DOCSLIB.ORG

Molecular Analysis on the Possible Mechanism of Β-Naphthoflavone-Induced Hepatocarcinogenesis in Rats

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Analysis on the Possible Mechanism of Β-Naphthoflavone-Induced Hepatocarcinogenesis in Rats J Toxicol Pathol 2007; 20: 29–37 Original Molecular Analysis on the Possible Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis in Rats Yusuke Yokouchi1, Masako Muguruma1, Mitsuyoshi Moto1, Miwa Takahashi1, Meilan Jin1, Yusuke Kenmochi1, Taichi Kohno1, Yasuaki Dewa1, and Kunitoshi Mitsumori1 1Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3–5–8 Saiwai-cho, Fuchu, Tokyo 183–8509, Japan Abstract: It has been speculated that oxidative stress is involved in the liver tumor-promoting effect of β- naphthoflavone (BNF; 5,6-benzoflavone) in rats, because of its strong induction of cytochrome P450 (CYP) 1A enzymes. In order to clarify the mechanism of liver tumor promoting effects of BNF, male F344 rats were initiated with a single intraperitoneal injection of 200 mg/kg diethylnitrosamine (DEN), and fed diet containing 2% of BNF for 6 weeks staring 2 weeks after injection. Two/third partial hepatectomy was perfomed at Week 3 after the treatment of BNF. Low-density Rat Toxicology & Drug Resistance Microarray and quantitative analyses of mRNA expressions of the selected genes using real-time reverse transcription (RT) -PCR were carried out on total RNAs extracted from the livers of F344 rats. Collected liver tissues were subjected to light microscopic examinations (hematoxylin and eosin staining), immunohistochemistries of proliferating cell nuclear antigen (PCNA), glutathione S-transferase placental form (GST-P) and CYP1A1, and Schmorl staining to identify lipofuscin. Gene expression analysis showed that 7 genes (CYP1A1, CYP1A2, CYP1B1, Gstm2 (GST mu2), Gstm3, glutathione peroxidase (Gpx)2 and NAD(P)H dehydrogenase, quinone 1(Nqo1)) were up-regulated (> 1.5 fold), and 4 genes (8-oxoguanine DNA glycosylase (Ogg1), Gpx1, peroxiredoxin (Prdx) 1 and P450 oxidoreductase (Por)) were down-regulated (< 0.67 fold) in the DEN + BNF group rats as compared with the DEN alone group. In immunohistochemical analyses, the numbers of foci positive for GST- P, the rate of PCNA-positive cells, and the rate of CYP1A1-positive cells were significantly increased in the DEN + BNF group, as compared to the corresponding control. Furthermore, deposition of lipofuscin, positive for Schmorl staining, was moderately increased in the DEN + BNF group. These results confirm the possibility that oxidative stress is involved in the liver tumor-promoting effect of BNF in rats. (J Toxicol Pathol 2007; 20: 29–37) Key words: β-naphthoflavone, non-genotoxic carcinogen, hepatocarcinogenesis, oxidative stress, rats Introduction these chemicals, BNF itself showed no mutagenic activity when screened over a wide range of concentrations in BNF is a synthetic derivative of a naturally occurring several strains of the Salmonella/mammalian microsome flavonoid which strongly induces CYP 1A1/2, and it has been assay5. In addition, a liver tumor promotion effect of BNF used as a specific CYP1A1/2 inducer in pharmacological has been demonstrated using a two-stage rat liver and/or pharmacokinetic experiments. With regard to CYP carcinogenesis model in rats given BNF for 6 weeks6. induction, BNF shows a similar potency and specificity to It has been reported that there is a good correlation polycyclic aromatic hydrocarbons (e.g, 3- between the ability of chemicals inducing CYP2B1/2 methylcholanthrene, benzo [a] pyrene) as well as isozymes such as phenobarbital (PB) and their potential to polyhalogenated aromatic compounds (2,3,7,8- promote hepatocarcinogenesis7,8. Additionally, the fact that tetrachlorodibenzo-p-dioxion (TCDD), and 3,3’,4,4’,5,5’- various types of liver tumor-promoting agents including PB hexachlorobiphenyl), which are mutagenic and/or have the ability to inhibit gap junctional intercellular carcinogenic in laboratory animals1–4. Although, unlike communication (GJIC) in the rat liver in vivo has been demonstrated9–11. Decreases in the abundance of the GJIC