DOCSLIB.ORG

Classical Taxonomy and 16S Rrna Gene Marker Confirmed First Record of the Menippid Crab Menippe Rumphii (Fabricius, 1798) from the West Coast of India

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Classical Taxonomy and 16S Rrna Gene Marker Confirmed First Record of the Menippid Crab Menippe Rumphii (Fabricius, 1798) from the West Coast of India Indian Journal of Geo-Marine Sciences Vol. 44(1), January 2015, pp. Classical taxonomy and 16S rRNA gene marker confirmed first record of the Menippid crab Menippe rumphii (Fabricius, 1798) from the West coast of India Vivek Rohidas Vartak1*, Rajendran N2 & Wazir S. Lakra3 1Khar Land Research Station, Panvel-410206, Maharashtra, India 2Vellore Institute of Technology, Vellore- 632 014, Tamil Nadu, India 3Central Institute of Fisheries Education, Andheri (E), Mumbai-400061, India * [E-mail: [email protected]] Received 22 February 2014; revised 7 July 2014 The Menippe rumphii (Fabricius, 1798), marine crab, occurring along the rocky shores of coastal areas of east coast of India was located along the rocky shores of the Konkan coastal region of Maharashtra. Classical taxonomy is applied for identification of this crab. Taxonomic descriptions and morphometric analysis confirmed the species as Menippe rumphii. The 16S rRNA gene from Menippe rumphii adults was sequenced to corroborate species identification. Phylogenetic analysis showed ostensible clade between sequences of Menippe rumphii from NCBI and study crab. Classical taxonomy and 16S rRNA gene marker substantiated the record of the specimens from the Konkan coast. [Key words: First record, Menippe rumphii, 16S rRNA gene, Classical taxonomy] 5 Introduction pictures of Chhapgar on the collections from this region also shored up this observation. After Menippid crab, Menippe rumphii (Fabricius, 4 1798) known as maroon stone crab is a coastal detailed taxonomic examination as per Alcock crab species distributed in the Pacific Ocean this species was identified as Menippe rumphii from Taiwan to Indonesia1. This crab is found in (Fabricius, 1798) and has a valid record from the Brunei Darsm, Cambodia, China, Indonesia, Chennai, east coast of India. To authenticate the Malaysia, Singapore, Taiwan, Thailand, Viet taxonomic identity of this crab we decided to Nam, Brazil, India (east coast), Sri Lanka, develop molecular marker for this species. Djibouti, Somalia, and Oman2, 3. Indian Museum Proper species identification is important for effective fisheries resource management and possesses 100 specimens of this crab from 6, 7, 8, 9, 10 Penang, Tavoy, Mergui, Chennai coast, Ceylon, commercialization . Taxonomic Lakshadweep, Karachi and Persian Gulf 4. This identification by DNA based methods is more crab is found along the rocky shores beneath sophisticated way which identifies specimens in stones, corals and other hiding spots. They have all stages. Molecular methods are more exact, large maroon colored oval body with red eyes. saves time and an advanced step of species This crab is edible and is captured with the help identification if utilized along with classical taxonomy. Earlier studies on molecular methods of gill net from rocky sea shores of Sindhudurg 9, district of coastal region of Maharashtra state, showed effectiveness in identifying crustaceans 11, 12, 13, 14, 15, 16, 17. The use of 16S rRNA gene in India. This crab is a delicacy of the local people 18 of the Konkan coastal region of Maharashtra. crustaceans is reviewed by Schubart and Neigel This species falsely resembles to bashful crab suggesting molecular systematics as a highly Atergatis integerrimus and stone crab effective tool for documenting and classifying Myomenippe hardwickii. Preliminary the biodiversity of this world. The 16SrRNA gene is used for phylogenetic studies19 due to identification on the basis of pictures of related 20 species suggested that the species might be stone high conservancy between different species . crab Myomenippe hardwickii. Perusals of the Hence, we decided