Molecular Analysis on the Possible Mechanism of Β-Naphthoflavone-Induced Hepatocarcinogenesis in Rats

J Toxicol Pathol 2007; 20: 29–37

Original Molecular Analysis on the Possible Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis in Rats

Yusuke Yokouchi1, Masako Muguruma1, Mitsuyoshi Moto1, Miwa Takahashi1, Meilan Jin1, Yusuke Kenmochi1, Taichi Kohno1, Yasuaki Dewa1, and Kunitoshi Mitsumori1

1Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3–5–8 Saiwai-cho, Fuchu, Tokyo 183–8509, Japan

Abstract: It has been speculated that oxidative stress is involved in the liver tumor-promoting effect of β- naphthoflavone (BNF; 5,6-benzoflavone) in rats, because of its strong induction of cytochrome P450 (CYP) 1A enzymes. In order to clarify the mechanism of liver tumor promoting effects of BNF, male F344 rats were initiated with a single intraperitoneal injection of 200 mg/kg diethylnitrosamine (DEN), and fed diet containing 2% of BNF for 6 weeks staring 2 weeks after injection. Two/third partial hepatectomy was perfomed at Week 3 after the treatment of BNF. Low-density Rat Toxicology & Drug Resistance Microarray and quantitative analyses of mRNA expressions of the selected genes using real-time reverse transcription (RT) -PCR were carried out on total RNAs extracted from the livers of F344 rats. Collected liver tissues were subjected to light microscopic examinations (hematoxylin and eosin staining), immunohistochemistries of proliferating cell nuclear antigen (PCNA), glutathione S-transferase placental form (GST-P) and CYP1A1, and Schmorl staining to identify lipofuscin. Gene expression analysis showed that 7 genes (CYP1A1, CYP1A2, CYP1B1, Gstm2 (GST mu2), Gstm3, glutathione peroxidase (Gpx)2 and NAD(P)H dehydrogenase, quinone 1(Nqo1)) were up-regulated (> 1.5 fold), and 4 genes (8-oxoguanine DNA glycosylase (Ogg1), Gpx1, peroxiredoxin (Prdx) 1 and P450 oxidoreductase (Por)) were down-regulated (< 0.67 fold) in the DEN + BNF group rats as compared with the DEN alone group. In immunohistochemical analyses, the numbers of foci positive for GST- P, the rate of PCNA-positive cells, and the rate of CYP1A1-positive cells were significantly increased in the DEN + BNF group, as compared to the corresponding control. Furthermore, deposition of lipofuscin, positive for Schmorl staining, was moderately increased in the DEN + BNF group. These results confirm the possibility that oxidative stress is involved in the liver tumor-promoting effect of BNF in rats. (J Toxicol Pathol 2007; 20: 29–37) Key words: β-naphthoflavone, non-genotoxic carcinogen, hepatocarcinogenesis, oxidative stress, rats

Introduction these chemicals, BNF itself showed no mutagenic activity when screened over a wide range of concentrations in BNF is a synthetic derivative of a naturally occurring several strains of the Salmonella/mammalian microsome flavonoid which strongly induces CYP 1A1/2, and it has been assay5. In addition, a liver tumor promotion effect of BNF used as a specific CYP1A1/2 inducer in pharmacological has been demonstrated using a two-stage rat liver and/or pharmacokinetic experiments. With regard to CYP carcinogenesis model in rats given BNF for 6 weeks6. induction, BNF shows a similar potency and specificity to It has been reported that there is a good correlation polycyclic aromatic hydrocarbons (e.g, 3- between the ability of chemicals inducing CYP2B1/2 methylcholanthrene, benzo [a] pyrene) as well as isozymes such as phenobarbital (PB) and their potential to polyhalogenated aromatic compounds (2,3,7,8- promote hepatocarcinogenesis7,8. Additionally, the fact that tetrachlorodibenzo-p-dioxion (TCDD), and 3,3’,4,4’,5,5’- various types of liver tumor-promoting agents including PB hexachlorobiphenyl), which are mutagenic and/or have the ability to inhibit gap junctional intercellular carcinogenic in laboratory animals1–4. Although, unlike communication (GJIC) in the rat liver in vivo has been demonstrated9–11. Decreases in the abundance of the GJIC protein connexin 32 (Cx32) were induced in both altered Received: 27 October 2006, Accepted: 2 December 2006 hepatocellular foci12 and centrilobular hepatocytes where Mailing address: Yusuke Yokouchi, Laboratory of Veterinary 13 Pathology, Tokyo University of Agriculture and Technology, 3–5–8 CYP2B1/2 isozymes are induced , suggesting a relationship Saiwai-cho, Fuchu, Tokyo 183–8509, Japan between the agents inducing CYP2B1/2 isozymes and TEL & FAX: 81-42-367-5771 reducing Cx32 in the same area of the liver tumor promoting E-mail: [email protected] mechanism. However, it is unclear whether there is good 30 Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis

Fig. 1. Experimental design.