protein connexin 32 (Cx32) were induced in both altered Received: 27 October 2006, Accepted: 2 December 2006 hepatocellular foci12 and centrilobular hepatocytes where Mailing address: Yusuke Yokouchi, Laboratory of Veterinary 13 Pathology, Tokyo University of Agriculture and Technology, 3–5–8 CYP2B1/2 isozymes are induced , suggesting a relationship Saiwai-cho, Fuchu, Tokyo 183–8509, Japan between the agents inducing CYP2B1/2 isozymes and TEL & FAX: 81-42-367-5771 reducing Cx32 in the same area of the liver tumor promoting E-mail: [email protected] mechanism. However, it is unclear whether there is good 30 Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis Fig. 1. Experimental design. correlationship between the induction of CYP1A subfamilies were fed powdered diet containing BNF at a concentration of other than CYP2B1/2 and liver tumor promoting activity. 2% for 6 weeks. To enhance the hepatocellular proliferation Shoda et al. performed a two-stage rat liver carcinogenesis in the liver, all rats were subjected to two-thirds partial model using BNF, and demonstrated that there is a link hepatectomy (left and median lobes excised) at Week 3. For between CYP1A2 induction and liver tumor promotion sampling of the liver at Week 8, all surviving animals were activity of BNF6. In addition, there have been some reports sacrificed under anesthesia with ether by exsanguination suggesting that the mechanism of liver tumor promoting from the abdominal aorta after measurement of body activity associated with the induction of CYP1A subfamily is weights. The animals were necropsied, the livers excised related to oxidative stress14–16. and their weights recorded. Since the animals had been In the present study, a short term study using the two- subjected to a partial hepatectomy, the remaining liver stage hepatocarcinogenesis model was performed in rats to consisted of the anterior and posterior right and caudate clarify the molecular mechanism of the liver tumor lobes. One section obtained from each lobe was fixed with promoting effect of BNF. neutral-buffered formalin for the histochemical and histological examinations. One hundred milligrams of liver Materials and Methods samples from the remaining liver were frozen in RNA-Later (Qiagen, Hilden, Germany) and stored at –80°C until use for Animals and chemicals gene expression analysis. Male Fischer 344 rats, 5 weeks old, were purchased from Japan SLC Inc. (Shizuoka, Japan). The rats were Histological examination housed in stainless steel cages with two or three animals per The fixed liver tissue from each animal was embedded cage and allowed free access to tap water and commercial in paraffin, sectioned at 4 µm and stained with hematoxylin basal diet (MF, Oriental Yeast Industries Co, Ltd. Tokyo, and eosin (H-E) for histological examinations. The level of Japan). All the animals were handled under standard lipofuscin in the liver was determined by the method of conditions (room temperature, 22 ± 2°C; relative humidity, Schmorl. Immunohistochemical staining was conducted 55 ± 5%; 12-h light- dark cycle). They were acclimatized for using the labeled avidin-biotin-peroxidase complex (ABC) 1 week before dosing and were randomly allocated to four method for binding of anti-rat GST-P (1:1000; MBL, test groups (five rats per group) by the stratification method Nagoya, Japan), anti-rat CYP1A1 (1:200; Santa Cruz based on their body weights immediately prior to the dosing. Biotechnology Inc, Santa Cruz CA, USA), and anti-rat The animal care and experiments were carried out in PCNA (1:200; Dako Japan, Kyoto, Japan) as primary accordance with the Guide for Animal Experimentation of antibodies. All specimens were lightly counterstained using Tokyo University of Agriculture and Technology. hematoxylin. Numbers and areas of altered foci positive for BNF (purity > 98%) and DEN were obtained from GST-P (> 2 hepatocytes in cross section) were measured Wako Pure Chemical Industries Ltd. (Osaka, Japan). using a Scion Image analyzer. All positive foci were counted in the DEN alone and DEN + BNF groups. To Experimental design obtain the PCNA labeling index, the