to make use of classical INDIAN J. MAR. SCI., VOL. 44, NO. 1 JANUARY 2015 taxonomy and 16S rRNA gene marker for The DNA extraction was carried out using the identification and validation of this species. standard SDS-phenolphenol/chloroform/chloroform method21 with slight modifications. Concentration of isolated Material and Methods DNA was estimated using a UV Sample collection and morphometrics spectrophotometer and diluted to a final concentration of 100 ng⁄µl. Amplification of TThehe first recorded Menippid crab Menippe 16S rRNA gene was carried out with universal rumphii caught in February of 2013 on the rocky primers:16Sar(5’-CCTGTTTATCAAAAACAT- shores of Kelus (15° 54' 12.0528'' N; 73° 35' 3’)and16Sbr(5’CCGGTCTGAACTCAGATCAC 35.7864'' E), located along the KKonkanonkan coastal GT-3’) 22. PCPCRR reaction includes 10X Taq region of MahMaharashtraarashtra State of West coast of polymerase buffer, 10 mM of dNTP mix; 0.6 India (Figure 1). unit of Taq polymerase; 0.01 mM of each primer and 100 ng of DNA template. General Lat: 15° 54' 23.28" thermocyclerthermocycler conditions were an initial step of 2 Long:Long: 73° 35' 13.21" min at 95°C and 34 cycles of 30 s at 95°C, 40 s at 50°C and 1 min at 72°C, followed by a final extension at 72°C for 10 min. Amplified products were sequenced at Eurofins Genomics India Pvt. Ltd, Bangalore India. Sequences were aligned using CLUSTALW23 in BioEdit v. 7.2.3. For comparison and validation, the 16S rRNA bian Sea gene sequences for other sympatric species were Ara obtained from NCBI Gene Bank (Table 2). TheseThese sequences includes one sequence of Menippe rumphii ffromrom Singapore and 9 Figure 1 Location of Menippe rumphii crab record in SinSindhudurgdhudurg district (dark shade) of Maharashtra state of sequences of MenippMenippee adina, Menippe West coast of India mercenaria,mercenaria, Menippe nodifrons, Myomenippe hardwickii, Chlorodiella Cytherea, Xantho First specimen found was female with 90 mm poressa, Paraxanthus barbiger, Xantho pilipes carapace width (Figure 2). Total ten crabs were and Atergatis integerrimus belonging to two found in catch and all were female. All crabs sympatric families, Menippidae and Xanthidae have been carefully stored in absolute alcohol in of Brachyuran subsection Heterotremata. plastic bottles and taken to the laboratory for Evolutionary history was inferred using the identification. Crabs were identifiedidentified based on Neighbor-Joining (NJ) mmethodethod 24 with bootstrap phenotypic criteria such as morphology, colour support of 10000 replicates25. Branches and appendages. Voucher specimensspecimens were stored correspondingcorresponding to partitions reproduced in less 0 at -80 C in DNA barcoding laboratory. Hundred than 50% bootstrap replicates are collapsed. mmgg muscle tissue from chelipeds was removed Perercentagecentage of replicate trees in which the from both the crabs with sterile scissors and associated taxa clustered together in the stored in absolute alcohol at -2020°C°C for molecular bootstrap test is shown above the branches. All study. Nine mmorphometricorphometric measurements with positionspositions containing gaps and missing data were five ratios were used in analysis (Table 1a). eliminated. Maximum Composite Likelihood method26 was ususeded for computing evolutionary Table 1a Measurements used for morphometric analysis distances, which are in tthehe units of the number of base substitutions per site. EvEvolutionaryolutionary analyses Sr. No. Measurements taken were conducted in MEGA528. 