correlationship between the induction of CYP1A subfamilies were fed powdered diet containing BNF at a concentration of other than CYP2B1/2 and liver tumor promoting activity. 2% for 6 weeks. To enhance the hepatocellular proliferation Shoda et al. performed a two-stage rat liver carcinogenesis in the liver, all rats were subjected to two-thirds partial model using BNF, and demonstrated that there is a link hepatectomy (left and median lobes excised) at Week 3. For between CYP1A2 induction and liver tumor promotion sampling of the liver at Week 8, all surviving animals were activity of BNF6. In addition, there have been some reports sacrificed under anesthesia with ether by exsanguination suggesting that the mechanism of liver tumor promoting from the abdominal aorta after measurement of body activity associated with the induction of CYP1A subfamily is weights. The animals were necropsied, the livers excised related to oxidative stress14–16. and their weights recorded. Since the animals had been In the present study, a short term study using the two- subjected to a partial hepatectomy, the remaining liver stage hepatocarcinogenesis model was performed in rats to consisted of the anterior and posterior right and caudate clarify the molecular mechanism of the liver tumor lobes. One section obtained from each lobe was fixed with promoting effect of BNF. neutral-buffered formalin for the histochemical and histological examinations. One hundred milligrams of liver Materials and Methods samples from the remaining liver were frozen in RNA-Later (Qiagen, Hilden, Germany) and stored at –80°C until use for Animals and chemicals gene expression analysis. Male Fischer 344 rats, 5 weeks old, were purchased from Japan SLC Inc. (Shizuoka, Japan). The rats were Histological examination housed in stainless steel cages with two or three animals per The fixed liver tissue from each animal was embedded cage and allowed free access to tap water and commercial in paraffin, sectioned at 4 µm and stained with hematoxylin basal diet (MF, Oriental Yeast Industries Co, Ltd. Tokyo, and eosin (H-E) for histological examinations. The level of Japan). All the animals were handled under standard lipofuscin in the liver was determined by the method of conditions (room temperature, 22 ± 2°C; relative humidity, Schmorl. Immunohistochemical staining was conducted 55 ± 5%; 12-h light- dark cycle). They were acclimatized for using the labeled avidin-biotin-peroxidase complex (ABC) 1 week before dosing and were randomly allocated to four method for binding of anti-rat GST-P (1:1000; MBL, test groups (five rats per group) by the stratification method Nagoya, Japan), anti-rat CYP1A1 (1:200; Santa Cruz based on their body weights immediately prior to the dosing. Biotechnology Inc, Santa Cruz CA, USA), and anti-rat The animal care and experiments were carried out in PCNA (1:200; Dako Japan, Kyoto, Japan) as primary accordance with the Guide for Animal Experimentation of antibodies. All specimens were lightly counterstained using Tokyo University of Agriculture and Technology. hematoxylin. Numbers and areas of altered foci positive for BNF (purity > 98%) and DEN were obtained from GST-P (> 2 hepatocytes in cross section) were measured Wako Pure Chemical Industries Ltd. (Osaka, Japan). using a Scion Image analyzer. All positive foci were counted in the DEN alone and DEN + BNF groups. To Experimental design obtain the PCNA labeling index, the number of PCNA- A two-stage liver carcinogenesis model in rats was positive cells was counted in 200–300 cells × 5 areas / slide, employed (Fig. 1). A total of 20 rats were divided into 4 without any recognition of the presence of foci. groups of 5 animals each. Animals in Group 3 and 4 were initiated with a single intraperitoneal injection of DEN at a Low-density rat toxicology & drug resistance dose of 200 mg/kg and animals in Group 1 (control) and 2 microarray received a single intraperitoneal injection of saline vehicle Gene expressions of the liver sample from the DEN alone. Two weeks after the injection, rats in Group 2 and 4 alone and DEN + BNF groups were analyzed by Oligo Yokouchi, Muguruma, Mitsuyoshi et al. 31 wn) Bioscience Corporation (base sequence is not shown) is not sequence (base Corporation Bioscience AAC CTTAGCATCACTGAGGACCTTGAA AAATATG GCCTTCGGTGTACATGTCAATC † †† TTTGTGA CCCAATTTTTGCATTTCCTGAA ATTG TGCAGGAGGATGGCTAAGAAG AGCTCATCAT TCTCAAAGTTCCAGGACACATCTG AAAACGATCT ATACCATGGGAACCGGAGTGT from SuperArray Bioscience Corporation (base sequence is not sho is not sequence (base Corporation Bioscience from SuperArray CGTGCAAT CATACTTGAGGGAATTCAGAATCTCTT TTGATCGGAAA CAAGGCGAGCGAAGTACAAGT 4.14 ± 0.41** ± 4.14 0.90** ± 5.09 Weeks after DEN Initiation GCCCCCAACTTCTG TCTGCGTGGGCCAATACA GAGATGGGCCGTCTGAA GACAGCAGCCAGGAATGGAT †† †† Liver weight mber 3 TCCCACTTCTCGGAGACAGT 10.5 ± 1.80** ± 10.5 -Naphthoflavone (BNF) -Naphthoflavone for 6 ypeptide 1 CTTGGCCA β polypeptide 2 AAGCGCCGGTGC 2 TGCCCCTGGAAGTGTCAAA GGCTGTACTGTATCCCCAGAAGA -test). t †† mily, polypeptide A6 TGGCTACCCC ase, alpha type2ase, alpha CAACTACATCGCCACC SD) of Rats Given Diet Containing Containing Diet Given of Rats SD) ± in in Real-Time RT-PCR Analysis om the untreated control group at P < 0.05 or 0.01, respectively (Dunnett’s test). (Dunnett’s at respectively P < or group 0.01, control 0.05 om the untreated om the DEN-alone group at P < 0.01 ( < 0.01 at P group DEN-alone the om Cytochrome P450, family 1, subfamily a, polypeptide subfamily 1 family 1, Cytochrome P450, purchased glutathione-S-transfer UDP glycosyltransferase 1 fa Cytochrome P450, family 1, subfamily a, Cytochrome P450, family 1, subfamily b, pol NAD(P)Hdehydrogenase, quinone 1 S-transferase,Glutathione mu 2Glutathione S-transferase, mu 3 TCC CGAATTCCTGGGCAAGCA GCCATCCTGCGCTATCTTG GGACATCGTAAACAAGAAAATCCA CACGAATCCTCTCCTCTTCTGTCT glutathione peroxidase 2nuclear factor, erythroid derived 2, like ACCGATCCCA ATP-binding cassette, sub-family C (CFTR/MRP), me Peroxiredoxin 1Peroxiredoxin CACGGTTGGTTCTG actin, beta CCCTGGCTCCTAGCACCAT AGAGCCACCAATCCACACAGA 8-oxoguanine DNA glycosylase8-oxoguanine purchased from SuperArray Glutathione peroxidase 1Glutathione (cytochrome) oxidoreductaseP450 GT CTCGGTTTCC No of examinedNo weight Body Absolute Relative Por Nrf2 Nqo1 Gpx2 Gpx1 Ogg1 Gsta2 Prdx1 Abcc3 bactin Gstm2 Gstm3 Ugt1a6 Cyp1a1 Cyp1a2 Cyp1b1 Group animals (g) (g) (%) List of Primer Sequences Used Body and Liver Weights (mean and Liver (mean Body Weights number symbol name Gene Forward primer Reverse primer Accession Gene Untreated control (p.h) Untreated control BNF 2% 5 5 17.6 ± 232.3 7.9** ± 221.7 0.88 ± 5.7 ± 0.86** 9.18 0.47 ± 2.47 NM_012540 NM_017000 NM_017013 NM_057105 DEN aloneDEN DEN + BNF 2%represents significant**: differencefr 5 5 ± 5.8** 206.2 10.3 ± 245.4 0.13 ± 5.6 0.11 ± 2.29 †, ††: represents significant difference fr p.h: Partial hepatectomyalone. NM_012541 NM_012940 NM_177426 NM_031154 NM_183403 NM_031789 NM_080581 NM_057114 NM_030826 NM_031144 NM_031576 NM_030870 Table 1. Table Table 2. Table 32 Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis

A C E

B D F

Fig. 2. Microscopic photographs of the livers of rats given diet containing 0% or 2% BNF for 6 weeks after DEN initiation. As compared with the control animal (A), diffuse hepatocellular hypertrophy with eosinophilic cytoplasm is apparent in the DEN + BNF group (B) (H-E stain). GST-P-positive foci are observed in the DEN + BNF group (D) in comparison with the DEN alone group (C) (GST-P immunohistochemistry). Hepatocytes are positive for CYP1A1 in the DEN + BNF group (F), but negative in the DEN alone group (E) (CYP1A1 immunohistochemistry).

GEArray Rat toxicology and Drug Resistance Microarray synthesized from 3 µg total RNA using the TrueLabeling- (ORN-401; SuperArray Bioscience Corp, Fredrick, MD, AMP kit (SuperArray Bioscience Corp) with conversion of USA). The list of all genes and functional gene grouping in the total RNA biotin-labeled cRNA probe through cDNA this microarray are available on the web site: http:// synthesis step. The array filters were hybridized with biotin- www.superarray.com/gene_array_product/HTML/ORN- labeled probes at 60°C for overnight. The filters were then 401.html. The total RNA from the liver was isolated using washed twice with 2 × saline-sodium citrate buffer (SSC) / TRIzol reagent (Invitrogen Corp, Carlsbad, CA, USA) in 1% sodium dodecyl sulfate (SDS) and then twice with 0.1 × accordance with the manufacturer’s instructions. cRNA was SSC / 1% SDS at 60°C for 15 min each. Chemilumilescent Yokouchi, Muguruma, Mitsuyoshi et al. 33

