLJ37927 0.05 CDC20-like protein 5q11.2 240161_s_at GSTA2 0.06 glutathione S- A2 6p12.1 203924_at IMUP 0.06 immortalization-upregulated protein 19q13.13 223631_s_at LTF 0.06 lactotransferrin 3q21-q23 202018_s_at --- 0.06 Homo sapiens cDNA FLJ44282 fis, clone TRACH2003516 16p13.11 240304_s_at TMC5 0.06 transmembrane channel-like 5 16p13.11 219580_s_at KRT4 0.06 4 12q12-q13 213240_s_at C9orf24 0.06 open reading frame 24 9p13.2 229012_at PIGR 0.06 polymeric immunoglobulin receptor 1q31-q41 226147_s_at FLJ25333 0.07 hypothetical protein FLJ25333 5q15 240065_at TSGA2 0.07 testes specific A2 homolog (mouse) 21q22.3 230093_at FLJ25200 0.07 hypothetical protein FLJ25200 3p24.3 239477_at MSMB 0.07 microseminoprotein, beta- 10q11.2 207430_s_at S100P 0.07 S100 calcium binding protein P 4p16 204351_at OMG 0.08 oligodendrocyte glycoprotein 17q11.2 238720_at AKAP28 0.08 A-kinase anchoring protein 28 Xq25 237281_at LOC136288 0.08 hypothetical protein LOC136288 7p12.3 1557636_a_at --- 0.08 Homo sapiens similar to RIKEN cDNA 1700028P14 (LOC138255), mRNA 9q21.13 243610_at LOC146845 0.08 hypothetical protein LOC146845 17p13.1 239916_at LCN2 0.08 lipocalin 2 (oncogene 24p3) 9q34 212531_at MUC4 0.08 mucin 4, tracheobronchial 3q29 204895_x_at UPK1B 0.08 uroplakin 1B 3q13.3-q21 210064_s_at DKFZp547I048 0.08 hypothetical protein DKFZp547I048 1p31.1 229973_at DNCL2B 0.08 , cytoplasmic, light polypeptide 2B 16q23.3 238116_at SCGB1A1 0.08 secretoglobin, family 1A, member 1 (uteroglobin) 11q12.3-q13.1 205725_at MSMB 0.08 microseminoprotein, beta- 10q11.2 210297_s_at MUC16 0.09 mucin 16 19q13.2 220196_at TMC5 0.09 transmembrane channel-like 5 16p13.11 222904_s_at HSPC065 0.09 HSPC065 protein 16q13 222890_at CYP4B1 0.09 cytochrome P450, family 4, subfamily B, polypeptide 1 1p34-p12 210096_at KCNE1 0.09 potassium voltage-gated channel, Isk-related family, member 1 21q22.1-q22.2 236407_at CHST9 0.09 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 18q11.2 223737_x_at CGI-38 0.09 brain specific protein 16q22.1 218876_at CLIC6 0.09 chloride intracellular channel 6 21q22.12 227742_at CHST9 0.09 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 /// carbohydrate 18q11.2 /// 18q11.2 224400_s_at (N-acetylgalactosamine 4-0) sulfotransferase 9 FLJ40427 0.10 hypothetical protein FLJ40427 3p21.2 243802_at SERPINB3 0.10 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 18q21.3 209720_s_at MGC27085 0.10 hypothetical protein MGC27085 3q26.31 236918_s_at MGC26610 0.10 hypothetical protein MGC26610 5p13.2 236085_at MGC13040 0.10 hypothetical protein MGC13040 /// hypothetical protein MGC13040 11q22.2 /// 11q22.2 224463_s_at SPAG6 0.10 sperm associated antigen 6 10p12.2 210033_s_at SLPI 0.11 secretory leukocyte inhibitor (antileukoproteinase) 20q12 203021_at PROM1 0.11 prominin 1 4p15.33 204304_s_at FLJ32926 0.11 hypothetical protein FLJ32926 19q13.33 233157_x_at LOC120224 0.11 hypothetical protein BC016153 11q24.3 230323_s_at RRAD 0.11 Ras-related associated with diabetes 16q22 204803_s_at TSPAN-1 0.11 tetraspan 1 1p34.1 209114_at FLJ22944 0.11 hypothetical protein FLJ22944 10q25.1 231084_at --- 0.11 Homo sapiens transcribed sequences --- 236489_at --- 0.11 Homo sapiens mRNA; cDNA DKFZp666G057 (from clone DKFZp666G057) 15q25.1 1556158_at RRAD 0.12 Ras-related associated with diabetes 16q22 204802_at LAS1 0.12 lung adenoma susceptibility 1-like 12p12.1 220168_at HUMAUANTIG 0.12 nucleolar GTPase 1p34.2 227081_at KRT14 0.12 (epidermolysis bullosa simplex, Dowling-Meara, Koebner) 17q12-q21 209351_at C20orf114 0.13 chromosome 20 open reading frame 114 20q11.22 226067_at ASP 0.13 AKAP-associated sperm protein 5p15.31 223609_at DNALI1 0.13 dynein, axonemal, light intermediate polypeptide 1 1p35.1 205186_at DKFZP434H0115 0.13 hypothetical protein DKFZp434H0115 17q21.31 223924_at FLJ23049 0.13 hypothetical protein FLJ23049 3q26.2 220269_at FLJ23129 0.13 hypothetical protein FLJ23129 1p31.3 229816_at SERPINB3 0.13 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 18q21.3 209719_x_at LOC132671 0.13 LOC132671 4q12 229331_at --- 0.13 Homo sapiens, clone IMAGE:5206016, mRNA --- 1559333_at AKR1C3 0.13 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) 10p15-p14 209160_at --- 0.13 Homo sapiens cDNA: FLJ21590 fis, clone COL06990 --- 1556003_a_at RSHL3 0.14 radial spokehead-like 3 6q22.31 233071_at PI3 0.14 protease inhibitor 3, skin-derived (SKALP) 20q12-q13 203691_at MGC4309 0.15 hypothetical protein MGC4309 1q32.1 219476_at CAPS 0.15 calcyphosine 19p13.3 231729_s_at MDAC1 0.15 MDAC1 19q13.42 1552594_at B3GNT7 0.15 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 2q37.1 1555963_x_at CLDN10 0.15 claudin 10 13q31-q34 205328_at FLJ40919 0.15 hypothetical protein FLJ40919 13q14.11 1556711_at MUC1 0.15 mucin 1, transmembrane 1q21 213693_s_at S100A9 0.15 S100 calcium binding protein A9 (calgranulin B) 1q21 203535_at SIAT7A 0.15 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl- 17q25.3 227725_at galactosaminide alpha-2,6-sialyltransferase) A MUC20 0.15 mucin 20 3q29 226622_at NYD-SP14 0.15 NYD-SP14 protein 4q31.21 223962_at --- 0.15 Homo sapiens cDNA FLJ13332 fis, clone OVARC1001813. 1q23.1 231077_at SPA17 0.16 sperm autoantigenic protein 17 11q24.2 205406_s_at MGC35043 0.16 hypothetical protein MGC35043 4q21.3 231565_at CDH26 0.16 cadherin-like 26 20q13.2-q13.33 232306_at DNER 0.16 delta-notch-like EGF repeat-containing transmembrane 2q37.1 226281_at CLDN23 0.16 claudin 23 8p23.1 228707_at FLJ25955 0.16 hypothetical protein FLJ25955 2q36.3 242162_at DNAH5 0.16 dynein, axonemal, heavy polypeptide 5 5p15.2 232381_s_at PI3 0.16 protease inhibitor 3, skin-derived (SKALP) 20q12-q13 41469_at DNAJA4 0.16 DnaJ (Hsp40) homolog, subfamily A, member 4 15q24.1 225061_at --- 0.16 Homo sapiens similar to KIAA0563-related gene (LOC376854), mRNA 22q13.2 1562921_at SCGB2A1 0.16 secretoglobin, family 2A, member 1 11q13 205979_at CAPS 0.17 calcyphosine 19p13.3 226424_at TEKT1 0.17 1 17p13.2 239216_at NQO1 0.17 NAD(P)H dehydrogenase, quinone 1 16q22.1 210519_s_at LOC128344 0.17 hypothetical protein LOC128344 1p13.2 228100_at FLJ46909 0.17 FLJ46909 protein 9q34.11 229976_at MGC48998 0.17 hypothetical protein MGC48998 1q23.2 1554960_at SPAG6 0.17 sperm associated antigen 6 10p12.2 210032_s_at WFDC2 0.18 WAP four-disulfide core domain 2 20q12-q13.2 203892_at ATP12A 0.18 ATPase, H+/K+ transporting, nongastric, alpha polypeptide 13q11-q12.1 207367_at --- 0.18 Homo sapiens transcribed sequences --- 241310_at DNAI2 0.18 dynein, axonemal, intermediate polypeptide 2 17q25 220636_at PACRG 0.18 PARK2 co-regulated 6q26 214204_at ECRG4 0.18 esophageal cancer related gene 4 protein 2q12.2 223623_at --- 0.18 Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. --- 225728_at NQO1 0.18 NAD(P)H dehydrogenase, quinone 1 16q22.1 201467_s_at NESG1 0.18 nasopharyngeal specific protein 1 1q22 220308_at MGC39581 0.18 hypothetical protein MGC39581 19p13.3 237020_at ABCA13 0.18 ATP binding cassette gene, sub-family A (ABC1), member 13 7p12.3 1553605_a_at B3GNT7 0.18 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 2q37.1 1555962_at FLJ32827 0.18 hypothetical protein FLJ32827 10p12.31 240275_at --- 0.18 Homo sapiens transcribed sequences --- 243803_at --- 0.18 H. sapiens hypothetical protein LOC134121, mRNA (cDNA clone IMAGE:5766979), partial cds --- 239722_at AK7 0.19 adenylate kinase 7 14q32.31 1553734_at --- 0.19 ------1558077_s_at CHST5 0.19 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 16q22.3 64900_at --- 0.19 Homo sapiens transcribed sequences --- 222271_at FLJ10817 0.19 hypothetical protein FLJ10817 10p12.1-p11.23 223794_at RNPC6 0.19 RNA-binding region (RNP1, RRM) containing 6 6p22.3 235004_at SAA2 0.19 serum amyloid A2 /// serum amyloid A2 11p15.1-p14 /// 208607_s_at 11p15.1-p14 C14orf78 0.19 open reading frame 78 14q32.33 212992_at ADH1C 0.19 alcohol dehydrogenase 1C (class I), gamma polypeptide 4q21-q23 206262_at LTB4DH 0.19 leukotriene B4 12-hydroxydehydrogenase 9q32 231897_at AKAP28 0.19 A-kinase anchoring protein 28 Xq25 237282_s_at LRP11 0.19 low density receptor-related protein 11 6q24.3 225060_at TTC9 0.20 tetratricopeptide repeat domain 9 14q24.1 213172_at MS4A8B 0.20 membrane-spanning 4-domains, subfamily A, member 8B /// membrane-spanning 4-domains, 11q12.2 /// 11q12.2 224355_s_at subfamily A, member 8B C6orf29 0.20 chromosome 6 open reading frame 29 6p21.3 205597_at CAPS 0.20 calcyphosine 19p13.3 231728_at --- 0.20 Homo sapiens similar to RIKEN cDNA 2010300C02 gene (LOC343990), mRNA 2q11.2 228067_at C6orf206 0.20 chromosome 6 open reading frame 205 6p21.1 230695_s_at LOC374427 0.20 hypothetical gene supported by BC039505 11q23.2 1568606_at FLJ22527 0.20 hypothetical protein FLJ22527 2q37.3 238584_at DUOX1 0.20 dual oxidase 1 15q15.3 219597_s_at FLJ39553 0.20 hypothetical protein FLJ39553 8q22.2 1552390_a_at MGC26733 0.20 hypothetical protein MGC26733 2q11.2 1562371_s_at KIAA0266 0.21 KIAA0266 13q12.2-q13.3 237168_at NQO1 0.21 NAD(P)H dehydrogenase, quinone 1 16q22.1 201468_s_at LOC115811 0.21 hypothetical protein BC013151 12q24.21 1552540_s_at --- 0.21 Homo sapiens cDNA FLJ44282 fis, clone TRACH2003516 16p13.11 240303_at MS4A1 0.21 membrane-spanning 4-domains, subfamily A, member 1 11q12 228599_at DKFZp761N1114 0.21 hypothetical protein DKFZp761N1114 1q32.1 229254_at LOC120224 0.21 hypothetical protein BC016153 11q24.3 226226_at FLJ90575 0.21 hypothetical protein FLJ90575 4p16.1 238682_at FAM3B 0.22 family with sequence similarity 3, member B 21q22.3 227194_at ABCA13 0.22 ATP binding cassette gene, sub-family A (ABC1), member 13 7p12.3 1553604_at SLC22A4 0.22 solute carrier family 22 (organic cation transporter), member 4 5q31.1 205896_at FLJ23834 0.22 hypothetical protein FLJ23834 7q22.2 235650_at ZD52F10 0.22 hypothetical gene ZD52F10 19q13.13 226926_at KCNRG 0.22 regulator 13q14.13 240288_at ZMYND10 0.22 zinc finger, MYND domain containing 10 3p21.3 205714_s_at LOC128153 0.22 hypothetical protein BC014608 1q41 230763_at NOR1 0.22 oxidored-nitro domain-containing protein 1p34.3 227359_at MUC13 0.22 mucin 13, epithelial transmembrane --- 218687_s_at LOC57821 0.22 hypothetical protein LOC57821 1q24 206721_at DNAH9 0.22 dynein, axonemal, heavy polypeptide 9 17p12 240857_at HYDIN 0.22 hydrocephalus inducing 16q22.2 232984_at p25 0.23 brain-specific protein p25 alpha 5p15.3 230104_s_at MGC14839 0.23 similar to RIKEN cDNA 2310030G06 gene 11q23.2 238805_at MGC29761 0.23 hypothetical protein MGC29761 9q34.3 59437_at FBXO15 0.23 F-box only protein 15 18q22.3 231472_at CES1 0.23 1 (monocyte/macrophage serine esterase 1) 16q13-q22.1 209616_s_at FLJ32743 0.23 hypothetical protein FLJ32743 18q21.1 1552326_a_at --- 0.23 Homo sapiens similar to putative leucine-rich repeat protein (LOC376030), mRNA 11q12.3 236666_s_at SLC2A10 0.23 solute carrier family 2 (facilitated glucose transporter), member 10 /// solute carrier family 2 20q13.1 /// 20q13.1 221024_s_at (facilitated glucose transporter), member 10 FLJ25429 0.23 hypothetical protein FLJ25429 1p36.13 238657_at KRT7 0.23 12q12-q13 209016_s_at DKFZP586M1120 0.23 hypothetical protein DKFZp586M1120 /// hypothetical protein DKFZp586M1120 17p11.2 /// 17p11.2 208140_s_at MUC20 0.23 mucin 20 3q29 231941_s_at MGC33630 0.24 hypothetical protein MGC33630 12q24.31 230193_at DYX1C1 0.24 dyslexia susceptibility 1 candidate 1 15q21.1 235273_at SELENBP1 0.24 selenium binding protein 1 1q21-q22 214433_s_at --- 0.24 H. sapiens hypothetical protein LOC285103, mRNA (cDNA clone IMAGE:5273139), partial cds --- 227966_s_at GSTA3 0.24 glutathione S-transferase A3 6p12.1 222102_at FAM3D 0.24 family with sequence similarity 3, member D 3p21.2 227676_at LOC129881 0.24 hypothetical LOC129881 2q31.1 236909_at AGR2 0.24 anterior gradient 2 homolog (Xenopus laevis) 7p21.3 209173_at BANK1 0.25 B-cell scaffold protein with repeats 1 4q24 219667_s_at --- 0.25 Homo sapiens cDNA FLJ46553 fis, clone THYMU3038879 --- 243780_at C14orf45 0.25 chromosome 14 open reading frame 45 14q24.2 220173_at SLC27A2 0.25 solute carrier family 27 ( transporter), member 2 15q21.2 205768_s_at SAA2 0.25 serum amyloid A2 11p15.1-p14 214456_x_at DAF 0.25 decay accelerating factor for complement (CD55, Cromer blood group system) 1q32 201926_s_at DNAH9 0.25 dynein, axonemal, heavy polypeptide 9 17p12 207959_s_at FLJ34497 0.25 hypothetical protein FLJ34497 1p12 233516_s_at ELF3 0.26 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) 1q32.2 229842_at SLC27A2 0.26 solute carrier family 27 (fatty acid transporter), member 2 15q21.2 205769_at CHST5 0.26 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 16q22.3 219182_at MGC26778 0.26 hypothetical protein MGC26778 10p12.31 237314_at SERPINB4 0.26 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4 18q21.3 210413_x_at MGC34837 0.26 hypothetical protein MGC34837 1p32.1 236710_at DKFZp434B227 0.26 hypothetical protein DKFZp434B227 3q29 221185_s_at MOPT 0.26 protein containing single MORN motif in testis --- 226790_at MGC16372 0.27 CG10958-like 2p24.1 231133_at NBEA 0.27 neurobeachin 13q13 221207_s_at FLJ40873 0.27 hypothetical protein FLJ40873 1p31.3 1553635_s_at FLJ23514 0.27 hypothetical protein FLJ23514 11q14.1 220389_at FLJ33084 0.27 hypothetical protein FLJ33084 1p34.1 236320_at FLJ46675 0.27 FLJ46675 protein 17p13.2 239499_at ADSSL1 0.27 adenylosuccinate synthase like 1 14q32.33 226325_at C6orf165 0.27 chromosome 6 open reading frame 165 6q15 230273_at MGC33630 0.27 hypothetical protein MGC33630 12q24.31 1555007_s_at FLJ23598 0.27 hypothetical protein FLJ23598 11p11.2 220390_at FLJ20366 0.27 hypothetical protein FLJ20366 8q23.2 218692_at DHCR24 0.27 24-dehydrocholesterol reductase 1p33-p31.1 200862_at FLJ23577 0.27 hypothetical protein FLJ23577 5p13.2 232745_x_at MGC4309 0.27 hypothetical protein MGC4309 1q32.1 228865_at MGC13040 0.27 hypothetical protein MGC13040 11q22.2 241198_s_at CXCL1 0.28 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) 4q21 204470_at PAX5 0.28 paired box gene 5 (B-cell lineage specific activator protein) 9p13 221969_at LOC222171 0.28 hypothetical protein LOC222171 7p15.1 226961_at --- 0.28 Homo sapiens cDNA FLJ16628 fis, clone TESTI4017763, moderately similar to Mitogen- 2q21.3 1555804_a_at activated protein kinase kinase kinase 3 (EC 2.7.1.