number of PCNA- A two-stage liver carcinogenesis model in rats was positive cells was counted in 200–300 cells × 5 areas / slide, employed (Fig. 1). A total of 20 rats were divided into 4 without any recognition of the presence of foci. groups of 5 animals each. Animals in Group 3 and 4 were initiated with a single intraperitoneal injection of DEN at a Low-density rat toxicology & drug resistance dose of 200 mg/kg and animals in Group 1 (control) and 2 microarray received a single intraperitoneal injection of saline vehicle Gene expressions of the liver sample from the DEN alone. Two weeks after the injection, rats in Group 2 and 4 alone and DEN + BNF groups were analyzed by Oligo Table 1. List of Primer Sequences Used in Real-Time RT-PCR Analysis Accession Gene number symbol Gene name Forward primer Reverse primer NM_017013 Gsta2 glutathione-S-transferase, alpha type2 CAACTACATCGCCACCAAATATG GCCTTCGGTGTACATGTCAATC NM_057105 Ugt1a6 UDP glycosyltransferase 1 family, polypeptide A6 TGGCTACCCCAAAACGATCT ATACCATGGGAACCGGAGTGT NM_012540 Cyp1a1 Cytochrome P450, family 1, subfamily a, polypeptide 1 purchased from SuperArray Bioscience Corporation (base sequence is not shown) NM_012541 Cyp1a2 Cytochrome P450, family 1, subfamily a, polypeptide 2 AAGCGCCGGTGCATTG TGCAGGAGGATGGCTAAGAAG NM_012940 Cyp1b1 Cytochrome P450, family 1, subfamily b, polypeptide 1 CTTGGCCATTGATCGGAAA CAAGGCGAGCGAAGTACAAGT NM_017000 Nqo1 NAD(P)H dehydrogenase, quinone 1 TCCGCCCCCAACTTCTG TCTGCGTGGGCCAATACA NM_177426 Gstm2
Load more

Recommended publications
  • University of Groningen Drug Metabolism in Human and Rat
    University of Groningen Drug metabolism in human and rat intestine van de Kerkhof, Esther Gesina IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2007 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): van de Kerkhof, E. G. (2007). Drug metabolism in human and rat intestine: an 'in vitro' approach. s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 27-09-2021 Chapter 5 Induction of drug metabolism along the rat intestinal tract EG van de Kerkhof IAM de Graaf MH de Jager GMM Groothuis In preparation Chapter 5 Abstract Induction of drug metabolizing enzymes in the intestine can result in a marked variation in the bioavailability of drugs and cause an imbalance between local toxification and detoxification.
    [Show full text]
  • Time-Dependent Inhibition by 2,3,7,8-Tetrachlorodibenzo-P-Dioxin of Skin Tumorigenesis with Polycyclic Hydrocarbons1
    [CANCER RESEARCH 40. 1580-1587, May 1980] 0008-5472/80/0040-OOOOS02.00 Time-dependent Inhibition by 2,3,7,8-Tetrachlorodibenzo-p-dioxin of Skin Tumorigenesis with Polycyclic Hydrocarbons1 J. DiGiovanni,2 D. L. Berry, G. L. Gleason, G. S. Kishore, and T. J. Slaga McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, Wisconsin 53706 ¡J. D.. G. S K.J. and Biology Division, Oak Ridge National Laboratory. Oak Ridge. Tennessee 37830 ¡D.L B . G L G.. T. J. S.J ABSTRACT reactive intermediates that are capable of interacting covalently with cellular macromolecules (20). The interaction with DNA, a The effects of treating female mice with single topical doses target for activated PAH intermediates, has received consid of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) at various times erable attention in recent years and is presently considered a before and after 7,12-dimethylbenz(a)anthracene (DMBA), critical event in the initiation of chemical carcinogenesip. Cur benzo(a)pyrene, 3-methylcholanthrene (MCA), and (±)-trans- rent evidence suggests that bay-region diol-epoxides may be 7/S,8«-dihydroxy-9a,10a-epoxy-7,8,9,10-tetrahydrobenzo(a)- ultimate carcinogenic forms for some PAH (24). This is sup pyrene were studied. TCDD, at doses of 1 /ig/mouse, was ported by recent data concerning BaP and DMBA epoxides applied topically 3 days prior to, 5 min prior to, or 1 day after that produce a DMA-binding product similar to that isolated in the initiator. The application of TCDD 5 min prior to or 1 day vivo after treatment with the parent hydrocarbon (2, 11, 17, after initiation with DMBA, benzo(a)pyrene, or MCA had little 22, 33, 42, 48, 49).