1 Carapace length (CL) 2 Carapace width (CW) Results 3 Major cheliped merus length (MEL) 4 Major cheliped merus width (MEW) Systematics 5 Major cheliped manus length (MAL) 6 Major cheliped dactylus length (DAL) Family: Menippidae Ortmann, 1893 7 Penultimate segment length (PL) Genus: Menippe De Haan, 1833 8 Penultimate segment width (PW) 9 Telson width (TW) Synonymized taxa: Alpheus rumphii Weber, 1795 (nomen nudum) DNA extraction, polymerase chain reaction and Cancer rumphii Fabricius, 1798 data analysis Pseudocarcinus bellangerii H. Milne Edwards, 1834 VARTAK et al.: FIRST RECORD OF MENIPPE RUMPHII FROM WEST COAST OF INDIA Classification Molecular analysis Kingdom: Animalia, Phylum: ArthropodaArthropoda Neighbour Joining (NJ) tree involving Class: Malacostraca, Order: Decapoda 18 nucleotide sequences is given in Figure 3. Super family: Eriphioidea, Sequences of Menippe rumphii obtained under Family: Menippidae this study (Haplotypes 1-5) showed distinctive Species: Menippe rumphii clade with sequence of its haplotype (6) from Singapore. Other species under genus Menippe Morphological description clusteredclustered separately from Menippe rumphii Gastric region is distinct and fairly subdivided haplotypes without ambiguity, which indicated into three lobes. There are four blunt tubercles robustness of 16S rRNA gene in phylogenetic positioned in a square towards front between studies. Apart from this, NJ tree resulted in lobes and eyes. Brachial region has two low comprehensiblecomprehensible clade between two families indistinct transverse granular elevations which supported with higher bootstrap values run nearly parallel with the curve of the antero- indicating proper molecular differences between lateral border. First elevation is the more distinct these species. Numumberber of base differences per and can generally be traced across the gastric site between sequences is shown in Table 3. region also. Cardiac region has transverse Base differences per site between sequences of uninterrupted ridge. Surface of the carapace is Menippe rumphii from NCBI and present study smooth except antero-laterallateral fine pitting. Front was zero. Divergence was 0.08 and 0.18 of the carapace has two prominent round pointed between Menippe rumphii with other falsely lobes which ends with a prominent rounded resembling species viz. Myomenippe hardwickii
Load more

Recommended publications
  • A Classification of Living and Fossil Genera of Decapod Crustaceans
    RAFFLES BULLETIN OF ZOOLOGY 2009 Supplement No. 21: 1–109 Date of Publication: 15 Sep.2009 © National University of Singapore A CLASSIFICATION OF LIVING AND FOSSIL GENERA OF DECAPOD CRUSTACEANS Sammy De Grave1, N. Dean Pentcheff 2, Shane T. Ahyong3, Tin-Yam Chan4, Keith A. Crandall5, Peter C. Dworschak6, Darryl L. Felder7, Rodney M. Feldmann8, Charles H. J. M. Fransen9, Laura Y. D. Goulding1, Rafael Lemaitre10, Martyn E. Y. Low11, Joel W. Martin2, Peter K. L. Ng11, Carrie E. Schweitzer12, S. H. Tan11, Dale Tshudy13, Regina Wetzer2 1Oxford University Museum of Natural History, Parks Road, Oxford, OX1 3PW, United Kingdom [email protected] [email protected] 2Natural History Museum of Los Angeles County, 900 Exposition Blvd., Los Angeles, CA 90007 United States of America [email protected] [email protected] [email protected] 3Marine Biodiversity and Biosecurity, NIWA, Private Bag 14901, Kilbirnie Wellington, New Zealand [email protected] 4Institute of Marine Biology, National Taiwan Ocean University, Keelung 20224, Taiwan, Republic of China [email protected] 5Department of Biology and Monte L. Bean Life Science Museum, Brigham Young University, Provo, UT 84602 United States of America [email protected] 6Dritte Zoologische Abteilung, Naturhistorisches Museum, Wien, Austria [email protected] 7Department of Biology, University of Louisiana, Lafayette, LA 70504 United States of America [email protected] 8Department of Geology, Kent State University, Kent, OH 44242 United States of America [email protected] 9Nationaal Natuurhistorisch Museum, P. O. Box 9517, 2300 RA Leiden, The Netherlands [email protected] 10Invertebrate Zoology, Smithsonian Institution, National Museum of Natural History, 10th and Constitution Avenue, Washington, DC 20560 United States of America [email protected] 11Department of Biological Sciences, National University of Singapore, Science Drive 4, Singapore 117543 [email protected] [email protected] [email protected] 12Department of Geology, Kent State University Stark Campus, 6000 Frank Ave.