-) EFHC1 0.28 EF-hand domain (C-terminal) containing 1 6p12.3 219833_s_at MGC35261 0.28 hypothetical protein MGC35261 Xq22.3 231389_at --- 0.28 Homo sapiens transcribed sequence with moderate similarity to protein sp:P39189 --- 229810_at (H.sapiens) ALU2_HUMAN Alu subfamily SB sequence contamination warning entry HRASLS2 0.28 HRAS-like suppressor 2 11q13.1 221122_at LOC222967 0.29 hypothetical protein LOC222967 7p22.2 1557417_s_at TEKT2 0.29 tektin 2 (testicular) 1p35.3-p34.1 210323_at DAF 0.29 decay accelerating factor for complement (CD55, Cromer blood group system) 1q32 1555950_a_at FANK1 0.29 fibronectin type 3 and ankyrin repeat domains 1 10q26.2 232968_at ARMC2 0.30 armadillo repeat containing 2 6q21 223866_at SLC16A5 0.30 solute carrier family 16 (monocarboxylic acid transporters), member 5 17q25.2 206600_s_at ELF3 0.30 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) 1q32.2 210827_s_at SLC22A16 0.30 solute carrier family 22 (organic cation transporter), member 16 6q22.1 232232_s_at MUC1 0.30 mucin 1, transmembrane 1q21 207847_s_at TNRC9 0.30 trinucleotide repeat containing 9 16q12.2 214774_x_at STOML3 0.30 stomatin (EPB72)-like 3 13q13.3 1553794_at TUBB 0.30 , beta polypeptide 6p25 204141_at ELF3 0.30 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) 1q32.2 201510_at TTC9 0.30 tetratricopeptide repeat domain 9 14q24.1 213174_at DNAH7 0.30 dynein, axonemal, heavy polypeptide 7 2q33.1 214222_at ELL3 0.31 RNA polymerase II-like 3 15q15.1 219518_s_at TSGA10 0.31 testis specific, 10 2q11.2 223838_at CR2 0.31 complement component (3d/Epstein Barr virus) receptor 2 1q32 205544_s_at EPPK1 0.31 1 8q24.3 232165_at C6orf118 0.31 chromosome 6 open reading frame 118 6q27 232777_s_at ALDH3B1 0.31 aldehyde dehydrogenase 3 family, member B1 11q13 205640_at SERPINB7 0.31 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7 18q22.1 206421_s_at --- 0.31 Homo sapiens transcribed sequences --- 244313_at ZMYND12 0.31 zinc finger, MYND domain containing 12 1p34.1 223636_at CHST6 0.32 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 16q22 223786_at --- 0.32 Homo sapiens similar to CG5435-PA (LOC127003), mRNA 1p13.3 231044_at MGC29761 0.32 hypothetical protein MGC29761 9q34.3 221946_at CLIC3 0.32 chloride intracellular channel 3 9q34.3 219529_at --- 0.32 Homo sapiens, clone IMAGE:4820483, mRNA --- 1568906_at CDH26 0.32 cadherin-like 26 20q13.2-q13.33 233663_s_at TJP3 0.33 tight junction protein 3 (zona occludens 3) 19p13.3 35148_at --- 0.33 Homo sapiens cDNA clone IMAGE:4441572, partial cds --- 225102_at CKB 0.33 creatine kinase, brain 14q32 200884_at VNN3 0.33 vanin 3 6q23-q24 220528_at --- 0.33 Homo sapiens similar to shippo 1 (LOC375177), mRNA 22q13.33 238327_at BF 0.33 B-factor, properdin 6p21.3 202357_s_at AGR2 0.33 anterior gradient 2 homolog (Xenopus laevis) 7p21.3 228969_at SPAG1 0.33 sperm associated antigen 1 8q22.2 210117_at BNIPL 0.33 BCL2/adenovirus E1B 19kD interacting protein like 1q21.3 236534_at NYD-SP29 0.33 testis development protein NYD-SP29 1p22.3 243087_at TMPRSS4 0.33 transmembrane protease, serine 4 /// transmembrane protease, serine 4 11q23.3 /// 11q23.3 218960_at DNAI1 0.33 dynein, axonemal, intermediate polypeptide 1 9p21-p13 220125_at DNAH10 0.34 dynein, axonemal, heavy polypeptide 10 12q24.31 229738_at LOC123872 0.34 similar to RIKEN cDNA 4930457P18 16q24.1 222068_s_at TTC12 0.34 tetratricopeptide repeat domain 12 11q23.2 219587_at TUBB2 0.34 tubulin, beta, 2 --- 213726_x_at DKFZP566F0546 0.34 DKFZP566F0546 protein 22q13.31 206526_at --- 0.34 Homo sapiens cDNA clone MGC:2062 IMAGE:3534501, complete cds --- 210608_s_at KIAA1345 0.34 KIAA1345 protein 4p15.33 234936_s_at TCL1A 0.35 T-cell leukemia/lymphoma 1A 14q32.1 39318_at --- 0.35 ------211474_s_at TCEA3 0.35 transcription elongation factor A (SII), 3 1p36.11 226388_at --- 0.35 Homo sapiens cDNA clone IMAGE:4480427, partial cds --- 241382_at NYD-SP28 0.35 NYD-SP28 protein 12q13.12 1552321_a_at --- 0.35 Homo sapiens mRNA; cDNA DKFZp434N2116 (from clone DKFZp434N2116) --- 227917_at C21orf63 0.35 open reading frame 63 21q22.11 227188_at OIP106 0.35 OGT(O-Glc-NAc transferase)-interacting protein 106 KDa 3p25.3-p24.1 226013_at TUBB2 0.35 tubulin, beta, 2 --- 208977_x_at FLJ23129 0.35 hypothetical protein FLJ23129 1p31.3 220769_s_at FLJ25791 0.35 hypothetical protein FLJ25791 6q21 239828_at STI2 0.35 TPR domain containing STI2 3p21.33 230997_at ELL3 0.35 elongation factor RNA polymerase II-like 3 15q15.1 219517_at C14orf142 0.35 chromosome 14 open reading frame 142 14q32.13 223273_at SLC22A16 0.36 solute carrier family 22 (organic cation transporter), member 16 6q22.1 232233_at TRIM7 0.36 tripartite motif-containing 7 5q35.3 223694_at KRT4 0.36 12q12-q13 214399_s_at TFF3 0.36 trefoil factor 3 (intestinal) 21q22.3 204623_at KCNRG 0.36 potassium channel regulator 13q14.13 239098_at ABLIM1 0.37 actin binding LIM protein 1 10q25 200965_s_at --- 0.37 Homo sapiens transcribed sequences --- 239500_at TUBA4 0.37 tubulin, alpha 4 2q36.1 207490_at LOC130752 0.37 hypothetical protein LOC130752 2q34 238721_at PPIL6 0.37 peptidylprolyl (cyclophilin)-like 6 6q21 1553684_at FLJ25124 0.37 hypothetical protein FLJ25124 1q21.2 231118_at --- 0.37 Homo sapiens transcribed sequences --- 236682_at RECQL5 0.37 RecQ protein-like 5 17q25.2-q25.3 229740_at CGN 0.37 cingulin 1q21 223233_s_at --- 0.38 Homo sapiens cDNA FLJ43756 fis, clone TESTI2045920 2p23.3 236717_at CETN2 0.38 centrin, EF-hand protein, 2 Xq28 209194_at --- 0.38 Homo sapiens transcribed sequences --- 227533_at BASP1 0.38 brain abundant, membrane attached signal protein 1 5p15.1-p14 202391_at TACC2 0.38 transforming, acidic coiled-coil containing protein 2 10q26 202289_s_at FLJ12953 0.38 hypothetical protein FLJ12953 similar to Mus musculus D3Mm3e 2p13.1 225898_at MS4A1 0.38 membrane-spanning 4-domains, subfamily A, member 1 11q12 210356_x_at FLJ32783 0.38 hypothetical protein FLJ32783 Xp11.23 235946_at TUBB4 0.38 tubulin, beta, 4 16q24.3 202154_x_at MYO1D 0.39 ID 17q11-q12 212338_at PTPRN2 0.39 protein tyrosine phosphatase, receptor type, N polypeptide 2 7q36 203029_s_at TUBA3 0.39 tubulin, alpha 3 12q12-12q14.3 209118_s_at --- 0.39 Homo sapiens, clone IMAGE:4694422, mRNA --- 1569675_at MS4A1 0.39 membrane-spanning 4-domains, subfamily A, member 1 11q12 231418_at HIST2H2BE 0.39 2, H2be 1q21-q23 202708_s_at PEN2 0.39 enhancer 2 19q13.13 218302_at FLJ32028 0.39 hypothetical protein FLJ32028 4q31.3 238063_at --- 0.39 Homo sapiens cDNA clone IMAGE:5286266, partial cds --- 225812_at TM4SF6 0.39 transmembrane 4 superfamily member 6 Xq22 209109_s_at LOH11CR2A 0.39 loss of heterozygosity, 11, chromosomal region 2, gene A 11q23 205011_at GCLM 0.39 glutamate-cysteine , modifier subunit 1p22.1 203925_at --- 0.39 Homo sapiens cDNA FLJ20031 fis, clone ADSU02180 --- 241359_at APM2 0.39 adipose specific 2 10q23.31 203571_s_at NEK11 0.39 NIMA (never in gene a)- related kinase 11 3q22.1 219542_at MS4A1 0.39 membrane-spanning 4-domains, subfamily A, member 1 11q12 217418_x_at VPREB3 0.40 pre-B lymphocyte gene 3 22q11.23 220068_at --- 0.40 Homo sapiens cDNA FLJ45450 fis, clone BRSTN2002691 --- 230917_at ANXA11 0.40 A11 10q23 206200_s_at COBL 0.40 KIAA0633 protein 7p12.2-p12.1 213050_at TNFRSF21 0.41 tumor necrosis factor receptor superfamily, member 21 6p21.1-12.2 218856_at CIB1 0.41 calcium and integrin binding 1 (calmyrin) 15q25.3-q26 201953_at LZTFL1 0.41 leucine zipper transcription factor-like 1 3p21.3 218437_s_at MGC44593 0.41 hypothetical protein MGC44593 10q21.3 1553630_at --- 0.41 ------211200_s_at MAP17 0.41 membrane-associated protein 17 1p33 219630_at LOC120379 0.42 hypothetical protein BC019238 11q23.2 235062_at TACC2 0.42 transforming, acidic coiled-coil containing protein 2 10q26 211382_s_at CD19 0.42 CD19 antigen 16p11.2 206398_s_at ASS 0.42 argininosuccinate synthetase 9q34.1 207076_s_at SYTL4 0.42 -like 4 (granuphilin-a) --- 227703_s_at VILL 0.42 villin-like 3p21.3 209950_s_at FTHFD 0.42 formyltetrahydrofolate dehydrogenase 3q21.2 205208_at FLJ11036 0.42 hypothetical protein FLJ11036 3p25.2 222892_s_at TM4SF6 0.42 transmembrane 4 superfamily member 6 Xq22 209108_at FKBP1B 0.42 FK506 binding protein 1B, 12.6 kDa 2p24.1 206857_s_at LOC161577 0.42 LOC161577 protein 15q21.2 243198_at ARHV 0.43 ras homolog gene family, member V 15q13.3 241990_at AQP3 0.43 aquaporin 3 9p13 39249_at ALDH3B2 0.43 aldehyde dehydrogenase 3 family, member B2 11q13 204942_s_at TUBB4 0.43 tubulin, beta, 4 16q24.3 213476_x_at --- 0.43 Homo sapiens similar to hypothetical protein MGC38936 (LOC344403), mRNA 2p16.3 229656_s_at --- 0.43 Homo sapiens, clone IMAGE:5166045, mRNA --- 229599_at LOC128153 0.43 hypothetical protein BC014608 1q41 1552269_at EPPB9 0.44 B9 protein 17p11.2 210534_s_at TNFSF11 0.44 tumor necrosis factor (ligand) superfamily, member 11 13q14 210643_at OIP106 0.44 OGT(O-Glc-NAc transferase)-interacting protein 106 KDa 3p25.3-p24.1 214924_s_at --- 0.44 ------223695_s_at CLDN7 0.44 claudin 7 17p13 202790_at TNFRSF21 0.44 tumor necrosis factor receptor superfamily, member 21 6p21.1-12.2 214581_x_at PRDX5 0.44 peroxiredoxin 5 11q13 1560587_s_at Lrp2bp 0.44 low density lipoprotein receptor-related protein binding protein 4q35.1 227337_at FZD4 0.44 frizzled homolog 4 (Drosophila) 11q14.2 229441_at DKFZP564J102 0.44 DKFZP564J102 protein 4q35.1 214889_at FLJ38615 0.44 hypothetical protein FLJ38615 15q24.3 1552950_at IL20RA 0.45 interleukin 20 receptor, alpha 6q22.33-q23.1 219115_s_at MGC33338 0.45 hypothetical protein MGC33338 1q23.1 227582_at SLB 0.45 selective LIM binding factor, rat homolog 2p23.3 226324_s_at MAP17 0.45 membrane-associated protein 17 1p33 1553589_a_at C14orf168 0.45 chromosome 14 open reading frame 168 14q24.3 226309_at MSH5 0.45 mutS homolog 5 (E. coli) 6p21.3 230096_at ESRRBL1 0.45 estrogen-related receptor beta like 1 3q13.13 218100_s_at FLJ10901 0.45 hypothetical protein FLJ10901 1q32.1 219010_at FLJ11767 0.45 hypothetical protein FLJ11767 8q11.21 220156_at NMU 0.46 neuromedin U 4q12 206023_at --- 0.46 Homo sapiens cDNA FLJ12187 fis, clone MAMMA1000831. --- 232286_at CSTB 0.46 cystatin B (stefin B) 21q22.3 201201_at PH-4 0.46 hypoxia-inducible factor prolyl 4-hydroxylase 3p21.31 222125_s_at FLJ31606 0.46 hypothetical protein FLJ31606 16q24.3 230811_at MGC9913 0.46 hypothetical protein MGC9913 19q13.43 244741_s_at ALOX15 0.46 arachidonate 15-lipoxygenase 17p13.3 207328_at FMO5 0.46 flavin containing monooxygenase 5 1q21.1 205776_at VIL2 0.47 villin 2 (ezrin) 6q25.2-q26 208623_s_at BACE2 0.47 beta-site APP-cleaving 2 21q22.3 222446_s_at BACE2 0.47 beta-site APP-cleaving enzyme 2 21q22.3 217867_x_at TMC4 0.47 transmembrane channel-like 4 19q13.42 226403_at --- 0.47 Homo sapiens transcribed sequences --- 235247_at --- 0.47 Homo sapiens hypothetical LOC158730 (LOC158730), mRNA Xp21.1 241538_at --- 0.47 Homo sapiens, clone IMAGE:5268696, mRNA --- 226546_at MIP-T3 0.48 -interacting protein that associates with TRAF3 2q37.3 238494_at PRDX5 0.48 peroxiredoxin 5 11q13 222994_at --- 0.48 Homo sapiens cDNA FLJ30065 fis, clone ADRGL2000328. --- 230986_at ARSD 0.48 D Xp22.3 225280_x_at PLCE1 0.48 , epsilon 1 10q23 205111_s_at LOC283385 0.48 morn 12q24.31 237211_x_at LOC119710 0.48 hypothetical protein BC009561 11p13 228249_at MT2A 0.48 metallothionein 2A 16q13 212859_x_at LRG 0.48 leucine-rich alpha-2-glycoprotein 19p13.3 228648_at SYNGR1 0.49 synaptogyrin 1 22q13.1 210613_s_at HSPC195 0.49 hypothetical protein HSPC195 5q31.3 222996_s_at ATP10B 0.49 ATPase, Class V, type 10B 5q34 214070_s_at ZFYVE21 0.49 zinc finger, FYVE domain containing 21 /// zinc finger, FYVE domain containing 21 14q32.33 /// 14q32.33 224445_s_at FREB 0.49 Fc receptor homolog expressed in B cells 1q23.1 235372_at TRIM7 0.50 tripartite motif-containing 7 5q35.3 239694_at CAPN5 0.50 5 11q14 226292_at UNG2 0.50 uracil-DNA glycosylase 2 5p15.2-p13.1 210021_s_at IMPA2 0.51 inositol(myo)-1(or 4)-monophosphatase 2 18p11.2 203126_at FLJ12750 0.51 hypothetical protein FLJ12750 /// hypothetical protein FLJ12750 12q24.31 /// 12q24.31 221704_s_at BCDO2 0.52 beta-carotene dioxygenase 2 11q22.3-q23.1 232449_at POR 0.52 P450 (cytochrome) 7q11.2 208928_at ARSD 0.52 arylsulfatase D Xp22.3 230131_x_at IL20RA 0.52 interleukin 20 receptor, alpha 6q22.33-q23.1 222829_s_at FLJ38379 0.52 hypothetical protein FLJ38379 2q37.3 1556474_a_at SPINLW1 0.54 serine protease inhibitor-like, with Kunitz and WAP domains 1 (eppin) 20q12-q13.2 206319_s_at EPB41L4B 0.54 erythrocyte band 4.1 like 4B 9q31 220161_s_at B7-H4 0.55 immune costimulatory protein B7-H4 1p12 219768_at MGC22773 0.55 hypothetical protein MGC22773 1p31.1 235498_at LOC91689 0.55 hypothetical gene supported by AL449243 22q13.31 225794_s_at --- 0.56 Homo sapiens transcribed sequences --- 243955_at RUSC2 0.56 RUN and SH3 domain containing 2 9p13.2 229941_at MGC35308 0.57 hypothetical protein MGC35308 6q27 238008_at PRDX1 0.57 peroxiredoxin 1 1p34.1 208680_at SIX2 0.58 sine oculis homolog 2 (Drosophila) 2p16-p15 206510_at FOXJ1 0.59 forkhead box J1 17q22-17q25 205906_at WDR13 0.59 WD repeat domain 13 /// WD repeat domain 13 Xp11.23 /// Xp11.23 222138_s_at MGC21688 0.59 hypothetical protein MGC21688 3q27.3 221904_at CAPN9 0.60 calpain 9 (nCL-4) 1q42.11-q42.3 208063_s_at CRYL1 0.60 crystallin, lambda 1 13q12.11 220753_s_at --- 0.61 Homo sapiens, clone IMAGE:4816940, mRNA --- 51158_at MGC15429 0.63 hypothetical protein MGC15429 3p21.31 224821_at PIAS3 0.65 protein inhibitor of activated STAT3 1q21 203035_s_at KATNB1 0.65 katanin p80 (WD repeat containing) subunit B 1 16q13 203162_s_at --- 0.65 Homo sapiens, clone IMAGE:4816940, mRNA --- 221880_s_at