detection steps were performed by subsequent incubation of Table 3. Numbers and Area (mean ± SD) of GST-P Positive Foci in the filters with alkaline phosphatase-conjugated streptavidin the Livers of Rats Given Diet Containing β-Naphthoflavone and CDP-Star substrate, and exposed to Hyperfilm™ ECL (BNF) for 6 Weeks after DEN Initiation X-ray film (Amersham Biosciences UK Ltd, Foci Buckinghamshire, UK). The image data obtained from the No. animals Number Area GEArray were analyzed using the GEArray Expression Group examined (no./cm2)(mm2/cm2) Analysis Suite software (SuperArray Bioscience Corp) correcting for background noise by subtraction of the DEN alone 5 21.2 ± 1.0 0.293 ± 0.108 minimum value and normalizing to the value of two house- DEN + BNF 2% 5 70.6 ± 12.0* 0.980 ± 0.424* keeping genes (β-actin and GAPDH). For each spot, the * represents significant difference from the DEN-alone group at P < 0.05 ratio of intensities between the DEN and DEN + BNF groups (t-test). was analyzed. Genes were considered to be significant in the DEN + BNF group if the values of changes were less than 0.67 or greater than 1.5-fold, as compared to the DEN alone Table 4. The Number of PCNA Positive Cells per 200 Cells in the Livers of Rats Given Diet Containing β-Naphthoflavone group. (BNF) for 6 Weeks after DEN Initiation Quantitative real-time Reverse Transcription (RT)- Group No. animals examined Positive cells (%) PCR DEN alone 4 3.27 ± 1.45 The genes which were up-regulated more than 1.5-fold DEN + BNF 2% 4 9.67 ± 2.74* or down-regulated less than 0.67-fold by BNF treatment and related to oxidative stress or Nrf2 were validated by * represents significant difference from the DEN-alone group at P < 0.05 quantitative real-time RT-PCR. RT was carried out using (t-test). ThermoScript RT-PCR System (Invitrogen Corp), and the cDNA aliquots were used in the quantitative real-time RT- Table 5. Incidence of Lipofuscin Deposition in the Liver of Rats PCR with SYBR Green using an ABI Prism 7000 Sequence Given Diet Containing β-Naphthoflavone (BNF) for 6 Detection System (Applied Biosystems, Japan Ltd, Tokyo, Weeks after DEN Initiation Japan). cDNA was synthesized from 2 µg of RNA in the Lipofuscin deposition presence of DTT, dNTPs, random primers, RNaseOUT, and No. animals SuperScript™ III reverse transcriptase (Invitrogen Corp) in a Group examined ± +++ total of 20 µg reaction mix, after the concentration and DEN alone 5 5 0 0 quality of RNA had been measured using an DEN + BNF 2% 5 0 1 4 electrophotometer and a spectrometer. The real-time RT- PCR reaction was performed according to the SYBR Green ±: equivocal, +: slight, ++: moderate. PCR master mix protocol, and it was repeated in triplicate for each gene. The PCR primers were designed using Primer Express software (Applied Biosystems). The designed PCR control group and the DEN alone group, and was also primers were verified for their singularities using the web observed in the BNF alone group as compared with the DEN site: http://130.14.29.110/blast/. The amount of target gene, alone group. The absolute and relative liver weights normalized to an endogenous reference (β-actin) and relative (relative to body weight) were significantly increased in the to a control, was given by the 2(-Delta Delta C(T)) method17. DEN + BNF group and the BNF alone group as compared The sequence of primers used for real-time RT-PCR analysis with the corresponding control groups (Table 2). is shown in Table 1. Pathological and immunohistochemical examinations Statistical evaluation In the DEN + BNF group, diffuse hepatocellular The data concerning body weights, liver weights, GST- hypertrophy with eosinophilic cytoplasm was P-positive foci, the PCNA labeling index, the Low-density microscopically observed (Fig. 2A and B). Altered microarray and real-time RT-PCR were compared between hepatocellular foci which consisted mainly of eosinophilic two corresponding groups using Student’s t-test after one- or clear cells, were found in both the DEN-initiated groups. way ANOVA. Additionally, Dunnett’s test was used to A few larger eosinophilic cell foci featuring large pale isolate the group(s) that differed significantly from the eosinophilic hepatocytes with atypia, mitosis, apoptotic untreated group in body and liver weights. figures and compression of adjacent hepatic cords were apparent in all animals of the DEN + BNF group. Results Furthermore, localized inflammatory cell infiltration with small foci of necrosis were also detected in all animals of the Body and liver weights DEN + BNF group. In the DEN + BNF group, the numbers A significant decrease in body weights was observed in and areas of GST-P-positive foci were significantly the DEN + BNF group as compared with the untreated increased group as compared with the DEN alone group 34 Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis

Table 6. List of Genes in Which Fluctuations were Observed in the DEN + BNF Group in a Low-density Rat Toxicology & Drug Resistance Microarray

Accession Classfication Ratio number Gene name Gene symbol (DEN + BNF/DEN)