    [Show full text]
  • Downloaded from Brill.Com10/11/2021 08:33:28AM Via Free Access 224 E
    Contributions to Zoology, 67 (4) 223-235 (1998) SPB Academic Publishing bv, Amsterdam Optics and phylogeny: is there an insight? The evolution of superposition eyes in the Decapoda (Crustacea) Edward Gaten Department of Biology, University’ ofLeicester, Leicester LEI 7RH, U.K. E-mail: [email protected] Keywords: Compound eyes, superposition optics, adaptation, evolution, decapod crustaceans, phylogeny Abstract cannot normally be predicted by external exami- nation alone, and usually microscopic investiga- This addresses the of structure and in paper use eye optics the tion of properly fixed optical elements is required construction of and crustacean phylogenies presents an hypoth- for a complete diagnosis. This largely rules out esis for the evolution of in the superposition eyes Decapoda, the use of fossil material in the based the of in comparatively on distribution eye types extant decapod fami- few lies. It that arthropodan specimens where the are is suggested reflecting superposition optics are eyes symplesiomorphic for the Decapoda, having evolved only preserved (Glaessner, 1969), although the optics once, probably in the Devonian. loss of Subsequent reflecting of some species of trilobite have been described has superposition optics occurred following the adoption of a (Clarkson & Levi-Setti, 1975). Also the require- new habitat (e.g. Aristeidae,Aeglidae) or by progenetic paedo- ment for good fixation and the fact that complete morphosis (Paguroidea, Eubrachyura). examination invariably involves the destruction of the specimen means that museum collections Introduction rarely reveal enough information to define the optics unequivocally. Where the optics of the The is one of the compound eye most complex component parts of the eye are under investiga- and remarkable not on of its fixation organs, only account tion, specialised to preserve the refrac- but also for the optical precision, diversity of tive properties must be used (Oaten, 1994).
    [Show full text]
  • Brachyura, Majoidea) Genera Acanthonyx Latreille, 1828 and Epialtus H
    Nauplius 20(2): 179-186, 2012 179 Range extensions along western Atlantic for Epialtidae crabs (Brachyura, Majoidea) genera Acanthonyx Latreille, 1828 and Epialtus H. Milne Edwards, 1834 Ana Francisca Tamburus and Fernando L. Mantelatto Laboratory of Bioecology and Crustacean Systematics (LBSC) - Postgraduate Program in Comparative Biology - Department of Biology - Faculty of Philosophy, Sciences and Letters of Ribeirão Preto (FFCLRP) - University of São Paulo (USP). Av. Bandeirantes 3900, CEP 14040- 901, Ribeirão Preto (SP), Brazil. E-mails: (AFT) [email protected]; (FLM) [email protected] Abstract The present study provided information extending the known geographical distribution of three species of majoid crabs, the epialtids Acanthonyx dissimulatus Coelho, 1993, Epialtus bituberculatus H. Milne Edwards, 1834, and E. brasiliensis Dana, 1852. Specimens of both genera from different carcinological collections were studied by comparing morphological characters. We provide new data that extends the geographical distributions of E. bituberculatus to the coast of the states of Paraná and Santa Catarina (Brazil), and offer new records from Belize and Costa Rica. Epialtus brasiliensis is recorded for the first time in the state of Rio Grande do Sul (Brazil), and A. dissimulatus is reported from Quintana Roo, Mexico. The distribution of A. dissimulatus, previously known as endemic to Brazil, has a gap between the states of Espírito Santo and Rio de Janeiro. However, this restricted southern distribution is herein amplified by the Mexican specimens. Key words: Geographic distribution, majoid, new records, spider crabs. Introduction (Melo, 1996). Epialtus bituberculatus H. Milne Edwards, 1834 has been from Florida (USA), The family Epialtidae MacLeay, 1838 Gulf of Mexico, West Indies, Colombia, includes 76 genera, among them Acanthonyx Venezuela and Brazil (Ceará to São Paulo Latreille, 1828 and Epialtus H.