Genes might be represented my multiple probesets Supplementary Table 4: Analysis of Genes Upregulated in Tumors

GO annotation GO ID Total number Number of Z_b* Mean Z_q** of human genes Score fold up Score genes in GO upregulated annotation in NPC fibrillar collagen GO:0005583 28 9 19.46 1.8 10.97 structural constituent GO:0005201 212 23 17.27 1.16 7.77 collagen GO:0005581 96 14 15.9 1.38 11.16 mitotic chromosome condensation GO:0007076 11 4 13.83 1.77 6.67 mitotic prophase GO:0000088 11 4 13.83 1.77 6.67 DNA replication and chromosome cycle GO:0000067 412 25 12.72 1.18 11.97 M phase of mitotic cell cycle GO:0000087 294 20 12.21 1.24 13.17 spindle assembly GO:0007051 31 6 12.14 1.35 5.92 mitotic spindle assembly GO:0007052 31 6 12.14 1.35 5.92 mitosis GO:0007067 287 19 11.7 1.24 12.8 M phase GO:0000279 380 21 10.97 1.2 12.74 mitotic cell cycle GO:0000278 454 23 10.85 1.19 13.21 nuclear division GO:0000280 362 20 10.7 1.19 11.72 phosphate transport GO:0006817 192 14 10.65 1.21 9.35 extracellular matrix GO:0005578 659 28 10.62 1.08 6.86 M phase specific microtubule process GO:0000072 40 6 10.56 1.36 6.89 chromosome condensation GO:0030261 29 5 10.41 1.3 5.06 mitotic sister chromatid segregation GO:0000070 19 4 10.37 1.43 5.56 sister chromatid segregation GO:0000819 19 4 10.37 1.43 5.56 collagen binding GO:0005518 44 6 10.02 1.41 8.16 chromosome, pericentric region GO:0000775 77 8 9.92 1.26 7.24 mitotic anaphase GO:0000090 33 5 9.7 1.32 5.69 kinetochore GO:0000776 47 6 9.66 1.36 7.4 cell cycle GO:0007049 1633 44 9.41 1.11 14.95 response to fungi GO:0009620 24 4 9.14 1.43 6.15 cell proliferation GO:0008283 2346 54 9.08 1.07 12.29 glycosaminoglycan binding GO:0005539 177 11 8.55 1.18 8.08 DNA-dependent DNA replication GO:0006261 153 10 8.41 1.24 9.61 DNA replication GO:0006260 321 15 8.28 1.17 10.27 cellular physiological process GO:0050875 8973 125 7.98 1.02 6.84 skeletal development GO:0001501 271 13 7.85 1.12 6.77 deoxyribonucleotide GO:0009262 19 3 7.68 1.56 6.85 cell cycle checkpoint GO:0000075 93 7 7.67 1.3 9 basement membrane GO:0005604 122 8 7.54 1.19 6.83 chromosome GO:0005694 509 18 7.43 1.12 8.9 microtubule cytoskeleton organization and biogenesis GO:0000226 107 7 7.04 1.14 5 spindle GO:0005819 108 7 7 1.24 8.1 DNA metabolism GO:0006259 1128 28 6.94 1.09 10.72 delta DNA polymerase complex GO:0005659 11 2 6.77 1.66 5.95 mitotic checkpoint GO:0007093 25 3 6.59 1.54 7.69 cell growth and/or maintenance GO:0008151 7831 103 6.49 1.02 6.72 cellular_component GO:0005575 22002 225 6.45 1.01 6.61 binding GO:0008201 123 7 6.44 1.18 6.64 hyaluronic acid binding GO:0005540 45 4 6.4 1.27 5.76 chemokine activity GO:0008009 69 5 6.33 1.19 5.15 chemokine receptor binding GO:0042379 69 5 6.33 1.19 5.15 intracellular GO:0005622 13914 155 6.06 1.03 13.75 deoxyribonucleotide metabolism GO:0009219 14 2 5.94 1.55 5.81 physiological process GO:0007582 20816 210 5.87 1.01 8.45 regulation of mitosis GO:0007088 78 5 5.87 1.28 7.67 regulation of cell cycle GO:0000074 938 22 5.82 1.1 11.04 biological_process GO:0008150 24118 235 5.81 1.01 5.95 DNA polymerase complex GO:0042575 15 2 5.71 1.5 5.56 binding GO:0005488 16238 171 5.65 1.01 9.16 traversing start control point of mitotic cell cycle GO:0007089 16 2 5.51 1.47 5.42 DNA-dependent ATPase activity GO:0008094 89 5 5.4 1.24 7.35 DNA replication initiation GO:0006270 36 3 5.34 1.38 6.8

Gene Ontology Analysis of Genes Downregulated in Tumors

GO annotation GO ID Total number Number of Z_b* Mean Z_q** of human genes Score fold down Score genes in GO downregulated annotation in NPC microtubule-based movement GO:0007018 112 13 12.99 1.2 6.73 cytoskeleton-dependent intracellular transport GO:0030705 112 13 12.99 1.2 6.73 dynein complex GO:0030286 72 10 12.61 1.44 10.9 spermatid development GO:0007286 15 4 11.36 1.54 5.85 GO:0005930 27 5 10.45 1.67 9.39 response to toxin GO:0009636 19 4 10.01 1.43 5.43 cytochrome-b5 reductase activity GO:0004128 13 3 9.11 1.62 6.1 serine-type endopeptidase inhibitor activity GO:0004867 146 10 8.32 1.28 10.38 cell projection GO:0042995 82 7 7.96 1.23 6.54 flagellum GO:0019861 18 3 7.64 1.51 6.15 microtubule motor activity GO:0003777 115 8 7.51 1.17 5.99 protein secretion GO:0009306 53 5 7.14 1.22 5.02 endopeptidase inhibitor activity GO:0004866 237 11 6.74 1.16 7.9 protease inhibitor activity GO:0030414 238 11 6.72 1.16 7.89 microtubule associated complex GO:0005875 208 10 6.59 1.13 6.19 regulation of protein secretion GO:0050708 11 2 6.54 1.61 5.52 axonemal dynein complex GO:0005858 24 3 6.51 1.5 6.96 fertilization (sensu Animalia) GO:0007338 62 5 6.5 1.32 7.55 motor activity GO:0003774 298 12 6.36 1.11 6.38 hormone metabolism GO:0042445 66 5 6.26 1.23 5.96 fertilization GO:0009566 67 5 6.2 1.28 7.07 aldehyde dehydrogenase [NAD(P)+] activity GO:0004030 13 2 5.97 1.66 6.43 tight junction GO:0005923 91 5 5.1 1.2 5.98

* Pearson-related Z scores (Z_b) ** Correlation-related Z scores (Z_q) Supplementary Table 5: Functional gene networks containing multiple human genes differentially expressed between tumor and normal samples (Ingenuity Pathway Analysis)

Group Global functions of genes in this group Probability Genes present in this group score**

1 Cell Cycle. DNA Replication, Recombination, 25 AKT1, AKT3(+), APPL, ASK(+), ASS(-), CCNE, CDC2(+), CDC7(+), and Repair. Cell Death. CDKN1A, CHC1, CHTF18, COPEB, DLG7(+), DPYSL2(+), FKBP1B(-), GADD45G, KIAA0101(+), KPNB3(+), MCM4(+), MYOD1, NFKBIA(+), PCNA(+), POSTN(+), PRDX1(-), PRKDC(+), RAN(+), RANBP3, RFC3(+), ROCK2, RRAD*(-), RYR1, TCL1A(-), TOPK(+), UNG(+), XPO1(+)

2 Cell Cycle. Cancer. Reproductive System 17 ANXA11(-), BUB1B(+), BUB3, CDC20, CENPE(+), CENPF*(+), CKB(-), Disease. GMNN(+), GSTA1(-), GSTA2, GSTM2, GSTM3, GSTP1, GSTYB4, JRK, KIF23(+), MAD2L1(+), MAD2L2, NDE1(+), OK/SW-CL.56, PRC1(+), RACGAP1(+), RBBP9(+), TUBA1(-), TUBA2, TUBA3(-), TUBA4,TUBA6, TUBA8, TUBB(-), TUBB1, TUBB2*(-), TUBB4*(-), TUBB5, TUBG1

3 Developmental Disorder. Cancer. Auditory 17 ADRB3, AHR, ALOX15(-), ARNT2(+), CAV1, CETN2(-), CYP4B1(-), Disease. DHFR, ELF3*(-), EP300, RBM9(+), SIM1, SIM2, SOCS2(+), STIM1, STOML3(+), TACC2*(-), TDG(+), TNFSF11(-), XPC, ESR1, FOXC2, GATA6(+), GCLC, GCLM(-), JAK2, KCNE1(-), KCNQ1, MGLL(-), MUC13(-), NFE2L2, NQO1*(-), PPARG, PRNP(+), RAD23B,

4 Cell Cycle. Cellular Assembly and 14 ANLN(+), AURKB, BARD1, CBX3(+), CDC6, DCT, DHFR, , E2F3(+), Organization. DNA Replication, , HIST2H2AA, HIST2H2BE(-), KNTC2(+), LMNA, MCM6, NEK2, Recombination, and Repair. PIR51(+), POLA2, RAD51, RB1, RBBP8(+),RNF144, RRM1(+), RRM2(+), SMC1L1(+), SMC2L1, SSX2IP(+), TAF1, TFDP2, TFE3, TFEC(+), TMPO*(+), TOP2A(+), TTK(+), ZNF267(+)

5 Cancer. Cellular Movement. Organismal 13 COPEB, FN1*(+), GZMA(+), GZMB(+), HMGB2(+), HNRPA2B1(+), Injury and Abnormalities. ITGAV(+), ITGB5, ITGB6, ITGB8, KRT4*(-), LAMA1, LAMA2, LAMA3, LAMA4, LAMA5, LAMB1*(+), LAMB1-2, LAMB3, LAMC1(+), LAMC2, LGALS3BP, LRG1(-), MMP12, MMP13, MMP14, MMP7, NID(+), PLAT, PLAU(+), SPARC*(+), THY1(+), TNFRSF9(+), TNFSF9, VHL

6 Cellular Development. Cellular Growth and 13 ACTA2(+), ACTB, ACTC, ACTG1, ACTG2, CCT4, CCT6A(+), CHEK1(+), Proliferation. Cancer. CIAA1, CIAA2, CLIC4, COL10A1, COL11A2, COL18A1, COL1A1*(+), COL1A2*(+), COL3A1*(+), COL4A1(+), COL5A3, CSF2RA, FGF7, GART(+), GBP1(+), ID2*(+), ID3, IGHM, IGLL1, OSM, PAX5(-), SFRS3(+), SLPI(-), TCEA3(-), THRB, TP53, VPREB3(-)

7 Immune Response. Cell-To-Cell Signaling 13 CD44, CRADD, CSF1R, CSPG2*(+), CXCL10(+), CXCL9(+), CXCR3, and Interaction. Hematological System DPP4, FANCA, FANCC, FANCE, FANCF, FANCG, FANCL(+), FBN1(+), Development and Function. FGF2(+), FYN, HIPK2, IFNG(+), IFNGR1, IL2RB, KRT14(-), MS4A1*(-), PF4, POR(-), SDC3, SELL, SOCS1(+), SPN, STAT1*(+), TBX21, TNFRSF21*(-), TNFRSF6*(+), TRADD, VIL2(-)

8 Cancer. Cell Cycle. Cell Death. 12 BRRN1, CCNA2, CCNE2(+), CD9, CDC2(+), CDC25A, CDK2, CDKN1A, CDKN1B, CNAP1, CUL1, DHFR, DUT(+), , E2F4, EED, EXOSC9(+), EZH2(+), FBXO15(-), GLI2, HCAP-G*(+), ICAM1, ITGA8, ITGB1, JJAZ1, KIAA0186(+), LOC255743(+), PI3*(-), PMAIP1(+), RBBP4, RBBP7, SMC2L1, SMC4L1*(+), TYMS(+), UNG2(-)

9 Immune Response. Inflammatory Disease. 12 AGC1, BNIPL(-), CCL2(+), CCR5, CEBPB, COL4A2(+), COL8A1(+), Cellular Movement. CXCL1, CXCL11*(+), CXCL2(-), DCN, HMGA2, ICAM1, IFNG(+), IL15*(+), IL2, IL6, IL8, LCN2(-), MIF, MMP1, MMP3, MMP9, MTPN, NFKB1, PIAS3(-), PTGS2*(+), PTX3, RELA, SAA1(-), SPARC*(+), TGFB1, TIMP1, TNF, TNFAIP6(+)

10 Cell Cycle. DNA Replication, Recombination, 10 ANGPT2(+), ARL6, ARL6IP, ARL6IP2(+), ARTS-1(+), BLM, CALD1*(+), and Repair. Cancer. CENPJ(+), F2, GJA1(+), IGHA1, IL8, KLF2, MGC33864(+), MLH1, MRE11A, MSH2, MSH6, , NBS1(+)*, NMI, PCNA(+), PIGR(-), PMS1(+), , RFC1, RFC2, RFC4, SERPINB6(-), STAT5A, TFRC*(+), TP73, VEGF, VTN, YY1

11 Embryonic Development. Tissue 10 APBA1, APOC1(+), CASK(+), CDH11(+), CGN(-), CIB1(-), CLDN1, Development. Neurological Disease. CTNNB1, DLG4, ETS1, FZD7*(+), GJA1(+), GJA7, GRIK2, GSK3B, HNF4A, HTR2C, JUP, KCNJ2, KCNJ4, LIN7C, NCSTN, OCLN, PEN2(-), PSEN1, PSEN2, RCN2(+), SLC27A2*(-), STXBP1, SYTL4(-), TJP1, TJP2, TJP3(-), VDR, VEZATIN*(+)

12 Immune Response. Cancer. Cellular 10 APCS, BMP1, CAPN10, CAPN11, CAPN2, CAPN5(-), CAPN6, CAPN7, Function and Maintenance. CAPN8, CAPN9(-), CASP8, COL5A1(+), COL5A2*(+), COL5A3, DDEF1(+), ERBB2, ERBB3, ERBB4, ESRRBL1(-), FCER1G, FCGR1A*(+), FCGR2A(+), FCGR3A(+), FURIN, HIP1, IGF1R, IGH-1A, MS4A2, MUC1*(-), MUC4*(-), PCSK5, PMCH(+), PTK2, SYK, TNFRSF10B(+) 13 . Tissue Development. 9 BAD, CAMK4, CREB1, CREM, EGR2, FKBP4, FKBP5(+), FOS, FOSL1, Cellular Growth and Proliferation. FOSL2, KCNMA1(+), MITF, NFATC1, NFYB(+), NR3C1, PRKACA, PRKCD, PTPRN, PTPRN2(-), RAF1, RAP2B(+), RCN1(+), ROBO1(+), RUNX1, S100A9(-), SELENBP1(-), SERPINB7(-), SERPINE1, SMAD1, SMAD3, STAR(+), STAT1*(+), TNF, VEGF, VIM

14 Cell Signaling. Cell-To-Cell Signaling and 6 CD14(+), CD151, CD19(-), CD2, CD36, CD37, CD4, CD81, CD9, CEBPA, Interaction. Tissue Development. CHN1(+), CR1, CR2(-), DAF*(-), FYN, IFITM1, ITGA3, ITGA4, ITGA5, ITGB1, LCK, LTF(-), MAL, PLCG2, PRKCA, PRKCB1, SCGB1A1(-), SOX4(+), SPI1, SYK, TITF1, TMP21, TPPP(-), VAV1, VMP

Genes in bold are differentially expressed between tumor and normal samples, either up (+) or down (-) regulated * Detected from multiple probesets ** Random chance of the genes in bold being identified in a single network is 1 in 10^Probability score Supplementary Table 6: Quantitative Real Time PCR measurements of EBV gene expression and MHC class I HLA expression in tumor (T) and normal (N) samples

Sample Number of Transcripts* ID EBNA1 LMP1 EBNA2 LMP2A BZLF1 BARF0 BHRF1 EBNA3A EBNA3B EBNA3C HLA-A, F

N1 4.17E+01 6.84E+02 0.00E+00 3.67E+01 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 2.37E+08 N2 1.08E+02 0.00E+00 0.00E+00 0.00E+00 2.15E+01 1.75E+02 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.11E+09 N3 2.71E+01 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 8.83E+08 N4 6.70E+02 2.01E+03 0.00E+00 2.31E+02 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.12E+10 N8 3.05E+01 0.00E+00 0.00E+00 0.00E+00 4.44E+01 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.18E+09 N7 4.14E+02 2.15E+03 0.00E+00 1.85E+02 0.00E+00 3.14E+03 0.00E+00 0.00E+00 0.00E+00 0.00E+00 2.19E+09 N5 1.49E+02 0.00E+00 0.00E+00 0.00E+00 0.00E+00 3.38E+02 0.00E+00 0.00E+00 0.00E+00 0.00E+00 3.64E+09 N6 1.48E+02 0.00E+00 0.00E+00 0.00E+00 2.48E+01 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 7.78E+08 N9 4.22E+01 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.04E+09 N10 2.90E+02 5.99E+02 0.00E+00 0.00E+00 5.55E+02 1.24E+03 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.90E+09 T1 7.77E+04 0.00E+00 9.68E+01 7.34E+01 7.37E+00 2.16E+07 0.00E+00 1.38E+01 0.00E+00 0.00E+00 7.05E+08 T2 5.17E+02 0.00E+00 0.00E+00 1.18E+03 0.00E+00 1.80E+06 0.00E+00 0.00E+00 0.00E+00 2.21E+01 8.21E+08 T3 1.87E+04 2.08E+01 8.82E+01 8.99E+03 5.75E+04 2.42E+04 1.91E+03 6.66E+02 5.95E+00 8.51E+01 6.24E+08 T4 1.28E+02 0.00E+00 0.00E+00 1.49E+01 9.87E-01 1.01E+03 0.00E+00 0.00E+00 0.00E+00 0.00E+00 4.70E+08 T5 5.91E+03 4.98E+04 5.49E+00 1.41E+04 1.88E+01 2.18E+07 1.48E+02 1.16E+01 2.62E+01 1.63E+00 4.61E+08 T6 9.11E+03 4.20E+02 2.55E+01 1.08E+04 0.00E+00 5.70E+06 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.15E+09 T7 8.51E+04 2.08E+03 3.38E+00 4.06E+04 1.34E+03 2.43E+07 0.00E+00 2.35E+01 1.29E+00 5.01E+01 6.48E+08 T8 3.87E+02 0.00E+00 0.00E+00 0.00E+00 1.89E+01 4.13E+06 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.00E+09 T9 1.22E+04 1.49E+03 4.13E+00 8.17E+03 1.90E+03 7.58E+06 2.62E+02 4.63E+01 1.63E+02 1.80E+01 4.27E+08 T10 9.83E+03 1.28E+05 3.35E+01 3.38E+03 6.69E+00 1.35E+06 0.00E+00 0.00E+00 0.00E+00 1.07E+01 1.63E+09 T11 8.84E+03 0.00E+00 1.24E+01 2.82E+02 4.38E+02 7.70E+06 1.10E+00 2.15E+01 1.63E+01 3.24E+01 4.70E+08 T12 1.11E+04 1.18E+04 0.00E+00 8.38E+03 0.00E+00 4.27E+02 0.00E+00 0.00E+00 0.00E+00 0.00E+00 5.12E+08 T13 4.81E+03 0.00E+00 0.00E+00 2.02E+03 3.25E+02 1.15E+07 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.06E+09 T14 1.06E+04 0.00E+00 0.00E+00 3.59E+02 9.17E+03 7.70E+06 0.00E+00 0.00E+00 0.00E+00 1.19E+01 1.64E+09 T15 3.30E+03 4.14E+03 1.12E+02 9.59E+03 1.88E+04 1.54E+07 4.75E+02 0.00E+00 6.36E+01 0.00E+00 6.05E+08 T16 2.56E+04 0.00E+00 1.50E+02 1.43E+04 3.78E+04 9.61E+05 0.00E+00 0.00E+00 0.00E+00 0.00E+00 6.38E+08 T17 1.07E+04 0.00E+00 7.05E+00 9.91E+02 1.93E+00 1.00E+07 0.00E+00 1.03E+00 3.36E+01 0.00E+00 7.36E+08 T18 2.68E+02 0.00E+00 0.00E+00 1.70E+03 5.92E+01 2.82E+07 0.00E+00 0.00E+00 0.00E+00 0.00E+00 7.46E+08 T19 2.12E+04 2.23E+02 2.29E+02 4.08E+03 3.50E+03 1.29E+07 2.29E+02 7.93E+01 3.31E+01 7.57E+01 2.41E+08 T20 8.32E+04 5.44E+03 0.00E+00 1.57E+04 2.11E+05 3.37E+05 9.74E+03 9.46E+01 1.27E+00 6.73E+02 3.43E+08 T21 1.18E+04 0.00E+00 0.00E+00 2.11E+03 1.62E+04 4.67E+07 0.00E+00 0.00E+00 0.00E+00 5.94E+01 2.13E+09 T22 1.72E+04 6.95E+04 0.00E+00 2.75E+04 0.00E+00 8.52E+06 0.00E+00 0.00E+00 0.00E+00 0.00E+00 1.31E+09 T23 1.25E+05 2.67E+02 2.33E+02 2.68E+04 1.17E+03 1.64E+07 8.51E+02 2.21E+02 1.76E+02 4.44E+02 2.28E+08 T24 4.11E+04 9.99E+03 0.00E+00 7.07E+01 3.48E+03 1.29E+07 0.00E+00 0.00E+00 0.00E+00 0.00E+00 7.39E+08 T25 3.71E+03 9.38E+01 2.58E+01 3.96E+03 9.02E+01 1.38E+07 1.25E+02 2.04E+01 1.63E+01 7.44E+00 5.81E+08 T26 2.15E+04 2.68E+03 4.74E+02 4.59E+03 8.74E+01 2.41E+07 0.00E+00 0.00E+00 0.00E+00 0.00E+00 7.35E+08 T27 3.24E+04 4.65E+02 2.15E+01 9.63E+03 2.13E+04 1.98E+07 2.58E+02 2.38E+02 4.16E-01 1.33E+02 6.73E+08 T28 1.67E+04 2.46E+02 1.52E+02 1.53E+04 1.52E+03 6.48E+07 0.00E+00 1.47E+01 9.04E+00 0.00E+00 7.12E+08 T29 2.30E+04 1.03E+02 3.08E+00 5.11E+03 6.52E+02 5.75E+06 0.00E+00 0.00E+00 0.00E+00 0.00E+00 4.08E+08 T30 5.97E+02 0.00E+00 1.15E+02 6.76E+03 0.00E+00 6.26E+07 0.00E+00 0.00E+00 0.00E+00 0.00E+00 5.21E+09 T31 8.43E+03 4.38E+02 3.69E+00 1.38E+04 5.52E+04 4.06E+07 4.00E+03 7.58E+00 1.89E+01 0.00E+00 4.92E+08