Up-regulated genes (>1.5-fold) Drug metabolizing enzymes (Oxidoreductases) NM_012540 Cytochrome P450, family 1, subfamily a, polypeptide 1 Cyp1a1 16.6 NM_012940 Cytochrome P450, family 1, subfamily b, polypeptide 1 Cyp1b1 7.2 NM_017000 NAD(P)H dehydrogenase, quinone 1 Nqo1 4.8 NM_017286 Cytochrome P450, family 11, subfamily a, polypeptide 1 Cyp11a1 2.6 NM_012541 Cytochrome P450, family 1, subfamily a, polypeptide 2 Cyp1a2 2.0 NM_031241 Cytochrome P450, family 8, subfamily b, polypeptide 1 Cyp8b1 1.9 NM_024387 Heme oxygenase (decycling) 2 HO2 1.7 Drug metabolizing enzymes (Glutathione peroxidases) NM_177426 Glutathione S-transferase, mu 2 Gstm2 4.0 NM_138974 Glutathione S-transferase, pi 2 Gstp2 2.5 NM_053293 Glutathione S-transferase theta 1 Gstt1 2.2 NM_031154 Glutathione S-transferase, mu 3 Gstm3 1.7 Drug metabolizing enzymes (Methyltransferses) NM_012531 Catecholamine-O-methyltransferase Comt 1.7 Drug metabolizing enzymes (Others) NM_057105 UDP glycosyltransferase 1 family, polypeptide A6 Ugt1a6 1.6 XM_231437 Paraoxonase 3 Pon3 1.6 Chaperones NM_012935 Crystallin alpha polypeptide 2 Cryab 3.2 Cell cycle genes NM_031762 Cyclin-dependent kinase inhibitor 1B (p27 Kip1) Cdkn1b 2.8 Cell adhesion molecules XM_213831 Integrin, alpha 7 Itga7 2.7 XM_215984 Integrin, alpha 6 Itga6 2.4 Down-regulated genes (<0.67-fold) Drug metabolizing enzymes (Oxidoreductases) NM_057114 Peroxiredoxin 1 Prdx1 0.6 NM_031576 P450 (cytochrome) oxidoreductase Por 0.6 NM_019184 Cytochrome P450, subfamily IIC Cyp2c 0.4 NM_017158 Cytochrome P450, family 2, subfamily c, polypeptide 7 Cyp2c7 0.4 Drug metabolizing enzymes (Glutathione peroxidases) NM_030826 Glutathione peroxidase 1 Gpx1 0.6 Chaperones NM_012670 t-Complex protein 1 TCP1 0.6 Unclassfied XM_341808 Cytochrome P450, family 2, subfamily b, polypeptide 2 Cyp2b2 0.6 NM_138512 Cytochrome P450, family 2, subfamily c, polypeptide 70 Cyp2c70 0.5 NM_147206 Cytochrome P450, family 3, subfamily a, polypeptide 13 Cyp3a13 0.4

(Table 3, Fig. 2C and D). A significant increase in the regulated less than 0.67-fold in comparison with DEN alone PCNA labeling index was observed in the DEN + BNF group (Table 6). Of these 27 genes, 19 were metabolism/ group as compared with the DEN alone group (Table 4). oxidation/reduction related genes. To check the expressions Although almost all the hepatocytes were negative for of these 19 genes, real-time RT-PCR analysis was carried CYP1A1 in the DEN alone group, they were diffusely out. The results of the microarray and real-time RT-PCR are stained in the DEN + BNF group (Fig. 2E and F). The summarized in Fig. 3. The gene expression levels in real- deposition of lipofuscin was observed slightly or equivocally time RT-PCR were approximately similar to those in the in the DEN alone group, and was observed moderately in the microarray, and significant differences were predominantly DEN + BNF group (Table 5). observed in metabolism/oxidation-related genes such as CYP1A1, CYP1B1 and NAD(P)H dehydrogenase quinone 1 Analysis of BNF-induced gene expressions (Nqo1) between the DEN alone and DEN + BNF groups. In In the microarray analysis of the livers in rats treated addition, nuclear factor erythroid-derived 2-like 2 (Nrf2), with BNF for 6 weeks after DEN initiation, 18 genes ere up- multidrug resistance-associated protein 3 (Abcc3) and UDP regulated more than 1.5-fold and 9 genes were down- glycosyltransferase 1 family, polypeptide A6 (Ugt1a6) Yokouchi, Muguruma, Mitsuyoshi et al. 35

Fig. 3. Real-time RT-PCR analysis of mRNA expression. Columns represent the mean ± S.D. of 4 animals. Individual gene expression levels were normalized by using β-actin. The values are presented as group mean changes over the control in folds. *,** represents significant difference from the DEN alone group at P < 0.05 or 0.01, respectively (t-test).