    [Show full text]
  • Role of Aryl Hydrocarbon Receptor in Central Nervous System Tumors: Biological and Therapeutic Implications (Review)
    ONCOLOGY LETTERS 21: 460, 2021 Role of aryl hydrocarbon receptor in central nervous system tumors: Biological and therapeutic implications (Review) MONTSERRAT ZARAGOZA‑OJEDA1,2, ELISA APATIGA‑VEGA1 and FRANCISCO ARENAS‑HUERTERO1 1Laboratorio de Investigación en Patología Experimental, Hospital Infantil de México Federico Gómez, Mexico City 06720; 2Posgrado en Ciencias Biológicas, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico City 04510, México Received January 28, 2020; Accepted January 25, 2021 DOI: 10.3892/ol.2021.12721 Abstract. Aryl hydrocarbon receptor (AHR) is a ligand‑ 6. Non‑canonical AhR pathway activated transcription factor, whose canonical pathway 7. Potential therapeutic applications of the crosstalk between mainly regulates the genes involved in xenobiotic metabolism. AhR pathway and central nervous system tumors However, it can also regulate several responses in a non‑ 8. Conclusions canonical manner, such as proliferation, differentiation, cell death and cell adhesion. AhR plays an important role in central nervous system tumors, as it can regulate several 1. Background of AhR research cellular responses via different pathways. The polymorphisms of the AHR gene have been associated with the development of The study of AhR can be discussed from two standpoints; the gliomas. In addition, the metabolism of tumor cells promotes first one reflects the reality of current times, that is, human tumor growth, particularly in tryptophan synthesis, where exposure to synthetic organic compounds and the conse‑ some metabolites, such as kynurenine, can activate the AhR quences that has on human health. During the 1970s, the pathway, triggering cell proliferation in astrocytomas, medul‑ studies of several toxicologists, biochemists and molecular loblastomas and glioblastomas.
    [Show full text]
  • 3-Methylcholanthrene Induces Chylous Ascites and Lethality in Tiparp Knockout Mice
    3-Methylcholanthrene Induces Chylous Ascites and Lethality in Tiparp Knockout Mice by Tiffany Elizabeth Cho A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Pharmacology and Toxicology University of Toronto © Copyright by Tiffany Elizabeth Cho (2015) 3-Methylcholanthrene Induces Chylous Ascites and Lethality in Tiparp Knockout Mice Tiffany Elizabeth Cho Master of Science Department of Pharmacology and Toxicology University of Toronto 2015 Abstract The aryl hydrocarbon receptor (AHR) is a ligand-regulated transcription factor that is activated upon binding to various ligands. The activated AHR modulates the expression of many genes including cytochrome P450s (CYPs) such as Cyp1a1, Cyp1b1, and 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD)-inducible poly(ADP-ribose) polymerase (Tiparp). We recently reported that TIPARP is a transcriptional repressor of AHR and Tiparp knockout mice show increased sensitivity to dioxin-induced toxicities. Because of these findings, we examined the sensitivity of Tiparp knockout mice to 3-methylcholanthrene (3-MC), another potent AHR ligand. Tiparp knockout mice treated with 100mg/kg of 3-MC exhibited increased hepatotoxicity, increased lipolysis, and developed chylous ascites compared with treated wildtype mice. No treated Tiparp knockout mice survived beyond day 16; all wildtype mice survived the 30 day treatment. Collectively, this thesis shows that Tiparp knockout mice exhibit increased sensitivity to 3-MC- induced toxicity and lethality supporting our previous findings that TIPARP is an important negative regulator of AHR activity. ii Acknowledgements My M.Sc. has been a great learning experience and a fulfilling journey. I am forever grateful for the support and help that my supervisor, Dr.