* Number of transcripts = number of transcripts detected/number of β-actin transcripts in the same sample X 10^8 Supplementary Table 7. Genes in Gene Ontology class 'antigen presentation, endogenous antigen'

Serial Gene Spearman's Affymetrix Gene Title Chromosomal Number Symbol rank correlation Probeset ID Location with EBNA1

1 HLA-A -0.616 213932_x_at major histocompatibility complex, class I, A 6p21.3 2 HLA-A -0.5904 215313_x_at major histocompatibility complex, class I, A 6p21.3 3 HLA-B -0.4548 209140_x_at major histocompatibility complex, class I, B 6p21.3 4 HLA-B -0.4185 211911_x_at major histocompatibility complex, class I, B 6p21.3 5 HLA-B -0.404 208729_x_at major histocompatibility complex, class I, B 6p21.3 6 HLA-C -0.5746 208812_x_at major histocompatibility complex, class I, C 6p21.3 7 HLA-C -0.5565 214459_x_at major histocompatibility complex, class I, C 6p21.3 8 HLA-C -0.5539 216526_x_at major histocompatibility complex, class I, C 6p21.3 9 HLA-C -0.4419 211799_x_at major histocompatibility complex, class I, C 6p21.3 10 HLA-E -0.4855 200904_at major histocompatibility complex, class I, E 6p21.3 11 HLA-E -0.4052 200905_x_at major histocompatibility complex, class I, E 6p21.3 12 HLA-E -0.4036 217456_x_at major histocompatibility complex, class I, E 6p21.3 13 HLA-F -0.6391 221875_x_at major histocompatibility complex, class I, F 6p21.3 14 HLA-F -0.6048 204806_x_at major histocompatibility complex, class I, F 6p21.3 15 HLA-F -0.5452 221978_at major histocompatibility complex, class I, F 6p21.3 16 HLA-F -0.256 222279_at major histocompatibility complex, class I, F 6p21.3 17 HLA-G -0.5536 210514_x_at HLA-G histocompatibility antigen, class I, G 6p21.3 18 HLA-G -0.548 211529_x_at HLA-G histocompatibility antigen, class I, G 6p21.3 19 HLA-G -0.5286 211528_x_at HLA-G histocompatibility antigen, class I, G 6p21.3 20 HLA-G -0.4339 211530_x_at HLA-G histocompatibility antigen, class I, G 6p21.3 21 HFE -0.4427 210864_x_at hemochromatosis 6p21.3 22 HFE -0.3831 211863_x_at hemochromatosis 6p21.3 23 HFE -0.3645 211331_x_at hemochromatosis 6p21.3 24 HFE -0.3617 211326_x_at hemochromatosis 6p21.3 25 HFE -0.3583 211328_x_at hemochromatosis 6p21.3 26 HFE -0.3 211332_x_at hemochromatosis 6p21.3 27 HFE -0.2657 211329_x_at hemochromatosis 6p21.3 28 HFE -0.102 211327_x_at hemochromatosis 6p21.3 29 HFE -0.0863 211866_x_at hemochromatosis 6p21.3 30 HFE -0.0847 206086_x_at hemochromatosis 6p21.3 31 HFE -0.0536 206087_x_at hemochromatosis 6p21.3 32 HFE -0.0496 235754_at hemochromatosis 6p21.3 33 HFE -0.025 1553402_a_at hemochromatosis 6p21.3 34 HFE 0.0153 211330_s_at hemochromatosis 6p21.3 35 HFE 0.2633 214647_s_at hemochromatosis 6p21.3 36 TAP2 -0.3218 204769_s_at transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) 6p21.3 37 TAP2 -0.2601 204770_at transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) 6p21.3 38 TAP2 -0.2109 225973_at transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) 6p21.3 39 TAP2 -0.1339 208428_at transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) 6p21.3 40 TRPC4AP 0.0597 212059_s_at transient receptor potential cation channel, subfamily C, 3q23 member 4 associated protein 41 CD1D -0.3794 205789_at CD1D antigen, d polypeptide 1q22-q23 42 HCG9 -0.3871 208287_at HLA complex group 9 6p21.3 Supplementary Table 8: Genes whose expression is most inversely correlated with that of EBV EBNA1.

Gene Symbol Spearman's Gene Title Chromosomal Affymetrix rank correlation Location ProbeSet ID coefficient

PSMD5 -0.76 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 9q34.11 239958_at --- -0.73 ------216739_at BASP1 -0.72 brain abundant, membrane attached signal protein 1 5p15.1-p14 228589_at LOC339483 -0.72 hypothetical protein LOC339483 1p34.3 228593_at CACNA1I -0.71 calcium channel, voltage-dependent, alpha 1I subunit 22q13.1 221631_at ARPC4 -0.71 actin related protein 2/3 complex, subunit 4, 20kDa 3p25.3 210129_s_at --- -0.71 ------216630_at ZFP42 -0.71 zinc finger protein 42 4q35.2 1554776_at SLC39A3 -0.70 solute carrier family 39 (zinc transporter), member 3 19p13.3 229677_at ARHGEF1 -0.70 Rho guanine exchange factor (GEF) 1 19q13.13 203055_s_at --- -0.70 ------234460_at B3GALT4 -0.70 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 6p21.3 210205_at HPX -0.69 hemopexin 11p15.5-p15.4 39763_at WBSCR20A -0.69 Williams Beuren syndrome chromosome region 20A 7q11.23 203802_x_at FLJ20014 -0.69 hypothetical protein FLJ20014 17p13.1 219417_s_at FLJ32752 -0.69 hypothetical protein FLJ32752 11p15.4 229631_at FLJ10154 -0.69 hypothetical protein FLJ10154 13q33.2 228477_at PPARD -0.68 peroxisome proliferative activated receptor, delta 6p21.2-p21.1 208044_s_at --- -0.68 ------1555400_at --- -0.68 Homo sapiens transcribed sequences --- 238141_s_at D21S2056E -0.68 DNA segment on chromosome 21 (unique) 2056 expressed sequence 21q22.3 222733_x_at PTPRE -0.68 protein tyrosine phosphatase, receptor type, E 10q26 1559018_at BCL6B -0.68 B-cell CLL/lymphoma 6, member B (zinc finger protein) 17p13.1 242148_at WDTC1 -0.68 WD and tetratricopeptide repeats 1 1p35.3 40829_at --- -0.67 Homo sapiens hypothetical protein LOC339988, mRNA --- 1562697_at (cDNA clone IMAGE:5217034), partial cds HYAL3 -0.67 hyaluronoglucosaminidase 3 3p21.3 210874_s_at GATA2 -0.67 GATA binding protein 2 3q21.3 210358_x_at TFEB -0.67 transcription factor EB 6p21 221866_at KIAA0356 -0.67 KIAA0356 gene product 17q21.31 212717_at FLJ10640 -0.67 hypothetical protein FLJ10640 16q22.1 219695_at PDE6B -0.67 6B, cGMP-specific, rod, beta (congenital stationary 4p16.3 1557777_at night blindness 3, autosomal dominant) KCNAB2 -0.67 potassium voltage-gated channel, shaker-related subfamily, beta member 2 1p36.3 203402_at ZNF151 -0.67 zinc finger protein 151 (pHZ-67) 1p36.2-p36.1 203602_s_at --- -0.67 Homo sapiens transcribed sequence with strong similarity to protein --- 230980_x_at ref:NP_078795.1 (H.sapiens) hypothetical protein FLJ13725; KIAA1930 protein [Homo sapiens] --- -0.67 Homo sapiens cDNA FLJ16052 fis, clone KIDNE2010264 --- 230381_at FLJ21438 -0.67 hypothetical protein FLJ21438 19p13.12 228677_s_at --- -0.67 Homo sapiens mRNA; cDNA DKFZp667F0617 (from clone DKFZp667F0617) --- 236854_at MGC5566 -0.67 hypothetical protein MGC5566 20q13.12 220449_at FLJ40906 -0.67 hypothetical protein FLJ40906 1p34.2 241450_at PITPNM2 -0.67 phosphatidylinositol transfer protein, membrane-associated 2 12q24.31 232950_s_at CSF2 -0.67 colony stimulating factor 2 (granulocyte-macrophage) 5q31.1 210228_at C10orf26 -0.67 chromosome 10 open reading frame 26 10q24.33 202808_at CYLD -0.66 cylindromatosis (turban tumor syndrome) 16q12-q13 221903_s_at STK10 -0.66 serine/threonine kinase 10 5q35.1 40420_at KIAA1643 -0.66 KIAA1643 protein 4p16.3 1569369_at --- -0.66 Homo sapiens cDNA FLJ44327 fis, clone TRACH3002866 2q14.2 231043_at DKFZp434I1117 -0.66 hypothetical protein DKFZp434I1117 9q22.32 234414_at FAM13A1 -0.66 family with sequence similarity 13, member A1 4q22.1 1558711_at SPG7 -0.66 spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive) 16q24.3 235325_at --- -0.66 Homo sapiens transcribed sequences --- 239060_at PLEKHF1 -0.66 pleckstrin homology domain containing, family F (with FYVE domain) member 1 19q13.11 219566_at FLJ39502 -0.66 hypothetical protein FLJ39502 2q31.3 1553645_at ANXA9 -0.66 annexin A9 /// annexin A9 1q21 /// 1q21 211712_s_at MSRA -0.66 methionine sulfoxide reductase A 8p23.1 219281_at ZDHHC14 -0.66 zinc finger, DHHC domain containing 14 6q25.3 219247_s_at SYMPK -0.66 symplekin 19q13.3 202339_at --- -0.66 Homo sapiens transcribed sequence with strong similarity to protein --- /// --- 205611_at ref:NP_003800.1 (H.sapiens) tumor necrosis factor (ligand) superfamily, member 12 [Homo sapiens] --- -0.65 ------1560814_a_at FLJ40288 -0.65 hypothetical protein FLJ40288 7q32.3 237659_at RASA3 -0.65 RAS p21 protein activator 3 13q34 225562_at --- -0.65 ------216406_at --- -0.65 Homo sapiens transcribed sequence with weak similarity to protein --- 237977_at sp:Q08379 (H.sapiens) GG95_HUMAN Golgin-95 --- -0.65 ------1563903_x_at --- -0.65 Homo sapiens transcribed sequences --- 243929_at NIN -0.65 ninein (GSK3B interacting protein) 14q22.1 224304_x_at --- -0.65 Homo sapiens transcribed sequence with weak similarity to protein --- 239408_at ref:NP_062553.1 (H.sapiens) hypothetical protein FLJ11267 [Homo sapiens] LIMD1 -0.65 LIM domains containing 1 3p21.3 234687_x_at LRRN4 -0.65 leucine rich repeat neuronal 4 7q22 222017_x_at AKIP -0.65 aurora-A kinase interacting protein 1p36.33 228800_x_at --- -0.65 Homo sapiens clone IMAGE:123704, mRNA sequence --- 233670_at LOC116236 -0.65 hypothetical protein LOC116236 17q11.2 226796_at MGC39372 -0.65 hypothetical protein MGC39372 6p25.2 239186_at CTLA4 -0.65 cytotoxic T-lymphocyte-associated protein 4 2q33 221331_x_at PRRX1 -0.65 paired related homeobox 1 1q24 217226_s_at 7h3 -0.64 hypothetical protein FLJ13511 19p13.13 212962_at --- -0.64 Homo sapiens, clone IMAGE:5172167, mRNA --- 1570182_at CYFIP2 -0.64 cytoplasmic FMR1 interacting protein 2 5q33.3 215785_s_at SP100 -0.64 nuclear antigen Sp100 2q37.1 210219_at FLJ12242 -0.64 hypothetical protein FLJ12242 22q13.1 205561_at --- -0.64 Homo sapiens transcribed sequences --- 228675_at --- -0.64 Homo sapiens mRNA; cDNA DKFZp686I0374 (from clone DKFZp686I0374) --- 236406_at WBSCR20A -0.64 Williams Beuren syndrome chromosome region 20A 7q11.23 213773_x_at LOC90313 -0.64 hypothetical protein BC004507 17q11.2 225605_at MIST1 -0.64 class II bHLH protein MIST1 7q22.1 227581_at USP35 -0.64 ubiquitin specific protease 35 11q13.4 229198_at KRT4 -0.64 keratin 4 12q12-q13 214399_s_at MGC47869 -0.64 hypothetical protein MGC47869 12p13.1 243056_at --- -0.64 Homo sapiens similar to Rho GTPase activating protein 12 (LOC374805), mRNA 17q21.31 225618_at HLA-F -0.64 major histocompatibility complex, class I, F 6p21.3 221875_x_at FLJ36878 -0.64 hypothetical protein FLJ36878 17p13.2 230633_at --- -0.64 Homo sapiens hypothetical protein LOC339988, mRNA --- 1562698_x_at (cDNA clone IMAGE:5217034), partial cds FLJ37464 -0.64 hypothetical protein FLJ37464 16q22.1 228903_at SREBF1 -0.64 sterol regulatory element binding transcription factor 1 17p11.2 1558875_at ITGB3 -0.64 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 17q21.32 216261_at TEX261 -0.64 testis expressed gene 261 2p13.2 1559675_at FLJ00007 -0.64 hypothetical protein FLJ00007 5q31.3 226699_at FLJ39249 -0.63 ADP-ribosylation factor-like membrane-associated protein 5q35.3 1553207_at --- -0.63 Homo sapiens cDNA: FLJ21256 fis, clone COL01402 --- 216166_at FLJ35827 -0.63 hypothetical protein FLJ35827 11q12.3 203442_x_at MGC15875 -0.63 hypothetical protein MGC15875 5q35.3 226519_s_at TAGLN -0.63 transgelin 11q23.2 218765_at NAP1 -0.63 pronapsin A 19q13.33 223806_s_at FCRH1 -0.63 Fc receptor-like protein 1 1q21-q22 235982_at --- -0.63 ------1566232_at KIAA1530 -0.63 KIAA1530 protein 4p16.3 1555107_a_at WBSCR20C -0.63 Williams Beuren syndrome chromosome region 20C 7q11.23 213842_x_at LOC51257 -0.63 hypothetical protein LOC51257 19p13.3 210075_at MGC43690 -0.63 hypothetical protein MGC43690 6q27 237823_at --- -0.63 Homo sapiens transcribed sequences --- 236176_at HSD17B1 -0.63 hydroxysteroid (17-beta) dehydrogenase 1 17q11-q21 205829_at NOD27 -0.63 nucleotide-binding oligomerization domains 27 16q13 226474_at TU3A -0.63 TU3A protein 3p21.1 209074_s_at NHLH1 -0.63 nescient helix loop helix 1 1q22 214628_at --- -0.63 Homo sapiens, clone IMAGE:5302821, mRNA --- 1562974_at --- -0.63 Homo sapiens transcribed sequences --- 240737_at AIM1L -0.63 absent in melanoma 1-like 1p35.3 220289_s_at MAP2K3 -0.63 mitogen-activated protein kinase kinase 3 17q11.2 215499_at MBC2 -0.63 likely ortholog of mouse membrane bound containing protein 12q13.13 239338_x_at ACTN2 -0.63 , alpha 2 1q42-q43 203863_at --- -0.63 Homo sapiens transcribed sequences --- 243168_at HRASLS3 -0.63 HRAS-like suppressor 3 11q13.1 209581_at --- -0.63 Homo sapiens EST from clone 898903, full insert --- 214783_s_at PPP1R3B -0.63 1, regulatory (inhibitor) subunit 3B 8p23.1 1552669_at LOC170394 -0.63 hypothetical protein BC011630 10q26.3 227999_at WBSCR20C -0.62 Williams Beuren syndrome chromosome region 20C 7q11.23 213460_x_at WBSCR20C -0.62 Williams Beuren syndrome chromosome region 20C 7q11.23 213670_x_at SPTBN5 -0.62 , beta, non-erythrocytic 5 15q21 1556839_s_at UNC84B -0.62 unc-84 homolog B (C. elegans) 22q13.1 212144_at KCNK7 -0.62 potassium channel, subfamily K, member 7 11q13 220412_x_at GALNS -0.62 galactosamine (N-acetyl)-6-sulfate sulfatase (Morquio syndrome, 16q24.3 236866_at mucopolysaccharidosis type IVA) KIAA0226 -0.62 KIAA0226 gene product 3q29 212735_at PRX -0.62 periaxin 19q13.13-q13.2 220024_s_at IDS -0.62 iduronate 2-sulfatase (Hunter syndrome) Xq28 212221_x_at SLC25A28 -0.62 solute carrier family 25, member 28 10q23-q24 223192_at NEU3 -0.62 sialidase 3 (membrane sialidase) 11q13.5 206948_at CAMTA2 -0.62 calmodulin binding transcription activator 2 17p13.3 212948_at --- -0.62 Homo sapiens mRNA; cDNA DKFZp547G1017 (from clone DKFZp547G1017) --- 1564937_at PITX1 -0.62 paired-like homeodomain transcription factor 1 5q31 1569561_at FLJ40597 -0.62 hypothetical protein FLJ40597 3q21.1 1553380_at DKFZp547K1113 -0.62 hypothetical protein DKFZp547K1113 15q26.1 213542_at FLJ33817 -0.62 hypothetical protein FLJ33817 17p13.3 226738_at PP1665 -0.62 hypothetical protein PP1665 11q13.3 32502_at --- -0.62 Homo sapiens similar to Inosine-5-monophosphate dehydrogenase 1 10q22.3 240049_at (IMP dehydrogenase 1) (IMPDH-I) (IMPD 1) (LOC340780), mRNA GADD45B -0.62 growth arrest and DNA-damage-inducible, beta 19p13.3 207574_s_at HLA-A -0.62 major histocompatibility complex, class I, A 6p21.3 213932_x_at STK10 -0.62 serine/threonine kinase 10 5q35.1 203047_at --- -0.62 Homo sapiens transcribed sequences --- 230286_at SYT11 -0.61 synaptotagmin XI 1q21.2 209197_at LIMS2 -0.61 LIM and senescent cell antigen-like domains 2 2q21.1 220765_s_at LENEP -0.61 lens epithelial protein 1q22 221115_s_at LOC143425 -0.61 similar to synaptotagmin V 11p15.4 232445_at FUT5 -0.61 5 (alpha (1,3) fucosyltransferase) 19p13.3 211225_at MCF2L -0.61 MCF.2 cell line derived transforming sequence-like 13q34 1552743_at --- -0.61 Homo sapiens cDNA clone IMAGE:5269842, partial cds --- 1561668_at LRRN4 -0.61 leucine rich repeat neuronal 4 7q22 204692_at SCYL1 -0.61 SCY1-like 1 (S. cerevisiae) 11q13 229601_at ESR2 -0.61 2 (ER beta) 14q 1569554_at E2-230K -0.61 likely ortholog of mouse ubiquitin-conjugating enzyme E2-230K 17q25.1 1554814_at LOC255025 -0.61 hypothetical protein LOC255025 3q11.2 1556406_at T3JAM -0.61 TRAF3-interacting Jun N-terminal kinase (JNK)-activating modulator 1q32.3-q41 213888_s_at TNFRSF18 -0.61 tumor necrosis factor receptor superfamily, member 18 1p36.3 223851_s_at STK10 -0.61 serine/threonine kinase 10 5q35.1 228394_at --- -0.61 Homo sapiens mRNA similar to RIKEN cDNA 1110028A07 gene 14q11.2 229567_at (cDNA clone MGC:46490 IMAGE:5225142), complete cds FGD2 -0.61 FGD1 family, member 2 6p21.31 1565754_x_at COTL1 -0.61 coactosin-like 1 (Dictyostelium) 16q24.1 1556346_at VIK -0.61 vav-1 interacting Kruppel-like protein 7q22.1 230277_at PPARD -0.61 peroxisome proliferative activated receptor, delta 6p21.2-p21.1 37152_at --- -0.61 ------211902_x_at POU6F1 -0.61 POU domain, class 6, transcription factor 1 12q13.13 216330_s_at FLJ11127 -0.61 hypothetical protein FLJ11127 5p15.2 219694_at LLT1 -0.61 lectin-like NK cell receptor 12p13 235522_at STARD3 -0.61 START domain containing 3 17q11-q12 202991_at CTNS -0.61 cystinosis, nephropathic 17p13 204925_at ARHGAP4 -0.61 Rho GTPase activating protein 4 Xq28 204425_at FLJ11383 -0.61 hypothetical protein FLJ11383 1q42.2 205689_at --- -0.61 Homo sapiens cDNA FLJ12624 fis, clone NT2RM4001754. --- 216448_at CD3Z -0.61 CD3Z antigen, zeta polypeptide (TiT3 complex) 1q22-q23 210031_at FBI1 -0.61 HIV-1 inducer of short transcripts binding protein 19p13.3 222082_at RPS6KA1 -0.61 ribosomal protein S6 kinase, 90kDa, polypeptide 1 3 203379_at CNK -0.61 cytokine-inducible kinase 1p34.1 204958_at PTPN1 -0.61 protein tyrosine phosphatase, non-receptor type 1 20q13.1-q13.2 239526_x_at --- -0.61 Homo sapiens cDNA FLJ40163 fis, clone TESTI2015830. --- 1561575_at KIF13B -0.61 kinesin family member 13B 8p21.1 1561052_s_at HT011 -0.61 uncharacterized hypothalamus protein HT011 Xq26.1 1562919_at ASB14 -0.61 ankyrin repeat and SOCS box-containing 14 3p21.1 237785_at HLA-F -0.60 major histocompatibility complex, class I, F 6p21.3 204806_x_at FGF11 -0.60 fibroblast growth factor 11 17p13.1 227271_at --- -0.60 Homo sapiens cDNA FLJ30493 fis, clone BRAWH2000248. --- 241218_at FGD2 -0.60 FGD1 family, member 2 6p21.31 1565752_at SIGLEC7 -0.60 sialic acid binding Ig-like lectin 7 19q13.3 216537_s_at KIAA0513 -0.60 KIAA0513 gene product 16q24.1 204546_at MRPL39 -0.60 mitochondrial ribosomal protein L39 21q21.3 225124_at GRF2 -0.60 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) 9q34.3 225738_at --- -0.60 Homo sapiens mRNA; cDNA DKFZp564C156 (from clone DKFZp564C156) --- 232910_at MGC50844 -0.60 hypothetical protein MGC50844 7q32.3 225775_at BA108L7.2 -0.60 similar to rat tricarboxylate carrier-like protein /// similar to rat tricarboxylate 10q24.32 /// 220974_x_at carrier-like protein 10q24.32 FMNL1 -0.60 formin-like 1 17q21 204789_at --- -0.60 Homo sapiens similar to nuclear pore complex interacting protein 16q22.3 221992_at (LOC374745), mRNA FLJ11286 -0.60 hypothetical protein FLJ11286 19p13.2 1555491_a_at VAV2 -0.60 vav 2 oncogene 9q34.1 205536_at TNFSF14 -0.60 tumor necrosis factor (ligand) superfamily, member 14 19p13.3 207907_at ATP6V0E -0.60 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e 5q35.2 214150_x_at CISH -0.60 cytokine inducible SH2-containing protein 3p21.3 221223_x_at PACSIN1 -0.60 protein kinase C and casein kinase substrate in 1 6p21.3 227053_at CRX -0.60 cone-rod homeobox 19q13.3 231742_at --- -0.60 Homo sapiens transcribed sequences --- 241239_at SPAP1 -0.60 SH2 domain containing phosphatase anchor protein 1 1q21 224194_at T3JAM -0.60 TRAF3-interacting Jun N-terminal kinase (JNK)-activating modulator 1q32.3-q41 205804_s_at KCNG1 -0.60 potassium voltage-gated channel, subfamily G, member 1 /// 20q13 /// 20q13 211053_at potassium voltage-gated channel, subfamily G, member 1 H6PD -0.60 hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1p36 226160_at U5-116KD -0.60 U5 snRNP-specific protein, 116 kD 17q21.31 222397_at --- -0.60 Homo sapiens cDNA clone IMAGE:6103129, partial cds --- 231503_at LOC90557 -0.60 hypothetical protein BC016861 2q21.2 231657_s_at