showed significant increases in the DEN + BNF group. weeks results in the induction of oxidative stress in the livers of rats. Discussion In the low-density microarray, 18 were up-regulated and 9 genes were down-regulated in the DEN + BNF group, Histopathologically, remarkable increases in the when compared with the DEN alone group. Of the genes number and area of GST-P-positive foci as well as the identified, most of the up-regulated genes were classified as number of PCNA-positive cells were observed in the DEN + oxidizers or reducers, and real-time RT-PCR revealed BNF group, as compared with the DEN alone group. This significant increases of some genes related to oxidative suggests that BNF promotes the development of foci of stress such as CYP1A1, CYP1A2, CYP1B1, Nqo1, Gsta2, cellular alterations in the liver of rats. In addition, small Gstm2, Gstm3 and Gpx2. BNF is known as a bi-functional necrotic foci and deposition of lipofuscin were slightly inducer of phase I metabolic enzymes via the aryl observed in the BNF-treated groups. Lipofuscin is an age- hydrocarbon receptor (AHR) pathway as an AHR ligand and related wasting pigment that is considered to be an index of phase II metabolic enzymes via the Nrf2 pathway19. In this lipid peroxidation, because it is known to be cellular debris study, phase I metabolic enzymes such as CYP1A1, derived from lipid peroxidation by free radical-induced CYP1A2, and CYP1B1 having a XRE/DRE transcriptional oxidative stress18. Our histopathological findings suggest domain and phase II metabolic enzymes having an EpRE/ the possibility that treatment with BNF at 2% in diet for 6 ARE transcriptional domain were induced via the AHR and 36 Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis

Nrf2 pathways19. Among the CYPs, the most active isoform production of ROS, which may cause DNA damage, is one for catalyzing procarcinogens is CYP1A20,21, and the up- of the causes of the liver tumor promotion activity of BNF. regulation of CYP1A1 and/or CYP1A2 isoform(s) indirectly However, the suppression of p53 dependent apoptosis by up- results in the production of very large amounts of reactive regulation of Gpx2 and/or functional abnormalities in the oxygen species (ROS) in comparison with other CYPs21,22. maintenance of tissue constancy, cell growth, differentiation In addition, Nqo1 acts to protect oxidative stress induced by and tumor growth caused by decreases in GJIC such as Cx32 a variety of metabolic situations including metabolism of may also be related to the liver tumor promoting effect. quinones and other xenobiotics, by (i) functioning as a two Further studies are necessary to clarify whether the altered electron donor to provide a shunt that competes with the expression of such oxidative stress-related genes is also formation of ROS, (ii) maintaining reduced coenzyme Q, responsible for the development of BNF-induced and (iii) regulating the stress activated kinase pathway23. hepatocarcinogenesis in rats. Furthermore, GSTs catalyze the conjugation of glutathione to electrophilic substrates, which can react with cellular References components like DNA. Thus far, many isoforms of GSTs including α, µ, π, θ, ω, and σ have been identified in 1. Wang H, Huang M, Peng RX, and Le J. Influences of 3- mammals24,25, and each isoform is considered to play a role methylcholanthrene, phenobarbital and dexamethasone on in stress responses and metabolism in various ways. xenobiotic metabolizing-related cytochrome P450 enzymes Complex pathways regulate the mRNA expression of GSTs, and steroidogenesis in human fetal adrenal cortical cells. and many xenobiotics, classfied as bi-functional inducers, Acta Pharmacol Sin. 27: 1093–1096. 2006. 2. Harrigan JA, McGarrigle BP, Sutter TR, and Olson JR. are capable of directly or indirectly inducing both phase I Tissue specific induction of cytochrome P450 (CYP) 1A1 and phase II enzymes such as CYPs and GSTs. In addition, and 1B1 in rat liver and lung following in vitro (tissue slice) Gpx functions to convert hydrogen peroxide into water in the and in vivo exposure to benzo(a)pyrene. Toxicol In Vitro. presence of glutathione, and Gpx2 causes oxidative stress via 20: 426–438. 