    [Show full text]
  • The Role of Aryl-Hydrocarbon Receptor (Ahr) in Osteoclast Differentiation and Function
    cells Review The Role of Aryl-Hydrocarbon Receptor (AhR) in Osteoclast Differentiation and Function 1, 1, 2, Robin Park y, Shreya Madhavaram y and Jong Dae Ji * 1 MetroWest Medical Center/Tufts University School of Medicine, Framingham, MA 01702, USA; [email protected] (R.P.); [email protected] (S.M.) 2 Department of Rheumatology, College of Medicine, Korea University, Seoul 02841, Korea * Correspondence: [email protected] Robin Park and Shreya Madhavaram contributed equally to this work as first authors. y Received: 23 September 2020; Accepted: 13 October 2020; Published: 14 October 2020 Abstract: Aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that plays a crucial role in bone remodeling through altering the interplay between bone-forming osteoblasts and bone-resorbing osteoclasts. While effects of AhR signaling in osteoblasts are well understood, the role and mechanism of AhR signaling in regulating osteoclastogenesis is not widely understood. AhR, when binding with exogenous ligands (environmental pollutants such as polycylic aryl hydrocarbon (PAH), dioxins) or endogenous ligand indoxyl-sulfate (IS), has dual functions that are mediated by the nature of the binding ligand, binding time, and specific pathways of distinct ligands. In this review, AhR is discussed with a focus on (i) the role of AhR in osteoclast differentiation and function and (ii) the mechanisms of AhR signaling in inhibiting or promoting osteoclastogenesis. These findings facilitate an understanding of the role of AhR in the functional regulation of osteoclasts and in osteoclast-induced bone destructive conditions such as rheumatoid arthritis and cancer. Keywords: aryl-hydrocarbon receptor; osteoclastogenesis; bone remodeling; cytochrome P450 1.
    [Show full text]
  • Federal Register/Vol. 84, No. 230/Friday, November 29, 2019
    Federal Register / Vol. 84, No. 230 / Friday, November 29, 2019 / Proposed Rules 65739 are operated by a government LIBRARY OF CONGRESS 49966 (Sept. 24, 2019). The Office overseeing a population below 50,000. solicited public comments on a broad Of the impacts we estimate accruing U.S. Copyright Office range of subjects concerning the to grantees or eligible entities, all are administration of the new blanket voluntary and related mostly to an 37 CFR Part 210 compulsory license for digital uses of increase in the number of applications [Docket No. 2019–5] musical works that was created by the prepared and submitted annually for MMA, including regulations regarding competitive grant competitions. Music Modernization Act Implementing notices of license, notices of nonblanket Therefore, we do not believe that the Regulations for the Blanket License for activity, usage reports and adjustments, proposed priorities would significantly Digital Uses and Mechanical Licensing information to be included in the impact small entities beyond the Collective: Extension of Comment mechanical licensing collective’s potential for increasing the likelihood of Period database, database usability, their applying for, and receiving, interoperability, and usage restrictions, competitive grants from the Department. AGENCY: U.S. Copyright Office, Library and the handling of confidential of Congress. information. Paperwork Reduction Act ACTION: Notification of inquiry; To ensure that members of the public The proposed priorities do not extension of comment period. have sufficient time to respond, and to contain any information collection ensure that the Office has the benefit of SUMMARY: The U.S. Copyright Office is requirements. a complete record, the Office is extending the deadline for the extending the deadline for the Intergovernmental Review: This submission of written reply comments program is subject to Executive Order submission of written reply comments in response to its September 24, 2019 to no later than 5:00 p.m.
    [Show full text]
  • Inhibition of Uroporphyrinogen Decarboxylase by Halogenated Biphenyls in Chick Hepatocyte Cultures. Essential Role for Induction of Cytochrome P-448
    Biochem. J. (1984) 222, 737-748 737 Printed in Great Britain Inhibition of uroporphyrinogen decarboxylase by halogenated biphenyls in chick hepatocyte cultures Essential role for inducdon of cytochrome P-448 Peter R. SINCLAIR,*t§ William J. BEMENT,* Herbert L. BONKOVSKY,*j and Jacqueline F. SINCLAIR*t * VA Medical Center, White River Junction, VT 05001, U.S.A., and the Departments of fBiochemistry and tMedicine, Dartmouth Medical School, Hanover, NH 03756, U.S.A. (Received 16 April 1984/Accepted 23 May 1984) Uroporphyrinogen decarboxylase (EC 4.1.1.37) activity was assayed in cultures of chick-embryo hepatocytes by the changes in composition of porphyrins accumulated after addition of excess 5-aminolaevulinate. Control cells accumulated mainly protoporphyrin, whereas cells treated with 3,4,3',4'-tetrachlorobiphenyl or 2,4,5,3',4'- pentabromobiphenyl accumulated mainly uroporphyrin, indicating decreased activ- ity of the decarboxylase. 3-Methylcholanthrene and other polycyclic-hydrocarbon inducers of the P-448 isoenzyme of cytochrome P-450, did not affect the decarboxylase in the absence ofthe biphenyls. Induction ofP-448 was detected as an increase in ethoxyresorufin de-ethylase activity. Pretreatment of cells with methylcholanthrene decreased the time required for the halogenated biphenyls to inhibit the decarboxylase. The dose response of methylcholanthrene showed that less than 40% of the maximal induction of cytochrome P-448 was needed to produce the maximum biphenyl-mediated inhibition of the decarboxylase. In contrast, induction ofthe cytochrome P-450 isoenzyme by propylisopropylacetamide had no effect on the biphenyl-mediated decrease in decarboxylase activity. Use of inhibitors of the P-450 and P-448 isoenzymes (SKF-525A, piperonyl butoxide and ellipticine) supported the concept that only the P-448 isoenzyme is involved in the inhibition of the decarboxylase by the halogenated biphenyls.