Genes might be represented my multiple probesets Supplementary Table 9: Genes Differentially expressed between LMP1-positive and -negative tumors

Gene Symbol Fold Gene Title Chromosomal Affymetrix Change Location Probeset ID

PRO1073 4.44 PRO1073 protein 11cen-q12.3 224567_x_at PRO1073 3.78 PRO1073 protein 11cen-q12.3 226675_s_at RASSF6 3.73 Ras association (RalGDS/AF-6) domain family 6 4q21.21 235638_at TNFRSF11B 3.56 tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) 8q24 204932_at PRO1073 3.48 PRO1073 protein 11cen-q12.3 223940_x_at PRO1073 3.12 PRO1073 protein 11cen-q12.3 224568_x_at CDC42BPA 3.03 CDC42 binding protein kinase alpha (DMPK-like) 1q42.11 214464_at PMAIP1 3.01 phorbol-12-myristate-13-acetate-induced protein 1 18q21.32 204285_s_at --- 3.01 Homo sapiens mRNA; cDNA DKFZp586B0220 (from clone DKFZp586B0220) 12q14.2 213817_at C20orf6 2.83 chromosome 20 open reading frame 6 20p12.1 218859_s_at USP1 2.79 ubiquitin specific protease 1 1p32.1-p31.3 202412_s_at MEGF10 2.79 MEGF10 protein 5q33 232523_at --- 2.79 Homo sapiens cDNA FLJ37855 fis, clone BRSSN2014636. --- 236985_at MEST 2.77 mesoderm specific transcript homolog (mouse) 7q32 202016_at ATRX 2.75 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) Xq13.1-q21.1 208859_s_at CALB1 2.73 1, 28kDa 8q21.3-q22.1 205626_s_at BCL2A1 2.73 BCL2-related protein A1 15q24.3 205681_at DKFZP434D193 2.73 DKFZP434D193 protein 2q24.1 236620_at TOP2A 2.71 topoisomerase (DNA) II alpha 170kDa 17q21-q22 201291_s_at LIFR 2.71 leukemia inhibitory factor receptor 5p13-p12 225571_at TRA1 2.69 tumor rejection antigen (gp96) 1 12q24.2-q24.3 200598_s_at CBX3 2.66 chromobox homolog 3 (HP1 gamma homolog, Drosophila) 7p15.2 1555920_at CSPG6 2.62 chondroitin sulfate proteoglycan 6 (bamacan) 10q25 209258_s_at IRA1 2.58 likely ortholog of mouse IRA1 protein 3q26.33 222633_at --- 2.58 Homo sapiens transcribed sequences --- 238852_at KIAA1033 2.55 KIAA1033 protein 12q24.11 212794_s_at VDP 2.53 vesicle docking protein p115 4q21.21 201831_s_at CYP4X1 2.53 likely ortholog of rat cytochrome P450 4X1 1p33 227702_at --- 2.53 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060312.1 (H.sapiens) --- 242024_at hypothetical protein FLJ20489 [Homo sapiens] PRKAR2B 2.51 protein kinase, cAMP-dependent, regulatory, type II, beta 7q22-q31.1 203680_at MMP1 2.50 matrix metalloproteinase 1 (interstitial collagenase) 11q22.3 204475_at PMAIP1 2.48 phorbol-12-myristate-13-acetate-induced protein 1 18q21.32 204286_s_at TBDN100 2.48 transcriptional coactivator tubedown-100 4q31.1 219158_s_at SART3 2.45 squamous cell carcinoma antigen recognised by T cells 3 12q24.1 209127_s_at NEDD1 2.43 neural precursor cell expressed, developmentally down-regulated 1 12q23.1 1552417_a_at ZNF294 2.43 zinc finger protein 294 21q22.11 233819_s_at FLJ10201 2.41 hypothetical protein FLJ10201 3q27.3 236462_at --- 2.38 Homo sapiens, clone IMAGE:5285801, mRNA --- 1556194_a_at TOP1 2.38 topoisomerase (DNA) I 20q12-q13.1 208900_s_at IQGAP1 2.36 IQ motif containing GTPase activating protein 1 15q26.1 213446_s_at USP16 2.36 ubiquitin specific protease 16 21q22.11 222616_s_at PRO1073 2.35 PRO1073 protein 11cen-q12.3 1558678_s_at 2.35 protein syncoilin /// intermediate filament protein syncoilin 1p34.3-p33 /// 1p34.3-p33 221276_s_at MGC34032 2.35 hypothetical protein MGC34032 1p31.1 235763_at MYO6 2.31 myosin VI 6q13 203215_s_at --- 2.30 Homo sapiens, clone IMAGE:5278245, mRNA --- 1565811_at ZNF198 2.30 zinc finger protein 198 13q11-q12 210282_at MGC14289 2.30 similar to RIKEN cDNA 1200014N16 gene 7q34 228280_at SYNCRIP 2.28 synaptotagmin binding, cytoplasmic RNA interacting protein 6q14-q15 209024_s_at DHX9 2.28 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1q25 212107_s_at KIAA0924 2.28 KIAA0924 protein 17q21.33 243495_s_at UNQ8193 2.28 AAIR8193 Xq21.1 244187_at --- 2.27 Homo sapiens transcribed sequence with moderate similarity to protein pir:I60307 (E. coli) I60307 --- 231152_at beta-galactosidase, alpha peptide - Escherichia coli TNFRSF11B 2.25 tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) 8q24 204933_s_at APG-1 2.25 heat shock protein (hsp110 family) 4q28 205543_at SULF1 2.23 sulfatase 1 8q13.2 212353_at CALB1 2.20 calbindin 1, 28kDa 8q21.3-q22.1 205625_s_at ESRRG 2.20 estrogen-related receptor gamma 1q41 207981_s_at OSF-2 2.20 osteoblast specific factor 2 (fasciclin I-like) 13q13.3 210809_s_at PIR 2.19 Pirin Xp22.31 207469_s_at GATM 2.17 glycine amidinotransferase (L-arginine:glycine amidinotransferase) 15q15.1 203178_at TTC3 2.17 tetratricopeptide repeat domain 3 21q22.2 208663_s_at FAIM 2.17 Fas apoptotic inhibitory molecule 3q22.3 220643_s_at HSPCA 2.16 heat shock 90kDa protein 1, alpha 14q32.33 211968_s_at --- 2.14 Homo sapiens transcribed sequences --- 242693_at DYRK2 2.13 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 12q14.3 202971_s_at --- 2.13 Homo sapiens, clone IMAGE:4798349, mRNA --- 231576_at OSF-2 2.10 osteoblast specific factor 2 (fasciclin I-like) 13q13.3 1555778_a_at B3GALT3 2.10 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 3q25 223374_s_at --- 2.10 Homo sapiens transcribed sequences --- 242312_x_at DNAJC3 2.08 DnaJ (Hsp40) homolog, subfamily C, member 3 13q32 1558080_s_at --- 2.08 Homo sapiens cDNA clone IMAGE:5294683, partial cds --- 1558714_at SCAMP1 2.08 secretory carrier membrane protein 1 5q13.3-q14.1 212417_at FLJ11011 2.08 hypothetical protein FLJ11011 8q13.3 218521_s_at APPL 2.08 adaptor protein containing pH domain, PTB domain and leucine zipper motif 3p21.1-p14.3 222538_s_at --- 2.08 Homo sapiens mRNA; cDNA DKFZp686L18111 (from clone DKFZp686L18111) --- 238370_x_at --- 2.08 Homo sapiens transcribed sequences --- 243278_at SPAG9 2.07 sperm associated antigen 9 17q21.33 212468_at SFXN1 2.07 sideroflexin 1 --- 232055_at SPIB 2.07 Spi-B transcription factor (Spi-1/PU.1 related) 19q13.3-q13.4 232739_at --- 2.07 Homo sapiens full length insert cDNA clone YZ11B11 --- 244035_at GHR 2.06 growth 5p13-p12 205498_at EIF5A2 2.06 eukaryotic translation initiation factor 5A2 3q26.2 235296_at KIT 2.04 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 4q11-q12 205051_s_at GALNT1 2.03 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 18q12.1 1568618_a_at CSPG6 2.03 chondroitin sulfate proteoglycan 6 (bamacan) 10q25 209257_s_at KRAS2 2.03 v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog 12p12.1 214352_s_at RINZF 2.03 zinc finger protein RINZF 8q13-q21.1 219312_s_at TERA 2.03 TERA protein 12p11 223038_s_at --- 2.03 Homo sapiens mRNA; cDNA DKFZp686L01105 (from clone DKFZp686L01105) --- 227062_at KIAA0650 2.01 KIAA0650 protein 18p11.31 1558747_at NR1D2 2.01 subfamily 1, group D, member 2 3p24.1 209750_at ZNF22 2.01 zinc finger protein 22 (KOX 15) 10q11 218006_s_at --- 2.00 Homo sapiens cDNA: FLJ21448 fis, clone COL04473 --- 1564378_a_at HSXIAPAF1 2.00 XIAP associated factor-1 17p13.2 206133_at RINZF 2.00 zinc finger protein RINZF 8q13-q21.1 233899_x_at ARHGEF7 2.00 Rho guanine nucleotide exchange factor (GEF) 7 13q34 235412_at MEGF10 2.00 MEGF10 protein 5q33 236517_at --- 2.00 Homo sapiens transcribed sequences --- 239571_at KIAA0874 1.99 KIAA0874 protein 18p11.22 216550_x_at PRO1073 1.99 PRO1073 protein 11cen-q12.3 227510_x_at ILF3 1.97 interleukin enhancer binding factor 3, 90kDa 19p13.2 208930_s_at NKTR 1.97 natural killer-tumor recognition sequence 3p23-p21 231235_at USP37 1.97 ubiquitin specific protease 37 2q35 232033_at --- 1.97 ------233463_at PTGS2 1.96 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1q25.2-q25.3 1554997_a_at TRIM2 1.96 tripartite motif-containing 2 4q31.3 202342_s_at KIAA0092 1.96 translokin 11q21 203491_s_at DDX17 1.96 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 22q13.1 213998_s_at --- 1.96 Homo sapiens transcribed sequences --- 238970_at LOC90624 1.96 hypothetical protein LOC90624 5q31.1 239960_x_at HSPD1 1.96 heat shock 60kDa protein 1 (chaperonin) 2q33.1 241716_at NASP 1.96 nuclear autoantigenic sperm protein (histone-binding) 1p34.1 242918_at SPIC 1.95 likely ortholog of mouse Spi-C transcription factor (Spi-1/PU.1 related) 12q23.3 1553851_at MGC39518 1.95 hypothetical protein MGC39518 2q33.2 1554178_a_at ZNF146 1.95 zinc finger protein 146 19q13.1 1569312_at B3GALT3 1.95 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 3q25 211379_x_at MOCOS 1.95 molybdenum sulfurase 18q12 219959_at TRAG3 1.95 taxol resistance associated gene 3 Xq28 220445_s_at PNAS-4 1.95 CGI-146 protein 1q44 222158_s_at THAP6 1.95 THAP domain containing 6 4q21.21 235653_s_at OXR1 1.95 oxidation resistance 1 8q23 238408_at LOC360030 1.93 homeobox C14 12p13.31 1570021_at IMP-3 1.93 IGF-II mRNA-binding protein 3 7p11 203819_s_at UBXD2 1.93 UBX domain containing 2 2q21.3-q22.1 212007_at --- 1.93 ------220940_at LSM5 1.92 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) 7p14.3 202904_s_at --- 1.92 Homo sapiens transcribed sequence with weak similarity to protein pir:B34087 (H.sapiens) B3408 --- 240939_x_at hypothetical protein (L1H 3' region) - human LOC375743 1.92 similar to CG3073-PA 9q21.13 243995_at TFPI 1.91 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 2q31-q32.1 210664_s_at PSME4 1.91 proteasome (prosome, macropain) activator subunit 4 2p16.3 212220_at TRIPIN 1.91 tripin 2q33.2 235425_at --- 1.91 Homo sapiens transcribed sequences --- 237673_at TTC3 1.89 tetratricopeptide repeat domain 3 21q22.2 1569472_s_at MTHFD2 1.89 methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase 2p13.1 201761_at HELLS 1.89 helicase, lymphoid-specific 10q24.2 220085_at --- 1.89 Homo sapiens mRNA similar to nuclear localization signals binding protein 1 --- 227449_at (cDNA clone MGC:21810 IMAGE:4183576), complete cds PDCD1LG1 1.89 programmed cell death 1 ligand 1 9p24 227458_at CAMK2D 1.89 calcium/calmodulin-dependent protein kinase (CaM kinase) II delta 4q26 231042_s_at --- 1.89 Homo sapiens transcribed sequences --- 236000_s_at C2orf6 1.88 open reading frame 6 2p13.1 201299_s_at IFIT1 1.88 interferon-induced protein with tetratricopeptide repeats 1 10q25-q26 203153_at CGI-83 1.88 lactamase, beta 2 8p22-q22.3 218701_at EIF4G1 1.87 eukaryotic translation initiation factor 4 gamma, 1 3q27-qter 208624_s_at CG005 1.87 hypothetical protein from BCRA2 region 13q12-q13 235547_at SON 1.85 SON DNA binding protein 21q22.1-q22.2 201085_s_at ST13 1.85 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) 22q13.2 208666_s_at PRKCL2 1.85 protein kinase C-like 2 1p22.2 212629_s_at PAPOLA 1.85 poly(A) polymerase alpha 14q32.31 212720_at KIAA1033 1.85 KIAA1033 protein 12q24.11 215936_s_at --- 1.85 Homo sapiens cDNA FLJ26120 fis, clone SYN00419 --- 225239_at NRXN1 1.85 neurexin 1 2p21 228547_at --- 1.85 Homo sapiens cDNA: FLJ22822 fis, clone KAIA3968 --- 232028_at --- 1.85 Homo sapiens clone IMAGE:27725, mRNA sequence --- 232978_at --- 1.85 Homo sapiens transcribed sequences --- 239487_at FLJ11175 1.85 hypothetical protein FLJ11175 15q26.1-q26.2 243109_at PPIG 1.84 peptidyl-prolyl isomerase G (cyclophilin G) 2q31.1 208993_s_at FLJ37562 1.84 hypothetical protein FLJ37562 5q31.2 224875_at --- 1.84 Homo sapiens mRNA; cDNA DKFZp686J23256 (from clone DKFZp686J23256) --- 229994_at FLJ39885 1.84 hypothetical protein FLJ39885 7q21.3 235643_at --- 1.84 Homo sapiens transcribed sequences --- 237459_at --- 1.84 Homo sapiens transcribed sequences --- 239655_at --- 1.83 Homo sapiens full length insert cDNA clone YR43G06 --- 1560926_at --- 1.83 Homo sapiens full length insert cDNA clone ZD75H02 --- 1561123_at PAI-RBP1 1.83 PAI-1 mRNA-binding protein 1p31-p22 209669_s_at TFPI 1.83 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 2q31-q32.1 210665_at --- 1.83 ------216705_s_at CKTSF1B1 1.83 cysteine knot superfamily 1, BMP antagonist 1 15q13-q15 218468_s_at GALNT7 1.83 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 4q31.1 222587_s_at TNFRSF19 1.83 tumor necrosis factor receptor superfamily, member 19 13q12.11-q12.3 227812_at NCOA6IP 1.83 nuclear receptor coactivator 6 interacting protein 8q11 238346_s_at FMNL2 1.83 formin-like 2 2q24.1 242665_at --- 1.83 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060265.1 (H.sapiens) --- 242755_at hypothetical protein FLJ20378 [Homo sapiens] --- 1.83 Homo sapiens transcribed sequences --- 243236_at HSPA4 1.82 heat shock 70kDa protein 4 5q31.1-q31.2 208814_at CKTSF1B1 1.82 cysteine knot superfamily 1, BMP antagonist 1 15q13-q15 218469_at LOC90355 1.82 hypothetical gene supported by AF038182; BC009203 5q21.2 221823_at RP42 1.82 RP42 homolog 3q26.3 222679_s_at FAD104 1.82 FAD104 3q26.31 222693_at FLJ14281 1.82 hypothetical protein FLJ14281 4q23 222850_s_at SR140 1.82 U2-associated SR140 protein 3q23 236696_at --- 1.82 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060190.1 (H.sapiens) --- 241913_at hypothetical protein FLJ20234 [Homo sapiens] --- 1.82 Homo sapiens transcribed sequence with weak similarity to protein sp:P39188 (H.sapiens) --- 243125_x_at ALU1_HUMAN Alu subfamily J sequence contamination warning entry EPRS 1.80 glutamyl-prolyl-tRNA synthetase 1q41-q42 200842_s_at ACN9 1.80 ACN9 homolog (S. cerevisiae) 7q22.1 218981_at --- 1.80 Homo sapiens transcribed sequences --- 222313_at CYCS 1.80 cytochrome c, somatic 7p15.2 244546_at ZNF277 1.79 zinc finger protein (C2H2 type) 277 7q31.1 1555193_a_at CYorf15B 1.79 chromosome Y open reading frame 15B Yq11.222 214131_at SF3B1 1.79 splicing factor 3b, subunit 1, 155kDa 2q33.1 214305_s_at PBEF 1.79 pre-B-cell colony-enhancing factor 7q22.2 217738_at