2006. Nrf2 interposition in the lung26. On the other hand, it has 3. Landi MT, Bergen AW, Baccarelli A, Patterson DG Jr, been reported that Gpx2 suppresses apoptosis induced by Grassman J, Ter-Minassian M, Mocarelli P, Caporaso N, p53 pathway-dependent oxidative stress27. Based on the Masten SA, Pesatori AC, Pittman GS, and Bell DA. above findings, it can be considered that CYP enzymes were CYP1A1 and CYP1B1 genotypes, haplotypes, and TCDD- strongly induced by the activation of the AHR pathway due induced gene expression in subjects from Seveso, Italy. to the exposure of BNF, an AHR ligand, and phase II Toxicology. 207: 191–202. 2005. antioxidation / detoxification system enzymes were guided 4. Spink BC, Pang S, Pentecost BT, and Spink DC. Induction of cytochrome P450 1B1 in MDA-MB-231 human breast via the Nrf2 system activated by ROS generated from CYPs 16,28–30 cancer cells by non-ortho-substituted polychlorinated enzyme-dependent metabolism . biphenyls. Toxicol In Vitro. 16: 695–704. 2002. Among the down-regulated genes, significant decreases 5. Brown JP and Dietrich PS. Mutagenicity of plant flavonols in the expression of the genes of Ogg1, Gpx1, Prdx1 and Por in the Salmonella/mammalian microsome test:activation of were found in the real-time RT-PCR. Ogg1, the repair gene flavonol glycosides by mixed glycosidases from rat cecal which removes 8-hydroxy deoxyguanidine (8-OHdG), a bacteria and other sources. Mutat Res. 66: 223–240. 1979. DNA adduct generated through DNA oxidation by oxidative 6. Shoda T, Mitsumori K, Onodera H, Toyoda K, Uneyama C, stress, is known as an indicator of oxidative DNA damage Takada K, and Hirose M. Liver tumor-promoting effect of and is potentially involved in carcinogenesis in various beta-naphthoflavone, a strong CYP 1A1/2 inducer, and the experimental models14,31–34. The reason why Ogg1 was relationship between CYP 1A1/2 induction and Cx32 down-regulated is unclear, but it has been reported that decrease in its hepatocarcinogenesis in the rat. Toxicol Pathol. 28: 540–547. 2000. inactivation of Ogg1 leads to a higher risk of cancer, because 7. Diwan BA, Rice JM, Nims RW, Lubet RA, Hu H, and Ward cells with accumulated 8-OHdG still retain the ability to JM. P-450 enzyme induction by 5-ethyl-5-phenylhydantoin proliferate leading to an increase in the mutation and 5,5-diethylhydantoin, analogues of barbiturate tumor 35 frequency . Gpx1 and Prdx1 are antioxidant enzymes promoters phenobarbital and barbital, and promotion of liver removing hydrogen peroxide and lipid peroxides, and and thyroid carcinogenesis initiated by N- protect cells against oxidative stress originating from ROS nitrosodiethylamine in rats. Cancer Res. 48: 2492–2497. generation36. In particular, Prdx1 is an antioxidant enzyme 1988. which causes neutralization of ROS and suppresses the DNA 8. Lubet RA, Nims RW, Ward JM, Rice JM, and Diwan BA. oxidation37. Por is the gene of P450 oxidoreductase which Induction of cytochrome P450b and its relationship to liver may independently act as a coenzyme of P450, and some tumor promotion. J Am Coll Toxicol. 8: 259–268. 1989. chemicals induce the production of superoxide and/or lipid 9. Krutovskikh VA, Mesnil M, Mazzoleni G, and Yamasaki H. Inhibition of rat liver gap junction intercellular peroxidation with Por reaction14. However, the reason why communication by tumor-promoting agents in vivo. Gpx1, Prdx1 and Por were down-regulated in the present Association with aberrant localization of connexin proteins. study could not be clarified. Additional study is necessary to Lab Invest. 72: 571–577. 1995. investigate these decreases. 10. Machala M, Blaha L, Lehmler HJ, Pliskova M, Majkova Z, In conclusion, our experimental results suggest the Kapplova P, Sovadinova I, Vondracek J, Malmberg T, and Yokouchi, Muguruma, Mitsuyoshi et al. 37