    [Show full text]
  • Part I. an Annotated Checklist of Extant Brachyuran Crabs of the World
    THE RAFFLES BULLETIN OF ZOOLOGY 2008 17: 1–286 Date of Publication: 31 Jan.2008 © National University of Singapore SYSTEMA BRACHYURORUM: PART I. AN ANNOTATED CHECKLIST OF EXTANT BRACHYURAN CRABS OF THE WORLD Peter K. L. Ng Raffles Museum of Biodiversity Research, Department of Biological Sciences, National University of Singapore, Kent Ridge, Singapore 119260, Republic of Singapore Email: [email protected] Danièle Guinot Muséum national d'Histoire naturelle, Département Milieux et peuplements aquatiques, 61 rue Buffon, 75005 Paris, France Email: [email protected] Peter J. F. Davie Queensland Museum, PO Box 3300, South Brisbane, Queensland, Australia Email: [email protected] ABSTRACT. – An annotated checklist of the extant brachyuran crabs of the world is presented for the first time. Over 10,500 names are treated including 6,793 valid species and subspecies (with 1,907 primary synonyms), 1,271 genera and subgenera (with 393 primary synonyms), 93 families and 38 superfamilies. Nomenclatural and taxonomic problems are reviewed in detail, and many resolved. Detailed notes and references are provided where necessary. The constitution of a large number of families and superfamilies is discussed in detail, with the positions of some taxa rearranged in an attempt to form a stable base for future taxonomic studies. This is the first time the nomenclature of any large group of decapod crustaceans has been examined in such detail. KEY WORDS. – Annotated checklist, crabs of the world, Brachyura, systematics, nomenclature. CONTENTS Preamble .................................................................................. 3 Family Cymonomidae .......................................... 32 Caveats and acknowledgements ............................................... 5 Family Phyllotymolinidae .................................... 32 Introduction .............................................................................. 6 Superfamily DROMIOIDEA ..................................... 33 The higher classification of the Brachyura ........................
    [Show full text]
  • How to Become a Crab: Phenotypic Constraints on a Recurring Body Plan
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 25 December 2020 doi:10.20944/preprints202012.0664.v1 How to become a crab: Phenotypic constraints on a recurring body plan Joanna M. Wolfe1*, Javier Luque1,2,3, Heather D. Bracken-Grissom4 1 Museum of Comparative Zoology and Department of Organismic & Evolutionary Biology, Harvard University, 26 Oxford St, Cambridge, MA 02138, USA 2 Smithsonian Tropical Research Institute, Balboa–Ancon, 0843–03092, Panama, Panama 3 Department of Earth and Planetary Sciences, Yale University, New Haven, CT 06520-8109, USA 4 Institute of Environment and Department of Biological Sciences, Florida International University, Biscayne Bay Campus, 3000 NE 151 Street, North Miami, FL 33181, USA * E-mail: [email protected] Summary: A fundamental question in biology is whether phenotypes can be predicted by ecological or genomic rules. For over 140 years, convergent evolution of the crab-like body plan (with a wide and flattened shape, and a bent abdomen) at least five times in decapod crustaceans has been known as ‘carcinization’. The repeated loss of this body plan has been identified as ‘decarcinization’. We offer phylogenetic strategies to include poorly known groups, and direct evidence from fossils, that will resolve the pattern of crab evolution and the degree of phenotypic variation within crabs. Proposed ecological advantages of the crab body are summarized into a hypothesis of phenotypic integration suggesting correlated evolution of the carapace shape and abdomen. Our premise provides fertile ground for future studies of the genomic and developmental basis, and the predictability, of the crab-like body form. Keywords: Crustacea, Anomura, Brachyura, Carcinization, Phylogeny, Convergent evolution, Morphological integration 1 © 2020 by the author(s).