MFTC 1.79 mitochondrial folate transporter/carrier /// mitochondrial folate transporter/carrier 8q22.3 /// 8q22.3 221020_s_at P15RS 1.79 hypothetical protein FLJ10656 18q12.2 222558_at IMPACT 1.79 hypothetical protein IMPACT 18q11.2-q12.1 222698_s_at RINZF 1.79 zinc finger protein RINZF 8q13-q21.1 228562_at --- 1.79 Homo sapiens cDNA FLJ41537 fis, clone BRTHA2017985 --- 241887_at IPO7 1.78 importin 7 11p15.3 200993_at LYPLA1 1.78 I 8q11.23 203007_x_at BLVRA 1.78 biliverdin reductase A 7p14-cen 203771_s_at LIMS1 1.78 LIM and senescent cell antigen-like domains 1 2q12.3 207198_s_at TFPI 1.78 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 2q31-q32.1 213258_at --- 1.78 Homo sapiens mRNA; cDNA DKFZp586O031 (from clone DKFZp586O031) 1q21.2 214693_x_at OXR1 1.78 oxidation resistance 1 8q23 218197_s_at MIB 1.78 ubiquitin ligase mind bomb 18q11.2 224726_at --- 1.78 Homo sapiens transcribed sequence with weak similarity to protein sp:P39194 (H.sapiens) --- 229147_at ALU7_HUMAN Alu subfamily SQ sequence contamination warning entry --- 1.78 Homo sapiens, clone IMAGE:4716331, mRNA --- 239757_at --- 1.78 Homo sapiens transcribed sequences --- 242299_at MBNL1 1.77 muscleblind-like (Drosophila) 3q25 201151_s_at SCAMP1 1.77 secretory carrier membrane protein 1 5q13.3-q14.1 206668_s_at FLJ22490 1.77 hypothetical protein FLJ22490 8q13.1 220072_at CGI-83 1.77 lactamase, beta 2 8p22-q22.3 222714_s_at GNG12 1.77 guanine nucleotide binding protein (), gamma 12 1p31.2 222834_s_at AK3L1 1.77 adenylate kinase 3 like 1 9p24.1-p24.3 224151_s_at LUC7A 1.77 cisplatin resistance-associated overexpressed protein 17q21 229193_at SYNCOILIN 1.77 intermediate filament protein syncoilin 1p34.3-p33 237333_at C9orf10 1.75 chromosome 9 open reading frame 10 9q22.32 1555948_s_at ADA 1.75 20q12-q13.11 204639_at TCF4 1.75 transcription factor 4 18q21.1 212382_at --- 1.75 Homo sapiens mRNA; cDNA DKFZp586E2317 (from clone DKFZp586E2317) --- 215029_at FLJ20060 1.75 hypothetical protein FLJ20060 9p22.1 218602_s_at USP18 1.75 ubiquitin specific protease 18 22q11.21 219211_at FLJ38426 1.75 hypothetical protein FLJ38426 15q13.3 225086_at ETV6 1.75 ets variant gene 6 (TEL oncogene) 12p13 239364_at --- 1.75 Homo sapiens transcribed sequences --- 239661_at cig5 1.75 viperin 2p25.2 242625_at FLJ12542 1.75 hypothetical protein FLJ12542 18p11.21 52285_f_at --- 1.74 Homo sapiens mRNA; cDNA DKFZp564A232 (from clone DKFZp564A232) --- 1556300_s_at CAPZA2 1.74 capping protein (actin filament) muscle Z-line, alpha 2 7q31.2-q31.3 201237_at TFAM 1.74 transcription factor A, mitochondrial 10q21 203177_x_at LPL 1.74 lipoprotein 8p22 203548_s_at RNPC7 1.74 RNA-binding region (RNP1, RRM) containing 7 14q24.3 212027_at KIAA1946 1.74 KIAA1946 protein 2q32.2 227370_at B4GALT6 1.74 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 18q11 235333_at FLJ10618 1.74 hypothetical protein FLJ10618 3q23 237741_at FLJ21657 1.74 hypothetical protein FLJ21657 5p12 238635_at KIAA1731 1.73 KIAA1731 protein 11q21 1569302_at LPL 1.73 8p22 203549_s_at --- 1.73 ------225040_s_at ARHGAP18 1.73 Rho GTPase activating protein 18 6q23.1 225173_at ARG99 1.73 ARG99 protein 12p11.23 226931_at KIAA1327 1.73 KIAA1327 protein 4p16.1 235009_at FLJ12505 1.73 hypothetical protein FLJ12505 1q32.3 235343_at NDUFS1 1.73 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 2q33-q34 236356_at --- 1.73 Homo sapiens transcribed sequences --- 243648_at BTF 1.72 Bcl-2-associated transcription factor 6q22-q23 201083_s_at BTF 1.72 Bcl-2-associated transcription factor 6q22-q23 201101_s_at SEC63 1.72 SEC63-like (S. cerevisiae) 6q21 201914_s_at MTAP 1.72 methylthioadenosine 9p21 204956_at AKAP13 1.72 A kinase (PRKA) anchor protein 13 /// A kinase (PRKA) anchor protein 13 15q24-q25 /// 15q24-q25 209535_s_at FLJ13615 1.72 hypothetical protein FLJ13615 12q21.33 221683_s_at CPEB4 1.72 cytoplasmic polyadenylation element binding protein 4 5q21 224828_at EIF2C2 1.72 eukaryotic translation initiation factor 2C, 2 8q24 229841_at LOC283464 1.72 hypothetical protein LOC283464 12q12 232021_at MBNL2 1.72 muscleblind-like 2 (Drosophila) 13q32.2 232138_at --- 1.72 Homo sapiens transcribed sequences --- 236975_at --- 1.72 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060265.1 (H.sapiens) --- 242074_at hypothetical protein FLJ20378 [Homo sapiens] KIAA0205 1.71 KIAA0205 gene product 1p36.13-q42.3 1555058_a_at CDC25A 1.71 cell division cycle 25A 3p21 1555772_a_at ENPP2 1.71 ectonucleotide pyrophosphatase/ () 8q24.1 210839_s_at PRMT3 1.71 protein arginine N-methyltransferase 3(hnRNP methyltransferase S. cerevisiae)-like 3 11p15.1 213320_at GATM 1.71 glycine amidinotransferase (L-arginine:glycine amidinotransferase) 15q15.1 216733_s_at WDR3 1.71 WD repeat domain 3 1p13-p12 218882_s_at SEC13L 1.71 sec13-like protein 18p11.21 221931_s_at RNPC2 1.71 RNA-binding region (RNP1, RRM) containing 2 20q11.23 226404_at LOC157570 1.71 hypothetical protein LOC157570 8p21.1 235178_x_at --- 1.71 Homo sapiens cDNA FLJ14633 fis, clone NT2RP2000938. --- 238015_at MGC33648 1.71 hypothetical protein MGC33648 5q11.2 238465_at PLSCR1 1.71 1 3q23 241916_at PLAT 1.69 plasminogen activator, tissue 8p12 201860_s_at DMD 1.69 (muscular dystrophy, Duchenne and Becker types) Xp21.2 203881_s_at SPIB 1.69 Spi-B transcription factor (Spi-1/PU.1 related) 19q13.3-q13.4 205861_at TRAP150 1.69 -associated protein, 150 kDa subunit 1p34.3 222439_s_at KIAA1333 1.69 KIAA1333 14q12 223254_s_at LYAR 1.69 hypothetical protein FLJ20425 4p16.2 223413_s_at --- 1.69 Homo sapiens transcribed sequences --- 230479_at LOC134218 1.69 hypothetical protein LOC134218 5p13.3 230893_at KIAA0650 1.69 KIAA0650 protein 18p11.31 241620_at CRYZ 1.68 crystallin, zeta (quinone reductase) 1p31-p22 202950_at DKFZP564O0823 1.68 DKFZP564O0823 protein 4q13.3-q21.3 204687_at SLCO1A2 1.68 solute carrier organic anion transporter family, member 1A2 12p12 207308_at --- 1.68 ------217371_s_at --- 1.68 Homo sapiens cDNA FLJ31683 fis, clone NT2RI2005353. --- 228315_at ING3 1.68 inhibitor of growth family, member 3 7q31 231863_at --- 1.68 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_003473.1 (H.sapiens) --- 239486_at myeloid/lymphoid or mixed-lineage leukemia 2; ALL1-related gene [Homo sapiens] --- 1.68 Homo sapiens transcribed sequences --- 239978_at MATR3 1.68 matrin 3 5q31.3 242260_at TRIM5 1.67 tripartite motif-containing 5 --- 210705_s_at MGC4399 1.67 mitochondrial carrier protein 1p36.22 223296_at SLC12A2 1.67 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 5q23.3 225835_at --- 1.67 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060312.1 (H.sapiens) --- 230493_at hypothetical protein FLJ20489 [Homo sapiens] --- 1.67 Homo sapiens transcribed sequences --- 232242_at --- 1.67 Homo sapiens transcribed sequences --- 237246_at PPA2 1.66 inorganic pyrophosphatase 2 4q25 1556285_s_at SAP30 1.66 sin3-associated polypeptide, 30kDa 4q34.1 204900_x_at --- 1.66 Homo sapiens mRNA; cDNA DKFZp686E22185 (from clone DKFZp686E22185) --- 235438_at FLJ11196 1.66 acheron 15q22.32 236565_s_at --- 1.66 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_062553.1 (H.sapiens) --- 239274_at hypothetical protein FLJ11267 [Homo sapiens] --- 1.66 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060312.1 (H.sapiens) --- 243361_at hypothetical protein FLJ20489 [Homo sapiens] HSPCB 1.65 heat shock 90kDa protein 1, beta 6p12 1557910_at SLC7A11 1.65 solute carrier family 7, (cationic transporter, y+ system) member 11 4q28-q32 209921_at --- 1.65 Homo sapiens clone 24540 mRNA sequence --- 214078_at SFRP2 1.65 secreted frizzled-related protein 2 4q31.3 223122_s_at DDHD1 1.65 DDHD domain containing 1 14q21 225971_at MUC15 1.65 mucin 15 11p14.3 227241_at UGT8 1.65 UDP 8 (UDP-galactose ceramide galactosyltransferase) 4q26 228956_at --- 1.65 Homo sapiens transcribed sequences --- 242770_at SQLE 1.64 squalene epoxidase 8q24.1 209218_at TFPI 1.64 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 2q31-q32.1 209676_at cig5 1.64 viperin 2p25.2 213797_at RAP2A 1.64 RAP2A, member of RAS oncogene family 13q34 225585_at LOC129607 1.64 hypothetical protein LOC129607 2p25.2 226702_at KIAA1309 1.64 KIAA1309 Xq23-q24 227875_at --- 1.64 Homo sapiens full length insert cDNA clone ZD68B12 --- 230302_at ASPM 1.64 asp (abnormal spindle)-like, microcephaly associated (Drosophila) 1q31 232238_at --- 1.64 Homo sapiens cDNA FLJ14635 fis, clone NT2RP2001196. --- 236451_at TFEC 1.64 transcription factor EC 7q31.2 236995_x_at --- 1.62 Homo sapiens cDNA FLJ42172 fis, clone THYMU2029676 --- 1558842_at CHD4 1.62 chromodomain helicase DNA binding protein 4 12p13 201183_s_at WASL 1.62 Wiskott-Aldrich syndrome-like 7q31.3 205809_s_at SMC5L1 1.62 SMC5 structural maintenance of chromosomes 5-like 1 (yeast) 9q21.2 212926_at PPIA 1.62 peptidylprolyl isomerase A (cyclophilin A) 7p13-p11.2 217602_at PPM2C 1.62 protein phosphatase 2C, magnesium-dependent, catalytic subunit 8q22.1 218273_s_at FST 1.62 follistatin 5q11.2 226847_at BMP2K 1.62 BMP2 inducible kinase 4q21.23 37170_at HNMT 1.61 histamine N-methyltransferase 2q22.1 204112_s_at C11orf8 1.61 chromosome 11 open reading frame 8 11p13 205413_at TRNT1 1.61 tRNA nucleotidyl transferase, CCA-adding, 1 --- 222754_at ZAK 1.61 sterile alpha motif and leucine zipper containing kinase AZK 2q24.2 223519_at FLJ38736 1.61 hypothetical protein FLJ38736 15q21.1 227174_at ELL2 1.61 elongation factor, RNA polymerase II, 2 5q15 240038_at SPIN 1.60 spindlin 9q22.1-q22.3 217813_s_at TWSG1 1.60 twisted gastrulation homolog 1 (Drosophila) 18p11.3 225406_at --- 1.60 Homo sapiens transcribed sequences --- 244026_at FLJ22728 1.59 hypothetical protein FLJ22728 11p15.2 1558014_s_at PKP4 1.59 4 2q23-q31 201927_s_at RGS1 1.59 regulator of G-protein signalling 1 1q31 202988_s_at VPS35 1.59 vacuolar protein sorting 35 (yeast) 16q12 222387_s_at IFIT2 1.59 interferon-induced protein with tetratricopeptide repeats 2 10q23-q25 226757_at --- 1.59 Homo sapiens transcribed sequences --- 230064_at --- 1.59 Homo sapiens transcribed sequences --- 243882_at --- 1.59 Homo sapiens transcribed sequences --- 243997_x_at SERPINI1 1.58 serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1 3q26.2 205352_at B4GALT6 1.58 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 18q11 206233_at NRXN1 1.58 neurexin 1 2p21 209914_s_at C13orf10 1.58 open reading frame 10 13q22.2 226316_at FLJ21924 1.58 hypothetical protein FLJ21924 11p13 229982_at --- 1.58 Homo sapiens cDNA FLJ14210 fis, clone NT2RP3003403. --- 235696_at --- 1.57 Homo sapiens mRNA; cDNA DKFZp566E0124 (from clone DKFZp566E0124) --- 1558028_x_at ENPP4 1.57 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 6p21.1 204161_s_at RPC32 1.57 polymerase (RNA) III (DNA directed) (32kD) 5q14.3 206653_at TRPA1 1.57 transient receptor potential cation channel, subfamily A, member 1 8q13 217590_s_at FLJ23186 1.57 hypothetical protein FLJ23186 3q13.2 219474_at POPDC3 1.57 popeye domain containing 3 6q21 219926_at ST7 1.57 suppression of tumorigenicity 8q22.2-q23.1 220253_s_at DRE1 1.57 DRE1 protein 3q27.3 221986_s_at FLJ30596 1.57 hypothetical protein FLJ30596 5p13.2 229299_at --- 1.57 Homo sapiens transcribed sequences --- 229580_at --- 1.57 Homo sapiens transcribed sequences --- 238884_at PHLDA2 1.56 pleckstrin homology-like domain, family A, member 2 11p15.5 209803_s_at --- 1.56 Homo sapiens transcribed sequences --- 236752_at MTAC2D1 1.55 membrane targeting (tandem) C2 domain containing 1 14q32.12 1553132_a_at ARG99 1.55 ARG99 protein 12p11.23 226322_at PAPPA 1.55 pregnancy-associated plasma protein A 9q33.2 228128_x_at C3orf6 1.55 open reading frame 6 --- 236831_at --- 1.55 Homo sapiens cDNA FLJ34654 fis, clone KIDNE2018294. --- 236934_at --- 1.55 Homo sapiens mRNA; cDNA DKFZp686L18111 (from clone DKFZp686L18111) --- 238375_at --- 1.55 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_055301.1 (H.sapiens) --- 241702_at neuronal thread protein [Homo sapiens] --- 1.55 Homo sapiens transcribed sequences --- 244586_x_at nexilin 1.54 likely ortholog of rat F-actin binding protein nexilin 1p31.1 1552309_a_at TPR 1.54 translocated promoter region (to activated MET oncogene) 1q25 1557227_s_at --- 1.54 Homo sapiens, clone IMAGE:5285294, mRNA --- 1569539_at --- 1.54 Homo sapiens cDNA FLJ14208 fis, clone NT2RP3003264. --- 226158_at PRKRA 1.54 protein kinase, interferon-inducible double stranded RNA dependent activator 2q31.3 228620_at TFEC 1.54 transcription factor EC 7q31.2 232383_at EPHA4 1.53 EphA4 2q36.1 206114_at HOXA9 1.53 homeo box A9 7p15-p14 214651_s_at nexilin 1.53 likely ortholog of rat F-actin binding protein nexilin 1p31.1 226103_at SCAPIN1 1.53 scapinin 20q13.32-q13.33 227949_at TGFB2 1.53 transforming growth factor, beta 2 1q41 228121_at LMO7 1.53 LIM domain only 7 13q21.33 242722_at SQLE 1.52 squalene epoxidase 8q24.1 1557352_at DDX3Y 1.52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Yq11 205001_s_at DNCI1 1.52 dynein, cytoplasmic, intermediate polypeptide 1 7q21.3-q22.1 205348_s_at WDFY1 1.52 WD repeat and FYVE domain containing 1 2q36.3 224800_at --- 1.52 Homo sapiens cDNA FLJ44919 fis, clone BRAMY3010902 --- 230692_at EDG7 1.52 endothelial differentiation, G-protein-coupled receptor, 7 1p22.3-p31.1 231192_at --- 1.52 Homo sapiens cDNA FLJ38295 fis, clone FCBBF3012332. --- 239999_at LOC253012 1.52 hypothetical protein LOC253012 7q21.3 242601_at MDM2 1.51 Mdm2, transformed 3T3 cell double minute 2, binding protein (mouse) 12q14.3-q15 205386_s_at HMGA2 