Robertson LW. Toxicity of hydroxylated and quinoid PCB susceptibility to carcinogens: a review. Mutat Res. 463: metabolites: inhibition of gap junctional intercellular 247–283. 2000. communication and activation of aryl hydrocarbon and 26. Singh A, Rangasamy T, Thimmulappa RK, Lee H, Osburn estrogen receptors in hepatic and mammary cells. Chem Res WO, Brigelius-Flohe R, Kensler TW, Yamamoto M, and Toxicol. 17: 340–347. 2004. Biswal S. Glutathione Peroxidase 2, the Major Cigarette 11. Warner KA, Fernstrom MJ, and Ruch RJ. Inhibition of Smoke-inducible Isoform of GPX in Lungs is Regulated by mouse hepatocyte gap junctional intercellular Nrf2. Am J Respir Cell Mol Biol. 2006 [Epub ahead of communication by phenobarbital correlates with strain- print]. specific hepatocarcinogenesis. Toxicol Sci. 71: 190–197. 27. Yan W and Chen X. GPX2, a direct target of p63, inhibits 2003. oxidative stress-induced apoptosis in a p53-dependent 12. Neveu MJ, Hully JR, Paul DL, and Pitot HC. Reversible manner. J Biol Chem. 281: 7856–7862. 2006. alteration in the expression of the gap junctional protein 28. Hughes EM and Gallagher EP. Effects of beta- connexin 32 during tumor promotion in rat liver and its role naphthoflavone on hepatic biotransformation and during cell proliferation. Cancer Commun. 2: 21–31. 1990. glutathione biosynthesis in largemouth bass (Micropterus 13. Neveu MJ, Babcock KL, Hertzberg EL, Paul DL, Nicholson salmoides). Mar Environ Res. 58: 675–679. 2004. BJ, and Pitot HC. Colocalized alterations in connexin 32 and 29. Nebert DW, Dalton TP, Okey AB, and Gonzalez FJ. Role of cytochrome P450IIB1/2 by phenobarbital and related liver aryl hydrocarbon receptor-mediated induction of the CYP1 tumor promoters. Cancer Res. 54: 3145–3152. 1994. enzymes in environmental toxicity and cancer. J Biol Chem. 14. Moto M, Okamura M, Muto T, Kashida Y, Machida N, and 279: 23847–23850. 2004. Mitsumori K. Molecular pathological analysis on the 30. Gravato C and Santos MA. Liver phase I and phase II mechanism of liver carcinogenesis in dicyclanil-treated enzymatic induction and genotoxic responses of beta- mice. Toxicology. 207: 419–436. 2005. naphthoflavone water-exposed sea bass. Ecotoxicol Environ 15. Delescluse C, Ledirac N, Li R, Piechocki MP, Hines RN, Saf. 52: 62–68. 2002. Gidrol X, and Rahmani R. Induction of cytochrome P450 31. Nakae D, Kobayashi Y, Akai H, Andoh N, Satoh H, Ohashi 1A1 gene expression, oxidative stress, and genotoxicity by K, Tsutsumi M, and Konishi Y. Involvement of 8- carbaryl and thiabendazole in transfected human HepG2 and hydroxyguanine formation in the initiation of rat liver lymphoblastoid cells. Biochem Pharmacol. 61: 399–407. carcinogenesis by low dose levels of N-nitrosodiethylamine. 2001. Cancer Res. 57: 1281–1287. 1997. 16. Elbekai RH, Korashy HM, Wills K, Gharavi N, and El-Kadi 32. Yoshida M, Miyajima K, Shiraki K, Ando J, Kudoh K, AO. Benzo[a]pyrene, 3-methylcholanthrene and beta- Nakae D, Takahashi M, and Maekawa A. Hepatotoxicity and naphthoflavone induce oxidative stress in hepatoma hepa consequently increased cell proliferation are associated with 1c1c7 Cells by an AHR-dependent pathway. Free Radic Res. flumequine hepatocarcinogenesis in mice. Cancer Lett. 141: 38: 1191–1200. 2004. 99–107. 1999. 17. Livak KJ and Schmittgen TD. Analysis of relative gene 33. Kinoshita A, Wanibuchi H, Imaoka S, Ogawa M, Masuda C, expression data using real-time quantitative PCR and the 2(- Morimura K, Funae Y, and Fukushima S. Formation of 8- Delta Delta C(T)) method. Methods. 25: 402–408. 2001. hydroxydeoxyguanosine and cell-cycle arrest in the rat liver 18. Tsuchida M, Miura T, and Aibara K. Lipofuscin and via generation of oxidative stress by phenobarbital: lipofuscin-like substances. Chem Phys Lipids. 44: 297–325. association with expression profiles of p21(WAF1/Cip1), 1987. cyclin D1 and Ogg1. Carcinogenesis. 23: 341–349. 2002. 19. Giudice A and Montella M. Activation of the Nrf2-ARE 34. Kinoshita A, Wanibuchi H, Morimura K, Wei M, Shen J, signaling pathway: a promising strategy in cancer Imaoka S, Funae Y, and Fukushima S. Phenobarbital at low prevention. Bioessays. 28: 169–181. 2006. dose exerts hormesis in rat hepatocarcinogenesis by 20. Guengerich FP and Shimada T. Oxidation of toxic and reducing oxidative DNA damage, altering cell proliferation, carcinogenic chemicals by human cytochrome P-450 apoptosis and gene expression. Carcinogenesis. 24: 1389– enzymes. Chem Res Toxicol. 4: 391–407. 1991. 1399. 2003. 21. Puntarulo S and Cederbaum AI. Production of reactive 35. Arai T, Kelly VP, Komoro K, Minowa O, Noda T, and oxygen species by microsomes enriched in specific human Nishimura S. Cell proliferation in liver of Mmh/Ogg1- cytochrome P450 enzymes. Free Radic Biol Med. 24: 1324– deficient mice enhances mutation frequency because of the 1330. 1998. presence of 8-hydroxyguanine in DNA. Cancer Res. 63: 22. Canistro D, Cantelli-Forti G, Biagi GL, and Paolini M. Re: 4287–4292. 2003. dioxin increases reactive oxygen production in mouse liver 36. Lee CH, Lee KY, Choe KH, Hong YC, Noh SI, Eom SY, Ko mitochondria (Toxicol Appl Pharmacol. 178: 15–21, 2002). YJ, Zhang YW, Yim DH, Kang JW, Kim H, and Kim YD. To the editor. Toxicol Appl Pharmacol. 185: 74–75. 2002. Effects of oxidative DNA damage and genetic 23. Raina AK, Templeton DJ, Deak JC, Perry G, and Smith MA. polymorphism of the glutathioneperoxidase 1 (GPX1) and 8- Quinone reductase (NQO1), a sensitive redox indicator, is oxoguanine glycosylase 1 (hOGG1) on lung cancer. J Prev increased in Alzheimer’s disease. Redox Rep. 4: 23–27. Med Pub Health. 39: 130–134. 2006. 1999. 37. Kropotov A, Serikov V, Suh J, Smirnova A, Bashkirov V, 24. Hayes JD and Pulford DJ. The glutathione S-transferase Zhivotovsky B, and Tomilin N. Constitutive expression of supergene family: regulation of GST and the contribution of the human peroxiredoxin V gene contributes to protection of the isoenzymes to cancer chemoprotection and drug the genome from oxidative DNA lesions and to suppression resistance. Crit Rev Biochem Mol Biol. 30: 445–600. 1995. of transcription of noncoding DNA. FEBS J. 273: 2607– 25. Landi S. Mammalian class theta GST and differential 2617. 2006.