    [Show full text]
  • Chemicals Subject to TSCA Section 12(B) Export Notification Requirements (January 16, 2020)
    Chemicals Subject to TSCA Section 12(b) Export Notification Requirements (January 16, 2020) All of the chemical substances appearing on this list are subject to the Toxic Substances Control Act (TSCA) section 12(b) export notification requirements delineated at 40 CFR part 707, subpart D. The chemicals in the following tables are listed under three (3) sections: Substances to be reported by Notification Name; Substances to be reported by Mixture and Notification Name; and Category Tables. TSCA Regulatory Actions Triggering Section 12(b) Export Notification TSCA section 12(b) requires any person who exports or intends to export a chemical substance or mixture to notify the Environmental Protection Agency (EPA) of such exportation if any of the following actions have been taken under TSCA with respect to that chemical substance or mixture: (1) data are required under section 4 or 5(b), (2) an order has been issued under section 5, (3) a rule has been proposed or promulgated under section 5 or 6, or (4) an action is pending, or relief has been granted under section 5 or 7. Other Section 12(b) Export Notification Considerations The following additional provisions are included in the Agency's regulations implementing section 12(b) of TSCA (i.e. 40 CFR part 707, subpart D): (a) No notice of export will be required for articles, except PCB articles, unless the Agency so requires in the context of individual section 5, 6, or 7 actions. (b) Any person who exports or intends to export polychlorinated biphenyls (PCBs) or PCB articles, for any purpose other than disposal, shall notify EPA of such intent or exportation under section 12(b).
    [Show full text]
  • Toxicological Review of Biphenyl (CAS No. 922-52-4) in Support Of
    EPA/635/R-11/005F www.epa.gov/iris TOXICOLOGICAL REVIEW OF BIPHENYL (CAS No. 92-52-4) In Support of Summary Information on the Integrated Risk Information System (IRIS) August 2013 U.S. Environmental Protection Agency Washington, DC DISCLAIMER This document has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use. ii CONTENTS—TOXICOLOGICAL REVIEW OF BIPHENYL (CAS No. 92-52-4) LIST OF TABLES ......................................................................................................................... vi LIST OF FIGURES ....................................................................................................................... ix LIST OF ABBREVIATIONS AND ACRONYMS ........................................................................x FOREWORD ................................................................................................................................ xii AUTHORS, CONTRIBUTORS, AND REVIEWERS ............................................................... xiii 1. INTRODUCTION ......................................................................................................................1 2. CHEMICAL AND PHYSICAL INFORMATION ....................................................................4 3. TOXICOKINETICS ...................................................................................................................6 3.1. ABSORPTION
    [Show full text]
  • Principles for Evaluating Health Risks in Children Associated with Exposure to Chemicals
    This report contains the collective views of an international group of experts and does not necessarily represent the decisions or the stated policy of the United Nations Environment Programme, the International Labour Organization or the World Health Organization. Environmental Health Criteria 237 PRINCIPLES FOR EVALUATING HEALTH RISKS IN CHILDREN ASSOCIATED WITH EXPOSURE TO CHEMICALS First drafts prepared by Dr Germaine Buck Louis, Bethesda, USA; Dr Terri Damstra, Research Triangle Park, USA; Dr Fernando Díaz- Barriga, San Luis Potosi, Mexico; Dr Elaine Faustman, Washington, USA; Dr Ulla Hass, Soborg, Denmark; Dr Robert Kavlock, Research Triangle Park, USA; Dr Carole Kimmel, Washington, USA; Dr Gary Kimmel, Silver Spring, USA; Dr Kannan Krishnan, Montreal, Canada; Dr Ulrike Luderer, Irvine, USA; and Dr Linda Sheldon, Research Triangle Park, USA