1.51 high mobility group AT-hook 2 /// high mobility group AT-hook 2 12q15 /// 12q15 208025_s_at IGFBP5 1.51 -like growth factor binding protein 5 2q33-q36 211959_at IFIT4 1.51 interferon-induced protein with tetratricopeptide repeats 4 10q24 229450_at --- 1.51 Homo sapiens transcribed sequences --- 229823_at MGC45586 1.51 hypothetical protein MGC45586 19q13.13 242429_at HBS1L 1.49 HBS1-like (S. cerevisiae) 6q23-q24 209314_s_at CLIC2 1.49 chloride intracellular channel 2 Xq28 213415_at --- 1.49 Homo sapiens transcribed sequences --- 229281_at --- 1.49 Homo sapiens, clone IMAGE:5271371, mRNA --- 231164_at FOXA1 1.49 forkhead box A1 14q12-q13 237086_at RBMS3 1.49 RNA binding motif, single stranded interacting protein 3p24-p23 238447_at --- 1.49 Homo sapiens transcribed sequence with strong similarity to protein ref:NP_002576.1 (H.sapiens) --- 239210_at pre-B-cell leukemia transcription factor 1; Pre-B cell leukemia transcription factor-1 [Homo sapiens] DKFZp434A128 1.49 hypothetical protein DKFZp434A128 3q27.2 241863_x_at --- 1.48 Homo sapiens, clone IMAGE:5300703, mRNA --- 1560739_a_at MBNL2 1.48 muscleblind-like 2 (Drosophila) 13q32.2 203640_at PLAG1 1.48 pleiomorphic adenoma gene 1 8q12 205372_at KLF5 1.48 Kruppel-like factor 5 (intestinal) 13q21.33 209212_s_at KIAA1363 1.48 KIAA1363 protein 3q26.31-q26.32 225847_at KIAA0820 1.47 KIAA0820 protein 1q24.1 1558501_at ALCAM 1.47 activated leukocyte cell adhesion molecule 3q13.1 201951_at --- 1.47 ------224525_s_at CROT 1.47 carnitine O-octanoyltransferase 7q21.1 231102_at OAS1 1.46 2',5'-oligoadenylate synthetase 1, 40/46kDa 12q24.1 205552_s_at PTX3 1.46 pentaxin-related gene, rapidly induced by IL-1 beta 3q25 206157_at PTPRR 1.46 protein tyrosine phosphatase, receptor type, R 12q15 210675_s_at --- 1.46 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_004563.1 (H.sapiens) --- 222335_at plakophilin 2 [Homo sapiens] ENPP4 1.45 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 6p21.1 204160_s_at TGFB2 1.45 transforming growth factor, beta 2 1q41 209909_s_at DKFZp686B2197 1.45 hypothetical protein DKFZp686B2197 19q13.43 229007_at --- 1.45 Human HepG2 partial cDNA, clone hmd6b09m5. --- 229349_at IFNGR1 1.45 interferon gamma receptor 1 6q23-q24 242903_at KIAA0820 1.44 KIAA0820 protein 1q24.1 209839_at KIAA0146 1.44 KIAA0146 protein 8q11.21 213006_at FLJ21934 1.44 hypothetical protein FLJ21934 4q13.3 219948_x_at --- 1.44 ------224941_at HNMT 1.44 histamine N-methyltransferase 2q22.1 228772_at ZFY 1.44 zinc finger protein, Y-linked Yp11.3 230760_at TFG 1.44 TRK-fused gene 3q11-q12 239385_at C14orf39 1.43 chromosome 14 open reading frame 39 14q23.1 1561985_at ENPP2 1.43 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 8q24.1 209392_at FLJ20366 1.43 hypothetical protein FLJ20366 8q23.2 218692_at CORTBP2 1.43 cortactin binding protein 2 --- 232136_s_at --- 1.43 Homo sapiens transcribed sequences --- 235201_at --- 1.43 Homo sapiens transcribed sequences --- 241403_at PRKCN 1.43 protein kinase C, nu 2p21 242549_at HLA-DQA1 1.42 major histocompatibility complex, class II, DQ alpha 1 6p21.3 203290_at PTPRR 1.42 protein tyrosine phosphatase, receptor type, R 12q15 206084_at SQLE 1.42 squalene epoxidase 8q24.1 213562_s_at KIAA1641 1.42 KIAA1641 protein 2q11.2 214723_x_at EHF 1.42 ets homologous factor 11p12 219850_s_at TNFRSF11A 1.42 tumor necrosis factor receptor superfamily, member 11a, activator of NFKB 18q22.1 238846_at OTX2 1.42 orthodenticle homolog 2 (Drosophila) 14q21-q22 242128_at HPS3 1.41 Hermansky-Pudlak syndrome 3 3q24 227253_at --- 1.41 Homo sapiens, clone IMAGE:3923185, mRNA --- 238576_at PTHLH 1.40 parathyroid hormone-like hormone /// parathyroid hormone-like hormone 12p12.1-p11.2 /// 12p12.1-p11.2 211756_at PTPN13 1.40 protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase) 4q21.3 243792_x_at PKIB 1.39 protein kinase (cAMP-dependent, catalytic) inhibitor beta 6q22.32 223551_at --- 1.39 H.sapiens mRNA; clone CD 43T7 --- 238483_at FLJ25972 1.39 hypothetical protein FLJ25972 3q25.1 1556579_s_at MMP10 1.39 matrix metalloproteinase 10 (stromelysin 2) 11q22.3 205680_at KL 1.39 13q12 205978_at ANXA3 1.39 annexin A3 4q13-q22 209369_at CNR1 1.39 cannabinoid receptor 1 (brain) 6q14-q15 213436_at ATP8A1 1.39 ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1 4p14-p12 231484_at --- 1.39 Homo sapiens transcribed sequences --- 241635_at EIF1AY 1.38 eukaryotic translation initiation factor 1A, Y-linked Yq11.222 204409_s_at FBXW7 1.38 F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) 4q31.3 229419_at SLITRK6 1.38 slit and trk like gene 6 13q31.1 235976_at --- 1.38 Homo sapiens transcribed sequence with strong similarity to protein ref:NP_112576.1 (H.sapiens) --- 241962_at SH3BGRL3-like protein [Homo sapiens] AKR1C1 1.37 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 10p15-p14 1562102_at 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) CDKAL1 1.37 CDK5 regulatory subunit associated protein 1-like 1 6p22.2 214877_at --- 1.37 Homo sapiens cDNA FLJ42757 fis, clone BRAWH3001712 4q27 227088_at FLJ14712 1.37 hypothetical protein FLJ14712 7p21.3 239552_at FLJ14712 1.36 hypothetical protein FLJ14712 7p21.3 1562226_at DHRS2 1.36 dehydrogenase/reductase (SDR family) member 2 14q11.2 214079_at FLJ22344 1.36 hypothetical protein FLJ22344 5q15 220122_at FLJ30596 1.36 hypothetical protein FLJ30596 5p13.2 226946_at --- 1.36 Homo sapiens mRNA; cDNA DKFZp686O2263 (from clone DKFZp686O2263) 15q21.3 241031_at --- 1.35 ------1555352_at FLJ00310 1.35 FLJ00310 protein 1q21.1 1570255_s_at GPR64 1.35 G protein-coupled receptor 64 Xp22.22 206002_at CP 1.34 ceruloplasmin (ferroxidase) 3q23-q25 1558034_s_at ORAOV2 1.34 oral cancer overexpressed 2 11q13.2 218804_at --- 1.34 Homo sapiens cDNA FLJ41269 fis, clone BRAMY2036079 --- 230451_at RIS1 1.33 Ras-induced senescence 1 3p21.3 213338_at HF1 1.33 H factor 1 (complement) 1q32 213800_at TNC 1.33 tenascin C (hexabrachion) 9q33 216005_at CFTR 1.32 transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) 7q31.2 205043_at LOC339903 1.32 hypothetical protein LOC339903 3p21.33 228721_at --- 1.32 Homo sapiens transcribed sequences --- 236385_at --- 1.31 ------1561737_at KYNU 1.31 kynureninase (L-kynurenine ) 2q22.3 210662_at CAPN13 1.30 calpain 13 --- 234709_at --- 1.30 Homo sapiens transcribed sequences --- 240259_at LPHN2 1.29 latrophilin 2 1p31.1 206953_s_at RET 1.29 ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) 10q11.2 211421_s_at CEB1 1.28 cyclin-E binding protein 1 4q22.1-q23 219863_at FLJ20513 1.28 hypothetical protein FLJ20513 4q13.3 220133_at ASB9 1.27 ankyrin repeat and SOCS box-containing 9 --- 205673_s_at CEL 1.27 carboxyl ester lipase (bile salt-stimulated lipase) 9q34.3 205910_s_at ADAMTS5 1.27 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) 21q21.3 219935_at GPR91 1.27 G protein-coupled receptor 91 3q24-3q25.1 223939_at --- 1.27 Homo sapiens full length insert cDNA clone YI40A07 --- 231033_at --- 1.27 Homo sapiens transcribed sequences --- 244107_at PDC 1.27 phosducin 1q25.2 211496_s_at --- 1.27 ------211506_s_at C14orf161 1.27 chromosome 14 open reading frame 161 14q32.12 220293_at --- 1.27 ------229030_at SNCAIP 1.26 synuclein, alpha interacting protein (synphilin) 5q23.1-q23.3 219511_s_at --- 1.26 Homo sapiens transcribed sequences --- 235236_at CADPS 1.25 Ca2+-dependent activator protein for secretion 3p21.1 1568604_a_at FLJ22344 1.25 hypothetical protein FLJ22344 5q15 235740_at --- 1.24 Homo sapiens, Similar to LOC203339, clone IMAGE:4824854, mRNA --- 1556378_a_at --- 1.23 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_071431.1 (H.sapiens) --- 242649_x_at cytokine receptor-like factor 2; cytokine receptor CRL2 precusor [Homo sapiens] --- 1.22 Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 2344436 --- 1566764_at AVIL 1.22 advillin 12q13.2 205539_at ADAMTS1 1.22 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1 21q21.2 222162_s_at CADPS 1.21 Ca2+-dependent activator protein for secretion 3p21.1 1568603_at SLITRK6 1.21 slit and trk like gene 6 13q31.1 232481_s_at --- 1.21 Homo sapiens hypothetical protein LOC157381, mRNA (cDNA clone IMAGE:5296323), partial cds --- 236950_s_at FLJ10462 1.21 hypothetical protein FLJ10462 12p11.23 239108_at SLC22A3 1.21 solute carrier family 22 (extraneuronal monoamine transporter), member 3 6q26-q27 205421_at ADAMTS5 1.21 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) 21q21.3 235368_at --- 1.21 Homo sapiens cDNA FLJ38396 fis, clone FEBRA2007957. --- 242488_at CEL 1.20 carboxyl ester lipase (bile salt-stimulated lipase) 9q34.3 1553970_s_at --- 1.20 Homo sapiens, clone IMAGE:5194369, mRNA --- 1561368_at SLCO4C1 1.20 solute carrier organic anion transporter family, member 4C1 5q21.2 222071_s_at ADAMTS5 1.20 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) 21q21.3 229357_at ASB17 1.20 ankyrin repeat and SOCS box-containing 17 1p31.1 231622_at RNASE4 1.19 , RNase A family, 4 14q11.1 213397_x_at LOC91752 1.19 similar to C630007C17Rik protein 2q32.1 215767_at PSG4 1.18 pregnancy specific beta-1-glycoprotein 4 19q13.2 204830_x_at NETO2 1.18 neuropilin (NRP) and tolloid (TLL)-like 2 16q11 218888_s_at LOC199920 1.18 hypothetical protein LOC199920 1p32.2 238625_at FABP4 1.17 fatty acid binding protein 4, 8q21 203980_at DKFZp761G058 1.17 hypothetical protein DKFZp761G058 4q22.1 235061_at IMP-3 1.16 IGF-II mRNA-binding protein 3 7p11 203820_s_at HEPH 1.16 hephaestin Xq11-q12 203903_s_at SCGB2A1 1.16 secretoglobin, family 2A, member 1 11q13 205979_at CFTR 1.16 cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) 7q31.2 215702_s_at --- 1.16 Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 131775 --- 1562169_at FXYD2 1.16 FXYD domain containing ion transport regulator 2 11q23 207434_s_at CFTR 1.16 cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) 7q31.2 215703_at TRIM36 1.16 tripartite motif-containing 36 5q23.1 219736_at --- 1.16 Homo sapiens transcribed sequences --- 231381_at --- 1.15 Homo sapiens full length insert cDNA clone ZD49G09 --- 1556161_a_at FLJ10462 1.15 hypothetical protein FLJ10462 12p11.23 220615_s_at SAC 1.14 testicular soluble 1q24 214547_at ELSPBP1 1.14 epididymal sperm binding protein 1 19q13.33 220366_at LGALS4 1.13 lectin, galactoside-binding, soluble, 4 (galectin 4) 19q13.2 204272_at SLITRK6 1.13 slit and trk like gene 6 13q31.1 232176_at SPINK1 1.13 serine protease inhibitor, Kazal type 1 5q32 206239_s_at --- 1.13 Homo sapiens mRNA for immunoglobulin light chain variable region, Fab fragment, clone PSG72 --- 233969_at LOC131368 1.12 hypothetical protein LOC131368 3q13.11 1561969_at MATN2 1.12 matrilin 2 8q22 202350_s_at --- 1.1 1 Homo sapiens transcribed sequences --- 236141_at PRTFDC1 1.10 phosphoribosyl transferase domain containing 1 10p12.31 222803_at --- 1.10 Homo sapiens transcribed sequences --- 236697_at GJB6 1.07 gap junction protein, beta 6 (connexin 30) 13q11-q12.1 231771_at MEOX2 1.06 mesenchyme homeo box 2 (growth arrest-specific homeo box) 7p22.1-p21.3 206201_s_at CCL15 1.06 chemokine (C-C motif) ligand 15 17q11.2 210390_s_at SOX8 1.06 SRY (sex determining region Y)-box 8 16p13.3 226913_s_at FABP7 1.06 fatty acid binding protein 7, brain 6q22-q23 205029_s_at FABP7 1.06 fatty acid binding protein 7, brain 6q22-q23 205030_at CLDN18 1.06 claudin 18 3q22.3 214135_at PLAB 1.04 prostate differentiation factor 19p13.1-13.2 221577_x_at ANXA1 1.04 9q12-q21.2 233011_at CRISP3 1.03 cysteine-rich secretory protein 3 6p12.3 207802_at F5 1.01 coagulation factor V (proaccelerin, labile factor) 1q23 204714_s_at SESN3 1.01 sestrin 3 11q21 235683_at MLLT10 1.00 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 10p12 238257_at UNQ473 0.99 DMC 19q13.31 226960_at STE 0.96 sulfotransferase, estrogen-preferring 4q13.1 222940_at IL13RA2 0.95 interleukin 13 receptor, alpha 2 Xq13.1-q28 206172_at MMP7 0.93 matrix metalloproteinase 7 (matrilysin, uterine) 11q21-q22 204259_at CXCL6 0.93 chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) 4q21 206336_at SCGB3A1 0.93 secretoglobin, family 3A, member 1 5q35-qter 230378_at --- 0.91 ------1570020_at --- 0.91 Homo sapiens transcribed sequences --- 239519_at NNMT 0.91 nicotinamide N-methyltransferase 11q23.1 202237_at PLP1 0.90 proteolipid protein 1 (Pelizaeus-Merzbacher disease, spastic paraplegia 2, uncomplicated) Xq22 210198_s_at ABCA12 0.88 ATP-binding cassette, sub-family A (ABC1), member 12 2q34-q35 215465_at LAMA1 0.88 laminin, alpha 1 18p11.23 227048_at --- 0.88 Homo sapiens cDNA FLJ34356 fis, clone FEBRA2012195. --- 1556842_at DCBLD1 0.88 discoidin, CUB and LCCL domain containing 1 6q22.31 226609_at GREB1 0.87 GREB1 protein 2p25.1 205862_at SIAT7E 0.87 sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide 1p31.1 /// 1p31.1 220979_s_at alpha-2,6-sialyltransferase) E /// sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferas MAMDC2 0.87 MAM domain containing 1 9q21.2 228885_at --- 0.87 Homo sapiens transcribed sequences --- 239832_at TPD52L1 0.86 tumor protein D52-like 1 6q22-q23 203786_s_at SAH 0.86 SA hypertension-associated homolog (rat) 16p13.11 210377_at HSPC065 0.86 HSPC065 protein 16q13 222890_at NPY1R 0.86 neuropeptide Y receptor Y1 4q31.3-q32 205440_s_at --- 0.85 Homo sapiens, clone IMAGE:5263441, mRNA --- 230179_at --- 0.85 Homo sapiens cDNA: FLJ21545 fis, clone COL06195 --- 224589_at RDH10 0.85 retinol dehydrogenase 10 (all-trans) 8q13.3 226021_at NQO1 0.84 NAD(P)H dehydrogenase, quinone 1 16q22.1 201468_s_at DNER 0.84 