    [Show full text]
  • Fishery Bulletin/U S Dept of Commerce National Oceanic
    LARVAL DEVELOPMENT OF THE CUBAN STONE CRAB, MENlPPE NODlFRONS (BRACHYURA, XANTHIDAE), UNDER LABORATORY CONDITIONS WITH NOTES ON THE STATUS OF THE FAMILY MENIPPIDAE1 LumInA E. SCO,I'02 ABSTRACT The complete larval development of the Cuban stone crab, Menippc nodifrons, is described and illustrated. Larvae reared in the laboratory passed through a prezoeal, five and uncommonly six zoeal, and one megalopal stage. At 30" C the megalopal stage was attained in 16-17 clays, at 20" C, 28-37 days. The six zoeal stages of M. nodifrons are compared with those of its sympatric congener M. mcrc<'!laria and with the first zoeal stage of the Indo-Pacific species M. rumphii. Larvae ofthe genus Menippe may be distinguished from other xanthid larvae by a combination of morphological features, including lilltennal development (exopodite at least three-fourths the length ofprotopoditel, lack of setae on the basal segment of the second maxillipL'<!al endopodite, and number oflarval stages (Menippe, 5 or 6; most other xanthids, 4). Using Lebour's criteria (emphasizing antenna! development and number of zoeal stages) to determine the primitive or advancL'<! status of decapod larvae, the genus Menippe is more closely related to the phylogentically primitive family Cancriclae than to most of the Xanthidae. The possible reestablishment of the family Menippidae is discussed in view of new larval evidence. The Cuban stone crab, MCllippe llodij'rolls tions of West Africa (Capart 1951; Monod 1956), a Stimpson 1859, is a medium-sized xanthid crab survey of stomatopod and decapod crustaceans of closely allied to the common commercial stone Portuguese Guiana (Vilela ]951), and an ecologi­ crab, MCllippc I/lcrcenaria (Say 18] 8).
    [Show full text]
  • Decapod Crustacean Phylogenetics
    CRUSTACEAN ISSUES ] 3 II %. m Decapod Crustacean Phylogenetics edited by Joel W. Martin, Keith A. Crandall, and Darryl L. Felder £\ CRC Press J Taylor & Francis Group Decapod Crustacean Phylogenetics Edited by Joel W. Martin Natural History Museum of L. A. County Los Angeles, California, U.S.A. KeithA.Crandall Brigham Young University Provo,Utah,U.S.A. Darryl L. Felder University of Louisiana Lafayette, Louisiana, U. S. A. CRC Press is an imprint of the Taylor & Francis Croup, an informa business CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, Fl. 33487 2742 <r) 2009 by Taylor & Francis Group, I.I.G CRC Press is an imprint of 'Taylor & Francis Group, an In forma business No claim to original U.S. Government works Printed in the United States of America on acid-free paper 109 8765 43 21 International Standard Book Number-13: 978-1-4200-9258-5 (Hardcover) Ibis book contains information obtained from authentic and highly regarded sources. Reasonable efforts have been made to publish reliable data and information, but the author and publisher cannot assume responsibility for the valid­ ity of all materials or the consequences of their use. The authors and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged please write and let us know so we may rectify in any future reprint. Except as permitted under U.S. Copyright Faw, no part of this book maybe reprinted, reproduced, transmitted, or uti­ lized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopy­ ing, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers.
    [Show full text]
  • Download Download
    PLATINUM The Journal of Threatened Taxa (JoTT) is dedicated to building evidence for conservaton globally by publishing peer-reviewed artcles OPEN ACCESS online every month at a reasonably rapid rate at www.threatenedtaxa.org. All artcles published in JoTT are registered under Creatve Commons Atributon 4.0 Internatonal License unless otherwise mentoned. JoTT allows unrestricted use, reproducton, and distributon of artcles in any medium by providing adequate credit to the author(s) and the source of publicaton. Journal of Threatened Taxa Building evidence for conservaton globally www.threatenedtaxa.org ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) Communication Varying colour pattern, yet genetically similar: Pebble Crab Seulocia vittata (Stimpson, 1858) (Brachyura: Leucosiidae) from the southeastern coast of India Sanjeevi Prakash & Amit Kumar 26 April 2020 | Vol. 12 | No. 5 | Pages: 15612–15618 DOI: 10.11609/jot.5801.12.5.15612-15618 For Focus, Scope, Aims, Policies, and Guidelines visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-0 For Artcle Submission Guidelines, visit htps://threatenedtaxa.org/index.php/JoTT/about/submissions#onlineSubmissions For Policies against Scientfc Misconduct, visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-2 For reprints, contact <[email protected]> The opinions expressed by the authors do not refect the views of the Journal of Threatened Taxa, Wildlife Informaton Liaison Development Society, Zoo Outreach Organizaton, or any of the partners.