Published under the joint sponsorship of the United Nations Environment Programme, the International Labour Organization and the World Health Organization, and produced within the framework of the Inter-Organization Programme for the Sound Management of Chemicals. The International Programme on Chemical Safety (IPCS), established in 1980, is a joint venture of the United Nations Environment Programme (UNEP), the International Labour Organization (ILO) and the World Health Organization (WHO). The overall objec- tives of the IPCS are to establish the scientific basis for assessment of the risk to human health and the environment from exposure to chemicals, through international peer review processes,
    [Show full text]
  • Attachment a (April 2008)
    A. Tittabawassee River System Assessment Area Biota Lists SC11317 Attachment A (April 2008) Table A.1. Fish sampled in the TRSAA Tittabawassee and TRSAA Common name (species) Saginaw rivers Saginaw Bay tributaries Alewife (Dorosoma cepedianum) x x Black bullhead (Ameiurus melas) x x Black crappie (Pomoxis nigromaculatus) x x x Blacknose dace (Rhinichthys atratus) x Blackside darter (Percina maculata) x Bluegill (Lepomis macrochirus) x x Bowfin (Amia calva)a x Brook stickleback (Culaea inconstans) x Burbot (Lota lota) x Carp (Cyprinus carpio)a x x x Channel catfish (Ictalurus punctatus) x x Chinook salmon (Oncorhynchus tschawytscha)a x x Common shiner (Notropis cornutus) x Emerald shiner (Notropis atherinoides) x x x Fathead minnow (Pimephales promelas) x Freshwater drum (Aplodinotus grunniens) x x Gizzard shad (Dorosoma cepedianum) x x x Golden shiner (Notemigonus crysoleucas) x Goldfish (Carassius auratus)a x x Green sunfish (Lepomis cyanellus) x Hog sucker (Hypentelium nigricans) x Hornyhead chub (Hybopsis biguttata) x Johnny darter (Etheostoma nigrum) x Lake herring (Coregonus artedii) x x Lake sturgeon (Acipenser fulvescens) x x Lake trout (Salvelinus namaycush) x x Lake whitefish (Coregonus clupeaformis) x Largemouth bass (Micropterus salmoides) x x x Logperch darter (Percina caprodes) x Longear sunfish (Lepomis megalotis) x Page A-1 SC11317 Attachment A (April 2008) Table A.1. Fish sampled in the TRSAA (cont.) Tittabawassee and TRSAA Common name (species) Saginaw rivers Saginaw Bay tributaries Longnose sucker (Catostomus catostomus)
    [Show full text]
  • Polycyclic Aromatic Hydrocarbons (Pahs) and to Emphasize the Human Health Effects That May Result from Exposure to Them
    TOXICOLOGICAL PROFILE FOR POLYCYCLIC AROMATIC HYDROCARBONS U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES Public Health Service Agency for Toxic Substances and Disease Registry August 1995 PAHs ii DISCLAIMER The use of company or product name(s) is for identification only and does not imply endorsement by the Agency for Toxic Substances and Disease Registry. PAHs iii UPDATE STATEMENT A Toxicological Profile for Polycyclic Aromatic Hydrocarbons was released in December 1990. This edition supersedes any previously released draft or final profile. Toxicological profiles are revised and republished as necessary, but no less than once every three years. For information regarding the update status of previously released profiles, contact ATSDR at: Agency for Toxic Substances and Disease Registry Division of Toxicology/Toxicology Information Branch 1600 Clifton Road NE, E-29 Atlanta, Georgia 30333 PAHs 1 1. PUBLIC HEALTH STATEMENT This statement was prepared to give you information about polycyclic aromatic hydrocarbons (PAHs) and to emphasize the human health effects that may result from exposure to them. The Environmental Protection Agency (EPA) has identified 1,408 hazardous waste sites as the most serious in the nation. These sites make up the National Priorities List (NPL) and are the sites targeted for long-term federal clean-up activities. PAHs have been found in at least 600 of the sites on the NPL. However, the number of NPL sites evaluated for PAHs is not known. As EPA evaluates more sites, the number of sites at which PAHs are found may increase. This information is important because exposure to PAHs may cause harmful health effects and because these sites are potential or actual sources of human exposure to PAHs.
    [Show full text]