delta-notch-like EGF repeat-containing transmembrane 2q37.1 226281_at T1A-2 0.84 lung type-I -associated glycoprotein 1p36 221898_at ANPEP 0.82 alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, 15q25-q26 202888_s_at CD13, p150) BXMAS2-10 0.81 BXMAS2-10 11q12.2 1554712_a_at MGC48998 0.81 hypothetical protein MGC48998 1q23.2 1554960_at NQO1 0.81 NAD(P)H dehydrogenase, quinone 1 16q22.1 201467_s_at CCL7 0.81 chemokine (C-C motif) ligand 7 /// chemokine (C-C motif) ligand 7 17q11.2-q12 /// 17q11.2-q12 208075_s_at MAGEA3 0.81 melanoma antigen, family A, 3 Xq28 209942_x_at FAM11A 0.81 family with sequence similarity 11 member A Xq28 210503_at MAGEA6 0.81 melanoma antigen, family A, 6 Xq28 214612_x_at BUCS1 0.81 butyryl Coenzyme A synthetase 1 16p13.11 234643_x_at TRPM8 0.81 transient receptor potential cation channel, subfamily M, member 8 2q37.2 243483_at KRT7 0.81 keratin 7 12q12-q13 209016_s_at DACH 0.80 dachshund homolog (Drosophila) 13q22 205471_s_at --- 0.80 Homo sapiens transcribed sequences --- 244579_at C10orf30 0.80 chromosome 10 open reading frame 30 10p14 227341_at NNMT 0.79 nicotinamide N-methyltransferase 11q23.1 202238_s_at MAGP2 0.79 Microfibril-associated glycoprotein-2 12p13.1-p12.3 213765_at MAGEA4 0.79 melanoma antigen, family A, 4 Xq28 214254_at CTAG2 0.79 cancer/testis antigen 2 Xq28 215733_x_at DNAJC6 0.78 DnaJ (Hsp40) homolog, subfamily C, member 6 1pter-q31.3 204720_s_at GW112 0.78 differentially expressed in hematopoietic lineages 13q14.2 212768_s_at MAGP2 0.78 Microfibril-associated glycoprotein-2 12p13.1-p12.3 213764_s_at CXCL5 0.78 chemokine (C-X-C motif) ligand 5 4q12-q13 214974_x_at ZNF322A 0.78 zinc finger protein 322A 6p22.1 219376_at --- 0.78 Homo sapiens cDNA FLJ26063 fis, clone PRS04788 --- 230207_s_at FLJ25471 0.78 hypothetical protein FLJ25471 8q11.22 241942_at NTT73 0.78 homolog of rat orphan transporter v7-3 12q21.3 206376_at HAS3 0.78 3 16q22.1 223541_at DKFZp686J0811 0.78 hypothetical protein DKFZp686J0811 13q13.3 230964_at --- 0.78 Homo sapiens hypothetical protein LOC339535, mRNA (cDNA clone IMAGE:5186761), partial cds --- 235599_at FLJ25200 0.78 hypothetical protein FLJ25200 3p24.3 239477_at PRH1 0.77 proline-rich protein HaeIII subfamily 1 12p13.2 205272_s_at DCX 0.77 doublecortex; lissencephaly, X-linked (doublecortin) Xq22.3-q23 204850_s_at S100A12 0.77 S100 calcium binding protein A12 (calgranulin C) 1q21 205863_at SCEL 0.77 sciellin 13q22 206884_s_at FLJ32798 0.77 hypothetical protein FLJ32798 10p12.1 238778_at FLJ25333 0.77 hypothetical protein FLJ25333 5q15 240065_at --- 0.76 ------1567101_at PDK4 0.76 kinase, isoenzyme 4 7q21.3-q22.1 225207_at DCX 0.76 doublecortex; lissencephaly, X-linked (doublecortin) Xq22.3-q23 204851_s_at NQO1 0.76 NAD(P)H dehydrogenase, quinone 1 16q22.1 210519_s_at NALP7 0.76 NACHT, leucine rich repeat and PYD containing 7 19q13.42 237461_at MAP2 0.75 microtubule-associated protein 2 2q34-q35 225540_at --- 0.75 Homo sapiens clone DNA49141 LGLL338 (UNQ338) mRNA, complete cds --- 235496_at GDA 0.75 9q21.11-21.33 224209_s_at --- 0.75 Homo sapiens transcribed sequences --- 242286_at MAGP2 0.74 Microfibril-associated glycoprotein-2 12p13.1-p12.3 209758_s_at PROL4 0.74 proline rich 4 (lacrimal) 12p13 204919_at RARRES1 0.74 responder (tazarotene induced) 1 3q25.32 206391_at PROS1 0.74 protein S (alpha) 3p11-q11.2 207808_s_at MYBL1 0.74 v- myeloblastosis viral oncogene homolog (avian)-like 1 8q22 213906_at FBXO2 0.74 F-box only protein 2 1p36.21 219305_x_at --- 0.74 Homo sapiens cDNA FLJ44379 fis, clone TRACH3035235 3p21.1 239150_at BK65A6.2 0.73 Sushi domain (SCR repeat) containing 22q11-q12 227480_at NTS 0.73 neurotensin 12q21 206291_at SLC26A4 0.73 solute carrier family 26, member 4 7q31 206529_x_at ART3 0.73 ADP-ribosyltransferase 3 4p15.1-p14 210147_at MAP1B 0.73 microtubule-associated protein 1B 5q13 226084_at --- 0.72 ------1569788_at SERPINA3 0.72 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 14q32.1 202376_at MCOLN3 0.72 mucolipin 3 1p22.3 229797_at --- 0.72 Homo sapiens cDNA FLJ41906 fis, clone PEBLM2006135 --- 1558186_s_at RARRES1 0.72 retinoic acid receptor responder (tazarotene induced) 1 3q25.32 206392_s_at GFOD1 0.72 glucose-fructose oxidoreductase domain containing 1 6pter-p22.1 219821_s_at --- 0.72 Homo sapiens cDNA: FLJ21545 fis, clone COL06195 --- 224590_at LBP-9 0.72 LBP protein; likely ortholog of mouse CRTR-1 2q14 227642_at SLC4A4 0.71 solute carrier family 4, sodium bicarbonate cotransporter, member 4 4q21 203908_at TF 0.71 transferrin 3q21 214063_s_at --- 0.71 Homo sapiens cDNA FLJ43172 fis, clone FCBBF3007242 --- 231040_at --- 0.71 Homo sapiens cDNA FLJ30680 fis, clone FCBBF2000123. --- 1555929_s_at MSLN 0.71 mesothelin 16p13.3 204885_s_at UGT2B4 0.71 UDP glycosyltransferase 2 family, polypeptide B4 4q13 206505_at TGFBR3 0.70 transforming growth factor, beta receptor III (betaglycan, 300kDa) 1p33-p32 204731_at FZD8 0.70 frizzled homolog 8 (Drosophila) /// frizzled homolog 8 (Drosophila) 10p11.22 /// 10p11.22 224325_at --- 0.70 Homo sapiens cDNA FLJ26063 fis, clone PRS04788 --- 230263_s_at KRT4 0.69 keratin 4 12q12-q13 213240_s_at RNF128 0.69 ring finger protein 128 Xq22.3 219263_at TF 0.69 transferrin 3q21 203400_s_at PROM1 0.69 prominin 1 4p15.33 204304_s_at RAB40B 0.69 RAB40B, member RAS oncogene family 17q25.3 204547_at --- 0.69 Homo sapiens cDNA FLJ44521 fis, clone UTERU3002786 15q14 227272_at PI3 0.68 protease inhibitor 3, skin-derived (SKALP) 20q12-q13 203691_at ABCA5 0.68 ATP-binding cassette, sub-family A (ABC1), member 5 17q24.3 213353_at DNCL2B 0.68 dynein, cytoplasmic, light polypeptide 2B 16q23.3 238116_at PI3 0.68 protease inhibitor 3, skin-derived (SKALP) 20q12-q13 41469_at DEFB1 0.67 defensin, beta 1 8p23.2-p23.1 210397_at LOC80298 0.67 transcription termination factor-like protein 12q24.1 225346_at TCL1A 0.67 T-cell leukemia/lymphoma 1A 14q32.1 39318_at BF 0.67 B-factor, properdin 6p21.3 202357_s_at C7 0.67 complement component 7 5p13 202992_at AADAC 0.67 arylacetamide deacetylase (esterase) 3q21.3-q25.2 205969_at LOC118491 0.67 tetratricopeptide repeat-containing protein 10q22.3 229170_s_at DJ667H12.2 0.67 hypothetical protein DJ667H12.2 1q32.1-q41 230660_at DNASE1L3 0.66 I-like 3 3p21.1-3p14.3 205554_s_at TMPRSS3 0.66 transmembrane protease, serine 3 21q22.3 220177_s_at KRT24 0.66 keratin 24 17q11.2 220267_at S100A8 0.65 S100 calcium binding protein A8 (calgranulin A) 1q21 214370_at KRT23 0.65 keratin 23 (histone deacetylase inducible) 17q21.2 218963_s_at KIAA0626 0.65 KIAA0626 gene product 4q32.3 205442_at MAP1B 0.65 microtubule-associated protein 1B 5q13 212233_at CHI3L2 0.65 chitinase 3-like 2 1p13.3 213060_s_at --- 0.65 Homo sapiens transcribed sequences --- 227980_at HAK 0.65 heart alpha-kinase 18q21.31-q21.32 228367_at ANXA8 0.64 annexin A8 10q11.2 1557094_at PRKCB1 0.64 protein kinase C, beta 1 16p11.2 207957_s_at TCL1A 0.64 T-cell leukemia/lymphoma 1A 14q32.1 209995_s_at COL27A1 0.64 collagen, type XXVII, alpha 1 9q33.1 225293_at C20orf85 0.64 chromosome 20 open reading frame 85 20q13.32 229542_at OMG 0.64 oligodendrocyte myelin glycoprotein 17q11.2 238720_at PARC 0.64 p53-associated parkin-like cytoplasmic protein 6p21.1 213204_at --- 0.64 Homo sapiens C2H2 zinc finger protein pseudogene, mRNA sequence --- 214823_at --- 0.64 Homo sapiens cDNA FLJ12203 fis, clone MAMMA1000914. --- 233265_at --- 0.64 Homo sapiens cDNA FLJ44593 fis, clone BLADE2002744 --- 238715_at ZNF297B 0.63 zinc finger protein 297B 9p24.1-q22.33 231393_x_at ACACB 0.63 acetyl-Coenzyme A carboxylase beta 12q24.1 43427_at BICD1 0.63 Bicaudal D homolog 1 (Drosophila) 12p11.2-p11.1 1556051_a_at RRAD 0.63 Ras-related associated with diabetes 16q22 204803_s_at CRABP2 0.62 cellular retinoic acid binding protein 2 1q21.3 202575_at CEACAM6 0.62 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) 19q13.2 203757_s_at --- 0.62 Homo sapiens mRNA for CMP-N-acetylneuraminic acid hydroxylase, complete cds. /// Homo sapiens --- /// --- 205518_s_at mRNA for CMP-N-acetylneuraminic acid hydroxylase, complete cds. MS4A1 0.62 membrane-spanning 4-domains, subfamily A, member 1 11q12 228599_at FLJ10178 0.62 hypothetical protein FLJ10178 Xq22.3 219355_at CLIC6 0.62 chloride intracellular channel 6 21q22.12 227742_at MS4A1 0.62 membrane-spanning 4-domains, subfamily A, member 1 11q12 228592_at C9orf24 0.62 chromosome 9 open reading frame 24 9p13.2 229012_at ZD52F10 0.62 hypothetical gene ZD52F10 19q13.13 226926_at SPRR1A 0.61 small proline-rich protein 1A 1q21-q22 214549_x_at ABCB1 0.61 ATP-binding cassette, sub-family B (MDR/TAP), member 1 7q21.1 209994_s_at ICAM4 0.60 intercellular adhesion molecule 4, Landsteiner-Wiener blood group 19p13.2-cen 207194_s_at CD109 0.60 CD109 antigen (Gov platelet alloantigens) 6q14.1 226545_at AMICA 0.60 adhesion molecule AMICA 11q23.3 228094_at S100A9 0.60 S100 calcium binding protein A9 (calgranulin B) 1q21 203535_at CLCA2 0.60 chloride channel, calcium activated, family member 2 1p31-p22 206166_s_at C14orf78 0.60 chromosome 14 open reading frame 78 14q32.33 212992_at CD72 0.60 CD72 antigen 9p13.2 215925_s_at MAP17 0.60 membrane-associated protein 17 1p33 219630_at CR2 0.59 complement component (3d/Epstein Barr virus) receptor 2 1q32 205544_s_at ACACB 0.59 acetyl-Coenzyme A carboxylase beta 12q24.1 49452_at CAPNS2 0.59 calpain small subunit 2 16q13 223832_s_at FLJ32343 0.59 hypothetical protein FLJ32343 11q23.1 237040_at RARRES1 0.59 retinoic acid receptor responder (tazarotene induced) 1 3q25.32 221872_at LOC124220 0.59 similar to common salivary protein 1 16p13.3 228058_at FLJ32535 0.59 butyrophilin 3 5q35.3 228434_at --- 0.58 Homo sapiens cDNA FLJ42708 fis, clone BRAMY3007311 --- 231384_at ITGAL 0.58 integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) 16p11.2 213475_s_at SPRR3 0.58 small proline-rich protein 3 1q21-q22 232082_x_at --- 0.58 ------241617_x_at ELF5 0.57 E74-like factor 5 (ets domain transcription factor) 11p13-p12 220625_s_at GJB2 0.57 gap junction protein, beta 2, 26kDa (connexin 26) 13q11-q12 223278_at KRT6B 0.57 12q12-q13 213680_at SERPINA1 0.57 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 14q32.1 202833_s_at FLJ21963 0.57 FLJ21963 protein 12q21.31 229222_at --- 0.56 Homo sapiens PRO2275 mRNA, complete cds --- 211429_s_at SLC6A14 0.56 solute carrier family 6 (neurotransmitter transporter), member 14 Xq23-q24 219795_at --- 0.56 Homo sapiens mRNA; cDNA DKFZp667O0320 (from clone DKFZp667O0320) --- 240890_at MAP17 0.56 membrane-associated protein 17 1p33 1553589_a_at S100A7 0.56 S100 calcium binding protein A7 (psoriasin 1) 1q21 205916_at --- 0.56 Homo sapiens transcribed sequence with strong similarity to protein ref:NP_068585.1 (H.sapiens) BTB and --- 236796_at CNC homology 1, basic leucine zipper transcription factor 2 [Homo sapiens] KRT14 0.55 keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner) 17q12-q21 209351_at ARSD 0.55 arylsulfatase D Xp22.3 225280_x_at CLCA2 0.55 chloride channel, calcium activated, family member 2 1p31-p22 206164_at --- 0.55 Homo sapiens transcribed sequence with strong similarity to protein ref:NP_078795.1 (H.sapiens) --- 230980_x_at hypothetical protein FLJ13725; KIAA1930 protein [Homo sapiens] C20orf128 0.54 chromosome 20 open reading frame 128 20q11.23 1556793_a_at SERPINB4 0.54 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4 /// serine (or cysteine) 18q21.3 /// 18q21.3 211906_s_at proteinase inhibitor, clade B (ovalbumin), member 4 SPRR3 0.54 small proline-rich protein 3 1q21-q22 218990_s_at --- 0.53 Homo sapiens cDNA FLJ41706 fis, clone HLUNG2010181 15q21.2 230245_s_at --- 0.53 ------223695_s_at FCRH3 0.52 Fc receptor-like protein 3 1q21-q22 231093_at SERPINB4 0.51 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4 18q21.3 210413_x_at SLC6A13 0.50 solute carrier family 6 (neurotransmitter transporter, GABA), member 13 12p13.3 237058_x_at MMP28 0.49 matrix metalloproteinase 28 17q11-q21.1 219909_at UPK1B 0.49 uroplakin 1B 3q13.3-q21 210064_s_at SPRR1A 0.49 small proline-rich protein 1A 1q21-q22 213796_at ASS 0.48 argininosuccinate synthetase 9q34.1 207076_s_at CEACAM6 0.48 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) /// 19q13.2 /// 19q13.2 211657_at carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) S100P 0.48 S100 calcium binding protein P 4p16 204351_at GC 0.48 group-specific component (vitamin D binding protein) 4q12-q13 204965_at TARSH 0.48 target of Nesh-SH3 3q12 223395_at GSTA2 0.47 glutathione S-transferase A2 6p12.1 203924_at SPRR1B 0.47 small proline-rich protein 1B (cornifin) 1q21-q22 205064_at S100A8 0.45 S100 calcium binding protein A8 (calgranulin A) 1q21 202917_s_at CLCA2 0.44 chloride channel, calcium activated, family member 2 1p31-p22 206165_s_at IGHM 0.44 immunoglobulin heavy constant mu 14q32.33 212827_at LCN2 0.44 lipocalin 2 (oncogene 24p3) 9q34 212531_at PIGR 0.43 polymeric immunoglobulin receptor 1q31-q41 226147_s_at GABRP 0.42 gamma-aminobutyric acid (GABA) A receptor, pi 5q33-q34 205044_at SERPINB3 0.42 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 18q21.3 209719_x_at IMUP 0.41 immortalization-upregulated protein 19q13.13 223631_s_at UPK1B 0.40 uroplakin 1B 3q13.3-q21 210065_s_at PIGR 0.39 polymeric immunoglobulin receptor 1q31-q41 229659_s_at CLCA2 0.38 chloride channel, calcium activated, family member 2 1p31-p22 217528_at SERPINB3 0.30 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 18q21.3 209720_s_at

Genes may be represented by multiple probesets