    [Show full text]
  • Comportamento Predatório Ex Situ Do Caranguejo Menippe Nodifrons Stimpson, 1859 (Decapoda, Brachyura) Sobre Moluscos Gastrópodes
    Comportamento Predatório Ex situ do Caranguejo Menippe nodifrons Stimpson, 1859 (Decapoda, Brachyura) sobre Moluscos Gastrópodes 1 1 GIVANILDO XIMENES SANTANA , ANTÔNIO ADAUTO FONTELES FILHO , LUIS ERNESTO 2 1,3 ARRUDA BEZERRA & HELENA MATTHEWS-CASCON 1Pós-Graduação em Ciências Marinhas Tropicais, Instituto de Ciências do Mar (LABOMAR), Universidade Federal do Ceará, Av. da Abolição, 3207 - Meireles - CEP: 60165-081, Fortaleza, Ceará - Brasil. Email: [email protected] 2Pós-Graduação em Oceanografia, Departamento de Oceanografia, Universidade Federal de Pernambuco, Av. da Arquitetura, S/N, Cidade Universitária. 50670-901 Recife, Pernambuco – Brasil. 3Departamento de Biologia, Universidade Federal do Ceará, Campus do Pici, Fortaleza, Ceará - Brasil 60455-760. Abstract. Predatory Behaviour Ex situ of the Stone Crab Menippe nodifrons Stimpson, 1859 (Decapoda, Brachyura) on Gastropods in Laboratory. Laboratory experiments were used to study the effect predation of the crab Menippe nodifrons Stimpson, 1859 on gastropods Stramonita haemastoma Linnaeus, 1758 Tegula viridula Gmelin, 1791 and Neritina virginea Linnaeus, 1758. The observed aspects had been of prey preference, handling time, predation techniques, prey critical size and chelal biomechanic analysis of the crabs. The crabs and the clams had been collected in the beach of the Pacheco, located in the city of Caucaia-Ce. Menippe nodifrons preferred Neritina virginea over both S. haemastoma and Tegula viridula, and S. haemastoma was strongly preferred over T. viridula. The males crabs preyed more heavily upon Neritina virginea than on both gastropods Stramonita haemastoma and Tegula viridula, while the females had eaten indistinctly the three gastropods. There were differences in hadling times between Neritina virginea, Stramonita haemastoma and Tegula viridula. The mean critical size for Neritina virginea was significantly smaller than for Stramonita haemastoma, which in turn was smaller than for Tegula viridula.
    [Show full text]
  • Genus Panopeus H. Milne Edwards, 1834 Key to Species [Based on Rathbun, 1930, and Williams, 1983] 1
    610 Family Xanthidae Genus Panopeus H. Milne Edwards, 1834 Key to species [Based on Rathbun, 1930, and Williams, 1983] 1. Dark color of immovable finger continued more or less on palm, especially in males. 2 Dark color of immovable finger not continued on palm 7 2. (1) Outer edge of fourth lateral tooth longitudinal or nearly so. P. americanus Outer edge of fourth lateral tooth arcuate 3 3. (2) Edge of front thick, beveled, and with transverse groove P. bermudensis Edge of front if thick not transversely grooved 4 4. (3) Major chela with cusps of teeth on immovable finger not reaching above imaginary straight line drawn between tip and angle at juncture of finger with anterior margin of palm (= length immovable finger) 5 Major chela with cusps of teeth near midlength of immovable finger reaching above imaginary straight line drawn between tip and angle at juncture of finger with anterior margin of palm (= length immovable finger) 6 5. (4) Coalesced anterolateral teeth 1-2 separated by shallow rounded notch, 2 broader than but not so prominent as 1; 4 curved forward as much as 3; 5 much smaller than 4, acute and hooked forward; palm with distance between crest at base of movable finger and tip of cusp lateral to base of dactylus 0.7 or less length of immovable finger P. herbstii Coalesced anterolateral teeth 1-2 separated by deep rounded notch, adjacent slopes of 1 and 2 about equal, 2 nearly as prominent as 1; 4 not curved forward as much as 3; 5 much smaller than 4, usually projecting straight anterolaterally, sometimes slightly hooked; distance between crest of palm and tip of cusp lateral to base of movable finger 0.8 or more length of immovable finger P.
    [Show full text]
  • The Stalk-Eyed Crustacea of Peru and the Adjacent Coast
    \\ ij- ,^y j 1 ^cj^Vibon THE STALK-EYED CRUSTACEA OF PERU AND THE ADJACENT COAST u ¥' A- tX %'<" £ BY MARY J. RATHBUN Assistant Curator, Division of Marine Invertebrates, U. S. National Museur No. 1766.—From the Proceedings of the United States National Museum, '<•: Vol.*38, pages 531-620, with Plates 36-56 * Published October 20, 1910 Washington Government Printing Office 1910 UQS3> THE STALK-EYED CRUSTACEA OF PERU AND THE ADJA­ CENT COAST. By MARY J. RATHBUN, Assistant Curator, Division of Marine Invertebrates, U. S. National Museum. INTKODUCTION. Among the collections obtained by Dr. Robert E. Coker during his investigations of the fishery resources of Peru during 1906-1908 were a large number of Crustacea, representing 80 species. It was the original intention to publish the reports on the Crustacea under one cover, but as it has not been feasible to complete them at the same time, the accounts of the barnacles a and isopods b have been issued first. There remain the decapods, which comprise the bulk of the collection, the stomatopods, and two species of amphipods. One of these, inhabiting the sea-coast, has been determined by Mr. Alfred O. Walker; the other, from Lake Titicaca, by Miss Ada L. Weckel. See papers immediately following. Throughout this paper, the notes printed in smaller type were con­ tributed by Doctor Coker. One set of specimens has been returned to the Peruvian Government; the other has been given to the United States National Museum. Economic value.—The west coast of South America supports an unusual number of species of large crabs, which form an important article of food.
    [Show full text]
  • A Profile of the Wester Gulf Stone Crab, Menippe Adina 1995
    Gulf St tes Marine Fisher Commiss1 January 1995 o. 1 A PROFILE OF 1HE WF.STERN GULF STONE CRAB, Memppe adim by , The Gulf States Marine Fisheries Commission TCC Crab Subcommittee edited by Vince Guillory Harriet M Perry Richard L. Leard published by Gulf States Marine Fisheries Commission P.O. Box 726 Ocean Springs, Mississippi 39566-0726 January 1995 Number 31 A publication of the Gulf States Marine Fisheries Commission pursuant to National Oceanic and Atmospheric Administration Award Number NA26FI0026-03. This paper is funded by a grant from the National Oceanic and Atmospheric Administration. The views expressed herein are those of the author(s) and do not necessarily reflect the views of NOAA or any of its sub-agencies. ACKDOWieagements The GSMFC, TCC Crab Subcommittee gratefully acknowledges the support for and technical critique of the profile by Dr. Theresa Bert (Florida Department of Environmental Protection). We also thank Ms. Christine Trigg (Gulf Coast Research Laboratory [GCRL]) for supplying physiological data and technical review, Mr. Charles Dugas (Louisiana Department of Wildlife and Fisheries [LDWF]) for morphometric data from the fishery, Mr. Lee Usie (National Marine Fisheries Service [NMFS]) for landings data, and Mr. Walter Brehm (Clinical Research Laboratory, Keesler Air Force Base) for statistical analysis of data. We are also grateful for editorial review by Ms. Marjorie Williams (GCRL), Mr. Paul Prejean (LDWF), and Mr. Martin Bourgeois (LDWF). Special appreciation is extended to Mr. Dave Donaldson (GSMFC) for preparation of graphics and to Ms. Cindy Yocom for her special attention and dedication to the quality of this document. 1 Table of Omtents Page 1.
    [Show full text]